Science.gov

Sample records for 16s-23s rrna internal

  1. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    NASA Astrophysics Data System (ADS)

    Okamura, K.; Hisada, T.; Takata, K.; Hiraishi, A.

    2013-04-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  2. Variations in the 16S-23S rRNA internal transcribed spacer of fibrolytic Butyrivibrio isolates from the reindeer rumen.

    PubMed

    Præsteng, Kirsti E; Mackie, Roderick I; Cann, Isaac K O; Mathiesen, Svein D; Sundset, Monica A

    2011-07-01

    Strains of Butyrivibrio are principal cellulytic bacteria in the rumen of the High Arctic Svalbard reindeer ( Rangifer tarandus platyrhynchus ). According to phylogenetic analysis based on 16S rRNA gene sequencing, Butyrivibrio can be divided into three subgroups within the Clostridia class of the phylum Firmicutes, but the current phenotypic and genotypic differentiation within the family Lachnospiraceae is insufficient. This current study describes the sequence diversity of the 16S-23S rRNA intergenic transcribed spacer (ITS) region of Butyrivibrio isolates from reindeer. A total of 17 different ITS sequences with sizes between 449 and 784 nt were obtained. Genes encoding tRNA(Ile) and tRNA(Ala) were identified in four of the sequences. Phylogenetic neighbor-joining trees were constructed based on the ITS sequence and compared with a phylogenetic neighbor-joining tree based on 16S rRNA gene sequences previously obtained for the same isolates. These comparisons indicated a better differentiation between strains in the ITS sequence than the 16S rRNA gene based tree. Through this study, a better means for identifying and tracking fibrolytic and potentially probiotic Butyrivibrio strains in reindeer and other ruminants has been provided.

  3. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  4. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  5. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  6. Cyanobacterial Ecotypes in Different Optical Microenvironments of a 68°C Hot Spring Mat Community Revealed by 16S-23S rRNA Internal Transcribed Spacer Region Variation†

    PubMed Central

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea; Ward, David M.

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynthesis demonstrated the existence of physiologically distinct Synechococcus populations at different depths along a light gradient quantified by scalar irradiance microprobes. Molecular methods were used to evaluate whether physiologically distinct populations could be correlated with genetically distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S rRNA genes suggested the existence of closely related but genetically distinct populations corresponding to different functional populations occurring at different depths. PMID:12732563

  7. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.

    1999-01-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  8. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis. PMID:27546720

  9. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  10. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  11. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.

    PubMed

    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik

    2013-02-01

    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  12. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.

    PubMed

    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P

    2013-01-01

    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology.

  13. Phylogeny of bradyrhizobia from Chinese cowpea miscellany inferred from 16S rRNA, atpD, glnII, and 16S-23S intergenic spacer sequences.

    PubMed

    Zhang, Sufang; Xie, Fuli; Yang, Jiangke; Li, Youguo

    2011-04-01

    The cowpea (Vigna unguiculata L.), peanut (Arachis hypogaea L.), and mung bean (Vigna radiata L.) belong to a group of plants known as the "cowpea miscellany" plants, which are widely cultivated throughout the tropic and subtropical zones of Africa and Asia. However, the phylogeny of the rhizobial strains that nodulate these plants is poorly understood. Previous studies have isolated a diversity of rhizobial strains from cowpea miscellany hosts and have suggested that, phylogenetically, they are from different species. In this work, the phylogeny of 42 slow-growing rhizobial strains, isolated from root nodules of cowpea, peanut, and mung bean from different geographical regions of China, was investigated using sequences from the 16S rRNA, atpD and glnII genes, and the 16S-23S rRNA intergenic spacer. The indigenous rhizobial strains from the cowpea miscellany could all be placed in the genus Bradyrhizobium , and Bradyrhizobium liaoningense and Bradyrhizobium yuanmingense were the main species. Phylogenies derived from housekeeping genes were consistent with phylogenies generated from the ribosomal gene. Mung bean rhizobia clustered only into B. liaoningense and B. yuanmingense and were phylogenetically less diverse than cowpea and peanut rhizobia. Geographical origin was significantly reflected in the phylogeny of mung bean rhizobia. Most cowpea rhizobia were more closely related to the 3 major groups B. liaoningense, B. yuanmingense, and Bradyrhizobium elkanii than to the minor groups Bradyrhizobium japonicum or Bradyrhizobium canariense . However, most peanut rhizobia were more closely related to the 2 major groups B. liaoningense and B. yuanmingense than to the minor group B. elkanii.

  14. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    PubMed

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  15. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.

    PubMed

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-08-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  16. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  17. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.

    1999-01-01

    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  18. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    PubMed

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  19. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing.

  20. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  1. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  2. Genotypic Characterization of Bradyrhizobium Strains Nodulating Small Senegalese Legumes by 16S-23S rRNA Intergenic Gene Spacers and Amplified Fragment Length Polymorphism Fingerprint Analyses

    PubMed Central

    Doignon-Bourcier, Florence; Willems, Anne; Coopman, Renata; Laguerre, Gisele; Gillis, Monique; de Lajudie, Philippe

    2000-01-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations. PMID:10966419

  3. Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length polymorphism fingerprint analyses.

    PubMed

    Doignon-Bourcier, F; Willems, A; Coopman, R; Laguerre, G; Gillis, M; de Lajudie, P

    2000-09-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations.

  4. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S-23S Spacer rRNA Genes

    PubMed Central

    Madico, Guillermo; Quinn, Thomas C.; Boman, Jens; Gaydos, Charlotte A.

    2000-01-01

    Three touchdown enzyme time release (TETR)-PCR assays were used to amplify different DNA sequences in the variable regions of the 16S and 16S-23S spacer rRNA genes specific for Chlamydia trachomatis, Chlamydia pneumoniae, and Chlamydia psittaci as improved tests for sensitive diagnosis and rapid species differentiation. The TETR-PCR protocol used 60 cycles of amplification, which provided improved analytical sensitivity (0.004 to 0.063 inclusion-forming unit of Chlamydia species per PCR). The sensitivity of TETR-PCR with primer set CTR 70-CTR 71 was 96.7%, and the specificity was 99.6%, compared to those of the AMPLICOR PCR for the detection of C. trachomatis in vaginal swab samples. TETR-PCR for C. pneumoniae with primer set CPN 90-CPN 91 was 90% sensitive and 93.3% specific compared with a nested PCR with primer set CP1/2-CPC/D for clinical respiratory samples. TETR-PCR for C. psittaci with primer set CPS 100-CPS 101 showed substantial agreement with cell culturing (κ, 0.78) for animal tissue samples. Primer sets were then combined into a single multiplex TETR-PCR test. The respective 315-, 195-, and 111-bp DNA target products were precisely amplified when DNA from each of the respective Chlamydia species or combinations of them was used. Multiplex chlamydia TETR-PCR correctly identified one strain of each of the 15 serovars of C. trachomatis, 22 isolates of C. pneumoniae, and 20 isolates of C. psittaci. The primer sets were specific for each species. No target products were amplified when DNA from C. pecorum or a variety of other microorganisms was tested for specificity. TETR-PCR with primers selected for specific sequences in the 16S and 16S-23S spacer rRNA genes is a valuable test that could be used either with individual primers or in a multiplex assay for the identification and differentiation of Chlamydia species from culture isolates or for the detection of chlamydiae in clinical samples. PMID:10699002

  5. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.

    PubMed

    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain

    2005-04-01

    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  6. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    PubMed Central

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  7. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    PubMed

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here.

  8. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  9. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  10. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  11. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  12. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.

    PubMed

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  13. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    PubMed

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  14. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    PubMed

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  15. Use of denaturing gradient gel electrophoresis to detect mutation in VS2 of the 16S-23S rDNA spacer amplified from Staphylococcus aureus isolates.

    PubMed

    Gürtler, V; Barrie, H D; Mayall, B C

    2001-06-01

    To develop a double gradient denaturing gradient gel electrophoresis (DG-DGGE) based typing method that rapidly and accurately types clinical isolates of Staphylococcus aureus, the VS2 region of the 16S-23S rRNA spacer region (ISR) was chosen because of its potential high variation. The VS2 region was amplified with a 40-mer GC-clamp attached to the 5'-end of the reverse primer. The 145 bp PCR product was then separated by DG-DGGE using denaturant concentrations of 25-40% and polyacrylamide concentrations of 6-12%. Of the five mutations identified in 336 S. aureus isolates, one mutation was found to be highly specific for 161/171 (94%) of methicillin-resistant S. aureus (MRSA) isolates from different geographic locations and isolation times. This same mutation was found in 15/160 (9%) of penicillin- or methicillin-sensitive S. aureus isolates. In some isolates two mutations occured together in the one genome suggesting some S. aureus isolates have two copies of VS2. In these 336 isolates nine genotypes with different combinations of the five mutations were identified. In 18 coagulase-negative staphylococci (CNS), the MRSA-specific mutation was found along with two other mutations in all isolates demonstrating consistent differences in the presence of these mutations between CNS and S. aureus. The marked differences in VS2 sequences found between MRSA, methicillin- or penicillin-sensitive S. aureus (SSA), and CNS by DGGE in the present study may be useful in evolutionary studies and in the development of a specific assay for MRSA from clinical specimens.

  16. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    PubMed

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  17. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    PubMed Central

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated allowed the soft rot erwinias to be differentiated from all other Erwinia and non-Erwinia species and placed into one of three groups (I to III). Group I comprised all Erwinia carotovora subsp. atroseptica and subsp. betavasculorum isolates. Group II comprised all E. carotovora subsp. carotovora, subsp. odorifera, and subsp. wasabiae and E. cacticida isolates, and group III comprised all E. chrysanthemi isolates. To increase the level of discrimination further, the ITS-PCR products were digested with one of two restriction enzymes. Digestion with CfoI identified E. carotovora subsp. atroseptica and subsp. betavasculorum (group I) and E. chrysanthemi (group III) isolates, while digestion with RsaI identified E. carotovora subsp. wasabiae, subsp. carotovora, and subsp. odorifera/carotovora and E. cacticida isolates (group II). In the latter case, it was necessary to distinguish E. carotovora subsp. odorifera and subsp. carotovora using the α-methyl glucoside test. Sixty suspected soft rot erwinia isolates from Australia were identified as E. carotovora subsp. atroseptica, E. chrysanthemi, E. carotovora subsp. carotovora, and non-soft rot species. Ten “atypical” E. carotovora subsp. atroseptica isolates were identified as E. carotovora subsp. atroseptica, subsp. carotovora, and subsp. betavasculorum and non-soft rot species, and two “atypical” E. carotovora subsp. carotovora isolates were identified as E. carotovora subsp. carotovora and subsp. atroseptica. PMID:11526007

  18. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.

    PubMed

    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C

    1999-07-01

    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  19. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  20. Characterization of the Lancefield group C streptococcus 16S-23S RNA gene intergenic spacer and its potential for identification and sub-specific typing.

    PubMed Central

    Chanter, N.; Collin, N.; Holmes, N.; Binns, M.; Mumford, J.

    1997-01-01

    The 16S-23S RNA gene intergenic spacers of isolates of Streptococcus equi (n = 5), S. zooepidemicus (n = 5), S. equisimilis (n = 3) and S. dysgalactiae (n = 2) were sequenced and compared. There were distinct regions within the spacer, arranged in the order 1-9 for all S. equi and one S. zooepidemicus isolate and 1,2 and 4-9 for the remaining isolates. Region 4 was identical to the tRNA(ala) gene found in the 16S-23S intergenic spacers of other streptococci. Regions 1, 5, 6 and 7 had distinct variations, each conserved in different isolates. However, amongst the intergenic spacers there were different combinations of variant regions, suggesting a role for DNA recombination in their evolution. The intergenic spacer of all isolates of S. equi and one S. zooepidemicus isolate were almost identical. Primers derived from the variant sequences of regions 1 and 5 to 6 were used to group all S. zooepidemicus (n = 17) and S. equi (n = 5) into 1 of 8 types by polymerase chain reaction; three S. zooepidemicus isolates typed the same as S. equi. S. equi and S. zooepidemicus were clearly distinguishable from S. equisimilis and S. dysgalactiae which had shorter regions 5 and 6 and no region 7. Most homology for the group C sequences was found in previously published sequences for the 16S-23S intergenic spacers of S. anginosis, S. constellatus, S. intermedius, S. salivarius and S. agalactiae. A 75-90 nucleotide length shared with S. anginosus and S. intermedius in opposite orientations in the two main variants of region 6 supported the role for DNA recombination in the evolution of the spacer. The 16S-23S intergenic spacers indicate that S. zooepidemicus was the archetypal species for S. equi and that both are genetically more distant from S. equisimilis and S. dysgalactiae. The intergenic spacer can be used to identify specifically the group C streptococci and as an epidemiological marker for S. zooepidemicus. PMID:9129589

  1. DNA fingerprinting of Paenibacillus popilliae and Paenibacillus lentimorbus using PCR-amplified 16S-23S rDNA intergenic transcribed spacer (ITS) regions.

    PubMed

    Dingman, Douglas W

    2009-01-01

    Failure to identify correctly the milky disease bacteria, Paenibacillus popilliae and Paenibacillus lentimorbus, has resulted in published research errors and commercial production problems. A DNA fingerprinting procedure, using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS) regions, has been shown to easily and accurately identify isolates of milky disease bacteria. Using 34 P. popilliae and 15 P. lentimorbus strains, PCR amplification of different ITS regions produced three DNA fingerprints. For P. lentimorbus phylogenic group 2 strains and for all P. popilliae strains tested, electrophoresis of amplified DNA produced a migratory pattern (i.e., ITS-PCR fingerprint) exhibiting three DNA bands. P. lentimorbus group 1 strains also produced this ITS-PCR fingerprint. However, the fingerprint was phase-shifted toward larger DNA sizes. Alignment of the respective P. popilliae and P. lentimorbus group 1 ITS DNA sequences showed extensive homology, except for a 108bp insert in all P. lentimorbus ITS regions. This insert occurred at the same location relative to the 23S rDNA and accounted for the phase-shift difference in P. lentimorbus group 1 DNA fingerprints. At present, there is no explanation for this 108bp insert. The third ITS-PCR fingerprint, produced by P. lentimorbus group 3 strains, exhibited approximately eight DNA bands. Comparison of the three fingerprints of milky disease bacteria to the ITS-PCR fingerprints of other Paenibacillus species demonstrated uniqueness. ITS-PCR fingerprinting successfully identified eight unknown isolates as milky disease bacteria. Therefore, this procedure can serve as a standard protocol to identify P. popilliae and P. lentimorbus.

  2. Phylogenetic analysis of vertically transmitted psyllid endosymbionts (Candidatus Carsonella ruddii) based on atpAGD and rpoC: comparisons with 16S-23S rDNA-derived phylogeny.

    PubMed

    Thao, M L; Clark, M A; Burckhardt, D H; Moran, N A; Baumann, P

    2001-06-01

    Psyllids are insects that harbor endosymbionts (Candidatuus Carsonella ruddii) within specialized cells found in the insect's body cavity. Previous phylogenetic analyses based on endosymbiont 16S-23S ribosomal DNA and a host gene were concordant (M.L. Thao, et al., Appl. Env. Microbiol. 66:2898, 2000). Additional analyses with atpAGD and rpoBC gave similar trees showing the agreement expected from organisms that evolve through vertical transmission with no gene exchange.

  3. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    PubMed

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  4. Direct identification of slowly growing Mycobacterium species by analysis of the intergenic 16S-23S rDNA spacer region (ISR) using a GelCompar II database containing sequence based optimization for restriction fragment site polymorphisms (RFLPs) for 12 enzymes.

    PubMed

    Gürtler, Volker; Harford, Cate; Bywater, Judy; Mayall, Barrie C

    2006-02-01

    To obtain Mycobacterium species identification directly from clinical specimens and cultures, the 16S-23S rDNA spacer (ISR) was amplified using previously published primers that detect all Mycobacterium species. The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms (RFLPs) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species. Subsequently a GelCompar II database was constructed from RFLPs for 10 enzymes that have been used in the literature to differentiate slowly growing Mycobacterium species. The combination of Sau96I and HaeIII were the best choice of enzymes for differentiating clinically relevant slowly growing Mycobacterium species. A total of 392 specimens were studied by PCR with 195 negative and 197 positive specimens. The ISR-PCR product was digested with HaeIII (previously reported) and Sau96I (new to this study) to obtain a Mycobacterium species identification based on the ISR-RFLPs. The species identification obtained by ISR-RFLP was confirmed by DNA sequencing (isolate numbers are shown in parentheses) for M. avium (3), M. intracellulare (4), M. avium complex (1), M. gordonae (2) and M. tuberculosis (1). The total number of specimens (99) identified were from culture (67), Bactectrade mark 12B culture bottles (11), EDTA blood (3), directly from smear positive specimens (13), tissue (4) and urine (1). Direct species identification was obtained from all 13/13 smear positive specimens. The total number of specimens (99) were identified as M. tuberculosis (41), M. avium (7), M. avium complex (11), M. intracellulare MIN-A (20), M. flavescens (2), M. fortuitum (10), M. gordonae (4), M. shimoidei (1), M. ulcerans (1) and M. chelonae (2). This method reduces the time taken for Mycobacterium species identification from 8-10 weeks for culture and biochemical identification; to 4-6 weeks for culture and ISR-RFLP; to 2 days

  5. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  6. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).

    PubMed

    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A

    2000-06-01

    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  7. Ecotypes of planktonic actinobacteria with identical 16S rRNA genes adapted to thermal niches in temperate, subtropical, and tropical freshwater habitats.

    PubMed

    Hahn, Martin W; Pöckl, Matthias

    2005-02-01

    Seven strains with identical 16S rRNA genes affiliated with the Luna2 cluster (Actinobacteria) were isolated from six freshwater habitats located in temperate (Austria and Australia), subtropical (People's Republic of China), and tropical (Uganda) climatic zones. The isolates had sequence differences at zero to five positions in a 2,310-nucleotide fragment of the ribosomal operon, including part of the intergenic spacer upstream of the 16S rRNA gene, the complete 16S rRNA gene, the complete 16S-23S internal transcribed spacer (ITS1), and a short part of the 23S rRNA gene. Most of the few sequence differences found were located in the internal transcribed spacer sequences. Two isolates obtained from habitats in Asia and Europe, as well as two isolates obtained from different habitats in the People's Republic of China, had identical sequences for the entire fragment sequenced. In spite of minimal sequence differences in the part of the ribosomal operon investigated, the strains exhibited significant differences in their temperature response curves (with one exception), as well as pronounced differences in their temperature optima (25.0 to 35.6 degrees C). The observed differences in temperature adaptation were generally in accordance with the thermal conditions in the habitats where the strains were isolated. Strains obtained from temperate zone habitats had the lowest temperature optima, strains from subtropical habitats had intermediate temperature optima, and a strain from a tropical habitat had the highest temperature optimum. Based on the observed temperature responses, we concluded that the strains investigated are well adapted to the thermal conditions in their home habitats. Consequently, these closely related strains represent different ecotypes adapted to different thermal niches.

  8. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  9. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  10. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    PubMed

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  12. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    PubMed

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  13. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  14. Internal Transcribed Spacer rRNA Gene-Based Phylogenetic Reconstruction Using Algorithms with Local and Global Sequence Alignment for Black Yeasts and Their Relatives

    PubMed Central

    Caligiorne, R. B.; Licinio, P.; Dupont, J.; de Hoog, G. S.

    2005-01-01

    Sequences of rRNA gene internal transcribed spacer (ITS) of a standard set of black yeast-like fungal pathogens were compared using two methods: local and global alignments. The latter is based on DNA-walk divergence analysis. This method has become recently available as an algorithm (DNAWD program) which converts sequences into three-dimensional walks. The walks are compared with, or fit to, each other generating global alignments. The DNA-walk geometry defines a proper metric used to create a distance matrix appropriated for phylogenetic reconstruction. In this work, the analyses were carried out for species currently classified in Capronia, Cladophialophora, Exophiala, Fonsecaea, Phialophora, and Ramichloridium. Main groups were verified by small-subunit rRNA gene data. DNAWD applied to ITS2 alone enabled species recognition as well as phylogenetic reconstruction reflecting clades discriminated in small-subunit rRNA gene phylogeny, which was not possible with any other algorithm using local alignment for the same data set. It is concluded that DNAWD provides rapid insight into broader relationships between groups using genes that otherwise would be hardly usable for this purpose. PMID:15956403

  15. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single strand conformation polymorphism (SSCP). Diversity indexes sh...

  16. From genus to phylum: large-subunit and internal transcribed spacer rRNA operon regions show similar classification accuracies influenced by database composition.

    PubMed

    Porras-Alfaro, Andrea; Liu, Kuan-Liang; Kuske, Cheryl R; Xie, Gary

    2014-02-01

    We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5' section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets.

  17. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    PubMed

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

  18. ARC-1, a sequence element complementary to an internal 18S rRNA segment, enhances translation efficiency in plants when present in the leader or intercistronic region of mRNAs

    PubMed Central

    Akbergenov, R. Zh.; Zhanybekova, S. Sh.; Kryldakov, R. V.; Zhigailov, A.; Polimbetova, N. S.; Hohn, T.; Iskakov, B. K.

    2004-01-01

    The sequences of different plant viral leaders with known translation enhancer ability show partial complementarity to the central region of 18S rRNA. Such complementarity might serve as a means to attract 40S ribosomal subunits and explain in part the translation-enhancing property of these sequences. To verify this notion, we designed β-glucuronidase (GUS) mRNAs differing only in the nature of 10 nt inserts in the center of their 41 base leaders. These were complementary to consecutive domains of plant 18S rRNA. Sucrose gradient analysis revealed that leaders with inserts complementary to regions 1105–1114 and 1115–1124 (‘ARC-1’) of plant 18S rRNA bound most efficiently to the 40S ribosomal subunit after dissociation from 80S ribosomes under conditions of high ionic strength, a treatment known to remove translation initiation factors. Using wheat germ cell-free extracts, we could demonstrate that mRNAs with these leaders were translated more than three times more efficiently than a control lacking such a complementarity. Three linked copies of the insert enhanced translation of reporter mRNA to levels comparable with those directed by the natural translation enhancing leaders of tobacco mosaic virus and potato virus Y RNAs. Moreover, inserting the same leaders as intercistronic sequences in dicistronic mRNAs substantially increased translation of the second cistron, thereby revealing internal ribosome entry site activity. Thus, for plant systems, the complementary interaction between mRNA leader and the central region of 18S rRNA allows cap-independent binding of mRNA to the 43S pre-initiation complex without assistance of translation initiation factors. PMID:14718549

  19. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  20. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    PubMed

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  1. Internal Transcribed Spacer 2 (nu ITS2 rRNA) Sequence-Structure Phylogenetics: Towards an Automated Reconstruction of the Green Algal Tree of Life

    PubMed Central

    Buchheim, Mark A.; Keller, Alexander; Koetschan, Christian; Förster, Frank; Merget, Benjamin; Wolf, Matthias

    2011-01-01

    Background Chloroplast-encoded genes (matK and rbcL) have been formally proposed for use in DNA barcoding efforts targeting embryophytes. Extending such a protocol to chlorophytan green algae, though, is fraught with problems including non homology (matK) and heterogeneity that prevents the creation of a universal PCR toolkit (rbcL). Some have advocated the use of the nuclear-encoded, internal transcribed spacer two (ITS2) as an alternative to the traditional chloroplast markers. However, the ITS2 is broadly perceived to be insufficiently conserved or to be confounded by introgression or biparental inheritance patterns, precluding its broad use in phylogenetic reconstruction or as a DNA barcode. A growing body of evidence has shown that simultaneous analysis of nucleotide data with secondary structure information can overcome at least some of the limitations of ITS2. The goal of this investigation was to assess the feasibility of an automated, sequence-structure approach for analysis of IT2 data from a large sampling of phylum Chlorophyta. Methodology/Principal Findings Sequences and secondary structures from 591 chlorophycean, 741 trebouxiophycean and 938 ulvophycean algae, all obtained from the ITS2 Database, were aligned using a sequence structure-specific scoring matrix. Phylogenetic relationships were reconstructed by Profile Neighbor-Joining coupled with a sequence structure-specific, general time reversible substitution model. Results from analyses of the ITS2 data were robust at multiple nodes and showed considerable congruence with results from published phylogenetic analyses. Conclusions/Significance Our observations on the power of automated, sequence-structure analyses of ITS2 to reconstruct phylum-level phylogenies of the green algae validate this approach to assessing diversity for large sets of chlorophytan taxa. Moreover, our results indicate that objections to the use of ITS2 for DNA barcoding should be weighed against the utility of an automated

  2. Single-Cell DNA barcoding using sequences from the small subunit rRNA and internal transcribed spacer region identifies new species of Trichonympha and Trichomitopsis from the hindgut of the termite Zootermopsis angusticollis.

