Science.gov

Sample records for 16s-23s rrna intergenic

  1. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  2. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  3. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.

    1999-01-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  4. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  5. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.

    PubMed

    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik

    2013-02-01

    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  6. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.

    PubMed

    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P

    2013-01-01

    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology.

  7. Phylogeny of bradyrhizobia from Chinese cowpea miscellany inferred from 16S rRNA, atpD, glnII, and 16S-23S intergenic spacer sequences.

    PubMed

    Zhang, Sufang; Xie, Fuli; Yang, Jiangke; Li, Youguo

    2011-04-01

    The cowpea (Vigna unguiculata L.), peanut (Arachis hypogaea L.), and mung bean (Vigna radiata L.) belong to a group of plants known as the "cowpea miscellany" plants, which are widely cultivated throughout the tropic and subtropical zones of Africa and Asia. However, the phylogeny of the rhizobial strains that nodulate these plants is poorly understood. Previous studies have isolated a diversity of rhizobial strains from cowpea miscellany hosts and have suggested that, phylogenetically, they are from different species. In this work, the phylogeny of 42 slow-growing rhizobial strains, isolated from root nodules of cowpea, peanut, and mung bean from different geographical regions of China, was investigated using sequences from the 16S rRNA, atpD and glnII genes, and the 16S-23S rRNA intergenic spacer. The indigenous rhizobial strains from the cowpea miscellany could all be placed in the genus Bradyrhizobium , and Bradyrhizobium liaoningense and Bradyrhizobium yuanmingense were the main species. Phylogenies derived from housekeeping genes were consistent with phylogenies generated from the ribosomal gene. Mung bean rhizobia clustered only into B. liaoningense and B. yuanmingense and were phylogenetically less diverse than cowpea and peanut rhizobia. Geographical origin was significantly reflected in the phylogeny of mung bean rhizobia. Most cowpea rhizobia were more closely related to the 3 major groups B. liaoningense, B. yuanmingense, and Bradyrhizobium elkanii than to the minor groups Bradyrhizobium japonicum or Bradyrhizobium canariense . However, most peanut rhizobia were more closely related to the 2 major groups B. liaoningense and B. yuanmingense than to the minor group B. elkanii.

  8. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.

    PubMed

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-08-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  9. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing.

  10. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  11. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Small Senegalese Legumes by 16S-23S rRNA Intergenic Gene Spacers and Amplified Fragment Length Polymorphism Fingerprint Analyses

    PubMed Central

    Doignon-Bourcier, Florence; Willems, Anne; Coopman, Renata; Laguerre, Gisele; Gillis, Monique; de Lajudie, Philippe

    2000-01-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations. PMID:10966419

  13. Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length polymorphism fingerprint analyses.

    PubMed

    Doignon-Bourcier, F; Willems, A; Coopman, R; Laguerre, G; Gillis, M; de Lajudie, P

    2000-09-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations.

  14. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    PubMed

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  15. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.

    1999-01-01

    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  16. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    PubMed

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here.

  17. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  18. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  19. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  20. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    PubMed

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  1. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  2. Characterization of the Lancefield group C streptococcus 16S-23S RNA gene intergenic spacer and its potential for identification and sub-specific typing.

    PubMed Central

    Chanter, N.; Collin, N.; Holmes, N.; Binns, M.; Mumford, J.

    1997-01-01

    The 16S-23S RNA gene intergenic spacers of isolates of Streptococcus equi (n = 5), S. zooepidemicus (n = 5), S. equisimilis (n = 3) and S. dysgalactiae (n = 2) were sequenced and compared. There were distinct regions within the spacer, arranged in the order 1-9 for all S. equi and one S. zooepidemicus isolate and 1,2 and 4-9 for the remaining isolates. Region 4 was identical to the tRNA(ala) gene found in the 16S-23S intergenic spacers of other streptococci. Regions 1, 5, 6 and 7 had distinct variations, each conserved in different isolates. However, amongst the intergenic spacers there were different combinations of variant regions, suggesting a role for DNA recombination in their evolution. The intergenic spacer of all isolates of S. equi and one S. zooepidemicus isolate were almost identical. Primers derived from the variant sequences of regions 1 and 5 to 6 were used to group all S. zooepidemicus (n = 17) and S. equi (n = 5) into 1 of 8 types by polymerase chain reaction; three S. zooepidemicus isolates typed the same as S. equi. S. equi and S. zooepidemicus were clearly distinguishable from S. equisimilis and S. dysgalactiae which had shorter regions 5 and 6 and no region 7. Most homology for the group C sequences was found in previously published sequences for the 16S-23S intergenic spacers of S. anginosis, S. constellatus, S. intermedius, S. salivarius and S. agalactiae. A 75-90 nucleotide length shared with S. anginosus and S. intermedius in opposite orientations in the two main variants of region 6 supported the role for DNA recombination in the evolution of the spacer. The 16S-23S intergenic spacers indicate that S. zooepidemicus was the archetypal species for S. equi and that both are genetically more distant from S. equisimilis and S. dysgalactiae. The intergenic spacer can be used to identify specifically the group C streptococci and as an epidemiological marker for S. zooepidemicus. PMID:9129589

  3. Variations in the 16S-23S rRNA internal transcribed spacer of fibrolytic Butyrivibrio isolates from the reindeer rumen.

    PubMed

    Præsteng, Kirsti E; Mackie, Roderick I; Cann, Isaac K O; Mathiesen, Svein D; Sundset, Monica A

    2011-07-01

    Strains of Butyrivibrio are principal cellulytic bacteria in the rumen of the High Arctic Svalbard reindeer ( Rangifer tarandus platyrhynchus ). According to phylogenetic analysis based on 16S rRNA gene sequencing, Butyrivibrio can be divided into three subgroups within the Clostridia class of the phylum Firmicutes, but the current phenotypic and genotypic differentiation within the family Lachnospiraceae is insufficient. This current study describes the sequence diversity of the 16S-23S rRNA intergenic transcribed spacer (ITS) region of Butyrivibrio isolates from reindeer. A total of 17 different ITS sequences with sizes between 449 and 784 nt were obtained. Genes encoding tRNA(Ile) and tRNA(Ala) were identified in four of the sequences. Phylogenetic neighbor-joining trees were constructed based on the ITS sequence and compared with a phylogenetic neighbor-joining tree based on 16S rRNA gene sequences previously obtained for the same isolates. These comparisons indicated a better differentiation between strains in the ITS sequence than the 16S rRNA gene based tree. Through this study, a better means for identifying and tracking fibrolytic and potentially probiotic Butyrivibrio strains in reindeer and other ruminants has been provided.

  4. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    PubMed

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  5. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    PubMed Central

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated allowed the soft rot erwinias to be differentiated from all other Erwinia and non-Erwinia species and placed into one of three groups (I to III). Group I comprised all Erwinia carotovora subsp. atroseptica and subsp. betavasculorum isolates. Group II comprised all E. carotovora subsp. carotovora, subsp. odorifera, and subsp. wasabiae and E. cacticida isolates, and group III comprised all E. chrysanthemi isolates. To increase the level of discrimination further, the ITS-PCR products were digested with one of two restriction enzymes. Digestion with CfoI identified E. carotovora subsp. atroseptica and subsp. betavasculorum (group I) and E. chrysanthemi (group III) isolates, while digestion with RsaI identified E. carotovora subsp. wasabiae, subsp. carotovora, and subsp. odorifera/carotovora and E. cacticida isolates (group II). In the latter case, it was necessary to distinguish E. carotovora subsp. odorifera and subsp. carotovora using the α-methyl glucoside test. Sixty suspected soft rot erwinia isolates from Australia were identified as E. carotovora subsp. atroseptica, E. chrysanthemi, E. carotovora subsp. carotovora, and non-soft rot species. Ten “atypical” E. carotovora subsp. atroseptica isolates were identified as E. carotovora subsp. atroseptica, subsp. carotovora, and subsp. betavasculorum and non-soft rot species, and two “atypical” E. carotovora subsp. carotovora isolates were identified as E. carotovora subsp. carotovora and subsp. atroseptica. PMID:11526007

  6. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis. PMID:27546720

  7. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  8. DNA fingerprinting of Paenibacillus popilliae and Paenibacillus lentimorbus using PCR-amplified 16S-23S rDNA intergenic transcribed spacer (ITS) regions.

    PubMed

    Dingman, Douglas W

    2009-01-01

    Failure to identify correctly the milky disease bacteria, Paenibacillus popilliae and Paenibacillus lentimorbus, has resulted in published research errors and commercial production problems. A DNA fingerprinting procedure, using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS) regions, has been shown to easily and accurately identify isolates of milky disease bacteria. Using 34 P. popilliae and 15 P. lentimorbus strains, PCR amplification of different ITS regions produced three DNA fingerprints. For P. lentimorbus phylogenic group 2 strains and for all P. popilliae strains tested, electrophoresis of amplified DNA produced a migratory pattern (i.e., ITS-PCR fingerprint) exhibiting three DNA bands. P. lentimorbus group 1 strains also produced this ITS-PCR fingerprint. However, the fingerprint was phase-shifted toward larger DNA sizes. Alignment of the respective P. popilliae and P. lentimorbus group 1 ITS DNA sequences showed extensive homology, except for a 108bp insert in all P. lentimorbus ITS regions. This insert occurred at the same location relative to the 23S rDNA and accounted for the phase-shift difference in P. lentimorbus group 1 DNA fingerprints. At present, there is no explanation for this 108bp insert. The third ITS-PCR fingerprint, produced by P. lentimorbus group 3 strains, exhibited approximately eight DNA bands. Comparison of the three fingerprints of milky disease bacteria to the ITS-PCR fingerprints of other Paenibacillus species demonstrated uniqueness. ITS-PCR fingerprinting successfully identified eight unknown isolates as milky disease bacteria. Therefore, this procedure can serve as a standard protocol to identify P. popilliae and P. lentimorbus.

  9. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    NASA Astrophysics Data System (ADS)

    Okamura, K.; Hisada, T.; Takata, K.; Hiraishi, A.

    2013-04-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  10. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.

    PubMed

    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain

    2005-04-01

    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  11. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  12. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S-23S Spacer rRNA Genes

    PubMed Central

    Madico, Guillermo; Quinn, Thomas C.; Boman, Jens; Gaydos, Charlotte A.

    2000-01-01

    Three touchdown enzyme time release (TETR)-PCR assays were used to amplify different DNA sequences in the variable regions of the 16S and 16S-23S spacer rRNA genes specific for Chlamydia trachomatis, Chlamydia pneumoniae, and Chlamydia psittaci as improved tests for sensitive diagnosis and rapid species differentiation. The TETR-PCR protocol used 60 cycles of amplification, which provided improved analytical sensitivity (0.004 to 0.063 inclusion-forming unit of Chlamydia species per PCR). The sensitivity of TETR-PCR with primer set CTR 70-CTR 71 was 96.7%, and the specificity was 99.6%, compared to those of the AMPLICOR PCR for the detection of C. trachomatis in vaginal swab samples. TETR-PCR for C. pneumoniae with primer set CPN 90-CPN 91 was 90% sensitive and 93.3% specific compared with a nested PCR with primer set CP1/2-CPC/D for clinical respiratory samples. TETR-PCR for C. psittaci with primer set CPS 100-CPS 101 showed substantial agreement with cell culturing (κ, 0.78) for animal tissue samples. Primer sets were then combined into a single multiplex TETR-PCR test. The respective 315-, 195-, and 111-bp DNA target products were precisely amplified when DNA from each of the respective Chlamydia species or combinations of them was used. Multiplex chlamydia TETR-PCR correctly identified one strain of each of the 15 serovars of C. trachomatis, 22 isolates of C. pneumoniae, and 20 isolates of C. psittaci. The primer sets were specific for each species. No target products were amplified when DNA from C. pecorum or a variety of other microorganisms was tested for specificity. TETR-PCR with primers selected for specific sequences in the 16S and 16S-23S spacer rRNA genes is a valuable test that could be used either with individual primers or in a multiplex assay for the identification and differentiation of Chlamydia species from culture isolates or for the detection of chlamydiae in clinical samples. PMID:10699002

  13. Cyanobacterial Ecotypes in Different Optical Microenvironments of a 68°C Hot Spring Mat Community Revealed by 16S-23S rRNA Internal Transcribed Spacer Region Variation†

    PubMed Central

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea; Ward, David M.

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynthesis demonstrated the existence of physiologically distinct Synechococcus populations at different depths along a light gradient quantified by scalar irradiance microprobes. Molecular methods were used to evaluate whether physiologically distinct populations could be correlated with genetically distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S rRNA genes suggested the existence of closely related but genetically distinct populations corresponding to different functional populations occurring at different depths. PMID:12732563

  14. Direct identification of slowly growing Mycobacterium species by analysis of the intergenic 16S-23S rDNA spacer region (ISR) using a GelCompar II database containing sequence based optimization for restriction fragment site polymorphisms (RFLPs) for 12 enzymes.

    PubMed

    Gürtler, Volker; Harford, Cate; Bywater, Judy; Mayall, Barrie C

    2006-02-01

    To obtain Mycobacterium species identification directly from clinical specimens and cultures, the 16S-23S rDNA spacer (ISR) was amplified using previously published primers that detect all Mycobacterium species. The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms (RFLPs) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species. Subsequently a GelCompar II database was constructed from RFLPs for 10 enzymes that have been used in the literature to differentiate slowly growing Mycobacterium species. The combination of Sau96I and HaeIII were the best choice of enzymes for differentiating clinically relevant slowly growing Mycobacterium species. A total of 392 specimens were studied by PCR with 195 negative and 197 positive specimens. The ISR-PCR product was digested with HaeIII (previously reported) and Sau96I (new to this study) to obtain a Mycobacterium species identification based on the ISR-RFLPs. The species identification obtained by ISR-RFLP was confirmed by DNA sequencing (isolate numbers are shown in parentheses) for M. avium (3), M. intracellulare (4), M. avium complex (1), M. gordonae (2) and M. tuberculosis (1). The total number of specimens (99) identified were from culture (67), Bactectrade mark 12B culture bottles (11), EDTA blood (3), directly from smear positive specimens (13), tissue (4) and urine (1). Direct species identification was obtained from all 13/13 smear positive specimens. The total number of specimens (99) were identified as M. tuberculosis (41), M. avium (7), M. avium complex (11), M. intracellulare MIN-A (20), M. flavescens (2), M. fortuitum (10), M. gordonae (4), M. shimoidei (1), M. ulcerans (1) and M. chelonae (2). This method reduces the time taken for Mycobacterium species identification from 8-10 weeks for culture and biochemical identification; to 4-6 weeks for culture and ISR-RFLP; to 2 days

  15. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    PubMed

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  16. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.

    PubMed

    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C

    1999-07-01

    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  17. Use of denaturing gradient gel electrophoresis to detect mutation in VS2 of the 16S-23S rDNA spacer amplified from Staphylococcus aureus isolates.

    PubMed

    Gürtler, V; Barrie, H D; Mayall, B C

    2001-06-01

    To develop a double gradient denaturing gradient gel electrophoresis (DG-DGGE) based typing method that rapidly and accurately types clinical isolates of Staphylococcus aureus, the VS2 region of the 16S-23S rRNA spacer region (ISR) was chosen because of its potential high variation. The VS2 region was amplified with a 40-mer GC-clamp attached to the 5'-end of the reverse primer. The 145 bp PCR product was then separated by DG-DGGE using denaturant concentrations of 25-40% and polyacrylamide concentrations of 6-12%. Of the five mutations identified in 336 S. aureus isolates, one mutation was found to be highly specific for 161/171 (94%) of methicillin-resistant S. aureus (MRSA) isolates from different geographic locations and isolation times. This same mutation was found in 15/160 (9%) of penicillin- or methicillin-sensitive S. aureus isolates. In some isolates two mutations occured together in the one genome suggesting some S. aureus isolates have two copies of VS2. In these 336 isolates nine genotypes with different combinations of the five mutations were identified. In 18 coagulase-negative staphylococci (CNS), the MRSA-specific mutation was found along with two other mutations in all isolates demonstrating consistent differences in the presence of these mutations between CNS and S. aureus. The marked differences in VS2 sequences found between MRSA, methicillin- or penicillin-sensitive S. aureus (SSA), and CNS by DGGE in the present study may be useful in evolutionary studies and in the development of a specific assay for MRSA from clinical specimens.

  18. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    PubMed

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

  19. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    PubMed

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  20. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    PubMed Central

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  1. Phylogenetic analysis of vertically transmitted psyllid endosymbionts (Candidatus Carsonella ruddii) based on atpAGD and rpoC: comparisons with 16S-23S rDNA-derived phylogeny.

    PubMed

    Thao, M L; Clark, M A; Burckhardt, D H; Moran, N A; Baumann, P

    2001-06-01

    Psyllids are insects that harbor endosymbionts (Candidatuus Carsonella ruddii) within specialized cells found in the insect's body cavity. Previous phylogenetic analyses based on endosymbiont 16S-23S ribosomal DNA and a host gene were concordant (M.L. Thao, et al., Appl. Env. Microbiol. 66:2898, 2000). Additional analyses with atpAGD and rpoBC gave similar trees showing the agreement expected from organisms that evolve through vertical transmission with no gene exchange.

  2. 16S–23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    PubMed Central

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S–23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S–23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2–57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes), ITSAla(TGC), ITSAla(TGC)+Ile(GAT), ITSIle(GAT)+Ala(TGC), and ITS Ile(GAT)+Pseudo. All of the identified tRNAAla(TGC) molecules consisted of 73 bases, and all of the tRNAIle(GAT) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S–23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  3. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    PubMed

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  4. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  5. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.

    PubMed

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  6. Identification of Mushroom Species by Automated rRNA Intergenic Spacer Analysis (ARISA) and Its Application to a Suspected Case of Food Poisoning with Tricholoma ustale.

    PubMed

    Sugawara, Ryota; Yamada, Sayumi; Tu, Zhihao; Sugawara, Akiko; Hoshiba, Toshihiro; Eisaka, Sadao; Yamaguchi, Akihiro

    2016-01-01

    Automated rRNA intergenic spacer analysis (ARISA), a method of microbiome analysis, was evaluated for species identification of mushrooms based on the specific fragment sizes. We used 51 wild mushroom-fruiting bodies collected in the centre of Hokkaido and two cultivated mushrooms. Samples were hot-air-dried and DNA were extracted by a beads beating procedure. Sequencing analysis of portions of the rRNA gene (rDNA) provided 33 identifications of mushrooms by genus or species. The results of ARISA identification based on the combination of the fragment sizes corresponding to two inter spacer regions (ITS2 and ITS1) of rDNA within±0.1% accuracy showed that 27 out of the 33 species had specific fragment sizes differentiated from other species. The remaining 6 species formed 3 pairs that showed overlapping fragment sizes. In addition, within-species polymorphisms were observed as 1 bp differences among 32 samples of 13 species. ARISA was applied to investigate a case of suspected food poisoning in which the mushroom was thought to be a toxic Kakishimeji. The morphological identification of the mushroom was ambiguous since the remaining sample lacked a part of the fruiting body. Further, yeast colonies had grown on the surface of the fruiting body during storage. The ARISA fragment size of the mushroom showed 7 bp difference from that of the candidate toxic mushroom. Although ARISA could be a useful tools for estimation of mushroom species, especially in case where the fruiting bodies have deteriorated or been processed, further studies are necessary for reliable identification. For example, it may be necessary to adopt more informative genes which could provide clearer species-specific polymorphisms than the ITS regions. PMID:27211917

  7. Sequence Diversity of the Intergenic Spacer Region of the rRNA Gene of Malassezia globosa Colonizing the Skin of Patients with Atopic Dermatitis and Healthy Individuals

    PubMed Central

    Sugita, Takashi; Kodama, Minako; Saito, Masuyoshi; Ito, Tomonobu; Kato, Yukihiko; Tsuboi, Ryoji; Nishikawa, Akemi

    2003-01-01

    The lipophilic yeast Malassezia globosa is one of the major constituents of the mycoflora of the skin of patients with atopic dermatitis (AD). We compared the genotypes of M. globosa colonizing the skin surface of 32 AD patients and 20 healthy individuals for polymorphism of the intergenic spacer (IGS) 1 region of the rRNA gene. Sequence analysis demonstrated that M. globosa was divided into four major groups, which corresponded to the sources of the samples, on the phylogenetic tree. Of the four groups, two were from AD patients and one was from healthy subjects. The remaining group included samples from both AD patients and healthy subjects. In addition, the IGS 1 region of M. globosa contained short sequence repeats: (CT)n, and (GT)n. The number of sequence repeats also differed between the IGS 1 of M. globosa from AD patients and that from healthy subjects. These findings suggest that a specific genotype of M. globosa may play a significant role in AD, although M. globosa commonly colonizes both AD patients and healthy subjects. PMID:12843037

  8. Ecotypes of planktonic actinobacteria with identical 16S rRNA genes adapted to thermal niches in temperate, subtropical, and tropical freshwater habitats.

    PubMed

    Hahn, Martin W; Pöckl, Matthias

    2005-02-01

    Seven strains with identical 16S rRNA genes affiliated with the Luna2 cluster (Actinobacteria) were isolated from six freshwater habitats located in temperate (Austria and Australia), subtropical (People's Republic of China), and tropical (Uganda) climatic zones. The isolates had sequence differences at zero to five positions in a 2,310-nucleotide fragment of the ribosomal operon, including part of the intergenic spacer upstream of the 16S rRNA gene, the complete 16S rRNA gene, the complete 16S-23S internal transcribed spacer (ITS1), and a short part of the 23S rRNA gene. Most of the few sequence differences found were located in the internal transcribed spacer sequences. Two isolates obtained from habitats in Asia and Europe, as well as two isolates obtained from different habitats in the People's Republic of China, had identical sequences for the entire fragment sequenced. In spite of minimal sequence differences in the part of the ribosomal operon investigated, the strains exhibited significant differences in their temperature response curves (with one exception), as well as pronounced differences in their temperature optima (25.0 to 35.6 degrees C). The observed differences in temperature adaptation were generally in accordance with the thermal conditions in the habitats where the strains were isolated. Strains obtained from temperate zone habitats had the lowest temperature optima, strains from subtropical habitats had intermediate temperature optima, and a strain from a tropical habitat had the highest temperature optimum. Based on the observed temperature responses, we concluded that the strains investigated are well adapted to the thermal conditions in their home habitats. Consequently, these closely related strains represent different ecotypes adapted to different thermal niches.

  9. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).

    PubMed

    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A

    2000-06-01

    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  10. IntergenicDB: a database for intergenic sequences

    PubMed Central

    Notari, Daniel Luis; Molin, Aurione; Davanzo, Vanessa; Picolotto, Douglas; Ribeiro, Helena Graziottin; Silva, Scheila de Avila e

    2014-01-01

    A whole genome contains not only coding regions, but also non-coding regions. These are located between the end of a given coding region and the beginning of the following coding region. For this reason, the information about gene regulation process underlies in intergenic regions. There is no easy way to obtain intergenic regions from current available databases. IntergenicDB was developed to integrate data of intergenic regions and their gene related information from NCBI databases. The main goal of INTERGENICDB is to offer friendly database for intergenic sequences of bacterial genomes. Availability http://intergenicdb.bioinfoucs.com/ PMID:25097383

  11. Differentiation of Debaryomyces hansenii and Candida famata by rRNA gene intergenic spacer fingerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. flareri (=D. subglobosus) and D. prosopidis: description of D. vietnamensis sp. nov. closely related to D. nepalensis.

    PubMed

    Nguyen, Huu-Vang; Gaillardin, Claude; Neuvéglise, Cécile

    2009-06-01

    The intergenic spacer rDNA amplification and AluI fingerprinting (IGSAF) method detected four distinct groups among 170 Debaryomyces hansenii strains: D. hansenii var. hansenii; Candida famata var. famata; D. hansenii var. fabryi and C. famata var. flareri. IGS sequence comparison of representative strains showed that D. hansenii var. hansenii and C. famata var. famata belonged to one species, whereas D. hansenii var. fabryi and C. famata var. flareri belonged to two different ones. This confirmed the following three species recently reinstated: D. hansenii (=C. famata), Debaryomyces fabryi and Debaryomyces subglobosus (=Candida flareri). Accordingly, growth at 37 degrees C may no longer be used to differentiate D. hansenii from D. fabryi. Riboflavin production is more specific for D. fabryi and D. subglobosus strains. IGSAF identified all the other 17 species of the genus Debaryomyces, six of them sharing with D. hansenii an rRNA gene unit harbouring two 5S rRNA genes. The phylogenetic tree established with IGS sequences was congruent with the one based on ACT1, GPD1 and COX2 sequences depicting a distinct D. hansenii clade close to the D. subglobosus, Debaryomyces prosopidis and D. fabryi clade. Description of Debaryomyces vietnamensis sp. nov. (type strain CBS 10535(T), MUCL 51648(T)), closely related to Debaryomyces nepalensis is given. PMID:19385997

  12. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    PubMed Central

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  13. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  14. Cladistic biogeography of Juglans (Juglandaceae) based on chloroplast DNA intergenic spacer sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phylogenetic utility of sequence variation from five chloroplast DNA intergenic spacer (IGS) regions: trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM was examined in the genus Juglans. A total of seventeen taxa representing the four sections within Juglans and an outgroup taxon, ...

  15. Functionality of Intergenic Transcription: An Evolutionary Comparison

    PubMed Central

    Visagie, Johann; Giger, Thomas; Joerchel, Sabrina; Petzold, Ekkehard; Green, Richard E; Lachmann, Michael; Pääbo, Svante

    2006-01-01

    Although a large proportion of human transcription occurs outside the boundaries of known genes, the functional significance of this transcription remains unknown. We have compared the expression patterns of known genes as well as intergenic transcripts within the ENCODE regions between humans and chimpanzees in brain, heart, testis, and lymphoblastoid cell lines. We find that intergenic transcripts show patterns of tissue-specific conservation of their expression, which are comparable to exonic transcripts of known genes. This suggests that intergenic transcripts are subject to functional constraints that restrict their rate of evolutionary change as well as putative positive selection to an extent comparable to that of classical protein-coding genes. In brain and testis, we find that part of this intergenic transcription is caused by widespread use of alternative promoters. Further, we find that about half of the expression differences between humans and chimpanzees are due to intergenic transcripts. PMID:17040132

  16. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  17. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    PubMed Central

    Wang, Deguo; Liu, Yanhong

    2015-01-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  18. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-06-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  19. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  20. Mycoplasmas hyorhinis in different regions of cuba. diagnosis

    PubMed Central

    Lobo, Evelyn; Poveda, Carlos; Gupta, Rakesh; Suarez, Alejandro; Hernández, Yenney; Ramírez, Ana; Poveda, José B.

    2011-01-01

    M. hyorhinis is considered one of the etiological agents of arthritis in sucking pigs, but recently as seen, some strains can produce pneumonia that could not be distinguished from the mycoplasmosis caused by M. hyopneumoniae. The study was conducted to research the presence of Mycoplasma hyorhinis (M. hyorhinis ) in different regions of the country from exudates of pig lungs with typical EP lesions. Exudates from 280 pig lungs with typical EP lesions were studied using molecular techniques such as PCR, real time PCR and amplification of the 16S-23S rRNA. It was detected that the 66% of the samples studied resulted positive to M. hyorhinis, and the presence of this species was detected in all the provinces. Amplification and studies on the intergenic region 16S-23S of M. hyorhinis rRNA demonstrated the existing variability among strains of a same species. This study is the first report on M. hyorhinis detection in Cuba. PMID:24031686

  1. Intergenic Transposable Elements Are Not Randomly Distributed in Bacteria

    PubMed Central

    Plague, Gordon R.

    2010-01-01

    Insertion sequences (ISs) are mobile genetic elements in bacterial genomes. In general, intergenic IS elements are probably less deleterious for their hosts than intragenic ISs, simply because they have a lower likelihood of disrupting native genes. However, since promoters, Shine–Dalgarno sequences, and transcription factor binding sites are intergenic and upstream of genes, I hypothesized that not all neighboring gene orientations (NGOs) are selectively equivalent for IS insertion. To test this, I analyzed the NGOs of all intergenic ISs in 326 fully sequenced bacterial chromosomes. Of the 116 genomes with enough IS elements for statistical analysis, 68 have significantly more ISs between convergently oriented genes than expected, and 46 have significantly fewer ISs between divergently oriented genes. This suggests that natural selection molds intergenic IS distributions because they are least intrusive between convergent gene pairs and most intrusive between divergent gene pairs. PMID:20697140

  2. Structure of Intergenic Spacer IGS1 of Ribosomal Operon from Schistidium Mosses.

    PubMed

    Milyutina, I A; Ignatova, E A; Ignatov, M S; Goryunov, D V; Troitsky, A V

    2015-11-01

    The structure of the intergenic spacer 1 (IGS1) of the ribosomal operon from 12 species of Schistidium mosses was studied. In the IGS1 sequences of these species, three conserved regions and two areas of GC- and A-enriched repeats were identified. All of the studied mosses have a conserved pyrimidine-enriched motif at the 5'-end of IGS1. Species-specific nucleotide substitutions and insertions were found in the conserved areas. The repeated units contain single nucleotide substitutions that make unique the majority of repeated units. The positions of such repeats in IGS1 are species-specific, but their number can vary within the species and among operons of the same specimen. The comparison of IGS1 sequences from the Schistidium species and from representatives of ten other moss genera revealed the presence of common conserved motifs with similar localization. Presumably, these motifs are elements of termination of the pre-rRNA transcription and processing of rRNA. PMID:26615440

  3. Structure of Intergenic Spacer IGS1 of Ribosomal Operon from Schistidium Mosses.

    PubMed

    Milyutina, I A; Ignatova, E A; Ignatov, M S; Goryunov, D V; Troitsky, A V

    2015-11-01

    The structure of the intergenic spacer 1 (IGS1) of the ribosomal operon from 12 species of Schistidium mosses was studied. In the IGS1 sequences of these species, three conserved regions and two areas of GC- and A-enriched repeats were identified. All of the studied mosses have a conserved pyrimidine-enriched motif at the 5'-end of IGS1. Species-specific nucleotide substitutions and insertions were found in the conserved areas. The repeated units contain single nucleotide substitutions that make unique the majority of repeated units. The positions of such repeats in IGS1 are species-specific, but their number can vary within the species and among operons of the same specimen. The comparison of IGS1 sequences from the Schistidium species and from representatives of ten other moss genera revealed the presence of common conserved motifs with similar localization. Presumably, these motifs are elements of termination of the pre-rRNA transcription and processing of rRNA.

  4. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  5. Enterococcus lactis sp. nov., from Italian raw milk cheeses.

    PubMed

    Morandi, Stefano; Cremonesi, Paola; Povolo, Milena; Brasca, Milena

    2012-08-01

    Ten atypical Enterococcus strains were isolated from Italian raw milk cheeses. The 16S rRNA gene, phenylalanyl-tRNA synthase alpha subunit (pheS), RNA polymerase alpha subunit (rpoA) and the 16S-23S rRNA intergenic transcribed spacer (ITS) sequences, randomly amplified polymorphic DNA (RAPD) PCR and the phenotypic properties revealed that the isolates represent a novel enterococcal species. On the basis of 16S rRNA gene sequence analysis, the isolates were closely related to Enterococcus hirae ATCC 8043(T), Enterococcus durans CECT 411(T) and Enterococcus faecium ATCC 19434(T), with 98.8, 98.9 and 99.4% sequence similarity, respectively. On the basis of sequence analysis of the housekeeping gene pheS, the reference strain, BT159(T), occupied a position separate from E. faecium LMG 16198. The group of isolates could be easily differentiated from recognized species of the genus Enterococcus by 16S-23S rRNA ITS analysis, RAPD-PCR and phenotypic characteristics. The name Enterococcus lactis sp. nov. is proposed, with BT159(T) ( = DSM 23655(T) = LMG 25958(T)) as the type strain.

  6. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

    PubMed Central

    Yang, Kiwoung; Robin, Arif Hasan Khan; Yi, Go-Eun; Lee, Jonghoon; Chung, Mi-Young; Yang, Tae-Jin; Nou, Ill-Sup

    2015-01-01

    Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea. PMID:26633391

  7. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  8. Intergenic exchange, geographic isolation, and the evolution of bioluminescent color for Pyrophorus click beetles.

    PubMed

    Feder, Jeffrey L; Velez, Sebastian

    2009-05-01

    Gene duplication is an evolutionary process in which the emergent property of the whole can become greater and different than the sum of its parts. One potential outcome for gene duplication is for loci to evolve different, yet related functions. In this case, intergenic exchange can shuffle blocks of differentiated nucleotides between paralogues to create new alleles and phenotypes rather than simply homogenize loci. Bioluminescent click beetles in the genus Pyrophorus (Coleoptera: Elateridae) provide an opportunity to explore the creative potential of intergenic exchange for gene family evolution. Pyrophorus beetles bioluminesce different light colors from a pair of dorsal light organs and a ventral light organ. The light organs are under the separate genetic control of dorsal and ventral luciferase loci. Here, we report that intergenic exchange is common between dorsal and ventral loci for beetles from Jamaica (P. plagiophthalamus), the Dominican Republic (P. mellifluous), Belize (P. luscus), and Trinidad (P. noctilucus). We also present evidence that periods of past geographic isolation for beetles on Jamaica, probably acting in concert with selection, built differentiated blocks of substitutions within dorsal and ventral P. plagiophthalamus luciferase loci. Gene flow and intergenic exchange subsequently shuffled these substitutions between dorsal and ventral loci to produce new color phenotypes on Jamaica, including a yellow-green polymorphism. We discuss the possibility of a previously unrecognized emergent evolutionary property of intergenic exchange for luciferase involving cycles of bioluminescent color change related to differences in selective constrains acting on dorsal versus ventral loci. We also explore whether intergenic exchange may commonly create novel variation and the potential for cyclic evolution in other multigene family systems.

  9. Identification and Tracing of Bifidobacterium Species by Use of Enterobacterial Repetitive Intergenic Consensus Sequences

    PubMed Central

    Ventura, Marco; Meylan, Valerie; Zink, Ralf

    2003-01-01

    Eighty-nine Bifidobacterium strains from 26 species were identified and classified to the species level with an enterobacterial repetitive intergenic consensus (ERIC)-PCR approach. We demonstrated that ERIC-PCR is useful for a phylogenetic and taxonomical analysis but as well as for a species composition analysis of mixed bifidobacterial cultures isolated from dairy products and other environments. PMID:12839818

  10. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    PubMed

    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk

    2015-01-01

    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  11. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  12. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  13. Identification and characterization of novel Mycoplasma spp. belonging to the hominis group from griffon vultures.

    PubMed

    Lecis, R; Chessa, B; Cacciotto, C; Addis, M F; Coradduzza, E; Berlinguer, F; Muzzeddu, M; Lierz, M; Carcangiu, L; Pittau, M; Alberti, A

    2010-08-01

    Mycoplasmas are commensals and pathogens of various avian species, and are also regularly found in birds of prey, although their significance to birds' health remains unclear. Here we describe two novel Mycoplasma isolated from the upper respiratory tract of four Eurasian griffon vultures (Gyps fulvus) housed in a wildlife recovery centre in Sardinia (Italy). By sequencing the 16S rRNA gene and the entire 16S/23S intergenic spacer region, the new strains were classified within the Mycoplasma taxonomy at the group and cluster levels, showing that the two isolates fall into the Mycoplasma synoviae and Mycoplasma hominis clusters of the hominis group, respectively. We combined molecular tools and immunoblotting methods in order to further characterize these isolates, and antigenic analyses overall confirmed the molecular findings. Different levels of pathogenicity and prevalence of these strains might have different implications for the conservation and reintroduction of vultures.

  14. High-prevalence Borrelia miyamotoi infection among [corrected] wild turkeys (Meleagris gallopavo) in Tennessee.

    PubMed

    Scott, M C; Rosen, M E; Hamer, S A; Baker, E; Edwards, H; Crowder, C; Tsao, J I; Hickling, G J

    2010-11-01

    During spring and fall 2009, 60 wild turkeys (Meleagris gallopavo) harvested by Tennessee hunters were surveyed for Borrelia spp. by sampling their blood, tissue, and attached ticks. In both seasons, 70% of turkeys were infested with juvenile Amblyomma americanum; one spring turkey hosted an adult female Ixodes brunneus. Polymerase chain reaction assays followed by DNA sequencing indicated that 58% of the turkeys were positive for the spirochete Borrelia miyamotoi, with tissue testing positive more frequently than blood (P = 0.015). Sequencing of the 16S-23S rRNA intergenic spacer indicated > or = 99% similarity to previously published sequences of the North American strain of this spirochete. Positive turkeys were present in both seasons and from all seven middle Tennessee counties sampled. No ticks from the turkeys tested positive for any Borrelia spp. This is the first report of B. miyamotoi in birds; the transmission pathways and epidemiological significance of this high-prevalence spirochetal infection remain uncertain.

  15. Genetic diversity of nodulating and non-nodulating rhizobia associated with wild soybean (Glycine soja Sieb. & Zucc.) in different ecoregions of China.

    PubMed

    Wu, Li Juan; Wang, Hai Qing; Wang, En Tao; Chen, Wen Xin; Tian, Chang Fu

    2011-06-01

    A total of 99 bacterial isolates that originated from root nodules of Glycine soja were characterized with restriction analyses of amplified 16S ribosomal DNA and 16S-23S rDNA intergenic spacers (ITS), and sequence analyses of 16S rRNA, rpoB, atpD, recA and nodC genes. When tested for nodulation of G. soja, 72 of the isolates were effective symbionts, and these belonged to five species: Bradyrhizobium japonicum, Bradyrhizobium elkanii, Bradyrhizobium yuanmingense, Bradyrhizobium liaoningense and Sinorhizobium fredii. All of these, except some B. yuanmingense strains, also formed effective nodules on the domesticated soybean Glycine max. The remaining 27 isolates did not nodulate either host, but were identified as Rhizobium. Phylogeny nodC in the G. soja symbionts suggested that this symbiosis gene was mainly maintained by vertical gene transfer. Different nodC sublineages and rrs-ITS clusters reflected the geographic origins of isolates in this study.

  16. Intergenic transcriptional interference is blocked by RNA polymerase III transcription factor TFIIIB in Saccharomyces cerevisiae.

    PubMed

    Korde, Asawari; Rosselot, Jessica M; Donze, David

    2014-02-01

    The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such "extratranscriptional" activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467-ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins.

  17. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  18. Patterns of variation in the intergenic spacers of ribosomal DNA in Drosophila melanogaster support a model for genetic exchanges during X-Y pairing.

    PubMed

    Polanco, C; González, A I; Dover, G A

    2000-07-01

    Detailed analysis of variation in intergenic spacer (IGS) and internal transcribed spacer (ITS) regions of rDNA drawn from natural populations of Drosophila melanogaster has revealed contrasting patterns of homogenization although both spacers are located in the same rDNA unit. On the basis of the role of IGS regions in X-Y chromosome pairing, we proposed a mechanism of single-strand exchanges at the IGS regions, which can explain the different evolutionary trajectories followed by the IGS and the ITS regions. Here, we provide data from the chromosomal distribution of selected IGS length variants, as well as the detailed internal structure of a large number of IGS regions obtained from specific X and Y chromosomes. The variability found in the different internal subrepeat regions of IGS regions isolated from X and Y chromosomes supports the proposed mechanism of genetic exchanges and suggests that only the "240" subrepeats are involved. The presence of a putative site for topoisomerase I at the 5' end of the 18S rRNA gene would allow for the exchange between X and Y chromosomes of some 240 subrepeats, the promoter, and the ETS region, leaving the rest of the rDNA unit to evolve along separate chromosomal lineages. The phenomenon of localized units (modules) of homogenization has implications for multigene family evolution in general.

  19. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    USGS Publications Warehouse

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  20. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans.

    PubMed

    Muller, Laura K; Lorch, Jeffrey M; Lindner, Daniel L; O'Connor, Michael; Gargas, Andrea; Blehert, David S

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was qualified further by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research. PMID:22962349

  1. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements.

    PubMed

    Schlesinger, Felix; Smith, Andrew D; Gingeras, Thomas R; Hannon, Gregory J; Hodges, Emily

    2013-10-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells.

  2. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  3. De Novo Identification of Regulatory Regions in Intergenic Spaces of Prokaryotic Genomes

    SciTech Connect

    Chain, P; Garcia, E; Mcloughlin, K; Ovcharenko, I

    2007-02-20

    This project was begun to implement, test, and experimentally validate the results of a novel algorithm for genome-wide identification of candidate transcription-factor binding sites in prokaryotes. Most techniques used to identify regulatory regions rely on conservation between different genomes or have a predetermined sequence motif(s) to perform a genome-wide search. Therefore, such techniques cannot be used with new genome sequences, where information regarding such motifs has not yet been discovered. This project aimed to apply a de novo search algorithm to identify candidate binding-site motifs in intergenic regions of prokaryotic organisms, initially testing the available genomes of the Yersinia genus. We retrofitted existing nucleotide pattern-matching algorithms, analyzed the candidate sites identified by these algorithms as well as their target genes to screen for meaningful patterns. Using properly annotated prokaryotic genomes, this project aimed to develop a set of procedures to identify candidate intergenic sites important for gene regulation. We planned to demonstrate this in Yersinia pestis, a model biodefense, Category A Select Agent pathogen, and then follow up with experimental evidence that these regions are indeed involved in regulation. The ability to quickly characterize transcription-factor binding sites will help lead to a better understanding of how known virulence pathways are modulated in biodefense-related organisms, and will help our understanding and exploration of regulons--gene regulatory networks--and novel pathways for metabolic processes in environmental microbes.

  4. Transcription through intergenic chromosomal memory elements of the Drosophila bithorax complex correlates with an epigenetic switch.

    PubMed

    Rank, Gerhard; Prestel, Matthias; Paro, Renato

    2002-11-01

    The proteins of the trithorax and Polycomb groups maintain the differential expression pattern of homeotic genes established by the early embryonic patterning system during development. These proteins generate stable and heritable chromatin structures by acting via particular chromosomal memory elements. We established a transgenic assay system showing that the Polycomb group response elements bxd and Mcp confer epigenetic inheritance throughout development. With previously published data for the Fab7 cellular memory module, we confirmed the cellular memory function of Polycomb group response elements. In Drosophila melanogaster, several of these memory elements are located in the large intergenic regulatory regions of the homeotic bithorax complex. Using a transgene assay, we showed that transcription through a memory element correlated with the relief of silencing imposed by the Polycomb group proteins and established an epigenetically heritable active chromatin mode. A memory element remodeled by the process of transcription was able to maintain active expression of a reporter gene throughout development. Thus, transcription appears to reset and change epigenetic marks at chromosomal memory elements regulated by the Polycomb and trithorax proteins. Interestingly, in the bithorax complex of D. melanogaster, the segment-specific expression of noncoding intergenic transcripts during embryogenesis seems to fulfill this switching role for memory elements regulating the homeotic genes. PMID:12391168

  5. Transcription through intergenic chromosomal memory elements of the Drosophila bithorax complex correlates with an epigenetic switch.

    PubMed

    Rank, Gerhard; Prestel, Matthias; Paro, Renato

    2002-11-01

    The proteins of the trithorax and Polycomb groups maintain the differential expression pattern of homeotic genes established by the early embryonic patterning system during development. These proteins generate stable and heritable chromatin structures by acting via particular chromosomal memory elements. We established a transgenic assay system showing that the Polycomb group response elements bxd and Mcp confer epigenetic inheritance throughout development. With previously published data for the Fab7 cellular memory module, we confirmed the cellular memory function of Polycomb group response elements. In Drosophila melanogaster, several of these memory elements are located in the large intergenic regulatory regions of the homeotic bithorax complex. Using a transgene assay, we showed that transcription through a memory element correlated with the relief of silencing imposed by the Polycomb group proteins and established an epigenetically heritable active chromatin mode. A memory element remodeled by the process of transcription was able to maintain active expression of a reporter gene throughout development. Thus, transcription appears to reset and change epigenetic marks at chromosomal memory elements regulated by the Polycomb and trithorax proteins. Interestingly, in the bithorax complex of D. melanogaster, the segment-specific expression of noncoding intergenic transcripts during embryogenesis seems to fulfill this switching role for memory elements regulating the homeotic genes.

  6. RNA 3′ processing functions of Arabidopsis FCA and FPA limit intergenic transcription

    PubMed Central

    Sonmez, Cagla; Bäurle, Isabel; Magusin, Andreas; Dreos, Rene; Laubinger, Sascha; Weigel, Detlef; Dean, Caroline

    2011-01-01

    The RNA-binding proteins FCA and FPA were identified based on their repression of the flowering time regulator FLC but have since been shown to have widespread roles in the Arabidopsis thaliana genome. Here, we use whole-genome tiling arrays to show that a wide spectrum of genes and transposable elements are misexpressed in the fca-9 fpa-7 (fcafpa) double mutant at two stages of seedling development. There was a significant bias for misregulated genomic segments mapping to the 3′ region of genes. In addition, the double mutant misexpressed a large number of previously unannotated genomic segments corresponding to intergenic regions. We characterized a subset of these misexpressed unannotated segments and established that they resulted from extensive transcriptional read-through, use of downstream polyadenylation sites, and alternative splicing. In some cases, the transcriptional read-through significantly reduced expression of the associated genes. FCA/FPA-dependent changes in DNA methylation were found at several loci, supporting previous associations of FCA/FPA function with chromatin modifications. Our data suggest that FCA and FPA play important roles in the A. thaliana genome in RNA 3′ processing and transcription termination, thus limiting intergenic transcription. PMID:21536901

  7. Genome-Wide Analyses in Bacteria Show Small-RNA Enrichment for Long and Conserved Intergenic Regions

    PubMed Central

    Tsai, Chen-Hsun; Liao, Rick; Chou, Brendan; Palumbo, Michael

    2014-01-01

    Interest in finding small RNAs (sRNAs) in bacteria has significantly increased in recent years due to their regulatory functions. Development of high-throughput methods and more sophisticated computational algorithms has allowed rapid identification of sRNA candidates in different species. However, given their various sizes (50 to 500 nucleotides [nt]) and their potential genomic locations in the 5′ and 3′ untranslated regions as well as in intergenic regions, identification and validation of true sRNAs have been challenging. In addition, the evolution of bacterial sRNAs across different species continues to be puzzling, given that they can exert similar functions with various sequences and structures. In this study, we analyzed the enrichment patterns of sRNAs in 13 well-annotated bacterial species using existing transcriptome and experimental data. All intergenic regions were analyzed by WU-BLAST to examine conservation levels relative to species within or outside their genus. In total, more than 900 validated bacterial sRNAs and 23,000 intergenic regions were analyzed. The results indicate that sRNAs are enriched in intergenic regions, which are longer and more conserved than the average intergenic regions in the corresponding bacterial genome. We also found that sRNA-coding regions have different conservation levels relative to their flanking regions. This work provides a way to analyze how noncoding RNAs are distributed in bacterial genomes and also shows conserved features of intergenic regions that encode sRNAs. These results also provide insight into the functions of regions surrounding sRNAs and into optimization of RNA search algorithms. PMID:25313390

  8. Identification and Functional Prediction of Large Intergenic Noncoding RNAs (lincRNAs) in Rainbow Trout (Oncorhynchus mykiss)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Long noncoding RNAs (lncRNAs) have been recognized in recent years as key regulators of diverse cellular processes. Genome-wide large-scale projects have uncovered thousands of lncRNAs in many model organisms. Large intergenic noncoding RNAs (lincRNAs) are lncRNAs that are transcribed from intergeni...

  9. Cytomolecular Analysis of Ribosomal DNA Evolution in a Natural Allotetraploid Brachypodium hybridum and Its Putative Ancestors—Dissecting Complex Repetitive Structure of Intergenic Spacers

    PubMed Central

    Borowska-Zuchowska, Natalia; Kwasniewski, Miroslaw; Hasterok, Robert

    2016-01-01

    Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n = 30), which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n = 10) and B. stacei (2n = 20). Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs) from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level. PMID:27790225

  10. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  11. Limitations and benefits of ARISA intra-genomic diversity fingerprinting.

    PubMed

    Popa, Radu; Popa, Rodica; Mashall, Matthew J; Nguyen, Hien; Tebo, Bradley M; Brauer, Suzanna

    2009-08-01

    Monitoring diversity changes and contamination in mixed cultures and simple microcosms is challenged by fast community structure dynamics, and the need for means allowing fast, cost-efficient and accurate identification of microorganisms at high phylogenetic resolution. The method we explored is a variant of Automated rRNA Intergenic Spacer Analysis based on Intra-Genomic Diversity Fingerprinting (ARISA-IGDF), and identifies phylotypes with multiple 16S-23S rRNA gene Intergenic Transcribed Spacers. We verified the effect of PCR conditions (annealing temperature, duration of final extension, number of cycles, group-specific primers and formamide) on ARISA-IGD fingerprints of 44 strains of Shewanella. We present a digitization algorithm and data analysis procedures needed to determine confidence in strain identification. Though using stringent PCR conditions and group-specific primers allow reasonably accurate identification of strains with three ARISA-IGD amplicons within the 82-1000 bp size range, ARISA-IGDF is best for phylotypes with >or=4 unambiguously different amplicons. This method allows monitoring the occurrence of culturable microbes and can be implemented in applications requiring high phylogenetic resolution, reproducibility, low cost and high throughput such as identifying contamination and monitoring the evolution of diversity in mixed cultures and low diversity microcosms and periodic screening of small microbial culture libraries. PMID:19538993

  12. An Intergenic Regulatory Region Mediates Drosophila Myc -Induced Apoptosis and Blocks Tissue Hyperplasia

    PubMed Central

    Zhang, Can; Tintó, Sergio Casas; Li, Guangyao; Lin, Nianwei; Chung, Michelle; Moreno, Eduardo; Moberg, Kenneth H.; Zhou, Lei

    2014-01-01

    Induction of cell autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However the detailed mechanism mediating this process remains enigmatic. In this study we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (Irradiation Responsive Enhancer Region). The IRER mediates expression of surrounding pro-apoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In prior work we showed that the IRER also mediates P53-dependent induction of pro-apoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by Polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53 and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress. PMID:24931167

  13. A Discrete Class of Intergenic DNA Dictates Meiotic DNA Break Hotspots in Fission Yeast

    PubMed Central

    Cam, Hugh P; Farah, Joseph A; Grewal, Shiv I. S; Smith, Gerald R

    2007-01-01

    Meiotic recombination is initiated by DNA double-strand breaks (DSBs) made by Spo11 (Rec12 in fission yeast), which becomes covalently linked to the DSB ends. Like recombination events, DSBs occur at hotspots in the genome, but the genetic factors responsible for most hotspots have remained elusive. Here we describe in fission yeast the genome-wide distribution of meiosis-specific Rec12-DNA linkages, which closely parallel DSBs measured by conventional Southern blot hybridization. Prominent DSB hotspots are located ∼65 kb apart, separated by intervals with little or no detectable breakage. Most hotspots lie within exceptionally large intergenic regions. Thus, the chromosomal architecture responsible for hotspots in fission yeast is markedly different from that of budding yeast, in which DSB hotspots are much more closely spaced and, in many regions of the genome, occur at each promoter. Our analysis in fission yeast reveals a clearly identifiable chromosomal feature that can predict the majority of recombination hotspots across a whole genome and provides a basis for searching for the chromosomal features that dictate hotspots of meiotic recombination in other organisms, including humans. PMID:17722984

  14. A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice

    PubMed Central

    Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.

    2013-01-01

    Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789

  15. Comparative Expression Dynamics of Intergenic Long Noncoding RNAs in the Genus Drosophila

    PubMed Central

    Nyberg, Kevin G.; Machado, Carlos A.

    2016-01-01

    Thousands of long noncoding RNAs (lncRNAs) have been annotated in eukaryotic genomes, but comparative transcriptomic approaches are necessary to understand their biological impact and evolution. To facilitate such comparative studies in Drosophila, we identified and characterized lncRNAs in a second Drosophilid—the evolutionary model Drosophila pseudoobscura. Using RNA-Seq and computational filtering of protein-coding potential, we identified 1,589 intergenic lncRNA loci in D. pseudoobscura. We surveyed multiple sex-specific developmental stages and found, like in Drosophila melanogaster, increasingly prolific lncRNA expression through male development and an overrepresentation of lncRNAs in the testes. Other trends seen in D. melanogaster, like reduced pupal expression, were not observed. Nonrandom distributions of female-biased and non-testis-specific male-biased lncRNAs between the X chromosome and autosomes are consistent with selection-based models of gene trafficking to optimize genomic location of sex-biased genes. The numerous testis-specific lncRNAs, however, are randomly distributed between the X and autosomes, and we cannot reject the hypothesis that many of these are likely to be spurious transcripts. Finally, using annotated lncRNAs in both species, we identified 134 putative lncRNA homologs between D. pseudoobscura and D. melanogaster and find that many have conserved developmental expression dynamics, making them ideal candidates for future functional analyses. PMID:27189981

  16. Computational identification of human long intergenic non-coding RNAs using a GA-SVM algorithm.

    PubMed

    Wang, Yanqiu; Li, Yang; Wang, Qi; Lv, Yingli; Wang, Shiyuan; Chen, Xi; Yu, Xuexin; Jiang, Wei; Li, Xia

    2014-01-01

    Long intergenic non-coding RNAs (lincRNAs) are a new type of non-coding RNAs and are closely related with the occurrence and development of diseases. In previous studies, most lincRNAs have been identified through next-generation sequencing. Because lincRNAs exhibit tissue-specific expression, the reproducibility of lincRNA discovery in different studies is very poor. In this study, not including lincRNA expression, we used the sequence, structural and protein-coding potential features as potential features to construct a classifier that can be used to distinguish lincRNAs from non-lincRNAs. The GA-SVM algorithm was performed to extract the optimized feature subset. Compared with several feature subsets, the five-fold cross validation results showed that this optimized feature subset exhibited the best performance for the identification of human lincRNAs. Moreover, the LincRNA Classifier based on Selected Features (linc-SF) was constructed by support vector machine (SVM) based on the optimized feature subset. The performance of this classifier was further evaluated by predicting lincRNAs from two independent lincRNA sets. Because the recognition rates for the two lincRNA sets were 100% and 99.8%, the linc-SF was found to be effective for the prediction of human lincRNAs.

  17. In silico prediction of long intergenic non-coding RNAs in sheep.

    PubMed

    Bakhtiarizadeh, Mohammad Reza; Hosseinpour, Batool; Arefnezhad, Babak; Shamabadi, Narges; Salami, Seyed Alireza

    2016-04-01

    Long non-coding RNAs (lncRNAs) are transcribed RNA molecules >200 nucleotides in length that do not encode proteins and serve as key regulators of diverse biological processes. Recently, thousands of long intergenic non-coding RNAs (lincRNAs), a type of lncRNAs, have been identified in mammalians using massive parallel large sequencing technologies. The availability of the genome sequence of sheep (Ovis aries) has allowed us genomic prediction of non-coding RNAs. This is the first study to identify lincRNAs using RNA-seq data of eight different tissues of sheep, including brain, heart, kidney, liver, lung, ovary, skin, and white adipose. A computational pipeline was employed to characterize 325 putative lincRNAs with high confidence from eight important tissues of sheep using different criteria such as GC content, exon number, gene length, co-expression analysis, stability, and tissue-specific scores. Sixty-four putative lincRNAs displayed tissues-specific expression. The highest number of tissues-specific lincRNAs was found in skin and brain. All novel lincRNAs that aligned to the human and mouse lincRNAs had conserved synteny. These closest protein-coding genes were enriched in 11 significant GO terms such as limb development, appendage development, striated muscle tissue development, and multicellular organismal development. The findings reported here have important implications for the study of sheep genome.

  18. Structural and phylogenetic analysis of the rDNA intergenic spacer region of Verticillium dahliae.

    PubMed

    Papaioannou, Ioannis A; Dimopoulou, Chrysoula D; Typas, Milton A

    2013-10-01

    The nuclear ribosomal intergenic spacer (IGS) region was structurally analyzed and exploited for molecular discrimination and phylogenetic analysis of vegetative compatibility groups (VCGs) of Verticillium dahliae. A structural study of 201 available IGS sequences of the fungus was performed, and four classes of ubiquitous repetitive elements, organized in higher-order repetitive structures or composite blocks, were detected in a variable IGS subregion. This subregion was amplified from an international collection of 59 V. dahliae isolates covering all VCGs, together with nine representative V. albo-atrum and V. longisporum isolates, and sequenced. Structural and phylogenetic analyses of the sequences of this polymorphic IGS subregion were consistently informative and allowed the identification of two main lineages in V. dahliae, that is, clade I including VCGs 1A, 1B, 2A, 4B, and 3 and clade II containing VCGs 2B, 4A, and 6. Analysis of IGS sequences proved a highly suitable molecular tool for (a) rapid interspecific differentiation, (b) intraspecific discrimination among VCGs of V. dahliae, facilitating high-throughput VCG confirmation and prediction/profiling, and (c) phylogenetic analysis within and among V. dahliae VCGs.

  19. Epistasis in intra- and inter-gene pool crosses of the common bean.

    PubMed

    Borel, J C; Ramalho, M A P; Abreu, A F B

    2016-02-26

    Epistasis has been shown to have an important role in the genetic control of several quantitative traits in the common bean. This study aimed to investigate the occurrence of epistasis in intra- and inter-pool gene crosses of the common bean. Four elite lines adapted to Brazilian conditions were used as parents, two from the Andean gene pool (ESAL 686; BRS Radiante) and two from the Mesoamerican gene pool (BRSMG Majestoso; BRS Valente). Four F2 populations were obtained: "A" (ESAL 686 x BRS Radiante), "B" (BRSMG Majestoso x BRS Valente), "C" (BRS Radiante x BRSMG Majestoso), and "D" (BRS Valente x ESAL 686). A random sample of F2 plants from each population was backcrossed to parents and F1 individuals, according to the triple test cross. Three types of progenies from each population were evaluated in contiguous trials. Seed yield and 100-seed weight were evaluated. Dominance genetic variance was predominant in most cases. However, the estimates of genetic variance may be biased by the occurrence of linkage disequilibrium and epistasis. Epistasis was detected for both traits; however, the occurrence differed among the populations and between the two traits. The results of this study reinforce the hypothesis that epistasis is present in the genetic control of traits in the common bean and suggest that the phenomenon is more frequent in inter-gene pool crosses than in intra-gene pool crosses.

  20. The evolutionary landscape of intergenic trans-splicing events in insects

    PubMed Central

    Kong, Yimeng; Zhou, Hongxia; Yu, Yao; Chen, Longxian; Hao, Pei; Li, Xuan

    2015-01-01

    To explore the landscape of intergenic trans-splicing events and characterize their functions and evolutionary dynamics, we conduct a mega-data study of a phylogeny containing eight species across five orders of class Insecta, a model system spanning 400 million years of evolution. A total of 1,627 trans-splicing events involving 2,199 genes are identified, accounting for 1.58% of the total genes. Homology analysis reveals that mod(mdg4)-like trans-splicing is the only conserved event that is consistently observed in multiple species across two orders, which represents a unique case of functional diversification involving trans-splicing. Thus, evolutionarily its potential for generating proteins with novel function is not broadly utilized by insects. Furthermore, 146 non-mod trans-spliced transcripts are found to resemble canonical genes from different species. Trans-splicing preserving the function of ‘breakup' genes may serve as a general mechanism for relaxing the constraints on gene structure, with profound implications for the evolution of genes and genomes. PMID:26521696

  1. The evolutionary landscape of intergenic trans-splicing events in insects.

    PubMed

    Kong, Yimeng; Zhou, Hongxia; Yu, Yao; Chen, Longxian; Hao, Pei; Li, Xuan

    2015-11-02

    To explore the landscape of intergenic trans-splicing events and characterize their functions and evolutionary dynamics, we conduct a mega-data study of a phylogeny containing eight species across five orders of class Insecta, a model system spanning 400 million years of evolution. A total of 1,627 trans-splicing events involving 2,199 genes are identified, accounting for 1.58% of the total genes. Homology analysis reveals that mod(mdg4)-like trans-splicing is the only conserved event that is consistently observed in multiple species across two orders, which represents a unique case of functional diversification involving trans-splicing. Thus, evolutionarily its potential for generating proteins with novel function is not broadly utilized by insects. Furthermore, 146 non-mod trans-spliced transcripts are found to resemble canonical genes from different species. Trans-splicing preserving the function of 'breakup' genes may serve as a general mechanism for relaxing the constraints on gene structure, with profound implications for the evolution of genes and genomes.

  2. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  3. Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination

    PubMed Central

    Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

    2016-01-01

    Background We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Methods Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Results Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Conclusions Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case

  4. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively.

  5. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively. PMID:25011595

  6. Enterobacterial Repetitive Intergenic Consensus Sequence Repeats in Yersiniae: Genomic Organization and Functional Properties

    PubMed Central

    De Gregorio, Eliana; Silvestro, Giustina; Petrillo, Mauro; Carlomagno, Maria Stella; Di Nocera, Pier Paolo

    2005-01-01

    Genome-wide analyses carried out in silico revealed that the DNA repeats called enterobacterial repetitive intergenic consensus sequences (ERICs), which are present in several Enterobacteriaceae, are overrepresented in yersiniae. From the alignment of DNA regions from the wholly sequenced Yersinia enterocolitica 8081 and Yersinia pestis CO92 strains, we could establish that ERICs are miniature mobile elements whose insertion leads to duplication of the dinucleotide TA. ERICs feature long terminal inverted repeats (TIRs) and can fold as RNA into hairpin structures. The proximity to coding regions suggests that most Y. enterocolitica ERICs are cotranscribed with flanking genes. Elements which either overlap or are located next to stop codons are preferentially inserted in the same (or B) orientation. In contrast, ERICs located far apart from open reading frames are inserted in the opposite (or A) orientation. The expression of genes cotranscribed with A- and B-oriented ERICs has been monitored in vivo. In mRNAs spanning B-oriented ERICs, upstream gene transcripts accumulated at lower levels than downstream gene transcripts. This difference was abolished by treating cells with chloramphenicol. We hypothesize that folding of B-oriented elements is impeded by translating ribosomes. Consequently, upstream RNA degradation is triggered by the unmasking of a site for the RNase E located in the right-hand TIR of ERIC. A-oriented ERICs may act in contrast as upstream RNA stabilizers or may have other functions. The hypothesis that ERICs act as regulatory RNA elements is supported by analyses carried out in Yersinia strains which either lack ERIC sequences or carry alternatively oriented ERICs at specific loci. PMID:16291667

  7. Molecular Characterization and Phylogeny of a Phytoplasma Associated with Phyllody Disease of toria (Brassica rapa L. subsp. dichotoma (Roxb.)) in India.

    PubMed

    Azadvar, M; Baranwal, V K

    2010-10-01

    Samples from toria plants (Brassica rapa L. subsp. dichotoma (Roxb.)) exhibiting phyllody, virescence, witches broom, extensive malformation of floral parts, formation of bladder like siliquae and flower sterility were collected from four different locations in India. Sequencing and phylogenetic analysis of the 16S rRNA, a part of 23S rRNA, partial sec A genes, rp gene and 16S-23S intergenic spacer region indicated that the phytoplasmas associated with toria phyllody (TP) symptoms were identical and belonged to 16SrIX phytoplasma Pigeon pea witches'-broom (PPWB) group. The iPhyClassifier generated virtual RFLP pattern of 1.25 kb 16S rDNA sequences indicated that TP phytoplasma belongs to 16SrIX-C phytoplasma subgroup. Complete 23S rRNA gene of TP phytoplasma had 2,787 nucleotides and is the first sequence of 16SrIX phytoplasma group. Restriction digestion of 16S rDNA and 23S rDNA PCR products has also shown that TP phytoplasmas from all the four locations in India were identical. Toria is a previously unreported host for a phytoplasma in16SrIX-C subgroup.