    PubMed

    Tai, Vera; James, Erick R; Perlman, Steve J; Keeling, Patrick J

    2013-01-01

    To aid in their digestion of wood, lower termites are known to harbour a diverse community of prokaryotes as well as parabasalid and oxymonad protist symbionts. One of the best-studied lower termite gut communities is that of Zootermopsis angusticollis which has been known for almost 100 years to possess 3 species of Trichonympha (T. campanula, T. collaris, and T. sphaerica), 1 species of Trichomitopsis (T. termopsidis), as well as smaller flagellates. We have re-assessed this community by sequencing the small subunit (SSU) rRNA gene and the internal transcribed spacer (ITS) region from a large number of single Trichonympha and Trichomitopsis cells for which morphology was also documented. Based on phylogenetic clustering and sequence divergence, we identify 3 new species: Trichonympha postcylindrica, Trichomitopsis minor, and Trichomitopsis parvus spp. nov. Once identified by sequencing, the morphology of the isolated cells for all 3 new species was re-examined and found to be distinct from the previously described species: Trichonympha postcylindrica can be morphologically distinguished from the other Trichonympha species by an extension on its posterior end, whereas Trichomitopsis minor and T. parvus are smaller than T. termopsidis but similar in size to each other and cannot be distinguished based on morphology using light microscopy. Given that Z. angusticollis has one of the best characterized hindgut communities, the near doubling of the number of the largest and most easily identifiable symbiont species suggests that the diversity of hindgut symbionts is substantially underestimated in other termites as well. Accurate descriptions of the diversity of these microbial communities are essential for understanding hindgut ecology and disentangling the interactions among the symbionts, and molecular barcoding should be a priority for these systems.

  3. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  4. Use of PCR Targeting of Internal Transcribed Spacer Regions and Single-Stranded Conformation Polymorphism Analysis of Sequence Variation in Different Regions of rRNA Genes in Fungi for Rapid Diagnosis of Mycotic Keratitis†

    PubMed Central

    Kumar, Manish; Shukla, P. K.

    2005-01-01

    The increased incidence of fungal infections in the recent past has been attributed to the increase in the number of human immunodeficiency virus-positive and AIDS patients. Early diagnosis of mycoses in patients is crucial for prompt antifungal therapy. Immunological methods of diagnosis have not been found to be satisfactory, and recent research has been diverted to the use of PCR for the sensitive and early diagnosis at the molecular level. In the present study we targeted different regions of the rRNA gene to diagnose cases of mycotic keratitis and identify the causal agents. Six fungus-specific primers (primers ITS1, ITS2, ITS3, ITS4, invSR1R, and LR12R) were used, and the amplified products were analyzed by single-stranded conformation polymorphism (SSCP) analysis. Dendrograms of these SSCP patterns, prepared on the basis of Jaccard's coefficient, indicated that the PCR products obtained with primer pair ITS1 and ITS2 were the best for the identification of fungi. The results were confirmed by sequencing of the PCR products, and the approach was successfully tested experimentally for the detection of mycotic keratitis caused by Aspergillus fumigatus and was used for the diagnosis of fungal corneal ulcers in patients. PMID:15695661

  5. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  6. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  7. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  8. A comparison of polymerase chain reaction and international organization for standardization methods for determination of Enterobacter sakazakii contamination of infant formulas from Chinese mainland markets.

    PubMed

    Ye, Yingwang; Wu, Qingping; Yao, Lin; Dong, Xiaohui; Wu, Kui; Zhang, Jumei

    2009-12-01

    Enterobacter sakazakii is an emerging foodborne pathogen associated with meningitis, necrotizing enterocolitis, and sepsis in infants. One of the main transmission vehicles is the commercially available infant formulas. To provide efficient options and direction for detecting E. sakazakii in infant formulas, evaluation of different polymerase chain reaction (PCR) assays targeting the 16S-23S rDNA internal transcribed spacer (ITS), the ompA gene, and the alpha-1,4-glucosidase gene (gluA) of this organism, were compared to the International Organization for Standardization (ISO) method for detecting E. sakazakii in the 243 commercial infant formula samples. Twelve samples were found to be positive for E. sakazakii by all the PCR assays used, followed by sequencing of PCR products. Ten samples were found to be positive by the ISO method, and all 10 gave positive signals for all the PCR amplifications. In contrast, four false-positive results were generated by single-PCR of the ITS region and one false-positive result targeting the ompA gene, while two false-negative results occurred with the ISO method. Combined with selective enrichment step(s), duplex-PCR targeting ITS and ompA and targeting ompA and gluA genes or single-PCR of the gluA gene can be used to test for contamination by E. sakazakii in infant formulas before they enter the market. PCR techniques will be helpful for routine monitoring and risk assessment for large-scale screenings.

  9. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  10. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  11. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  12. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively.

  13. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively. PMID:25011595

  14. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  15. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    PubMed Central

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  16. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  17. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  18. Bead Array Direct rRNA Capture Assay (rCapA) for Amplification Free Speciation of Mycobacterium Cultures

    PubMed Central

    de Ronde, Hans; González Alonso, Paula; van Soolingen, Dick; Klatser, Paul R.; Anthony, Richard M.

    2012-01-01

    Mycobacterium cultures, from patients suspected of tuberculosis or nontuberculous mycobacteria (NTM) infection, need to be identified. It is most critical to identify cultures belonging to the Mycobacterium tuberculosis complex, but also important to recognize clinically irrelevant or important NTM to allow appropriate patient management. Identification of M. tuberculosis can be achieved by a simple and cheap lateral flow assay, but identification of other Mycobacterium spp. generally requires more complex molecular methods. Here we demonstrate that a paramagnetic liquid bead array method can be used to capture mycobacterial rRNA in crude lysates of positive cultures and use a robust reader to identify the species in a direct and sensitive manner. We developed an array composed of paramagnetic beads coupled to oligonucleotides to capture 16 rRNA from eight specific Mycobacterium species and a single secondary biotinilated reporter probe to allow the captured rRNA to be detected. A ninth less specific bead and its associated reporter probe, designed to capture 23S rRNA from mycobacteria and related genera, is included as an internal control to confirm the presence of bacterial rRNA from a GC rich Gram variable genera. Using this rRNA capture assay (rCapA) with the array developed we were already able to confirm the presence of members of the M. tuberculosis complex and to discriminate a range of NTM species. This approach is not based on DNA amplification and therefore does not require precautions to avoid amplicon contamination. Moreover, the new generation of stable and cost effective liquid bead readers provides the necessary multiplexing potential to develop a robust and highly discriminatory assay. PMID:22396779

  19. Genetic diversity of Bartonella genotypes found in the striped field mouse (Apodemus agrarius) in Central Europe.

    PubMed

    Kraljik, Jasna; Paziewska-Harris, Anna; Miklisová, Dana; Blaňarová, Lucia; Mošanský, Ladislav; Bona, Martin; Stanko, Michal

    2016-09-01

    We investigated the diversity of Bartonella in Apodemus agrarius, an important rodent of peri-domestic habitats, which has spread into Europe in the past 1000 years. Spleen samples of 344 A. agrarius from Eastern Slovakia were screened for the presence of Bartonella spp. using 16S-23S rRNA internal transcribed spacer region and bacteria were detected in 9% of rodents. Based on sequencing of three housekeeping genes (gltA, rpoB and groEL) Bartonella genotypes were ascribed to the species typical for mice and voles: B. grahamii, B. taylorii and B. birtlesii. However, the study also confirmed presence of genotypes belonging to the B. clarridgeiae/B. rochalimae clade, and the B. elizabethae/B. tribocorum clade, which are not commonly found in woodland rodents. In addition, a potential recombination event between these two genotypes was noted, which highlights an important role of A. agrarius in shaping Bartonella diversity and evolution. PMID:27279125

  20. A comparison of polymerase chain reaction and international organization for standardization methods for determination of Enterobacter sakazakii contamination of infant formulas from Chinese mainland markets.

    PubMed

    Ye, Yingwang; Wu, Qingping; Yao, Lin; Dong, Xiaohui; Wu, Kui; Zhang, Jumei

    2009-12-01

    Enterobacter sakazakii is an emerging foodborne pathogen associated with meningitis, necrotizing enterocolitis, and sepsis in infants. One of the main transmission vehicles is the commercially available infant formulas. To provide efficient options and direction for detecting E. sakazakii in infant formulas, evaluation of different polymerase chain reaction (PCR) assays targeting the 16S-23S rDNA internal transcribed spacer (ITS), the ompA gene, and the alpha-1,4-glucosidase gene (gluA) of this organism, were compared to the International Organization for Standardization (ISO) method for detecting E. sakazakii in the 243 commercial infant formula samples. Twelve samples were found to be positive for E. sakazakii by all the PCR assays used, followed by sequencing of PCR products. Ten samples were found to be positive by the ISO method, and all 10 gave positive signals for all the PCR amplifications. In contrast, four false-positive results were generated by single-PCR of the ITS region and one false-positive result targeting the ompA gene, while two false-negative results occurred with the ISO method. Combined with selective enrichment step(s), duplex-PCR targeting ITS and ompA and targeting ompA and gluA genes or single-PCR of the gluA gene can be used to test for contamination by E. sakazakii in infant formulas before they enter the market. PCR techniques will be helpful for routine monitoring and risk assessment for large-scale screenings. PMID:19743923

  1. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  2. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  3. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  4. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  5. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  6. Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

    PubMed

    Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

    2007-04-01

    International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

  7. [CpcHID operon as a new tool for classification and identification of Arthrospira platensis strains].

    PubMed

    Yang, Ling-yong; Wang, Zhi-ping; Cao, Xue-cheng; Chen, Xiao-yan; Xu, Bu-jin; Li, Xue-bin; Huang, Hui

    2006-12-01

    Arthrospira is a photoautotrophic filamentous cyanobacterium belonging to the family Oscillatoriaceae, phylum Cyanophyta. Morphological criteria alone were inadequate for classification of Arthrospira . To develop new molecular markers, in this study, the cpcHID operon, 16S rRNA and 16S-23S rRNA internally transcribed spacer (ITS) of seven Arthrospira platensis strains, Sp-10, Sp-2, Sp-9, Sp-1, Sp-1ll, Sp-3 and Sp-5, were cloned and sequenced. And the results of bioinformatics and molecular phylogenetics analyses with BioEdit 7.0, Clustal X 1.81 and Phylip 3.65 were as follows: (1) The sequences of cpcHID operon, 16S rRNA and ITS from the seven strains were highly homologous to the each corresponding gene based on multiple pair-wise comparison. (2) The mean absolute deviation of the G + C content, the ratio of different sites and the genetic distance coefficient based on the sequences of cpcHID operon in the seven strains were generally greater than that based on 16S rRNA and ITS region. (3) The phylogenetic dendrogram based on the sequences of cpcHID operon was almost same with that based on the sequences of 16S rRNA and ITS region. Therefore, it revealed that cpcHID operon could be applied as a new molecular marker to classification and identification of cyanobacterium, and more appropriate for species or strains determination due to its abundant information. PMID:17302170

  8. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  9. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  10. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    PubMed Central

    Wang, Deguo; Liu, Yanhong

    2015-01-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  11. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-06-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  12. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  13. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  14. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  15. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  16. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  17. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  18. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  19. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  20. The identification of spermine binding sites in 16S rRNA allows interpretation of the spermine effect on ribosomal 30S subunit functions

    PubMed Central

    Amarantos, Ioannis; Zarkadis, Ioannis K.; Kalpaxis, Dimitrios L.

    2002-01-01

    A photoreactive analogue of spermine, N1-azidobenzamidino (ABA)-spermine, was covalently attached after irradiation to Escherichia coli 30S ribosomal subunits or naked 16S rRNA. By means of RNase H digestion and primer extension, the cross-linking sites of ABA-spermine in naked 16S rRNA were characterised and compared with those identified in 30S subunits. The 5′ domain, the internal and terminal loops of helix H24, as well as the upper part of helix H44 in naked 16S rRNA, were found to be preferable binding sites for polyamines. Association of 16S rRNA with ribosomal proteins facilitated its interaction with photoprobe, except for 530 stem–loop nt, whose modification by ABA-spermine was abolished. Association of 30S with 50S subunits, poly(U) and AcPhe-tRNA (complex C) further altered the susceptibility of ABA-spermine cross-linking to 16S rRNA. Complex C, modified in its 30S subunit by ABA-spermine, reacted with puromycin similarly to non-photolabelled complex. On the contrary, poly(U)-programmed 70S ribosomes reconstituted from photolabelled 30S subunits and untreated 50S subunits bound AcPhe-tRNA more efficiently than untreated ribosomes, but were less able to recognise and reject near cognate aminoacyl-tRNA. The above can be interpreted in terms of conformational changes in 16S rRNA, induced by the incorporation of ABA-spermine. PMID:12087167

  1. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  2. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  3. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.

    PubMed

    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W

    2008-05-01

    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  4. High temporal but low spatial heterogeneity of bacterioplankton in the Chesapeake Bay.

    PubMed

    Kan, Jinjun; Suzuki, Marcelino T; Wang, Kui; Evans, Sarah E; Chen, Feng

    2007-11-01

    Compared to freshwater and the open ocean, less is known about bacterioplankton community structure and spatiotemporal dynamics in estuaries, particularly those with long residence times. The Chesapeake Bay is the largest estuary in the United States, but despite its ecological and economic significance, little is known about its microbial community composition. A rapid screening approach, ITS (internal transcribed spacer)-LH (length heterogeneity)-PCR, was used to screen six rRNA operon (16S rRNA-ITS-23S rRNA) clone libraries constructed from bacterioplankton collected in three distinct regions of the Chesapeake Bay over two seasons. The natural length variation of the 16S-23S rRNA gene ITS region, as well as the presence and location of tRNA-alanine coding regions within the ITS, was determined for 576 clones. Clones representing unique ITS-LH-PCR sizes were sequenced and identified. Dramatic shifts in bacterial composition (changes within subgroups or clades) were observed for the Alphaproteobacteria (Roseobacter clade, SAR11), Cyanobacteria (Synechococcus), and Actinobacteria, suggesting strong seasonal variation within these taxonomic groups. Despite large gradients in salinity and phytoplankton parameters, a remarkably homogeneous bacterioplankton community was observed in the bay in each season. Stronger seasonal, rather than spatial, variation of the bacterioplankton population was also supported by denaturing gradient gel electrophoresis and LH-PCR analyses, indicating that environmental parameters with stronger seasonal, rather than regional, dynamics, such as temperature, might determine bacterioplankton community composition in the Chesapeake Bay.

  5. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  6. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  7. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  8. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  9. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  10. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  11. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  12. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes.

    PubMed

    Baker, Brett J; Hugenholtz, Philip; Dawson, Scott C; Banfield, Jillian F

    2003-09-01

    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name "Candidatus Captivus acidiprotistae." To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat.

  13. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    PubMed Central

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  14. Mycoplasmas hyorhinis in different regions of cuba. diagnosis

    PubMed Central

    Lobo, Evelyn; Poveda, Carlos; Gupta, Rakesh; Suarez, Alejandro; Hernández, Yenney; Ramírez, Ana; Poveda, José B.

    2011-01-01

    M. hyorhinis is considered one of the etiological agents of arthritis in sucking pigs, but recently as seen, some strains can produce pneumonia that could not be distinguished from the mycoplasmosis caused by M. hyopneumoniae. The study was conducted to research the presence of Mycoplasma hyorhinis (M. hyorhinis ) in different regions of the country from exudates of pig lungs with typical EP lesions. Exudates from 280 pig lungs with typical EP lesions were studied using molecular techniques such as PCR, real time PCR and amplification of the 16S-23S rRNA. It was detected that the 66% of the samples studied resulted positive to M. hyorhinis, and the presence of this species was detected in all the provinces. Amplification and studies on the intergenic region 16S-23S of M. hyorhinis rRNA demonstrated the existing variability among strains of a same species. This study is the first report on M. hyorhinis detection in Cuba. PMID:24031686

  15. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  16. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  17. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  18. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.

    PubMed

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5'-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  19. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression

    PubMed Central

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5′-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  20. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  1. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  2. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  3. Molecular evolution of the 5'-terminal domain of large-subunit rRNA from lower eukaryotes. A broad phylogeny covering photosynthetic and non-photosynthetic protists.

    PubMed

    Qu, L H; Perasso, R; Baroin, A; Brugerolle, G; Bachellerie, J P; Adoutte, A

    1988-01-01

    This paper summarizes the present status of an analysis of protist phylogeny using rapid partial sequencing of 28S rRNA. Data from 12 protistan phyla are now available and have been used to construct a tentative dendrogram based on a distance matrix method. The tree is robust and has considerable internal consistency. The following salient points are observed: a number of flagellate groups (particularly Euglenozoa) emerge very early among eukaryotes, whereas ciliates and dinoflagellates emerge late, suggesting that some characteristics that had been considered as primitive may in fact be derived. Both chlorophytic and chromophytic photosynthetic protists emerge very late in the tree, close to the Metazoa-Metaphyta-Fungi radiation, suggesting relatively late occurrence of the photosynthetic symbiosis. Taxonomic and phylogenetic information is also obtained within a phylum where rRNA of enough species are sequenced. A deep trichotomy is thus observed within the ciliates. The data are discussed with respect to classical protist phylogenies. PMID:3395679

  4. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation.

    PubMed

    Malygin, Alexey A; Kossinova, Olga A; Shatsky, Ivan N; Karpova, Galina G

    2013-10-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES-rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors.

  5. Molecular evolution of the 5'-terminal domain of large-subunit rRNA from lower eukaryotes. A broad phylogeny covering photosynthetic and non-photosynthetic protists.

    PubMed

    Qu, L H; Perasso, R; Baroin, A; Brugerolle, G; Bachellerie, J P; Adoutte, A

    1988-01-01

    This paper summarizes the present status of an analysis of protist phylogeny using rapid partial sequencing of 28S rRNA. Data from 12 protistan phyla are now available and have been used to construct a tentative dendrogram based on a distance matrix method. The tree is robust and has considerable internal consistency. The following salient points are observed: a number of flagellate groups (particularly Euglenozoa) emerge very early among eukaryotes, whereas ciliates and dinoflagellates emerge late, suggesting that some characteristics that had been considered as primitive may in fact be derived. Both chlorophytic and chromophytic photosynthetic protists emerge very late in the tree, close to the Metazoa-Metaphyta-Fungi radiation, suggesting relatively late occurrence of the photosynthetic symbiosis. Taxonomic and phylogenetic information is also obtained within a phylum where rRNA of enough species are sequenced. A deep trichotomy is thus observed within the ciliates. The data are discussed with respect to classical protist phylogenies.

  6. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil

    PubMed Central

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo

    2016-01-01

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs). PMID:27231360

  7. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  8. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  9. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  10. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  11. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  12. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  14. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  15. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  16. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  17. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  18. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  19. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  20. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  1. Accurate, rapid taxonomic classification of fungal large-subunit rRNA genes.

    PubMed

    Liu, Kuan-Liang; Porras-Alfaro, Andrea; Kuske, Cheryl R; Eichorst, Stephanie A; Xie, Gary

    2012-03-01

    Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project.

  2. Differential gene expression in Neurospora crassa cell types: heterogeneity and multiple copies of rRNA genes. Annual progress report, July 1981-June 1982

    SciTech Connect

    Dutta, S.K.

    1982-01-01

    The significant results obtained were as follows: (I) Multiple copies of isolated rRNA genes from N. crassa were tested for heterogeneity by rRNA: rDNA reassociation kinetics. More than 90% of rDNA copies were identical. The possible heterogeneity of a small fraction of rDNAs could not be attributed to inclusion of any tDNA sequences. (II) Two approaches to study gross differences between rRNA genes from N. crassa cell types-conidia, germinated conidia, and mycelia were undertaken. No difference was seen in either the restriction patterns nor the autoradiographs. Either gross differences between rDNAS of N. crassa cell types were not present or they were not detected by these two approaches. (III) Using similar DNA restriction analysis procedures, differences between closely related heterothallic and homothallic species of Neurospora were detected. (IV) Successful sequencing of 317 bases of the N. crassa slime mutant pMF2 clone which includes the 5.8S rDNA and it's flanking internal spacer regions was achieved. (ERB)

  3. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    PubMed

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy. PMID:26203886

  4. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    PubMed

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

  5. Identification of acetic acid bacteria in traditionally produced vinegar and mother of vinegar by using different molecular techniques.

    PubMed

    Yetiman, Ahmet E; Kesmen, Zülal

    2015-07-01

    Culture-dependent and culture-independent methods were combined for the investigation of acetic acid bacteria (AAB) populations in traditionally produced vinegars and mother of vinegar samples obtained from apple and grape. The culture-independent denaturing gradient gel electrophoresis (DGGE) analysis, which targeted the V7-V8 regions of the 16S rRNA gene, showed that Komagataeibacter hansenii and Komagataeibacter europaeus/Komagataeibacter xylinus were the most dominant species in almost all of the samples analyzed directly. The culture-independent GTG5-rep PCR fingerprinting was used in the preliminary characterization of AAB isolates and species-level identification was carried out by sequencing of the 16S rRNA gene, 16S-23S rDNA internally transcribed to the spacer (ITS) region and tuf gene. Acetobacter okinawensis was frequently isolated from samples obtained from apple while K. europaeus was identified as the dominant species, followed by Acetobacter indonesiensis in the samples originating from grape. In addition to common molecular techniques, real-time PCR intercalating dye assays, including DNA melting temperature (Tm) and high resolution melting analysis (HRM), were applied to acetic acid bacterial isolates for the first time. The target sequence of ITS region generated species-specific HRM profiles and Tm values allowed discrimination at species level.

  6. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    PubMed

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  7. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    PubMed

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life. PMID:23316189

  8. Cyanobacterial diversity and a new acaryochloris-like symbiont from Bahamian sea-squirts.

    PubMed

    López-Legentil, Susanna; Song, Bongkeun; Bosch, Manel; Pawlik, Joseph R; Turon, Xavier

    2011-01-01

    Symbiotic interactions between ascidians (sea-squirts) and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS) and by examining symbiont morphology with transmission electron (TEM) and confocal microscopy (CM). As described previously for other species, Trididemnum spp. mostly contained symbionts associated with the Prochloron-Synechocystis group. However, sequence analysis of the symbionts in Lissoclinum revealed two unique clades. The first contained a novel cyanobacterial clade, while the second clade was closely associated with Acaryochloris marina. CM revealed the presence of chlorophyll d (chl d) and phycobiliproteins (PBPs) within these symbiont cells, as is characteristic of Acaryochloris species. The presence of symbionts was also observed by TEM inside the tunic of both the adult and larvae of L. fragile, indicating vertical transmission to progeny. Based on molecular phylogenetic and microscopic analyses, Candidatus Acaryochloris bahamiensis nov. sp. is proposed for this symbiotic cyanobacterium. Our results support the hypothesis that photosymbiont communities in ascidians are structured by host phylogeny, but in some cases, also by sampling location.

  9. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with descriptions of three new species.

    PubMed

    Johansen, Jeffrey R; Bohunická, Markéta; Lukešová, Alena; Hrčková, Kristýna; Vaccarino, Melissa A; Chesarino, Nicholas M

    2014-02-01

    Twenty-six strains morphologically identified as Cylindrospermum as well as the closely related taxon Cronbergia siamensis were examined microscopically as well as phylogenetically using sequence data for the 16S rRNA gene and the 16S-23S internal transcribed spacer (ITS) region. Phylogenetic analysis of the 16S rRNA revealed three distinct clades. The clade we designate as Cylindrospermum sensu stricto contained all five of the foundational species, C. maius, C. stagnale, C. licheniforme, C. muscicola, and C. catenatum. In addition to these taxa, three species new to science in this clade were described: C. badium, C. moravicum, and C. pellucidum. Our evidence indicated that Cronbergia is a later synonym of Cylindrospermum. The phylogenetic position of Cylindrospermum within the Nostocaceae was not clearly resolved in our analyses. Cylindrospermum is unusual among cyanobacterial genera in that the morphological diversity appears to be more evident than sequence divergence. Taxa were clearly separable using morphology, but had very high percent similarity among ribosomal sequences. Given the high diversity we noted in this study, we conclude that there is likely much more diversity remaining to be described in this genus. PMID:26988018

  10. Identification of acetic acid bacteria in traditionally produced vinegar and mother of vinegar by using different molecular techniques.