  8. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    SciTech Connect

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  9. Functional Characterization of MC1R-TUBB3 Intergenic Splice Variants of the Human Melanocortin 1 Receptor

    PubMed Central

    Herraiz, Cecilia; Olivares, Conchi; Castejón-Griñán, Maria; Abrisqueta, Marta; Jiménez-Cervantes, Celia; García-Borrón, José Carlos

    2015-01-01

    The melanocortin 1 receptor gene (MC1R) expressed in melanocytes is a major determinant of skin pigmentation. It encodes a Gs protein-coupled receptor activated by α-melanocyte stimulating hormone (αMSH). Human MC1R has an inefficient poly(A) site allowing intergenic splicing with its downstream neighbour Tubulin-β-III (TUBB3). Intergenic splicing produces two MC1R isoforms, designated Iso1 and Iso2, bearing the complete seven transmembrane helices from MC1R fused to TUBB3-derived C-terminal extensions, in-frame for Iso1 and out-of-frame for Iso2. It has been reported that exposure to ultraviolet radiation (UVR) might promote an isoform switch from canonical MC1R (MC1R-001) to the MC1R-TUBB3 chimeras, which might lead to novel phenotypes required for tanning. We expressed the Flag epitope-tagged intergenic isoforms in heterologous HEK293T cells and human melanoma cells, for functional characterization. Iso1 was expressed with the expected size. Iso2 yielded a doublet of Mr significantly lower than predicted, and impaired intracellular stability. Although Iso1- and Iso2 bound radiolabelled agonist with the same affinity as MC1R-001, their plasma membrane expression was strongly reduced. Decreased surface expression mostly resulted from aberrant forward trafficking, rather than high rates of endocytosis. Functional coupling of both isoforms to cAMP was lower than wild-type, but ERK activation upon binding of αMSH was unimpaired, suggesting imbalanced signaling from the splice variants. Heterodimerization of differentially labelled MC1R-001 with the splicing isoforms analyzed by co-immunoprecipitation was efficient and caused decreased surface expression of binding sites. Thus, UVR-induced MC1R isoforms might contribute to fine-tune the tanning response by modulating MC1R-001 availability and functional parameters. PMID:26657157

  10. Functional Characterization of MC1R-TUBB3 Intergenic Splice Variants of the Human Melanocortin 1 Receptor.

    PubMed

    Herraiz, Cecilia; Olivares, Conchi; Castejón-Griñán, Maria; Abrisqueta, Marta; Jiménez-Cervantes, Celia; García-Borrón, José Carlos

    2015-01-01

    The melanocortin 1 receptor gene (MC1R) expressed in melanocytes is a major determinant of skin pigmentation. It encodes a Gs protein-coupled receptor activated by α-melanocyte stimulating hormone (αMSH). Human MC1R has an inefficient poly(A) site allowing intergenic splicing with its downstream neighbour Tubulin-β-III (TUBB3). Intergenic splicing produces two MC1R isoforms, designated Iso1 and Iso2, bearing the complete seven transmembrane helices from MC1R fused to TUBB3-derived C-terminal extensions, in-frame for Iso1 and out-of-frame for Iso2. It has been reported that exposure to ultraviolet radiation (UVR) might promote an isoform switch from canonical MC1R (MC1R-001) to the MC1R-TUBB3 chimeras, which might lead to novel phenotypes required for tanning. We expressed the Flag epitope-tagged intergenic isoforms in heterologous HEK293T cells and human melanoma cells, for functional characterization. Iso1 was expressed with the expected size. Iso2 yielded a doublet of Mr significantly lower than predicted, and impaired intracellular stability. Although Iso1- and Iso2 bound radiolabelled agonist with the same affinity as MC1R-001, their plasma membrane expression was strongly reduced. Decreased surface expression mostly resulted from aberrant forward trafficking, rather than high rates of endocytosis. Functional coupling of both isoforms to cAMP was lower than wild-type, but ERK activation upon binding of αMSH was unimpaired, suggesting imbalanced signaling from the splice variants. Heterodimerization of differentially labelled MC1R-001 with the splicing isoforms analyzed by co-immunoprecipitation was efficient and caused decreased surface expression of binding sites. Thus, UVR-induced MC1R isoforms might contribute to fine-tune the tanning response by modulating MC1R-001 availability and functional parameters. PMID:26657157

  11. Identification and detection of Trypanosoma cruzi by using a DNA amplification fingerprint obtained from the ribosomal intergenic spacer.

    PubMed Central

    González, N; Galindo, I; Guevara, P; Novak, E; Scorza, J V; Añez, N; Da Silveira, J F; Ramírez, J L

    1994-01-01

    We designed a PCR assay targeted on repeated elements of the ribosomal intergenic spacer which produces highly polymorphic DNA band patterns for different strains of Trypanosoma cruzi. By labeling the PCR products with digoxigenin and by chemiluminescence detection, we improved the assay sensitivity by three orders of magnitude to get T. cruzi strain fingerprints in feces of the trypanosome-infected triatomine bug vector. We also developed a capture assay for the digoxigenin-labeled PCR products that allowed us to detect T. cruzi in triatomine bug vector feces and in human serum samples with a solid support. Images PMID:8126172

  12. Identification and Functional Prediction of Large Intergenic Noncoding RNAs (lincRNAs) in Rainbow Trout (Oncorhynchus mykiss).

    PubMed

    Wang, Jian; Fu, Liyuan; Koganti, Prasanthi P; Wang, Lei; Hand, Jacqelyn M; Ma, Hao; Yao, Jianbo

    2016-04-01

    Long noncoding RNAs (lncRNAs) have been recognized in recent years as key regulators of diverse cellular processes. Genome-wide large-scale projects have uncovered thousands of lncRNAs in many model organisms. Large intergenic noncoding RNAs (lincRNAs) are lncRNAs that are transcribed from intergenic regions of genomes. To date, no lincRNAs in non-model teleost fish have been reported. In this report, we present the first reference catalog of 9674 rainbow trout lincRNAs based on analysis of RNA-Seq data from 15 tissues. Systematic analysis revealed that lincRNAs in rainbow trout share many characteristics with those in other mammalian species. They are shorter and lower in exon number and expression level compared with protein-coding genes. They show tissue-specific expression pattern and are typically co-expressed with their neighboring genes. Co-expression network analysis suggested that many lincRNAs are associated with immune response, muscle differentiation, and neural development. The study provides an opportunity for future experimental and computational studies to uncover the functions of lincRNAs in rainbow trout.

  13. Shewanella knowledgebase: integration of the experimental data and computational predictions suggests a biological role for transcription of intergenic regions

    SciTech Connect

    Karpinets, Tatiana V; Romine, Margaret; Schmoyer, Denise D; Kora, Guruprasad H; Syed, Mustafa H; Leuze, Michael Rex; Serres, Margrethe H.; Park, Byung; Uberbacher, Edward C

    2010-01-01

    Shewanellae are facultative gamma-proteobacteria whose remarkable respiratory versatility has resulted in interest in their utility for bioremediation of heavy metals and radionuclides and for energy generation in microbial fuel cells. Extensive experimental efforts over the last several years and the availability of 21 sequenced Shewanella genomes made it possible to collect and integrate a wealth of information on the genus into one public resource providing new avenues for making biological discoveries and for developing a system level understanding of the cellular processes. The Shewanella knowledgebase was established in 2005 to provide a framework for integrated genome-based studies on Shewanella ecophysiology. The present version of the knowledgebase provides access to a diverse set of experimental and genomic data along with tools for curation of genome annotations and visualization and integration of genomic data with experimental data. As a demonstration of the utility of this resource, we examined a single microarray data set from Shewanella oneidensis MR-1 for new insights into regulatory processes. The integrated analysis of the data predicted a new type of bacterial transcriptional regulation involving co-transcription of the intergenic region with the downstream gene and suggested a biological role for co-transcription that likely prevents the binding of a regulator of the upstream gene to the regulator binding site located in the intergenic region. Database URL: http://shewanella-knowledgebase.org:8080/Shewanella/ or http://spruce.ornl.gov:8080/Shewanella/

  14. The CASC15 long intergenic non-coding RNA locus is involved in melanoma progression and phenotype-switching

    PubMed Central

    Lessard, Laurent; Liu, Michelle; Marzese, Diego M.; Wang, Hongwei; Chong, Kelly; Kawas, Neal; Donovan, Nicholas C; Kiyohara, Eiji; Hsu, Sandy; Nelson, Nellie; Izraely, Sivan; Sagi-Assif, Orit; Witz, Isaac P; Ma, Xiao-Jun; Luo, Yuling; Hoon, Dave SB

    2015-01-01

    In recent years, considerable advances have been made in the characterization of protein-coding alterations involved in the pathogenesis of melanoma. However, despite their growing implication in cancer, little is known about the role of long non-coding RNAs in melanoma progression. We hypothesized that copy number alterations of intergenic non-protein coding domains could help identify long intergenic non-coding RNAs (lincRNAs) associated with metastatic cutaneous melanoma. Among several candidates, our approach uncovered the chromosome 6p22.3 CASC15 lincRNA locus as a frequently gained genomic segment in metastatic melanoma tumors and cell lines. The locus was actively transcribed in metastatic melanoma cells, and up-regulation of CASC15 expression was associated with metastatic progression to brain metastasis in a mouse xenograft model. In clinical specimens, CASC15 levels increased during melanoma progression and were independent predictors of disease recurrence in a cohort of 141 patients with AJCC stage III lymph node metastasis. Moreover, siRNA knockdown experiments revealed that CASC15 regulates melanoma cell phenotype switching between proliferative and invasive states. Accordingly, CASC15 levels correlated with known gene signatures corresponding to melanoma proliferative and invasive phenotypes. These findings support a key role for CASC15 in metastatic melanoma. PMID:26016895

  15. Characterization of the intergenic RNA profile at abdominal-A and Abdominal-B in the Drosophila bithorax complex

    PubMed Central

    Bae, Esther; Calhoun, Vincent C.; Levine, Michael; Lewis, Edward B.; Drewell, Robert A.

    2002-01-01

    The correct spatial expression of two Drosophila bithorax complex (BX-C) genes, abdominal-A (abdA) and Abdominal-B (AbdB), is dependent on the 100-kb intergenic infraabdominal (iab) region. The iab region is known to contain a number of different domains (iab2 through iab8) that harbor cis-regulatory elements responsible for directing expression of abdA and AbdB in the second through eighth abdominal segments. Here, we use in situ hybridization to perform high-resolution mapping of the transcriptional activity in the iab control regions. We show that transcription of the control regions themselves is abundant and precedes activation of the abdA and AbdB genes. As with the homeotic genes of the BX-C, the transcription patterns of the RNAs from the iab control regions demonstrate colinearity with the sequence of the iab regions along the chromosome and the domains in the embryo under the control of the specific iab regions. These observations suggest that the intergenic RNAs may play a role in initiating cis regulation at the BX-C early in development. PMID:12481037

  16. Microcosm enrichment of biphenyl-degrading microbial communities from soils and sediments

    SciTech Connect

    Wagner-Doebler, I.; Bennasar, A.; Stroempl, C.; Bruemmer, I.; Eichner, C.; Grammel, I.; Moore, E.R.B.; Vancanneyt, M.

    1998-08-01

    A microcosm enrichment approach was employed to isolate bacteria which are representative of long-term biphenyl-adapted microbial communities. Growth of microorganisms was stimulated by incubating soil and sediment samples from polluted and nonpolluted sites with biphenyl crystals. After 6 months, stable population densities between 8 {times} 10{sup 9} and 2 {times} 10{sup 11} CFU/ml were established in the microcosms, and a large percentage of the organisms were able to grow on biphenyl-containing minimal medium plates. A total of 177 biphenyl-degrading strains were subsequently isolated and characterized by their ability to grow on biphenyl in liquid culture and to accumulate a yellow meta cleavage product when they were sprayed with dihydroxy-biphenyl. Isolates were identified by using a polyphasic approach, including fatty acid methyl ester (FAME) analysis, 16S rRNA gene sequence comparison, sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, and genomic fingerprinting based on sequence variability in the 16S-23S ribosomal DNA intergenic spacer region. In all of the microcosms, isolates identified as Rhodococcus opacus dominated the cultivable microbial community, comprising a cluster of 137 isolates with very similar FAME profiles (Euclidean distances, <10) and identical 16S rRNA gene sequences.

  17. Development of a sensitive DNA microarray suitable for rapid detection of Campylobacter spp.

    PubMed

    Keramas, Georgios; Bang, Dang Duong; Lund, Marianne; Madsen, Mogens; Rasmussen, Svend Erik; Bunkenborg, Henrik; Telleman, Pieter; Christensen, Claus Bo Vöge

    2003-08-01

    Campylobacter is the most common cause of human acute bacterial gastroenteritis worldwide, widely distributed and isolated from human clinical samples as well as from many other different sources. To comply with the demands of consumers for food safety, there is a need for development of a rapid, sensitive and specific detection method for Campylobacter. In this study, we present the development of a novel sensitive DNA-microarray based detection method, evaluated on Campylobacter and non-Campylobacter reference strains, to detect Campylobacter directly from the faecal cloacal swabs. The DNA-microarray method consists of two steps: first, both universal bacterial sequences and specific Campylobacter sequences (size range: 149-307 bp) are amplified and fluorescently labeled using multiplex-PCR, targeting the 16S rRNA, the 16S-23S rRNA intergenic region and specific Campylobacter genes. Secondly, the Cy5 labeled PCR-amplicons are hybridised to immobilised capture probes on the microarray. The method allows detection of three to thirty genome equivalents (6-60 fg DNA) of Campylobacter within 3 h, with a hands on time of only 15 min. Using the DNA-microarrays, two closely related Campylobacter species, Campylobacter jejuni and Campylobacter coli could be detected and differentiated directly from chicken faeces. The DNA-microarray method has a high potential for automation and incorporation into a dedicated mass screening microsystem.

  18. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history. PMID:27054834

  19. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history.

  20. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  1. [Comparative characteristics of intergenic spacers of ribosomal RNA gene cluster in mosquitoes of the genus Culex (Diptera: Culicidae)].

    PubMed

    Shaĭkevich, E V; Zagoskin, M V; Mukha, D V

    2013-01-01

    Nucleotide sequences of intergenic spacer of ribosomal RNA gene cluster (rIGS) were identified in mosquitoes Culex modestus, Culex torrentium and Culex pipiens pallens. The level of interpopulation variability of the rIGS in the subspecies C. pipiens pipiens (form pipiens--mosquitoes that inhabit the open waters, and form molestus--mosquitoes that inhabit basements) living in Russia was estimated. No extensive repetitive sequences characteristic of the rIGS of all previously described species of mosquitoes were found within the rIGS of Culex mosquitoes. At the same time, evolutionarily conserved motifs and relatively short degenerate sequences of different classes of transposable elements, as well as multiple blocks of variable microsatellite repeats were identified. Our data demonstrated that the rIGS of Culex mosquitoes can be considered as a promising molecular marker for the analysis of population and phylogenetic relationships within this group of insects.

  2. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals

    PubMed Central

    Chernikova, Diana; Managadze, David; Glazko, Galina V.; Makalowski, Wojciech; Rogozin, Igor B.

    2016-01-01

    The abundance of mammalian long intergenic non-coding RNA (lincRNA) genes is high, yet their functions remain largely unknown. One possible way to study this important question is to use large-scale comparisons of various characteristics of lincRNA with those of protein-coding genes for which a large body of functional information is available. A prominent feature of mammalian protein-coding genes is the high evolutionary conservation of the exon-intron structure. Comparative analysis of putative intron positions in lincRNA genes from various mammalian genomes suggests that some lincRNA introns have been conserved for over 100 million years, thus the primary and/or secondary structure of these molecules is likely to be functionally important. PMID:27429005

  3. Capturing intergenerativity: the use of student reflective journals to identify learning within an undergraduate course in gerontological nursing.

    PubMed

    Davies, Susan M; Reitmaier, Amy B; Smith, Linda Reveling; Mangan-Danckwart, Deborah

    2013-03-01

    The benefits of intergenerational contact between older and young adults have been demonstrated; yet, nursing programs have underexplored the potential of such relationships for enhancing student learning. This article presents an analysis of student reflective journals as part of an evaluation of an undergraduate gerontological nursing course. The course aims to create positive learning experiences by involving older adults as partners in student learning. Older adults are recruited to receive visits from a designated student to share aspects of their life and experiences. Students write reflective journals based on these visits as a method of evaluating their learning. A framework analysis of 80 journals completed by 59 students identified four major themes representing the impact of these visits on student learning: becoming aware, making connections, seeing the unique person, and valuing intergenerational relationships. The analysis suggests the relevance of the concept of intergenerativity in illuminating shared benefits of the practicum experience.

  4. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites

    PubMed Central

    Lee, Seung-Tae; Wiemels, Joseph L.

    2016-01-01

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as ‘backbone’, largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. PMID:26464434

  5. Conservation of the Exon-Intron Structure of Long Intergenic Non-Coding RNA Genes in Eutherian Mammals.

    PubMed

    Chernikova, Diana; Managadze, David; Glazko, Galina V; Makalowski, Wojciech; Rogozin, Igor B

    2016-01-01

    The abundance of mammalian long intergenic non-coding RNA (lincRNA) genes is high, yet their functions remain largely unknown. One possible way to study this important question is to use large-scale comparisons of various characteristics of lincRNA with those of protein-coding genes for which a large body of functional information is available. A prominent feature of mammalian protein-coding genes is the high evolutionary conservation of the exon-intron structure. Comparative analysis of putative intron positions in lincRNA genes from various mammalian genomes suggests that some lincRNA introns have been conserved for over 100 million years, thus the primary and/or secondary structure of these molecules is likely to be functionally important. PMID:27429005

  6. Analysis of the CYP21A2 gene with intergenic recombination and multiple gene deletions in the RCCX module.

    PubMed

    Chang, Shwu-Fen; Lee, Hsien-Hsiung

    2011-01-01

    The most frequent bimodular RCCX module of the RP1-C4A-CYP21A1P-TNXA-RP2-C4B-CYP21A2-TNXB gene sequence is located on chromosome 6p21.3. To determine RCCX alterations, we used the polymerase chain reaction (PCR) product containing the tenascin B (TNXB) and CYP21A2 genes with TaqI digestion and Southern blot analysis with AseI and NdeI endonuclease digestion of genomic DNA from congenital adrenal hyperplasia patients with common mutations resulting from an intergenic conversion of CYP21A1P, such as an I2 splice, I172N, V281L, F306-L307insT, Q318X, and R356W, and dual mutations of I236N/V237E in the CYP21A2 gene. The results showed that a 3.7-kb fragment of the CYP21A2 gene was detected in each case, and 21.6- and 11.3-kb DNA fragments were found in the RCCX region by a Southern blot analysis with these corresponding mutations. However, the IVS2-12A/C- > G (I2 splice) haplotype in combination with the 707-714delGAGACTAC (without the P30L mutation) mutation produced a 3.2-kb TaqI fragment in the PCR product analysis and a specific 9.3-kb fragment by the Southern blot method. Therefore, we concluded that the rearrangement in the RCCX region resulting from processing of either an intergenic recombination or multiple gene deletions can be identified by the PCR analysis and Southern blot method based on a fragment-distinguishing configuration without a family study.

  7. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

    PubMed

    Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars. PMID:27434138

  8. Diversification of the light-harvesting complex gene family via intra- and intergenic duplications in the coral symbiotic alga Symbiodinium.

    PubMed

    Maruyama, Shinichiro; Shoguchi, Eiichi; Satoh, Nori; Minagawa, Jun

    2015-01-01

    The light-harvesting complex (LHC) is an essential component in light energy capture and transduction to facilitate downstream photosynthetic reactions in plant and algal chloroplasts. The unicellular dinoflagellate alga Symbiodinium is an endosymbiont of cnidarian animals, including corals and sea anemones, and provides carbohydrates generated through photosynthesis to host animals. Although Symbiodinium possesses a unique LHC gene family, called chlorophyll a-chlorophyll c2-peridinin protein complex (acpPC), its genome-level diversity and evolutionary trajectories have not been investigated. Here, we describe a phylogenetic analysis revealing that many of the LHCs are encoded by highly duplicated genes with multi-subunit polyprotein structures in the nuclear genome of Symbiodinium minutum. This analysis provides an extended list of the LHC gene family in a single organism, including 80 loci encoding polyproteins composed of 145 LHC subunits recovered in the phylogenetic tree. In S. minutum, 5 phylogenetic groups of the Lhcf-type gene family, which is exclusively conserved in algae harboring secondary plastids of red algal origin, were identified. Moreover, 5 groups of the Lhcr-type gene family, of which members are known to be associated with PSI in red algal plastids and secondary plastids of red algal origin, were identified. Notably, members classified within a phylogenetic group of the Lhcf-type (group F1) are highly duplicated, which may explain the presence of an unusually large number of LHC genes in this species. Some gene units were homologous to other units within single loci of the polyprotein genes, whereas intergenic homologies between separate loci were conspicuous in other cases, implying that gene unit 'shuffling' by gene conversion and/or genome rearrangement might have been a driving force for diversification. These results suggest that vigorous intra- and intergenic gene duplication events have resulted in the genomic framework of

  9. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

    PubMed

    Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

  10. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.)

    PubMed Central

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars. PMID:27434138

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  12. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  13. The apolipoprotein CIII enhancer regulates both extensive histone modification and intergenic transcription of human apolipoprotein AI/CIII/AIV genes but not apolipoprotein AV.

    PubMed

    Li, Ya-Jun; Wei, Yu-Sheng; Fu, Xiang-Hui; Hao, De-Long; Xue, Zheng; Gong, Huan; Zhang, Zhu-Qin; Liu, De-Pei; Liang, Chih-Chuan

    2008-10-17

    The apolipoprotein (apo) AI/CIII/AIV/AV cluster genes are expressed at different levels in the liver and intestine. The apoCIII enhancer, a common regulatory element, regulates the tissue-specific expression of apoAI, apoCIII, and apoAIV but not apoAV. To study this regulation at the chromatin level, the histone modifications and intergenic transcription in the human apoAI/CIII/AIV/AV cluster were investigated in HepG2 and Caco-2 cells and in the livers of transgenic mice carrying the human gene cluster constructs with or without the apoCIII enhancer. We found that both the promoters and the intergenic regions of the apoAI/CIII/AIV genes were hyperacetylated and formed an open subdomain that did not include the apoAV gene. Hepatic and intestinal intergenic transcripts were identified to transcribe bidirectionally with strand preferences along the cluster. The deletion of the apoCIII enhancer influenced both histone modification and intergenic transcription in the apoAI/CIII/AIV gene region. These results demonstrate that the apoCIII enhancer contributes to the maintenance of an active chromatin subdomain of the apoAI/CIII/AIV genes, but not apoAV.

  14. Enterobacterial repetitive intergenic consensus 1R PCR assay for detection of Raoultella sp. isolates among strains identified as Klebsiella oxytoca in the clinical laboratory.

    PubMed

    Granier, Sophie A; Leflon-Guibout, Véronique; Goldstein, Fred W; Nicolas-Chanoine, Marie-Hélène

    2003-04-01

    The enterobacterial repetitive intergenic consensus 1R PCR method, which provided recognizable profiles for reference strains of the three species of Raoultella and the two genetic groups of Klebsiella oxytoca, was applied to 19 clinical isolates identified as K. oxytoca. By this method, as confirmed by species-specific gene sequencing, two Raoultella ornithinolytica and two unclassifiable K. oxytoca isolates were identified.

  15. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design.

  16. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    PubMed

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  17. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single strand conformation polymorphism (SSCP). Diversity indexes sh...

  18. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  19. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  20. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  1. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  2. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  3. Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA).

    PubMed

    Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

    2011-08-01

    During collection, maple sap is contaminated by bacteria and fungi that subsequently colonize the tubing system. The bacterial microbiota has been more characterized than the fungal microbiota, but the impact of both components on maple sap quality remains unclear. This study focused on identifying bacterial and fungal members of maple sap and correlating microbiota composition with maple sap properties. A multiplex automated ribosomal intergenic spacer analysis (MARISA) method was developed to presumptively identify bacterial and fungal members of maple sap samples collected from 19 production sites during the tapping period. Results indicate that the fungal community of maple sap is mainly composed of yeast related to Mrakia sp., Mrakiella sp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia, Mrakiella and Guehomyces peaks were identified in samples of all production sites and can be considered dominant and stable members of the fungal microbiota of maple sap. A multivariate analysis based on MARISA profiles and maple sap chemical composition data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus sp., Pseudomonas tolaasii, G. pullulans and maple sap composition at different flow periods. This study provides new insights on the relationship between microbial community and maple sap quality.

  4. Evidence for RNA synthesis in the intergenic region between enhancer and promoter and its inhibition by insulators in Drosophila melanogaster.

    PubMed

    Tchurikov, Nickolai A; Kretova, Olga V; Moiseeva, Evgenia D; Sosin, Dmitri V

    2009-01-01

    Uncovering the nature of communication between enhancers, promoters and insulators is important for understanding the fundamental mechanisms that ensure appropriate gene expression levels. Here we describe an approach employing transient expression of genetic luciferase reporter gene constructs with quantitative RT-PCR analysis of transcription between an enhancer and Hsp70 promoter. We tested genetic constructs containing gypsy and/or Fab7 insulators in different orientations, and an enhancer from copia LTR-retroelement [(enh)copia]. A single gypsy or Fab7 insulator inserted between the promoter and enhancer in any polarity reduced enhancer action. A pair of insulators flanking the gene in any orientation exhibited increased insulation activity. We detected promoter-independent synthesis of non-coding RNA in the intergenic region of the constructs, which was induced by the enhancer in both directions and repressed by a single insulator or a pair of insulators. These results highlight the involvement of RNA-tracking mechanisms in the communications between enhancers and promoters, which are inhibited by insulators.

  5. Comparison of the bacterial community structure within the equine hindgut and faeces using Automated Ribosomal Intergenic Spacer Analysis (ARISA).

    PubMed

    Sadet-Bourgeteau, S; Philippeau, C; Dequiedt, S; Julliand, V

    2014-12-01

    The horse's hindgut bacterial ecosystem has often been studied using faecal samples. However few studies compared both bacterial ecosystems and the validity of using faecal samples may be questionable. Hence, the present study aimed to compare the structure of the equine bacterial community in the hindgut (caecum, right ventral colon) and faeces using a fingerprint technique known as Automated Ribosomal Intergenic Spacer Analysis (ARISA). Two DNA extraction methods were also assessed. Intestinal contents and faeces were sampled 3 h after the morning meal on four adult fistulated horses fed meadow hay and pelleted concentrate. Irrespective of the intestinal segment, Principal Component Analysis of ARISA profiles showed a strong individual effect (P<0.0001). However, across the study, faecal bacterial community structure significantly (P<0.001) differed from those of the caecum and colon, while there was no difference between the two hindgut communities. The use of a QIAamp(®) DNA Stool Mini kit increased the quality of DNA extracted irrespective of sample type. The differences observed between faecal and hindgut bacterial communities challenge the use of faeces as a representative for hindgut activity. Further investigations are necessary to compare bacterial activity between the hindgut and faeces in order to understand the validity of using faecal samples. PMID:25075719

  6. Genome-wide analysis of long intergenic non-coding RNAs in chickpea and their potential role in flower development.

    PubMed

    Khemka, Niraj; Singh, Vikash Kumar; Garg, Rohini; Jain, Mukesh

    2016-01-01

    Non-coding RNAs constitute a major portion of the transcriptome in most of eukaryotes. Long non-coding transcripts originating from the DNA segment present between the protein coding genes are termed as long intergenic non-coding RNAs (lincRNAs). Several evidences suggest the role of lincRNAs in regulation of various biological processes. In this study, we identified a total of 2248 lincRNAs in chickpea using RNA-seq data from eight successive stages of flower development and three vegetative tissues via an optimized pipeline. Different characteristic features of lincRNAs were studied and compared with those of predicted mRNAs in chickpea. Further, we utilized a method using network propagation algorithm to reveal the putative function of lincRNAs in plants. In total, at least 79% of the identified chickpea lincRNAs were assigned with a putative function. A comprehensive expression profiling revealed differential expression patterns and tissue specificity of lincRNAs in different stages of flower development in chickpea. In addition, potential lincRNAs-miRNA interactions were explored for the predicted lincRNAs in chickpea. These findings will pave the way for understanding the role of lincRNAs in the regulatory mechanism underlying flower development in chickpea and other legumes. PMID:27628568

  7. Identification of chimeric TSNAX-DISC1 resulting from intergenic splicing in endometrial carcinoma through high-throughput RNA sequencing.

    PubMed

    Li, Na; Zheng, Jian; Li, Hua; Deng, Jieqiong; Hu, Min; Wu, Hongchun; Li, Wei; Li, Fang; Lan, Xun; Lu, Jiachun; Zhou, Yifeng

    2014-12-01

    Gene fusion is among the primary processes that generate new genes and has been well characterized as potent pathway of oncogenesis. Here, by high-throughput RNA sequencing in nine paired human endometrial carcinoma (EC) and matched non-cancerous tissues, we obtained that chimeric translin-associated factor X-disrupted-in-schizophrenia 1 (TSNAX-DISC1) occurred significantly upregulated in multiple EC samples. Experimental investigation showed that TSNAX-DISC1 appears to be formed by splicing without chromosomal rearrangement. The chimera expression inversely correlated with the binding of CCCTC-binding factor (CTCF) to the insulators. Subsequent investigations indicate that long intergenic non-coding RNA lincRNA-NR_034037, separating TSNAX from DISC1, regulates TSNAX -DISC1 production and TSNAX/DISC1 expression levels by extricating CTCF from insulators. Dysregulation of TSNAX influences steroidogenic factor-1-stimulated transcription on the StAR promoter, altering progesterone actions, implying the association with cancer. Together, these results advance our understanding of the mechanism in which lincRNA-NR_034037 regulates TSNAX-DISC1 formation programs that tightly regulate EC development.

  8. Identification of chimeric TSNAX-DISC1 resulting from intergenic splicing in endometrial carcinoma through high-throughput RNA sequencing.

    PubMed

    Li, Na; Zheng, Jian; Li, Hua; Deng, Jieqiong; Hu, Min; Wu, Hongchun; Li, Wei; Li, Fang; Lan, Xun; Lu, Jiachun; Zhou, Yifeng

    2014-12-01

    Gene fusion is among the primary processes that generate new genes and has been well characterized as potent pathway of oncogenesis. Here, by high-throughput RNA sequencing in nine paired human endometrial carcinoma (EC) and matched non-cancerous tissues, we obtained that chimeric translin-associated factor X-disrupted-in-schizophrenia 1 (TSNAX-DISC1) occurred significantly upregulated in multiple EC samples. Experimental investigation showed that TSNAX-DISC1 appears to be formed by splicing without chromosomal rearrangement. The chimera expression inversely correlated with the binding of CCCTC-binding factor (CTCF) to the insulators. Subsequent investigations indicate that long intergenic non-coding RNA lincRNA-NR_034037, separating TSNAX from DISC1, regulates TSNAX -DISC1 production and TSNAX/DISC1 expression levels by extricating CTCF from insulators. Dysregulation of TSNAX influences steroidogenic factor-1-stimulated transcription on the StAR promoter, altering progesterone actions, implying the association with cancer. Together, these results advance our understanding of the mechanism in which lincRNA-NR_034037 regulates TSNAX-DISC1 formation programs that tightly regulate EC development. PMID:25239642

  9. A comparison of fungal communities from four salt marsh plants using automated ribosomal intergenic spacer analysis (ARISA).

    PubMed

    Torzilli, Albert P; Sikaroodi, Masoumeh; Chalkley, David; Gillevet, Patrick M

    2006-01-01

    Fungal decomposers are important contributors to the detritus-based food webs of salt marsh ecosystems. Knowing the composition of salt marsh fungal communities is essential in understanding how detritus processing is affected by changes in community dynamics. Automated ribosomal intergenic spacer analysis (ARISA) was used to examine the composition of fungal communities associated with four temperate salt marsh plants, Spartina alterniflora (short and tall forms), Juncus roemerianus, Distichlis spicata and Sarcocornia perennis. Plant tissues were homogenized and subjected to a particle-filtration protocol that yielded 106 microm particulate fractions, which were used as a source of fungal isolates and fungal DNA. Genera identified from sporulating cultures demonstrated that the 106 microm particles from each host plant were reliable sources of fungal DNA for ARISA. Analysis of ARISA data by principal component analysis (PCA), principal coordinate analysis (PCO) and species diversity comparisons indicated that the fungal communities from the two grasses, S. alterniflora and D. spicata were more similar to each other than they were to the distinct communities associated with J. roemerianus and S. perennis. Principal component analysis also showed no consistent, seasonal pattern in the composition of these fungal communities. Comparisons of ARISA fingerprints from the different fungal communities and those from pure cultures of selected Spartina ascomycetes supported the host/substrate specificity observed for the fungal communities.

  10. Genome-wide identification of long intergenic noncoding RNA genes and their potential association with domestication in pigs.

    PubMed

    Zhou, Zhong-Yin; Li, Ai-Min; Adeola, Adeniyi C; Liu, Yan-Hu; Irwin, David M; Xie, Hai-Bing; Zhang, Ya-Ping

    2014-06-02

    Thousands of long intergenic noncoding RNAs (lincRNAs) have been identified in the human and mouse genomes, some of which play important roles in fundamental biological processes. The pig is an important domesticated animal, however, pig lincRNAs remain poorly characterized and it is unknown if they were involved in the domestication of the pig. Here, we used available RNA-seq resources derived from 93 samples and expressed sequence tag data sets, and identified 6,621 lincRNA transcripts from 4,515 gene loci. Among the identified lincRNAs, some lincRNA genes exhibit synteny and sequence conservation, including linc-sscg2561, whose gene neighbor Dnmt3a is associated with emotional behaviors. Both linc-sscg2561 and Dnmt3a show differential expression in the frontal cortex between domesticated pigs and wild boars, suggesting a possible role in pig domestication. This study provides the first comprehensive genome-wide analysis of pig lincRNAs.

  11. Functional analysis of long intergenic non-coding RNAs in phosphate-starved rice using competing endogenous RNA network

    PubMed Central

    Xu, Xi-Wen; Zhou, Xiong-Hui; Wang, Rui-Ru; Peng, Wen-Lei; An, Yue; Chen, Ling-Ling

    2016-01-01

    Long intergenic non-coding RNAs (lincRNAs) may play widespread roles in gene regulation and other biological processes, however, a systematic examination of the functions of lincRNAs in the biological responses of rice to phosphate (Pi) starvation has not been performed. Here, we used a computational method to predict the functions of lincRNAs in Pi-starved rice. Overall, 3,170 lincRNA loci were identified using RNA sequencing data from the roots and shoots of control and Pi-starved rice. A competing endogenous RNA (ceRNA) network was constructed for each tissue by considering the competing relationships between lincRNAs and genes, and the correlations between the expression levels of RNAs in ceRNA pairs. Enrichment analyses showed that most of the communities in the networks were related to the biological processes of Pi starvation. The lincRNAs in the two tissues were individually functionally annotated based on the ceRNA networks, and the differentially expressed lincRNAs were biologically meaningful. For example, XLOC_026030 was upregulated from 3 days after Pi starvation, and its functional annotation was ‘cellular response to Pi starvation’. In conclusion, we systematically annotated lincRNAs in rice and identified those involved in the biological response to Pi starvation. PMID:26860696

  12. A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

    PubMed

    Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-01-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

  13. Evaluation of Automated Ribosomal Intergenic Spacer Analysis for Bacterial Fingerprinting of Rumen Microbiome Compared to Pyrosequencing Technology

    PubMed Central

    Jami, Elie; Shterzer, Naama; Mizrahi, Itzhak

    2014-01-01

    The mammalian gut houses a complex microbial community which is believed to play a significant role in host physiology. In recent years, several microbial community analysis methods have been implemented to study the whole gut microbial environment, in contrast to classical microbiological methods focusing on bacteria which can be cultivated. One of these is automated ribosomal intergenic spacer analysis (ARISA), an inexpensive and popular way of analyzing bacterial diversity and community fingerprinting in ecological samples. ARISA uses the natural variability in length of the DNA fragment found between the 16S and 23S genes in different bacterial lineages to infer diversity. This method is now being supplanted by affordable next-generation sequencing technologies that can also simultaneously annotate operational taxonomic units for taxonomic identification. We compared ARISA and pyrosequencing of samples from the rumen microbiome of cows, previously sampled at different stages of development and varying in microbial complexity using several ecological parameters. We revealed close agreement between ARISA and pyrosequencing outputs, especially in their ability to discriminate samples from different ecological niches. In contrast, the ARISA method seemed to underestimate sample richness. The good performance of the relatively inexpensive ARISA makes it relevant for straightforward use in bacterial fingerprinting analysis as well as for quick cross-validation of pyrosequencing data. PMID:25437610

  14. The Mitochondrial Genome of the Leaf-Cutter Ant Atta laevigata: A Mitogenome with a Large Number of Intergenic Spacers

    PubMed Central

    Rodovalho, Cynara de Melo; Lyra, Mariana Lúcio; Ferro, Milene; Bacci, Maurício

    2014-01-01

    In this paper we describe the nearly complete mitochondrial genome of the leaf-cutter ant Atta laevigata, assembled using transcriptomic libraries from Sanger and Illumina next generation sequencing (NGS), and PCR products. This mitogenome was found to be very large (18,729 bp), given the presence of 30 non-coding intergenic spacers (IGS) spanning 3,808 bp. A portion of the putative control region remained unsequenced. The gene content and organization correspond to that inferred for the ancestral pancrustacea, except for two tRNA gene rearrangements that have been described previously in other ants. The IGS were highly variable in length and dispersed through the mitogenome. This pattern was also found for the other hymenopterans in particular for the monophyletic Apocrita. These spacers with unknown function may be valuable for characterizing genome evolution and distinguishing closely related species and individuals. NGS provided better coverage than Sanger sequencing, especially for tRNA and ribosomal subunit genes, thus facilitating efforts to fill in sequence gaps. The results obtained showed that data from transcriptomic libraries contain valuable information for assembling mitogenomes. The present data also provide a source of molecular markers that will be very important for improving our understanding of genomic evolutionary processes and phylogenetic relationships among hymenopterans. PMID:24828084

  15. Genome-wide analysis of long intergenic non-coding RNAs in chickpea and their potential role in flower development

    PubMed Central

    Khemka, Niraj; Singh, Vikash Kumar; Garg, Rohini; Jain, Mukesh

    2016-01-01

    Non-coding RNAs constitute a major portion of the transcriptome in most of eukaryotes. Long non-coding transcripts originating from the DNA segment present between the protein coding genes are termed as long intergenic non-coding RNAs (lincRNAs). Several evidences suggest the role of lincRNAs in regulation of various biological processes. In this study, we identified a total of 2248 lincRNAs in chickpea using RNA-seq data from eight successive stages of flower development and three vegetative tissues via an optimized pipeline. Different characteristic features of lincRNAs were studied and compared with those of predicted mRNAs in chickpea. Further, we utilized a method using network propagation algorithm to reveal the putative function of lincRNAs in plants. In total, at least 79% of the identified chickpea lincRNAs were assigned with a putative function. A comprehensive expression profiling revealed differential expression patterns and tissue specificity of lincRNAs in different stages of flower development in chickpea. In addition, potential lincRNAs-miRNA interactions were explored for the predicted lincRNAs in chickpea. These findings will pave the way for understanding the role of lincRNAs in the regulatory mechanism underlying flower development in chickpea and other legumes. PMID:27628568

  16. Evaluation of automated ribosomal intergenic spacer analysis for bacterial fingerprinting of rumen microbiome compared to pyrosequencing technology.

    PubMed

    Jami, Elie; Shterzer, Naama; Mizrahi, Itzhak

    2014-01-01

    The mammalian gut houses a complex microbial community which is believed to play a significant role in host physiology. In recent years, several microbial community analysis methods have been implemented to study the whole gut microbial environment, in contrast to classical microbiological methods focusing on bacteria which can be cultivated. One of these is automated ribosomal intergenic spacer analysis (ARISA), an inexpensive and popular way of analyzing bacterial diversity and community fingerprinting in ecological samples. ARISA uses the natural variability in length of the DNA fragment found between the 16S and 23S genes in different bacterial lineages to infer diversity. This method is now being supplanted by affordable next-generation sequencing technologies that can also simultaneously annotate operational taxonomic units for taxonomic identification. We compared ARISA and pyrosequencing of samples from the rumen microbiome of cows, previously sampled at different stages of development and varying in microbial complexity using several ecological parameters. We revealed close agreement between ARISA and pyrosequencing outputs, especially in their ability to discriminate samples from different ecological niches. In contrast, the ARISA method seemed to underestimate sample richness. The good performance of the relatively inexpensive ARISA makes it relevant for straightforward use in bacterial fingerprinting analysis as well as for quick cross-validation of pyrosequencing data. PMID:25437610

  17. Genomic Variability of Haemophilus influenzae Isolated from Mexican Children Determined by Using Enterobacterial Repetitive Intergenic Consensus Sequences and PCR

    PubMed Central

    Gomez-De-Leon, Patricia; Santos, Jose I.; Caballero, Javier; Gomez, Demostenes; Espinosa, Luz E.; Moreno, Isabel; Piñero, Daniel; Cravioto, Alejandro

    2000-01-01

    Genomic fingerprints from 92 capsulated and noncapsulated strains of Haemophilus influenzae from Mexican children with different diseases and healthy carriers were generated by PCR using the enterobacterial repetitive intergenic consensus (ERIC) sequences. A cluster analysis by the unweighted pair-group method with arithmetic averages based on the overall similarity as estimated from the characteristics of the genomic fingerprints, was conducted to group the strains. A total of 69 fingerprint patterns were detected in the H. influenzae strains. Isolates from patients with different diseases were represented by a variety of patterns, which clustered into two major groups. Of the 37 strains isolated from cases of meningitis, 24 shared patterns and were clustered into five groups within a similarity level of 1.0. One fragment of 1.25 kb was common to all meningitis strains. H. influenzae strains from healthy carriers presented fingerprint patterns different from those found in strains from sick children. Isolates from healthy individuals were more variable and were distributed differently from those from patients. The results show that ERIC-PCR provides a powerful tool for the determination of the distinctive pathogenicity potentials of H. influenzae strains and encourage its use for molecular epidemiology investigations. PMID:10878033

  18. Pan-Cancer Analyses Reveal Long Intergenic Non-Coding RNAs Relevant to Tumor Diagnosis, Subtyping and Prognosis.

    PubMed

    Ching, Travers; Peplowska, Karolina; Huang, Sijia; Zhu, Xun; Shen, Yi; Molnar, Janos; Yu, Herbert; Tiirikainen, Maarit; Fogelgren, Ben; Fan, Rong; Garmire, Lana X

    2016-05-01

    Long intergenic noncoding RNAs (lincRNAs) are a relatively new class of non-coding RNAs that have the potential as cancer biomarkers. To seek a panel of lincRNAs as pan-cancer biomarkers, we have analyzed transcriptomes from over 3300 cancer samples with clinical information. Compared to mRNA, lincRNAs exhibit significantly higher tissue specificities that are then diminished in cancer tissues. Moreover, lincRNA clustering results accurately classify tumor subtypes. Using RNA-Seq data from thousands of paired tumor and adjacent normal samples in The Cancer Genome Atlas (TCGA), we identify six lincRNAs as potential pan-cancer diagnostic biomarkers (PCAN-1 to PCAN-6). These lincRNAs are robustly validated using cancer samples from four independent RNA-Seq data sets, and are verified by qPCR in both primary breast cancers and MCF-7 cell line. Interestingly, the expression levels of these six lincRNAs are also associated with prognosis in various cancers. We further experimentally explored the growth and migration dependence of breast and colon cancer cell lines on two of the identified lncRNAs. In summary, our study highlights the emerging role of lincRNAs as potentially powerful and biologically functional pan-cancer biomarkers and represents a significant leap forward in understanding the biological and clinical functions of lincRNAs in cancers.

  19. Characterization of mitochondrial control region, two intergenic spacers and tRNAs of Zaprionus indianus (Diptera: Drosophilidae).

    PubMed

    da Silva, Norma Machado; de Souza Dias, Aline; da Silva Valente, Vera Lúcia; Valiati, Victor Hugo

    2009-12-01

    The control region in insects is the major noncoding region in animal mitochondrial DNA (mtDNA), and is responsible for a large part of the variation in the DNA sequence and size of the genome of this organelle. In this study, the mtDNA control region, two intergenic spacers and tRNA genes of a Zaprionus indianus strain were cloned, sequenced and compared with other Drosophila species. The overall A+T content in the Z. indianus control region is 94.3%, and a comparison with other Drosophila species demonstrated that the most conserved region appears to be the 420 base pairs nearest to the tRNA(ile), similar to the findings of other authors. We also describe conserved sequence blocks, including a poly-T involved in the replication process of Drosophila mtDNA; a putative secondary structure also involved in the replication process and repeated sequences. tRNA(ile) sequence demonstrated the greatest variability when the tRNA sequences of species were compared.

  20. A p53-bound enhancer region controls a long intergenic noncoding RNA required for p53 stress response.

    PubMed

    Melo, C A; Léveillé, N; Rooijers, K; Wijchers, P J; Geeven, G; Tal, A; Melo, S A; de Laat, W; Agami, R

    2016-08-18

    Genome-wide chromatin studies identified the tumor suppressor p53 as both a promoter and an enhancer-binding transcription factor. As an enhancer factor, p53 can induce local production of enhancer RNAs, as well as transcriptional activation of distal neighboring genes. Beyond the regulation of protein-coding genes, p53 has the capacity to regulate long intergenic noncoding RNA molecules (lincRNAs); however, their importance to the p53 tumor suppressive function remains poorly characterized. Here, we identified and characterized a novel p53-bound intronic enhancer that controls the expression of its host, the lincRNA00475 (linc-475). We demonstrate the requirement of linc-475 for the proper induction of a p53-dependent cell cycle inhibitory response. We further confirm the functional importance of linc-475 in the maintenance of CDKN1A/p21 levels, a cell cycle inhibitor and a major p53 target gene, following p53 activation. Interestingly, loss of linc-475 reduced the binding of both p53 and RNA polymerase II (RNAPII) to the promoter of p21, attenuating its transcription rate following p53 activation. Altogether, our data suggest a direct role of p53-bound enhancer domains in the activation of lincRNAs required for an efficient p53 transcriptional response.

  1. Molecular typing among beef isolates of Escherichia coli using consensus repetitive intergenic enterobacteria-polymerase chain reaction (ERIC-PCR)

    NASA Astrophysics Data System (ADS)

    Zoolkifli, Nurliyana Wan; Mutalib, Sahilah Abd

    2013-11-01

    Genomic DNA of Escherichia coli were characterized by enterobacterial repetitive intergenic consensus-Polymerase chain reaction (ERIC-PCR) and the presence of Shiga toxin gene-I (Stx1) and Shiga toxin gene-2 (Stx2). These isolates were originated from imported raw beef which are come from two countries namely Australia and India. The isolation of E. coli was conducted by using Eosin Methylene Blue Agar (EMBA). A total of 94 strains had been isolated from 30 samples of imported raw beefand 42 strains had been detected positively E. coli by doing biochemical tests. All strains had been tested and the results of biochemical tests showed that 3 strains were from Australia samples while the other 39 strains were from India samples. The biochemical tests used are Indole test, Methyl Red test, Voges-Proskauer test and Citrate test. All the 42 strains were examined for Shiga toxin (stx1 and stx2) gene detection by two pair primers which are stx2F (5'-TTCTTCGGTATCCTATTCCC-3'), stx2R (5'-ATGCATCTCTGGTCATTGTA-3'), stx1F (5'-CAGTTAATGTGGTGGCGAAG-3'), and stx1R (5'-CTGTCACAGTAACAACCGT-3'). The results showed that none of the strains are positive for Shiga toxin gene. Application of ERIC-PCR method towards E. coli had successfully shown the high diversity polymorphism in 21 different genome types of DNA with primers ERIC1R (5'- CACTTAGGGGTCCTCGAATGTA- 3') and ERIC2R (5'- AAGTAAGTGACTGGGGTGACGC- 3').

  2. Genotypic and symbiotic diversity of Rhizobium populations associated with cultivated lentil and pea in sub-humid and semi-arid regions of Eastern Algeria.

    PubMed

    Riah, Nassira; Béna, Gilles; Djekoun, Abdelhamid; Heulin, Karine; de Lajudie, Philippe; Laguerre, Gisèle

    2014-07-01

    The genetic structure of rhizobia nodulating pea and lentil in Algeria, Northern Africa was determined. A total of 237 isolates were obtained from root nodules collected on lentil (Lens culinaris), proteaginous and forage pea (Pisum sativum) growing in two eco-climatic zones, sub-humid and semi-arid, in Eastern Algeria. They were characterised by PCR-restriction fragment length polymorphism (RFLP) of the 16S-23S rRNA intergenic region (IGS), and the nodD-F symbiotic region. The combination of these haplotypes allowed the isolates to be clustered into 26 distinct genotypes, and all isolates were classified as Rhizobium leguminosarum. Symbiotic marker variation (nodD-F) was low but with the predominance of one nod haplotype (g), which had been recovered previously at a high frequency in Europe. Sequence analysis of the IGS further confirmed its high variability in the studied strains. An AMOVA analysis showed highly significant differentiation in the IGS haplotype distribution between populations from both eco-climatic zones. This differentiation was reflected by differences in dominant genotype frequencies. Conversely, no host plant effect was detected. The nodD gene sequence-based phylogeny suggested that symbiotic gene diversity in pea and lentil nodulating rhizobial populations in Algeria was low compared to that reported elsewhere in the world.

  3. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis.

    PubMed

    Laroucau, Karine; Trichereau, Alain; Vorimore, Fabien; Mahé, Anne-Marie

    2007-03-31

    In a previous study we described the use of a new set of PCR primers (CpsiA/CpsiB) specific of the conserved pmp-family genes of Chlamydophila abortus as an efficient tool for the detection of these bacteria in ruminants including also preliminary results on avian strains. In this work, the use of this set of primers was extended to representative strains of the six major avian serovars (serovars A-F) and to field isolates of C. psittaci. For all the studied representative strains, using purified genomic DNA as a template, CpsiA/CpsiB primers allowed, as observed for C. abortus, a minimal 10-fold PCR signal increase compared to the one observed with ompA specific primers. In comparison to primers targeting the 16S-23S rRNA intergenic spacer, similar or increased sensitivity was observed depending on the strain. All the field isolates were amplified with CpsiA/CpsiB primers. On clinical samples, our primers are the best among those tested for detection of C. psittaci by simple conventional PCR. RFLP experiments performed using PCR fragments amplified with the CpsiA/CpsiB primers gave promising results demonstrating that these primers may provide an interesting tool for molecular typing when the bacterium cannot be grown from pathological samples.

  4. Bacterial Functional Redundancy along a Soil Reclamation Gradient

    PubMed Central

    Yin, Bei; Crowley, David; Sparovek, Gerd; De Melo, Wanderley Jose; Borneman, James

    2000-01-01

    A strategy to measure bacterial functional redundancy was developed and tested with soils collected along a soil reclamation gradient by determining the richness and diversity of bacterial groups capable of in situ growth on selected carbon substrates. Soil cores were collected from four sites along a transect from the Jamari tin mine site in the Jamari National Forest, Rondonia, RO, Brazil: denuded mine spoil, soil from below the canopy of invading pioneer trees, revegetated soil under new growth on the forest edge, and the forest floor of an adjacent preserved forest. Bacterial population responses were analyzed by amending these soil samples with individual carbon substrates in the presence of bromodeoxyuridine (BrdU). BrdU-labeled DNA was then subjected to a 16S-23S rRNA intergenic analysis to depict the actively growing bacteria from each site. The number and diversity of bacterial groups responding to four carbon substrates (l-serine, l-threonine, sodium citrate, and α-lactose hydrate) increased along the reclamation-vegetation gradient such that the preserved forest soil samples contained the highest functional redundancy for each substrate. These data suggest that bacterial functional redundancy increases in relation to the regrowth of plant communities and may therefore represent an important aspect of the restoration of soil biological functionality to reclaimed mine spoils. They also suggest that bacterial functional redundancy may be a useful indicator of soil quality and ecosystem functioning. PMID:11010883

  5. The analysis of core and symbiotic genes of rhizobia nodulating Vicia from different continents reveals their common phylogenetic origin and suggests the distribution of Rhizobium leguminosarum strains together with Vicia seeds.

    PubMed

    Alvarez-Martínez, Estela R; Valverde, Angel; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Tejedor, Carmen; Mateos, Pedro F; Santillana, Nery; Zúñiga, Doris; Peix, Alvaro; Velázquez, Encarna

    2009-08-01

    In this work, we analysed the core and symbiotic genes of rhizobial strains isolated from Vicia sativa in three soils from the Northwest of Spain, and compared them with other Vicia endosymbionts isolated in other geographical locations. The analysis of rrs, recA and atpD genes and 16S-23S rRNA intergenic spacer showed that the Spanish strains nodulating V. sativa are phylogenetically close to those isolated from V. sativa and V. faba in different European, American and Asian countries forming a group related to Rhizobium leguminosarum. The analysis of the nodC gene of strains nodulating V. sativa and V. faba in different continents showed they belong to a phylogenetically compact group indicating that these legumes are restrictive hosts. The results of the nodC gene analysis allow the delineation of the biovar viciae showing a common phylogenetic origin of V. sativa and V. faba endosymbionts in several continents. Since these two legume species are indigenous from Europe, our results suggest a world distribution of strains from R. leguminosarum together with the V. sativa and V. faba seeds and a close coevolution among chromosome, symbiotic genes and legume host in this Rhizobium-Vicia symbiosis.

  6. Diversity and antimicrobial properties of lactic acid bacteria isolated from rhizosphere of olive trees and desert truffles of Tunisia.

    PubMed

    Fhoula, Imene; Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota.

  7. Detection of Campylobacter jejuni in rectal swab samples from Rousettus amplexicaudatus in the Philippines

    PubMed Central

    HATTA, Yuki; OMATSU, Tsutomu; TSUCHIAKA, Shinobu; KATAYAMA, Yukie; TANIGUCHI, Satoshi; MASANGKAY, Joseph S; PUENTESPINA, Roberto; ERES, Eduardo; COSICO, Edison; UNE, Yumi; YOSHIKAWA, Yasuhiro; MAEDA, Ken; KYUWA, Shigeru; MIZUTANI, Tetsuya

    2016-01-01

    Bats are the second diversity species of mammals and widely distributed in the world. They are thought to be reservoir and vectors of zoonotic pathogens. However, there is scarce report of the evidence of pathogenic bacteria kept in bats. The precise knowledge of the pathogenic bacteria in bat microbiota is important for zoonosis control. Thus, metagenomic analysis targeting the V3-V4 region of the 16S rRNA of the rectal microbiota in Rousettus amplexicaudatus was performed using high throughput sequencing. The results revealed that 103 genera of bacteria including Camplyobacter were detected. Campylobacter was second predominant genus, and Campylobacter coli and Campylobacter jejuni were identified in microbiome of R. amplexicaudatus. Campylobacteriosis is one of the serious bacterial diarrhea in human, and the most often implicated species as the causative agent of campylobacteriosis is C. jejuni. Therefore, we investigated the prevalence of C. jejuni in 91 wild bats with PCR. As a result of PCR assay targeted on 16S-23S intergenic spacer, partial genome of C. jejuni was detected only in five R. amplexicaudatus. This is the first report that C. jejuni was detected in bat rectal swab samples. C. jejuni is the most common cause of campylobacteriosis in humans, transmitted through water and contact with livestock animals. This result indicated that R. amplexicaudatus may be a carrier of C. jejuni. PMID:27109214

  8. Mycoplasma corogypsi-associated polyarthritis and tenosynovitis in black vultures (Coragyps atratus).

    PubMed

    Van Wettere, A J; Ley, D H; Scott, D E; Buckanoff, H D; Degernes, L A

    2013-03-01

    Three wild American black vultures (Coragyps atratus) were presented to rehabilitation centers with swelling of multiple joints, including elbows, stifles, hocks, and carpal joints, and of the gastrocnemius tendons. Cytological examination of the joint fluid exudate indicated heterophilic arthritis. Radiographic examination in 2 vultures demonstrated periarticular soft tissue swelling in both birds and irregular articular surfaces with subchondral bone erosion in both elbows in 1 bird. Prolonged antibiotic therapy administered in 2 birds did not improve the clinical signs. Necropsy and histological examination demonstrated a chronic lymphoplasmacytic arthritis involving multiple joints and gastrocnemius tenosynovitis. Articular lesions varied in severity and ranged from moderate synovitis and cartilage erosion and fibrillation to severe synovitis, diffuse cartilage ulceration, subchondral bone loss and/or sclerosis, pannus, synovial cysts, and epiphyseal osteomyelitis. No walled bacteria were observed or isolated from the joints. However, mycoplasmas polymerase chain reactions were positive in at least 1 affected joint from each bird. Mycoplasmas were isolated from joints of 1 vulture that did not receive antibiotic therapy. Sequencing of 16S rRNA gene amplicons from joint samples and the mycoplasma isolate identified Mycoplasma corogypsi in 2 vultures and was suggestive in the third vulture. Mycoplasma corogypsi identification was confirmed by sequencing the 16S-23S intergenic spacer region of mycoplasma isolates. This report provides further evidence that M. corogypsi is a likely cause of arthritis and tenosynovitis in American black vultures. Cases of arthritis and tenosynovitis in New World vultures should be investigated for presence of Mycoplasma spp, especially M. corogypsi.

  9. Bartonella melophagi in Melophagus ovinus (sheep ked) collected from sheep in northern Oromia, Ethiopia.

    PubMed

    Kumsa, Bersissa; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-01-01

    Melophagus ovinus (sheep ked) is one of the most common ectoparasites that contributes to enormous economic losses in the productivity of sheep in many countries. The present study was conducted from January 2012 to July 2013 on M. ovinus collected from sheep at three sites in Ethiopia. Of the sheep studied, 65.7% (88/134) were infested with M. ovinus. The prevalence of M. ovinus was 76% (76/100), 47% (8/17) and 23.5% (4/17) at the Kimbibit, Chacha and Shano sites, respectively. An overall number of 229 M. ovinus specimens (138 females, 86 males and five pupae) and 554 M. ovinus specimens (272 females, 282 males) were collected from young and adult sheep, respectively. Bartonella DNA was detected in 89% (694/783) of M. ovinus using a quantitative Bartonella genus-specific PCR assay targeting the 16S/23S rRNA intergenic spacer region. The sequencing of the PCR products of fragments of the gltA and rpoB genes showed 99.6-100% and 100% homology, respectively, with B. melophagi. Statistically significant variation was not noted in the overall prevalence of Bartonella DNA between female and male M. ovinus. All of the sheep infested with M. ovinus 100% (88/88) harbored at least one M. ovinus specimen that contained Bartonella DNA. This study highlights that B. melophagi in M. ovinus from sheep in highlands in Ethiopia possibly has certain zoonotic importance.

  10. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    PubMed

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  11. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia

    PubMed Central

    Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota. PMID:24151598

  12. Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

    PubMed

    Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X

    2016-02-01

    Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish.

  13. Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov.

    PubMed

    Safni, Irda; Cleenwerck, Ilse; De Vos, Paul; Fegan, Mark; Sly, Lindsay; Kappler, Ulrike

    2014-09-01

    The Ralstonia solanacearum species complex has long been recognized as a group of phenotypically diverse strains that can be subdivided into four phylotypes. Using a polyphasic taxonomic approach on an extensive set of strains, this study provides evidence for a taxonomic and nomenclatural revision of members of this complex. Data obtained from phylogenetic analysis of 16S-23S rRNA ITS gene sequences, 16S-23S rRNA intergenic spacer (ITS) region sequences and partial endoglucanase (egl) gene sequences and DNA-DNA hybridizations demonstrate that the R. solanacearum species complex comprises three genospecies. One of these includes the type strain of Ralstonia solanacearum and consists of strains of R. solanacearum phylotype II only. The second genospecies includes the type strain of Ralstonia syzygii and contains only phylotype IV strains. This genospecies is subdivided into three distinct groups, namely R. syzygii, the causal agent of Sumatra disease on clove trees in Indonesia, R. solanacearum phylotype IV strains isolated from different host plants mostly from Indonesia, and strains of the blood disease bacterium (BDB), the causal agent of the banana blood disease, a bacterial wilt disease in Indonesia that affects bananas and plantains. The last genospecies is composed of R. solanacearum strains that belong to phylotypes I and III. As these genospecies are also supported by phenotypic data that allow the differentiation of the three genospecies, the following taxonomic proposals are made: emendation of the descriptions of Ralstonia solanacearum and Ralstonia syzygii and descriptions of Ralstonia syzygii subsp. nov. (type strain R 001(T) = LMG 10661(T) = DSM 7385(T)) for the current R. syzygii strains, Ralstonia syzygii subsp. indonesiensis subsp. nov. (type strain UQRS 464(T) = LMG 27703(T) = DSM 27478(T)) for the current R. solanacearum phylotype IV strains, Ralstonia syzygii subsp. celebesensis subsp. nov. (type strain UQRS 627(T

  14. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.

    PubMed

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments.

  15. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.

    PubMed

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments. PMID:24005887

  16. First complete genome sequence of a capsicum chlorosis tospovirus isolate from Australia with an unusually large S RNA intergenic region.

    PubMed

    Widana Gamage, Shirani; Persley, Denis M; Higgins, Colleen M; Dietzgen, Ralf G

    2015-03-01

    The first complete genome sequence of capsicum chlorosis virus (CaCV) from Australia was determined using a combination of Illumina HiSeq RNA and Sanger sequencing technologies. Australian CaCV had a tripartite genome structure like other CaCV isolates. The large (L) RNA was 8913 nucleotides (nt) in length and contained a single open reading frame (ORF) of 8634 nt encoding a predicted RNA-dependent RNA polymerase (RdRp) in the viral-complementary (vc) sense. The medium (M) and small (S) RNA segments were 4846 and 3944 nt in length, respectively, each containing two non-overlapping ORFs in ambisense orientation, separated by intergenic regions (IGR). The M segment contained ORFs encoding the predicted non-structural movement protein (NSm; 927 nt) and precursor of glycoproteins (GP; 3366 nt) in the viral sense (v) and vc strand, respectively, separated by a 449-nt IGR. The S segment coded for the predicted nucleocapsid (N) protein (828 nt) and non-structural suppressor of silencing protein (NSs; 1320 nt) in the vc and v strand, respectively. The S RNA contained an IGR of 1663 nt, being the largest IGR of all CaCV isolates sequenced so far. Comparison of the Australian CaCV genome with complete CaCV genome sequences from other geographic regions showed highest sequence identity with a Taiwanese isolate. Genome sequence comparisons and phylogeny of all available CaCV isolates provided evidence for at least two highly diverged groups of CaCV isolates that may warrant re-classification of AIT-Thailand and CP-China isolates as unique tospoviruses, separate from CaCV.

  17. Long Intergenic Noncoding RNAs Mediate the Human Chondrocyte Inflammatory Response and Are Differentially Expressed in Osteoarthritis Cartilage

    PubMed Central

    Pearson, Mark J.; Philp, Ashleigh M.; Heward, James A.; Roux, Benoit T.; Walsh, David A.; Davis, Edward T.; Lindsay, Mark A.

    2016-01-01

    Objective To identify long noncoding RNAs (lncRNAs), including long intergenic noncoding RNAs (lincRNAs), antisense RNAs, and pseudogenes, associated with the inflammatory response in human primary osteoarthritis (OA) chondrocytes and to explore their expression and function in OA. Methods OA cartilage was obtained from patients with hip or knee OA following joint replacement surgery. Non‐OA cartilage was obtained from postmortem donors and patients with fracture of the neck of the femur. Primary OA chondrocytes were isolated by collagenase digestion. LncRNA expression analysis was performed by RNA sequencing (RNAseq) and quantitative reverse transcriptase–polymerase chain reaction. Modulation of lncRNA chondrocyte expression was achieved using LNA longRNA GapmeRs (Exiqon). Cytokine production was measured with Luminex. Results RNAseq identified 983 lncRNAs in primary human hip OA chondrocytes, 183 of which had not previously been identified. Following interleukin‐1β (IL‐1β) stimulation, we identified 125 lincRNAs that were differentially expressed. The lincRNA p50‐associated cyclooxygenase 2–extragenic RNA (PACER) and 2 novel chondrocyte inflammation–associated lincRNAs (CILinc01 and CILinc02) were differentially expressed in both knee and hip OA cartilage compared to non‐OA cartilage. In primary OA chondrocytes, these lincRNAs were rapidly and transiently induced in response to multiple proinflammatory cytokines. Knockdown of CILinc01 and CILinc02 expression in human chondrocytes significantly enhanced the IL‐1–stimulated secretion of proinflammatory cytokines. Conclusion The inflammatory response in human OA chondrocytes is associated with widespread changes in the profile of lncRNAs, including PACER, CILinc01, and CILinc02. Differential expression of CILinc01 and CIinc02 in hip and knee OA cartilage, and their role in modulating cytokine production during the chondrocyte inflammatory response, suggest that they may play an important role

  18. Identification of Aedes aegypti Long Intergenic Non-coding RNAs and Their Association with Wolbachia and Dengue Virus Infection

    PubMed Central

    Etebari, Kayvan; Asad, Sultan; Zhang, Guangmei; Asgari, Sassan

    2016-01-01

    Long intergenic non-coding RNAs (lincRNAs) are appearing as an important class of regulatory RNAs with a variety of biological functions. The aim of this study was to identify the lincRNA profile in the dengue vector Aedes aegypti and evaluate their potential role in host-pathogen interaction. The majority of previous RNA-Seq transcriptome studies in Ae. aegypti have focused on the expression pattern of annotated protein coding genes under different biological conditions. Here, we used 35 publically available RNA-Seq datasets with relatively high depth to screen the Ae. aegypti genome for lincRNA discovery. This led to the identification of 3,482 putative lincRNAs. These lincRNA genes displayed a slightly lower GC content and shorter transcript lengths compared to protein-encoding genes. Ae. aegypti lincRNAs also demonstrate low evolutionary sequence conservation even among closely related species such as Culex quinquefasciatus and Anopheles gambiae. We examined their expression in dengue virus serotype 2 (DENV-2) and Wolbachia infected and non-infected adult mosquitoes and Aa20 cells. The results revealed that DENV-2 infection increased the abundance of a number of host lincRNAs, from which some suppress viral replication in mosquito cells. RNAi-mediated silencing of lincRNA_1317 led to enhancement in viral replication, which possibly indicates its potential involvement in the host anti-viral defense. A number of lincRNAs were also differentially expressed in Wolbachia-infected mosquitoes. The results will facilitate future studies to unravel the function of lncRNAs in insects and may prove to be beneficial in developing new ways to control vectors or inhibit replication of viruses in them. PMID:27760142

  19. Increased expression of long intergenic non-coding RNA LINC00152 in gastric cancer and its clinical significance.

    PubMed

    Pang, Qianqian; Ge, Jiaxin; Shao, Yongfu; Sun, Weiliang; Song, Haojun; Xia, Tian; Xiao, Bingxiu; Guo, Junming

    2014-06-01

    It has been known that differential expression of long non-coding RNA (lncRNA) plays critical roles in carcinogenesis. However, the significance of lncRNA, especially long intergenic ncRNA (lincRNA, the main type of lncRNA family), in the diagnosis of gastric cancer is largely unknown. The aim of this study was to determine the expression level of LINC00152, a newfound lincRNA, in gastric carcinoma and its clinical association. The expression of LINC00152 in 71 pairs of tumorous and adjacent normal tissues from patients with gastric cancer was detected by quantitative real-time reverse transcription-polymerase chain reaction. And then, the potential associations between its level in gastric cancer tissue and the clinicopathological features were analyzed. Finally, a receiver operating characteristic (ROC) curve was constructed for differentiating patients with gastric cancer from patients with benign gastric diseases. The results showed that the expression level of LINC00152 in gastric carcinoma was significantly increased, compared with matched normal tissue (P=0.045) and normal mucosa from health control (P=0.004), respectively. Levels of LINC00152 in gastric cancer cell lines, BGC-823, MGC-803, and SGC-7901, were significantly higher than those in human normal gastric epithelial cell line GES-1. In addition, high expression of LINC00152 was correlated with invasion (P=0.042). LINC00152 levels in gastric juice from patients with gastric cancer were further found significantly higher than those from normal controls (P=0.002). Moreover, the area under the ROC curve (AUC) was up to 0.645 (95 % CI=0.559-0.740, P=0.003). This study highlights that lincRNA LINC00152 might be a novel biomarker for predicting gastric cancer.