    PubMed

    Yetiman, Ahmet E; Kesmen, Zülal

    2015-07-01

    Culture-dependent and culture-independent methods were combined for the investigation of acetic acid bacteria (AAB) populations in traditionally produced vinegars and mother of vinegar samples obtained from apple and grape. The culture-independent denaturing gradient gel electrophoresis (DGGE) analysis, which targeted the V7-V8 regions of the 16S rRNA gene, showed that Komagataeibacter hansenii and Komagataeibacter europaeus/Komagataeibacter xylinus were the most dominant species in almost all of the samples analyzed directly. The culture-independent GTG5-rep PCR fingerprinting was used in the preliminary characterization of AAB isolates and species-level identification was carried out by sequencing of the 16S rRNA gene, 16S-23S rDNA internally transcribed to the spacer (ITS) region and tuf gene. Acetobacter okinawensis was frequently isolated from samples obtained from apple while K. europaeus was identified as the dominant species, followed by Acetobacter indonesiensis in the samples originating from grape. In addition to common molecular techniques, real-time PCR intercalating dye assays, including DNA melting temperature (Tm) and high resolution melting analysis (HRM), were applied to acetic acid bacterial isolates for the first time. The target sequence of ITS region generated species-specific HRM profiles and Tm values allowed discrimination at species level. PMID:25828705

  11. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history. PMID:27054834

  12. Acetic acid bacteria isolated from grapes of South Australian vineyards.

    PubMed

    Mateo, E; Torija, M J; Mas, A; Bartowsky, E J

    2014-05-16

    Acetic acid bacteria (AAB) diversity from healthy, mould-infected and rot-affected grapes collected from three vineyards of Adelaide Hills (South Australia) was analyzed by molecular typing and identification methods. Nine different AAB species were identified from the 624 isolates recovered: Four species from Gluconobacter genus, two from Asaia and one from Acetobacter were identified by the analysis of 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer. However, the identification of other isolates that were assigned as Asaia sp. and Ameyamaea chiangmaiensis required more analysis for a correct species classification. The species of Gluconobacter cerinus was the main one identified; while one genotype of Asaia siamensis presented the highest number of isolates. The number of colonies recovered and genotypes identified was strongly affected by the infection status of the grapes; the rot-affected with the highest number. However, the species diversity was similar in all the cases. High AAB diversity was detected with a specific genotype distribution for each vineyard.

  13. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history.

  14. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA.

  15. Use of Universal 16S rRNA Gene PCR as a Diagnostic Tool for Venous Access Port-Related Bloodstream Infections

    PubMed Central

    Marín, M.; Martín-Rabadán, P.; Echenagusia, A.; Camúñez, F.; Rodríguez-Rosales, G.; Simó, G.; Echenagusia, M.; Bouza, E.

    2013-01-01

    Amplification of the universal 16S rRNA gene using PCR has improved the diagnostic yield of microbiological samples. However, no data have been reported on the reliability of this technique with venous access ports (VAPs). We assessed the utility of 16S rRNA PCR for the prediction of VAP-related bloodstream infection (VAP-RBSI). During a 2-year period, we prospectively received all VAPs removed by interventional radiologists. PCR and conventional cultures were performed using samples from the different VAP sites. We compared the results of PCR with those of conventional culture for patients with confirmed VAP-RBSI. We collected 219 VAPs from 219 patients. Conventional VAP culture revealed 15 episodes of VAP-RBSI. PCR revealed a further 4 episodes in patients undergoing antibiotic therapy which would have gone undetected using conventional culture. Moreover, it had a negative predictive value of 97.8% for the prediction of VAP-RBSI when it was performed using biofilm from the internal surface of the port. In conclusion, universal 16S rRNA PCR performed with samples from the inside of VAPs proved to be a useful tool for the diagnosis of VAP-RBSI. It increased detection of VAP-RBSI episodes by 21.1% in patients undergoing antibiotic therapy whose episodes would have gone undetected using conventional culture. Therefore, we propose a new application of 16S rRNA PCR as a useful tool for the diagnosis of VAP-RBSI in patients receiving antibiotic therapy. PMID:23254136

  16. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  17. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  20. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  1. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  2. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  3. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  4. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  5. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  6. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  7. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  8. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  9. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  10. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  11. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  12. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  13. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  14. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  15. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  16. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  17. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae.

    PubMed

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto

    2011-11-01

    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen.

  18. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  19. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  20. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  1. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  2. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  3. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  4. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  5. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  6. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  7. The GA motif: an RNA element common to bacterial antitermination systems, rRNA, and eukaryotic RNAs.

    PubMed Central

    Winkler, W C; Grundy, F J; Murphy, B A; Henkin, T M

    2001-01-01

    Two different transcription termination control mechanisms, the T box and S box systems, are used to regulate transcription of many bacterial aminoacyl-tRNA synthetase, amino acid biosynthesis, and amino acid transport genes. Both of these regulatory mechanisms involve an untranslated mRNA leader region capable of adopting alternate structural conformations that result in transcription termination or transcription elongation into the downstream region. Comparative analyses revealed a small RNA secondary structural element, designated the GA motif, that is highly conserved in both T box and S box leader sequences. The motif consists of two short helices separated by an asymmetric internal loop, with highly conserved GA dinucleotide sequences on either side of the internal loop. Site-directed mutagenesis of this motif in model T and S box leader sequences indicated that it is essential for transcriptional regulation in both systems. This motif is similar to the binding site of yeast ribosomal protein L30, the Snu13p binding sites found in U4 snRNA and box C/D snoRNAs, and two elements in 23S rRNA. PMID:11497434

  8. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  9. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  10. Ribosomal cistrons in higher plant cells. II. Sequence homology between the two mature rRNAs of sycamore cells and intracistronic reiteration. A DNA - rRNA hybridization study.

    PubMed

    Miassod, R; Cecchini, J P

    1976-01-01

    1. Uniformly labelled rRNA of sycamore cells has been annealed with homologous DNA. The fractions of DNA complementary to the 17S, or 26S, or 17S + 26S rRNAs are found to be 0.19%, 0.15% and 0.23%. They are not in the ratio of the molecular weight values (0.8, 1.2 and 2 - 10(6), respectively for the 17S, 26S and 17S + 26S rRNAs). This result is compatible with the large hybridization competition observed between the two rRNAs (53 and 72%) and with the shift-down of saturation curves when DNA is presaturated with unlabelled rRNA before the incubation with the other labelled rRNA. 2. Under the selected experimental procedure, the DNA - rRNA hybrids formed appear to be specific. Since there is an equal number of structural genes for the 17S and 26S rRNAs, these results mean the occurrence of a great sequence homology, strictly restricted to the two rRNAs. Homologous and specific sequences have been estimated to 0.1 and 0.7, or 0.85 and 0.35 million daltons, respectively in the 17S or 26S structural genes. 3. From the calculated lengths of homologous sequences, an intracistronic reiteration of some ribosomal sequences can be deduced. This internal reiteration is directly evidenced by the complex pattern of DNA - rRNA annealing curves. As demonstrated by base-composition analysis, the internal reiteration is heterogeneous and concerns both the homologous and specific sequences. In addition, the DNA saturation values allow the calculation of 4000 copies for the ribosomal cistron in the whole sycamore genome.

  11. Identification of Clinically Relevant Fungi and Prototheca Species by rRNA Gene Sequencing and Multilocus PCR Coupled with Electrospray Ionization Mass Spectrometry

    PubMed Central

    Wang, Rui-Ying; Li, Li; Cao, Ya-Hui; Chen, Yan-Qiong; Zhao, Hua-Zhen; Zhang, Qiang-Qiang; Wu, Ji-Qin; Weng, Xin-Hua; Cheng, Xun-Jia; Zhu, Li-Ping

    2014-01-01

    Background Multilocus PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) is a new strategy for pathogen identification, but information about its application in fungal identification remains sparse. Methods One-hundred and twelve strains and isolates of clinically important fungi and Prototheca species were subjected to both rRNA gene sequencing and PCR/ESI-MS. Three regions of the rRNA gene were used as targets for sequencing: the 5′ end of the large subunit rRNA gene (D1/D2 region), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 regions). Microbial identification (Micro ID), acquired by combining results of phenotypic methods and rRNA gene sequencing, was used to evaluate the results of PCR/ESI-MS. Results For identification of yeasts and filamentous fungi, combined sequencing of the three regions had the best performance (species-level identification rate of 93.8% and 81.8% respectively). The highest species-level identification rate was achieved by sequencing of D1/D2 for yeasts (92.2%) and ITS2 for filamentous fungi (75.8%). The two Prototheca species could be identified to species level by D1/D2 sequencing but not by ITS1 or ITS2. For the 102 strains and isolates within the coverage of PCR/ESI-MS identification, 87.3% (89/102) achieved species-level identification, 100% (89/89) of which were concordant to Micro ID on species/complex level. The species-level identification rates for yeasts and filamentous fungi were 93.9% (62/66) and 75% (27/36) respectively. Conclusions rRNA gene sequencing provides accurate identification information, with the best results obtained by a combination of ITS1, ITS2 and D1/D2 sequencing. Our preliminary data indicated that PCR/ESI-MS method also provides a rapid and accurate identification for many clinical relevant fungi. PMID:24835205

  12. Complementarity of Bacillus subtilis 16S rRNA with sites of antibiotic-dependent ribosome stalling in cat and erm leaders.

    PubMed Central

    Rogers, E J; Ambulos, N P; Lovett, P S

    1990-01-01

    Inducible cat and erm genes are regulated by translational attenuation. In this regulatory model, gene activation results from chloramphenicol- or erythromycin-dependent stalling of a ribosome at a precise site in the leader region of cat or erm transcripts. The stalled ribosome is believed to destabilize a downstream region of RNA secondary structure that sequesters the ribosome-binding site for the cat or erm coding sequence. Here we show that the ribosome stall sites in cat and erm leader mRNAs, designated crb and erb, respectively, are largely complementary to an internal sequence in 16S rRNA of Bacillus subtilis. A tetracycline resistance gene that is likely regulated by translational attenuation also contains a sequence in its leader mRNA, trb, which is complementary to a sequence in 16S rRNA that overlaps with the crb and erb complements. An in vivo assay is described which is designed to test whether 16S rRNA of a translating ribosome can interact with the crb sequence in mRNA in an inducer-dependent reaction. The assay compares the growth rate of cells expressing crb-86 with the growth rate of cells lacking crb-86 in the presence of subinhibitory levels of inducers of cat-86, chloramphenicol, fluorothiamphenicol, amicetin, or erythromycin. Under these conditions, crb-86 retarded growth. Deletion of the crb-86 sequence, insertion of ochre mutations into crb-86, or synonymous codon changes in crb-86 that decreased its complementarity with 16S rRNA all eliminated from detection inducer-dependent growth retardation. Lincomycin, a ribosomally targeted antibiotic that is not an inducer of cat-86, failed to selectively retard the growth of cells expressing crb-86. We suggest that cat-86 inducers enable the crb-86 sequence in mRNA to base pair with 16S rRNA of translating ribosome. When the base pairing is extensive, as with crb-86, ribosomes become transiently trapped on crb and are temporarily withdrawn from protein synthesis to the extent that growth rate

  13. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  14. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  15. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  16. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  17. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  18. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  19. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  20. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  1. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  2. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  3. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  4. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  5. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  6. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  7. Proceedings of the international workshop on Ribosomal RNA technology, April 7-9, 2008, Bremen, Germany.

    PubMed

    Amaral-Zettler, Linda; Peplies, Jörg; Ramette, Alban; Fuchs, Bernhard; Ludwig, Wolfgang; Glöckner, Frank Oliver

    2008-09-01

    Thirty years have passed since Carl Woese proposed three primary domains of life based on the phylogenetic analysis of ribosomal RNA (rRNA) genes. Adopted by researchers worldwide, rRNA has become the "gold-standard" for molecular taxonomy, biodiversity analysis and the identification of microorganisms. The more than 700,000 rRNA sequences in public databases constitute an unprecedented hallmark of the richness of microbial biodiversity on earth. The International Workshop on Ribosomal RNA Technology convened on April 7-9, 2008 in Bremen, Germany (http://www.arb-silva.de/rrna-workshop) to summarize the current status of the field and strategize on the best ways of proceeding on both biological and technological fronts. In five sessions, 26 leading international speakers and approximately 120 participants representing diverse disciplines discussed new technological approaches to address three basic ecological questions: "Who is out there?" "How many are there?" and "What are they doing?".

  8. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  9. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  10. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  11. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  12. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  13. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  14. Polymorphism of genes coding for nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10 from other groups in the Rhizoctonia solani species complex.

    PubMed

    Liu, Z L; Domier, L L; Sinclair, J B

    1995-07-01

    DNA polymorphism in the 18S nuclear rRNA gene region was investigated by using 11 restriction endonucleases for 161 isolates of 25 intraspecific groups (ISGs) representing 11 reported anastomosis groups (AGs) of Rhizoctonia solani. A PCR-based restriction mapping method in which enzymatically amplified DNA fragments and subfragments were digested with one or two restriction enzymes was employed. Four types of DNA restriction maps of this region were constructed for these 25 ISGs. Map type I of the 18S rDNA region was represented by isolates of a majority of R. solani ISGs. Map types II and III, represented by ISG 2E and 9 isolates and 5C isolates, respectively, differed from map I by the absence of one (map type II) or two (map type III) restriction sites. Map type IV, represented by ISG 10A and B (or AG 10) isolates, showed significant restriction site variations, with five enzymes in this region compared with those of the remaining ISGs or AGs. Ten of the 25 restriction sites in the 18S rRNA gene region were informative and selected for analysis. Previously reported restriction maps of the 5.8S rRNA gene region, including the internal transcribed spacers, were aligned with each other, and 12 informative restriction sites were identified. These data were used alone and in combination to evaluate group relationships. Analyses derived from these data sets by maximum parsimony and likelihood methods showed that AG 10 isolates were distinct and distantly related to the majority isolates of the other AGs of this species complex.

  15. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  16. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  17. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  18. A renaissance for the pioneering 16S rRNA gene

    SciTech Connect

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  19. Detection and identification of mycobacteria by amplification of rRNA.

    PubMed

    Böddinghaus, B; Rogall, T; Flohr, T; Blöcker, H; Böttger, E C

    1990-08-01

    Oligonucleotides specific at a genus, group, or species level were defined by a systematic comparison of small-subunit rRNA sequences from Mycobacterium tuberculosis, M. bovis, M. africanum, M. bovis BCG, M. avium, M. kansasii, M. marinum, M. gastri, M. chelonae, M. smegmatis, M. terrae, M. nonchromogenicum, M. xenopi, M. malmoense, M. szulgai, M. scrofulaceum, M. fortuitum, M. gordonae, M. intracellulare, M. simiae, M. flavescens, M. paratuberculosis, M. sphagni, M. cookii, M. komossense, M. phlei, and M. farcinica. On the basis of the defined oligonucleotides, the polymerase chain reaction technique was explored to develop a sensitive taxon-specific detection system for mycobacteria. By using M. tuberculosis as a model system, fewer than 10 bacteria could be reliably detected by this kind of assay. These results suggest that amplification of rRNA sequences by the polymerase chain reaction may provide a highly sensitive and specific tool for the direct detection of microorganisms without the need for prior cultivation.

  20. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  1. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  2. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  3. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    PubMed

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general.

  4. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    SciTech Connect

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  5. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  6. Expanding the mycobacterial diversity of metalworking fluids (MWFs): evidence showing MWF colonization by Mycobacterium abscessus.

    PubMed

    Kapoor, Renuka; Yadav, Jagjit S

    2012-02-01

    Nontuberculous mycobacteria (NTM) have been associated with hypersensitivity pneumonitis in machinists. Only two species of NTM, namely Mycobacterium immunogenum and Mycobacterium chelonae, have been reported thus far to have the ability to colonize contaminated metalworking fluids (MWFs). Here, we report, for the first time, the presence and characterization (phenotypic and genotypic) of a third species, Mycobacterium abscessus, colonizing these harsh alkaline machining fluids. Two Mycobacterium morphotypes, smooth (S) and rough (R), were isolated (two isolates each) from an in-use industrial MWFs. Biocide susceptibility analysis using triclosan as a model yielded the same minimal inhibitory concentration for the two morphotypes. PCR-restriction analysis-based speciation of the morphotypes confirmed their identity as M. abscessus. Genotyping based on partial DNA sequences corresponding to the variable regions of the hsp65 gene and 16S-23S rRNA operon internal transcribed spacer region and randomly amplified polymorphic DNA-PCR analysis showed that both morphotypes belong to a single genotype. In addition, we isolated and confirmed two novel mycobacterial genotypes, one each of M. immunogenum and M. chelonae from additional in-use MWF screening. Taken together, this study expands the known mycobacterial species- and strain-diversity colonizing MWF. Furthermore, the study emphasizes the need for including M. abscessus species in the existing mycobacterial screening of contaminated MWF. PMID:22092754

  7. Caldora penicillata gen. nov., comb. nov. (cyanobacteria), a pantropical marine species with biomedical relevance.

    PubMed

    Engene, Niclas; Tronholm, Ana; Salvador-Reyes, Lilibeth A; Luesch, Hendrik; Paul, Valerie J

    2015-08-01

    Many tropical marine cyanobacteria are prolific producers of bioactive secondary metabolites with ecological relevance and promising pharmaceutical applications. One species of chemically rich, tropical marine cyanobacteria that was previously identified as Symploca hydnoides or Symploca sp. corresponds to the traditional taxonomic definition of Phormidium penicillatum. In this study, we clarified the taxonomy of this biomedically and ecologically important cyanobacterium by comparing recently collected specimens with the original type material and the taxonomic description of P. penicillatum. Molecular phylogenetic analyses of the 16S rRNA gene and the 16S-23S internal transcribed spacer regions showed that P. penicillatum formed an independent clade sister to the genus Symploca, and distantly related to Phormidium and Lyngbya. We propose the new genus Caldora for this clade, with Caldora penicillata comb. nov. as the type species and designate as the epitype the recently collected strain FK13-1. Furthermore, the production of bioactive secondary metabolites among various geographically dispersed collections of C. penicillata showed that this species consistently produced the metabolite dolastatin 10 and/or the related compound symplostatin 1, which appear to be robust autapomorphic characters and chemotaxonomic markers for this taxon. PMID:26327714

  8. Use of a DNA Microarray for Detection and Identification of Bacterial Pathogens Associated with Fishery Products▿

    PubMed Central

    Cao, Boyang; Li, Rongrong; Xiong, Songjin; Yao, Fangfang; Liu, Xiangqian; Wang, Min; Feng, Lu; Wang, Lei

    2011-01-01

    We established a microarray for the simultaneous detection and identification of diverse putative pathogens often associated with fishery products by targeting specific genes of Listeria monocytogenes, Salmonella, Shigella, Staphylococcus aureus, Streptococcus pyogenes, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, and Yersinia enterocolitica and the 16S-23S rRNA gene internal transcribed spacer (ITS) region of Proteus mirabilis and Proteus vulgaris. The microarray contained 26 specific probes and was tested against a total of 123 target bacterial strains that included 55 representative strains, 68 clinical isolates, and 45 strains of other bacterial species that belonged to 8 genera and 34 species, and it was shown to be specific and reproducible. A detection sensitivity of 10 ng DNA or 10 CFU/ml for pure cultures of each target organism demonstrated that the assay was highly sensitive and reproducible. Mock and real fishery product samples were tested by the microarray, and the accuracy was 100%. The DNA microarray method described in this communication is specific, sensitive, and reliable and has several advantages over traditional methods of bacterial culture and antiserum agglutination assays. PMID:21965411

  9. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.

    PubMed

    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás

    2004-02-01

    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  10. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    PubMed

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H

    2013-10-01

    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment.

  11. Characterization of Xanthomonas campestris Pathovars by rRNA Gene Restriction Patterns

    PubMed Central

    Berthier, Yvette; Verdier, Valérie; Guesdon, Jean-Luc; Chevrier, Danièle; Denis, Jean-Baptiste; Decoux, Guy; Lemattre, Monique

    1993-01-01

    Genomic DNA of 191 strains of the family Pseudomonadaceae, including 187 strains of the genus Xanthomonas, was cleaved by EcoRI endonuclease. After hybridization of Southern transfer blots with 2-acetylamino-fluorene-labelled Escherichia coli 16+23S rRNA probe, 27 different patterns were obtained. The strains are clearly distinguishable at the genus, species, and pathovar levels. The variability of the rRNA gene restriction patterns was determined for four pathovars of Xanthomonas campestris species. The 16 strains of X. campestris pv. begoniae analyzed gave only one pattern. The variability of rRNA gene restriction patterns of X. campestris pv. manihotis strains could be related to ecotypes. In contrast, the variability of patterns observed for X. campestris pv. malvacearum was not correlated with pathogenicity or with the geographical origins of the strains. The highest degree of variability of DNA fingerprints was observed within X. campestris pv. dieffenbachiae, which is pathogenic to several hosts of the Araceae family. In this case, variability was related to both host plant and pathogenicity. Images PMID:16348894

  12. Phylogenetic analysis based evolutionary study of 16S rRNA in known Pseudomonas sp

    PubMed Central

    Adhikari, Arindam; Nandi, Suvodip; Bhattacharya, Indrabrata; Roy, Mithu De; Mandal, Tanusri; Dutta, Subrata

    2015-01-01

    Molecular evolution analysis of 16S rRNA sequences of native Pseudomonas strains and different fluorescent pseudomonads were conducted on the basis of Molecular Evolutionary Genetics Analysis version 5.2 (MEGA5.2). Topological evaluations show common origin for native strains with other known strains with available sequences at GenBank database. Phylogenetic affiliation of different Pseudomonas sp based on 16S rRNA gene shows that molecular divergence contributes to the genetic diversity of Pseudomonas sp. Result indicate direct dynamic interactions with the rhizospheric pathogenic microbial community. The selection pressure acting on 16S rRNA gene was related to the nucleotide diversity of Pseudomonas sp in soil rhizosphere community among different agricultural crops. Besides, nucleotide diversity among the whole population was very low and tajima test statistic value (D) was also slightly positive (Tajima׳s test statistics D value 0.351). This data indicated increasing trends of infection of soil-borne pathogens under gangetic-alluvial regions of West Bengal due to high degree of nucleotide diversity with decreased population of plant growth promoting rhizobacteria like fluorescent Pseudomonads in soil. PMID:26664032

  13. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  14. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  15. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  16. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  17. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  18. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  19. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  20. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.

    PubMed

    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem

    2016-02-01

    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  1. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  2. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  3. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  4. International Reports.

    ERIC Educational Resources Information Center

    Valauskas, Edward J.; Crosby, John, IV; Haycock, Ken; Oh, Mary

    1999-01-01

    Includes the following international reports: International Federation of Library Associations and Institutions; Special Libraries Association; and Trends and Issues in Library and Information Services in Canada, 1998. (AEF)

  5. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  6. Design and Experimental Application of a Novel Non-Degenerate Universal Primer Set that Amplifies Prokaryotic 16S rRNA Genes with a Low Possibility to Amplify Eukaryotic rRNA Genes

    PubMed Central

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities. PMID:24277737

  7. Design and experimental application of a novel non-degenerate universal primer set that amplifies prokaryotic 16S rRNA genes with a low possibility to amplify eukaryotic rRNA genes.

    PubMed

    Mori, Hiroshi; Maruyama, Fumito; Kato, Hiromi; Toyoda, Atsushi; Dozono, Ayumi; Ohtsubo, Yoshiyuki; Nagata, Yuji; Fujiyama, Asao; Tsuda, Masataka; Kurokawa, Ken

    2014-01-01

    The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.

  8. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  9. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  10. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  11. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.

    PubMed

    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon

    2014-09-01

    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  12. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  13. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    PubMed

    Zhang, Chenyu; Kuspa, Adam

    2009-01-01

    Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA) is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial protein synthesis in D

  14. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    PubMed

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (<1%) have disproportionally high ratios of rRNA to rDNA, an indication of higher protein synthesis, compared to abundant taxa (≥1%) and suggests that rare taxa likely play an unrecognized role in bioreactor performance. There were also significant differences in community-wide rRNA expression signatures at 20-day SRT: anaerobic-oxic-anoxic periods were the primary driver of rRNA similarity. These results indicate differential expression of rRNA at high SRTs, which may further explain why high SRTs promote higher rates of micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  15. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    PubMed

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  16. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated.

  17. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys.