  20. Concerted Actions of a Thermo-labile Regulator and a Unique Intergenic RNA Thermosensor Control Yersinia Virulence

    PubMed Central

    Kortmann, Jens; Seekircher, Stephanie; Heroven, Ann Kathrin; Berger, Evelin; Pisano, Fabio; Thiermann, Tanja; Wolf-Watz, Hans; Narberhaus, Franz; Dersch, Petra

    2012-01-01

    Expression of all Yersinia pathogenicity factors encoded on the virulence plasmid, including the yop effector and the ysc type III secretion genes, is controlled by the transcriptional activator LcrF in response to temperature. Here, we show that a protein- and RNA-dependent hierarchy of thermosensors induce LcrF synthesis at body temperature. Thermally regulated transcription of lcrF is modest and mediated by the thermo-sensitive modulator YmoA, which represses transcription from a single promoter located far upstream of the yscW-lcrF operon at moderate temperatures. The transcriptional response is complemented by a second layer of temperature-control induced by a unique cis-acting RNA element located within the intergenic region of the yscW-lcrF transcript. Structure probing demonstrated that this region forms a secondary structure composed of two stemloops at 25°C. The second hairpin sequesters the lcrF ribosomal binding site by a stretch of four uracils. Opening of this structure was favored at 37°C and permitted ribosome binding at host body temperature. Our study further provides experimental evidence for the biological relevance of an RNA thermometer in an animal model. Following oral infections in mice, we found that two different Y. pseudotuberculosis patient isolates expressing a stabilized thermometer variant were strongly reduced in their ability to disseminate into the Peyer's patches, liver and spleen and have fully lost their lethality. Intriguingly, Yersinia strains with a destabilized version of the thermosensor were attenuated or exhibited a similar, but not a higher mortality. This illustrates that the RNA thermometer is the decisive control element providing just the appropriate amounts of LcrF protein for optimal infection efficiency. PMID:22359501

  1. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  2. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  3. An evaluation of logic regression-based biomarker discovery across multiple intergenic regions for predicting host specificity in Escherichia coli.

    PubMed

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Banting, Graham; Edge, Thomas A; Topp, Edward; McAllister, Tim A; Neumann, Norman F

    2016-10-01

    Several studies have demonstrated that E. coli appears to display some level of host adaptation and specificity. Recent studies in our laboratory support these findings as determined by logic regression modeling of single nucleotide polymorphisms (SNP) in intergenic regions (ITGRs). We sought to determine the degree of host-specific information encoded in various ITGRs across a library of animal E. coli isolates using both whole genome analysis and a targeted ITGR sequencing approach. Our findings demonstrated that ITGRs across the genome encode various degrees of host-specific information. Incorporating multiple ITGRs (i.e., concatenation) into logic regression model building resulted in greater host-specificity and sensitivity outcomes in biomarkers, but the overall level of polymorphism in an ITGR did not correlate with the degree of host-specificity encoded in the ITGR. This suggests that distinct SNPs in ITGRs may be more important in defining host-specificity than overall sequence variation, explaining why traditional unsupervised learning phylogenetic approaches may be less informative in terms of revealing host-specific information encoded in DNA sequence. In silico analysis of 80 candidate ITGRs from publically available E. coli genomes was performed as a tool for discovering highly host-specific ITGRs. In one ITGR (ydeR-yedS) we identified a SNP biomarker that was 98% specific for cattle and for which 92% of all E. coli isolates originating from cattle carried this unique biomarker. In the case of humans, a host-specific biomarker (98% specificity) was identified in the concatenated ITGR sequences of rcsD-ompC, ydeR-yedS, and rclR-ykgE, and for which 78% of E. coli originating from humans carried this biomarker. Interestingly, human-specific biomarkers were dominant in ITGRs regulating antibiotic resistance, whereas in cattle host-specific biomarkers were found in ITGRs involved in stress regulation. These data suggest that evolution towards host

  4. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone

    PubMed Central

    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza

    2015-01-01

    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  5. Genetic diversity, inter-gene pool introgression and nutritional quality of common beans (Phaseolus vulgaris L.) from Central Africa.

    PubMed

    Blair, Matthew W; González, Laura F; Kimani, Paul M; Butare, Louis

    2010-07-01

    The Great Lakes region of Central Africa is a major producer of common beans in Africa. The region is known for high population density and small average farm size. The common bean represents the most important legume crop of the region, grown on over a third of the cultivated land area, and the per capita consumption is among the highest in the world for the food crop. The objective of this study was to evaluate the genetic diversity in a collection of 365 genotypes from the Great Lakes region of Central Africa, including a large group of landraces from Rwanda as well as varieties from primary centers of diversity and from neighboring countries of Central Africa, such as the Democratic Republic of Congo and Uganda, using 30 fluorescently labeled microsatellite markers and automated allele detection. In addition, the landraces were evaluated for their seed iron and zinc concentration to determine if genetic diversity influenced nutritional quality. Principal coordinate and neighbor-joining analyses allowed the separation of the landraces into 132 Andean and 195 Mesoamerican (or Middle American) genotypes with 32 landraces and 6 varieties intermediate between the gene pools and representing inter-gene pool introgression in terms of seed characteristics and alleles. Genetic diversity and the number of alleles were high for the collection, reflecting the preference for a wide range of seed types in the region and no strong commercial class preference, although red, red mottled and brown seeded beans were common. Observed heterozygosity was also high and may be explained by the common practice of maintaining seed and plant mixtures, a coping strategy practiced by Central African farmers to reduce the effects of abiotic and biotic stresses. Finally, nutritional quality differed between the gene pools with respect to seed iron and zinc concentration, while genotypes from the intermediate group were notably high in both minerals. In conclusion, this study has shown that

  6. An evaluation of logic regression-based biomarker discovery across multiple intergenic regions for predicting host specificity in Escherichia coli.

    PubMed

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Banting, Graham; Edge, Thomas A; Topp, Edward; McAllister, Tim A; Neumann, Norman F

    2016-10-01

    Several studies have demonstrated that E. coli appears to display some level of host adaptation and specificity. Recent studies in our laboratory support these findings as determined by logic regression modeling of single nucleotide polymorphisms (SNP) in intergenic regions (ITGRs). We sought to determine the degree of host-specific information encoded in various ITGRs across a library of animal E. coli isolates using both whole genome analysis and a targeted ITGR sequencing approach. Our findings demonstrated that ITGRs across the genome encode various degrees of host-specific information. Incorporating multiple ITGRs (i.e., concatenation) into logic regression model building resulted in greater host-specificity and sensitivity outcomes in biomarkers, but the overall level of polymorphism in an ITGR did not correlate with the degree of host-specificity encoded in the ITGR. This suggests that distinct SNPs in ITGRs may be more important in defining host-specificity than overall sequence variation, explaining why traditional unsupervised learning phylogenetic approaches may be less informative in terms of revealing host-specific information encoded in DNA sequence. In silico analysis of 80 candidate ITGRs from publically available E. coli genomes was performed as a tool for discovering highly host-specific ITGRs. In one ITGR (ydeR-yedS) we identified a SNP biomarker that was 98% specific for cattle and for which 92% of all E. coli isolates originating from cattle carried this unique biomarker. In the case of humans, a host-specific biomarker (98% specificity) was identified in the concatenated ITGR sequences of rcsD-ompC, ydeR-yedS, and rclR-ykgE, and for which 78% of E. coli originating from humans carried this biomarker. Interestingly, human-specific biomarkers were dominant in ITGRs regulating antibiotic resistance, whereas in cattle host-specific biomarkers were found in ITGRs involved in stress regulation. These data suggest that evolution towards host

  7. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  8. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  9. Functional analysis of developmentally regulated chromatin-hypersensitive domains carrying the alpha 1-fetoprotein gene promoter and the albumin/alpha 1-fetoprotein intergenic enhancer.

    PubMed Central

    Bernier, D; Thomassin, H; Allard, D; Guertin, M; Hamel, D; Blaquière, M; Beauchemin, M; LaRue, H; Estable-Puig, M; Bélanger, L

    1993-01-01

    During liver development, the tandem alpha 1-fetoprotein (AFP)/albumin locus is triggered at the AFP end and then asymmetrically enhanced; this is followed by autonomous repression of the AFP-encoding gene. To understand this regulation better, we characterized the two early developmental stage-specific DNase I-hypersensitive (DH) sites so far identified in rat liver AFP/albumin chromatin: an intergenic DH-enhancer site and the AFP DH-promoter site. Mutation-transfection analyses circumscribed the DH-enhancer domain to a 200-bp DNA segment stringently conserved among species. Targeted mutations, DNA-protein-binding assays, and coexpression experiments pinpointed C/EBP as the major activatory component of the intergenic enhancer. Structure-function relationships at the AFP DH-promoter site defined a discrete glucocorticoid-regulated domain activated cooperatively by HNF1 and a highly specific AFP transcription factor, FTF, which binds to a steroid receptor recognition motif. The HNF1/FTF/DNA complex is deactivated by glucocorticoid receptors or by the ubiquitous factor NF1, which eliminates HNF1 by competition at an overlapping, high-affinity binding site. We propose that the HNF1-NF1 site might serve as a developmental switch to direct autonomous AFP gene repression in late liver development. We also conclude that the intergenic enhancer is driven by C/EBP alpha primarily to fulfill albumin gene activation functions at early developmental stages. Factor FTF seems to be the key regulator of AFP gene-specific functions in carcinoembryonic states. Images PMID:7680097

  10. Molecular instability in the COII-tRNA(Lys) intergenic region of the human mitochondrial genome: multiple origins of the 9-bp deletion and heteroplasmy for expanded repeats.

    PubMed Central

    Thomas, M G; Cook, C E; Miller, K W; Waring, M J; Hagelberg, E

    1998-01-01

    We have identified two individuals from Glasgow in Scotland who have a deletion of one of two copies of the intergenic 9-bp sequence motif CCCCCTCTA, located between the cytochrome oxidase II (COII) and lysine tRNA (tRNA(Lys)) genes of the human mitochondrial genome. Although this polymorphism is common in Africa and Asia, it has not been reported in Northern Europe. Analysis of the mitochondrial DNA control region sequences of these two individuals suggests that they belong to a lineage that originated independently of the previously characterized African and Asian 9-bp deleted lineages. Among the Scottish population we have also identified a maternal lineage of three generations exhibiting heteroplasmy for two, three and four copies of the CCCCCTCTA motif. Polymerase chain reaction amplification across the COII-tRNA(Lys) intergenic region of these individuals gives different ratios of the three product lengths that are dependent on the concentration of the DNA-binding dye crystal violet. To investigate whether changes in repeat number were generated de novo, we constructed clones containing known numbers of the CCCCCTCTA motif. In the presence of high concentrations of crystal violet we obtained two, three and four copies of this motif when the amplification template contained only four copies. Various DNA-binding drugs are known to stabilize bulged structures in DNA and contribute to the process of slipped-strand mispairing during DNA replication. These results suggest that the COII-tRNA(Lys) intergenic region is unstable owing to slipped-strand mispairing. Although sequences containing four copies of the CCCCCTCTA motif are less stable in vitro, we observed an increase in the proportion of mitochondrial genomes with four repeats between-a mother and a daughter in the heteroplasmic lineage. From this we conclude that drift in the germ-line lineage is a main factor in the maintenance or loss of heteroplasmy. PMID:9684291

  11. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  12. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  13. Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions.

    PubMed

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F

    2015-11-01

    Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates

  14. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  15. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  16. Probiotic attributes of Lactobacillus strains isolated from food and of human origin.

    PubMed

    Gaudana, Sandeep B; Dhanani, Akhilesh S; Bagchi, Tamishraha

    2010-06-01

    Lactobacilli isolated from various sources were identified on the basis of 16S-23S rRNA gene intergenic region amplification and subsequent sequencing of the smaller intergenic region. An in vitro analysis of probiotic properties including binding, ability to tolerate different concentrations of bile, survival in acidic buffer and antimicrobial activity of four different isolates and two standard strains (Lactobacillus plantarum American Type Culture Collection (ATCC) 8014 and L. rhamnosus GG (LGG)) was carried out. The ability of each isolate to stimulate Caco-2 cells, human peripheral blood mononuclear cells (PBMC) and THP-1 cells resulting in immunomodulation of these cells was analysed. Isolates L. rhamnosus CS25 and L. delbrueckii M and standard strain ATCC 8014 showed broad antimicrobial activity, and isolates CS25 (percentage of survival 6.9 % at pH 2.5, 5.1 % at pH 2.0) and L. plantarum CS23 (5.7 % at pH 2.5, 4.9 % at pH 2.0) have shown good tolerance to acidic pH. Isolate CS23 showed a good survival (14 %) after 2 h incubation in de Man, Rogosa and Sharpe (MRS) medium containing 3 % bile salts. Isolates CS23, CS25 and L. fermentum ASt1 could stimulate Caco-2 cells, human PBMC and THP-1 cells for a strong and varied immunomodulatory response in these cells. Though LGG showed poor antimicrobial activity as well as bile and acid tolerance, it was found to be the best binding strain tested. Child faecal isolate CS23 from the present study showed high binding ability (seventeen bacteria/Caco-2), high tolerance to acidic pH and bile salts and significant immunomodulation; therefore it is a good potential probiotic candidate.

  17. Phylogenetic Analysis of 16S rRNA Genes and PCR Analysis of the nec1 Gene from Streptomyces spp. Causing Common Scab, Pitted Scab, and Netted Scab in Finland.

    PubMed

    Kreuze, J F; Suomalainen, S; Paulin, L; Valkonen, J P

    1999-06-01

    ABSTRACT The sequences of the 16S rRNA genes (nucleotides 29 to 1,521) from various Streptomyces strains pathogenic to potato were compared. These included 10 pathogenic Streptomyces strains isolated from potato scab lesions in Finland, the type strains of S. aureofaciens NRRL 2209(T) and S. lydicus ATCC 25470(T), 'S. griseus subsp. scabies' ATCC 10246, and two S. griseus strains that were originally deposited to the collection as pathogens. The nucleotide sequence (>94.5% sequence identity [SI]) and length (1,469 to 1,481 nucleotides) of the analyzed region varied. Phylogenetic analysis of 16S rRNA genes placed Finnish strains into three species, supported by previously characterized morphological and physiological traits. Six Finnish strains, including two strains that deviated from the others in one trait (no spiral sporophores or D-xylose utilization), had identical 16S rRNA genes and were identified as S. scabies (99.9% SI to S. scabies ATCC 49173). Three Finnish strains were identified as S. turgidiscabies, a species previously described only in Japan (99.9% SI to S. turgidiscabies ATCC 700248). Finnish strain 317 and S. aureofaciens NRRL 2209 (99.8% SI) were placed in a distinct phylogenetic cluster together with Kitosatospora spp., which suggests that S. aureofaciens may belong to the recently revived genus Kitosatospora. In pathogenicity tests, S. scabies caused characteristic symptoms of common scab, S. turgidiscabies caused mainly pitted scab, and S. aureofaciens caused netted scab and necrotic lesions on stolons of potato cultivars Bintje and Matilda in the greenhouse. The nec1 gene and the intergenic region between nec1 and the 5' transposase pseudogene ORFtnp were successfully amplified by polymerase chain reaction from S. scabies ATCC 49173 and the pathogenic Finnish strains of S. scabies, but not from a nonpathogenic strain of S. scabies, three pathogenic and two nonpathogenic strains of S. turgidiscabies, and S. aureofaciens.

  18. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  19. The intergenic region of maize streak virus contains a GC-rich element that activates rightward transcription and binds maize nuclear factors.

    PubMed

    Fenoll, C; Schwarz, J J; Black, D M; Schneider, M; Howell, S H

    1990-12-01

    Maize streak virus (MSV) is transcribed bidirectionally from an intergenic region and rightward transcription produces an RNA that encodes the coat protein. The intergenic region contains promoter elements required for rightward transcription including an upstream activating sequence (UAS) which endows the promoter with full activity in a maize transient expression system. The UAS contains two GC-rich repeats (GC boxes) and a long inverted repeat or hairpin with a loop harboring a TAATATTAC sequence common to all geminiviruses. Deletions through the UAS demonstrated the presence of an element, called the rightward promoter element (rpe1), which is responsible for transcriptional activation. Rpe1 includes the two GC-rich boxes, which are similar in sequence to Sp1 binding sites in mammalian cells, but not the conserved hairpin loop. Rpe1 binds maize nuclear factors in vitro and the characteristics of the binding interaction have been determined by 1) binding competition with oligonucleotides, 2) methidiumpropyl-EDTA footprinting and 3) methylation interference assays. Binding of maize nuclear factors to the UAS generates two major bands, slow and fast migrating bands, in gel retardation assays. Footprinting and factor titration data suggest that the fast bands arise by the binding of factors to one GC box while the slow bands are generated by factors binding to both boxes. The data further indicate that the factors bind to the two GC-rich boxes with little cooperativity and bind on opposite faces of the DNA helix.

  20. Bacterial diversity in water samples from uranium wastes as demonstrated by 16S rDNA and ribosomal intergenic spacer amplification retrievals.

    PubMed

    Radeva, Galina; Selenska-Pobell, Sonja

    2005-11-01

    Bacterial diversity was assessed in water samples collected from several uranium mining wastes in Ger many and in the United States by using 16S rDNA and ribosomal intergenic spacer amplification retrievals. The results obtained using the 16S rDNA retrieval showed that the samples collected from the uranium mill tailings of Schlema/Alberoda, Germany, were predominated by Nitrospina-like bacteria, whereas those from the mill tailings of Shiprock, New Mexico, USA, were predominated by gamma-Pseudomonas and Frauteria spp. Additional smaller populations of the Cytophaga-Flavobacterium-Bacteroides group and alpha- and delta-Proteobacteria were identified in the Shiprock samples as well. Proteobacteria and Cytophaga-Flavobacterium-Bacteroides were also found in the third uranium mill tailings studied, Gittersee/Coschütz, Germany, but the groups of the predominant clones were rather small. Most of the clones of the Gittersee/Coschütz samples represented individual sequences, which indicates a high level of bacterial diversity. The samples from the fourth uranium waste studied, Steinsee Deponie B1, Germany, were predominantly occupied by Acinetobacter spp. The ribosomal intergenic spacer amplification retrieval provided results complementary to those obtained by the 16S rDNA analyses. For instance, in the Shiprock samples, an additional predominant bacterial group was identified and affiliated with Nitrosomonas sp., whereas in the Gittersee/Coschütz samples, anammox populations were identified that were not retrieved by the applied 16S rDNA approach.

  1. Genetic variability and geographical diversity of the main Chagas' disease vector Panstrongylus megistus (Hemiptera: Triatominae) in Brazil based on ribosomal DNA intergenic sequences.

    PubMed

    Cavassin, Francelisse Bridi; Kuehn, Christian Collins; Kopp, Rogério Luiz; Thomaz-Soccol, Vanette; Da Rosa, João Aristeu; Luz, Ennio; Mas-Coma, Santiago; Bargues, María Dolores

    2014-05-01

    Studies were made on the ribosomal DNA intergenic region, comprising complete internal transcribed spacer (ITS)-1, 5.8S, and ITS-2 sequences, of populations of the triatomine Panstrongylus megistus, the most important vector of Chagas' disease in Brazil since Triatoma infestans eradication. Specimens were from 26 localities of Rio Grande do Sul, Santa Catarina, Paraná, São Paulo, Minas Gerais, Bahia, and Sergipe states. In total, 21 ITS-1 and 12 ITS-2 haplotypes were found. Nucleotide differences were higher in ITS-1 (3.00%) than in ITS-2 (1.33%). The intergenic region was 1,513-1,522-bp-long (mean 1,516.9 bp), providing 26 combined haplotypes. The combination of microsatellites found in both ITSs may be of applied usefulness, to assess interpopulation specimen exchange and potential recolonizations after vector elimination by control implementation. Network results suggest that São Paulo may be considered one of the spreading centers of this species. Molecular clock datation suggests that P. megistus populations are diversifying at least since 4.54 million years ago, with diversification still ongoing today by geographical isolation of populations. Evidence is provided about the relationship of genetic diversity with geographical spread that characterizes a major vector and explains its ability to colonize distant areas and different ecotopes, including human habitats, and consequently its importance in Chagas' disease epidemiology.

  2. Evidence for Introduction Bottleneck and Extensive Inter-Gene Pool (Mesoamerica x Andes) Hybridization in the European Common Bean (Phaseolus vulgaris L.) Germplasm

    PubMed Central

    Gioia, Tania; Logozzo, Giuseppina; Attene, Giovanna; Bellucci, Elisa; Benedettelli, Stefano; Negri, Valeria; Papa, Roberto; Spagnoletti Zeuli, Pierluigi

    2013-01-01

    Common bean diversity within and between Mesoamerican and Andean gene pools was compared in 89 landraces from America and 256 landraces from Europe, to elucidate the effects of bottleneck of introduction and selection for adaptation during the expansion of common bean (Phaseolus vulgaris L.) in Europe. Thirteen highly polymorphic nuclear microsatellite markers (nuSSRs) were used to complement chloroplast microsatellite (cpSSRs) and nuclear markers (phaseolin and Pv-shatterproof1) data from previous studies. To verify the extent of the introduction bottleneck, inter-gene pool hybrids were distinguished from “pure” accessions. Hybrids were identified on the basis of recombination of gene pool specific cpSSR, phaseolin and Pv-shatterproof1 markers with a Bayesian assignments based on nuSSRs, and with STRUCTURE admixture analysis. More hybrids were detected than previously, and their frequency was almost four times larger in Europe (40.2%) than in America (12.3%). The genetic bottleneck following the introduction into Europe was not evidenced in the analysis including all the accessions, but it was significant when estimated only with “pure” accessions, and five times larger for Mesoamerican than for Andean germplasm. The extensive inter-gene pool hybridization generated a large amount of genotypic diversity that mitigated the effects of the bottleneck that occurred when common bean was introduced in Europe. The implication for evolution and the advantages for common bean breeding are discussed. PMID:24098412

  3. The intergenic region between the divergently transcribed niiA and niaD genes of Aspergillus nidulans contains multiple NirA binding sites which act bidirectionally.

    PubMed Central

    Punt, P J; Strauss, J; Smit, R; Kinghorn, J R; van den Hondel, C A; Scazzocchio, C

    1995-01-01

    The niaD and niiA genes of Aspergillus nidulans, which code, respectively, for nitrate and nitrite reductases, are divergently transcribed, and their ATGs are separated by 1,200 bp. The genes are under the control of the positively acting NirA transcription factor, which mediates nitrate induction. The DNA binding domain of NirA was expressed as a fusion protein with the glutathione S-transferase of Schistosoma japonicum. Gel shift and footprint experiments have shown that in the intergenic region there are four binding sites for the NirA transcription factor. These sites can be represented by the nonpalindromic consensus 5'CTCCGHGG3'. Making use of a bidirectional expression vector, we have analyzed the role of each of the sites in niaD and niiA expression. The sites were numbered from the niiA side. It appeared that site 1 is necessary for the inducibility of niiA only, while sites 2, 3, and to a lesser extent 4 (which is nearer to and strongly affects niaD) act bidirectionally. The results also suggest that of the 10 binding sites for the AreA protein, which mediates nitrogen metabolite repression, those which are centrally located are physiologically important. The insertion of an unrelated upstream activating sequence into the intergenic region strongly affected the expression of both genes, irrespective of the orientation in which the element was inserted. PMID:7565720

  4. Phylogenetic analysis of the genus Avena based on chloroplast intergenic spacer psbA-trnH and single-copy nuclear gene Acc1.

    PubMed

    Yan, Hong-Hai; Baum, Bernard R; Zhou, Ping-Ping; Zhao, Jun; Wei, Yu-Ming; Ren, Chang-Zhong; Xiong, Fang-Qiu; Liu, Gang; Zhong, Lin; Zhao, Gang; Peng, Yuan-Ying

    2014-05-01

    Two uncorrelated nucleotide sequences, chloroplast intergenic spacer psbA-trnH and acetyl CoA carboxylase gene (Acc1), were used to perform phylogenetic analyses in 75 accessions of the genus Avena, representing 13 diploids, seven tetraploid, and four hexaploids by maximum parsimony and Bayesian inference. Phylogenic analyses based on the chloroplast intergenic spacer psbA-trnH confirmed that the A genome diploid might be the maternal donor of species of the genus Avena. Two haplotypes of the Acc1 gene region were obtained from the AB genome tetraploids, indicating an allopolyploid origin for the tetraploid species. Among the AB genome species, both gene trees revealed differences between Avena agadiriana and the other species, suggesting that an AS genome diploid might be the A genome donor and the other genome diploid donor might be the Ac genome diploid Avena canariensis or the Ad genome diploid Avena damascena. Three haplotypes of the Acc1 gene have been detected among the ACD genome hexaploid species. The haplotype that seems to represent the D genome clustered with the tetraploid species Avena murphyi and Avena maroccana, which supported the CD genomic designation instead of AC for A. murphyi and A. maroccana.

  5. Identification of SmtB/ArsR cis elements and proteins in archaea using the Prokaryotic InterGenic Exploration Database (PIGED).

    PubMed

    Bose, Michael; Slick, David; Sarto, Mickey J; Murphy, Patrick; Roberts, David; Roberts, Jacqueline; Barber, Robert D

    2006-08-01

    Microbial genome sequencing projects have revealed an apparently wide distribution of SmtB/ArsR metal-responsive transcriptional regulators among prokaryotes. Using a position-dependent weight matrix approach, prokaryotic genome sequences were screened for SmtB/ArsR DNA binding sites using data derived from intergenic sequences upstream of orthologous genes encoding these regulators. Sixty SmtB/ArsR operators linked to metal detoxification genes, including nine among various archaeal species, are predicted among 230 annotated and draft prokaryotic genome sequences. Independent multiple sequence alignments of putative operator sites and corresponding winged helix-turn-helix motifs define sequence signatures for the DNA binding activity of this SmtB/ArsR subfamily. Prediction of an archaeal SmtB/ArsR based upon these signature sequences is confirmed using purified Methanosarcina acetivorans C2A protein and electrophoretic mobility shift assays. Tools used in this study have been incorporated into a web application, the Prokaryotic InterGenic Exploration Database (PIGED; http://bioinformatics.uwp.edu/~PIGED/home.htm), facilitating comparable studies. Use of this tool and establishment of orthology based on DNA binding signatures holds promise for deciphering potential cellular roles of various archaeal winged helix-turn-helix transcriptional regulators.

  6. Trypanosoma vivax: characterization of the spliced-leader gene of a Brazilian stock and species-specific detection by PCR amplification of an intergenic spacer sequence.

    PubMed

    Ventura, R M; Paiva, F; Silva, R A; Takeda, G F; Buck, G A; Teixeira, M M

    2001-09-01

    The sequence of the spliced-leader gene repeat of a Brazilian Trypanosoma vivax stock from cattle showed high similarity to sequences of West African T. vivax in both intron and intergenic sequences. This is the first evidence based on DNA sequences of close-relatedness between Brazilian and West African T. vivax stocks. A T. vivax-specific diagnostic PCR assay based on spliced-leader gene intergenic sequences was able to amplify DNA from T. vivax stocks from South America (Brazil, Bolivia, and Colombia) and West Africa. Species-specificity of this method was confirmed by results obtained by testing 15 other trypanosomes, including other species and subspecies that can also infect cattle. The PCR assay developed presented high sensitivity, detecting the DNA content of only one parasite and also revealing T. vivax infection in asymptomatic animals without detectable parasitemia by microhematocrit or in Giemsa-stained blood smears. Use of crude preparations from field-blood samples collected on both filter paper and glass slides as DNA template suggested that this method could be useful for the diagnosis of T. vivax in large epidemiological studies.

  7. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  8. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  9. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  10. Bradyrhizobium neotropicale sp. nov., isolated from effective nodules of Centrolobium paraense.

    PubMed

    Zilli, Jerri E; Baraúna, Alexandre C; da Silva, Krisle; De Meyer, Sofie E; Farias, Eliane N C; Kaminski, Paulo E; da Costa, Ismaele B; Ardley, Julie K; Willems, Anne; Camacho, Natália N; Dourado, Fernanda dos S; O'Hara, Graham

    2014-12-01

    Root nodule bacteria were isolated from Centrolobium paraense Tul. grown in soils from the Amazon region, State of Roraima (Brazil). 16S rRNA gene sequence analysis of seven strains (BR 10247(T), BR 10296, BR 10297, BR 10298, BR 10299, BR 10300 and BR 10301) placed them in the genus Bradyrhizobium with the closest neighbours being the type strains of Bradyrhizobium paxllaeri (98.8 % similarity), Bradyrhizobium icense (98.8 %), Bradyrhizobium lablabi (98.7 %), Bradyrhizobium jicamae (98.6 %), Bradyrhizobium elkanii (98.6 %), Bradyrhizobium pachyrhizi (98.6 %) and Bradyrhizobium retamae (98.3 %). This high similarity, however, was not confirmed by the intergenic transcribed spacer (ITS) 16S-23S rRNA region sequence analysis nor by multi-locus sequence analysis. Phylogenetic analyses of five housekeeping genes (dnaK, glnII, gyrB, recA and rpoB) revealed Bradyrhizobium iriomotense EK05(T) ( = LMG 24129(T)) to be the most closely related type strain (95.7 % sequence similarity or less). Chemotaxonomic data, including fatty acid profiles [major components being C16 : 0 and summed feature 8 (18 : 1ω6c/18 : 1ω7c)], DNA G+C content, slow growth rate and carbon compound utilization patterns, supported the placement of the novel strains in the genus Bradyrhizobium. Results of DNA-DNA relatedness studies and physiological data (especially carbon source utilization) differentiated the strains from the closest recognized species of the genus Bradyrhizobium. Symbiosis-related genes for nodulation (nodC) and nitrogen fixation (nifH) placed the novel species in a new branch within the genus Bradyrhizobium. Based on the current data, these seven strains represent a novel species for which the name Bradyrhizobium neotropicale sp. nov. is proposed. The type strain is BR 10247(T) ( = HAMBI 3599(T)).

  11. Bradyrhizobium pachyrhizi sp. nov. and Bradyrhizobium jicamae sp. nov., isolated from effective nodules of Pachyrhizus erosus.

    PubMed

    Ramírez-Bahena, Martha Helena; Peix, Alvaro; Rivas, Raúl; Camacho, María; Rodríguez-Navarro, Dulce N; Mateos, Pedro F; Martínez-Molina, Eustoquio; Willems, Anne; Velázquez, Encarna

    2009-08-01

    Several strains isolated from the legume Pachyrhizus erosus were characterized on the basis of diverse genetic, phenotypic and symbiotic approaches. These novel strains formed two groups closely related to Bradyrhizobium elkanii according to their 16S rRNA gene sequences. Strains PAC48T and PAC68T, designated as the type strains of these two groups, presented 99.8 and 99.1% similarity, respectively, in their 16S rRNA gene sequences with respect to B. elkanii USDA 76T. In spite of these high similarity values, the analysis of additional phylogenetic markers such as atpD and glnII genes and the 16S-23S intergenic spacer (ITS) showed that strains PAC48T and PAC68T represented two separate novel species of the genus Bradyrhizobium with B. elkanii as their closest relative. Phenotypic differences among the novel strains isolated from Pachyrhizus and B. elkanii were found regarding the assimilation of carbon sources and antibiotic resistance. All these differences were congruent with DNA-DNA hybridization analysis which revealed 21% genetic relatedness between strains PAC48T and PAC68T and 46% and 25%, respectively, between these strains and B. elkanii LMG 6134T. The nodD and nifH genes of strains PAC48T and PAC68T were phylogenetically divergent from those of bradyrhizobia species that nodulate soybean. Soybean was not nodulated by the novel Pachyrhizus isolates. Based on the genotypic and phenotypic data obtained in this study, the new strains represent two novel species for which the names Bradyrhizobium pachyrhizi sp. nov. (type strain PAC48T=LMG 24246T=CECT 7396T) and Bradyrhizobium jicamae sp. nov. (type strain PAC68T=LMG 24556T=CECT 7395T) are proposed. PMID:19567584

  12. Inter- and intraspecies identification of Bartonella (Rochalimaea) species.

    PubMed

    Roux, V; Raoult, D

    1995-06-01

    Species of the genus Rochalimaea, recently renamed Bartonella, are of a growing medical interest. Bartonella quintana was reported as the cause of trench fever, endocarditis, and bacillary angiomatosis. B. henselae has been implicated in symptoms and infections of human immunodeficiency virus-infected patients, such as fever, endocarditis, and bacillary angiomatosis, and is involved in the etiology of cat scratch disease. Such a wide spectrum of infections makes it necessary to obtain an intraspecies identification tool in order to perform epidemiological studies. B. vinsonii, B. elizabethae, seven isolates of B. quintana, and four isolates of B. henselae were studied by pulsed-field gel electrophoresis (PFGE) after restriction with the infrequently cutting endonucleases NotI, EagI, and SmaI. Specific profiles were obtained for each of the four Bartonella species. Comparison of genomic fingerprints of isolates of the same species showed polymorphism in DNA restriction patterns, and a specific profile was obtained for each isolate. A phylogenetic analysis of the B. quintana isolates was obtained by using the Dice coefficient, UPGMA (unweighted pair-group method of arithmetic averages), and Package Philip programming. Amplification by PCR and subsequent sequencing using an automated laser fluorescent DNA sequencer (Pharmacia) was performed on the intergenic spacer region (ITS) between the 16 and 23S rRNA genes. It was found that each B. henselae isolate had a specific sequence, while the B. quintana isolates fell into only two groups. When endonuclease restriction analysis of the ITS PCR product was done, three enzymes, TaqI, HindIII, and HaeIII, allowed species identification of Bartonella spp. Restriction fragment length polymorphism after PCR amplification of the 16S-23S rRNA gene ITS may be useful for rapid species identification, and PFGE could be an efficient method for isolate identification.

  13. A panel of real-time PCR assays for specific detection of three phytoplasmas from the apple proliferation group.

    PubMed

    Nikolić, Petra; Mehle, Natasa; Gruden, Kristina; Ravnikar, Maja; Dermastia, Marina

    2010-10-01

    We report here on the development of combination of assays for fast, reliable, specific and sensitive detection and discrimination of 'Candidatus Phytoplasma mali', 'Ca. P. prunorum' and 'Ca. P. pyri' from the 16Sr-X (apple proliferation - AP) group. These phytoplasmas are causal agents of diseases of fruit trees within the family Rosaceae, namely apple proliferation (AP), European stone fruit yellows (ESFY) and pear decline (PD). The designed panel of assays uses TaqMan minor groove binder probes (MGB). It comprises the same set of primers and specific probes for species-specific amplification within the 16S-23S rRNA intergenic spacer region, a set of primers and probes for amplification of the 16S ribosomal DNA region for the universal phytoplasma detection, and an additional set of primers and probe for 18S rRNA as an endogenous quality control of DNA extraction. The performance characteristics of the panel were evaluated. The advantages of new assays were shown in a comparative study with the conventional PCR, which proved their higher sensitivity combined with three-fold shorter time of testing process; and in comparison with two reported multiplex real-time PCR assays for detection of 'Ca. P. mali' or 'Ca. P. pyri'. New panel of assays were tested on the DNA samples of 'Ca. P. mali', 'Ca. P. prunorum', 'Ca. P. pyri', other phytoplasmas and other bacteria isolated from plant material. Additionally, 198 symptomatic and asymptomatic fruit tree field samples collecting during several growing seasons were tested with new assays as well. The results of this study indicate that the combination of three specific assays may be applied in routine phytoplasma surveys and in the certification programs.

  14. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    PubMed

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa.

  15. Comparison of genospecies and antimicrobial resistance profiles of isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex from various clinical specimens.

    PubMed

    Tien, Ni; You, Bang-Jau; Chang, Hui-Lan; Lin, Hsiu-Shen; Lee, Chin-Yi; Chung, Tung-Ching; Lu, Jang-Jih; Chang, Chao-Chin

    2012-12-01

    This study was conducted to compare the prevalences of antimicrobial resistance profiles of clinical isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex from sterile and nonsterile sites and to further study the relationship of antimicrobial resistance profiles and genospecies by amplified rRNA gene restriction analysis (ARDRA). A total of 1,381 isolates were tested with 12 different antibiotics to show their antimicrobial susceptibility profiles. A total of 205 clinical isolates were further analyzed by ARDRA of the intergenic spacer (ITS) region of the 16S-23S rRNA gene. It was found that the overall percentage of isolates from nonsterile sites (urine, sputum, pus, or catheter tip) that were resistant to the 12 antibiotics tested was significantly higher than that of isolates from sterile sites (cerebrospinal fluid [CSF], ascites fluid, and bloodstream) (46% versus 22%; P < 0.05). After ARDRA, it was found that 97% of the 62 isolates resistant to all antibiotics tested were the A. baumannii genospecies, which was identified in only 31% of the isolates susceptible to all antibiotics tested. More genospecies diversity was identified in the isolates susceptible to all antibiotics tested, including genospecies of 13TU (34%), genotype 3 (29%), and A. calcoaceticus (5%). Furthermore, as 91% (10/11) of the isolates from CSF were susceptible to all antibiotics tested, the A. calcoaceticus-A. baumannii complex isolates with multidrug resistance could be less invasive than the more susceptible isolates. This study also indicated current emergence of carbapenem-, fluoroquinolone-, aminoglycoside-, and cephalosporin-resistant A. calcoaceticus-A. baumannii complex isolates in Taiwan.

  16. Oligonucleotide array-based identification of species in the Acinetobacter calcoaceticus-A. baumannii complex in isolates from blood cultures and antimicrobial susceptibility testing of the isolates.

    PubMed

    Ko, Wen-Chien; Lee, Nan-Yao; Su, Siou Cing; Dijkshoorn, Lenie; Vaneechoutte, Mario; Wang, Li-Rong; Yan, Jin-Jou; Chang, Tsung Chain

    2008-06-01

    Acinetobacter calcoaceticus, A. baumannii, Acinetobacter genomic species (gen. sp.) 3, and Acinetobacter gen. sp. 13TU, which are included in the A. calcoaceticus-A. baumannii complex, are difficult to distinguish by phenotypic methods. An array with six oligonucleotide probes based on the 16S-23S rRNA gene intergenic spacer (ITS) region was developed to differentiate species in the A. calcoaceticus-A. baumannii complex. Validation of the array with a reference collection of 52 strains of the A. calcoaceticus-A. baumannii complex and 137 strains of other species resulted in an identification sensitivity and specificity of 100%. By using the array, the species distribution of 291 isolates of the A. calcoaceticus-A. baumannii complex from patients with bacteremia were determined to be A. baumannii (221 strains [75.9%]), Acinetobacter gen. sp. 3 (67 strains [23.0%]), Acinetobacter gen. sp. 13TU (2 strains [0.7%]), and unidentified Acinetobacter sp. (1 strain [0.3%]). The identification accuracy of the array for 12 randomly selected isolates from patients with bacteremia was further confirmed by sequence analyses of the ITS region and the 16S rRNA gene. Antimicrobial susceptibility testing of the 291 isolates from patients with bacteremia revealed that A. baumannii strains were less susceptible to antimicrobial agents than Acinetobacter gen. sp. 3. All Acinetobacter gen. sp. 3 strains were susceptible to ampicillin-sulbactam, imipenem, and meropenem; but only 67.4%, 90%, and 86% of the A. baumannii strains were susceptible to ampicillin-sulbactam, imipenem, and meropenem, respectively. The observed significant variations in antimicrobial susceptibility among different species in the A. calcoaceticus-A. baumannii complex emphasize that the differentiation of species within the complex is relevant from a clinical-epidemiological point of view.

  17. Comparative analysis of the S-intergenic region in class-II S haplotypes of self-incompatible Brassica rapa (syn. campestris).

    PubMed

    Kakizaki, Tomohiro; Takada, Yoshinobu; Fujioka, Tomoaki; Suzuki, Go; Satta, Yoko; Shiba, Hiroshi; Isogai, Akira; Takayama, Seiji; Watanabe, Masao

    2006-02-01

    In the Brassica self-incompatibility (SI) system, a pollen determinant, SP11, is involved in dominance/recessive relationships in pollen SI phenotypes. In order to gain some insights into the genomic structure around the SP11 and the mechanisms that give dominance/recessive relationships, we characterized the genomic region containing SP11 and SRK genes in three pollen recessive class-II S haplotypes. The direction of transcription of S genes was completely conserved among class-II S haplotypes. However, the region between SP11 and SRK (S-intergenic region) was highly polymorphic without short repetitive sequences. In addition, we found a sequence similarity between the short repetitive sequence and 5'-upstream region of SP11. This sequence similarity was found to be potentially related to the expression of dominance relationships through the change of chromatin structure.

  18. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  19. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  20. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  1. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  2. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  3. Evidence for Regulation of ECM3 Expression by Methylation of Histone H3 Lysine 4 and Intergenic Transcription in Saccharomyces cerevisiae

    PubMed Central

    Raupach, Elizabeth A.; Martens, Joseph A.; Arndt, Karen M.

    2016-01-01

    Transcription of nonprotein-coding DNA is widespread in eukaryotes and plays important regulatory roles for many genes, including genes that are misregulated in cancer cells. Its pervasiveness presents the potential for a wealth of diverse regulatory roles for noncoding transcription. We previously showed that the act of transcribing noncoding DNA (ncDNA) across the promoter of the protein-coding SER3 gene in Saccharomyces cerevisiae positions nucleosomes over the upstream activating sequences, leading to strong repression of SER3 transcription. To explore the possibility of other regulatory roles for ncDNA transcription, we selected six candidate S. cerevisiae genes that express ncRNAs over their promoters and analyzed the regulation of one of these genes, ECM3, in detail. Because noncoding transcription can lead to changes in the local chromatin landscape that impinge on the expression of nearby coding genes, we surveyed the effects of various chromatin regulators on the expression of ECM3. These analyses identified roles for the Paf1 complex in positively regulating ECM3 transcription through methylation of histone H3 at lysine 4 (K4) and for Paf1 in controlling the pattern of intergenic transcription at this locus. By deleting a putative promoter for the noncoding transcription unit that lies upstream of ECM3, we provide evidence for a positive correlation between intergenic transcription and ECM3 expression. Our results are consistent with a model in which cotranscriptional methylation of histone H3 K4, mediated by the Paf1 complex and noncoding transcription, leads to activation of ECM3 transcription. PMID:27449519

  4. Identification of a novel DRB1 allele through intergenic recombination between HLA-DRB1 and HLA-DRB3∗02 in a Chinese family.

    PubMed

    Huang, Weijin; Liu, Xiangjun; Li, Erwei; Zhao, Chenyan; Liu, Qiang; Liang, Zhenglun; Wang, Youchun; Lu, Fengmin

    2013-12-01

    In this study, a novel DRB1 allele was revealed by routine HLA-SBT typing noted for its extensive mismatches to any known DRB1 alleles within the exon 2. Sequences containing the exons 2, 3 of HLA-DRB1, their surrounding introns, and the full-length cDNA of DRB1 were analyzed to determine a possible recombination event. Interestingly, the sequences of entire exon 2 were characterized as DRB3(∗)02:02:01:01/02; while exon 3 were characterized as DRB1(∗)14 like alleles. Further analysis of the sequences using Simplot software suggested that an intergenic recombinant event (i.e. exchange of sequence between non-allelic genes) may have occurred between DRB3(∗)02 allele and DRB1(∗)14 like allele, and the recombination sites are located at intron 1 and the boundary of exon 2 and intron 2 of DRB1. There are 5 CGGGG sequences flanking each side of exon 2 could serve as potential recombination site. Moreover, the full-length cDNA of the novel allele has been identified. The exon 1 and exon 3 to exon 6 share the same sequence as DRB1(∗)14 like alleles. At the mRNA level, the new allele has no significant difference when compared with the other DRB1 allele. This novel recombinant allele is also found to be paternally inherited. In conclusion, this is the first report of a DRB1 and DRB3 intergenic recombination event involving whole exon 2, which generate a new DRB1(∗)14:141.

  5. Genome-Wide Anaplasma phagocytophilum AnkA-DNA Interactions Are Enriched in Intergenic Regions and Gene Promoters and Correlate with Infection-Induced Differential Gene Expression

    PubMed Central

    Dumler, J. Stephen; Sinclair, Sara H.; Pappas-Brown, Valeria; Shetty, Amol C.

    2016-01-01

    Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils, and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR)-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: (i) intergenic regions predicted to be MARs; (ii) within predicted lamina-associated domains; and (iii) at promoters ≤ 3000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome “re-organizer.” AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity. PMID:27703927

  6. beta-Cyclodextrin derivatives as carriers to enhance the antiviral activity of an antisense oligonucleotide directed toward a coronavirus intergenic consensus sequence.

    PubMed

    Abdou, S; Collomb, J; Sallas, F; Marsura, A; Finance, C

    1997-01-01

    The ability of cyclodextrins to enhance the antiviral activity of a phosphodiester oligodeoxynucleotide has been investigated. A 18-mer oligodeoxynucleotide complementary to the initiation region of the mRNA coding for the spike protein and containing the intergenic consensus sequence of an enteric coronavirus has been tested for antiviral action against virus growth in human adenocarcinoma cells. The phosphodiester oligodeoxynucleotide only showed a limited effect on virus growth rate (from 12 to 34% viral inhibition in cells treated with 7.5 to 25 microM oligodeoxynucleotide, respectively, at a multiplicity of infection of 0.1 infectious particle per cell). In the same conditions, the phosphorothioate analogue exhibited stronger antiviral activity, the inhibition increased from 56 to 90%. The inhibitory effect of this analogue was antisense and sequence-specific. Northern blot analysis showed that the sequence-dependent mechanism of action appears to be the inhibition of mRNA transcription. We conclude that the coronavirus intergenic consensus sequence is a good target for an antisense oligonucleotide antiviral action. The properties of the phosphodiester oligonucleotide was improved after its complexation with cyclodextrins. The most important increase of the antiviral activity (90% inhibition) was obtained with only 7.5 microM oligonucleotide complexed to a cyclodextrin derivative, 6-deoxy-6-S-beta-D-galactopyranosyl-6-thio-cyclomalto-heptaose+ ++ in a molar ratio of 1:100. These studies suggest that the use of cyclodextrin derivatives as carrier for phosphodiester oligonucleotides delivery may be an effective method for increasing the therapeutic potential of these compounds in viral infections. PMID:9672621

  7. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  8. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  9. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  10. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  11. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  12. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  13. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  14. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  15. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  16. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil

    PubMed Central

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo

    2016-01-01

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs). PMID:27231360

  17. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  18. 'Candidatus Liberibacter americanus', associated with citrus huanglongbing (greening disease) in São Paulo State, Brazil.

    PubMed

    Teixeira, Diva do Carmo; Saillard, Colette; Eveillard, Sandrine; Danet, Jean Luc; da Costa, Paulo Inácio; Ayres, Antonio Juliano; Bové, Joseph

    2005-09-01

    Symptoms of huanglongbing (HLB) were reported in São Paulo State (SPS), Brazil, in March 2004. In Asia, HLB is caused by 'Candidatus Liberibacter asiaticus' and in Africa by 'Candidatus Liberibacter africanus'. Detection of the liberibacters is based on PCR amplification of their 16S rRNA gene with specific primers. Leaves with blotchy mottle symptoms characteristic of HLB were sampled in several farms of SPS and tested for the presence of liberibacters. 'Ca. L. asiaticus' was detected in a small number of samples but most samples gave negative PCR results. Therefore, a new HLB pathogen was suspected. Evidence for an SPS-HLB bacterium in symptomatic leaves was obtained by PCR amplification with universal primers for prokaryotic 16S rRNA gene sequences. The amplified 16S rRNA gene was cloned and sequenced. Sequence analysis and phylogeny studies showed that the 16S rRNA gene possessed the oligonucleotide signatures and the secondary loop structure characteristic of the alpha-Proteobacteria, including the liberibacters. The 16S rRNA gene sequence phylogenetic tree showed that the SPS-HLB bacterium clustered within the alpha-Proteobacteria, the liberibacters being its closest relatives. For these reasons, the SPS-HLB bacterium is considered a member of the genus 'Ca. Liberibacter'. However, while the 16S rRNA gene sequences of 'Ca. L. asiaticus' and 'Ca. L. africanus' had 98.4% similarity, the 16S rRNA gene sequence of the SPS-HLB liberibacter had only 96.0% similarity with the 16S rRNA gene sequences of 'Ca. L. asiaticus' or 'Ca. L. africanus'. This lower similarity was reflected in the phylogenetic tree, where the SPS-HLB liberibacter did not cluster within the 'Ca. L asiaticus'/'Ca. L. africanus group', but as a separate branch. Within the genus 'Candidatus Liberibacter' and for a given species, the 16S/23S intergenic region does not vary greatly. The intergenic regions of three strains of 'Ca. L. asiaticus', from India, the People's Republic of China and Japan

  19. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  20. Networks of intergenic long-range enhancers and snpRNAs drive castration-resistant phenotype of prostate cancer and contribute to pathogenesis of multiple common human disorders

    PubMed Central

    Glinskii, Anna B; Ma, Shuang; Ma, Jun; Grant, Denise; Lim, Chang-Uk; Guest, Ian; Sell, Stewart; Buttyan, Ralph

    2011-01-01

    The mechanistic relevance of intergenic disease-associated genetic loci (IDAGL) containing highly statistically significant disease-linked SNPs remains unknown. Here, we present experimental and clinical evidence supporting the importantance of the role of IDAGL in human diseases. A targeted RT-PCR screen coupled with sequencing of purified PCR products detects widespread transcription at multiple IDAGL and identifies 96 small noncoding trans-regulatory RNAs of ∼100–300 nt in length containing SNPs (snpRNAs) associated with 21 common disorders. Multiple independent lines of experimental evidence support functionality of snpRNAs by documenting their cell type-specific expression and evolutionary conservation of sequences, genomic coordinates and biological effects. Chromatin state signatures, expression profiling experiments and luciferase reporter assays demonstrate that many IDAGL are Polycomb-regulated long-range enhancers. Expression of snpRNAs in human and mouse cells markedly affects cellular behavior and induces allele-specific clinically relevant phenotypic changes: NLRP1-locus snpRNAs rs2670660 exert regulatory effects on monocyte/macrophage transdifferentiation, induce prostate cancer (PC) susceptibility snpRNAs and transform low-malignancy hormone-dependent human PC cells into highly malignant androgen-independent PC. Q-PCR analysis and luciferase reporter assays demonstrate that snpRNA sequences represent allele-specific “decoy” targets of microRNAs that function as SNP allele-specific modifiers of microRNA expression and activity. We demonstrate that trans-acting RNA molecules facilitating resistance to androgen depletion (RAD) in vitro and castration-resistant phenotype (CRP) in vivo of PC contain intergenic 8q24-locus SNP variants (rs1447295; rs16901979; rs6983267) that were recently linked with increased risk of PC. Q-PCR analysis of clinical samples reveals markedly increased and highly concordant (r = 0.896; p < 0.0001) snpRNA expression

  1. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  2. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  3. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  4. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  5. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  6. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  7. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  8. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  9. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  10. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  11. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  12. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  13. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  14. Structure and comparative analysis of the rDNA intergenic spacer of Brassica rapa. Implications for the function and evolution of the Cruciferae spacer.

    PubMed

    Da Rocha, P S; Bertrand, H

    1995-04-15

    The sequence of the intergenic spacer (IGS) of the Brassica rapa rDNA was determined and compared with those of other Cruciferae species. In the 3012-bp IGS, two segments of mostly unique sequence flank a 1.5-kb region consisting of two tandem arrays of repeats. A putative transcription initiation site (TIS) was identified by sequence comparison, 395 bp downstream from the repeat region. The intercalating segment displays unusual sequence patterns, and modelling of its topology predicts intrinsically bent DNA, with two elements of bending centered at positions -118 and -288 relative to the TIS. Comparative analysis of spacers from Cruciferae, revealed a common organization and high sequence similarity in their 5' and, particularly, 3' regions, whereas the repeat region upstream of TIS diverges rapidly. The conservation of structural elements, including the bent DNA upstream from the TIS, is discussed in light of their possible involvement in the IGS functions and structure of spacers in common ancestors. Examination of the Cruciferae spacers shows that, in addition to unequal crossover and gene conversion, insertional mutagenesis and replication slippage are molecular mechanisms significantly contributing to their evolution.

  15. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression.

    PubMed

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network.

  16. Long intergenic non-coding RNA HOTAIRM1 regulates cell cycle progression during myeloid maturation in NB4 human promyelocytic leukemia cells

    PubMed Central

    Zhang, Xueqing; Weissman, Sherman M; Newburger, Peter E

    2014-01-01

    HOTAIRM1 is a long intergenic non-coding RNA encoded in the human HOXA gene cluster, with gene expression highly specific for maturing myeloid cells. Knockdown of HOTAIRM1 in the NB4 acute promyelocytic leukemia cell line retarded all-trans retinoid acid (ATRA)-induced granulocytic differentiation, resulting in a significantly larger population of immature and proliferating cells that maintained cell cycle progression from G1 to S phases. Correspondingly, HOTAIRM1 knockdown resulted in retained expression of many otherwise ATRA-suppressed cell cycle and DNA replication genes, and abated ATRA induction of cell surface leukocyte activation, defense response, and other maturation-related genes. Resistance to ATRA-induced cell cycle arrest at the G1/S phase transition in knockdown cells was accompanied by retained expression of ITGA4 (CD49d) and decreased induction of ITGAX (CD11c). The coupling of cell cycle progression with temporal dynamics in the expression patterns of these integrin genes suggests a regulated switch to control the transit from the proliferative phase to granulocytic maturation. Furthermore, ITGAX was among a small number of genes showing perturbation in transcript levels upon HOTAIRM1 knockdown even without ATRA treatment, suggesting a direct pathway of regulation. These results indicate that HOTAIRM1 provides a regulatory link in myeloid maturation by modulating integrin-controlled cell cycle progression at the gene expression level. PMID:24824789

  17. Long intergenic non-coding RNA 00152 promotes tumor cell cycle progression by binding to EZH2 and repressing p15 and p21 in gastric cancer

    PubMed Central

    Kong, Rong; Xu, Tong-peng; Xia, Rui; Zhang, Er-bao; Shu, Yong-qian

    2016-01-01

    Long noncoding RNAs (lncRNAs) play important regulatory roles in several human cancers. Integrated analysis revealed that expression of long intergenic non-coding RNA 152 (LINC00152) was significantly upregulated in gastric cancer (GC). Further analysis in a cohort of 97 GC patients revealed that LINC00152 expression was positively correlated with tumor invasion depth, lymph node metastasis, higher TNM stage, and poor survival. Gene set enrichment analysis revealed that cell proliferation and cell cycle progression were increased in patients with high LINC00152 expression. In both GC cell lines and xenograft systems, LINC00152 overexpression facilitated GC cell proliferation by accelerating the cell cycle, whereas LINC00152 knockdown had the opposite effect. Moreover, by binding to enhancer of zeste homolog 2 (EZH2), LINC00152 promotes GC tumor cell cycle progression by silencing the expression of p15 and p21. These findings suggest that LINC00152 may play contribute to the progression of GC and may be an effective therapeutic target. PMID:26799422

  18. Complete nucleotide sequence of the Escherichia coli recC gene and of the thyA-recC intergenic region.

    PubMed Central

    Finch, P W; Wilson, R E; Brown, K; Hickson, I D; Tomkinson, A E; Emmerson, P T

    1986-01-01

    The nucleotide sequence of a 6,000 bp region of the E. coli chromosome that includes the 3' end of the coding region for the thyA gene and the entire recC gene has been determined. The proposed coding region for the RecC protein is 3369 nucleotides long, which would encode a polypeptide consisting of 1122 amino acids with a calculated molecular mass of 129 kDa. Mung bean nuclease mapping of a recC specific transcript produced in vivo indicates that transcription of recC is initiated 80 bp upstream of the translational start point. A weak promoter sequence situated 5' to the transcription initiation point has been identified. In the 1953 bp thyA-recC intergenic region there are three open reading frames that would code for polypeptides of molecular mass 30 kDa, 13.5 kDa and 12 kDa, respectively. Although the first and third of these open reading frames are preceded by possible ribosome binding sites, no obvious promoter sequences could be identified. Moreover, transcripts for these reading frames could not be detected. Images PMID:3520484

  19. Modulation of gene expression in U251 glioblastoma cells by binding of mutant p53 R273H to intronic and intergenic sequences

    PubMed Central

    Brázdová, Marie; Quante, Timo; Tögel, Lars; Walter, Korden; Loscher, Christine; Tichý, Vlastimil; Činčárová, Lenka; Deppert, Wolfgang; Tolstonog, Genrich V.

    2009-01-01

    Missense point mutations in the TP53 gene are frequent genetic alterations in human tumor tissue and cell lines derived thereof. Mutant p53 (mutp53) proteins have lost sequence-specific DNA binding, but have retained the ability to interact in a structure-selective manner with non-B DNA and to act as regulators of transcription. To identify functional binding sites of mutp53, we established a small library of genomic sequences bound by p53R273H in U251 human glioblastoma cells using chromatin immunoprecipitation (ChIP). Mutp53 binding to isolated DNA fragments confirmed the specificity of the ChIP. The mutp53 bound DNA sequences are rich in repetitive DNA elements, which are dispersed over non-coding DNA regions. Stable down-regulation of mutp53 expression strongly suggested that mutp53 binding to genomic DNA is functional. We identified the PPARGC1A and FRMD5 genes as p53R273H targets regulated by binding to intronic and intra-genic sequences. We propose a model that attributes the oncogenic functions of mutp53 to its ability to interact with intronic and intergenic non-B DNA sequences and modulate gene transcription via re-organization of chromatin. PMID:19139068

  20. The intergenic region of the maize defensin-like protein genes Def1 and Def2 functions as an embryo-specific asymmetric bidirectional promoter.

    PubMed

    Liu, Xiaoqing; Yang, Wenzhu; Li, Ye; Li, Suzhen; Zhou, Xiaojin; Zhao, Qianqian; Fan, Yunliu; Lin, Min; Chen, Rumei

    2016-07-01

    Bidirectional promoters are identified in diverse organisms with widely varied genome sizes, including bacteria, yeast, mammals, and plants. However, little research has been done on any individual endogenous bidirectional promoter from plants. Here, we describe a promoter positioned in the intergenic region of two defensin-like protein genes, Def1 and Def2 in maize (Zea mays). We examined the expression profiles of Def1 and Def2 in 14 maize tissues by qRT-PCR, and the results showed that this gene pair was expressed abundantly and specifically in seeds. When fused to either green fluorescent protein (GFP) or β-glucuronidase (GUS) reporter genes, P ZmBD1 , P ZmDef1 , and P ZmDef2 were active and reproduced the expression patterns of both Def1 and Def2 genes in transformed immature maize embryos, as well as in developing seeds of transgenic maize. Comparative analysis revealed that PZmBD1 shared most of the expression characteristics of the two polar promoters, but displayed more stringent embryo specificity, delayed expression initiation, and asymmetric promoter activity. Moreover, a truncated promoter study revealed that the core promoters only exhibit basic bidirectional activity, while interacting with necessary cis-elements, which leads to polarity and different strengths. The sophisticated interaction or counteraction between the core promoter and cis-elements may potentially regulate bidirectional promoters. PMID:27279278

  1. Genome-wide identification and characterization of long intergenic noncoding RNAs and their potential association with larval development in the Pacific oyster

    PubMed Central

    Yu, Hong; Zhao, Xuelin; Li, Qi

    2016-01-01

    An increasing amount of evidence suggests that long intergenic noncoding RNAs (lincRNAs) may play diverse roles in many cellular processes. However, little is known about lincRNAs in marine invertebrates. Here, we presented the first identification and characterization of lincRNAs in the Pacific oyster (Crassostrea gigas). We developed a pipeline and identified 11,668 lincRNAs in C. gigas based on RNA-Seq resources available. These lincRNAs exhibited many common characteristics with vertebrate lincRNAs: relatively short length, low exon numbers, low expression, and low sequence conservation. 1,175 lincRNAs were expressed in a tissue-specific manner, with 35.2% preferentially expressed in male gonad. 776 lincRNAs were specifically expressed in juvenile during different developmental stages. In addition, 47 lincRNAs were found to be potentially related to oyster settlement and metamorphosis. Such diverse temporal and spatial patterns of expression suggest that these lincRNAs might function in cell differentiation during early development, as well as sex differentiation and reproduction. Based on a co-expression network analysis, five lincRNAs were detected that have an expression correlation with key hub genes in four modules significantly correlated with larval development. Our study provides the first large-scale identification of lincRNAs in molluscs and offers new insights into potential functions of lincRNAs in marine invertebrates. PMID:26861843

  2. Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer

    PubMed Central

    Liao, X-H; Wang, J-G; Li, L-Y; Zhou, D-M; Ren, K-H; Jin, Y-T; Lv, L; Yu, J-G; Yang, J-Y; Lu, Q; Zou, Q; Yu, J; Liu, X-P; Zhou, P

    2016-01-01

    Increasing evidence indicates that long non-coding RNAs (lncRNAs) act as important regulatory factors in tumor progression. However, their roles in breast cancer remain largely unknown. In present studies, we identified aberrantly expressed long intergenic non-coding RNA APOC1P1-3 (lincRNA-APOC1P1-3) in breast cancer by microarray, verified it by quantitative real-time PCR, and assessed methylation status in the promoter region by pyrosequencing. We also investigated the biological functions with plasmid transfection and siRNA silencing experiments, and further explored their mechanisms by RNA pull-down and RNA immunoprecipitation to identify binding proteins. We found that 224 lncRNAs were upregulated in breast cancer, whereas 324 were downregulated. The lincRNA-APOC1P1-3 was overexpressed in breast cancer, which was related to tumor size and hypomethylation in its promoter region. We also found that APOC1P1-3 could directly bind to tubulin to decrease α-tubulin acetylation, to inactivate caspase-3, and to inhibit apoptosis. This study demonstrates that overexpression of APOC1P1-3 can inhibit breast cancer apoptosis. PMID:27228351

  3. The Intergenerational Impact of Genetic and Psychological Factors on Blood Pressure (InterGEN) Study: Design and Methods for Complex DNA Analysis.

    PubMed

    Taylor, Jacquelyn Y; Wright, Michelle L; Crusto, Cindy A; Sun, Yan V

    2016-10-01

    The Intergenerational Impact of Genetic and Psychological Factors on Blood Pressure (InterGEN) study aims to delineate the independent and interaction effects of genomic (genetic and epigenetic) and psychological-environmental (maternally perceived racial discrimination, mental health, and parenting behavior) factors on blood pressure (BP) among African American mother-child dyads over time. The purpose of this article is to describe the two-step genetic and epigenetic approach that will be executed to explore Gene × Environment interactions on BP using a longitudinal cohort design. Procedure for the single collection of DNA at Time 1 includes the use of the Oragene 500-format saliva sample collection tube, which provides enough DNA for both the Illumina Multi-Ethnic Genotyping and 850K EPIC methylation analyses. BP readings, height, weight, percentage of body fat, and percentage of body water will be measured on all participants every 6 months for 2 years for a total of 4 time points. Genomic data analyses to be completed include multivariate modeling, assessment of population admixture and structure, and extended analyses including Bonferroni correction, false discovery rate methods, Monte Carlo approach, EIGENSTRAT methods, and so on, to determine relationships among both main and interaction effects of genetic, epigenetic, and psychological environmental factors on BP.