    PubMed

    Nelson, Michael C; Morrison, Hilary G; Benjamino, Jacquelynn; Grim, Sharon L; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  18. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  19. Comparative analysis of dinoflagellate chloroplast genomes reveals rRNA and tRNA genes

    PubMed Central

    Barbrook, Adrian C; Santucci, Nicole; Plenderleith, Lindsey J; Hiller, Roger G; Howe, Christopher J

    2006-01-01

    Background Peridinin-containing dinoflagellates have a highly reduced chloroplast genome, which is unlike that found in other chloroplast containing organisms. Genome reduction appears to be the result of extensive transfer of genes to the nuclear genome. Unusually the genes believed to be remaining in the chloroplast genome are found on small DNA 'minicircles'. In this study we present a comparison of sets of minicircle sequences from three dinoflagellate species. Results PCR was used to amplify several minicircles from Amphidinium carterae so that a homologous set of gene-containing minicircles was available for Amphidinium carterae and Amphidinium operculatum, two apparently closely related peridinin-containing dinoflagellates. We compared the sequences of these minicircles to determine the content and characteristics of their chloroplast genomes. We also made comparisons with minicircles which had been obtained from Heterocapsa triquetra, another peridinin-containing dinoflagellate. These in silico comparisons have revealed several genetic features which were not apparent in single species analyses. The features include further protein coding genes, unusual rRNA genes, which we show are transcribed, and the first examples of tRNA genes from peridinin-containing dinoflagellate chloroplast genomes. Conclusion Comparative analysis of minicircle sequences has allowed us to identify previously unrecognised features of dinoflagellate chloroplast genomes, including additional protein and RNA genes. The chloroplast rRNA gene sequences are radically different from those in other organisms, and in many ways resemble the rRNA genes found in some highly reduced mitochondrial genomes. The retention of certain tRNA genes in the dinoflagellate chloroplast genome has important implications for models of chloroplast-mitochondrion interaction. PMID:17123435

  20. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  1. Phylogeny of the Centrohelida inferred from SSU rRNA, tubulins, and actin genes.

    PubMed

    Sakaguchi, Miako; Nakayama, Takeshi; Hashimoto, Tetsuo; Inouye, Isao

    2005-12-01

    Amoeboid protists are major targets of recent molecular phylogeny in connection with reconstruction of global phylogeny of eukaryotes as well as the search for the root of eukaryotes. The Centrohelida are one of the major groups of Heliozoa, classified in the Actinopodida, whose evolutionary position is not well understood. To clarify the relationships between the Centrohelida and other eukaryotes, we sequenced SSU rRNA, alpha-tubulin, and beta-tubulin genes from a centroheliozoan protist, Raphidiophrys contractilis. The SSU rRNA phylogeny showed that the Centrohelida are not closely related to other heliozoan groups, Actinophryida, Desmothoracida, or Taxopodida. Maximum likelihood analyses of the combined phylogeny using a concatenate model for an alpha- + beta-tubulin + actin data set, and a separate model for SSU rRNA, alpha- and beta-tubulin, and actin gene data sets revealed the best tree, in which the Centrohelida have a closer relationship to Rhodophyta than to other major eukaryotic groups. However, both weighted Shimodaira-Hasegawa and approximately unbiased tests for the concatenate protein phylogeny did not reject alternative trees in which Centrohelida were constrained to be sisters to the Amoebozoa. Moreover, alternative trees in which Centrohelida were placed at the node branching before and after Amoebozoa or Viridiplantae were not rejected by the WSH tests. These results narrowed the possibilities for the position of Centrohelida to a sister to the Rhodophyta, to the Amoebozoa, or to an independent branch between the branchings of Amoebozoa and Rhodophyta (or possibly Plantae) at the basal position within the bikonts clade in the eukaryotic tree.

  2. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  3. Greengenes, a Chimera-checked 16S rRNA gene database and workbenchcompatible with ARB

    SciTech Connect

    DeSantis, Todd Z.; Hugenholtz, Philip; Larsen, Neils; Rojas,Mark; Brodie, Eoin L.; Keller, Keith; Huber, Thomas; Dalevi, Daniel; Hu,Ping; Andersen, Gary L.

    2006-04-10

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that in congruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3 percent of environmental sequences and 0.2 percent of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  4. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  5. Evolutionary diversity of eukaryotic small-subunit rRNA genes.

    PubMed

    Sogin, M L; Elwood, H J; Gunderson, J H

    1986-03-01

    The small-subunit rRNA gene sequences of the flagellated protists Euglena gracilis and Trypanosoma brucei were determined and compared to those of other eukaryotes. A phylogenetic tree was constructed in which the earliest branching among the eukaryotes is represented by E. gracilis. The E. gracilis divergence far antedates a period of massive evolutionary radiation that gave rise to the plants, animals, fungi, and certain groups of protists such as ciliates and the acanthamoebae. The genetic diversity in this collection of eukaryotes is seen to exceed that displayed within either the eubacterial or the archaebacterial lines of descent.

  6. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    PubMed

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  7. 16S rRNA-, GroEL- and MucZ-based assessment of the taxonomic position of 'Rickettsiella melolonthae' and its implications for the organization of the genus Rickettsiella.

    PubMed

    Leclerque, Andreas; Kleespies, Regina G

    2008-04-01

    'Rickettsiella melolonthae' is an intracellularly multiplying bacterial pathogen of European cockchafers, Melolontha melolontha (Linnaeus, 1758) and Melolontha hippocastani (Fabricius, 1801) (Coleoptera: Scarabaeidae). We report the first determination of nucleotide sequences from this organism, i.e. the 16S rRNA encoding rrs gene, the chaperonin encoding groEL gene and the mucZ gene encoding the orthologue of a capsule synthesis-inducing factor of Coxiella burnetii. Within the genus Rickettsiella, the pathotype 'Rickettsiella melolonthae' is currently classified as a synonym of the nomenclatural type species Rickettsiella popilliae. Previous sequencing of a 16S rRNA gene from a different species, Rickettsiella grylli, has motivated the transfer of the entire genus from the alphaproteobacterial order Rickettsiales to the gammaproteobacterial order Legionellales, family Coxiellaceae. We investigated the validity of this taxonomic reorganization beyond the species Rickettsiella grylli by reconstructing the organismal phylogeny from comparisons of 16S rRNA gene and GroEL and MucZ protein sequences from a selected set of alpha- and gammaproteobacteria as well as bacterial pathogens from the order Chlamydiales. Our analysis strongly supported the transfer of the genus Rickettsiella to the order Legionellales, but not its classification in one of the recognized families present in this order. Furthermore, our results substantiated inconsistencies in the internal organization of the genus. In particular, the currently accepted delineation of Rickettsiella species and the claimed synonymy of 'Rickettsiella melolonthae' with Rickettsiella popilliae are not simultaneously consistent with our findings.

  8. Intragenomic heterogeneity and intergenomic recombination among Vibrio parahaemolyticus 16S rRNA genes.

    PubMed

    Harth, Erika; Romero, Jaime; Torres, Rafael; Espejo, Romilio T

    2007-08-01

    Vibrio parahaemolyticus is a marine bacterium bearing 11 copies of ribosomal operons. In some strains, such as RIMD2210633, the genome includes identical copies of 16S rRNA genes (rrs). However, it is known that other strains of the species, such as strains ATCC 17802 and RIMD2210856, show conspicuous intragenomic rrs heterogeneity. The extent and diversity of the rrs heterogeneity in V. parahaemolyticus were studied in further detail by characterization of the rrs copies in environmental isolates belonging to 21 different genotype groups. Thirteen of these groups showed intragenomic heterogeneity, containing altogether 16 sequences differing within a 25 bp segment of their rrs. These sequences grouped into four clusters differing in at least four nucleotide sites. Some isolates contained rrs alleles from up to three different clusters. Each segment sequence conserved the stem-loop characteristic of the 16S rRNA structure of this 25 bp sequence. The double-stranded stem sequence was quite variable, but almost every variation had a compensatory change to maintain seven to eight paired bases. Conversely, the single-strand loop sequence was conserved. The results may be explained as a consequence of recombination among rrs evolving in different bacteria. The results suggest that intergenomic rrs recombination is very high in V. parahaemolyticus and that it occurs solely among Vibrio species. This high rrs homologous intergenomic recombination could be an effective mechanism to maintain intragenomic rrs cohesion, mediating the dispersal of the most abundant rrs version among the 11 intragenomic loci. PMID:17660428

  9. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation

    PubMed Central

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Stier, Gunter; Clark, Sarah A.; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David

    2014-01-01

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a “distribution box,” transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation. PMID:25404745

  10. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  11. Greengenes: 16S rRNA Database and Workbench Compatible with ARB

    DOE Data Explorer

    DeSantis, T. Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E. L.; Keller, K.; Huber, T.; Dalevi, D. Hu, P. Andersen, G. L.

    Greengenes was developed, as the abstract of an AEM reprint states, to "addresse limitations of public repositories by providing chimera screening, standard alignment, and taxonomic classification using multiple published taxonomies. It was found that there is incongruent taxonomic nomenclature among curators even at the phylum level. Putative chimeras were identified in 3% of environmental sequences and in 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages in the Archaea and Bacteria....Greengenes is also a functional workbench to assist in analysis of user-generated 16S rRNA gene sequences. Batches of sequencing reads can be uploaded for quality-based trimming and creation of multiple-sequence alignments (9). Three types of non-MSA similarity searches are also available, seed extension by BLAST (1), similarity based on shared 7-mers by a tool called Simrank, and a direct degenerative pattern match for probe/primer evaluation. Results are displayed using user-preferred taxonomic nomenclature and can be saved between sessions. [Taken from DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl Environ Microbiol 72:5069-72, pages 1 and 3] (Specialized Interface)

  12. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  13. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  14. A network of assembly factors is involved in remodeling rRNA elements during preribosome maturation.

    PubMed

    Baßler, Jochen; Paternoga, Helge; Holdermann, Iris; Thoms, Matthias; Granneman, Sander; Barrio-Garcia, Clara; Nyarko, Afua; Lee, Woonghee; Stier, Gunter; Clark, Sarah A; Schraivogel, Daniel; Kallas, Martina; Beckmann, Roland; Tollervey, David; Barbar, Elisar; Sinning, Irmi; Hurt, Ed

    2014-11-24

    Eukaryotic ribosome biogenesis involves ∼200 assembly factors, but how these contribute to ribosome maturation is poorly understood. Here, we identify a network of factors on the nascent 60S subunit that actively remodels preribosome structure. At its hub is Rsa4, a direct substrate of the force-generating ATPase Rea1. We show that Rsa4 is connected to the central protuberance by binding to Rpl5 and to ribosomal RNA (rRNA) helix 89 of the nascent peptidyl transferase center (PTC) through Nsa2. Importantly, Nsa2 binds to helix 89 before relocation of helix 89 to the PTC. Structure-based mutations of these factors reveal the functional importance of their interactions for ribosome assembly. Thus, Rsa4 is held tightly in the preribosome and can serve as a "distribution box," transmitting remodeling energy from Rea1 into the developing ribosome. We suggest that a relay-like factor network coupled to a mechano-enzyme is strategically positioned to relocate rRNA elements during ribosome maturation.

  15. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  16. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    PubMed

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  17. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2013-03-15

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a completely complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, Escherichia coli16S rRNA was detected in real time with the detection limit of ~0.17 nM. The high specificity of the analysis was proven by differentiating Bacillus subtilis from E. coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds.

  18. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  19. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin.

  20. Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical Legumes

    PubMed Central

    Parker, Matthew A.

    2001-01-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5′ portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5′ 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii. PMID:11319084

  1. Case of localized recombination in 23S rRNA genes from divergent bradyrhizobium lineages associated with neotropical legumes.

    PubMed

    Parker, M A

    2001-05-01

    Enzyme electrophoresis and rRNA sequencing were used to analyze relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legumes (Clitoria javitensis, Erythrina costaricensis, Rhynchosia pyramidalis, and Desmodium axillare) growing on Barro Colorado Island (BCI), Panama. Bacteria with identical multilocus allele profiles were commonly found in association with two or more legume genera. Among the 16 multilocus genotypes (electrophoretic types [ETs]) detected, six ETs formed a closely related cluster that included isolates from all four legume taxa. Bacteria from two other BCI legumes (Platypodium and Machaerium) sampled in a previous study were also identical to certain ETs in this group. Isolates from different legume genera that had the same ET had identical nucleotide sequences for both a 5' portion of the 23S rRNA and the nearly full-length 16S rRNA genes. These results suggest that Bradyrhizobium genotypes with low host specificity may be prevalent in this tropical forest. Parsimony analysis of 16S rRNA sequence variation indicated that most isolates were related to Bradyrhizobium japonicum USDA 110, although one ET sampled from C. javitensis had a 16S rRNA gene highly similar to that of Bradyrhizobium elkanii USDA 76. However, this isolate displayed a mosaic structure within the 5' 23S rRNA region: one 84-bp segment was identical to that of BCI isolate Pe1-3 (a close relative of B. japonicum USDA 110, based on 16S rRNA data), while an adjacent 288-bp segment matched that of B. elkanii USDA 76. This mosaic structure is one of the first observations suggesting recombination in nature between Bradyrhizobium isolates related to B. japonicum versus B. elkanii.

  2. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  3. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  4. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    PubMed

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  5. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  6. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    PubMed

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  7. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  8. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  9. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  10. Identification of aquatic Burkholderia (Pseudomonas) cepacia by hybridization with species-specific rRNA gene probes

    SciTech Connect

    Leff, L.G.; Kernan, R.M.; McArthur, J.V.

    1995-04-01

    Burkholderia (Pseudomonas) cepacia is a common environmental bacterium which can be pathogenic for plants and humans. In this study, four strategies were used to identify aquatic isolates: API test strips, hybridization with species-specific DNA probes for the 16S and 23S rRNA genes, fatty acid methyl ester (FAME) profiles, and growth on selective medium (TB-T agar [C. Hagedorn, W.D. Gould, T.R. Bardinelli, and D.R. Gustarson, Appl. Environ. Microbiol. 53:2265-2268, 1987]). Only 59% of the isolates identified as B. cepacia with the API test strips were confirmed as B. cepacia by using fatty acids profiles. The 23S rRNA probe generated a few false-positive results but dramatically underestimated the number of B. cepacia isolates (i.e., 40% of the colonies that did not hybridize to the probe were B. cepacia, as determined by FAME). The 16S rRNA probe generated more false-positive results than the 23S rRNA probe but was effective in identifying the majority of the B. cepacia isolates. The selective medium was only partially successful in recovering B. cepacia. Use of the B. cepacia-specific 16S rRNA probe was the most efficient and accurate way of identifying B. cepacia. 13 refs., 1 fig., 2 tabs.

  11. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    PubMed Central

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  12. RRNA and dnaK relationships of Bradyrhizobium sp. nodule bacteria from four papilionoid legume trees in Costa Rica.

    PubMed

    Parker, Matthew A

    2004-05-01

    Enzyme electrophoresis and sequencing of rRNA and dnaK genes revealed high genetic diversity among root nodule bacteria from the Costa Rican trees Andira inermis, Dalbergia retusa, Platymiscium pinnatum (Papilionoideae tribe Dalbergieae) and Lonchocarpus atropurpureus (Papilionoideae tribe Millettieae). A total of 21 distinct multilocus genotypes [ETs (electrophoretic types)] was found among the 36 isolates analyzed, and no ETs were shared in common by isolates from different legume hosts. However, three of the ETs from D. retusa were identical to Bradyrhizobium sp. isolates detected in prior studies of several other legume genera in both Costa Rica and Panama. Nearly full-length 16S rRNA sequences and partial 23S rRNA sequences confirmed that two isolates from D. retusa were highly similar or identical to Bradyrhizobium strains isolated from the legumes Erythrina and Clitoria (Papilionoideae tribe Phaseoleae) in Panama. rRNA sequences for five isolates from L. atropurpureus, P. pinnatum and A. inermis were not closely related to any currently known strains from Central America or elsewhere, but had affinities to the reference strains Bradyrhizobium japonicum USDA 110 (three isolates) or to B. elkanii USDA 76 (two isolates). A phylogenetic tree for 21 Bradyrhizobium strains based on 603 bp of the dnaK gene showed several significant conflicts with the rRNA tree, suggesting that genealogical relationships may have been altered by lateral gene transfer events. PMID:15214639

  13. [Strategy of selecting 16S rRNA hypervariable regions for metagenome-phylogenetic marker genes based analysis].

    PubMed

    Zhang, Jun-yi; Zhu, Bing-chuan; Xu, Chao; Ding, Xiao; Li, Jun-feng; Zhang, Xue-gong; Lu, Zu-hong

    2015-11-01

    The advent of next generation sequencing technology enables parallel analysis of the whole microbial community from multiple samples. Particularly, sequencing 16S rRNA hypervariable tags has become the most efficient and cost-effective method for assessing microbial diversity. Due to its short read length of the 2nd-generation sequencing methods that cannot cover the full 16S rRNA genomic region, specific hypervariable regions or V-regions must be selected to act as the proxy. Over the past decade, selection of V-regions has not been consistent in assessing microbial diversity. Here we evaluated the current strategies of selecting 16S rRNA hypervariable regions for surveying microbial diversity. The environmental condition was considered as one of the important factors for selection of 16S rRNA hypervariable regions. We suggested that a pilot study to test different V-regions is required in bacterial diversity studies based on 16S rRNA genes.

  14. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-10-11

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years.

  15. Enterococcus lactis sp. nov., from Italian raw milk cheeses.

    PubMed

    Morandi, Stefano; Cremonesi, Paola; Povolo, Milena; Brasca, Milena

    2012-08-01

    Ten atypical Enterococcus strains were isolated from Italian raw milk cheeses. The 16S rRNA gene, phenylalanyl-tRNA synthase alpha subunit (pheS), RNA polymerase alpha subunit (rpoA) and the 16S-23S rRNA intergenic transcribed spacer (ITS) sequences, randomly amplified polymorphic DNA (RAPD) PCR and the phenotypic properties revealed that the isolates represent a novel enterococcal species. On the basis of 16S rRNA gene sequence analysis, the isolates were closely related to Enterococcus hirae ATCC 8043(T), Enterococcus durans CECT 411(T) and Enterococcus faecium ATCC 19434(T), with 98.8, 98.9 and 99.4% sequence similarity, respectively. On the basis of sequence analysis of the housekeeping gene pheS, the reference strain, BT159(T), occupied a position separate from E. faecium LMG 16198. The group of isolates could be easily differentiated from recognized species of the genus Enterococcus by 16S-23S rRNA ITS analysis, RAPD-PCR and phenotypic characteristics. The name Enterococcus lactis sp. nov. is proposed, with BT159(T) ( = DSM 23655(T) = LMG 25958(T)) as the type strain.

  16. International Perspectives.

    ERIC Educational Resources Information Center

    Allen, Kenn; Habermann, Ulla; Chowdhury, Omar Faruque; Guerra, Iraida Manzanilla

    1998-01-01

    Includes "Introduction to International Perspectives" (Allen); "Volunteerism in the Welfare State: The Case of Denmark" (Habermann); "Grassroots Organizing in Bangladesh" (Chowdhury); and "Volunteerism in Latin America" (Guerra). (SK)

  17. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  18. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  19. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  20. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  1. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta.

    PubMed

    Mackey, L Y; Winnepenninckx, B; De Wachter, R; Backeljau, T; Emschermann, P; Garey, J R

    1996-05-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

  2. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.

    PubMed

    Dorsch, M; Lane, D; Stackebrandt, E

    1992-01-01

    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  3. Virtual metagenome reconstruction from 16S rRNA gene sequences.

    PubMed

    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao

    2012-01-01

    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  4. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.

    PubMed

    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J

    2000-09-01

    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  5. Origin of the Mesozoa inferred from 18S rRNA gene sequences.

    PubMed

    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L

    1996-10-01

    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  6. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded.

  7. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  8. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  9. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  10. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    PubMed

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  11. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  12. Ribosome biogenesis requires a highly diverged XRN family 5'->3' exoribonuclease for rRNA processing in Trypanosoma brucei.

    PubMed

    Sakyiama, Joseph; Zimmer, Sara L; Ciganda, Martin; Williams, Noreen; Read, Laurie K

    2013-10-01

    Although biogenesis of ribosomes is a crucial process in all organisms and is thus well conserved, Trypanosoma brucei ribosome biogenesis, of which maturation of rRNAs is an early step, has multiple points of divergence. Our aim was to determine whether in the processing of the pre-rRNA precursor molecule, 5'→3' exoribonuclease activity in addition to endonucleolytic cleavage is necessary in T. brucei as in other organisms. Our approach initiated with the bioinformatic identification of a putative 5'→3' exoribonuclease, XRNE, which is highly diverged from the XRN2/Rat1 enzyme responsible for rRNA processing in other organisms. Tagging this protein in vivo allowed us to classify XRNE as nucleolar by indirect immunofluorescence and identify by copurification interacting proteins, many of which were ribosomal proteins, ribosome biogenesis proteins, and/or RNA processing proteins. To determine whether XRNE plays a role in ribosome biogenesis in procyclic form cells, we inducibly depleted the protein by RNA interference. This resulted in the generation of aberrant preprocessed 18S rRNA and 5' extended 5.8S rRNA, implicating XRNE in rRNA processing. Polysome profiles of XRNE-depleted cells demonstrated abnormal features including an increase in ribosome small subunit abundance, a decrease in large subunit abundance, and defects in polysome assembly. Furthermore, the 5' extended 5.8S rRNA in XRNE-depleted cells was observed in the large subunit, monosomes, and polysomes in this gradient. Therefore, the function of XRNE in rRNA processing, presumably due to exonucleolytic activity very early in ribosome biogenesis, has consequences that persist throughout all biogenesis stages.

  13. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    PubMed

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  14. Measurement of rRNA Variations in Natural Communities of Microorganisms on the Southeastern U.S. Continental Shelf †

    PubMed Central

    Kramer, Jonathan G.; Singleton, Fred L.

    1993-01-01

    The development of a clear understanding of the physiology of marine prokaryotes is complicated by the difficulties inherent in resolving the activity of various components of natural microbial communities. Application of appropriate molecular biological techniques offers a means of overcoming some of these problems. In this regard, we have used direct probing of bulk RNA purified from selective size fractions to examine variations in the rRNA content of heterotrophic communities and Synechococcus populations on the southeastern U.S. continental shelf. Heterotrophic communities in natural seawater cultures amended with selected substrates were examined. Synechococcus populations were isolated from the water column by differential filtration. The total cellular rRNA content of the target populations was assayed by probing RNA purified from these samples with an oligonucleotide complementing a universally conserved region in the eubacterial 16S rRNA (heterotrophs) or with a 1.5-kbp fragment encoding the Synechococcus sp. strain WH 7803 16S rRNA (cyanobacteria). The analyses revealed that heterotrophic bacteria responded to the addition of glucose and trace nutrients after a 6-h lag period. However, no response was detected after amino acids were added. The cellular rRNA content increased 48-fold before dropping to a value 20 times that detected before nutrients were added. Variations in the rRNA content from Synechococcus spp. followed a distinct diel pattern imposed by the phasing of cell division within the irradiance cycle. The results indicate that careful application of these appropriate molecular biological techniques can be of great use in discerning basic physiological characteristics of selected natural populations and the mechanisms which regulate growth at the subcellular level. Images PMID:16349009

  15. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  16. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.

    PubMed

    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V

    2015-02-25

    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  17. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  18. International Curriculums.

    ERIC Educational Resources Information Center

    Neal, Larry L.

    This workshop presentation on international curriculums in the field of parks, recreation, leisure, cultural services, and travel/tourism comments that the literature is replete with articles addressing what the field is about, but not about curriculum issues, models, and structure. It reports an international survey of 12 college educators…

  19. Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

    PubMed

    Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

    2013-07-01

    Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei.

  20. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    PubMed

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  1. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  2. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.

    PubMed

    Parker, A; Kornfield, I

    1996-08-01

    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  3. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    PubMed Central

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  4. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.

    PubMed

    Weller, R; Ward, D M

    1989-07-01

    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  5. Complete genome sequence of Microbacterium sp. CGR1, bacterium tolerant to wide abiotic conditions isolated from the Atacama Desert.

    PubMed

    Mandakovic, Dinka; Cabrera, Pablo; Pulgar, Rodrigo; Maldonado, Jonathan; Aravena, Pamela; Latorre, Mauricio; Cambiazo, Verónica; González, Mauricio

    2015-12-20

    Microbacterium sp. CGR1 (RGM2230) is an isolate from the Atacama Desert that displays a wide pH, salinity and temperature tolerance. This strain exhibits riboflavin overproducer features and traits for developing an environmental arsenic biosensor. Here, we report the complete genome sequence of this strain, which represents the first genome of the genus Microbacterium sequenced and assembled in a single contig. The genome contains 3,634,864bp, 3299 protein-coding genes, 45 tRNAs, six copies of 5S-16S-23S rRNA and a high genome average GC-content of 68.04%.

  6. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and high-resolution melt real-time PCR as diagnostic methods.

    PubMed

    Gutiérrez, Ricardo; Morick, Danny; Gross, Ifat; Winkler, Ronen; Abdeen, Ziad; Harrus, Shimon

    2013-12-01

    To determine the occurrence of feline bartonellosis in Israel, blood samples were collected from 179 stray and 155 domestic cats from 18 cities or villages in central and northcentral Israel. Samples were screened for Bartonella infection by culture isolation and molecular detection using high-resolution melt (HRM) real-time PCR assay targeting the 16S-23S rRNA internal transcribed spacer (ITS). All positive samples were confirmed by two additional HRM real-time PCR assays targeting two fragments of the β-subunit of RNA polymerase (rpoB) and the 16S rRNA genes. The prevalence of Bartonella spp. infection in the general tested population was 25.1% (84/334). A higher prevalence was detected in the stray (30.7%; 55/179) than the domestic cats (18.7%; 29/155). Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae were highly prevalent in both cat populations, however their distribution among the two populations varied significantly (p=0.016). B. clarridgeiae and B. koehlerae were found to be more prevalent in stray than domestic cats, whereas B. henselae was evenly distributed. Co-infection with two or more different Bartonella spp. was determined in 2.1% (7) of the cats. The ITS HRM real-time PCR assay used in this study was shown to have a greater screening power than bacterial isolation, detecting 94.0% (79/84) compared to 35.7% (30/84), respectively, of all positive samples. The high prevalence of these zoonotic Bartonella species, coupled with the overpopulation of stray cats, and increased numbers of domestic cats in the major urban centers in Israel represent a significant threat for the public health in this country.

  7. Effect of incubation temperature on the detection of thermophilic campylobacter species from freshwater beaches, nearby wastewater effluents, and bird fecal droppings.

    PubMed

    Khan, Izhar U H; Hill, Stephen; Nowak, Eva; Edge, Thomas A

    2013-12-01

    This large-scale study compared incubation temperatures (37°C versus 42°C) to study the detection of thermophilic Campylobacter species, including Campylobacter jejuni, C. coli, and C. lari, in various surface water samples and bird fecal droppings around Hamilton Harbor, Lake Ontario. The putative culture isolates obtained from incubation temperatures of 37 and 42°C were confirmed by Campylobacter genus- and species-specific triplex PCR assays targeting the 16S rRNA gene and the 16S-23S rRNA gene internal transcribed spacer (ITS) region. A total of 759 water, wastewater, and bird fecal dropping samples were tested. Positive amplification reactions for the genus Campylobacter were found for 454 (60%) samples incubated at 37°C, compared to 258 (34%) samples incubated at 42°C. C. jejuni (16%) and C. lari (12%) were detected significantly more frequently at the 42°C incubation temperature than at 37°C (8% and 5%, respectively). In contrast, significantly higher rates of C. coli (14%) and other Campylobacter spp. (36%) were detected at the 37°C incubation temperature than at 42°C (8% and 7%, respectively). These results were consistent across surface water, wastewater, and bird fecal dropping samples. At times, Campylobacter spp. were recovered and detected at 37°C (3% for C. jejuni, 10% for C. coli, and 3% for C. lari) when the same samples incubated at 42°C were negative. A significantly higher rate of other Campylobacter spp. was detected only at 37°C (32%) than only at 42°C (3%). These results indicate that incubation temperature can significantly influence the culturability and detection of thermophilic and other fastidious Campylobacter spp. and that a comprehensive characterization of the Campylobacter spp. in surface water, wastewaters, or bird fecal droppings will require incubation at both 37 and 42°C.

  8. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    PubMed

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa.

  9. Uneven distribution of Halobacillus trueperi species in arid natural saline systems of Southern Tunisian Sahara.

    PubMed

    Guesmi, Amel; Ettoumi, Besma; El Hidri, Darine; Essanaa, Jihene; Cherif, Hanene; Mapelli, Francesca; Marasco, Ramona; Rolli, Eleonora; Boudabous, Abdellatif; Cherif, Ameur

    2013-11-01

    The genetic diversity of a collection of 336 spore-forming isolates recovered from five salt-saturated brines and soils (Chott and Sebkhas) mainly located in the hyper-arid regions of the southern Tunisian Sahara has been assessed. Requirements and abilities for growth at a wide range of salinities\\ showed that 44.3 % of the isolates were extremely halotolerant, 23 % were moderate halotolerant, and 32.7 % were strict halophiles, indicating that they are adapted to thrive in these saline ecosystems. A wide genetic diversity was documented based on 16S-23S rRNA internal transcribed spacer fingerprinting profiles (ITS) and 16S rRNA gene sequences that clustered the strains into seven genera: Bacillus, Gracilibacillus, Halobacillus, Oceanobacillus, Paenibacillus, Pontibacillus, and Virgibacillus. Halobacillus trueperi was the most encountered species in all the sites and presented a large intraspecific diversity with a multiplicity of ITS types. The most frequent ITS type included 42 isolates that were chosen for assessing of the intraspecific diversity by BOX-PCR fingerprinting. A high intraspecific microdiversity was documented by 14 BOX-PCR genotypes whose distribution correlated with the strain geographic origin. Interestingly, H. trueperi isolates presented an uneven geographic distribution among sites with the highest frequency of isolation from the coastal sites, suggesting a marine rather than terrestrial origin of the strains. The high frequency and diversity of H. trueperi suggest that it is a major ecosystem-adapted microbial component of the Tunisian Sahara harsh saline systems of marine origin. PMID:23949950

  10. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  11. International Health

    MedlinePlus

    ... create refugee populations with immediate and long-term health problems. Some of the major diseases currently affecting ... also an international problem which can affect people's health. Many countries and health organizations are working together ...

  12. International Reports.

    ERIC Educational Resources Information Center

    Valauskas, Edward J.; Stowe, Jennifer L.; Haycock, Ken; Dodd, Frances

    1998-01-01

    Presents three reports: International Federation of Library Associations and Institutions; Special Libraries Association; and Canadian library trends, focusing on information technology and access to information and rights and examining provincial libraries and library education. (PEN)

  13. International Geology

    ERIC Educational Resources Information Center

    Hoover, Linn

    1977-01-01

    Briefly discusses recent international programs in various areas of geology, including land-use problems, coping with geological hazards, and conserving the environment while searching for energy and mineral resources. (MLH)

  14. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  15. Uracil content of 16S rRNA of thermophilic and psychrophilic prokaryotes correlates inversely with their optimal growth temperatures

    PubMed Central

    Khachane, Amit N.; Timmis, Kenneth N.; dos Santos, Vítor A. P. Martins

    2005-01-01

    We report here the finding of a highly significant inverse correlation of the uracil content of 16S rRNA and the optimum growth temperature (Topt) of cultured thermophilic and psychrophilic prokaryotes. This correlation was significantly different from the weaker correlations between the contents of other nucleotides and Topt. Analysis of the 16S rRNA secondary structure regions revealed a fall in the A:U base-pair content in step with the increase in Topt that was much steeper than that of mismatched base-pairs, which are thermodynamically less stable. These findings indicate that the 16S rRNA sequences of thermophiles and psychrophiles are under a strong thermo-adaptive pressure, and that structure–function constraints play a crucial role in determining their 16S rRNA nucleotide composition. The derived relationship between uracil content and Topt was used to develop an algorithm to predict the Topt values of uncultured prokaryotes lacking cultured close relatives and belonging to the phyla predominantly containing thermophiles. This algorithm may be useful in guiding the design of cultivation conditions for hitherto uncultured microbes. PMID:16030352

  16. rRNA operons and genome size of 'Candidatus Liberibacter americanus', a bacterium associated with citrus huanglongbing in Brazil.

    PubMed

    Wulff, N A; Eveillard, S; Foissac, X; Ayres, A J; Bové, J-M

    2009-08-01

    Huanglongbing is one of the most severe diseases of citrus worldwide and is associated with 'Candidatus (Ca.) Liberibacter africanus' in Africa, 'Ca. Liberibacter asiaticus' in Asia and the Americas (Brazil, USA and Cuba) and 'Ca. Liberibacter americanus' (Lam) in Brazil. In the absence of axenic cultures, genetic information on liberibacters is scarce. The sequences of the entire 23S rRNA and 5S rRNA genes from Lam have now been obtained, using a consensus primer designed on known tRNAMet sequences of rhizobia. The size of the Lam genome was determined by PFGE, using Lam-infected periwinkle plants for bacterial enrichment, and was found to be close to 1.31 Mbp. In order to determine the number of ribosomal operons on the Lam genome, probes designed to detect the 16S rRNA gene and the 3' end of the 23S rRNA gene were developed and used for Southern hybridization with I-CeuI-treated genomic DNA. Our results suggest that there are three ribosomal operons in a circular genome. Lam is the first liberibacter species for which such data are available.

  17. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    PubMed Central

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  18. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  19. Distinct Ectomycorrhizospheres Share Similar Bacterial Communities as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes

    PubMed Central

    Oger, P.; Morin, E.; Frey-Klett, P.

    2012-01-01

    Analysis of the 16S rRNA gene sequences generated from Xerocomus pruinatus and Scleroderma citrinum ectomycorrhizospheres revealed that similar bacterial communities inhabited the two ectomycorrhizospheres in terms of phyla and genera, with an enrichment of the Burkholderia genus. Compared to the bulk soil habitat, ectomycorrhizospheres hosted significantly more Alpha-, Beta-, and Gammaproteobacteria. PMID:22307291

  20. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  1. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  2. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    PubMed Central

    Pettersson, B; Johansson, K E; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing was performed in both directions. One previously unclassified avian mycoplasma was found to belong to the Mycoplasma lipophilum cluster of the hominis group. Microheterogeneities were discovered in the rRNA operons of Mycoplasma mycoides subsp. mycoides (SC type), confirming the existence of two different rRNA operons. The 16S rRNA sequence of M. mycoides subsp. capri was identical to that of M. mycoides subsp. mycoides (type SC), except that no microheterogeneities were revealed. Furthermore, automated solid-phase DNA sequencing was used to identify a mycoplasmal contamination of a cell culture as Mycoplasma hyorhinis, which proved to be very difficult by conventional methods. The results suggest that the direct solid-phase DNA sequencing procedure is a powerful tool for identification of mycoplasmas and is also useful in taxonomic studies. Images PMID:7521158

  3. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A.

    PubMed

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-06-05

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation.

  4. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  5. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila

    SciTech Connect

    Butler, D.K.; Yasuda, L.E.; Yao, Meng-Chao

    1995-12-01

    This report discusses the formation of rRNA gene palindrome in Tetrahymena thermophila and the involvement of intramolecular recombination. This, along with the authors` previous study, is the first to define a molecular pathway of palindrome formation. 48 refs., 6 figs.

  6. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  7. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    PubMed

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  8. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    PubMed

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts.

  9. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and relevance to genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  10. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing this important fish pathogen. Interpretation of restriction patterns can be difficult due to th...

  11. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  12. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei

    PubMed Central

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K. Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  13. First report of neonatal bacteremia caused by "Haemophilus quentini" diagnosed by 16S rRNA gene sequencing, Italy.

    PubMed

    Giufrè, Maria; Cardines, Rita; Degl'Innocenti, Roberto; Cerquetti, Marina

    2015-10-01

    We report the first case of neonatal bacteremia caused by a "Haemophilus quentini" isolate in Italy. The isolate was differentiated from H. influenzae by 16S rRNA sequencing and was characterized by comparison with the wild-type "H. quentini" CCUG 36167. Both isolates carried substitutions in penicillin-binding protein 3 but were susceptible to aminopenicillins.

  14. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment.

    PubMed

    LaFrentz, B R; Waldbieser, G C; Welch, T J; Shoemaker, C A

    2014-07-01

    Genetic variability in 16S rRNA gene sequences has been demonstrated among isolates of Flavobacterium columnare, and a restriction fragment length polymorphism (RFLP) assay is available for genetic typing of this important fish pathogen. Interpretation of restriction patterns can be difficult due to the lack of a formal description of the expected number and sizes of DNA fragments generated for each of the described genomovars. In this study, partial 16S rRNA gene sequences (ca. 1250-bp fragment) from isolates representing each described genomovar and isolates generating unique restriction patterns were cloned and sequenced. The results demonstrated that some isolates contained up to three different 16S rRNA genes whose sequences generate different RFLP patterns due to intragenomic heterogeneity within HaeIII restriction sites. The occurrence of HaeIII restriction sites within the portion of the 16S rRNA gene used for typing the F. columnare isolates and intragenomic heterogeneity within these sites explained the restriction patterns observed following RFLP analyses. This research provides a standard protocol for typing isolates of F. columnare by RFLP and a formal description of the expected restriction patterns for the previously described genomovars I, II, II-B and III. Additionally, we describe a new genomovar, I/II.

  15. Functional importance of individual rRNA 2′-O-ribose methylations revealed by high-resolution phenotyping

    PubMed Central

    Esguerra, Jonathan; Warringer, Jonas; Blomberg, Anders

    2008-01-01

    Ribosomal RNAs contain numerous modifications at specific nucleotides. Despite their evolutionary conservation, the functional role of individual 2′-O-ribose methylations in rRNA is not known. A distinct family of small nucleolar RNAs, box C/D snoRNAs, guides the methylating complex to specific rRNA sites. Using a high-resolution phenotyping approach, we characterized 20 box C/D snoRNA gene deletions for altered growth dynamics under a wide array of environmental perturbations, encompassing intraribosomal antibiotics, inhibitors of specific cellular features, as well as general stressors. Ribosome-specific antibiotics generated phenotypes indicating different and long-ranging structural effects of rRNA methylations on the ribosome. For all studied box C/D snoRNA mutants we uncovered phenotypes to extraribosomal growth inhibitors, most frequently reflected in alteration in growth lag (adaptation time). A number of strains were highly pleiotropic and displayed a great number of sensitive phenotypes, e.g., deletion mutants of snR70 and snR71, which both have clear human homologues, and deletion mutants of snR65 and snR68. Our data indicate that individual rRNA ribose methylations can play either distinct or general roles in the workings of the ribosome. PMID:18256246

  16. 23S rRNA gene mutations contributing to macrolide resistance in Campylobacter jejuni and Campylobacter coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Operon specific 23S rRNA mutations affecting minimum inhibitory concentrations (MICs) of macrolides (erythromycin [ERY], azithromycin [AZM], tylosin [TYL]) and a lincosamide (clindamycin [CLI]) were examined in a collection of Campylobacter jejuni and C. coli isolates. The three copies of the Campy...

  17. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates.

    PubMed

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Chujo, Takeshi; Ishigami, Yuma; Chemla, Yonatan; Blumberg, Amit; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-09-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  18. Differential rRNA genes expression in bread wheat and its inheritance.

    PubMed

    Carvalho, Ana; Polanco, Carlos; Guedes-Pinto, Henrique; Lima-Brito, José

    2013-09-01

    The expression of the ribosomal RNA (rRNA) genes from rye, located within the nucleolus organizer regions (NORs), is repressed by cytosine methylation in wheat x rye hybrids and in triticale, as consequence of nucleolar dominance. Our previous study revealed that bread wheat cultivars with a maximum number of four Ag-NORs presented high level of rDNA cytosine methylation when compared to others with a maximum of six Ag-NORs. In order to evaluate the inheritance of the Ag-NORs number and NOR methylation patterns, we produced F1 hybrids between bread wheat cultivars with four Ag-NORs and bread wheat cultivars with six Ag-NORs (in the direct and reciprocal senses). The F2 progenies of these F1 hybrids were also evaluated for the NOR number and methylation patterns. Parent bread wheat cultivars with a maximum of four Ag-NORs after treated with 5-azacytidine evidenced a maximum of six Ag-NORs per metaphase cell and a maximum of six nucleoli per interphase nucleus, confirming that the expression of the rRNA genes in bread wheat is related to cytosine methylation. Most of the F1 hybrids showed a maximum number of four or six Ag-NORs, similarly to that of the female parent suggesting a non-mendelian inheritance, while other hybrids presented four or six Ag-NORs in both senses of the cross. The F1 NOR methylation patterns showed some fragments common to their parents but also novel fragments suggesting genomic and/or chromosome rearrangements after hybridization. Despite the different NOR patterns among the parents, an invariable NOR pattern was found among the F1 plants suggesting a tendency to stability, which was also transmitted to the F2. The F2 progenies showed plants with a maximum of four, five and/or six Ag-NORs. The ratio of plants with four, five and/or six Ag-NORs per F2 progeny was variable and did not follow any specific mendelian proportion. These results allowed us to suggest that the inheritance of the number of Ag-NORs by the F1 and F2 plants did not

  19. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    PubMed

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  20. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    PubMed

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  1. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  2. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  3. Two Cases of Mycoplasma pneumoniae Pneumonia with A2063G Mutation in the 23S rRNA Gene in Siblings

    PubMed Central

    Hong, Joo Hee; Chun, Jin Kyong; Oh, Ki Jin; Kim, Juwon; Yoon, Kap Jun

    2013-01-01

    We describe 2 cases of pneumonia caused by the same macrolide-resistant Mycoplasma pneumoniae in siblings. M. pneumoniae was identified using real-time PCR. Direct sequence analysis of the 23S rRNA gene revealed a point mutation in V domain (A2063G) of the 23S rRNA gene. PMID:23301225

  4. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  5. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  6. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  7. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences

    PubMed Central

    Langille, Morgan G. I.; Zaneveld, Jesse; Caporaso, J. Gregory; McDonald, Daniel; Knights, Dan; Reyes, Joshua A.; Clemente, Jose C.; Burkepile, Deron E.; Vega Thurber, Rebecca L.; Knight, Rob; Beiko, Robert G.; Huttenhower, Curtis

    2013-01-01

    Profiling phylogenetic marker genes, such as the 16S rRNA gene, is a key tool for studies of microbial communities but does not provide direct evidence of a community’s functional capabilities. Here we describe PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States), a computational approach to predict the functional composition of a metagenome using marker gene data and a database of reference genomes. PICRUSt uses an extended ancestral-state reconstruction algorithm to predict which gene families are present and then combines gene families to estimate the composite metagenome. Using 16S information, PICRUSt recaptures key findings from the Human Microbiome Project and accurately predicts the abundance of gene families in host-associated and environmental communities, with quantifiable uncertainty. Our results demonstrate that phylogeny and function are sufficiently linked that this ‘predictive metagenomic’ approach should provide useful insights into the thousands of uncultivated microbial communities for which only marker gene surveys are currently available. PMID:23975157

  8. CATCh, an ensemble classifier for chimera detection in 16S rRNA sequencing studies.

    PubMed

    Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen; Monsieurs, Pieter

    2015-03-01

    In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

  9. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGESBeta

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  10. 16S rRNA targeted DGGE fingerprinting of microbial communities.

    PubMed

    Tzeneva, Vesela A; Heilig, Hans G H J; van Vliet, Wilma Akkermans; Akkermans, Antoon D L; de Vos, Willem M; Smidt, Hauke

    2008-01-01

    The past decades have seen the staggering development of molecular microbial ecology as a discipline that uses the detection of so-called biomarkers to monitor microbial communities in environment samples. A variety of molecules can be used as biomarkers, including cell-wall components, proteins, lipids, DNA or RNA. Especially, the application of small subunit ribosomal RNA (rRNA) and the corresponding genes have proven invaluable for advances in microbial ecology. Several types of fingerprinting methods have been developed for the description of microbial communities in environmental samples. Among the most commonly used approaches is denaturing gradient gel electrophoresis (DGGE) of PCR-amplified fragments. DGGE allows separation of DNA fragment mixtures of equal length depending on their sequence. The separation is based on their sequence-specific melting point in a polyacrylamide gel with a gradient of a denaturant chemical (generally a combination of urea and formamide). DGGE allows for a rapid analysis and comparison of microbial communities. Compositional diversity can be visualized using DGGE where each band in principle represents a bacterial phylotype. After staining bands are visualized at each position in the gel where DNA molecules stopped migration. In principle, DGGE fingerprinting can resolve single base pair differences.

  11. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  12. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    PubMed Central

    Javadi Nobandegani, Mohammad Bagher; Saud, Halimi Mohd; Yun, Wong Mui

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer) in an oil palm field. PMID:25632387

  13. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  14. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  15. Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple plastid losses and replacements.

    PubMed

    Saldarriaga, J F; Taylor, F J; Keeling, P J; Cavalier-Smith, T

    2001-09-01

    Dinoflagellates are a trophically diverse group of protists with photosynthetic and non-photosynthetic members that appears to incorporate and lose endosymbionts relatively easily. To trace the gain and loss of plastids in dinoflagellates, we have sequenced the nuclear small subunit rRNA gene of 28 photosynthetic and four non-photosynthetic species, and produced phylogenetic trees with a total of 81 dinoflagellate sequences. Patterns of plastid gain, loss, and replacement were plotted onto this phylogeny. With the exception of the apparently early-diverging Syndiniales and Noctilucales, all non-photosynthetic dinoflagellates are very likely to have had photosynthetic ancestors with peridinin-containing plastids. The same is true for all dinoflagellates with plastids other than the peridinin-containing plastid: their ancestors have replaced one type of plastid for another, in some cases most likely through a non-photosynthetic intermediate. Eight independent instances of plastid loss and three of replacement can be inferred from existing data, but as more non-photosynthetic lineages are characterized these numbers will surely grow.

  16. The nuclear phenotypic plasticity observed in fish during rRNA regulation entails Cajal bodies dynamics

    SciTech Connect

    Alvarez, Marco; Nardocci, Gino; Thiry, Marc; Alvarez, Rodrigo; Reyes, Mauricio; Molina, Alfredo; Vera, M. Ines . E-mail: mvera@unab.cl

    2007-08-17

    Cajal bodies (CBs) are small mobile organelles found throughout the nucleoplasm of animal and plant cells. The dynamics of these organelles involves interactions with the nucleolus. The later has been found to play a substantial role in the compensatory response that evolved in eurythermal fish to adapt to the cyclic seasonal habitat changes, i.e., temperature and photoperiod. Contrary to being constitutive, rRNA synthesis is dramatically regulated between summer and winter, thus affecting ribosomal biogenesis which plays a central role in the acclimatization process. To examine whether CBs, up to now, never described in fish, were also sustaining the phenotypic plasticity observed in nuclei of fish undergoing seasonal acclimatization, we identified these organelles both, by transmission electronic microscopy and immunodetection with the marker protein p80-coilin. We found transcripts in all tissues analyzed. Furthermore we assessed that p80-coilin gene expression was always higher in summer-acclimatized fish when compared to that adapted to the cold season, indicating that p80-coilin expression is modulated upon seasonal acclimatization. Concurrently, CBs were more frequently found in summer-acclimatized carp which suggests that the organization of CBs is involved in adaptive processes and contribute to the phenotypic plasticity of fish cell nuclei observed concomitantly with profound reprogramming of nucleolar components and regulation of ribosomal rRNAs.

  17. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  18. Molecular detection of adulteration in chicken products based on mitochondrial 12S rRNA gene.

    PubMed

    Abuzinadah, Osama H A; Yacoub, Haitham Ahmed; El Ashmaoui, Hassan M; Ramadan, Hassan A I

    2015-06-01

    The aim of this study is to detect the fraudulent in chicken products constitutes in order to protect consumers in Saudi Arabia from illegal substitutions. Two different approaches were used in this study, direct sequencing of specific fragments of amplified mitochondrial 12S rRNA gene in addition to species-specific PCR primers for confirmation of the obtained Blast search results. The results showed that all processed chicken products were identified as chicken (Gallus gallus) by 90-98% homology depending on obtained sequence quality. Samples labeled with chicken luncheon (samples tested in this study) were identified as turkey meat (Meleagris gallopavo) by 98% homology, suggesting adulteration with inedible parts of turkey in chicken luncheon ingredients. The results showed also that not only chicken luncheon was mixed with inedible parts of turkey but also all chicken products tested in this study (chicken balls, chicken burger, chicken sausage and chicken mined meat) contained this turkey meat. Applying methods used in this study could be useful for accurate and rapid identification of commercial processed meat.

  19. Formation of Tertiary Interactions during rRNA GTPase Center Folding.

    PubMed

    Rau, Michael J; Welty, Robb; Tom Stump, W; Hall, Kathleen B

    2015-08-28

    The 60-nt GTPase center (GAC) of 23S rRNA has a phylogenetically conserved secondary structure with two hairpin loops and a 3-way junction. It folds into an intricate tertiary structure upon addition of Mg(2+) ions, which is stabilized by the L11 protein in cocrystal structures. Here, we monitor the kinetics of its tertiary folding and Mg(2+)-dependent intermediate states by observing selected nucleobases that contribute specific interactions to the GAC tertiary structure in the cocrystals. The fluorescent nucleobase 2-aminopurine replaced three individual adenines, two of which make long-range stacking interactions and one that also forms hydrogen bonds. Each site reveals a unique response to Mg(2+) addition and temperature, reflecting its environmental change from secondary to tertiary structure. Stopped-flow fluorescence experiments revealed that kinetics of tertiary structure formation upon addition of MgCl2 are also site specific, with local conformational changes occurring from 5 ms to 4s and with global folding from 1 to 5s. Site-specific substitution with (15)N-nucleobases allowed observation of stable hydrogen bond formation by NMR experiments. Equilibrium titration experiments indicate that a stable folding intermediate is present at stoichiometric concentrations of Mg(2+) and suggest that there are two initial sites of Mg(2+) ion association. PMID:26210661

  20. Nearly complete rRNA genes from 371 Animalia: updated structure-based alignment and detailed phylogenetic analysis.

    PubMed

    Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

    2012-09-01

    This study presents a manually constructed alignment of nearly complete rRNA genes from most animal clades (371 taxa from ~33 of the ~36 metazoan phyla), expanded from the 197 sequences in a previous study. This thorough, taxon-rich alignment, available at http://www.wsu.edu/~jmallatt/research/rRNAalignment.html and in the Dryad Repository (doi: http://dx.doi.org/10.5061/dryad.1v62kr3q), is based rigidly on the secondary structure of the SSU and LSU rRNA molecules, and is annotated in detail, including labeling of the erroneous sequences (contaminants). The alignment can be used for future studies of the molecular evolution of rRNA. Here, we use it to explore if the larger number of sequences produces an improved phylogenetic tree of animal relationships. Disappointingly, the resolution did not improve, neither when the standard maximum-likelihood method was used, nor with more sophisticated methods that partitioned the rRNA into paired and unpaired sites (stem, loop, bulge, junction), or accounted for the evolution of the paired sites. For example, no doublet model of paired-site substitutions (16-state, 16A and 16B, 7A-F, or 6A-C models) corrected the placement of any rogue taxa or increased resolution. The following findings are from the simplest, standard, ML analysis. The 371-taxon tree only imperfectly supported the bilaterian clades of Lophotrochozoa and Ecdysozoa, and this problem remained after 17 taxa with unstably positioned sequences were omitted from the analysis. The problem seems to stem from base-compositional heterogeneity across taxa and from an overrepresentation of highly divergent sequences among the newly added taxa (e.g., sequences from Cephalopoda, Rotifera, Acoela, and Myxozoa). The rogue taxa continue to concentrate in two locations in the rRNA tree: near the base of Arthropoda and of Bilateria. The approximately uncertain (AU) test refuted the monophyly of Mollusca and of Chordata, probably due to long-branch attraction of the highly

  1. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  2. Internal shim

    DOEpatents

    Barth, Clyde H.; Blizinski, Theodore W.

    2003-05-13

    An internal shim used to accurately measure spaces in conjunction with a standard small probe has a shim top and a chassis. The internal shim is adjustably fixed within the space to be measured using grippers that emerge from the chassis and which are controlled by an arm pivotably attached to the shim top. A standard small probe passes through the shim along guides on the chassis and measures the distance between the exterior of the chassis and the boundary. By summing the measurements on each side of the chassis and the width of the chassis, the dimension of the space can be determined to within 0.001 inches.

  3. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

    PubMed

    Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  4. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    PubMed Central

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  5. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  6. International Reports.

    ERIC Educational Resources Information Center

    Anderson, Nancy D.; And Others

    1994-01-01

    Three reports discuss the International Federation of Library Associations and Institutions; the Frankfurt Book Fair, focusing on electronics; and Canadian library trends, including resource sharing, technology projects, information policy, censorship, services for persons with disabilities, construction projects, and library education and…

  7. International Marketplace.

    ERIC Educational Resources Information Center

    Wells, Donald A.; And Others

    1985-01-01

    This issue begins with a conceptual introduction to economic specialization, exports and imports, and the importance of international trade. Four instructional units follow this introduction, beginning with a preschool and kindergarten unit called "Traders and Travelers," which involves young students in five activities that illustrate our…

  8. Differential gene expression in neurospora crassa cell types: amplification of rRNA genes. Progress report, July 1979-30 June 1980

    SciTech Connect

    Dutta, S.K.

    1980-01-01

    The significant results obtained during 1979 to 1980 of the current research program are as follows: (1) the differential rRNA gene amplification in germinated conidia of N.crassa was confirmed. N.crassa rDNAs showed differences in degrees of homology with isolated DNAs from other Neurospora species which could be due to heterogeneity in internal spacers. Studies with N.crassa rDNA clones were initiated to study their heterogeneities. The organization of the Institutional Biohazard Committee (IBC) for Recombinant DNA research was completed and necessary certifications for the laboratory and the workers were obtained in accordance with the P/sub 2/EK/sub 1/ containment regulation of N.I.H. Known 17S and 26S N.crassa rDNA probes are being used to detect differences, if any, in restriction cleavage sites in rDNAs of different cell types and developmental mutants of N.crassa. DNAs from these N.crassa cells are restricted with EcoR/sub 1/ and Hind III and cleaved fragments separated by gel electrophoresis are transferred into nitrocellulose papers. Experiments are underway now to see if there are any changes in cleavage sites by annealing with /sup 32/P or /sup 3/H-17S or 26S rDNA probes followed by autoradiography.

  9. Genetic diversity of Helicobacter pylori indexed with respect to clinical symptomatology, using a 16S rRNA and a species-specific DNA probe.

    PubMed

    Desai, M; Linton, D; Owen, R J; Cameron, H; Stanley, J

    1993-12-01

    DNA probes are described which identify group and fingerprint strains of the human gastric pathogen Helicobacter pylori, on the basis of well-defined band homologies. A 544 bp internal fragment of the 16S ribosomal RNA gene was generated by polymerase chain reaction (PCR) with primers derived from the Escherichia coli rRNA gene sequence. In genomic Southern blots this probe detected restriction site variation around these loci, generating simple but strain-specific molecular fingerprints. A small conserved chromosomal fragment of 1.2 kbp, Hps, species-specific for H. pylori, was obtained by cloning random HindIII fragments into pUC19. It was useful for dot-blot identification, and also separated isolates into one major and two minor groups. When results for these two probes were combined, a baseline characterization of genotype was obtained. A band-matching database of molecular fingerprints for the type strain and 63 clinical isolates of H. pylori from asymptomatic, ulcer and gastritis contexts is presented. No significant association between the genotypes at this level of definition and the associated clinical symptomatology of the isolates was detected.

  10. Molecular confirmation of Trichomonas gallinae and other parabasalids from Brazil using the 5.8S and ITS-1 rRNA regions.

    PubMed

    Ecco, Roselene; Preis, Ingred S; Vilela, Daniel A R; Luppi, Marcela M; Malta, Marcelo C C; Beckstead, Robert B; Stimmelmayr, Raphaela; Stimmelmayer, Raphaela; Gerhold, Richard W

    2012-11-23

    Clinical, gross, and histopathology lesions and molecular characterization of Trichomonas spp. infection were described in two striped owls (Asio (Rhinoptynx) clamator), one American kestrel (Falco sparverius), two green-winged saltators (Saltator similis), and in a toco toucan (Ramphastos toco) from Brazil. These birds presented clinical signs including emaciation, ruffled feathers, abundant salivation and open mouth breathing presumably due to abundant caseous material. Gross lesions were characterized by multifocal yellow friable plaques on the surface of the tongue, pharynx and/or caseous masses partially occluding the laryngeal entrance. In the owls, the caseous material extended into the mandibular muscles and invaded the sinuses of the skull. Histopathologically, marked necrotic and inflammatory lesions were associated with numerous round to oval, pale eosinophilic structures (6-10μm) with basophilic nuclei, consistent with trichomonads. Organisms similar to those described above also were found in the liver of the two green-winged saltators. To the authors' knowledge, this is the first report of trichomonosis in a striped owl and a toco toucan. Sequence analysis of the Trichomonas spp. internal transcribed spacer 1 (ITS-1) region and partial 5.8S of the ribosomal RNA (rRNA) disclosed significant genetic diversity. Two sequences had 100% identity to Trichomonas gallinae, whereas two sequences had a 99% and 92% identity to a Trichomonas vaginalis-like sequence, respectively. One sequence (green-winged saltator 502-08) had a 100% identity to a newly recognized genus Simplicomonas. PMID:22749289

  11. Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers

    PubMed Central

    Hansson, Ingrid; Persson, Marianne; Svensson, Linda; Engvall, Eva Olsson; Johansson, Karl-Erik

    2008-01-01

    Background Campylobacter is the most commonly reported bacterial cause of enteritis in humans in the EU Member States and other industrialized countries. One significant source of infection is broilers and consumption of undercooked broiler meat. Campylobacter jejuni is the Campylobacter sp. predominantly found in infected humans and colonized broilers. Sequence analysis of the 16S rRNA gene is very useful for identification of bacteria to genus and species level. The objectives in this study were to determine the degree of intraspecific variation in the 16S rRNA genes of C. jejuni and C. coli and to determine whether the 16S rRNA sequence types correlated with genotypes generated by PFGE analysis of SmaI restricted genomic DNA of the strains. Methods The 16S rRNA genes of 45 strains of C. jejuni and two C. coli strains isolated from broilers were sequenced and compared with 16S rRNA sequences retrieved from the Ribosomal Database Project or GenBank. The strains were also genotyped by PFGE after digestion with SmaI. Results Sequence analyses of the 16S rRNA genes revealed nine sequence types of the Campylobacter strains and the similarities between the different sequence types were in the range 99.6–99.9%. The number of nucleotide substitutions varied between one and six among the nine 16S rRNA sequence types. One of the nine 16S rRNA sequence profiles was common to 12 of the strains from our study and two of these were identified as Campylobacter coli by PCR/REA. The other 10 strains were identified as Campylobacter jejuni. Five of the nine sequence types were also found among the Campylobacter sequences deposited in GenBank. The three 16S rRNA genes in the analysed strains were identical within each individual strain for all 47 strains. Conclusion C. jejuni and C. coli seem to lack polymorphisms in their 16S rRNA gene, but phylogenetic analysis based on 16S rRNA sequences was not always sufficient for differentiation between C. jejuni and C. coli. The strains

  12. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Noguera, Daniel R

    2012-02-01

    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu).

  13. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis

    PubMed Central

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-01-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans. PMID:23719154

  14. Emergence of Multidrug-Resistant Campylobacter Species Isolates with a Horizontally Acquired rRNA Methylase

    PubMed Central

    Wang, Yang; Zhang, Maojun; Deng, Fengru; Shen, Zhangqi; Wu, Congming; Zhang, Jianzhong

    2014-01-01

    Antibiotic-resistant Campylobacter constitutes a serious threat to public health, and resistance to macrolides is of particular concern, as this class of antibiotics is the drug of choice for clinical therapy of campylobacteriosis. Very recently, a horizontally transferrable macrolide resistance mediated by the rRNA methylase gene erm(B) was reported in a Campylobacter coli isolate, but little is known about the dissemination of erm(B) among Campylobacter isolates and the association of erm(B)-carrying isolates with clinical disease. To address this question and facilitate the control of antibiotic-resistant Campylobacter, we determined the distribution of erm(B) in 1,554 C. coli and Campylobacter jejuni isolates derived from food-producing animals and clinically confirmed human diarrheal cases. The results revealed that 58 of the examined isolates harbored erm(B) and exhibited high-level resistance to macrolides, and most were recent isolates, derived in 2011-2012. In addition, the erm(B)-positive isolates were all resistant to fluoroquinolones, another clinically important antibiotic used for treating campylobacteriosis. The erm(B) gene is found to be associated with chromosomal multidrug resistance genomic islands (MDRGIs) of Gram-positive origin or with plasmids of various sizes. All MDRGIs were transferrable to macrolide-susceptible C. jejuni by natural transformation under laboratory conditions. Molecular typing of the erm(B)-carrying isolates by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) identified diverse genotypes and outbreak-associated diarrheal isolates. Molecular typing also suggested zoonotic transmission of erm(B)-positive Campylobacter. These findings reveal an emerging and alarming trend of dissemination of erm(B) and MDRGIs in Campylobacter and underscore the need for heightened efforts to control their further spread. PMID:24982085

  15. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota

    PubMed Central

    Ellegaard, Kirsten M.; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630

  16. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis.

    PubMed

    Wong, Adam C-N; Chaston, John M; Douglas, Angela E

    2013-10-01

    The gut microorganisms in some animals are reported to include a core microbiota of consistently associated bacteria that is ecologically distinctive and may have coevolved with the host. The core microbiota is promoted by positive interactions among bacteria, favoring shared persistence; its retention over evolutionary timescales is evident as congruence between host phylogeny and bacterial community composition. This study applied multiple analyses to investigate variation in the composition of gut microbiota in drosophilid flies. First, the prevalence of five previously described gut bacteria (Acetobacter and Lactobacillus species) in individual flies of 21 strains (10 Drosophila species) were determined. Most bacteria were not present in all individuals of most strains, and bacterial species pairs co-occurred in individual flies less frequently than predicted by chance, contrary to expectations of a core microbiota. A complementary pyrosequencing analysis of 16S rRNA gene amplicons from the gut microbiota of 11 Drosophila species identified 209 bacterial operational taxonomic units (OTUs), with near-saturating sampling of sequences, but none of the OTUs was common to all host species. Furthermore, in both of two independent sets of Drosophila species, the gut bacterial community composition was not congruent with host phylogeny. The final analysis identified no common OTUs across three wild and four laboratory samples of D. melanogaster. Our results yielded no consistent evidence for a core microbiota in Drosophila. We conclude that the taxonomic composition of gut microbiota varies widely within and among Drosophila populations and species. This is reminiscent of the patterns of bacterial composition in guts of some other animals, including humans.

  17. 16S rRNA Gene Survey of Microbial Communities in Winogradsky Columns

    PubMed Central

    Rundell, Ethan A.; Banta, Lois M.; Ward, Doyle V.; Watts, Corey D.; Birren, Bruce; Esteban, David J.

    2014-01-01

    A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities. PMID:25101630

  18. Antibacterial resistance, macrophage influx, and activation induced by bacterial rRNA with dimethyldioctadecylammonium bromide.

    PubMed Central

    Gonggrijp, R; Mullers, W J; Dullens, H F; van Boven, C P

    1985-01-01

    Intraperitoneally injected rRNA from Pseudomonas aeruginosa combined with dimethyldioctadecylammonium bromide (DDA) increased nonspecifically the resistance of mice against an intraperitoneal challenge with extracellular (P. aeruginosa, Escherichia coli) and intracellular (Listeria monocytogenes) bacteria. This study concerns the mechanism underlying the nonspecific resistance. RNA with DDA (RNA-DDA) induced a cell influx and activated peritoneal macrophages (M phi) as judged by the decreased 5'-nucleotidase and alkaline phosphodiesterase activities in M phi lysates, the enhanced O2- release, and the increased antitumor activity in comparison with unstimulated M phi. RNA without DDA did not enhance the resistance and did not influence the peritoneal cell numbers or M phi properties. DDA without RNA enhanced the resistance of mice only slightly; it induced a cell influx, yielding elicited M phi as judged by the decreased 5'-nucleotidase activity and increased alkaline phosphodiesterase activity, the slightly enhanced O2- release, and the absence of increased antitumor activity. Both RNA-DDA and DDA M phi showed an enhanced capacity to ingest and kill L. monocytogenes in vitro, DDA M phi being slightly less effective than RNA-DDA M phi with respect to killing. We conclude that the enhanced killing capacity of M phi for L. monocytogenes is characteristic of both elicited DDA M phi and activated RNA-DDA M phi. The relationship between nonspecific resistance, peritoneal cell numbers, and antibacterial M phi activity is discussed. In addition, it is shown that RNA and DDA retain their activity when they are injected apart, suggesting that they activate M phi by sequential action. PMID:2415454

  19. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  1. Structural rRNA characters support monophyly of raptorial limbs and paraphyly of limb specialization in water fleas.

    PubMed Central

    Swain, Timothy D; Taylor, Derek J

    2003-01-01

    The evolutionary success of arthropods has been attributed partly to the diversity of their limb morphologies. Large morphological diversity and increased specialization are observed in water flea (Cladocera) limbs, but it is unclear whether the increased limb specialization in different cladoceran orders is the result of shared ancestry or parallel evolution. We inferred a robust among-order cladoceran phylogeny using small-subunit and large-subunit rRNA nuclear gene sequences, signature sequence regions, novel stem-loops and secondary structure morphometrics to assess the phylogenetic distribution of limb specialization. The sequence-based and structural rRNA morphometric phylogenies were congruent and suggested monophyly of orders with raptorial limbs, but paraphyly of orders with reduced numbers of specialized limbs. These results highlight the utility of complex molecular structural characters in resolving ancient rapid radiations. PMID:12803902

  2. Analysis of rRNA Gene Methylation in Arabidopsis thaliana by CHEF-Conventional 2D Gel Electrophoresis.

    PubMed

    Mohannath, Gireesha; Pikaard, Craig S

    2016-01-01

    Contour-clamped homogenous electric field (CHEF) gel electrophoresis, a variant of Pulsed-field gel electrophoresis (PFGE), is a powerful technique for resolving large fragments of DNA (10 kb-9 Mb). CHEF has many applications including the physical mapping of chromosomes, artificial chromosomes, and sub-chromosomal DNA fragments, etc. Here, we describe the use of CHEF and two-dimensional gel electrophoresis to analyze rRNA gene methylation patterns within the two ~4 million base pair nucleolus organizer regions (NORs) of Arabidopsis thaliana. The method involves CHEF gel electrophoresis of agarose-embedded DNA following restriction endonuclease digestion to cut the NORs into large but resolvable segments, followed by digestion with methylation-sensitive restriction endonucleases and conventional (or CHEF) gel electrophoresis, in a second dimension. Resulting products are then detected by Southern blotting or PCR analyses capable of discriminating rRNA gene subtypes. PMID:27576719

  3. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis. PMID:26618590

  4. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA.

    PubMed Central

    Weller, R; Weller, J W; Ward, D M

    1991-01-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences from three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type. Images PMID:1711832

  5. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    NASA Technical Reports Server (NTRS)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  6. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  7. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  8. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  9. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    SciTech Connect

    Weller, R.; Ward, D.M. ); Weller, J.W. )

    1991-04-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  10. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  11. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds. PMID:26189016

  12. Random mutagenesis of yeast 25S rRNA identify bases critical for 60S subunit structural integrity and function

    PubMed Central

    Nemoto, Naoki; Udagawa, Tsuyoshi; Chowdhury, Wasimul; Kitabatake, Makoto; Shin, Byung-shik; Hiraishi, Hiroyuki; Wang, Suzhi; Singh, Chingakham Ranjit; Brown, Susan J.; Ohno, Mutsuhito; Asano, Katsura

    2013-01-01

    In yeast Saccharomyces cerevisiae, 25S rRNA makes up the major mass and shape of the 60S ribosomal subunit. During translation initiation, the 60S subunit joins the 40S initiation complex, producing the 80S initiation complex. During elongation, the 60S subunit binds the CCA-ends of aminoacyl- and peptidyl-tRNAs at the A-loop and P-loop, respectively, transferring the peptide onto the α-amino group of the aminoacyl-tRNA. To study the role of 25S rRNA in translation in vivo, we randomly mutated 25S rRNA and isolated and characterized seven point mutations that affected yeast cell growth and polysome profiles. Four of these mutations, G651A, A1435U, A1446G and A1587G, change a base involved in base triples crucial for structural integrity. Three other mutations change bases near the ribosomal surface: C2879U and U2408C alter the A-loop and P-loop, respectively, and G1735A maps near a Eukarya-specific bridge to the 40S subunit. By polysome profiling in mmslΔ mutants defective in nonfunctional 25S rRNA decay, we show that some of these mutations are defective in both the initiation and elongation phases of translation. Of the mutants characterized, C2879U displays the strongest defect in translation initiation. The ribosome transit-time assay directly shows that this mutation is also defective in peptide elongation/termination. Thus, our genetic analysis not only identifies bases critical for structural integrity of the 60S subunit, but also suggests a role for bases near the peptidyl transferase center in translation initiation. PMID:26824023

  13. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    PubMed

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  14. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    PubMed

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  15. Plastid 16S rRNA Gene Diversity among Eukaryotic Picophytoplankton Sorted by Flow Cytometry from the South Pacific Ocean

    PubMed Central

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J.; Vaulot, Daniel

    2011-01-01

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image. PMID:21552558

  16. Essential role of conserved DUF177A protein in plastid 23S rRNA accumulation and plant embryogenesis

    PubMed Central

    Yang, Jiani; Suzuki, Masaharu; McCarty, Donald R.

    2016-01-01

    DUF177 proteins are nearly universally conserved in bacteria and plants except the Chlorophyceae algae. Thus far, duf177 mutants in bacteria have not established a function. In contrast, duf177a mutants have embryo lethal phenotypes in maize and Arabidopsis. In maize inbred W22, duf177a mutant embryos arrest at an early transition stage, whereas the block is suppressed in the B73 inbred background, conditioning an albino seedling phenotype. Background-dependent embryo lethal phenotypes are characteristic of maize plastid gene expression mutants. Consistent with the plastid gene expression hypothesis, quantitative real-time PCR revealed a significant reduction of 23S rRNA in an Escherichia coli duf177 knockout. Plastid 23S rRNA contents of duf177a mutant tissues were also markedly reduced compared with the wild-type, whereas plastid 16S, 5S, and 4.5S rRNA contents were less affected, indicating that DUF177 is specifically required for accumulation of prokaryote-type 23S rRNA. An AtDUF177A–green fluorescent protein (GFP) transgene controlled by the native AtDUF177A promoter fully complemented the Arabidopsis atduf177a mutant. Transient expression of AtDUF177A–GFP in Nicotiana benthamiana leaves showed that the protein was localized in chloroplasts. The essential role of DUF177A in chloroplast–ribosome formation is reminiscent of IOJAP, another highly conserved ribosome-associated protein, suggesting that key mechanisms controlling ribosome formation in plastids evolved from non-essential pathways for regulation of the prokaryotic ribosome. PMID:27574185

  17. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  18. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  19. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    PubMed Central

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

  20. RRP5 is required for formation of both 18S and 5.8S rRNA in yeast.

    PubMed Central

    Venema, J; Tollervey, D

    1996-01-01

    Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S) are synthesized as a single precursor which is subsequently processed into the mature rRNAs by a complex series of cleavage and modification reactions. In the yeast Saccharomyces cerevisiae, the early pre-rRNA cleavages at sites A0, A1 and A2, required for the synthesis of 18S rRNA, are inhibited in strains lacking RNA or protein components of the U3, U14, snR10 and snR30 small nucleolar ribonucleoproteins (snoRNPs). The subsequent cleavage at site A3, required for formation of the major, short form of 5.8S rRNA, is carried out by another ribonucleoprotein, RNase MRP. A screen for mutations showing synthetic lethality with deletion of the non-essential snoRNA, snR10, identified a novel gene, RRP5, which is essential for viability and encodes a 193 kDa nucleolar protein. Genetic depletion of Rrp5p inhibits the synthesis of 18S rRNA and, unexpectedly, also of the major short form of 5.8S rRNA. Pre-rRNA processing is concomitantly impaired at sites A0, A1, A2 and A3. This distinctive phenotype makes Rrp5p the first cellular component simultaneously required for the snoRNP-dependent cleavage at sites A0, A1 and A2 and the RNase MRP-dependent cleavage at A3 and provides evidence for a close interconnection between these processing events. Putative RRP5 homologues from Caenorhabditis elegans and humans were also identified, suggesting that the critical function of Rrp5p is evolutionarily conserved. Images PMID:8896463

  1. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  2. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    PubMed

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification.

  3. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  4. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    PubMed

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  5. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M

    1997-01-01

    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  6. Teaching International Law: Concepts in International Relations

    ERIC Educational Resources Information Center

    Starbird, Caroline; Pettit, Jenny; Singleton, Laurel

    2004-01-01

    This book is designed to introduce students to public international law. Topics covered include international public organizations, such as the United Nations and World Trade Organization, international courts, international human rights law, international trade law, and international environmental law. The goal of each study is to examine how…

  7. An empirical analysis of mt 16S rRNA covarion-like evolution in insects: site-specific rate variation is clustered and frequently detected.

    PubMed

    Misof, B; Anderson, C L; Buckley, T R; Erpenbeck, D; Rickert, A; Misof, K

    2002-10-01

    The structural and functional analysis of rRNA molecules has attracted considerable scientific interest. Empirical studies have demonstrated that sequence variation is not directly translated into modifications of rRNA secondary structure. Obviously, the maintenance of secondary structure and sequence variation are in part governed by different selection regimes. The nature of those selection regimes still remains quite elusive. The analysis of individual bacterial models cannot adequately explore this topic. Therefore, we used primary sequence data and secondary structures of a mitochondrial 16S rRNA fragment of 558 insect species from 15 monophyletic groups to study patterns of sequence variation, and variation of secondary structure. Using simulation studies to establish significance levels of change, we found that despite conservation of secondary structure, the location of sequence variation within the conserved rRNA structure changes significantly between groups of insects. Despite our conservative estimation procedure we found significant site-specific rate changes at 56 sites out of 184. Additionally, site-specific rate variation is somewhat clustered in certain helices. Both results confirm what has been predicted from an application of non-stationary maximum likelihood models to rRNA sequences. Clearly, constraints on sequence variation evolve and leave footprints in the form of evolutionary plasticity in rRNA sequences. Here, we show that a better understanding of the evolution of rRNA sequences can be obtained by integrating both phylogenetic and structural information.

  8. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    PubMed

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  9. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.

    PubMed

    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve

    2013-10-01

    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  10. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  11. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.

    PubMed

    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H

    1988-06-01

    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  12. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras.

    PubMed

    Ashelford, Kevin E; Chuzhanova, Nadia A; Fry, John C; Jones, Antonia J; Weightman, Andrew J

    2006-09-01

    A new computer program, called Mallard, is presented for screening entire 16S rRNA gene libraries of up to 1,000 sequences for chimeras and other artifacts. Written in the Java computer language and capable of running on all major operating systems, the program provides a novel graphical approach for visualizing phylogenetic relationships among 16S rRNA gene sequences. To illustrate its use, we analyzed most of the large libraries of cloned bacterial 16S rRNA gene sequences submitted to the public repository during 2005. Defining a large library as one containing 100 or more sequences of 1,200 bases or greater, we screened 25 of the 28 libraries and found that all but three contained substantial anomalies. Overall, 543 anomalous sequences were found. The average anomaly content per clone library was 9.0%, 4% higher than that previously estimated for the public repository overall. In addition, 90.8% of anomalies had characteristic chimeric patterns, a rise of 25.4% over that found previously. One library alone was found to contain 54 chimeras, representing 45.8% of its content. These figures far exceed previous estimates of artifacts within public repositories and further highlight the urgent need for all researchers to adequately screen their libraries prior to submission. Mallard is freely available from our website at http://www.cardiff.ac.uk/biosi/research/biosoft/.

  13. Clinical Fusobacterium mortiferum Isolates Cluster with Undifferentiated Clostridium rectum Species Based on 16S rRNA Gene Phylogenetic Analysis.

    PubMed

    Lee, Yangsoon; Eun, Chang Soo; Han, Dong Soo

    2016-05-01

    The most commonly encountered clinical Fusobacterium species are F. nucleatum and F. necrophorum; other Fusobacteria, such as F. mortiferum and F. varium, have occasionally been isolated from human specimens. Clostridium rectum is a gram-positive species characterized as a straight bacillus with oval sub-terminal spores. The close 16S rRNA gene sequence relationship of C. rectum with the genus Fusobacterium is unexpected given their very different phenotypic characteristics. Between 2014 and 2015, a total of 19 Fusobacterium isolates were recovered from the colonic tissue of 10 patients at a university hospital. All isolates were identified based on 16S rRNA gene sequencing. The phylogenetic relationship among these isolates was estimated using the neighbor-joining method and the Molecular Evolutionary Genetic Analysis (MEGA) version 6. Based on phylogenetic analysis, the F. mortiferum isolates clustered into two groups - F. mortiferum DSM 19809 (group I) and F. mortiferum ATCC 25557 (group II) - even though they are of the same species. Furthermore, the F. mortiferum DSM 19809 (group I) showed a close phylogenetic relationship with C. rectum, even though C. rectum is classified as a gram-positive spore-producing bacillus. C. rectum is clearly unrelated to the genus Clostridium as it shows highest 16S rRNA gene sequence similarity with species from the genus Fusobacterium Therefore, additional methods such as Gram staining and other biochemical methods should be performed for Fusobacterium identification. PMID:27312552

  14. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms.

  15. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  16. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  17. Comparison of Solution Conformations and Stabilities of Modified Helix 69 rRNA Analogues from Bacteria and Human†

    PubMed Central

    Sumita, Minako; Jiang, Jun; SantaLucia, John; Chow, Christine S.

    2012-01-01

    The helix 69 (H69) region of the large subunit (28S) rRNA of H. sapiens contains five pseudouridine (Ψ) residues out of 19 total nucleotides, three of which are highly conserved. In this study, the effects of this abundant modified nucleotide on the structure and stability of H69 were compared with those of uridine in double-stranded (stem) regions. These results were compared with previous hairpin (stem plus single-stranded loop) studies in order to understand the contributions of the loop sequences to H69 structure and stability. The role of a loop nucleotide substitution from an A in bacteria (position 1918 in E. coli 23S rRNA) to a G in eukaryotes (position 3734 in H. sapiens 28S rRNA) was examined. Thermodynamic parameters for the duplex RNAs were obtained through UV melting studies, and differences in the modified and unmodified RNA structures were examined by circular dichroism spectroscopy. The overall folded structure of human H69 appears to be similar to the bacterial RNA, consistent with the idea that ribosome structure and function are highly conserved; however, our results reveal subtle differences in structure and stability between the bacterial and human H69 RNAs in both the stem and loop regions. These findings may be significant with respect to H69 as a potential drug target site. PMID:21858779

  18. Genetic reconstruction of protozoan rRNA decoding sites provides a rationale for paromomycin activity against Leishmania and Trypanosoma.

    PubMed

    Hobbie, Sven N; Kaiser, Marcel; Schmidt, Sebastian; Shcherbakov, Dmitri; Janusic, Tanja; Brun, Reto; Böttger, Erik C

    2011-05-01

    Aminoglycoside antibiotics target the ribosomal decoding A-site and are active against a broad spectrum of bacteria. These compounds bind to a highly conserved stem-loop-stem structure in helix 44 of bacterial 16S rRNA. One particular aminoglycoside, paromomycin, also shows potent antiprotozoal activity and is used for the treatment of parasitic infections, e.g. by Leishmania spp. The precise drug target is, however, unclear; in particular whether aminoglycoside antibiotics target the cytosolic and/or the mitochondrial protozoan ribosome. To establish an experimental model for the study of protozoan decoding-site function, we constructed bacterial chimeric ribosomes where the central part of bacterial 16S rRNA helix 44 has been replaced by the corresponding Leishmania and Trypanosoma rRNA sequences. Relating the results from in-vitro ribosomal assays to that of in-vivo aminoglycoside activity against Trypanosoma brucei, as assessed in cell cultures and in a mouse model of infection, we conclude that aminoglycosides affect cytosolic translation while the mitochondrial ribosome of trypanosomes is not a target for aminoglycoside antibiotics.

  19. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.

    PubMed

    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo

    2007-11-01

    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  20. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  1. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  2. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  3. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  4. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    PubMed

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  5. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species.

  6. Diversity of Archaea in Icelandic hot springs based on 16S rRNA and chaperonin genes.

    PubMed

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2011-07-01

    The diversity of archaeal communities growing in four hot springs (65-90 °C, pH 6.5) was assessed with 16S rRNA gene primers specific for the domain Archaea. Overall, mainly uncultured members of the Desulfurococcales, the Thermoproteales and the Korarchaeota, were identified. Based on this diversity, a set of chaperonin heat-shock protein (Hsp60) gene sequences from different archaeal species were aligned to design two degenerate primer sets for the amplification of the chaperonin gene: Ths and Kor (which can also detect the korarchaeotal chaperonin gene from one of the samples). A phylogenetic tree was constructed using the chaperonin sequences retrieved and other sequences from cultured representatives. The Alpha and Beta paralogs of the chaperonin gene were observed within the main clades and orthologs among them. Cultivated representatives from these clades were assigned to either paralog in the chaperonin tree. Uncultured representatives observed in the 16S rRNA gene analysis were found to be related to the Desulfurococcales. The topologies of the 16S rRNA gene and chaperonin phylogenetic trees were compared, and similar phylogenetic relationships were observed. Our results suggest that the chaperonin Hsp60 gene may be used as a phylogenetic marker for the clades found in this extreme environment.

  7. Filtering and ranking techniques for automated selection of high-quality 16S rRNA gene sequences.

    PubMed

    De Smet, Wim; De Loof, Karel; De Vos, Paul; Dawyndt, Peter; De Baets, Bernard

    2013-12-01

    StrainInfo has augmented its type strain and species/subspecies passports with a recommendation for a high-quality 16S rRNA gene sequence available from the public sequence databases. These recommendations are generated by an automated pipeline that collects all candidate 16S rRNA gene sequences for a prokaryotic type strain, filters out low-quality sequences and retains a high-quality sequence from the remaining pool. Due to thorough automation, recommendations can be renewed daily using the latest updates of the public sequence databases and the latest species descriptions. We discuss the quality criteria constructed to filter and rank available 16S rRNA gene sequences, and show how a partially ordered set (poset) ranking algorithm can be applied to solve the multi-criteria ranking problem of selecting the best candidate sequence. The proof of concept of the recommender system is validated by comparing the results of automated selection with an expert selection made in the All-Species Living Tree Project. Based on these validation results, the pipeline may reliably be applied for non-type strains and developed further for the automated selection of housekeeping genes.

  8. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

    PubMed

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  9. The Cfr rRNA Methyltransferase Confers Resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A Antibiotics

    PubMed Central

    Long, Katherine S.; Poehlsgaard, Jacob; Kehrenberg, Corinna; Schwarz, Stefan; Vester, Birte

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and recently shown to encode a methyltransferase that modifies 23S rRNA at A2503. Antimicrobial susceptibility testing shows that S. aureus and E. coli strains expressing the cfr gene exhibit elevated MICs to a number of chemically unrelated drugs. The phenotype is named PhLOPSA for resistance to the following drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind to overlapping sites at the peptidyl transferase center that abut nucleotide A2503, is perturbed upon Cfr-mediated methylation. Decreased drug binding to Cfr-methylated ribosomes has been confirmed by footprinting analysis. No other rRNA methyltransferase is known to confer resistance to five chemically distinct classes of antimicrobials. In addition, the findings described in this study represent the first report of a gene conferring transferable resistance to pleuromutilins and oxazolidinones. PMID:16801432

  10. Ribosome Shut-Down by 16S rRNA Fragmentation in Stationary-Phase Escherichia coli.

    PubMed

    Luidalepp, Hannes; Berger, Stefan; Joss, Oliver; Tenson, Tanel; Polacek, Norbert

    2016-05-22

    Stationary-phase bacterial cells are characterized by vastly reduced metabolic activities yielding a dormant-like phenotype. Several hibernation programs ensure the establishment and maintenance of this resting growth state. Some of the stationary phase-specific modulations affect the ribosome and its translational activity directly. In stationary-phase Escherichia coli, we observed the appearance of a 16S rRNA fragmentation event at the tip of helix 6 within the small ribosomal subunit (30S). Stationary-phase 30S subunits showed markedly reduced activities in protein biosynthesis. On the other hand, the functional performance of stationary-phase large ribosomal subunits (50S) was indistinguishable from particles isolated from exponentially growing cells. Introduction of the 16S rRNA cut in vitro at helix 6 of exponential phase 30S subunits renders them less efficient in protein biosynthesis. This indicates that the helix 6 fragmentation is necessary and sufficient to attenuate translational activities of 30S ribosomal subunits. These results suggest that stationary phase-specific cleavage of 16S rRNA within the 30S subunit is an efficient means to reduce global translation activities under non-proliferating growth conditions. PMID:27067112

  11. RAP, the sole octotricopeptide repeat protein in Arabidopsis, is required for chloroplast 16S rRNA maturation.

    PubMed

    Kleinknecht, Laura; Wang, Fei; Stübe, Roland; Philippar, Katrin; Nickelsen, Jörg; Bohne, Alexandra-Viola

    2014-02-01

    The biogenesis and activity of chloroplasts in both vascular plants and algae depends on an intracellular network of nucleus-encoded, trans-acting factors that control almost all aspects of organellar gene expression. Most of these regulatory factors belong to the helical repeat protein superfamily, which includes tetratricopeptide repeat, pentatricopeptide repeat, and the recently identified octotricopeptide repeat (OPR) proteins. Whereas green algae express many different OPR proteins, only a single orthologous OPR protein is encoded in the genomes of most land plants. Here, we report the characterization of the only OPR protein in Arabidopsis thaliana, RAP, which has previously been implicated in plant pathogen defense. Loss of RAP led to a severe defect in processing of chloroplast 16S rRNA resulting in impaired chloroplast translation and photosynthesis. In vitro RNA binding and RNase protection assays revealed that RAP has an intrinsic and specific RNA binding capacity, and the RAP binding site was mapped to the 5' region of the 16S rRNA precursor. Nucleoid localization of RAP was shown by transient green fluorescent protein import assays, implicating the nucleoid as the site of chloroplast rRNA processing. Taken together, our data indicate that the single OPR protein in Arabidopsis is important for a basic process of chloroplast biogenesis.

  12. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species. PMID:25857192

  13. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  14. Clinical Fusobacterium mortiferum Isolates Cluster with Undifferentiated Clostridium rectum Species Based on 16S rRNA Gene Phylogenetic Analysis.

    PubMed

    Lee, Yangsoon; Eun, Chang Soo; Han, Dong Soo

    2016-05-01

    The most commonly encountered clinical Fusobacterium species are F. nucleatum and F. necrophorum; other Fusobacteria, such as F. mortiferum and F. varium, have occasionally been isolated from human specimens. Clostridium rectum is a gram-positive species characterized as a straight bacillus with oval sub-terminal spores. The close 16S rRNA gene sequence relationship of C. rectum with the genus Fusobacterium is unexpected given their very different phenotypic characteristics. Between 2014 and 2015, a total of 19 Fusobacterium isolates were recovered from the colonic tissue of 10 patients at a university hospital. All isolates were identified based on 16S rRNA gene sequencing. The phylogenetic relationship among these isolates was estimated using the neighbor-joining method and the Molecular Evolutionary Genetic Analysis (MEGA) version 6. Based on phylogenetic analysis, the F. mortiferum isolates clustered into two groups - F. mortiferum DSM 19809 (group I) and F. mortiferum ATCC 25557 (group II) - even though they are of the same species. Furthermore, the F. mortiferum DSM 19809 (group I) showed a close phylogenetic relationship with C. rectum, even though C. rectum is classified as a gram-positive spore-producing bacillus. C. rectum is clearly unrelated to the genus Clostridium as it shows highest 16S rRNA gene sequence similarity with species from the genus Fusobacterium Therefore, additional methods such as Gram staining and other biochemical methods should be performed for Fusobacterium identification.

  15. Microbial community of salt crystals processed from Mediterranean seawater based on 16S rRNA analysis.

    PubMed

    Baati, Houda; Guermazi, Sonda; Gharsallah, Neji; Sghir, Abdelghani; Ammar, Emna

    2010-01-01

    Phylogenetic analysis of 16S rRNA was used to investigate for the first time the structure of the microbial community that inhabits salt crystals retrieved from the bottom of a solar saltern, located in the coastal area of the Mediterranean Sea (Sfax, Tunisia). This community lives in an extremely salty environment of 250-310 g/L total dissolved salt. A total of 78 bacterial 16S rRNA clone sequences making up to 21 operational taxonomic units (OTUs), determined by the DOTUR program to 97% sequence similarity, was analyzed. These OTUs were affiliated to Bacteroidetes (71.4% of OTUs), and gamma-Proteobacteria and alpha-Proteobacteria (equally represented by 14.2% of the OTUs observed). The archaeal community composition appeared more diverse with 68 clones, resulting in 44 OTUs, all affiliated with the Euryarchaeota phylum. Of the bacterial and archaeal clones showing <97% 16S rRNA sequence identity with sequences in public databases, 47.6% and 84.1% respectively were novel clones. Both rarefaction curves and diversity measurements (Simpson, Shannon-Weaver, Chao) showed a more diverse archaeal than bacterial community at the Tunisian solar saltern pond. The analysis of an increasing clone's number may reveal additional local diversity. PMID:20130693

  16. IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies

    PubMed Central

    Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

    2016-01-01

    The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users’ own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org. PMID:27659943

  17. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  18. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.

    PubMed

    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R

    2015-04-17

    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  19. Healthcare international.

    PubMed

    Hensley, S; Jaklevic, M C; Rauber, C; Weissenstein, E; Moore, J D; Shinkman, R; Pallarito, K; Katzman, C N; Hallam, K; Morrissey, J

    1998-11-01

    How people are treated when they need medical care depends on where in the world they are. In deciding which tools of the medical trade are used to treat disease and when they're used, location is paramount. A country's social policy, healthcare payment systems and cultural factors bear heavily on the utilization of medical technology. The cover story kicks off the magazine's third international healthcare section. PMID:10186352

  20. Rotary International.

    PubMed

    Young, Janis

    2008-01-01

    Rotary International is the oldest United States service organization and one of the largest volunteer groups in the world. There are hundreds of educational, health, and humanitarian activities, almost all of which are conducted locally in order to ensure that Rotary clubs meet the needs of the communities they serve. Club membership requires regular active participation and offers Rotarians multiple opportunities for involvement. PMID:18551844

  1. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  2. International cooperation.

    PubMed

    1999-04-01

    As the most densely populated country in the world, China actively conducts international exchanges and cooperation. It takes every opportunity to publicize its family planning policies and practices during international forums. Moreover, the country's State Family Planning Commission has been collaborating with the United Nations Population Fund in implementing health and family planning programs. This program covers public awareness campaigns, technical services, sex education for the youth, and social marketing. For years, China has also been cooperating with WHO in the area of family planning and reproductive health, and has established partnership with the Japanese Organization for International Cooperation in Family Planning. In addition, the State Family Planning Commission has worked with the Public Media Center of the US as well as with the Rockefeller Foundation and Ford Foundation in introducing "contraceptive methods by informed choice" and "male participation in family planning" in the rural areas of the country. China has also worked closely with many other developing countries on population issues. In October 1998, China collaborated with the Partners in Population and Development for a reporting mission that was attended by journalists from 11 countries.

  3. Methylation sites in Escherichia coli ribosomal RNA: localization and identification of four new sites of methylation in 23S rRNA.

    PubMed

    Smith, J E; Cooperman, B S; Mitchell, P

    1992-11-10

    Four previously undetermined sites of methylation are mapped in Escherichia coli 23S rRNA employing a novel combination of methods. First, using a double-isotope approach, the total number of methyl groups in 23S rRNA was determined to be 14.9 +/- 1.6. Second, hybridization of methyl-labeled rRNA to complementary DNA restriction fragments and PAGE analysis were used to purify RNA-DNA heteroduplexes and to quantify methyl groups within specific 23S rRNA fragments. Third, the methylated nucleosides in these fragments were identified and quantified using HPLC, confirming the presence of 14 methylation sites in 23S rRNA, four more than had been previously identified. In contrast, a similar set of analyses conducted on 16S rRNA gave evidence for 10 sites of methylation, at all approximate locations consistent with published 16S methylated nucleoside identities and locations. Selected regions of the 23S rRNA molecule containing previously unidentified methylated nucleosides were released by site-directed cleavage with ribonuclease H and isolated by PAGE. Sites of methylation within the RNA fragments were determined by classical oligonucleotide analyses. The four newly identified methylation sites in 23S rRNA are m2G-1835, m5C-1962, m6A-2503, and m2G at one of positions 2445-2447. Together with previously described sites of modification, these new sites form a group that is clustered in a current model for the three-dimensional organization of the 23S rRNA in the 50S ribosomal subunit, at a locus congruent with nucleotides previously implicated in ribosomal function. PMID:1384701

  4. The Tumor Suppressive Role of eIF3f and Its Function in Translation Inhibition and rRNA Degradation

    PubMed Central

    Wen, Fushi; Zhou, Renyuan; Shen, Alex; Choi, Andrew; Uribe, Diana; Shi, Jiaqi

    2012-01-01

    Deregulated translation plays an important role in human cancer. We previously reported decreased eukaryotic initiation factor 3 subunit f (eIF3f) expression in pancreatic cancer. Whether decreased eIF3f expression can transform normal epithelial cells is not known. In our current study, we found evidence that stable knockdown of eIF3f in normal human pancreatic ductal epithelial cells increased cell size, nuclear pleomorphism, cytokinesis defects, cell proliferation, clonogenicity, apoptotic resistance, migration, and formation of 3-dimensional irregular masses. Our findings support the tumor suppressive role of eIF3f in pancreatic cancer. Mechanistically, we found that eIF3f inhibited both cap-dependent and cap-independent translation. An increase in the ribosomal RNA (rRNA) level was suggested to promote the generation of cancer. The regulatory mechanism of rRNA degradation in mammals is not well understood. We demonstrated here that eIF3f promotes rRNA degradation through direct interaction with heterogeneous nuclear ribonucleoprotein (hnRNP) K. We showed that hnRNP K is required for maintaining rRNA stability: under stress conditions, eIF3f dissociates hnRNP K from rRNA, thereby preventing it from protecting rRNA from degradation. We also demonstrated that rRNA degradation occurred in non-P body, non-stress granule cytoplasmic foci that contain eIF3f. Our findings established a new mechanism of rRNA decay regulation mediated by hnRNP K/eIF3f and suggest that the tumor suppressive function of eIF3f may link to impaired rRNA degradation and translation. PMID:22457825

  5. [Internal migration].

    PubMed

    Borisovna, L

    1991-06-01

    Very few studies have been conducted that truly permit explanation of internal migration and it repercussions on social and economic structure. It is clear however that a profound knowledge of the determinants and consequences of internal migration will be required as a basis for economic policy decisions that advance the goal of improving the level of living of the population. the basic supposition of most studies of the relationship of population and development is that socioeconomic development conditions demographic dynamics. The process of development in Mexico, which can be characterized by great heterogeneity, consequently produces great regional disparities. At the national level various studies have estimated the volume of internal migration in Mexico, but they have usually been limited to interstate migration because the main source of data, the census, is classified by states. But given the great heterogeneity within states in all the elements related to internal migration, it is clear that studies of internal migration within states are also needed. Such studies are almost nonexistent because of their technical difficulty. National level studies show that interstate migration increased significantly between 1940-80. The proportion of Mexicans living outside their states of birth increased by 558% in those years, compared to the 342% increase in the total Mexican population. Although Puebla has a high rate of increase, migration has kept it below Mexico's national growth rate. Migration between Puebla and other states and within Puebla has led to an increasing unevenness of spatial distribution. Between 1970-80, 57 of Puebla's municipios had growth rates above the state average of 2.8%/year, 6 had growth rates equal to the average, and 129 had growth rates that were below the average but not negative. 25 states with negative growth rates that were considered strongly expulsive. In 1980, 51.7% of the population was concentrated in the 57 municipios

  6. Direct PCR amplification of the 16S rRNA gene from single microbial cells isolated from an Antarctic iceberg using laser microdissection microscopy

    NASA Astrophysics Data System (ADS)

    Yanagihara, Katsuhiko; Niki, Hironori; Baba, Tomoya

    2011-09-01

    Here, we describe a technique that allows the genetic linage analysis of 16S rRNA genes in bacteria observed under a microscope. The technique includes the isolation of microbial cells using a laser microdissection microscope, lysis of the cells, and amplification of the 16S rRNA genes in the isolated cells without interference by bacterial DNA contamination from the experimental environment or reagents. Using this technique, we successfully determined 15 16S rRNA gene sequences in cells isolated from an Antarctic iceberg. These sequences showed 94%-100% identity to their closest strains, which included bacteria that occur in aqueous, marine, and soil environments.

  7. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  8. Loop-mediated isothermal amplification assay for 16S rRNA methylase genes in Gram-negative bacteria.

    PubMed

    Nagasawa, Mitsuaki; Kaku, Mitsuo; Kamachi, Kazunari; Shibayama, Keigo; Arakawa, Yoshichika; Yamaguchi, Keizo; Ishii, Yoshikazu

    2014-10-01

    Using the loop-mediated isothermal amplification (LAMP) method, we developed a rapid assay for detection of 16S rRNA methylase genes (rmtA, rmtB, and armA), and investigated 16S rRNA methylase-producing strains among clinical isolates. Primer Explorer V3 software was used to design the LAMP primers. LAMP primers were prepared for each gene, including two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (LF and LB). Detection was performed with the Loopamp DNA amplification kit. For all three genes (rmtA, rmtB, and armA), 10(2) copies/tube could be detected with a reaction time of 60 min. When nine bacterial species (65 strains saved in National Institute of Infectious Diseases) were tested, which had been confirmed to possess rmtA, rmtB, or armA by PCR and DNA sequencing, the genes were detected correctly in these bacteria with no false negative or false positive results. Among 8447 clinical isolates isolated at 36 medical institutions, the LAMP method was conducted for 191 strains that were resistant to aminoglycosides based on the results of antimicrobial susceptibility tests. Eight strains were found to produce 16S rRNA methylase (0.09%), with rmtB being identified in three strains (0.06%) of 4929 isolates of Enterobacteriaceae, rmtA in three strains (0.10%) of 3284 isolates of Pseudomonas aeruginosa, and armA in two strains (0.85%) of 234 isolates of Acinetobacter spp. At present, the incidence of strains possessing 16S rRNA methylase genes is very low in Japan. However, when Gram-negative bacteria showing high resistance to aminoglycosides are isolated by clinical laboratories, it seems very important to investigate the status of 16S rRNA methylase gene-harboring bacilli and monitor their trends among Japanese clinical settings.

  9. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    PubMed

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value <0.0001). dPCR quantification was also consistent with quantitative PCR (qPCR) measurements as well as cell counts for BioBall reference standard and 24 environmental water samples. qPCR and dPCR quantification of enterococci in the 24 environmental samples were significantly correlated (linear regression slope =1.08, R(2) of 0.96, and p value <0.0001); the group mean of the qPCR measurements was 0.19 log units higher than that of the dPCR measurements. At environmentally relevant concentrations, dPCR quantification was more precise (i.e., had narrower 95% confidence intervals than qPCR quantification). We observed that humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  10. Molecular evidence for genetic distinctions between Chlamydiaceae detected in Siamese crocodiles (Crocodylus siamensis) and known Chlamydiaceae species.

    PubMed

    Sariya, Ladawan; Kladmanee, Kan; Bhusri, Benjaporn; Thaijongrak, Prawporn; Tonchiangsai, Kanittha; Chaichoun, Kridsada; Ratanakorn, Parntep

    2015-02-01

    Chlamydiosis, caused by Chlamydiaceae, is a zoonotic disease found in humans and several species of animals, including reptiles and amphibians. Although chlamydiosis in saltwater crocodiles has been previously reported in South Africa and Papua New Guinea, the reported strains have not been identified or confirmed. Therefore, the main aim of this study was to sequence and characterize Chamydiaceae isolated from Siamese crocodiles. Results showed the 16S ribosomal (r) RNA and the 16S/23S rRNA gene of the crocodile isolates were closely related to the genus Chlamydophila with matched identity greater than 98%. The phylogenetic tree constructed from the 16S/23S rRNA gene showed the crocodile cluster diverges far from Cp. caviae with a 100% bootstrap value. The tree based on the ompA gene loci distinguished the crocodile strains into genotypes I, II, and III. The present study is the first report on Chlamydophila detected in Siamese crocodiles that is genetically distinct from the known species of Chlamydiaceae.

  11. Molecular evidence for genetic distinctions between Chlamydiaceae detected in Siamese crocodiles (Crocodylus siamensis) and known Chlamydiaceae species.

    PubMed

    Sariya, Ladawan; Kladmanee, Kan; Bhusri, Benjaporn; Thaijongrak, Prawporn; Tonchiangsai, Kanittha; Chaichoun, Kridsada; Ratanakorn, Parntep

    2015-02-01

    Chlamydiosis, caused by Chlamydiaceae, is a zoonotic disease found in humans and several species of animals, including reptiles and amphibians. Although chlamydiosis in saltwater crocodiles has been previously reported in South Africa and Papua New Guinea, the reported strains have not been identified or confirmed. Therefore, the main aim of this study was to sequence and characterize Chamydiaceae isolated from Siamese crocodiles. Results showed the 16S ribosomal (r) RNA and the 16S/23S rRNA gene of the crocodile isolates were closely related to the genus Chlamydophila with matched identity greater than 98%. The phylogenetic tree constructed from the 16S/23S rRNA gene showed the crocodile cluster diverges far from Cp. caviae with a 100% bootstrap value. The tree based on the ompA gene loci distinguished the crocodile strains into genotypes I, II, and III. The present study is the first report on Chlamydophila detected in Siamese crocodiles that is genetically distinct from the known species of Chlamydiaceae. PMID:25854083

  12. RNA isolation and fractionation with compaction agents

    NASA Technical Reports Server (NTRS)

    Murphy, J. C.; Fox, G. E.; Willson, R. C.

    2001-01-01

    A new approach to the isolation of RNA from bacterial lysates employs selective precipitation by compaction agents, such as hexammine cobalt and spermidine. Using 3.5 mM hexammine cobalt, total RNA can be selectively precipitated from a cell lysate. At a concentration of 2 mM hexammine cobalt, rRNA can be fractionated from low molecular weight RNA. The resulting RNA mixture is readily resolved to pure 5S and mixed 16S/23S rRNA by nondenaturing anion-exchange chromatography. Using a second stage of precipitation at 8 mM hexammine cobalt, the low molecular weight RNA fraction can be isolated by precipitation. Compaction precipitation was also applied to the purification of an artificial stable RNA derived from Escherichia coli 5S rRNA and to the isolation of an Escherichia coli-expressed ribozyme. Copyright 2001 Academic Press.

  13. Operating internationally

    SciTech Connect

    Seeley, R.S.

    1994-02-01

    When Enron Power Corp. took over a 28 MW power facility at the former US Naval base in Subic Bay, the Philippines, the company was required to employ 139 people to run the plant. This large labor force was necessary not because of the plant's operational needs, but because of local labor practices and unemployment pressures. Independent power companies have become all too familiar with the high cost and complexity of developing projects in emerging international markets. Some of the most significant issues involve taxation, unfamiliar legal systems, changing regulations, and foreign investment restrictions. In addition, questions about currency exchange, national credit worthiness, and political stability add to the difficulty of international development. However, one of the most daunting challenges centers not on development, but on long-term operations and maintenance (O M). A key concern is finding qualified labor. Most developers and O M companies agree that local people should run the plant, with the top person, or persons, thoroughly trained in the developer's company philosophy.

  14. [Fragment of mRNA coding part that is complementary to region 1638-1650 of wheat 18S rRNA functions as a translational enhancer].

    PubMed

    Zhigaĭlov, A V; Babaĭlova, E S; Polimbetova, N S; Graĭfer, D M; Karpova, G G; Iskakov, B K

    2012-01-01

    Possible involvement of 18S rRNA fragment 1638-1650 including basements of the helices h44 and h28 and nucleotides of the ribosomal decoding site in the cap-independent translation initiation on plant ribosomes is studied. This rRNA fragment is shown to be accessible for complementary interactions within the 40S ribosomal subunit. It is found that the sequence complementary to the 18S rRNA fragment 1638-1650 is able to enhance efficiency of a reporter mRNA translation when placed just after the initiation codon. The results obtained indicate that in the course of the cap-independent translation initiation, complementary interactions can occur between mRNA coding sequence and 18S rRNA fragment in the region of the ribosomal decoding site.

  15. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  16. Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station

    NASA Technical Reports Server (NTRS)

    Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri

    2005-01-01

    Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

  17. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.

    PubMed

    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D

    2006-03-01

    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis.

  18. Mild Glucose Starvation Induces KDM2A-Mediated H3K36me2 Demethylation through AMPK To Reduce rRNA Transcription and Cell Proliferation.

    PubMed

    Tanaka, Yuji; Yano, Hirohisa; Ogasawara, Sachiko; Yoshioka, Sho-Ichi; Imamura, Hiromi; Okamoto, Kengo; Tsuneoka, Makoto

    2015-12-01

    Environmental conditions control rRNA transcription. Previously, we found that serum and glucose deprivation induces KDM2A-mediated H3K36me2 demethylation in the rRNA gene (rDNA) promoter and reduces rRNA transcription in the human breast cancer cell line MCF-7. However, the molecular mechanism and biological significance are still unclear. In the present study, we found that glucose starvation alone induced the KDM2A-dependent reduction of rRNA transcription. The treatment of cells with 2-deoxy-d-glucose, an inhibitor of glycolysis, reduced rRNA transcription and H3K36me2 in the rDNA promoter, both of which were completely dependent on KDM2A in low concentrations of 2-deoxy-d-glucose, that is, mild starvation conditions. The mild starvation induced these KDM2A activities through AMP-activated kinase (AMPK) but did not affect another AMPK effector of rRNA transcription, TIF-IA. In the triple-negative breast cancer cell line MDA-MB-231, the mild starvation also reduced rRNA transcription in a KDM2A-dependent manner. We detected KDM2A in breast cancer tissues irrespective of their estrogen receptor, progesterone receptor, and HER2 status, including triple-negative cancer tissues. In both MCF-7 and MDA-MB-231 cells, mild starvation reduced cell proliferation, and KDM2A knockdown suppressed the reduction of cell proliferation. These results suggest that under mild glucose starvation AMPK induces KDM2A-dependent reduction of rRNA transcription to control cell proliferation.

  19. Mild Glucose Starvation Induces KDM2A-Mediated H3K36me2 Demethylation through AMPK To Reduce rRNA Transcription and Cell Proliferation

    PubMed Central

    Tanaka, Yuji; Yano, Hirohisa; Ogasawara, Sachiko; Yoshioka, Sho-ichi; Imamura, Hiromi; Okamoto, Kengo

    2015-01-01

    Environmental conditions control rRNA transcription. Previously, we found that serum and glucose deprivation induces KDM2A-mediated H3K36me2 demethylation in the rRNA gene (rDNA) promoter and reduces rRNA transcription in the human breast cancer cell line MCF-7. However, the molecular mechanism and biological significance are still unclear. In the present study, we found that glucose starvation alone induced the KDM2A-dependent reduction of rRNA transcription. The treatment of cells with 2-deoxy-d-glucose, an inhibitor of glycolysis, reduced rRNA transcription and H3K36me2 in the rDNA promoter, both of which were completely dependent on KDM2A in low concentrations of 2-deoxy-d-glucose, that is, mild starvation conditions. The mild starvation induced these KDM2A activities through AMP-activated kinase (AMPK) but did not affect another AMPK effector of rRNA transcription, TIF-IA. In the triple-negative breast cancer cell line MDA-MB-231, the mild starvation also reduced rRNA transcription in a KDM2A-dependent manner. We detected KDM2A in breast cancer tissues irrespective of their estrogen receptor, progesterone receptor, and HER2 status, including triple-negative cancer tissues. In both MCF-7 and MDA-MB-231 cells, mild starvation reduced cell proliferation, and KDM2A knockdown suppressed the reduction of cell proliferation. These results suggest that under mild glucose starvation AMPK induces KDM2A-dependent reduction of rRNA transcription to control cell proliferation. PMID:26416883

  20. Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

    NASA Technical Reports Server (NTRS)

    Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

    1992-01-01

    A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

  1. Phylogeny of intestinal ciliates, including Charonina ventriculi, and comparison of microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis.

    PubMed

    Kittelmann, Sandra; Devente, Savannah R; Kirk, Michelle R; Seedorf, Henning; Dehority, Burk A; Janssen, Peter H

    2015-04-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups.

  2. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.

    2015-01-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  3. Column internals

    SciTech Connect

    Bravo, J.L.

    1998-02-01

    In the fields of distillation, absorption, stripping and extraction, theory and technology go hand in hand. The thermodynamic principles of phase equilibrium and the concepts of mass transfer and fluid flow are of primary importance in all of these operations. The engineer must understand these phenomena to select equipment effectively. This article discusses the latest in commercial technology in column internals for gas-liquid and liquid-liquid contacting. The principles of operation are explained vis-a-vis the characteristics of the applications in which they are used. The focus is on moderate-to-large columns for refining and chemical applications. Guidelines for selecting the most appropriate type of device are presented, and examples of typical applications are described.

  4. Resistance to macrolides, lincosamides and streptogramin type B antibiotics due to a mutation in an rRNA operon of Streptomyces ambofaciens.

    PubMed Central

    Pernodet, J L; Boccard, F; Alegre, M T; Blondelet-Rouault, M H; Guérineau, M

    1988-01-01

    Streptomyces ambofaciens produces spiramycin, a macrolide antibiotic and expresses an inducible resistance to macrolides, lincosamides and streptogramin B antibiotics (MLS). From a mutant of S.ambofaciens exhibiting a constitutive MLS resistance phenotype a resistance determinant was cloned on a low copy number vector (pIJ61) through its expression in Streptomyces lividans. Further characterization has shown that this determinant corresponded to a mutant rRNA operon with a mutation in the 23S rRNA gene. In different organisms, mutations leading to MLS resistance have been located at a position corresponding to the adenine 2058 of Escherichia coli 23S rRNA. In the 23S rRNA from S.ambofaciens a similar position for the mutation has been postulated and DNA sequencing of this region has shown an adenine to guanine transition at a position corresponding to 2058. S.ambofaciens possesses four rRNA operons which we have cloned. In Streptomyces, contrary to other bacteria, a mutation in one among several rRNA operons confers a selectable MLS resistance phenotype. Possible reasons for this difference are discussed. Images PMID:2834204

  5. Comparison of 16S rRNA and protein-coding genes as molecular markers for assessing microbial diversity (Bacteria and Archaea) in ecosystems.

    PubMed

    Roux, Simon; Enault, François; Bronner, Gisèle; Debroas, Didier

    2011-12-01

    PCR amplification of the rRNA gene is the most popular method for assessing microbial diversity. However, this molecular marker is often present in multiple copies in cells presenting, in addition, an intragenomic heterogeneity. In this context, housekeeping genes may be used as taxonomic markers for ecological studies. However, the efficiency of these protein-coding genes compared to 16S rRNA genes has not been tested on environmental data. For this purpose, five protein marker genes for which primer sets are available, were selected (rplB, pyrG, fusA, leuS and rpoB) and compared with 16S rRNA gene results from PCR amplification or metagenomic data from aquatic ecosystems. Analysis of the major groups found in these ecosystems, such as Actinobacteria, Bacteroides, Proteobacteria and Cyanobacteria, showed good agreement between the protein markers and the results given by 16S rRNA genes from metagenomic reads. However, with the markers it was possible to detect minor groups among the microbial assemblages, providing more details compared to 16S rRNA results from PCR amplification. In addition, the use of a set of protein markers made it possible to deduce a mean copy number of rRNA operons. This average estimate is essentially lower than the one estimated in sequenced genomes. PMID:22066608

  6. Mycobacterium sediminis sp. nov. and Mycobacterium arabiense sp. nov., two rapidly growing members of the genus Mycobacterium.

    PubMed

    Zhang, Dao-Feng; Chen, Xiu; Zhang, Xiao-Mei; Zhi, Xiao-Yang; Yao, Ji-Cheng; Jiang, Yi; Xiong, Zhi; Li, Wen-jun

    2013-11-01

    Two novel isolates of rapidly growing, Gram-stain-positive, non-chromogenic species of the genus Mycobacterium, strain YIM M13028(T) from a sediment sample collected from the South China Sea (19° 30.261' N 111° 0.247' E) at a depth of 42 m and strain YIM 121001(T) from a coastal zone sand sample collected in Dubai, United Arab Emirates, were obtained in our laboratory. Their taxonomic positions were determined by a polyphasic approach. Good growth of the two strains was observed at 28 °C and pH 7.0 with 0-2 % NaCl on tryptic soy agar medium. Both strains formed round orange-red colonies, strain YIM M13028(T) had a rough surface, while YIM 121001(T) was smooth. Cellular fatty acids, whole-cell protein profiles and TLC analysis of their mycolic acids show significant differences from reference stains. Phenotypic characteristics and multilocus sequence analysis (MLSA) of 16S rRNA gene, hsp65, rpoB and 16S-23S internal transcribed spacer (ITS) sequences indicated that both strains YIM M13028(T) and YIM 121001(T) belong to the genus Mycobacterium. DNA-DNA hybridization values revealed a low relatedness (<70 %) of the two isolates with the type strains Mycobacterium neoaurum DSM 44074(T) and Mycobacterium hodleri DSM 44183(T). The low DNA-DNA hybridization values (40.4±3.5 %) between strains YIM M13028(T) and YIM 121001(T) and phenotypic distinctiveness indicated that the two strains were representatives of different novel species of the genus Mycobacterium. The names proposed for these novel species are Mycobacterium sediminis sp. nov. and Mycobacterium arabiense sp. nov., and the type strains are YIM M13028(T) ( = DSM 45643(T) = KCTC 19999(T)) and YIM 121001(T) ( = DSM 45768(T) = JCM 18538(T)), respectively.

  7. Novel lineages of Prochlorococcus and Synechococcus in the global oceans

    PubMed Central

    Huang, Sijun; Wilhelm, Steven W; Harvey, H Rodger; Taylor, Karen; Jiao, Nianzhi; Chen, Feng

    2012-01-01

    Picocyanobacteria represented by Prochlorococcus and Synechococcus have an important role in oceanic carbon fixation and nutrient cycling. In this study, we compared the community composition of picocyanobacteria from diverse marine ecosystems ranging from estuary to open oceans, tropical to polar oceans and surface to deep water, based on the sequences of 16S-23S rRNA internal transcribed spacer (ITS). A total of 1339 ITS sequences recovered from 20 samples unveiled diverse and several previously unknown clades of Prochlorococcus and Synechococcus. Six high-light (HL)-adapted Prochlorococcus clades were identified, among which clade HLVI had not been described previously. Prochlorococcus clades HLIII, HLIV and HLV, detected in the Equatorial Pacific samples, could be related to the HNLC clades recently found in the high-nutrient, low-chlorophyll (HNLC), iron-depleted tropical oceans. At least four novel Synechococcus clades (out of six clades in total) in subcluster 5.3 were found in subtropical open oceans and the South China Sea. A niche partitioning with depth was observed in the Synechococcus subcluster 5.3. Members of Synechococcus subcluster 5.2 were dominant in the high-latitude waters (northern Bering Sea and Chukchi Sea), suggesting a possible cold-adaptation of some marine Synechococcus in this subcluster. A distinct shift of the picocyanobacterial community was observed from the Bering Sea to the Chukchi Sea, which reflected the change of water temperature. Our study demonstrates that oceanic systems contain a large pool of diverse picocyanobacteria, and further suggest that new genotypes or ecotypes of picocyanobacteria will continue to emerge, as microbial consortia are explored with advanced sequencing technology. PMID:21955990

  8. Acetobacter malorum and Acetobacter cerevisiae identification and quantification by Real-Time PCR with TaqMan-MGB probes.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2013-10-01

    The identification and quantification of Acetobacter malorum and Acetobacter cerevisiae in wine and vinegar were performed using the Real-Time PCR (RT-PCR) with two TaqMan-MGB probes designed to amplify the internal transcribed spacer (ITS) region between the 16S-23S rRNA genes. The primers and probes were highly specific, with a detection limit of 10² cells/ml for both species, and the efficiency of the technique was >80%. The RT-PCR technique with these two new TaqMan-MGB probes, together with the five (Acetobacter aceti, Acetobacter pasteurianus, Gluconobacter oxydans, Gluconacetobacter hansenii and Gluconacetobacter europaeus) that are already available (Torija et al., 2010), were validated on known concentrations of Acetic Acid Bacteria (AAB) grown in glucose medium (GY) and in inoculated matrices of wine and vinegar. Furthermore, this technique was applied to evaluate the AAB population in real wine samples collected in the Canary Islands. PCR enrichment performed prior to RT-PCR increased the accuracy of quantification and produced results similar to those detected with SYBR-Green. In real wine samples, the total AAB enumeration ranged from 9 × 10² to 10⁶ cells/ml, and the seven AAB species tested were detected in more than one sample. However, AAB recovery on plates was poor; the isolates obtained on plates were A. malorum, G. oxydans, A. cerevisiae and A. pasteurianus species. RT-PCR with TaqMan-MGB probes is an accurate, specific and fast method for the identification and quantification of AAB species commonly found in wine and vinegar.

  9. Rhizobia Indigenous to the Okavango Region in Sub-Saharan Africa: Diversity, Adaptations, and Host Specificity.

    PubMed

    Grönemeyer, Jann L; Kulkarni, Ajinkya; Berkelmann, Dirk; Hurek, Thomas; Reinhold-Hurek, Barbara

    2014-12-01

    The rhizobial community indigenous to the Okavango region has not yet been characterized. The isolation of indigenous rhizobia can provide a basis for the formulation of a rhizobial inoculant. Moreover, their identification and characterization contribute to the general understanding of species distribution and ecology. Isolates were obtained from nodules of local varieties of the pulses cowpea, Bambara groundnut, peanut, hyacinth bean, and common bean. Ninety-one of them were identified by BOX repetitive element PCR (BOX-PCR) and sequence analyses of the 16S-23S rRNA internally transcribed spacer (ITS) and the recA, glnII, rpoB, and nifH genes. A striking geographical distribution was observed. Bradyrhizobium pachyrhizi dominated at sampling sites in Angola which were characterized by acid soils and a semihumid climate. Isolates from the semiarid sampling sites in Namibia were more diverse, with most of them being related to Bradyrhizobium yuanmingense and Bradyrhizobium daqingense. Host plant specificity was observed only for hyacinth bean, which was nodulated by rhizobia presumably representing yet-undescribed species. Furthermore, the isolates were characterized with respect to their adaptation to high temperatures, drought, and local host plants. The adaptation experiments revealed that the Namibian isolates shared an exceptionally high temperature tolerance, but none of the isolates showed considerable adaptation to drought. Moreover, the isolates' performance on different local hosts showed variable results, with most Namibian isolates inducing better nodulation on peanut and hyacinth bean than the Angolan strains. The local predominance of distinct genotypes implies that indigenous strains may exhibit a better performance in inoculant formulations. PMID:25239908

  10. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    PubMed Central

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  11. Effect of Rj genotype and cultivation temperature on the community structure of soybean-nodulating bradyrhizobia.

    PubMed

    Shiro, Sokichi; Yamamoto, Akihiro; Umehara, Yosuke; Hayashi, Masaki; Yoshida, Naoto; Nishiwaki, Aya; Yamakawa, Takeo; Saeki, Yuichi

    2012-02-01

    The nodulation tendency and community structure of indigenous bradyrhizobia on Rj genotype soybean cultivars at cultivation temperatures of 33/28°C, 28/23°C, and 23/18°C for 16/8 h (day/night degrees, hours) were investigated using 780 bradyrhizobial DNA samples from an Andosol with 13 soybean cultivars of four Rj genotypes (non-Rj, Rj(2)Rj(3), Rj(4), and Rj(2)Rj(3)Rj(4)). A dendrogram was constructed based on restriction fragment length polymorphism of the PCR products (PCR-RFLP) of the 16S-23S rRNA gene internal transcribed spacer region. Eleven Bradyrhizobium U.S. Department of Agriculture strains were used as a reference. The dendrogram indicated seven clusters based on similarities among the reference strains. The occupancy rate of the Bj123 cluster decreased with increasing cultivation temperature, whereas the occupancy rates of the Bj110 cluster, Be76 cluster, and Be94 cluster increased with increasing cultivation temperature. In particular, the Rj(2)Rj(3)Rj(4) genotype soybeans were infected with a number of Bj110 clusters, regardless of the increasing cultivation temperature, compared to other Rj genotype soybean cultivars. The ratio of beta diversity to gamma diversity (H'(β)/H'(γ)), which represents differences in the bradyrhizobial communities by pairwise comparison among cultivation temperature sets within the same soybean cultivar, indicated that the bradyrhizobial communities tended to be different among cultivation temperatures. Multidimensional scaling analysis indicated that the infection of the Bj110 cluster and the Bj123 cluster by host soybean genotype and the cultivation temperature affected the bradyrhizobial communities. These results suggested that the Rj genotypes and cultivation temperatures affected the nodulation tendency and community structures of soybean-nodulating bradyrhizobia.

  12. Real-time monitoring of mycobacterium genomic DNA with target-primed rolling circle amplification by a Au nanoparticle-embedded SPR biosensor.

    PubMed

    Xiang, Yang; Zhu, Xiaoyan; Huang, Qing; Zheng, Junsong; Fu, Weiling

    2015-04-15

    In this study, we developed a surface plasmon resonance (SPR) DNA biosensor array based on target-primed rolling circle amplification (RCA) for isothermal and rapid detection of two pathogenic mycobacteria, Mycobacterium tuberculosis complex (MTBC) and Mycobacterium avium complex (MAC).The species-specific padlock prob