  4. Genome wide discovery of long intergenic non-coding RNAs in Diamondback moth (Plutella xylostella) and their expression in insecticide resistant strains

    PubMed Central

    Etebari, Kayvan; Furlong, Michael J.; Asgari, Sassan

    2015-01-01

    Long non-coding RNAs (lncRNAs) play important roles in genomic imprinting, cancer, differentiation and regulation of gene expression. Here, we identified 3844 long intergenic ncRNAs (lincRNA) in Plutella xylostella, which is a notorious pest of cruciferous plants that has developed field resistance to all classes of insecticides, including Bacillus thuringiensis (Bt) endotoxins. Further, we found that some of those lincRNAs may potentially serve as precursors for the production of small ncRNAs. We found 280 and 350 lincRNAs that are differentially expressed in Chlorpyrifos and Fipronil resistant larvae. A survey on P. xylostella midgut transcriptome data from Bt-resistant populations revealed 59 altered lincRNA in two resistant strains compared with the susceptible population. We validated the transcript levels of a number of putative lincRNAs in deltamethrin-resistant larvae that were exposed to deltamethrin, which indicated that this group of lincRNAs might be involved in the response to xenobiotics in this insect. To functionally characterize DBM lincRNAs, gene ontology (GO) enrichment of their associated protein-coding genes was extracted and showed over representation of protein, DNA and RNA binding GO terms. The data presented here will facilitate future studies to unravel the function of lincRNAs in insecticide resistance or the response to xenobiotics of eukaryotic cells. PMID:26411386

  5. A Genome-Wide Association Study for Diabetic Retinopathy in a Japanese Population: Potential Association with a Long Intergenic Non-Coding RNA

    PubMed Central

    Awata, Takuya; Yamashita, Hisakuni; Kurihara, Susumu; Morita-Ohkubo, Tomoko; Miyashita, Yumi; Katayama, Shigehiro; Mori, Keisuke; Yoneya, Shin; Kohda, Masakazu; Okazaki, Yasushi; Maruyama, Taro; Shimada, Akira; Yasuda, Kazuki; Nishida, Nao; Tokunaga, Katsushi; Koike, Asako

    2014-01-01

    Elucidation of the genetic susceptibility factors for diabetic retinopathy (DR) is important to gain insight into the pathogenesis of DR, and may help to define genetic risk factors for this condition. In the present study, we conducted a three-stage genome-wide association study (GWAS) to identify DR susceptibility loci in Japanese patients, which comprised a total of 837 type 2 diabetes patients with DR (cases) and 1,149 without DR (controls). From the stage 1 genome-wide scan of 446 subjects (205 cases and 241 controls) on 614,216 SNPs, 249 SNPs were selected for the stage 2 replication in 623 subjects (335 cases and 288 controls). Eight SNPs were further followed up in a stage 3 study of 297 cases and 620 controls. The top signal from the present association analysis was rs9362054 in an intron of RP1-90L14.1 showing borderline genome-wide significance (Pmet = 1.4×10−7, meta-analysis of stage 1 and stage 2, allele model). RP1-90L14.1 is a long intergenic non-coding RNA (lincRNA) adjacent to KIAA1009/QN1/CEP162 gene; CEP162 plays a critical role in ciliary transition zone formation before ciliogenesis. The present study raises the possibility that the dysregulation of ciliary-associated genes plays a role in susceptibility to DR. PMID:25364816

  6. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  7. Population structure of the lyme borreliosis spirochete Borrelia burgdorferi in the western black-legged tick (Ixodes pacificus) in Northern California.

    PubMed

    Girard, Yvette A; Travinsky, Bridgit; Schotthoefer, Anna; Fedorova, Natalia; Eisen, Rebecca J; Eisen, Lars; Barbour, Alan G; Lane, Robert S

    2009-11-01

    Factors potentially contributing to the lower incidence of Lyme borreliosis (LB) in the far-western than in the northeastern United States include tick host-seeking behavior resulting in fewer human tick encounters, lower densities of Borrelia burgdorferi-infected vector ticks in peridomestic environments, and genetic variation among B. burgdorferi spirochetes to which humans are exposed. We determined the population structure of B. burgdorferi in over 200 infected nymphs of the primary bridging vector to humans, Ixodes pacificus, collected in Mendocino County, CA. This was accomplished by sequence typing the spirochete lipoprotein ospC and the 16S-23S rRNA intergenic spacer (IGS). Thirteen ospC alleles belonging to 12 genotypes were found in California, and the two most abundant, ospC genotypes H3 and E3, have not been detected in ticks in the Northeast. The most prevalent ospC and IGS biallelic profile in the population, found in about 22% of ticks, was a new B. burgdorferi strain defined by ospC genotype H3. Eight of the most common ospC genotypes in the northeastern United States, including genotypes I and K that are associated with disseminated human infections, were absent in Mendocino County nymphs. ospC H3 was associated with hardwood-dominated habitats where western gray squirrels, the reservoir host, are commonly infected with LB spirochetes. The differences in B. burgdorferi population structure in California ticks compared to the Northeast emphasize the need for a greater understanding of the genetic diversity of spirochetes infecting California LB patients. PMID:19783741

  8. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    PubMed Central

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella. PMID:16269740

  9. Mycoplasma corogypsi associated polyarthritis and tenosynovitis in black vultures (Coragyps atratus)

    PubMed Central

    Van Wettere, A. J.; Ley, D. H.; Scott, D. E.; Buckanoff, H. D.; Degernes, L. A.

    2013-01-01

    Three wild American black vultures (Coragyps atratus) were presented to rehabilitation centers with swelling of multiple joints, including elbows, stifles, hocks, and carpal joints, and of the gastrocnemius tendons. Cytological examination of the joint fluid exudate indicated heterophilic arthritis. Radiographic examination in 2 vultures demonstrated periarticular soft tissue swelling in both birds and irregular articular surfaces with subchondral bone erosion in both elbows in 1 bird. Prolonged antibiotic therapy administered in 2 birds did not improve the clinical signs. Necropsy and histological examination demonstrated a chronic lymphoplasmacytic arthritis involving multiple joints and gastrocnemius tenosynovitis. Articular lesions varied in severity and ranged from moderate synovitis and cartilage erosion and fibrillation to severe synovitis, diffuse cartilage ulceration, subchondral bone loss and/or sclerosis, pannus, synovial cysts, and epiphyseal osteomyelitis. No walled bacteria were observed or isolated from the joints. However, mycoplasmas polymerase chain reactions were positive in at least 1 affected joint from each bird. Mycoplasmas were isolated from joints of 1 vulture that did not receive antibiotic therapy. Sequencing of 16S rRNA gene amplicons from joint samples and the mycoplasma isolate identified Mycoplasma corogypsi in 2 vultures and was suggestive in the third vulture. Mycoplasma corogypsi identification was confirmed by sequencing the 16S-23S intergenic spacer region of mycoplasma isolates. This report provides further evidence that M. corogypsi is a likely cause of arthritis and tenosynovitis in American black vultures. Cases of arthritis and tenosynovitis in New World vultures should be investigated for presence of Mycoplasma spp, especially M. corogypsi. PMID:22903399

  10. Systemic Disease in Vaal Rhebok (Pelea capreolus) Caused by Mycoplasmas in the Mycoides Cluster

    PubMed Central

    Nicolas, Melissa M.; Stalis, Ilse H.; Clippinger, Tracy L.; Busch, Martin; Nordhausen, Robert; Maalouf, Gabriel; Schrenzel, Mark D.

    2005-01-01

    In the winter of 2002, an outbreak of mycoplasma infection in Vaal rhebok (Pelea capreolus) originating from South Africa occurred 15 weeks after their arrival in San Diego, Calif. Three rhebok developed inappetence, weight loss, lethargy, signs related to pulmonary or arthral dysfunction, and sepsis. All three rhebok died or were euthanized. Primary postmortem findings were erosive tracheitis, pleuropneumonia, regional cellulitis, and necrotizing lymphadenitis. Mycoplasmas were detected in numerous tissues by electron microscopy, immunohistochemistry, and PCR. The three deceased rhebok were coinfected with ovine herpesvirus-2, and two animals additionally had a novel gammaherpesvirus. However, no lesions indicative of herpesvirus were seen microscopically in any animal. The rheboks' mycoplasmas were characterized at the level of the 16S rRNA gene, the 16S-23S intergenic spacer region, and the fructose biphosphate aldolase gene. Denaturing gradient gel electrophoresis was carried out to address the possibility of infection with multiple strains. Two of the deceased rhebok were infected with a single strain of Mycoplasma capricolum subsp. capricolum, and the third animal had a single, unique strain most closely related to Mycoplasma mycoides subsp. mycoides large-colony. A PCR survey of DNA samples from 46 other ruminant species demonstrated the presence of several species of mycoplasmas in the mycoides cluster, including a strain of M. capricolum subsp. capricolum identical to that found in two of the rhebok. These findings demonstrate the pervasiveness of mycoplasmas in the mycoides cluster in small ruminants and the potential for interspecies transmission and disease when different animal taxa come in contact. PMID:15750104

  11. Analysis of Borrelia burgdorferi Genotypes in Patients with Lyme Arthritis: High Frequency of RST 1 Strains in Antibiotic-Refractory Arthritis

    PubMed Central

    Jones, Kathryn L.; McHugh, Gail A.; Glickstein, Lisa J.; Steere, Allen C.

    2009-01-01

    Objective Most of the B. burgdorferi genotypes have been isolated from erythema migrans (EM) skin lesions in patients with Lyme disease; outer-surface protein C (OspC) type K strains, which are 16S-23S rRNA intergenic spacer type 2 (RST 2), are most commonly recovered, but a higher percentage of OspC type A strains (RST 1), the next most common type, are detectable in blood. Our goals were to determine the B. burgdorferi genotypes in the joints of patients with Lyme arthritis. Methods Joint fluid samples from 124 patients seen over a 30-year period were analyzed for OspC types by semi-nested PCR and sequencing, and for RST by nested PCR and RFLP techniques. This information was correlated with clinical outcome. Results OspC and RST genotypes could be determined in 49 of the 124 joint fluid samples (40%). Of the 49 samples, 21 (43%) were OspC type K (RST 2), 11 (22%) were type A (RST 1), and 17 (35%) were distributed among 8 other OspC types and all 3 RSTs. However, among 17 patients who received current antibiotic regimens, all 7 infected with RST 1 strains had antibiotic-refractory arthritis compared with 4 of 6 patients infected with RST 2 strains and only 1 of 4 infected with RST 3 strains (P=0.03). Conclusions Most of the B. burgdorferi genotypes infected the joints of patients with Lyme arthritis, particularly OspC type K (RST 2); and genotype frequencies reflected those in EM skin lesions. However, RST 1 strains were most frequent in patients with antibiotic-refractory arthritis. PMID:19565522

  12. Borrelia burgdorferi Genetic Markers and Disseminated Disease in Patients with Early Lyme Disease▿

    PubMed Central

    Jones, Kathryn L.; Glickstein, Lisa J.; Damle, Nitin; Sikand, Vijay K.; McHugh, Gail; Steere, Allen C.

    2006-01-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P = 0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease. PMID:17035489

  13. Borrelia burgdorferi genetic markers and disseminated disease in patients with early Lyme disease.

    PubMed

    Jones, Kathryn L; Glickstein, Lisa J; Damle, Nitin; Sikand, Vijay K; McHugh, Gail; Steere, Allen C

    2006-12-01

    Three genetic markers of Borrelia burgdorferi have been associated with disseminated disease: the OspC type, the 16S-23S rRNA intergenic spacer type (RST), and vlsE. Here, we modified previous methods so as to identify the three markers by PCR and restriction fragment length polymorphism in parallel, analyzed B. burgdorferi isolates from erythema migrans (EM) skin lesions in 91 patients, and correlated the results with evidence of dissemination. OspC type A was found approximately twice as frequently in patients with disseminated disease, whereas type K was identified approximately twice as often in those without evidence of dissemination, but these trends were not statistically significant. The remaining seven types identified were found nearly equally in patients with or without evidence of dissemination. RST 1 strains were significantly associated with dissemination (P=0.03), whereas RST 2 and RST 3 strains tended to have an inverse association with this outcome. The vlsE gene was identified in all 91 cases, using primer sets specific for an N-terminal sequence of B. burgdorferi strain B31 (vlsEB31) or strain 297 (vlsE297), but neither marker was associated with dissemination. Specific combinations of the three genetic markers usually occurred together. OspC type A was always found with RST 1 and vlsEB31, type K was always identified with RST 2 and more often with vlsE297, and types E and I were almost always found with RST 3 and equally often with vlsEB31 and vlsE297. We conclude that B. burgdorferi strains vary in their capacity to disseminate, but almost all strains isolated from EM lesions sometimes caused disseminated disease.

  14. Polyphasic study of Zymomonas mobilis strains revealing the existence of a novel subspecies Z. mobilis subsp. francensis subsp. nov., isolated from French cider.

    PubMed

    Coton, Monika; Laplace, Jean-Marie; Auffray, Yanick; Coton, Emmanuel

    2006-01-01

    Zymomonas mobilis strains recently isolated from French 'framboisé' ciders were compared with collection strains of the two defined subspecies, Z. mobilis subsp. mobilis and Z. mobilis subsp. pomaceae, using a polyphasic approach. Six strains isolated from six different regions of France were compared with three strains of Z. mobilis subsp. mobilis, including the type strain LMG 404T, and four strains of Z. mobilis subsp. pomaceae, including the type strain LMG 448T, using phenotypic and genotypic methods. For phenotypic characterization, both physiological tests and SDS-PAGE protein profiles revealed significant differences between the two known subspecies and the French isolates; three distinct groups were observed. These findings were further confirmed by random amplified polymorphic DNA and repetitive extragenic palindromic-PCR genotyping methods in which the French isolates were clearly distinguished from the other two subspecies. Sequence analysis of a fragment ranging from 604 to 617 nucleotides corresponding to the 16S-23S rRNA gene intergenic spacer region (ISR), a 592 nucleotide HSP60 gene fragment and a 1044 nucleotide gyrB gene fragment confirmed the presence of three distinct groups. The French strains exhibited almost 94 % similarity to the ISR, 90 % to HSP60 and 86 % to gyrB sequences of the three collection strains of Z. mobilis subsp. mobilis and 87, 84 and 80 % sequence similarity, respectively, was observed with the four Z. mobilis subsp. pomaceae strains. Based on both the phenotypic and genotypic results, the French strains are proposed to represent a novel subspecies, Zymomonas mobilis subsp. francensis subsp. nov. Strain AN0101T (= LMG 22974T = CIP 108684T) was designated as the type strain. PMID:16403876

  15. Identification, clinical aspects, susceptibility pattern, and molecular epidemiology of beta-haemolytic group G Streptococcus anginosus group isolates from central Taiwan.

    PubMed

    Chang, Yi-Cheng; Lo, Hsueh-Hsia

    2013-07-01

    No literature is available on the prevalence and clinical aspects of beta-haemolytic group G Streptococcus anginosus group in central Taiwan. In this study, we used 16S rRNA gene sequencing and 16S-23S rDNA intergenic spacer sequencing (where necessary) as the gold standard for molecular identification. Twenty-seven S. anginosus group isolates were identified from 273 beta-haemolytic GGS isolates collected from patients in central Taiwan between February 2007 and August 2011. Of the 27 isolates, 22 were S. anginosus and 5 were Streptococcus constellatus. The 3 commercial methods, Rapid ID 32 Strep, API 20 Strep, and Vitek 2 GP card, identified 77.8%, 40.7%, and 37.0% of S. anginosus group isolates, respectively, with acceptable %ID or probability level. All the S. constellatus isolates possessed the lmb gene (encoding laminin-binding protein); however, none of the S. anginosus isolates possessed this gene. All the 27 isolates were susceptible to penicillin. Five S. anginosus group isolates (18.5%) were resistant to erythromycin. The resistance genes, ermB and mefA, were detected in 3 (2 S. anginosus and 1 S. constellatus) and 2 (2 S. anginosus) isolates, respectively. Pulsed field gel electrophoresis showed that most S. anginosus group isolates were genetically diverse. This is the first study to evaluate 3 commercial methods for the identification of beta-haemolytic group G S. anginosus group species, and only the Rapid ID 32 Strep system showed considerable ability. The clinical aspects, susceptibility pattern, and molecular epidemiology of beta-haemolytic group G S. anginosus group isolates from central Taiwan were also first presented.

  16. Analysis of genomic diversity among photosynthetic stem-nodulating rhizobial strains from northeast Argentina.

    PubMed

    Montecchia, Marcela S; Kerber, Norma L; Pucheu, Norma L; Perticari, Alejandro; García, Augusto F

    2002-10-01

    The genomic diversity among photosynthetic rhizobia from northeast Argentina was assessed. Forty six isolates obtained from naturally occurring stem and root nodules of Aeschynomene rudis plants were analyzed by three molecular typing methods with different levels of taxonomic resolution: repetitive sequence-based PCR (rep-PCR) genomic fingerprinting with BOX and REP primers, amplified 16S rDNA restriction analysis (ARDRA), and 16S-23S rDNA intergenic spacer-restriction fragment length polymorphism (IGS-RFLP) analysis. The in vivo absorption spectra of membranes of strains were similar in the near infrared region with peaks at 870 and 800 nm revealing the presence of light harvesting complex I, bacteriochlorophyll-binding polypeptides (LHI-Bchl complex). After extraction with acetone-methanol the spectra differed in the visible part displaying peaks belonging to canthaxanthin or spirilloxanthin as the main carotenoid complement. The genotypic characterization by rep-PCR revealed a high level of genomic diversity among the isolates and almost all the photosynthetic ones have identical ARDRA patterns and fell into one cluster different from Bradyrhizobium japonicum and Bradyrhizobium elkanii. In the combined analysis of ARDRA and rep-PCR fingerprints, 7 clusters were found including most of the isolates. Five of those contained only photosynthetic isolates; all canthaxanthin-containing strains grouped in one cluster, most of the other photosynthetic isolates were grouped in a second large cluster, while the remaining three clusters contained a few strains. The other two clusters comprising reference strains of B. japonicum and B. elkanii, respectively. The IGS-RFLP analysis produced similar clustering for almost all the strains. The 16S rRNA gene sequence of one representative isolate was determined and the DNA sequence analysis confirmed the position of photosynthetic rhizobia in a distinct phylogenetic group within the Bradyrhizobium rDNA cluster.

  17. Marine mesocosm bacterial colonisation of volcanic ash

    NASA Astrophysics Data System (ADS)

    Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

    2015-04-01

    Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

  18. Prevalence of Bartonella spp. in Canine Cutaneous Histiocytoma.

    PubMed

    Pultorak, E L; Linder, K; Maggi, R G; Balakrishnan, N; Breitschwerdt, E B

    2015-07-01

    Canine cutaneous histiocytoma (CCH) is a common, benign neoplastic proliferation of histiocytes of Langerhans cell origin that often ulcerate, become secondarily infected and regress spontaneously. Bartonella is a fastidious genus of facultative intracellular pathogens that can be transmitted through arthropod bites and epidermal animal scratches and has been identified previously in the cytoplasm of histiocytes within granulomatous lesions and in skin biopsy samples of inflammatory pustules and papules. Based on the established inflammatory and oncogenic properties of Bartonella, we hypothesized that Bartonella spp. DNA could be amplified from CCH more often than from non-lesional skin and bacteria could be localized within skin tumours using indirect immunofluorescence (IIF). Paraffin wax-embedded surgical biopsy samples from dogs with CCH and non-neoplastic skin adjacent to osteosarcomas (control group selected due to wide surgical margins) were retrieved from the archive of the pathology service of North Carolina State University College of Veterinary Medicine. DNA was extracted and regions of the 16S-23S rRNA intergenic transcribed spacer (ITS) region and the pap31 and gltA genes were amplified by polymerase chain reaction (PCR) using Bartonella-specific primers. IIF was performed using a primary Bartonella henselae monoclonal antibody to localize B. henselae in tissues of PCR-positive dogs. Bartonella vinsonii subsp. berkhoffii was amplified from 1/17 (5.8%) control tissues and B. henselae was amplified from 4/29 (13.8%) CCH tissues. The prevalence of B. vinsonii subsp. berkhoffii (P = 0.37) or B. henselae (P = 0.28) did not vary statistically between study groups. B. henselae could be visualized in 2/4 (50.0%) CCH tissues using IIF. Based on this study, Bartonella spp. are unlikely to cause CCH. PMID:25980841

  19. Allelic diversity and population structure in Oenococcus oeni as determined from sequence analysis of housekeeping genes.

    PubMed

    de Las Rivas, Blanca; Marcobal, Angela; Muñoz, Rosario

    2004-12-01

    Oenococcus oeni is the organism of choice for promoting malolactic fermentation in wine. The population biology of O. oeni is poorly understood and remains unclear. For a better understanding of the mode of genetic variation within this species, we investigated by using multilocus sequence typing (MLST) with the gyrB, pgm, ddl, recP, and mleA genes the genetic diversity and genetic relationships among 18 O. oeni strains isolated in various years from wines of the United States, France, Germany, Spain, and Italy. These strains have also been characterized by ribotyping and restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S-23S rRNA gene intergenic spacer region (ISR). Ribotyping grouped the strains into two groups; however, the RFLP analysis of the ISRs showed no differences in the strains analyzed. In contrast, MLST in oenococci had a good discriminatory ability, and we have found a higher genetic diversity than indicated by ribotyping analysis. All sequence types were represented by a single strain, and all the strains could be distinguished from each other because they had unique combinations of alleles. Strains assumed to be identical showed the same sequence type. Phylogenetic analyses indicated a panmictic population structure in O. oeni. Sequences were analyzed for evidence of recombination by split decomposition analysis and analysis of clustered polymorphisms. All results indicated that recombination plays a major role in creating the genetic heterogeneity of O. oeni. A low standardized index of association value indicated that the O. oeni genes analyzed are close to linkage equilibrium. This study constitutes the first step in the development of an MLST method for O. oeni and the first example of the application of MLST to a nonpathogenic food production bacteria. PMID:15574919

  20. Acinetobacter strains IH9 and OCI1, two rhizospheric phosphate solubilizing isolates able to promote plant growth, constitute a new genomovar of Acinetobacter calcoaceticus.

    PubMed

    Peix, Alvaro; Lang, Elke; Verbarg, Susanne; Spröer, Cathrin; Rivas, Raúl; Santa-Regina, Ignacio; Mateos, Pedro F; Martínez-Molina, Eustoquio; Rodríguez-Barrueco, Claudino; Velázquez, Encarna

    2009-08-01

    During a screening of phosphate solubilizing bacteria (PSB) in agricultural soils, two strains, IH9 and OCI1, were isolated from the rhizosphere of grasses in Spain, and they showed a high ability to solubilize phosphate in vitro. Inoculation experiments in chickpea and barley were conducted with both strains and the results demonstrated their ability to promote plant growth. The 16S rRNA gene sequences of these strains were nearly identical to each other and to those of Acinetobacter calcoaceticus DSM 30006(T), as well as the strain CIP 70.29 representing genomospecies 3. Their phenotypic characteristics also coincided with those of strains forming the A. calcoaceticus-baumannii complex. They differed from A. calcoaceticus in the utilization of l-tartrate as a carbon source and from genomospecies 3 in the use of d-asparagine as a carbon source. The 16S-23S intergenic spacer (ITS) sequences of the two isolates showed nearly 98% identities to those of A. calcoaceticus, confirming that they belong to this phylogenetic group. However, the isolates appeared as a separate branch from the A. calcoaceticus sequences, indicating their molecular separation from other A. calcoaceticus strains. The analysis of three housekeeping genes, recA, rpoD and gyrB, confirmed that IH9 and OCI1 form a distinct lineage within A. calcoaceticus. These results were congruent with those from DNA-DNA hybridization, indicating that strains IH9 and OCI1 constitute a new genomovar for which we propose the name A. calcoaceticus genomovar rhizosphaerae.

  1. Recurrent bacteremia caused by the Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

    PubMed

    Lai, Chih-Cheng; Hsu, Han-Lin; Tan, Che-Kim; Tsai, Hsih-Yeh; Cheng, Aristine; Liu, Chia-Ying; Huang, Yu-Tsung; Liao, Chun-Hsing; Sheng, Wang-Huei; Hsueh, Po-Ren

    2012-09-01

    This study investigated the clinical and microbiological characteristics of patients with recurrent bacteremia caused by the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex at a medical center. All ACB complex isolates associated with recurrent bacteremia were identified to the genomic species level using a 16S-23S rRNA gene intergenic spacer sequence-based method. Genotypes were determined by the random amplified polymorphic DNA patterns generated by arbitrarily primed PCR and by pulsotypes generated by pulsed-field gel electrophoresis. Relapse of infection was defined as when the genotype of the recurrent isolate was identical to that of the original infecting strain. Reinfection was defined as when the genospecies or genotype of the recurrent isolate differed from that of the original isolate. From 2006 to 2008, 446 patients had ACB complex bacteremia and 25 (5.6%) had recurrent bacteremia caused by the ACB complex. Among the 25 patients, 12 (48%) had relapse of bacteremia caused by A. nosocomialis (n = 7) or A. baumannii (n = 5). Among the 13 patients with reinfection, 5 (38.5%) had reinfection caused by different genospecies of the ACB complex. Most of the patients were immunocompromised, and most of the infection foci were catheter-related bloodstream infections. The overall in-hospital mortality rate was 33.3%. A. baumannii isolates had lower antimicrobial susceptibility rates than A. nosocomialis and A. pittii isolates. In conclusion, relapse of ACB complex bacteremia can develop in immunocompromised patients, especially those with central venous catheters. Molecular methods to identify the ACB complex to the genospecies level are essential for differentiating between reinfection and relapse of bacteremia caused by the ACB complex.

  2. Identification and methicillin resistance of coagulase-negative staphylococci isolated from nasal cavity of healthy horses.

    PubMed

    Karakulska, Jolanta; Fijałkowski, Karol; Nawrotek, Paweł; Pobucewicz, Anna; Poszumski, Filip; Czernomysy-Furowicz, Danuta

    2012-06-01

    The aim of this study was an analysis of the staphylococcal flora of the nasal cavity of 42 healthy horses from 4 farms, along with species identification of CoNS isolates and determination of resistance to 18 antimicrobial agents, particularly phenotypic and genotypic methicillin resistance. From the 81 swabs, 87 staphylococci were isolated. All isolates possessed the gap gene but the coa gene was not detected in any of these isolates. Using PCR-RFLP of the gap gene, 82.8% of CoNS were identified: S. equorum (14.9%), S. warneri (14.9%), S. sciuri (12.6%), S. vitulinus (12.6%), S. xylosus (11.5%), S. felis (5.7%), S. haemolyticus (3.4%), S. simulans (3.4%), S. capitis (1.1%), S. chromogenes (1.1%), and S. cohnii subsp. urealyticus (1.1%). To our knowledge, this was the first isolation of S. felis from a horse. The species identity of the remaining Staphylococcus spp. isolates (17.2%) could not be determined from the gap gene PCR-RFLP analysis and 16S rRNA gene sequencing data. Based on 16S-23S intergenic transcribed spacer PCR, 11 different ITS-PCR profiles were identified for the 87 analyzed isolates. Results of API Staph were consistent with molecular identification of 17 (19.5%) isolates. Resistance was detected to only 1 or 2 of the 18 antimicrobial agents tested in the 17.2% CoNS isolates, including 6.9% MRCoNS. The mecA gene was detected in each of the 5 (5.7%) phenotypically cefoxitin-resistant isolates and in 12 (13.8%) isolates susceptible to cefoxitin. In total, from 12 horses (28.6%), 17 (19.5%) MRCoNS were isolated. The highest percentage of MRCoNS was noted among S. sciuri isolates (100%). PMID:22752908

  3. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  4. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  5. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  6. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  7. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  8. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  9. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  10. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  11. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  12. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  13. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  14. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  15. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  16. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  17. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  18. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  19. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  20. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  1. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  2. Utility of indels for species-level identification of a biologically complex plant group: a study with intergenic spacer in Citrus.

    PubMed

    Mahadani, Pradosh; Ghosh, Sankar Kumar

    2014-11-01

    The Consortium of Barcode of Life plant working group proposed to use the defined portion of plastid genes rbcL and matK either singly or in combination as the standard DNA barcode for plants. But DNA barcode based identification of biologically complex plant groups are always a challenging task due to the occurrence of natural hybridization. Here, we examined the use of indels polymorphism in trnH-psbA and trnL-trnF sequences for rapid species identification of citrus. DNA from young leaves of selected citrus species were isolated and matK gene (~800 bp) and trnH-psbA spacer (~450 bp) of Chloroplast DNA was amplified for species level identification. The sequences within the group taxa of Citrus were aligned using the ClustalX program. With few obvious misalignments were corrected manually using the similarity criterion. We identified a 54 bp inverted repeat or palindrome sequence (27-80 regions) and 6 multi residues indel coding regions. Large inverted repeats in cpDNA provided authentication at the higher taxonomic levels. These diagnostics indel marker from trnH-psbA were successful in identifying different species (5 out of 7) within the studied Citrus except Citrus limon and Citrus medica. These two closely related species are distinguished through the 6 bp deletion in trnL-trnF. This study demonstrated that the indel polymorphism based approach easily characterizes the Citrus species and the same may be applied in other complex groups. Likewise other indels occurring intergenic spacer of chloroplast regions may be tested for rapid identification of other secondary citrus species.

  3. Utility of the trnH–psbA Intergenic Spacer Region and Its Combinations as Plant DNA Barcodes: A Meta-Analysis

    PubMed Central

    Liu, Rui; Liang, Dong; Li, Huan; Cherny, Stacey S.; Chen, Shilin

    2012-01-01

    Background The trnH–psbA intergenic spacer region has been used in many DNA barcoding studies. However, a comprehensive evaluation with rigorous sequence preprocessing and statistical testing on the utility of trnH–psbA and its combinations as DNA barcodes is lacking. Methodology/Principal Findings Sequences were searched from GenBank for a meta-analysis on the usefulness of trnH–psbA and its combinations as DNA barcodes. After preprocessing, we constructed full and matching data sets that contained 17 983 trnH–psbA sequences and 2190 sets of trnH–psbA, matK, rbcL, and ITS2 sequences from the same sample, repectively. These datasets were used to analyze the ability of trnH–psbA and its combinations to discriminate species by the BLAST and BLAST+P methods. The Fisher's exact test was used to evaluate the significance of performance differences. For the full data set, the identification success rates of trnH–psbA exceeded 70% in 18 families and 12 genera, respectively. For the matching data set, the identification rates of trnH–psbA were significantly higher than those of the other loci in two families and four genera. Similarly, the identification rates of trnH–psbA+ITS2 were significantly higher than those of matK+rbcL in 18 families and 21 genera. Conclusion/Significane This study provides valuable information on the higher utility of trnH–psbA and its combinations. We found that trnH–psbA+ITS2 combination performs better or equally well compared with other combinations in most taxonomic groups investigated. This information will guide the optimal usage of trnH–psbA and its combinations for species identification. PMID:23155412

  4. Exploring the stability of long intergenic non-coding RNA in K562 cells by comparative studies of RNA-Seq datasets

    PubMed Central

    2014-01-01

    Background The stability of long intergenic non-coding RNAs (lincRNAs) that possess tissue/cell-specific expression, might be closely related to their physiological functions. However, the mechanism associated with stability of lincRNA remains elusive. In this study, we try to study the stability of lincRNA in K562 cells, an important model cell, through comparing two K562 transcriptomes which are obtained from ENCODE Consortium and our sequenced RNA-Seq dataset (PH) respectively. Results By lincRNAs analysis pipeline, 1804 high-confidence lincRNAs involving 1564 annotated lincRNAs and 240 putative novel lincRNAs were identified in PH, and 1587 high-confidence lincRNAs including 1429 annotated lincRNAs and 158 putative novel lincRNAs in ENCODE. There are 1009 unique lincRNAs in PH, 792 unique lincRNAs were in ENCODE, and 795 overlapping lincRNAs in both datasets. The analysis of differences in minimum free energy distribution and lincRNA half-life showed that a large proportion of overlapping lincRNAs were more stable than the unique lincRNAs. Most lincRNAs were more unstable than protein-coding RNAs through comparing their minimum free energy. Conclusions Identification of overlapping and unique lincRNAs can be helpful to classify the stability of lincRNAs. Our results suggest that overlapping lincRNAs (relatively stable linRNAs) and unique lincRNAs (relatively unstable lincRNAs) might be involved in different cellular processes. Reviewers This article has been reviewed by Prof. Oliviero Carugo, Dr. Alistair Forrest and Prof. Manju Bansal. PMID:24996425

  5. Sequence analysis of two alleles reveals that intra-and intergenic recombination played a role in the evolution of the radish fertility restorer (Rfo)

    PubMed Central

    2010-01-01

    Background Land plant genomes contain multiple members of a eukaryote-specific gene family encoding proteins with pentatricopeptide repeat (PPR) motifs. Some PPR proteins were shown to participate in post-transcriptional events involved in organellar gene expression, and this type of function is now thought to be their main biological role. Among PPR genes, restorers of fertility (Rf) of cytoplasmic male sterility systems constitute a peculiar subgroup that is thought to evolve in response to the presence of mitochondrial sterility-inducing genes. Rf genes encoding PPR proteins are associated with very close relatives on complex loci. Results We sequenced a non-restoring allele (L7rfo) of the Rfo radish locus whose restoring allele (D81Rfo) was previously described, and compared the two alleles and their PPR genes. We identified a ca 13 kb long fragment, likely originating from another part of the radish genome, inserted into the L7rfo sequence. The L7rfo allele carries two genes (PPR-1 and PPR-2) closely related to the three previously described PPR genes of the restorer D81Rfo allele (PPR-A, PPR-B, and PPR-C). Our results indicate that alleles of the Rfo locus have experienced complex evolutionary events, including recombination and insertion of extra-locus sequences, since they diverged. Our analyses strongly suggest that present coding sequences of Rfo PPR genes result from intragenic recombination. We found that the 10 C-terminal PPR repeats in Rfo PPR gene encoded proteins result from the tandem duplication of a 5 PPR repeat block. Conclusions The Rfo locus appears to experience more complex evolution than its flanking sequences. The Rfo locus and PPR genes therein are likely to evolve as a result of intergenic and intragenic recombination. It is therefore not possible to determine which genes on the two alleles are direct orthologs. Our observations recall some previously reported data on pathogen resistance complex loci. PMID:20178653

  6. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    SciTech Connect

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  7. Trypanosoma cruzi I genotypes in different geographic regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced leader genes✯

    PubMed Central

    Cura, Carolina I.; Mejía-Jaramillo, Ana M.; Duffy, Tomás; Burgos, Juan M.; Rodriguero, Marcela; Cardinal, Marta V.; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M.; Tomasini, Nicolás; Silva, Alex Da; Russomando, Graciela; Cuba Cuba, Cesar A.; Aznar, Christine; Abate, Teresa; Levin, Mariano J.; Osuna, Antonio; Gürtler, Ricardo E.; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G.

    2011-01-01

    The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harboring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia + Tc Id, Tc Ia + Tc Ie and Tc Id + Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time. PMID:20670628

  8. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  9. The nuclear ribosomal DNA intergenic spacer as a target sequence to study intraspecific diversity of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum directly on pinus root systems.

    PubMed

    Guidot, A; Lumini, E; Debaud, J C; Marmeisse, R

    1999-03-01

    Polymorphism of the nuclear ribosomal DNA intergenic spacer (IGS) of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum was studied to evaluate whether this sequence could be used in field studies to estimate the diversity of strains forming mycorrhizas on individual Pinus pinaster root systems. This sequence was amplified by PCR from 125 haploid homokaryotic strains collected in 14 P. pinaster stands along the Atlantic coast of France by using conserved oligonucleotide primers. Restriction enzyme digestion of the amplified 3.4-kbp-long IGS allowed us to characterize 24 alleles whose frequencies differed. Nine of these alleles were found only once, whereas about 60% of the strains contained four of the alleles. Local populations could be almost as diverse as the entire population along a 150-km stretch of coastline that was examined; for example, 13 alleles were found in a single forest stand. The IGS from one strain was partially sequenced, and the sequence data were used to design oligonucleotides which allowed separate PCR amplification of three different segments of the IGS. Most polymorphisms observed among the full-length IGS regions resulted from polymorphisms in an internal ca. 1,500-bp-long sequence characterized by length variations that may have resulted from variable numbers of a T2AG3 motif. This internal polymorphic sequence could not be amplified from the genomes of nine other Hebeloma species. Analysis of this internal sequence amplified from the haploid progenies of 10 fruiting bodies collected in a 70-m2 area resulted in identification of six allelic forms and seven distinct diplotypes out of the 21 possible different combinations. Moreover, optimization of the PCR conditions resulted in amplification of this sequence from more than 80% of the DNA samples extracted from individual H. cylindrosporum infected P. pinaster mycorrhizal root tips, thus demonstrating the usefulness of this sequence for studying the below-ground diversity of

  10. Comparison of soil fungal community structure in different peanut rotation sequences using ribosomal intergenic spacer analysis in relation to aflatoxin-producing fungi.

    PubMed

    Sudini, H; Arias, C R; Liles, M R; Bowen, K L; Huettel, R N

    2011-01-01

    The present study focuses on determining soil fungal community structure in different peanut-cropping sequences by using a high-resolution DNA fingerprinting technique: ribosomal intergenic spacer analysis (RISA). This study was initiated to determine fungal community profiles in four peanut-cropping sequences (continuous peanut, 4 years of continuous bahiagrass followed by peanut, peanut-corn-cotton, and peanut-cotton rotations), with a special focus to evaluate whether the profiles under investigation may have also indicated microbial differences that could affect Aspergillus flavus populations. Results indicated 75% similarities among fungal communities from the same cropping sequences as well as with similar times of sampling. Polymerase chain reaction (PCR)-based detection of A. flavus directly from these soils was carried out using A. flavus-specific primers (FLA1 and FLA2) and also through quantitative estimation on A. flavus and A. parasiticus agar medium. Population levels of A. flavus in soil samples ranged from zero to 1.2 × 10(3) CFU g(-1) of soil (based on culturable methods); however, the fungus was not detected with A. flavus-specific primers. The minimum threshold limit at which these aflatoxin-producing fungi could be detected from the total soil genomic DNA was determined through artificial inoculation of samples with 10-fold increases in concentrations. The results indicated that a minimum population density of 2.6 × 10(6) CFU g(-1) of soil is required for PCR detection in our conditions. These results are useful in further determining the relative population levels of these fungi in peanut soils with other soil fungi. This is a new approach to understanding soil fungal communities and how they might change over time and under different rotation systems.

  11. Trypanosoma cruzi I genotypes in different geographical regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced-leader genes.

    PubMed

    Cura, Carolina I; Mejía-Jaramillo, Ana M; Duffy, Tomás; Burgos, Juan M; Rodriguero, Marcela; Cardinal, Marta V; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M; Tomasini, Nicolás; da Silva, Alexandre; Russomando, Graciela; Cuba, Cesar A Cuba; Aznar, Christine; Abate, Teresa; Levin, Mariano J; Osuna, Antonio; Gürtler, Ricardo E; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G

    2010-12-01

    The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harbouring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia+Tc Id, Tc Ia+Tc Ie and Tc Id+Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time.

  12. Fleas and Flea-Associated Bartonella Species in Dogs and Cats from Peru.

    PubMed

    Rizzo, M F; Billeter, S A; Osikowicz, L; Luna-Caipo, D V; Cáceres, A G; Kosoy, M

    2015-11-01

    In the present study, we investigated 238 fleas collected from cats and dogs in three regions of Peru (Ancash, Cajamarca, and Lima) for the presence of Bartonella DNA. Bartonella spp. were detected by amplification of the citrate synthase gene (16.4%) and the 16S-23S intergenic spacer region (20.6%). Bartonella rochalimae was the most common species detected followed by Bartonella clarridgeiae and Bartonella henselae. Our results demonstrate that dogs and cats in Peru are infested with fleas harboring zoonotic Bartonella spp. and these infected fleas could pose a disease risk for humans.

  13. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  14. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  15. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  16. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  17. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  18. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  19. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  20. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  1. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  2. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  3. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  4. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  5. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  6. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  7. The brome mosaic virus RNA3 intergenic replication enhancer folds to mimic a tRNA TpsiC-stem loop and is modified in vivo.

    PubMed Central

    Baumstark, T; Ahlquist, P

    2001-01-01

    The genome of brome mosaic virus (BMV), a positive-strand RNA virus in the alphavirus-like superfamily, consists of three capped, messenger-sense RNAs. RNA1 and RNA2 encode viral replication proteins 1a and 2a, respectively. RNA3 encodes the 3a movement protein and the coat protein, which are essential for systemic infection in plants but dispensable for RNA3 replication in plants and yeast. A subset of the 250-base intergenic region (IGR), the replication enhancer (RE), contains all cis-acting signals necessary for a crucial, early template selection step, the 1a-dependent recruitment of RNA3 into replication. One of these signals is a motif matching the conserved box B sequence of RNA polymerase III transcripts. Using chemical modification with CMCT, kethoxal, DMS, DEPC, and lead, we probed the structure of the IGR in short, defined transcripts and in full-length RNA3 in vitro, in yeast extracts, and in whole yeast cells. Our results reveal a stable, unbranched secondary structure that is not dependent on the surrounding ORF sequences or on host factors within the cell. Functional 5' and 3' deletions that defined the minimal RE in earlier deletion studies map to the end of a common helical segment. The box B motif is presented as a hairpin loop of 7 nt closed by G:C base pairs in perfect analogy to the TpsiC-stem loop in tRNA(Asp). An adjacent U-rich internal loop, a short helix, and another pyrimidine-rich loop were significantly protected from base modifications. This same arrangement is conserved between BMV and cucumoviruses CMV, TAV, and PSV. In the BMV box B loop sequence, uridines corresponding to tRNA positions T54 and psi55 were found to be modified in yeast and plants to 5mU and pseudouridine. Together with the aminoacylated viral 3'-end, this is thus the second RNA replication signal within BMV where the virus has evolved a tRNA structural mimicry to a degree that renders it a substrate for classical tRNA modification reactions in vivo. PMID:11720293

  8. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity

    PubMed Central

    Böhm, Maria-Elisabeth; Krey, Viktoria M.; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5′ intergenic regions (5′ IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5′ IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5′ untranslated regions (5′ UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5′ UTR in B. cereus INRA C3 showed that the entire 331 bp 5′ UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5′ UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5′ IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5′ UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. Plc

  9. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity.

    PubMed

    Böhm, Maria-Elisabeth; Krey, Viktoria M; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5' intergenic regions (5' IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5' IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5' untranslated regions (5' UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5' UTR in B. cereus INRA C3 showed that the entire 331 bp 5' UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5' UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5' IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5' UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. PlcR binding sites are

  10. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus hbl and nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity.

    PubMed

    Böhm, Maria-Elisabeth; Krey, Viktoria M; Jeßberger, Nadja; Frenzel, Elrike; Scherer, Siegfried

    2016-01-01

    Bacillus cereus is a food contaminant with greatly varying enteropathogenic potential. Almost all known strains harbor the genes for at least one of the three enterotoxins Nhe, Hbl, and CytK. While some strains show no cytotoxicity, others have caused outbreaks, in rare cases even with lethal outcome. The reason for these differences in cytotoxicity is unknown. To gain insight into the origin of enterotoxin expression heterogeneity in different strains, the architecture and role of 5' intergenic regions (5' IGRs) upstream of the nhe and hbl operons was investigated. In silico comparison of 142 strains of all seven phylogenetic groups of B. cereus sensu lato proved the presence of long 5' IGRs upstream of the nheABC and hblCDAB operons, which harbor recognition sites for several transcriptional regulators, including the virulence regulator PlcR, redox regulators ResD and Fnr, the nutrient-sensitive regulator CodY as well as the master regulator for biofilm formation SinR. By determining transcription start sites, unusually long 5' untranslated regions (5' UTRs) upstream of the nhe and hbl start codons were identified, which are not present upstream of cytK-1 and cytK-2. Promoter fusions lacking various parts of the nhe and hbl 5' UTR in B. cereus INRA C3 showed that the entire 331 bp 5' UTR of nhe is necessary for full promoter activity, while the presence of the complete 606 bp hbl 5' UTR lowers promoter activity. Repression was caused by a 268 bp sequence directly upstream of the hbl transcription start. Luciferase activity of reporter strains containing nhe and hbl 5' IGR lux fusions provided evidence that toxin gene transcription is upregulated by the depletion of free amino acids. Electrophoretic mobility shift assays showed that the branched-chain amino acid sensing regulator CodY binds to both nhe and hbl 5' UTR downstream of the promoter, potentially acting as a nutrient-responsive roadblock repressor of toxin gene transcription. PlcR binding sites are

  11. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  12. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  13. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  14. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  15. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  16. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  17. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  18. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  19. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  20. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  1. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  2. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  3. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  4. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  5. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  6. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  7. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  8. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  9. Phylogenetic and biogeographic implications inferred by mitochondrial intergenic region analyses and ITS1-5.8S-ITS2 of the entomopathogenic fungi Beauveria bassiana and B. brongniartii

    PubMed Central

    2010-01-01

    Background The entomopathogenic fungi of the genus Beauveria are cosmopolitan with a variety of different insect hosts. The two most important species, B. bassiana and B. brongniartii, have already been used as biological control agents of pests in agriculture and as models for the study of insect host - pathogen interactions. Mitochondrial (mt) genomes, due to their properties to evolve faster than the nuclear DNA, to contain introns and mobile elements and to exhibit extended polymorphisms, are ideal tools to examine genetic diversity within fungal populations and genetically identify a species or a particular isolate. Moreover, mt intergenic region can provide valuable phylogenetic information to study the biogeography of the fungus. Results The complete mt genomes of B. bassiana (32,263 bp) and B. brongniartii (33,920 bp) were fully analysed. Apart from a typical gene content and organization, the Beauveria mt genomes contained several introns and had longer intergenic regions when compared with their close relatives. The phylogenetic diversity of a population of 84 Beauveria strains -mainly B. bassiana (n = 76) - isolated from temperate, sub-tropical and tropical habitats was examined by analyzing the nucleotide sequences of two mt intergenic regions (atp6-rns and nad3-atp9) and the nuclear ITS1-5.8S-ITS2 domain. Mt sequences allowed better differentiation of strains than the ITS region. Based on mt and the concatenated dataset of all genes, the B. bassiana strains were placed into two main clades: (a) the B. bassiana s. l. and (b) the "pseudobassiana". The combination of molecular phylogeny with criteria of geographic and climatic origin showed for the first time in entomopathogenic fungi, that the B. bassiana s. l. can be subdivided into seven clusters with common climate characteristics. Conclusions This study indicates that mt genomes and in particular intergenic regions provide molecular phylogeny tools that combined with criteria of geographic and

  10. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  11. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  12. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  13. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  14. The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation

    PubMed Central

    Barr, J.N.; Tang, Xiaoling; Hinzman, Edward; Shen, Ruizhong; Wertz, Gail W.

    2008-01-01

    Transcription by the vesicular stomatitis virus (VSV) polymerase has been characterized as obligatorily sequential with transcription of each downstream gene dependant on termination of the gene immediately upstream. In studies described here we investigated the ability of the VSV RNA-dependant RNA polymerase (RdRp) to access mRNA initiation sites located at increasing distances either downstream or upstream of a transcription termination signal. Bicistronic subgenomic replicons were constructed containing progressively extended intergenic regions preceding the initiation site of a downstream gene. The ability of the RdRp to access the downstream sites was progressively reduced as the length of the intergenic region increased. Alternatively, bicistronic replicons were constructed containing a mRNA start signal located at increasing distances upstream of a termination site. Analysis of transcription of these "overlapped" genes showed that for an upstream mRNA start site to be recognized it had to contain not only the canonical 3'-UUGUCnnUAG-5' gene start signal, but that signal needed also to be preceded by a U7 tract. Access of these upstream mRNA initiation sites by the VSV RdRp was proportionately reduced with increasing distance between the termination site and the overlapped initiation signal. Possible mechanisms for how the RdRp accesses these upstream start sites are discussed. PMID:18241907

  15. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  16. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  17. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  18. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  19. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  20. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  1. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  2. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  3. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  4. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  5. Phylogenetic analysis based evolutionary study of 16S rRNA in known Pseudomonas sp

    PubMed Central

    Adhikari, Arindam; Nandi, Suvodip; Bhattacharya, Indrabrata; Roy, Mithu De; Mandal, Tanusri; Dutta, Subrata

    2015-01-01

    Molecular evolution analysis of 16S rRNA sequences of native Pseudomonas strains and different fluorescent pseudomonads were conducted on the basis of Molecular Evolutionary Genetics Analysis version 5.2 (MEGA5.2). Topological evaluations show common origin for native strains with other known strains with available sequences at GenBank database. Phylogenetic affiliation of different Pseudomonas sp based on 16S rRNA gene shows that molecular divergence contributes to the genetic diversity of Pseudomonas sp. Result indicate direct dynamic interactions with the rhizospheric pathogenic microbial community. The selection pressure acting on 16S rRNA gene was related to the nucleotide diversity of Pseudomonas sp in soil rhizosphere community among different agricultural crops. Besides, nucleotide diversity among the whole population was very low and tajima test statistic value (D) was also slightly positive (Tajima׳s test statistics D value 0.351). This data indicated increasing trends of infection of soil-borne pathogens under gangetic-alluvial regions of West Bengal due to high degree of nucleotide diversity with decreased population of plant growth promoting rhizobacteria like fluorescent Pseudomonads in soil. PMID:26664032

  6. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  7. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  8. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  9. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  10. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  11. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  12. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  13. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  14. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  15. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  16. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  17. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  18. Detection of Vibrio splendidus and related species in Chamelea gallina sampled in the Adriatic along the Abruzzi coastline.

    PubMed

    Torresi, Marina; Acciari, Vicdalia A; Piano, Annamaria; Serratore, Patrizia; Prencipe, Vincenza; Migliorati, Giacomo

    2011-01-01

    Vibrio species are an important and widespread component of marine microbial communities. Some Vibrio strains are potentially pathogenic to marine vertebrates and invertebrates. The aim of this study was to identify vibrios, in particular Vibrio splendidus and related species, isolated from clams (Chamelea gallina) collected along the coasts of the Abruzzi region from May to October 2007. The isolates obtained were phenotyped and classified as belonging to the genus Vibrio. The strains underwent biochemical testing in accordance with Alsina's scheme for V. splendidus identification. Molecular analysis of the 16S-23S intergenic space region and recA gene was used to identify V. splendidus and related species. All the samples examined were found to contain halophylic Vibrio species, with V. alginolyticus, V. splendidus-related species and V. mediterranei most commonly found. A polymerase chain reaction of the 16S-23S intergenic space region and sequencing of the recA gene from isolates confirmed that phenotyping of Vibrio species is not sufficient to distinguish between different species. Differentiation of the highly related species among V. splendidus-related clusters remains an important issue. In this regard, our data suggests sequencing the recA genes was far more discriminatory than sequencing 16S rDNA for this purpose.

  19. Design and Experimental Application of a Novel Non-Degenerate Universal Primer Set that Amplifies Prokaryotic 16S rRNA Genes with a Low Possibility to Amplify Eukaryotic rRNA Genes

    PubMed Central

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities. PMID:24277737

  20. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    PubMed

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  1. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  2. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  3. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  4. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.

    PubMed

    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon

    2014-09-01

    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  5. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  6. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  7. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    PubMed

    Zhang, Chenyu; Kuspa, Adam

    2009-01-01

    Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA) is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial protein synthesis in D

  8. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  9. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  10. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated.

  11. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys.

    PubMed

    Nelson, Michael C; Morrison, Hilary G; Benjamino, Jacquelynn; Grim, Sharon L; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  12. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  13. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  14. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  15. Phylogeny of the Centrohelida inferred from SSU rRNA, tubulins, and actin genes.

    PubMed

    Sakaguchi, Miako; Nakayama, Takeshi; Hashimoto, Tetsuo; Inouye, Isao

    2005-12-01

    Amoeboid protists are major targets of recent molecular phylogeny in connection with reconstruction of global phylogeny of eukaryotes as well as the search for the root of eukaryotes. The Centrohelida are one of the major groups of Heliozoa, classified in the Actinopodida, whose evolutionary position is not well understood. To clarify the relationships between the Centrohelida and other eukaryotes, we sequenced SSU rRNA, alpha-tubulin, and beta-tubulin genes from a centroheliozoan protist, Raphidiophrys contractilis. The SSU rRNA phylogeny showed that the Centrohelida are not closely related to other heliozoan groups, Actinophryida, Desmothoracida, or Taxopodida. Maximum likelihood analyses of the combined phylogeny using a concatenate model for an alpha- + beta-tubulin + actin data set, and a separate model for SSU rRNA, alpha- and beta-tubulin, and actin gene data sets revealed the best tree, in which the Centrohelida have a closer relationship to Rhodophyta than to other major eukaryotic groups. However, both weighted Shimodaira-Hasegawa and approximately unbiased tests for the concatenate protein phylogeny did not reject alternative trees in which Centrohelida were constrained to be sisters to the Amoebozoa. Moreover, alternative trees in which Centrohelida were placed at the node branching before and after Amoebozoa or Viridiplantae were not rejected by the WSH tests. These results narrowed the possibilities for the position of Centrohelida to a sister to the Rhodophyta, to the Amoebozoa, or to an independent branch between the branchings of Amoebozoa and Rhodophyta (or possibly Plantae) at the basal position within the bikonts clade in the eukaryotic tree.

  16. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  17. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  18. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  19. Evolutionary diversity of eukaryotic small-subunit rRNA genes.

    PubMed

    Sogin, M L; Elwood, H J; Gunderson, J H

    1986-03-01

    The small-subunit rRNA gene sequences of the flagellated protists Euglena gracilis and Trypanosoma brucei were determined and compared to those of other eukaryotes. A phylogenetic tree was constructed in which the earliest branching among the eukaryotes is represented by E. gracilis. The E. gracilis divergence far antedates a period of massive evolutionary radiation that gave rise to the plants, animals, fungi, and certain groups of protists such as ciliates and the acanthamoebae. The genetic diversity in this collection of eukaryotes is seen to exceed that displayed within either the eubacterial or the archaebacterial lines of descent.

  20. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    PubMed

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  1. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

    PubMed Central

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

    2013-01-01

    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  2. Coyotes (Canis latrans) as the Reservoir for a Human Pathogenic Bartonella sp.: Molecular Epidemiology of Bartonella vinsonii subsp. berkhoffii Infection in Coyotes from Central Coastal California

    PubMed Central

    Chang, Chao-Chin; Kasten, Rickie W.; Chomel, Bruno B.; Simpson, Darren C.; Hew, Carrie M.; Kordick, Dorsey L.; Heller, Remy; Piemont, Yves; Breitschwerdt, Edward B.

    2000-01-01

    Bartonella vinsonii subsp. berkhoffii was originally isolated from a dog suffering infectious endocarditis and was recently identified as a zoonotic agent causing human endocarditis. Following the coyote bite of a child who developed clinical signs compatible with Bartonella infection in Santa Clara County, Calif., this epidemiological study was conducted. Among 109 coyotes (Canis latrans) from central coastal California, 31 animals (28%) were found to be bacteremic with B. vinsonii subsp. berkhoffii and 83 animals (76%) had B. vinsonii subsp. berkhoffii antibodies. These findings suggest these animals could be the wildlife reservoir of B. vinsonii subsp. berkhoffii. PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the gltA and 16S rRNA genes for these 31 isolates yielded similar profiles that were identical to those of B. vinsonii subsp. berkhoffii. Partial sequencing of the gltA and 16S rRNA genes, respectively, indicated 99.5 and 100% homology between the coyote isolate and B. vinsonii subsp. berkhoffii (ATCC 51672). PCR-RFLP analysis of the 16S-23S intergenic spacer region showed the existence of two different strain profiles, as has been reported in dogs. Six (19%) of 31 Bartonella bacteremic coyotes exhibited the strain profile that was identified in the type strain of a canine endocarditis case (B. vinsonii subsp. berkhoffii ATCC 51672). The other 25 bacteremic coyotes were infected with a strain that was similar to the strains isolated from healthy dogs. Based on whole bacterial genome analysis by pulsed-field gel electrophoresis (PFGE) with SmaI restriction endonuclease, there was more diversity in fingerprints for the coyote isolates, which had at least 10 major variants compared to the two variants described for domestic dog isolates from the eastern United States. By PFGE analysis, three Bartonella bacteremic coyotes were infected by a strain identical to the one isolated from three healthy dog carriers. Further studies are necessary

  3. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  4. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation

    PubMed Central

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Stier, Gunter; Clark, Sarah A.; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David

    2014-01-01

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a “distribution box,” transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation. PMID:25404745

  5. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  6. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  7. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  8. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  9. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation.

    PubMed

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Lee, Woonghee; Stier, Gunter; Clark, Sarah A; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David; Barbar, Elisar; Sinning, Irmi; Hurt, Ed

    2014-11-24

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a "distribution box," transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation.

  10. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  11. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    PubMed

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  12. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2013-03-15

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a completely complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, Escherichia coli16S rRNA was detected in real time with the detection limit of ~0.17 nM. The high specificity of the analysis was proven by differentiating Bacillus subtilis from E. coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds.

  13. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  14. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.

    2001-01-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  15. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  16. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  17. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  18. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  19. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  20. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    PubMed

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  1. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  2. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  3. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  4. Identification of aquatic Burkholderia (Pseudomonas) cepacia by hybridization with species-specific rRNA gene probes

    SciTech Connect

    Leff, L.G.; Kernan, R.M.; McArthur, J.V.

    1995-04-01

    Burkholderia (Pseudomonas) cepacia is a common environmental bacterium which can be pathogenic for plants and humans. In this study, four strategies were used to identify aquatic isolates: API test strips, hybridization with species-specific DNA probes for the 16S and 23S rRNA genes, fatty acid methyl ester (FAME) profiles, and growth on selective medium (TB-T agar [C. Hagedorn, W.D. Gould, T.R. Bardinelli, and D.R. Gustarson, Appl. Environ. Microbiol. 53:2265-2268, 1987]). Only 59% of the isolates identified as B. cepacia with the API test strips were confirmed as B. cepacia by using fatty acids profiles. The 23S rRNA probe generated a few false-positive results but dramatically underestimated the number of B. cepacia isolates (i.e., 40% of the colonies that did not hybridize to the probe were B. cepacia, as determined by FAME). The 16S rRNA probe generated more false-positive results than the 23S rRNA probe but was effective in identifying the majority of the B. cepacia isolates. The selective medium was only partially successful in recovering B. cepacia. Use of the B. cepacia-specific 16S rRNA probe was the most efficient and accurate way of identifying B. cepacia. 13 refs., 1 fig., 2 tabs.

  5. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  6. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  7. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes.

  8. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-10-11

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years.

  9. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  10. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  11. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  12. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta.

    PubMed

    Mackey, L Y; Winnepenninckx, B; De Wachter, R; Backeljau, T; Emschermann, P; Garey, J R

    1996-05-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

  13. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  14. Virtual metagenome reconstruction from 16S rRNA gene sequences.

    PubMed

    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao

    2012-01-01

    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  15. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.

    PubMed

    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J

    2000-09-01

    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  16. Origin of the Mesozoa inferred from 18S rRNA gene sequences.

    PubMed

    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L

    1996-10-01

    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  17. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded.

  18. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  19. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  20. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  1. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    PubMed

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  2. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  3. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  4. Ribosome biogenesis requires a highly diverged XRN family 5'->3' exoribonuclease for rRNA processing in Trypanosoma brucei.

    PubMed

    Sakyiama, Joseph; Zimmer, Sara L; Ciganda, Martin; Williams, Noreen; Read, Laurie K

    2013-10-01

    Although biogenesis of ribosomes is a crucial process in all organisms and is thus well conserved, Trypanosoma brucei ribosome biogenesis, of which maturation of rRNAs is an early step, has multiple points of divergence. Our aim was to determine whether in the processing of the pre-rRNA precursor molecule, 5'→3' exoribonuclease activity in addition to endonucleolytic cleavage is necessary in T. brucei as in other organisms. Our approach initiated with the bioinformatic identification of a putative 5'→3' exoribonuclease, XRNE, which is highly diverged from the XRN2/Rat1 enzyme responsible for rRNA processing in other organisms. Tagging this protein in vivo allowed us to classify XRNE as nucleolar by indirect immunofluorescence and identify by copurification interacting proteins, many of which were ribosomal proteins, ribosome biogenesis proteins, and/or RNA processing proteins. To determine whether XRNE plays a role in ribosome biogenesis in procyclic form cells, we inducibly depleted the protein by RNA interference. This resulted in the generation of aberrant preprocessed 18S rRNA and 5' extended 5.8S rRNA, implicating XRNE in rRNA processing. Polysome profiles of XRNE-depleted cells demonstrated abnormal features including an increase in ribosome small subunit abundance, a decrease in large subunit abundance, and defects in polysome assembly. Furthermore, the 5' extended 5.8S rRNA in XRNE-depleted cells was observed in the large subunit, monosomes, and polysomes in this gradient. Therefore, the function of XRNE in rRNA processing, presumably due to exonucleolytic activity very early in ribosome biogenesis, has consequences that persist throughout all biogenesis stages.

  5. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    PubMed

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  6. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  7. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  8. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  9. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  10. Bead Array Direct rRNA Capture Assay (rCapA) for Amplification Free Speciation of Mycobacterium Cultures

    PubMed Central

    de Ronde, Hans; González Alonso, Paula; van Soolingen, Dick; Klatser, Paul R.; Anthony, Richard M.

    2012-01-01

    Mycobacterium cultures, from patients suspected of tuberculosis or nontuberculous mycobacteria (NTM) infection, need to be identified. It is most critical to identify cultures belonging to the Mycobacterium tuberculosis complex, but also important to recognize clinically irrelevant or important NTM to allow appropriate patient management. Identification of M. tuberculosis can be achieved by a simple and cheap lateral flow assay, but identification of other Mycobacterium spp. generally requires more complex molecular methods. Here we demonstrate that a paramagnetic liquid bead array method can be used to capture mycobacterial rRNA in crude lysates of positive cultures and use a robust reader to identify the species in a direct and sensitive manner. We developed an array composed of paramagnetic beads coupled to oligonucleotides to capture 16 rRNA from eight specific Mycobacterium species and a single secondary biotinilated reporter probe to allow the captured rRNA to be detected. A ninth less specific bead and its associated reporter probe, designed to capture 23S rRNA from mycobacteria and related genera, is included as an internal control to confirm the presence of bacterial rRNA from a GC rich Gram variable genera. Using this rRNA capture assay (rCapA) with the array developed we were already able to confirm the presence of members of the M. tuberculosis complex and to discriminate a range of NTM species. This approach is not based on DNA amplification and therefore does not require precautions to avoid amplicon contamination. Moreover, the new generation of stable and cost effective liquid bead readers provides the necessary multiplexing potential to develop a robust and highly discriminatory assay. PMID:22396779

  11. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  12. Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

    PubMed

    Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

    2013-07-01

    Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei.

  13. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    PubMed

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  14. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  15. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.

    PubMed

    Parker, A; Kornfield, I

    1996-08-01

    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  16. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    PubMed Central

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  17. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.

    PubMed

    Weller, R; Ward, D M

    1989-07-01

    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  18. Complete genome sequence of Microbacterium sp. CGR1, bacterium tolerant to wide abiotic conditions isolated from the Atacama Desert.

    PubMed

    Mandakovic, Dinka; Cabrera, Pablo; Pulgar, Rodrigo; Maldonado, Jonathan; Aravena, Pamela; Latorre, Mauricio; Cambiazo, Verónica; González, Mauricio

    2015-12-20

    Microbacterium sp. CGR1 (RGM2230) is an isolate from the Atacama Desert that displays a wide pH, salinity and temperature tolerance. This strain exhibits riboflavin overproducer features and traits for developing an environmental arsenic biosensor. Here, we report the complete genome sequence of this strain, which represents the first genome of the genus Microbacterium sequenced and assembled in a single contig. The genome contains 3,634,864bp, 3299 protein-coding genes, 45 tRNAs, six copies of 5S-16S-23S rRNA and a high genome average GC-content of 68.04%.

  19. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  20. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  1. Uracil content of 16S rRNA of thermophilic and psychrophilic prokaryotes correlates inversely with their optimal growth temperatures

    PubMed Central

    Khachane, Amit N.; Timmis, Kenneth N.; dos Santos, Vítor A. P. Martins

    2005-01-01

    We report here the finding of a highly significant inverse correlation of the uracil content of 16S rRNA and the optimum growth temperature (Topt) of cultured thermophilic and psychrophilic prokaryotes. This correlation was significantly different from the weaker correlations between the contents of other nucleotides and Topt. Analysis of the 16S rRNA secondary structure regions revealed a fall in the A:U base-pair content in step with the increase in Topt that was much steeper than that of mismatched base-pairs, which are thermodynamically less stable. These findings indicate that the 16S rRNA sequences of thermophiles and psychrophiles are under a strong thermo-adaptive pressure, and that structure–function constraints play a crucial role in determining their 16S rRNA nucleotide composition. The derived relationship between uracil content and Topt was used to develop an algorithm to predict the Topt values of uncultured prokaryotes lacking cultured close relatives and belonging to the phyla predominantly containing thermophiles. This algorithm may be useful in guiding the design of cultivation conditions for hitherto uncultured microbes. PMID:16030352

  2. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  3. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    PubMed Central

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  4. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  5. Distinct Ectomycorrhizospheres Share Similar Bacterial Communities as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes

    PubMed Central

    Oger, P.; Morin, E.; Frey-Klett, P.

    2012-01-01

    Analysis of the 16S rRNA gene sequences generated from Xerocomus pruinatus and Scleroderma citrinum ectomycorrhizospheres revealed that similar bacterial communities inhabited the two ectomycorrhizospheres in terms of phyla and genera, with an enrichment of the Burkholderia genus. Compared to the bulk soil habitat, ectomycorrhizospheres hosted significantly more Alpha-, Beta-, and Gammaproteobacteria. PMID:22307291

  6. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  7. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  8. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    PubMed Central

    Pettersson, B; Johansson, K E; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing was performed in both directions. One previously unclassified avian mycoplasma was found to belong to the Mycoplasma lipophilum cluster of the hominis group. Microheterogeneities were discovered in the rRNA operons of Mycoplasma mycoides subsp. mycoides (SC type), confirming the existence of two different rRNA operons. The 16S rRNA sequence of M. mycoides subsp. capri was identical to that of M. mycoides subsp. mycoides (type SC), except that no microheterogeneities were revealed. Furthermore, automated solid-phase DNA sequencing was used to identify a mycoplasmal contamination of a cell culture as Mycoplasma hyorhinis, which proved to be very difficult by conventional methods. The results suggest that the direct solid-phase DNA sequencing procedure is a powerful tool for identification of mycoplasmas and is also useful in taxonomic studies. Images PMID:7521158

  9. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A.

    PubMed

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-06-05

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation.

  10. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  11. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila

    SciTech Connect

    Butler, D.K.; Yasuda, L.E.; Yao, Meng-Chao

    1995-12-01

    This report discusses the formation of rRNA gene palindrome in Tetrahymena thermophila and the involvement of intramolecular recombination. This, along with the authors` previous study, is the first to define a molecular pathway of palindrome formation. 48 refs., 6 figs.

  12. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  13. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    PubMed

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  14. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    PubMed

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs o