Science.gov

Sample records for 16s-23s rrna spacer

  1. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence.

  2. 16S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads.

    PubMed

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2-57.9 mol%. Five distinct ITS types were identified: ITS(none) (without tRNA genes), ITS(Ala(TGC)), ITS(Ala(TGC)+Ile(GAT)), ITS(Ile(GAT)+Ala(TGC)), and ITS (Ile(GAT)+Pseudo). All of the identified tRNA(Ala(TGC)) molecules consisted of 73 bases, and all of the tRNA(Ile(GAT)) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S-23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  3. Analysis of 16S-23S rRNA Intergenic Spacer Regions of Vibrio cholerae and Vibrio mimicus

    PubMed Central

    Chun, Jongsik; Huq, Anwarul; Colwell, Rita R.

    1999-01-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3′ end of the 16S and the 5′ end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae. PMID:10224020

  4. PCR-based method for targeting 16S-23S rRNA intergenic spacer regions among Vibrio species

    PubMed Central

    2010-01-01

    Background The genus Vibrio is a diverse group of Gram-negative bacteria comprised of 74 species. Furthermore, the genus has and is expected to continue expanding with the addition of several new species annually. Consequently, it is of paramount importance to have a method which is able to reliably and efficiently differentiate the numerous Vibrio species. Results In this study, a novel and rapid polymerase chain reaction (PCR)-based intergenic spacer (IGS)-typing system for vibrios was developed that is based on the well-known IGS regions located between the 16S and 23S rRNA genes on the bacterial chromosome. The system was optimized to resolve heteroduplex formation as well as to take advantage of capillary gel electrophoresis technology such that reproducible analyses could be achieved in a rapid manner. System validation was achieved through testing of 69 archetypal Vibrio strains, representing 48 Vibrio species, from which an 'IGS-type' profile database was generated. These data, presented here in several cluster analyses, demonstrated successful differentiation of the 69 type strains showing that this PCR-based fingerprinting method easily discriminates bacterial strains at the species level among Vibrio. Furthermore, testing 36 strains each of V. parahaemolyticus and V. vulnificus, important food borne pathogens, isolated from a variety of geographical locations with the IGS-typing method demonstrated distinct IGS-typing patterns indicative of subspecies divergence in both populations making this technique equally useful for intraspecies differentiation, as well. Conclusion This rapid, reliable and efficient IGS-typing system, especially in combination with 16S rRNA gene sequencing, has the capacity to not only discern and identify vibrios at the species level but, in some cases, at the sub-species level, as well. This procedure is particularly well-suited for preliminary species identification and, lends itself nicely to epidemiological investigations

  5. Variations in the 16S-23S rRNA internal transcribed spacer of fibrolytic Butyrivibrio isolates from the reindeer rumen.

    PubMed

    Præsteng, Kirsti E; Mackie, Roderick I; Cann, Isaac K O; Mathiesen, Svein D; Sundset, Monica A

    2011-07-01

    Strains of Butyrivibrio are principal cellulytic bacteria in the rumen of the High Arctic Svalbard reindeer ( Rangifer tarandus platyrhynchus ). According to phylogenetic analysis based on 16S rRNA gene sequencing, Butyrivibrio can be divided into three subgroups within the Clostridia class of the phylum Firmicutes, but the current phenotypic and genotypic differentiation within the family Lachnospiraceae is insufficient. This current study describes the sequence diversity of the 16S-23S rRNA intergenic transcribed spacer (ITS) region of Butyrivibrio isolates from reindeer. A total of 17 different ITS sequences with sizes between 449 and 784 nt were obtained. Genes encoding tRNA(Ile) and tRNA(Ala) were identified in four of the sequences. Phylogenetic neighbor-joining trees were constructed based on the ITS sequence and compared with a phylogenetic neighbor-joining tree based on 16S rRNA gene sequences previously obtained for the same isolates. These comparisons indicated a better differentiation between strains in the ITS sequence than the 16S rRNA gene based tree. Through this study, a better means for identifying and tracking fibrolytic and potentially probiotic Butyrivibrio strains in reindeer and other ruminants has been provided.

  6. Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae.

    PubMed

    Thanh, Hien Dang; Park, Hee Kuk; Kim, Wonyong; Shin, Hyoung-Shik

    2013-02-01

    Lactococcus garvieae is an important foodborne pathogen causing lactococcosis associated with hemorrhagic septicemia in fish worldwide. A real-time quantitative polymerase chain reaction (qPCR) protocol targeting the 16S-23S rRNA intergenic spacer (ITS) region was developed for the detection and enum-eration of L. garvieae. The specificity was evaluated using genomic DNAs extracted from 66 cocci strains. Fourteen L. garvieae strains tested were positive, whereas 52 other strains including Lactococcus lactis ssp. lactis, Lactococcus lactis ssp. hordniae and Lactococcus lactis ssp. cremoris did not show a specific signal. The minimal limit of detection was 2.63 fg of purified genomic DNA, equivalent to 1 genome of L. garvieae. The optimized protocol was applied for the survey of L. garvieae in naturally contaminated fish samples. Our results suggest that the qPCR protocol using ITS is a sensitive and efficient tool for the rapid detection and enumeration of L. garvieae in fish and fish-containing foods.

  7. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.

    PubMed

    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P

    2013-01-01

    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology.

  8. Identification of Carnobacterium species by restriction fragment length polymorphism of the 16S-23S rRNA gene intergenic spacer region and species-specific PCR.

    PubMed

    Rachman, Cinta; Kabadjova, Petia; Valcheva, Rosica; Prévost, Hervé; Dousset, Xavier

    2004-08-01

    The genus Carnobacterium is currently divided into the following eight species: Carnobacterium piscicola, C. divergens, C. gallinarum, C. mobile, C. funditum, C. alterfunditum, C. inhibens, and C. viridans. An identification tool for the rapid differentiation of these eight Carnobacterium species was developed, based on the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR). PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of this 16S-23S rDNA ISR was performed in order to obtain restriction profiles for all of the species. Three PCR amplicons, which were designated small ISR (S-ISR), medium ISR (M-ISR), and large ISR (L-ISR), were obtained for all Carnobacterium species. The L-ISR sequence revealed the presence of two tRNA genes, tRNA(Ala) and tRNA(Ile), which were separated by a spacer region that varied from 24 to 38 bp long. This region was variable among the species, allowing the design of species-specific primers. These primers were tested and proved to be species specific. The identification method based on the 16S-23S rDNA ISR, using PCR-RFLP and specific primers, is very suitable for the rapid low-cost identification and discrimination of all of the Carnobacterium species from other phylogenetically related lactic acid bacteria.

  9. Phylogeny of bradyrhizobia from Chinese cowpea miscellany inferred from 16S rRNA, atpD, glnII, and 16S-23S intergenic spacer sequences.

    PubMed

    Zhang, Sufang; Xie, Fuli; Yang, Jiangke; Li, Youguo

    2011-04-01

    The cowpea (Vigna unguiculata L.), peanut (Arachis hypogaea L.), and mung bean (Vigna radiata L.) belong to a group of plants known as the "cowpea miscellany" plants, which are widely cultivated throughout the tropic and subtropical zones of Africa and Asia. However, the phylogeny of the rhizobial strains that nodulate these plants is poorly understood. Previous studies have isolated a diversity of rhizobial strains from cowpea miscellany hosts and have suggested that, phylogenetically, they are from different species. In this work, the phylogeny of 42 slow-growing rhizobial strains, isolated from root nodules of cowpea, peanut, and mung bean from different geographical regions of China, was investigated using sequences from the 16S rRNA, atpD and glnII genes, and the 16S-23S rRNA intergenic spacer. The indigenous rhizobial strains from the cowpea miscellany could all be placed in the genus Bradyrhizobium , and Bradyrhizobium liaoningense and Bradyrhizobium yuanmingense were the main species. Phylogenies derived from housekeeping genes were consistent with phylogenies generated from the ribosomal gene. Mung bean rhizobia clustered only into B. liaoningense and B. yuanmingense and were phylogenetically less diverse than cowpea and peanut rhizobia. Geographical origin was significantly reflected in the phylogeny of mung bean rhizobia. Most cowpea rhizobia were more closely related to the 3 major groups B. liaoningense, B. yuanmingense, and Bradyrhizobium elkanii than to the minor groups Bradyrhizobium japonicum or Bradyrhizobium canariense . However, most peanut rhizobia were more closely related to the 2 major groups B. liaoningense and B. yuanmingense than to the minor group B. elkanii.

  10. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    NASA Astrophysics Data System (ADS)

    Okamura, K.; Hisada, T.; Takata, K.; Hiraishi, A.

    2013-04-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  11. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M

    1982-01-01

    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  12. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.

    1999-01-01

    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  13. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing.

  14. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    PubMed

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  15. Nature of polymorphisms in 16S-23S rRNA gene intergenic transcribed spacer fingerprinting of Bacillus and related genera.

    PubMed

    Daffonchio, Daniele; Cherif, Ameur; Brusetti, Lorenzo; Rizzi, Aurora; Mora, Diego; Boudabous, Abdellatif; Borin, Sara

    2003-09-01

    The intergenic transcribed spacers (ITS) between the 16S and 23S rRNA genetic loci are frequently used in PCR fingerprinting to discriminate bacterial strains at the species and intraspecies levels. We investigated the molecular nature of polymorphisms in ITS-PCR fingerprinting of low-G+C-content spore-forming bacteria belonging to the genera Bacillus, Brevibacillus, Geobacillus, and Paenibacillus: We found that besides the polymorphisms in the homoduplex fragments amplified by PCR, heteroduplex products formed during PCR between amplicons from different ribosomal operons, with or without tRNA genes in the ITS, contribute to the interstrain variability in ITS-PCR fingerprinting patterns obtained in polyacrylamide-based gel matrices. The heteroduplex nature of the discriminating bands was demonstrated by fragment separation in denaturing polyacrylamide gels, by capillary electrophoresis, and by cloning, sequencing, and recombination of purified short and tRNA gene-containing long ITS. We also found that heteroduplex product formation is enhanced by increasing the number of PCR cycles. Homoduplex-heteroduplex polymorphisms (HHP) in a conserved region, such as the 16S and 23S rRNA gene ITS, allowed discrimination of closely related strains and species undistinguishable by other methods, indicating that ITS-HHP analysis is an easy and reproducible additional tool for strain typing. PMID:12957895

  16. Genotypic Characterization of Bradyrhizobium Strains Nodulating Small Senegalese Legumes by 16S-23S rRNA Intergenic Gene Spacers and Amplified Fragment Length Polymorphism Fingerprint Analyses

    PubMed Central

    Doignon-Bourcier, Florence; Willems, Anne; Coopman, Renata; Laguerre, Gisele; Gillis, Monique; de Lajudie, Philippe

    2000-01-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations. PMID:10966419

  17. Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length polymorphism fingerprint analyses.

    PubMed

    Doignon-Bourcier, F; Willems, A; Coopman, R; Laguerre, G; Gillis, M; de Lajudie, P

    2000-09-01

    We examined the genotypic diversity of 64 Bradyrhizobium strains isolated from nodules from 27 native leguminous plant species in Senegal (West Africa) belonging to the genera Abrus, Alysicarpus, Bryaspis, Chamaecrista, Cassia, Crotalaria, Desmodium, Eriosema, Indigofera, Moghania, Rhynchosia, Sesbania, Tephrosia, and Zornia, which play an ecological role and have agronomic potential in arid regions. The strains were characterized by intergenic spacer (between 16S and 23S rRNA genes) PCR and restriction fragment length polymorphism (IGS PCR-RFLP) and amplified fragment length polymorphism (AFLP) fingerprinting analyses. Fifty-three reference strains of the different Bradyrhizobium species and described groups were included for comparison. The strains were diverse and formed 27 groups by AFLP and 16 groups by IGS PCR-RFLP. The sizes of the IGS PCR products from the Bradyrhizobium strains that were studied varied from 780 to 1,038 bp and were correlated with the IGS PCR-RFLP results. The grouping of strains was consistent by the three methods AFLP, IGS PCR-RFLP, and previously reported 16S amplified ribosomal DNA restriction analysis. For investigating the whole genome, AFLP was the most discriminative technique, thus being of particular interest for future taxonomic studies in Bradyrhizobium, for which DNA is difficult to obtain in quantity and quality to perform extensive DNA:DNA hybridizations.

  18. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O 139 outbreak based on the inter-genomic heterogeneity of the 16S-23S rRNA intergenic spacer regions.

    PubMed

    Ghatak, Atreyi; Majumdar, Anasuya; Ghosh, Ranajit K

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O 139 outbreak. ISR classes 'a' and 'g' were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O 139 serogroup and post-O 139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  19. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S-23S Spacer rRNA Genes

    PubMed Central

    Madico, Guillermo; Quinn, Thomas C.; Boman, Jens; Gaydos, Charlotte A.

    2000-01-01

    Three touchdown enzyme time release (TETR)-PCR assays were used to amplify different DNA sequences in the variable regions of the 16S and 16S-23S spacer rRNA genes specific for Chlamydia trachomatis, Chlamydia pneumoniae, and Chlamydia psittaci as improved tests for sensitive diagnosis and rapid species differentiation. The TETR-PCR protocol used 60 cycles of amplification, which provided improved analytical sensitivity (0.004 to 0.063 inclusion-forming unit of Chlamydia species per PCR). The sensitivity of TETR-PCR with primer set CTR 70-CTR 71 was 96.7%, and the specificity was 99.6%, compared to those of the AMPLICOR PCR for the detection of C. trachomatis in vaginal swab samples. TETR-PCR for C. pneumoniae with primer set CPN 90-CPN 91 was 90% sensitive and 93.3% specific compared with a nested PCR with primer set CP1/2-CPC/D for clinical respiratory samples. TETR-PCR for C. psittaci with primer set CPS 100-CPS 101 showed substantial agreement with cell culturing (κ, 0.78) for animal tissue samples. Primer sets were then combined into a single multiplex TETR-PCR test. The respective 315-, 195-, and 111-bp DNA target products were precisely amplified when DNA from each of the respective Chlamydia species or combinations of them was used. Multiplex chlamydia TETR-PCR correctly identified one strain of each of the 15 serovars of C. trachomatis, 22 isolates of C. pneumoniae, and 20 isolates of C. psittaci. The primer sets were specific for each species. No target products were amplified when DNA from C. pecorum or a variety of other microorganisms was tested for specificity. TETR-PCR with primers selected for specific sequences in the 16S and 16S-23S spacer rRNA genes is a valuable test that could be used either with individual primers or in a multiplex assay for the identification and differentiation of Chlamydia species from culture isolates or for the detection of chlamydiae in clinical samples. PMID:10699002

  20. Species-level identification of isolates of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex by sequence analysis of the 16S-23S rRNA gene spacer region.

    PubMed

    Chang, Hsien Chang; Wei, Yu Fang; Dijkshoorn, Lenie; Vaneechoutte, Mario; Tang, Chung Tao; Chang, Tsung Chain

    2005-04-01

    The species Acinetobacter calcoaceticus, A. baumannii, genomic species 3, and genomic species 13TU included in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex are genetically highly related and difficult to distinguish phenotypically. Except for A. calcoaceticus, they are all important nosocomial species. In the present study, the usefulness of the 16S-23S rRNA gene intergenic spacer (ITS) sequence for the differentiation of (genomic) species in the A. calcoaceticus-A. baumannii complex was evaluated. The ITSs of 11 reference strains of the complex and 17 strains of other (genomic) species of Acinetobacter were sequenced. The ITS lengths (607 to 638 bp) and sequences were highly conserved for strains within the A. calcoaceticus-A. baumannii complex. Intraspecies ITS sequence similarities ranged from 0.99 to 1.0, whereas interspecies similarities varied from 0.86 to 0.92. By using these criteria, 79 clinical isolates identified as A. calcoaceticus (18 isolates) or A. baumannii (61 isolates) with the API 20 NE system (bioMerieux Vitek, Marcy l'Etoile, France) were identified as A. baumannii (46 isolates), genomic species 3 (19 isolates), and genomic species 13TU (11 isolates) by ITS sequencing. An identification rate of 96.2% (76 of 79 isolates) was obtained by using ITS sequence analysis for identification of isolates in the A. calcoaceticus-A. baumannii complex, and the accuracy of the method was confirmed for a subset of strains by amplified rRNA gene restriction analysis and genomic DNA analysis by AFLP analysis by using libraries of profiles of reference strains. In conclusion, ITS sequence-based identification is reliable and provides a promising tool for elucidation of the clinical significance of the different species of the A. calcoaceticus-A. baumannii complex.

  1. Cyanobacterial Ecotypes in Different Optical Microenvironments of a 68°C Hot Spring Mat Community Revealed by 16S-23S rRNA Internal Transcribed Spacer Region Variation†

    PubMed Central

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea; Ward, David M.

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynthesis demonstrated the existence of physiologically distinct Synechococcus populations at different depths along a light gradient quantified by scalar irradiance microprobes. Molecular methods were used to evaluate whether physiologically distinct populations could be correlated with genetically distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S rRNA genes suggested the existence of closely related but genetically distinct populations corresponding to different functional populations occurring at different depths. PMID:12732563

  2. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  3. Lactobacillus species identification by amplified ribosomal 16S-23S rRNA restriction fragment length polymorphism analysis.

    PubMed

    Sandes, S H C; Alvin, L B; Silva, B C; Zanirati, D F; Jung, L R C; Nicoli, J R; Neumann, E; Nunes, A C

    2014-12-01

    Lactic acid bacteria strains are commonly used for animal and human consumption due to their probiotic properties. One of the major genera used is Lactobacillus, a highly diverse genus comprised of several closely related species. The selection of new strains for probiotic use, especially strains of Lactobacillus, is the focus of several research groups. Accurate identification to species level is fundamental for research on new strains, as well as for safety assessment and quality assurance. The 16S-23S internal transcribed spacer (ITS-1) is a deeply homologous region among prokaryotes that is commonly used for identification to the species level because it is able to acquire and accumulate mutations without compromising general bacterial metabolism. In the present study, 16S-23S ITS regions of 45 Lactobacillus species (48 strains) were amplified and subjected to independent enzymatic digestions, using 12 restriction enzymes that recognise six-base sequences. Twenty-nine species showed unique restriction patterns, and could therefore be precisely identified solely by this assay (64%). This approach proved to be reproducible, allowing us to establish simplified restriction patterns for each evaluated species. The restriction patterns of each species were similar among homologous strains, and to a large extent reflected phylogenetic relationships based on 16S rRNA sequences, demonstrating the promising nature of this region for evolutionary studies.

  4. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    PubMed

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  5. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  6. Inter- and intraspecific genomic variability of the 16S-23S intergenic spacer regions (ISR) in representatives of Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans.

    PubMed

    Ni, Yong-Qing; Yang, Yuan; Bao, Jing-Ting; He, Kai-Yu; Li, Hong-Yu

    2007-05-01

    The complete sequences of 32 intergenic spacer regions (ISR) from Acidithiobacillus strains, including 29 field strains isolated from coal, copper, molybdenum mine wastes or sediment of different geoclimatic regions in China, reference strain ATCC19859 and the type strains of the two species were determined. These data, together with other sequences available in the GenBank database, were used to carry out the first detailed assessment of the inter- and intraspecific genomic variability of the ISR sequences and to infer phylogenetic relationships within the genus. The total length of the 16S-23S rRNA intergenic spacer regions of the Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans strains ranged from 451 to 490 bp, and from 434 to 456 bp, respectively. The degree of intrageneric ISR sequence similarity was higher than the degree of intergeneric similarity, and the overall similarity values of the ISRs varied from 60.49% to 84.71% between representatives of different species of the genus Acidithiobacillus. Sequences from the spacer of the A. thiooxidans and A. ferrooxidans strains ranged from 86.71% to 99.56% and 92.36% to 100% similarity, respectively. All Acidithiobacillus strains were separated into three phylogenetic major clusters and seven phylogenetic groups. ISR may be a potential target for the development of in situ hybridization probe aimed at accurately detecting acidithiobacilli in the various acidic environments.

  7. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis. PMID:27546720

  8. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S-23S ITS region.

    PubMed

    Sciuto, Katia; Moro, Isabella

    2016-12-01

    Cyanobacteria are widespread prokaryotes that are able to live in extreme conditions such as thermal springs. Strains attributable to the genus Leptolyngbya are among the most common cyanobacteria sampled from thermal environments. Leptolyngbya is a character-poor taxon that was demonstrated to be polyphyletic based on molecular analyses. The recent joining of 16S rRNA gene phylogenies with 16S-23S ITS secondary structure analysis is a useful approach to detect new cryptic taxa and has led to the separation of new genera from Leptolyngbya and to the description of new species inside this genus and in other related groups. In this study, phylogenetic investigations based on both the 16S rRNA gene and the 16S-23S ITS region were performed alongside 16S rRNA and 16S-23S ITS secondary structure analyses on cyanobacteria of the family Leptolyngbyaceae. These analyses focused on filamentous strains sampled from thermal springs with a morphology ascribable to the genus Leptolyngbya. The phylogenetic reconstructions showed that the Leptolyngbya-like thermal strains grouped into a monophyletic lineage that was distinct from Leptolyngbya. The 16S-23S ITS secondary structure results supported the separation of this cluster. A new genus named Thermoleptolyngbya was erected to encompass these strains, and two species were described inside this new taxon: T. albertanoae and T. oregonensis.

  9. Characterization of the Lancefield group C streptococcus 16S-23S RNA gene intergenic spacer and its potential for identification and sub-specific typing.

    PubMed Central

    Chanter, N.; Collin, N.; Holmes, N.; Binns, M.; Mumford, J.

    1997-01-01

    The 16S-23S RNA gene intergenic spacers of isolates of Streptococcus equi (n = 5), S. zooepidemicus (n = 5), S. equisimilis (n = 3) and S. dysgalactiae (n = 2) were sequenced and compared. There were distinct regions within the spacer, arranged in the order 1-9 for all S. equi and one S. zooepidemicus isolate and 1,2 and 4-9 for the remaining isolates. Region 4 was identical to the tRNA(ala) gene found in the 16S-23S intergenic spacers of other streptococci. Regions 1, 5, 6 and 7 had distinct variations, each conserved in different isolates. However, amongst the intergenic spacers there were different combinations of variant regions, suggesting a role for DNA recombination in their evolution. The intergenic spacer of all isolates of S. equi and one S. zooepidemicus isolate were almost identical. Primers derived from the variant sequences of regions 1 and 5 to 6 were used to group all S. zooepidemicus (n = 17) and S. equi (n = 5) into 1 of 8 types by polymerase chain reaction; three S. zooepidemicus isolates typed the same as S. equi. S. equi and S. zooepidemicus were clearly distinguishable from S. equisimilis and S. dysgalactiae which had shorter regions 5 and 6 and no region 7. Most homology for the group C sequences was found in previously published sequences for the 16S-23S intergenic spacers of S. anginosis, S. constellatus, S. intermedius, S. salivarius and S. agalactiae. A 75-90 nucleotide length shared with S. anginosus and S. intermedius in opposite orientations in the two main variants of region 6 supported the role for DNA recombination in the evolution of the spacer. The 16S-23S intergenic spacers indicate that S. zooepidemicus was the archetypal species for S. equi and that both are genetically more distant from S. equisimilis and S. dysgalactiae. The intergenic spacer can be used to identify specifically the group C streptococci and as an epidemiological marker for S. zooepidemicus. PMID:9129589

  10. Use of denaturing gradient gel electrophoresis to detect mutation in VS2 of the 16S-23S rDNA spacer amplified from Staphylococcus aureus isolates.

    PubMed

    Gürtler, V; Barrie, H D; Mayall, B C

    2001-06-01

    To develop a double gradient denaturing gradient gel electrophoresis (DG-DGGE) based typing method that rapidly and accurately types clinical isolates of Staphylococcus aureus, the VS2 region of the 16S-23S rRNA spacer region (ISR) was chosen because of its potential high variation. The VS2 region was amplified with a 40-mer GC-clamp attached to the 5'-end of the reverse primer. The 145 bp PCR product was then separated by DG-DGGE using denaturant concentrations of 25-40% and polyacrylamide concentrations of 6-12%. Of the five mutations identified in 336 S. aureus isolates, one mutation was found to be highly specific for 161/171 (94%) of methicillin-resistant S. aureus (MRSA) isolates from different geographic locations and isolation times. This same mutation was found in 15/160 (9%) of penicillin- or methicillin-sensitive S. aureus isolates. In some isolates two mutations occured together in the one genome suggesting some S. aureus isolates have two copies of VS2. In these 336 isolates nine genotypes with different combinations of the five mutations were identified. In 18 coagulase-negative staphylococci (CNS), the MRSA-specific mutation was found along with two other mutations in all isolates demonstrating consistent differences in the presence of these mutations between CNS and S. aureus. The marked differences in VS2 sequences found between MRSA, methicillin- or penicillin-sensitive S. aureus (SSA), and CNS by DGGE in the present study may be useful in evolutionary studies and in the development of a specific assay for MRSA from clinical specimens.

  11. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.

    PubMed

    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C

    2002-05-01

    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  12. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    PubMed Central

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated allowed the soft rot erwinias to be differentiated from all other Erwinia and non-Erwinia species and placed into one of three groups (I to III). Group I comprised all Erwinia carotovora subsp. atroseptica and subsp. betavasculorum isolates. Group II comprised all E. carotovora subsp. carotovora, subsp. odorifera, and subsp. wasabiae and E. cacticida isolates, and group III comprised all E. chrysanthemi isolates. To increase the level of discrimination further, the ITS-PCR products were digested with one of two restriction enzymes. Digestion with CfoI identified E. carotovora subsp. atroseptica and subsp. betavasculorum (group I) and E. chrysanthemi (group III) isolates, while digestion with RsaI identified E. carotovora subsp. wasabiae, subsp. carotovora, and subsp. odorifera/carotovora and E. cacticida isolates (group II). In the latter case, it was necessary to distinguish E. carotovora subsp. odorifera and subsp. carotovora using the α-methyl glucoside test. Sixty suspected soft rot erwinia isolates from Australia were identified as E. carotovora subsp. atroseptica, E. chrysanthemi, E. carotovora subsp. carotovora, and non-soft rot species. Ten “atypical” E. carotovora subsp. atroseptica isolates were identified as E. carotovora subsp. atroseptica, subsp. carotovora, and subsp. betavasculorum and non-soft rot species, and two “atypical” E. carotovora subsp. carotovora isolates were identified as E. carotovora subsp. carotovora and subsp. atroseptica. PMID:11526007

  13. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    PubMed

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  14. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.

    PubMed

    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C

    1999-07-01

    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  15. DNA fingerprinting of Paenibacillus popilliae and Paenibacillus lentimorbus using PCR-amplified 16S-23S rDNA intergenic transcribed spacer (ITS) regions.

    PubMed

    Dingman, Douglas W

    2009-01-01

    Failure to identify correctly the milky disease bacteria, Paenibacillus popilliae and Paenibacillus lentimorbus, has resulted in published research errors and commercial production problems. A DNA fingerprinting procedure, using PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS) regions, has been shown to easily and accurately identify isolates of milky disease bacteria. Using 34 P. popilliae and 15 P. lentimorbus strains, PCR amplification of different ITS regions produced three DNA fingerprints. For P. lentimorbus phylogenic group 2 strains and for all P. popilliae strains tested, electrophoresis of amplified DNA produced a migratory pattern (i.e., ITS-PCR fingerprint) exhibiting three DNA bands. P. lentimorbus group 1 strains also produced this ITS-PCR fingerprint. However, the fingerprint was phase-shifted toward larger DNA sizes. Alignment of the respective P. popilliae and P. lentimorbus group 1 ITS DNA sequences showed extensive homology, except for a 108bp insert in all P. lentimorbus ITS regions. This insert occurred at the same location relative to the 23S rDNA and accounted for the phase-shift difference in P. lentimorbus group 1 DNA fingerprints. At present, there is no explanation for this 108bp insert. The third ITS-PCR fingerprint, produced by P. lentimorbus group 3 strains, exhibited approximately eight DNA bands. Comparison of the three fingerprints of milky disease bacteria to the ITS-PCR fingerprints of other Paenibacillus species demonstrated uniqueness. ITS-PCR fingerprinting successfully identified eight unknown isolates as milky disease bacteria. Therefore, this procedure can serve as a standard protocol to identify P. popilliae and P. lentimorbus.

  16. 16S-23S Internal Transcribed Spacer Region PCR and Sequencer-Based Capillary Gel Electrophoresis has Potential as an Alternative to High Performance Liquid Chromatography for Identification of Slowly Growing Nontuberculous Mycobacteria

    PubMed Central

    Subedi, Shradha; Kong, Fanrong; Jelfs, Peter; Gray, Timothy J.; Xiao, Meng; Sintchenko, Vitali; Chen, Sharon C-A

    2016-01-01

    Accurate identification of slowly growing nontuberculous mycobacteria (SG-NTM) of clinical significance remains problematic. This study evaluated a novel method of SG-NTM identification by amplification of the mycobacterial 16S-23S rRNA internal transcribed spacer (ITS) region followed by resolution of amplified fragments by sequencer-based capillary gel electrophoresis (SCGE). Fourteen American Type Culture Collection (ATCC) strains and 103 clinical/environmental isolates (total n = 24 species) of SG-NTM were included. Identification was compared with that achieved by high performance liquid chromatography (HPLC), in-house PCR and 16S/ITS sequencing. Isolates of all species yielded a SCGE profile comprising a single fragment length (or peak) except for M. scrofulaceum (two peaks). SCGE peaks of ATCC strains were distinct except for peak overlap between Mycobacterium kansasii and M. marinum. Of clinical/environmental strains, unique peaks were seen for 7/17 (41%) species (M. haemophilum, M. kubicae, M. lentiflavum, M. terrae, M. kansasii, M. asiaticum and M. triplex); 3/17 (18%) species were identified by HPLC. There were five SCGE fragment length types (I–V) each of M. avium, M. intracellulare and M. gordonae. Overlap of fragment lengths was seen between M. marinum and M. ulcerans; for M. gordonae SCGE type III and M. paragordonae; M. avium SCGE types III and IV, and M. intracellulare SCGE type I; M. chimaera, M. parascrofulaceum and M. intracellulare SCGE types III and IV; M. branderi and M. avium type V; and M. vulneris and M. intracellulare type V. The ITS-SCGE method was able to provide the first line rapid and reproducible species identification/screening of SG-NTM and was more discriminatory than HPLC. PMID:27749897

  17. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals.

  18. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    PubMed

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here.

  19. Direct identification of slowly growing Mycobacterium species by analysis of the intergenic 16S-23S rDNA spacer region (ISR) using a GelCompar II database containing sequence based optimization for restriction fragment site polymorphisms (RFLPs) for 12 enzymes.

    PubMed

    Gürtler, Volker; Harford, Cate; Bywater, Judy; Mayall, Barrie C

    2006-02-01

    To obtain Mycobacterium species identification directly from clinical specimens and cultures, the 16S-23S rDNA spacer (ISR) was amplified using previously published primers that detect all Mycobacterium species. The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms (RFLPs) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species. Subsequently a GelCompar II database was constructed from RFLPs for 10 enzymes that have been used in the literature to differentiate slowly growing Mycobacterium species. The combination of Sau96I and HaeIII were the best choice of enzymes for differentiating clinically relevant slowly growing Mycobacterium species. A total of 392 specimens were studied by PCR with 195 negative and 197 positive specimens. The ISR-PCR product was digested with HaeIII (previously reported) and Sau96I (new to this study) to obtain a Mycobacterium species identification based on the ISR-RFLPs. The species identification obtained by ISR-RFLP was confirmed by DNA sequencing (isolate numbers are shown in parentheses) for M. avium (3), M. intracellulare (4), M. avium complex (1), M. gordonae (2) and M. tuberculosis (1). The total number of specimens (99) identified were from culture (67), Bactectrade mark 12B culture bottles (11), EDTA blood (3), directly from smear positive specimens (13), tissue (4) and urine (1). Direct species identification was obtained from all 13/13 smear positive specimens. The total number of specimens (99) were identified as M. tuberculosis (41), M. avium (7), M. avium complex (11), M. intracellulare MIN-A (20), M. flavescens (2), M. fortuitum (10), M. gordonae (4), M. shimoidei (1), M. ulcerans (1) and M. chelonae (2). This method reduces the time taken for Mycobacterium species identification from 8-10 weeks for culture and biochemical identification; to 4-6 weeks for culture and ISR-RFLP; to 2 days

  20. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  1. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.

    PubMed

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  2. Intragenomic heterogeneity of the 16S rRNA-23S rRNA internal transcribed spacer among Pseudomonas syringae and Pseudomonas fluorescens strains.

    PubMed

    Milyutina, Irina A; Bobrova, Vera K; Matveeva, Eugenia V; Schaad, Norman W; Troitsky, Alexey V

    2004-10-01

    The 16S-23S rRNA internal transcribed spacer regions (ITS1) from 14 strains of Pseudomonas syringae and P. fluorescens were sequenced. ITS1 exhibited significant sequence variability among different operons within a single genome. From 1 to 4 types of ITS1 were found in individual genomes of the P. syringae and P. fluorescens strains. A total of eight ITS1 types were identified among strains studied. The ITS1 nucleotide sequences consisted of conserved blocks including, among others, a stem-forming region of box B, tRNAIle and tRNAAla genes and several variable blocks. The differences in the variable regions were mostly due to insertions and/or deletions of nucleotide blocks. The intragenomic heterogeneity of ITS1 was brought about by different combinations of variable blocks, which possibly have resulted from recombination and horizontal transfer.

  3. Organization, structure, and variability of the rRNA operon of the Whipple's disease bacterium (Tropheryma whippelii).

    PubMed

    Maiwald, M; von Herbay, A; Lepp, P W; Relman, D A

    2000-06-01

    Whipple's disease is a systemic disorder associated with a cultivation-resistant, poorly characterized actinomycete, Tropheryma whippelii. We determined a nearly complete rRNA operon sequence of T. whippelii from specimens from 3 patients with Whipple's disease, as well as partial operon sequences from 43 patients. Variability was observed in the 16S-23S rRNA spacer sequences, leading to the description of five distinct sequence types. One specimen contained two spacer sequence types, raising the possibility of a double infection. Secondary structure models for the primary rRNA transcript and mature rRNAs revealed rare or unique features.

  4. Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S-23S rDNA intergenic spacer PCR analysis.

    PubMed

    Dec, Marta; Urban-Chmiel, Renata; Gnat, Sebastian; Puchalski, Andrzej; Wernicki, Andrzej

    2014-04-01

    The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1-10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

  5. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  6. Phylogenetic analysis of vertically transmitted psyllid endosymbionts (Candidatus Carsonella ruddii) based on atpAGD and rpoC: comparisons with 16S-23S rDNA-derived phylogeny.

    PubMed

    Thao, M L; Clark, M A; Burckhardt, D H; Moran, N A; Baumann, P

    2001-06-01

    Psyllids are insects that harbor endosymbionts (Candidatuus Carsonella ruddii) within specialized cells found in the insect's body cavity. Previous phylogenetic analyses based on endosymbiont 16S-23S ribosomal DNA and a host gene were concordant (M.L. Thao, et al., Appl. Env. Microbiol. 66:2898, 2000). Additional analyses with atpAGD and rpoBC gave similar trees showing the agreement expected from organisms that evolve through vertical transmission with no gene exchange.

  7. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  8. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S-23S interspace region molecular weight patterns.

    PubMed

    Ferreira, Adriano Martison; Bonesso, Mariana Fávero; Mondelli, Alessandro Lia; da Cunha, Maria de Lourdes Ribeiro de Souza

    2012-12-01

    The emergence of Staphylococcus spp. not only as human pathogens, but also as reservoirs of antibiotic resistance determinants, requires the development of methods for their rapid and reliable identification in medically important samples. The aim of this study was to compare three phenotypic methods for the identification of Staphylococcus spp. isolated from patients with urinary tract infection using the PCR of the 16S-23S interspace region generating molecular weight patterns (ITR-PCR) as reference. All 57 S. saprophyticus studied were correctly identified using only the novobiocin disk. A rate of agreement of 98.0% was obtained for the simplified battery of biochemical tests in relation to ITR-PCR, whereas the Vitek I system and novobiocin disk showed 81.2% and 89.1% agreement, respectively. No other novobiocin-resistant non-S. saprophyticus strain was identified. Thus, the novobiocin disk is a feasible alternative for the identification of S. saprophyticus in urine samples in laboratories with limited resources. ITR-PCR and the simplified battery of biochemical tests were more reliable than the commercial systems currently available. This study confirms that automated systems are still unable to correctly differentiate CoNS species and that simple, reliable and inexpensive methods can be used for routine identification.

  9. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  10. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    PubMed

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  11. 16S–23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    PubMed Central

    Tokajian, Sima; Issa, Nahla; Salloum, Tamara; Ibrahim, Joe; Farah, Maya

    2016-01-01

    Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S–23S rDNA intergenic spacer (ITS) sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S–23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 and 849 bp, while their G+C content was 42.2–57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes), ITSAla(TGC), ITSAla(TGC)+Ile(GAT), ITSIle(GAT)+Ala(TGC), and ITS Ile(GAT)+Pseudo. All of the identified tRNAAla(TGC) molecules consisted of 73 bases, and all of the tRNAIle(GAT) molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2. The importance of this study is that this is the first comparison of the 16S–23S rDNA ITS sequence similarities and tRNA genes from sphingomonads. Collectively the data obtained in this study revealed the heterogeneity and extent of variability within the ITS region compared to the 16S rRNA gene within closely related isolates. Sequence and length polymorphisms within the ITS region along with the ITS types (tRNA-containing or lacking and the type of tRNA) and ITS-2 size and sequence similarities allowed us to overcome the limitation we previously encountered in resolving closely related isolates based on the 16S rRNA gene sequence. PMID:26904019

  12. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  13. Internal Transcribed Spacer rRNA Gene-Based Phylogenetic Reconstruction Using Algorithms with Local and Global Sequence Alignment for Black Yeasts and Their Relatives

    PubMed Central

    Caligiorne, R. B.; Licinio, P.; Dupont, J.; de Hoog, G. S.

    2005-01-01

    Sequences of rRNA gene internal transcribed spacer (ITS) of a standard set of black yeast-like fungal pathogens were compared using two methods: local and global alignments. The latter is based on DNA-walk divergence analysis. This method has become recently available as an algorithm (DNAWD program) which converts sequences into three-dimensional walks. The walks are compared with, or fit to, each other generating global alignments. The DNA-walk geometry defines a proper metric used to create a distance matrix appropriated for phylogenetic reconstruction. In this work, the analyses were carried out for species currently classified in Capronia, Cladophialophora, Exophiala, Fonsecaea, Phialophora, and Ramichloridium. Main groups were verified by small-subunit rRNA gene data. DNAWD applied to ITS2 alone enabled species recognition as well as phylogenetic reconstruction reflecting clades discriminated in small-subunit rRNA gene phylogeny, which was not possible with any other algorithm using local alignment for the same data set. It is concluded that DNAWD provides rapid insight into broader relationships between groups using genes that otherwise would be hardly usable for this purpose. PMID:15956403

  14. Identification of Mushroom Species by Automated rRNA Intergenic Spacer Analysis (ARISA) and Its Application to a Suspected Case of Food Poisoning with Tricholoma ustale.

    PubMed

    Sugawara, Ryota; Yamada, Sayumi; Tu, Zhihao; Sugawara, Akiko; Hoshiba, Toshihiro; Eisaka, Sadao; Yamaguchi, Akihiro

    2016-01-01

    Automated rRNA intergenic spacer analysis (ARISA), a method of microbiome analysis, was evaluated for species identification of mushrooms based on the specific fragment sizes. We used 51 wild mushroom-fruiting bodies collected in the centre of Hokkaido and two cultivated mushrooms. Samples were hot-air-dried and DNA were extracted by a beads beating procedure. Sequencing analysis of portions of the rRNA gene (rDNA) provided 33 identifications of mushrooms by genus or species. The results of ARISA identification based on the combination of the fragment sizes corresponding to two inter spacer regions (ITS2 and ITS1) of rDNA within±0.1% accuracy showed that 27 out of the 33 species had specific fragment sizes differentiated from other species. The remaining 6 species formed 3 pairs that showed overlapping fragment sizes. In addition, within-species polymorphisms were observed as 1 bp differences among 32 samples of 13 species. ARISA was applied to investigate a case of suspected food poisoning in which the mushroom was thought to be a toxic Kakishimeji. The morphological identification of the mushroom was ambiguous since the remaining sample lacked a part of the fruiting body. Further, yeast colonies had grown on the surface of the fruiting body during storage. The ARISA fragment size of the mushroom showed 7 bp difference from that of the candidate toxic mushroom. Although ARISA could be a useful tools for estimation of mushroom species, especially in case where the fruiting bodies have deteriorated or been processed, further studies are necessary for reliable identification. For example, it may be necessary to adopt more informative genes which could provide clearer species-specific polymorphisms than the ITS regions. PMID:27211917

  15. Ecotypes of planktonic actinobacteria with identical 16S rRNA genes adapted to thermal niches in temperate, subtropical, and tropical freshwater habitats.

    PubMed

    Hahn, Martin W; Pöckl, Matthias

    2005-02-01

    Seven strains with identical 16S rRNA genes affiliated with the Luna2 cluster (Actinobacteria) were isolated from six freshwater habitats located in temperate (Austria and Australia), subtropical (People's Republic of China), and tropical (Uganda) climatic zones. The isolates had sequence differences at zero to five positions in a 2,310-nucleotide fragment of the ribosomal operon, including part of the intergenic spacer upstream of the 16S rRNA gene, the complete 16S rRNA gene, the complete 16S-23S internal transcribed spacer (ITS1), and a short part of the 23S rRNA gene. Most of the few sequence differences found were located in the internal transcribed spacer sequences. Two isolates obtained from habitats in Asia and Europe, as well as two isolates obtained from different habitats in the People's Republic of China, had identical sequences for the entire fragment sequenced. In spite of minimal sequence differences in the part of the ribosomal operon investigated, the strains exhibited significant differences in their temperature response curves (with one exception), as well as pronounced differences in their temperature optima (25.0 to 35.6 degrees C). The observed differences in temperature adaptation were generally in accordance with the thermal conditions in the habitats where the strains were isolated. Strains obtained from temperate zone habitats had the lowest temperature optima, strains from subtropical habitats had intermediate temperature optima, and a strain from a tropical habitat had the highest temperature optimum. Based on the observed temperature responses, we concluded that the strains investigated are well adapted to the thermal conditions in their home habitats. Consequently, these closely related strains represent different ecotypes adapted to different thermal niches.

  16. Sequence Diversity of the Intergenic Spacer Region of the rRNA Gene of Malassezia globosa Colonizing the Skin of Patients with Atopic Dermatitis and Healthy Individuals

    PubMed Central

    Sugita, Takashi; Kodama, Minako; Saito, Masuyoshi; Ito, Tomonobu; Kato, Yukihiko; Tsuboi, Ryoji; Nishikawa, Akemi

    2003-01-01

    The lipophilic yeast Malassezia globosa is one of the major constituents of the mycoflora of the skin of patients with atopic dermatitis (AD). We compared the genotypes of M. globosa colonizing the skin surface of 32 AD patients and 20 healthy individuals for polymorphism of the intergenic spacer (IGS) 1 region of the rRNA gene. Sequence analysis demonstrated that M. globosa was divided into four major groups, which corresponded to the sources of the samples, on the phylogenetic tree. Of the four groups, two were from AD patients and one was from healthy subjects. The remaining group included samples from both AD patients and healthy subjects. In addition, the IGS 1 region of M. globosa contained short sequence repeats: (CT)n, and (GT)n. The number of sequence repeats also differed between the IGS 1 of M. globosa from AD patients and that from healthy subjects. These findings suggest that a specific genotype of M. globosa may play a significant role in AD, although M. globosa commonly colonizes both AD patients and healthy subjects. PMID:12843037

  17. From genus to phylum: large-subunit and internal transcribed spacer rRNA operon regions show similar classification accuracies influenced by database composition.

    PubMed

    Porras-Alfaro, Andrea; Liu, Kuan-Liang; Kuske, Cheryl R; Xie, Gary

    2014-02-01

    We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5' section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets.

  18. Determination of the nucleotide sequence of the 23S ribosomal RNA and flanking spacers of an Enterococcus faecium strain, reveals insertion-deletion events in the ribosomal spacer 1 of enterococci.

    PubMed

    Naimi, A; Beck, G; Monique, M; Lefèbvre, G; Branlanti, C

    1999-02-01

    The usefulness of 16S-23S (ITS1) and 23S-5S (ITS2) ribosomal spacer nucleotide sequence determination, as a complementary approach to the biochemical tests traditionally used for enterococcal species identification, is shown by its application to the identification of a strain, E27, isolated from a natural bacteria mixture used for cheese production. Using combined approaches we showed, unambiguously, that strain E27 belongs to the Enterococcus faecium species. However, its ITS1 region has an interesting peculiarity. In our previous study of ITS1s from various enterococcal species (NAIMI et al., 1997, Microbiology 143, 823-834), the ITS1s of the two E. faecium strains studied, were found to contain an additional 115-nt long stem-loop structure as compared to the ITS1s of other enterococci, only one out of the 3 ITS1s of E. hirae ATCC 9790, was found to contain a similar 107-nt long stem-loop structure. The ITS1 of strain E27 is 100% identical to that of E. faecium ATCC 19434T, except that the 115-nt additional fragment is absent. This strongly suggests the existence of lateral DNA transfer or DNA recombination events at a hot spot position of the ITS1s from E. faecium and E. hirae. Small and large ITS1 nucleotide sequence determination for strain E27 generalized the notion of two kinds of ITSs in enterococci: one with a tRNA(Ala) gene, one without tRNA gene. To complete strain E27 characterization, its 23S rRNA sequence was established. This is the first complete 23S rRNA nucleotide sequence determined for an enterococcal species.

  19. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    PubMed

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  20. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  1. Internal Transcribed Spacer 2 (nu ITS2 rRNA) Sequence-Structure Phylogenetics: Towards an Automated Reconstruction of the Green Algal Tree of Life

    PubMed Central

    Buchheim, Mark A.; Keller, Alexander; Koetschan, Christian; Förster, Frank; Merget, Benjamin; Wolf, Matthias

    2011-01-01

    Background Chloroplast-encoded genes (matK and rbcL) have been formally proposed for use in DNA barcoding efforts targeting embryophytes. Extending such a protocol to chlorophytan green algae, though, is fraught with problems including non homology (matK) and heterogeneity that prevents the creation of a universal PCR toolkit (rbcL). Some have advocated the use of the nuclear-encoded, internal transcribed spacer two (ITS2) as an alternative to the traditional chloroplast markers. However, the ITS2 is broadly perceived to be insufficiently conserved or to be confounded by introgression or biparental inheritance patterns, precluding its broad use in phylogenetic reconstruction or as a DNA barcode. A growing body of evidence has shown that simultaneous analysis of nucleotide data with secondary structure information can overcome at least some of the limitations of ITS2. The goal of this investigation was to assess the feasibility of an automated, sequence-structure approach for analysis of IT2 data from a large sampling of phylum Chlorophyta. Methodology/Principal Findings Sequences and secondary structures from 591 chlorophycean, 741 trebouxiophycean and 938 ulvophycean algae, all obtained from the ITS2 Database, were aligned using a sequence structure-specific scoring matrix. Phylogenetic relationships were reconstructed by Profile Neighbor-Joining coupled with a sequence structure-specific, general time reversible substitution model. Results from analyses of the ITS2 data were robust at multiple nodes and showed considerable congruence with results from published phylogenetic analyses. Conclusions/Significance Our observations on the power of automated, sequence-structure analyses of ITS2 to reconstruct phylum-level phylogenies of the green algae validate this approach to assessing diversity for large sets of chlorophytan taxa. Moreover, our results indicate that objections to the use of ITS2 for DNA barcoding should be weighed against the utility of an automated

  2. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  3. Single-Cell DNA barcoding using sequences from the small subunit rRNA and internal transcribed spacer region identifies new species of Trichonympha and Trichomitopsis from the hindgut of the termite Zootermopsis angusticollis.

    PubMed

    Tai, Vera; James, Erick R; Perlman, Steve J; Keeling, Patrick J

    2013-01-01

    To aid in their digestion of wood, lower termites are known to harbour a diverse community of prokaryotes as well as parabasalid and oxymonad protist symbionts. One of the best-studied lower termite gut communities is that of Zootermopsis angusticollis which has been known for almost 100 years to possess 3 species of Trichonympha (T. campanula, T. collaris, and T. sphaerica), 1 species of Trichomitopsis (T. termopsidis), as well as smaller flagellates. We have re-assessed this community by sequencing the small subunit (SSU) rRNA gene and the internal transcribed spacer (ITS) region from a large number of single Trichonympha and Trichomitopsis cells for which morphology was also documented. Based on phylogenetic clustering and sequence divergence, we identify 3 new species: Trichonympha postcylindrica, Trichomitopsis minor, and Trichomitopsis parvus spp. nov. Once identified by sequencing, the morphology of the isolated cells for all 3 new species was re-examined and found to be distinct from the previously described species: Trichonympha postcylindrica can be morphologically distinguished from the other Trichonympha species by an extension on its posterior end, whereas Trichomitopsis minor and T. parvus are smaller than T. termopsidis but similar in size to each other and cannot be distinguished based on morphology using light microscopy. Given that Z. angusticollis has one of the best characterized hindgut communities, the near doubling of the number of the largest and most easily identifiable symbiont species suggests that the diversity of hindgut symbionts is substantially underestimated in other termites as well. Accurate descriptions of the diversity of these microbial communities are essential for understanding hindgut ecology and disentangling the interactions among the symbionts, and molecular barcoding should be a priority for these systems.

  4. Molecular Method for Bartonella Species Identification in Clinical and Environmental Samples▿

    PubMed Central

    García-Esteban, Coral; Gil, Horacio; Rodríguez-Vargas, Manuela; Gerrikagoitia, Xeider; Barandika, Jesse; Escudero, Raquel; Jado, Isabel; García-Amil, Cristina; Barral, Marta; García-Pérez, Ana L.; Bhide, Mangesh; Anda, Pedro

    2008-01-01

    A new, efficient molecular method for detection of Bartonella, based on the 16S-23S rRNA intergenic spacer and 16S rRNA amplification by multiplex PCR combined with reverse line blotting, was designed. This assay could simultaneously detect 20 different known species and other Bartonella species not described previously. PMID:18094134

  5. Differentiation of Debaryomyces hansenii and Candida famata by rRNA gene intergenic spacer fingerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. flareri (=D. subglobosus) and D. prosopidis: description of D. vietnamensis sp. nov. closely related to D. nepalensis.

    PubMed

    Nguyen, Huu-Vang; Gaillardin, Claude; Neuvéglise, Cécile

    2009-06-01

    The intergenic spacer rDNA amplification and AluI fingerprinting (IGSAF) method detected four distinct groups among 170 Debaryomyces hansenii strains: D. hansenii var. hansenii; Candida famata var. famata; D. hansenii var. fabryi and C. famata var. flareri. IGS sequence comparison of representative strains showed that D. hansenii var. hansenii and C. famata var. famata belonged to one species, whereas D. hansenii var. fabryi and C. famata var. flareri belonged to two different ones. This confirmed the following three species recently reinstated: D. hansenii (=C. famata), Debaryomyces fabryi and Debaryomyces subglobosus (=Candida flareri). Accordingly, growth at 37 degrees C may no longer be used to differentiate D. hansenii from D. fabryi. Riboflavin production is more specific for D. fabryi and D. subglobosus strains. IGSAF identified all the other 17 species of the genus Debaryomyces, six of them sharing with D. hansenii an rRNA gene unit harbouring two 5S rRNA genes. The phylogenetic tree established with IGS sequences was congruent with the one based on ACT1, GPD1 and COX2 sequences depicting a distinct D. hansenii clade close to the D. subglobosus, Debaryomyces prosopidis and D. fabryi clade. Description of Debaryomyces vietnamensis sp. nov. (type strain CBS 10535(T), MUCL 51648(T)), closely related to Debaryomyces nepalensis is given. PMID:19385997

  6. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single strand conformation polymorphism (SSCP). Diversity indexes sh...

  7. Use of PCR Targeting of Internal Transcribed Spacer Regions and Single-Stranded Conformation Polymorphism Analysis of Sequence Variation in Different Regions of rRNA Genes in Fungi for Rapid Diagnosis of Mycotic Keratitis†

    PubMed Central

    Kumar, Manish; Shukla, P. K.

    2005-01-01

    The increased incidence of fungal infections in the recent past has been attributed to the increase in the number of human immunodeficiency virus-positive and AIDS patients. Early diagnosis of mycoses in patients is crucial for prompt antifungal therapy. Immunological methods of diagnosis have not been found to be satisfactory, and recent research has been diverted to the use of PCR for the sensitive and early diagnosis at the molecular level. In the present study we targeted different regions of the rRNA gene to diagnose cases of mycotic keratitis and identify the causal agents. Six fungus-specific primers (primers ITS1, ITS2, ITS3, ITS4, invSR1R, and LR12R) were used, and the amplified products were analyzed by single-stranded conformation polymorphism (SSCP) analysis. Dendrograms of these SSCP patterns, prepared on the basis of Jaccard's coefficient, indicated that the PCR products obtained with primer pair ITS1 and ITS2 were the best for the identification of fungi. The results were confirmed by sequencing of the PCR products, and the approach was successfully tested experimentally for the detection of mycotic keratitis caused by Aspergillus fumigatus and was used for the diagnosis of fungal corneal ulcers in patients. PMID:15695661

  8. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  9. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    PubMed Central

    Wang, Deguo; Liu, Yanhong

    2015-01-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  10. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-06-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  11. Improving Resident Knowledge of Spacers.

    PubMed

    Kilgore, Brian; Al Katranji, Khalid; Woodall, Meredith; Shepherd, Meagan; Flesher, Susan L

    2016-10-01

    Studies show the delivery of inhaled medications is maximized when a metered-dose inhaler (MDI) with a spacer is utilized. Our residents expressed concern with their knowledge of MDIs and spacers. This study was designed to address those concerns. Residents were given a 12-question pre-intervention, self-assessment questionnaire that explored their overall knowledge and comfort in utilizing MDI with spacers. Participants then received educational intervention via multimedia videos and a demonstration of proper use of MDI with spacer. Participants were given the same questionnaire immediately following the education and again 3 months later. Improvement was significant (P < .05) for each element studied as derived from the 12 questions. Improvement remained significant when these variables were assessed in the 3-month follow-up. In this study, we successfully improved the ability of our residents to deliver quality care by improving their knowledge and confidence in utilizing MDIs with spacers. PMID:27630006

  12. Cladistic biogeography of Juglans (Juglandaceae) based on chloroplast DNA intergenic spacer sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phylogenetic utility of sequence variation from five chloroplast DNA intergenic spacer (IGS) regions: trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM was examined in the genus Juglans. A total of seventeen taxa representing the four sections within Juglans and an outgroup taxon, ...

  13. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  14. Functional analysis of transcribed spacers of yeast ribosomal DNA.

    PubMed Central

    Musters, W; Boon, K; van der Sande, C A; van Heerikhuizen, H; Planta, R J

    1990-01-01

    Making use of an rDNA unit, containing oligonucleotide tags in both the 17S and 26S rRNA gene, we have analyzed the effect of various deletions in the External Transcribed Spacer (ETS) and in one of the Internal Transcribed Spacers 1 (ITS1) on the process of ribosome formation in yeast. By following the fate of the tagged transcripts of this rDNA unit in vivo by Northern hybridization we found that deleting various parts of the ETS prevents the accumulation of tagged 17S rRNA and its assembly into 40S subunits, but not the formation of 60S subunits. Deleting the central region of ITS1, including a processing site that is used in an early stage of the maturation process, was also found to prevent the accumulation of functional 49 S subunits, whereas no effect on the formation of 60S subunits was detected. The implications of these findings for yeast pre-rRNA processing are discussed. Images Fig. 3. Fig. 4. Fig. 6. Fig. 7. PMID:2249660

  15. Electrostatic precipitator construction having spacers

    SciTech Connect

    Jonelis, J.A.

    1984-10-23

    The present invention relates to an improved construction for an electrostatic precipitator. The electrostatic precipitator collects solid particles carried by a flue gas from a source of combustion. The precipitator includes a plurality of spaced plates for collecting solid particles from the flue gas by electrostatic attraction of the solid particles to the plates. A plurality of elongated electrodes is positioned among the plates. Each of the electrodes is mounted between a pair of adjacent plates. Each of the electrodes is parallel to the other electrodes and is parallel to the plates. A plurality of identical spacers is positioned between adjacent plates to hold the plates in a flat attitude and to maintain adjacent surfaces of adjacent plates equidistantly spaced from one another. Each of the spacers is an elongated single unitary member and has one end fixed to a surface of one of a pair of adjacent surfaces of the plates and the other end abutting the other of the adjacent surfaces.

  16. Spacer grid assembly and locking mechanism

    DOEpatents

    Snyder, Jr., Harold J.; Veca, Anthony R.; Donck, Harry A.

    1982-01-01

    A spacer grid assembly is disclosed for retaining a plurality of fuel rods in substantially parallel spaced relation, the spacer grids being formed with rhombic openings defining contact means for engaging from one to four fuel rods arranged in each opening, the spacer grids being of symmetric configuration with their rhombic openings being asymmetrically offset to permit inversion and relative rotation of the similar spacer grids for improved support of the fuel rods. An improved locking mechanism includes tie bars having chordal surfaces to facilitate their installation in slotted circular openings of the spacer grids, the tie rods being rotatable into locking engagement with the slotted openings.

  17. Generator stator core vent duct spacer posts

    DOEpatents

    Griffith, John Wesley; Tong, Wei

    2003-06-24

    Generator stator cores are constructed by stacking many layers of magnetic laminations. Ventilation ducts may be inserted between these layers by inserting spacers into the core stack. The ventilation ducts allow for the passage of cooling gas through the core during operation. The spacers or spacer posts are positioned between groups of the magnetic laminations to define the ventilation ducts. The spacer posts are secured with longitudinal axes thereof substantially parallel to the core axis. With this structure, core tightness can be assured while maximizing ventilation duct cross section for gas flow and minimizing magnetic loss in the spacers.

  18. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  19. Analysis of Mammalian rDNA Internal Transcribed Spacers

    PubMed Central

    Coleman, Annette W.

    2013-01-01

    Nuclear rDNA Internal Transcribed Spacers, ITS1 and ITS2, are widely used for eukaryote phylogenetic studies from the ordinal level to the species level, and there is even a database for ITS2 sequences. However, ITS regions have been ignored in mammalian phylogenetic studies, and only a few rodent and ape sequences are represented in GenBank. The reasons for this dearth, and the remedies, are described here. We have recovered these sequences, mostly >1 kb in length, for 36 mammalian species. Sequence alignment and transcript folding comparisons reveal the rRNA transcript secondary structure. Mammalian ITS regions, though quite long, still fold into the recognizable secondary structure of other eukaryotes. The ITS2 in particular bears the four standard helix loops, and loops II and III have the hallmark characters universal to eukaryotes. Both sequence and insertions/deletions of transcript secondary structure helices observed here support the four superorder taxonomy of Placentalia. On the family level, major unique indels, neatly excising entire helices, will be useful when additional species are represented, resulting in significant further understanding of the details of mammalian evolutionary history. Furthermore, the identification of a highly conserved element of ITS1 common to warm-blooded vertebrates may aid in deciphering the complex mechanism of RNA transcript processing. This is the last major group of terrestrial vertebrates for which rRNA ITS secondary structure has been resolved. PMID:24260162

  20. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  1. Allele-specific germ cell epimutation in the spacer promoter of the 45S ribosomal RNA gene after Cr(III) exposure

    SciTech Connect

    Shiao, Y.-H. . E-mail: shiao@mail.ncifrcf.gov; Crawford, Erik B.; Anderson, Lucy M.; Patel, Pritesh; Ko, Kinarm

    2005-06-15

    Paternal exposure of mice to Cr(III) causes increased tumor risk in offspring; an epigenetic mechanism has been hypothesized. Representational difference analysis of gene methylation in sperm revealed hypomethylation in the 45S ribosomal RNA (rRNA) gene after Cr(III) exposure, compared with controls. The most striking effects were seen in the rRNA spacer promoter, a region in the intergenic region of rRNA gene clusters that can influence transcription. Methylation of the rRNA spacer promoter has not been studied heretofore. Sperm DNAs from Cr(III)-treated and control mice were modified by the bisulfite method followed by PCR amplification of the spacer promoter, including 27 CpG sites. Cloning and dideoxy sequencing identified sequence variants (T or G at base -2214) in the spacer promoter. The T allele had less DNA methylation than the G allele in control mice (17 of 17 clones vs. 42 of 72 clones, P = 0.0004). In spite of diversity of sperm DNA methylation patterns, the DNA clones from Cr(III)-exposed mice had fewer methylated CpG sites, by an average of 19% (P < 0.0001). This difference was limited to the G allele. The pyrosequencing technique was applied to quantify the percentage of methylation directly from amplified PCR products. Strikingly, for nine CpG sites including the spacer promoter core region, hypomethylation was highly significant in the Cr(III)-treated group (paired T test, P < 0.0001). Thus, one allele of the 45S rRNA spacer promoter is hypomethylated in sperm germ cells after Cr(III) exposure. This epimutation may lead to increase of tumor risk in the offspring.

  2. Metagenomic data of fungal internal transcribed spacer from serofluid dish, a traditional Chinese fermented food.

    PubMed

    Chen, Peng; Zhao, Yang; Wu, Zhengrong; Liu, Ronghui; Xu, Ruixiang; Yan, Lei; Li, Hongyu

    2016-03-01

    Serofluid dish (or Jiangshui, in Chinese), a traditional food in the Chinese culture for thousands of years, is made from vegetables by fermentation. In this work, microorganism community of the fermented serofluid dish was investigated by the culture-independent method. The metagenomic data in this article contains the sequences of fungal internal transcribed spacer (ITS) regions of rRNA genes from 12 different serofluid dish samples. The metagenome comprised of 50,865 average raw reads with an average of 8,958,220 bp and G + C content is 45.62%. This is the first report on metagenomic data of fungal ITS from serofluid dish employing Illumina platform to profile the fungal communities of this little known fermented food from Gansu Province, China. The Metagenomic data of fungal internal transcribed spacer can be accessed at NCBI, SRA database accession no. SRP067411. PMID:26981389

  3. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  4. Gemini surfactants with a disaccharide spacer.

    PubMed

    Menger, F M; Mbadugha, B N

    2001-02-01

    A gemini surfactant is an amphiphile possessing (in sequence) the following: hydrocarbon tail/polar group/spacer/polar group/hydrocarbon tail. Widespread interest in geminis has emerged recently from both industrial and academic laboratories. In the present contribution, two related families of geminis have been synthesized, both with trehalose, a disaccharide, as a polar spacer. One family, Series-A, is nonionic and has amide groups separating the long chains from the trehalose spacer. The other family, Series-B, has quaternary ammonium ions connecting the long chains to the trehalose spacer. It was found that Series-A geminis are water insoluble despite the two amides and multiple hydroxyls. When hydrated or extruded, these geminis form microscopically visible vesicular and tubular structures above their transition temperatures (which were determined calorimetrically). Insoluble monomolecular films, constructed from these geminis, have interfacial areas that are dominated by the sugar spacer although intermolecular chain/chain interactions seem to stabilize the films. Thus, the behavior of Series-A geminis in many ways parallels that of phospholipids and simple double-chain surfactants. It is as if the trehalose is less of a spacer than a large but conventional headgroup. In contrast, cationic Series-B geminis are water soluble and form micelles with critical micelle concentrations an order of magnitude lower than that of corresponding conventional surfactants. Molecular modeling using the Amber force field explains the difference in properties between the two families of geminis. Series-A are tubular in shape and thus prefer bilayer packing as do other amphiphiles in which the headgroups are similar in width to the sum of the tail diameters. Series-B geminis are conical-shaped and pack more readily into spherical micelles. This work entails synthesis, tensiometry, conductance, microscopy, surface balance studies, calorimetry, light scattering, and molecular

  5. Enterococcus lactis sp. nov., from Italian raw milk cheeses.

    PubMed

    Morandi, Stefano; Cremonesi, Paola; Povolo, Milena; Brasca, Milena

    2012-08-01

    Ten atypical Enterococcus strains were isolated from Italian raw milk cheeses. The 16S rRNA gene, phenylalanyl-tRNA synthase alpha subunit (pheS), RNA polymerase alpha subunit (rpoA) and the 16S-23S rRNA intergenic transcribed spacer (ITS) sequences, randomly amplified polymorphic DNA (RAPD) PCR and the phenotypic properties revealed that the isolates represent a novel enterococcal species. On the basis of 16S rRNA gene sequence analysis, the isolates were closely related to Enterococcus hirae ATCC 8043(T), Enterococcus durans CECT 411(T) and Enterococcus faecium ATCC 19434(T), with 98.8, 98.9 and 99.4% sequence similarity, respectively. On the basis of sequence analysis of the housekeeping gene pheS, the reference strain, BT159(T), occupied a position separate from E. faecium LMG 16198. The group of isolates could be easily differentiated from recognized species of the genus Enterococcus by 16S-23S rRNA ITS analysis, RAPD-PCR and phenotypic characteristics. The name Enterococcus lactis sp. nov. is proposed, with BT159(T) ( = DSM 23655(T) = LMG 25958(T)) as the type strain.

  6. Separator-spacer for electrochemical systems

    DOEpatents

    Grimes, Patrick G.; Einstein, Harry; Newby, Kenneth R.; Bellows, Richard J.

    1983-08-02

    An electrochemical cell construction features a novel co-extruded plastic electrode in an interleaved construction with a novel integral separator-spacer. Also featured is a leak and impact resistant construction for preventing the spill of corrosive materials in the event of rupture.

  7. Genetic differences in internal transcribed spacer 1 between Dermanyssus gallinae from wild birds and domestic chickens.

    PubMed

    Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J

    2008-06-01

    We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.

  8. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  9. Heterogeneous diversity of spacers within CRISPR

    NASA Astrophysics Data System (ADS)

    Deem, Michael; He, Jiankui

    2011-03-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of anti-viral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face. 1) J. He and M. W. Deem, Phys. Rev. Lett. 105 (2010) 128102

  10. Tube support grid and spacer therefor

    DOEpatents

    Ringsmuth, Richard J.; Kaufman, Jay S.

    1986-01-01

    A tube support grid and spacers therefor provide radially inward preloading of heat exchange tubes to minimize stress upon base welds due to differential thermal expansion. The grid comprises a concentric series of rings and spacers with opposing concave sides for conforming to the tubes and V-shaped ends to provide resilient flexibility. The flexibility aids in assembly and in transmitting seismic vibrations from the tubes to a shroud. The tube support grid may be assembled in place to achieve the desired inwardly radial preloading of the heat exchange tubes. Tab and slot assembly further minimizes stresses in the system. The radii of the grid rings may be preselected to effect the desired radially inward preloading.

  11. Honeycomb spacer crush stength test results

    SciTech Connect

    Leader, D.R.

    1993-09-15

    This report discusses aluminum honeycomb spacers, which are used as an energy absorbent material in shipping packages for off site shipment of radioactive materials and which were ordered in two crush strengths, 1,000 psi and 2,000 psi for use in drop tests requested by the Packaging and Transportation group as part of the shipping container rectification process. Both the group as part of the shipping container rectification process. Both the vendor and the SRTC Materials Laboratory performed crush strength measurements on test samples made from the material used to fabricate the actual spacers. The measurements of crush strength made in the SRTC Materials Laboratory are within 100 psi of the measurements made by the manufacturer for all samples tested and all test measurements are within 10% of the specified crush strength, which is acceptable to the P&T group for the planned tests.

  12. Improved nuclear fuel assembly grid spacer

    DOEpatents

    Marshall, John; Kaplan, Samuel

    1977-01-01

    An improved fuel assembly grid spacer and method of retaining the basic fuel rod support elements in position within the fuel assembly containment channel. The improvement involves attachment of the grids to the hexagonal channel and of forming the basic fuel rod support element into a grid structure, which provides a design which is insensitive to potential channel distortion (ballooning) at high fluence levels. In addition the improved method eliminates problems associated with component fabrication and assembly.

  13. Method of forming tiny silicon nitride spacer for flash EPROM

    NASA Astrophysics Data System (ADS)

    Liu, H. H.; Wu, K. C.; Hwang, Yuan-Ko; Chen, Shih-Shiung

    2001-04-01

    The silicon nitride spacer technology is widely used in split gate non-volatile memory device sand flash EPROM. A tiny spacer structure is formed on tunnel oxide layer adjacent to the sidewall of floating gate electrode to prevent write disturbance that caused by reverse tunneling. But the processing is very critical for such flash EPROM devices since the dimension the SN spacer are so small. It was influenced not only by SN spacer dry etching but also later photo-resistance strip process of implantation for threshold voltage adjustment. A new method of forming tiny SN spacer by using anisotropic dry etching and isotropic wet etching was presented in this paper.

  14. Designing string-of-beads vaccines with optimal spacers.

    PubMed

    Schubert, Benjamin; Kohlbacher, Oliver

    2016-01-26

    String-of-beads polypeptides allow convenient delivery of epitope-based vaccines. The success of a polypeptide relies on efficient processing: constituent epitopes need to be recovered while avoiding neo-epitopes from epitope junctions. Spacers between epitopes are employed to ensure this, but spacer selection is non-trivial.We present a framework to determine optimally the length and sequence of a spacer through multi-objective optimization for human leukocyte antigen class I restricted polypeptides. The method yields string-of-bead vaccines with flexible spacer lengths that increase the predicted epitope recovery rate fivefold while reducing the immunogenicity from neo-epitopes by 44% compared to designs without spacers.

  15. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

    PubMed Central

    Yang, Kiwoung; Robin, Arif Hasan Khan; Yi, Go-Eun; Lee, Jonghoon; Chung, Mi-Young; Yang, Tae-Jin; Nou, Ill-Sup

    2015-01-01

    Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea. PMID:26633391

  16. NEUTRONIC REACTOR SHIELD AND SPACER CONSTRUCTION

    DOEpatents

    Wigner, E.P.; Ohlinger, L.A.

    1958-11-18

    Reactors of the heterogeneous, graphite moderated, fluid cooled type and shielding and spacing plugs for the coolant channels thereof are reported. In this design, the coolant passages extend horizontally through the moderator structure, accommodating the fuel elements in abutting end-to-end relationship, and have access openings through the outer shield at one face of the reactor to facilitate loading of the fuel elements. In the outer ends of the channels which extend through the shields are provided spacers and shielding plugs designed to offer minimal reslstance to coolant fluid flow while preventing emanation of harmful radiation through the access openings when closed between loadings.

  17. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  18. Properties of cellulase immobilized on agarose gel with spacer

    SciTech Connect

    Chim-anage, P.; Kashiwagi, Y.; Magae, Y.; Ohta, T.; Sasaki, T.

    1986-12-01

    Cellulase produced by fungus Trichoderma viride was immobilized on agarose beads (Sepharose 4B) activated by cyanogen bromide and also on activated agarose beads that contained spacer arm (activated Ch-Sepharose 4B and Affi-Gel 15). The CMCase activity retained by immobilized cellulase on activated Sepharose containing the spacer tended to be higher than that immobilized without spacer, although the extent of protein immobilization was lower. Also, the higher substrate specificity for cellulase immobilized on beads with spacer was obtained for cellobiose, acid-swollen cellulose, or cellulose powder. The hydrolysis product from their substrates was mainly glucose. 10 references.

  19. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  20. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  1. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  2. Molecular recordings by directed CRISPR spacer acquisition.

    PubMed

    Shipman, Seth L; Nivala, Jeff; Macklis, Jeffrey D; Church, George M

    2016-07-29

    The ability to write a stable record of identified molecular events into a specific genomic locus would enable the examination of long cellular histories and have many applications, ranging from developmental biology to synthetic devices. We show that the type I-E CRISPR (clustered regularly interspaced short palindromic repeats)-Cas system of Escherichia coli can mediate acquisition of defined pieces of synthetic DNA. We harnessed this feature to generate records of specific DNA sequences into a population of bacterial genomes. We then applied directed evolution so as to alter the recognition of a protospacer adjacent motif by the Cas1-Cas2 complex, which enabled recording in two modes simultaneously. We used this system to reveal aspects of spacer acquisition, fundamental to the CRISPR-Cas adaptation process. These results lay the foundations of a multimodal intracellular recording device.

  3. Molecular recordings by directed CRISPR spacer acquisition.

    PubMed

    Shipman, Seth L; Nivala, Jeff; Macklis, Jeffrey D; Church, George M

    2016-07-29

    The ability to write a stable record of identified molecular events into a specific genomic locus would enable the examination of long cellular histories and have many applications, ranging from developmental biology to synthetic devices. We show that the type I-E CRISPR (clustered regularly interspaced short palindromic repeats)-Cas system of Escherichia coli can mediate acquisition of defined pieces of synthetic DNA. We harnessed this feature to generate records of specific DNA sequences into a population of bacterial genomes. We then applied directed evolution so as to alter the recognition of a protospacer adjacent motif by the Cas1-Cas2 complex, which enabled recording in two modes simultaneously. We used this system to reveal aspects of spacer acquisition, fundamental to the CRISPR-Cas adaptation process. These results lay the foundations of a multimodal intracellular recording device. PMID:27284167

  4. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Improvement of inhaler efficacy by home-made spacer.

    PubMed

    Sritara, P; Janvitayanuchit, S

    1993-12-01

    The delivery of aerosol from a metered dose inhaler (MDI) was reported to be more efficient with a spacer. Hence, a home-made spacer modified from a 950 ml low cost plastic bottle, was compared with a MDI and with a 750 ml imported spacer (Nebuhaler). On three consecutive days, at the same time of day, 20 adult patients with chronic asthma inhaled two puffs of terbutaline sulphate (0.5 mg), delivered from MDI alone, MDI with a 750 ml Nebuhlaer and MDI with a home-made spacer. The following measurements were made: forced expiratory volume in one second (FEV1), forced vital capacity (FVC) and pulse rate. These measurements were carried out immediately before and at 5, 20, 60 min after inhalation of terbutaline. FEV1 was significantly increased (P < 0.05) at 5, 20 and 60 min after administration of terbutaline with MDI via either spacers than with MDI alone but no significant difference was observed between Nebuhaler and the home-made spacer. FVC and pulse rate showed no significant change with each method of administration. In conclusion, terbutaline delivered by MDI and home-made spacer was more effective in bronchodilatation than by MDI alone and was just as effective as MDI and Nebuhaler. The home-made spacer therefore offers a simple, inexpensive and more effective method for delivering aerosol drug. PMID:7798822

  6. Pervasive generation of oppositely oriented spacers during CRISPR adaptation

    PubMed Central

    Shmakov, Sergey; Savitskaya, Ekaterina; Semenova, Ekaterina; Logacheva, Maria D.; Datsenko, Kirill A.; Severinov, Konstantin

    2014-01-01

    During the process of prokaryotic CRISPR adaptation, a copy of a segment of foreign deoxyribonucleic acid referred to as protospacer is added to the CRISPR cassette and becomes a spacer. When a protospacer contains a neighboring target interference motif, the specific small CRISPR ribonucleic acid (crRNA) transcribed from expanded CRISPR cassette can protect a prokaryotic cell from virus infection or plasmid transformation and conjugation. We show that in Escherichia coli, a vast majority of plasmid protospacers generate spacers integrated in CRISPR cassette in two opposing orientations, leading to frequent appearance of complementary spacer pairs in a population of cells that underwent CRISPR adaptation. When a protospacer contains a spacer acquisition motif AAG, spacer orientation that generates functional protective crRNA is strongly preferred. All other protospacers give rise to spacers oriented in both ways at comparable frequencies. This phenomenon increases the repertoire of available spacers and should make it more likely that a protective crRNA is formed as a result of CRISPR adaptation. PMID:24728991

  7. Inhalational drug delivery from seven different spacer devices.

    PubMed Central

    Barry, P. W.; O'Callaghan, C.

    1996-01-01

    BACKGROUND: A study was performed to determine in vitro the difference in drug output of seven currently available spacer devices when used with different inhaled medications. METHODS: A glass multistage liquid impinger (MSLI) was used to determine the amount of disodium cromoglycate (DSCG, 5 mg), salbutamol (100 micrograms), or budesonide (200 micrograms) obtained in various particle size ranges from metered dose inhalers (MDIs) actuated directly into the MSLI or via one of seven different spacer devices; the Fisonair, Nebuhaler, Volumatic, Inspirease, Aerochamber, Aerosol Cloud Enhancer, and Dynahaler. RESULTS: In particles smaller than 5 microns in diameter the dose of DSCG recovered from the Fisonair and Nebuhaler was 118% and 124%, respectively, of that recovered using the MDI alone. The dose recovered from the smaller volume spacers was 90% (Inspirease), 36% (Aerochamber), 33% (Aerosol Cloud Enhancer), and 21% (Dynahaler) of that from the MDI alone. The Volumatic increased the amount of salbutamol in particles smaller than 5 microns to 117% of that from the MDI, and the Inspirease and Aerochamber spacers decreased it by nearly 50%. The amount of budesonide in small particles recovered after use of the Nebuhaler, Inspirease, and the Aerochamber was 92%, 101%, and 78%, respectively, of that from the MDI alone. CONCLUSIONS: Under the test conditions used, large volume spacers such as the Fisonair, Nebuhaler, and Volumatic delivered significantly more DSCG and salbutamol than the smaller spacers tested. The differences between spacers were less for budesonide than the other medications studied. This study shows that there are significant differences in the amount of drug available for inhalation when different spacers are used as inhalational aids with different drugs. Spacer devices need to be fully evaluated for each drug prescribed for them. Images PMID:8795674

  8. Electrostatic precipatator construction having ladder bar spacers

    SciTech Connect

    Jonelis, J.A.

    1984-10-30

    The present invention relates to an improved construction for an electrostatic precipitator having ladder bar spacers. The electrostatic precipitator collects solid particles carried by a flue gas from a source of combustion. The precipitator includes a plurality of spaced plates for collecting solid particles from the flue gas by electrostatic attraction of the solid particles to the plates. A second plurality of elongated electrodes is positioned among the plates. Each of the electrodes is mounted between a pair of adjacent plates. Each of the electrodes is parallel to the other electrodes and is parallel to the plates. A third plurality of ladder bars is positioned between adjacent plates to hold the plates in a flat attitude and to maintain adjacent surfaces of adjacent plates substantially equidistantly spaced from one another. Each of the ladder bars has a connector bar secured to one of the pair of adjacent surfaces. Each of the ladder bars has a fourth plurality of holder bars. Each of the holder bars having one end connected to its respective connector bar and extending outwardly from the connector bar toward the other of the pair of adjacent surfaces. A contact on the other end of each holder bar engages the other of the pair of adjacent surfaces to hold the pair of adjacent surfaces apart.

  9. Preclinical Evaluation of Bioabsorbable Polyglycolic Acid Spacer for Particle Therapy

    SciTech Connect

    Akasaka, Hiroaki; Sasaki, Ryohei; Miyawaki, Daisuke; Mukumoto, Naritoshi; Sulaiman, Nor Shazrina Binti; Nagata, Masaaki; Yamada, Shigeru; Murakami, Masao; Demizu, Yusuke; Fukumoto, Takumi

    2014-12-01

    Purpose: To evaluate the efficacy and safety of a polyglycolic acid (PGA) spacer through physical and animal experiments. Methods and Materials: The spacer was produced with surgical suture material made of PGA, forming a 3-dimensional nonwoven fabric. For evaluation or physical experiments, 150-MeV proton or 320-MeV carbon-ion beams were used to generate 60-mm width of spread-out Bragg peak. For animal experiments, the abdomens of C57BL/6 mice, with or without the inserted PGA spacers, were irradiated with 20 Gy of carbon-ion beam (290 MeV) using the spread-out Bragg peak. Body weight changes over time were scored, and radiation damage to the intestine was investigated using hematoxylin and eosin stain. Blood samples were also evaluated 24 days after the irradiation. Long-term thickness retention and safety were evaluated using crab-eating macaques. Results: No chemical or structural changes after 100 Gy of proton or carbon-ion irradiation were observed in the PGA spacer. Water equivalency of the PGA spacer was equal to the water thickness under wet condition. During 24 days' observation after 20 Gy of carbon-ion irradiation, the body weights of mice with the PGA spacer were relatively unchanged, whereas significant weight loss was observed in those mice without the PGA spacer (P<.05). In mice with the PGA spacer, villus and crypt structure were preserved after irradiation. No inflammatory reactions or liver or renal dysfunctions due to placement of the PGA spacer were observed. In the abdomen of crab-eating macaques, thickness of the PGA spacer was maintained 8 weeks after placement. Conclusions: The absorbable PGA spacer had water-equivalent, bio-compatible, and thickness-retaining properties. Although further evaluation is warranted in a clinical setting, the PGA spacer may be effective to stop proton or carbon-ion beams and to separate normal tissues from the radiation field.

  10. Bioinformatics analyses of Shigella CRISPR structure and spacer classification.

    PubMed

    Wang, Pengfei; Zhang, Bing; Duan, Guangcai; Wang, Yingfang; Hong, Lijuan; Wang, Linlin; Guo, Xiangjiao; Xi, Yuanlin; Yang, Haiyan

    2016-03-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are inheritable genetic elements of a variety of archaea and bacteria and indicative of the bacterial ecological adaptation, conferring acquired immunity against invading foreign nucleic acids. Shigella is an important pathogen for anthroponosis. This study aimed to analyze the features of Shigella CRISPR structure and classify the spacers through bioinformatics approach. Among 107 Shigella, 434 CRISPR structure loci were identified with two to seven loci in different strains. CRISPR-Q1, CRISPR-Q4 and CRISPR-Q5 were widely distributed in Shigella strains. Comparison of the first and last repeats of CRISPR1, CRISPR2 and CRISPR3 revealed several base variants and different stem-loop structures. A total of 259 cas genes were found among these 107 Shigella strains. The cas gene deletions were discovered in 88 strains. However, there is one strain that does not contain cas gene. Intact clusters of cas genes were found in 19 strains. From comprehensive analysis of sequence signature and BLAST and CRISPRTarget score, the 708 spacers were classified into three subtypes: Type I, Type II and Type III. Of them, Type I spacer referred to those linked with one gene segment, Type II spacer linked with two or more different gene segments, and Type III spacer undefined. This study examined the diversity of CRISPR/cas system in Shigella strains, demonstrated the main features of CRISPR structure and spacer classification, which provided critical information for elucidation of the mechanisms of spacer formation and exploration of the role the spacers play in the function of the CRISPR/cas system.

  11. Nuclear reactor spacer grid and ductless core component

    DOEpatents

    Christiansen, David W.; Karnesky, Richard A.

    1989-01-01

    The invention relates to a nuclear reactor spacer grid member for use in a liquid cooled nuclear reactor and to a ductless core component employing a plurality of these spacer grid members. The spacer grid member is of the egg-shell type and is constructed so that the walls of the cell members of the grid member are formed of a single thickness of metal to avoid tolerance problems. Within each cell member is a hydraulic spring which laterally constrains the nuclear material bearing rod which passes through each cell member against a hardstop in response to coolant flow through the cell member. This hydraulic spring is also suitable for use in a water cooled nuclear reactor. A core component constructed of, among other components, a plurality of these spacer grid members, avoids the use of a full length duct by providing spacer sleeves about the sodium tubes passing through the spacer grid members at locations between the grid members, thereby maintaining a predetermined space between adjacent grid members.

  12. Alternate pathways for processing in the internal transcribed spacer 1 in pre-rRNA of Saccharomyces cerevisiae.

    PubMed Central

    Lindahl, L; Archer, R H; Zengel, J M

    1994-01-01

    We have extended the system of Nogi et al. (Proc. Natl. Acad. Sci. USA 88, 1991, 3962-3966) for transcription of rRNA from an RNA polymerase II promoter in strains lacking functional RNA polymerase I. In our strains two differentially marked rRNA transcription units can be expressed alternately. Using this system we have shown that the A2 processing site in the internal transcribed spacer 1 (ITS1) of the pre-rRNA is dispensable. According to the accepted processing scheme, the A2 site serves to separate the parts of the primary rRNA transcript that are destined for incorporation into the two ribosomal subunits. However, we have found that, when A2 is impaired, separation of the small and large subunit rRNAs occurs at a processing site further downstream in ITS1, indicating that alternate pathways for ITS1 processing exist. Short deletions in the A2 region still allow residual processing at the A2 site. Mapping of the cleavage sites in such deletion transcripts suggests that sequences downstream of the A2 site are used for determining the position of the cleavage. Images PMID:7816631

  13. Impact of spacer thickness on biofouling in forward osmosis.

    PubMed

    Valladares Linares, R; Bucs, Sz S; Li, Z; AbuGhdeeb, M; Amy, G; Vrouwenvelder, J S

    2014-06-15

    Forward osmosis (FO) indirect desalination systems integrate wastewater recovery with seawater desalination. Niche applications for FO systems have been reported recently, due to the demonstrated advantages compared to conventional high-pressure membrane processes such as nanofiltration (NF) and reverse osmosis (RO). Among them, wastewater recovery has been identified to be particularly suitable for practical applications. However, biofouling in FO membranes has rarely been studied in applications involving wastewater effluents. Feed spacers separating the membrane sheets in cross-flow systems play an important role in biofilm formation. The objective of this study was to determine the influence of feed spacer thickness (28, 31 and 46 mil) on biofouling development and membrane performance in a FO system, using identical cross-flow cells in parallel studies. Flux development, biomass accumulation, fouling localization and composition were determined and analyzed. For all spacer thicknesses, operated at the same feed flow and the same run time, the same amount of biomass was found, while the flux reduction decreased with thicker spacers. These observations are in good agreement with biofouling studies for RO systems, considering the key differences between FO and RO. Our findings contradict previous cross-flow studies on particulate/colloidal fouling, where higher cross-flow velocities improved system performance. Thicker spacers reduced the impact of biofouling on FO membrane flux.

  14. CRISPR interference and priming varies with individual spacer sequences.

    PubMed

    Xue, Chaoyou; Seetharam, Arun S; Musharova, Olga; Severinov, Konstantin; Brouns, Stan J J; Severin, Andrew J; Sashital, Dipali G

    2015-12-15

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR associated) systems allow bacteria to adapt to infection by acquiring 'spacer' sequences from invader DNA into genomic CRISPR loci. Cas proteins use RNAs derived from these loci to target cognate sequences for destruction through CRISPR interference. Mutations in the protospacer adjacent motif (PAM) and seed regions block interference but promote rapid 'primed' adaptation. Here, we use multiple spacer sequences to reexamine the PAM and seed sequence requirements for interference and priming in the Escherichia coli Type I-E CRISPR-Cas system. Surprisingly, CRISPR interference is far more tolerant of mutations in the seed and the PAM than previously reported, and this mutational tolerance, as well as priming activity, is highly dependent on spacer sequence. We identify a large number of functional PAMs that can promote interference, priming or both activities, depending on the associated spacer sequence. Functional PAMs are preferentially acquired during unprimed 'naïve' adaptation, leading to a rapid priming response following infection. Our results provide numerous insights into the importance of both spacer and target sequences for interference and priming, and reveal that priming is a major pathway for adaptation during initial infection.

  15. Mandrel and spacer engineering based self-aligned triple patterning

    NASA Astrophysics Data System (ADS)

    Chen, Yijian; Cheng, Qi; Kang, Weiling

    2012-03-01

    Self-aligned triple patterning (SATP) technique offers both improved resolution and quasi-2D design flexibility for scaling integrated circuits down to sub-15nm half pitch. By implementation of active layout decomposition/synthesis using mandrel and spacer engineering, SATP process represents a prospective trend that not only drives up the feature density, but also breaks the 1-D gridded limitations posed to future device design. In this paper, we shall present the research progress made in optimizing SATP process to improve its lithographic performance. To solve the previously reported difficulties in etching small mandrels and removing sacrificial spacers, new materials are tested and a promising scheme (using oxide as the mandrel and poly/amorphous Si as the sacrificial spacer) is identified. In the new process, a diluted HF process is applied to shrink the mandrel (oxide) line CD and a highly selective dry etch (which does not attack the mandrel and structural spacer) is developed to strip the sacrificial Si spacers, resulting in significantly improved process performance. We also address the issue of reducing SATP process complexity by exploring the feasibility of a 2-mask concept for specific types of layout.

  16. Impact of spacer thickness on biofouling in forward osmosis.

    PubMed

    Valladares Linares, R; Bucs, Sz S; Li, Z; AbuGhdeeb, M; Amy, G; Vrouwenvelder, J S

    2014-06-15

    Forward osmosis (FO) indirect desalination systems integrate wastewater recovery with seawater desalination. Niche applications for FO systems have been reported recently, due to the demonstrated advantages compared to conventional high-pressure membrane processes such as nanofiltration (NF) and reverse osmosis (RO). Among them, wastewater recovery has been identified to be particularly suitable for practical applications. However, biofouling in FO membranes has rarely been studied in applications involving wastewater effluents. Feed spacers separating the membrane sheets in cross-flow systems play an important role in biofilm formation. The objective of this study was to determine the influence of feed spacer thickness (28, 31 and 46 mil) on biofouling development and membrane performance in a FO system, using identical cross-flow cells in parallel studies. Flux development, biomass accumulation, fouling localization and composition were determined and analyzed. For all spacer thicknesses, operated at the same feed flow and the same run time, the same amount of biomass was found, while the flux reduction decreased with thicker spacers. These observations are in good agreement with biofouling studies for RO systems, considering the key differences between FO and RO. Our findings contradict previous cross-flow studies on particulate/colloidal fouling, where higher cross-flow velocities improved system performance. Thicker spacers reduced the impact of biofouling on FO membrane flux. PMID:24726992

  17. Identification and characterization of novel Mycoplasma spp. belonging to the hominis group from griffon vultures.

    PubMed

    Lecis, R; Chessa, B; Cacciotto, C; Addis, M F; Coradduzza, E; Berlinguer, F; Muzzeddu, M; Lierz, M; Carcangiu, L; Pittau, M; Alberti, A

    2010-08-01

    Mycoplasmas are commensals and pathogens of various avian species, and are also regularly found in birds of prey, although their significance to birds' health remains unclear. Here we describe two novel Mycoplasma isolated from the upper respiratory tract of four Eurasian griffon vultures (Gyps fulvus) housed in a wildlife recovery centre in Sardinia (Italy). By sequencing the 16S rRNA gene and the entire 16S/23S intergenic spacer region, the new strains were classified within the Mycoplasma taxonomy at the group and cluster levels, showing that the two isolates fall into the Mycoplasma synoviae and Mycoplasma hominis clusters of the hominis group, respectively. We combined molecular tools and immunoblotting methods in order to further characterize these isolates, and antigenic analyses overall confirmed the molecular findings. Different levels of pathogenicity and prevalence of these strains might have different implications for the conservation and reintroduction of vultures.

  18. A direct PCR detection method for Clostridium tyrobutyricum spores in up to 100 milliliters of raw milk.

    PubMed Central

    Herman, L M; De Block, J H; Waes, G M

    1995-01-01

    A direct detection method for Clostridium tyrobutyricum spores in up to 100 ml of raw milk is presented. The bacterial spores are concentrated by centrifugation after chemical extraction of the milk components. The vegetative cells are selectively lysed, and their DNA is digested and washed away. Afterwards, the DNA is liberated from the spores by microwave treatment. For the identification of the C. tyrobutyricum DNA, a two-step PCR method with two nested pairs of primers is used. The primers were derived from the 16S-23S rRNA spacer region of C. tyrobutyricum, and the specificity of each of them for C. tyrobutyricum is demonstrated. The detection limit can be estimated to be between 3 and 30 spores in 100 ml of raw milk. PMID:8534081

  19. High-prevalence Borrelia miyamotoi infection among [corrected] wild turkeys (Meleagris gallopavo) in Tennessee.

    PubMed

    Scott, M C; Rosen, M E; Hamer, S A; Baker, E; Edwards, H; Crowder, C; Tsao, J I; Hickling, G J

    2010-11-01

    During spring and fall 2009, 60 wild turkeys (Meleagris gallopavo) harvested by Tennessee hunters were surveyed for Borrelia spp. by sampling their blood, tissue, and attached ticks. In both seasons, 70% of turkeys were infested with juvenile Amblyomma americanum; one spring turkey hosted an adult female Ixodes brunneus. Polymerase chain reaction assays followed by DNA sequencing indicated that 58% of the turkeys were positive for the spirochete Borrelia miyamotoi, with tissue testing positive more frequently than blood (P = 0.015). Sequencing of the 16S-23S rRNA intergenic spacer indicated > or = 99% similarity to previously published sequences of the North American strain of this spirochete. Positive turkeys were present in both seasons and from all seven middle Tennessee counties sampled. No ticks from the turkeys tested positive for any Borrelia spp. This is the first report of B. miyamotoi in birds; the transmission pathways and epidemiological significance of this high-prevalence spirochetal infection remain uncertain.

  20. Genetic diversity of nodulating and non-nodulating rhizobia associated with wild soybean (Glycine soja Sieb. & Zucc.) in different ecoregions of China.

    PubMed

    Wu, Li Juan; Wang, Hai Qing; Wang, En Tao; Chen, Wen Xin; Tian, Chang Fu

    2011-06-01

    A total of 99 bacterial isolates that originated from root nodules of Glycine soja were characterized with restriction analyses of amplified 16S ribosomal DNA and 16S-23S rDNA intergenic spacers (ITS), and sequence analyses of 16S rRNA, rpoB, atpD, recA and nodC genes. When tested for nodulation of G. soja, 72 of the isolates were effective symbionts, and these belonged to five species: Bradyrhizobium japonicum, Bradyrhizobium elkanii, Bradyrhizobium yuanmingense, Bradyrhizobium liaoningense and Sinorhizobium fredii. All of these, except some B. yuanmingense strains, also formed effective nodules on the domesticated soybean Glycine max. The remaining 27 isolates did not nodulate either host, but were identified as Rhizobium. Phylogeny nodC in the G. soja symbionts suggested that this symbiosis gene was mainly maintained by vertical gene transfer. Different nodC sublineages and rrs-ITS clusters reflected the geographic origins of isolates in this study.

  1. Genetic diversity of Bartonella genotypes found in the striped field mouse (Apodemus agrarius) in Central Europe.

    PubMed

    Kraljik, Jasna; Paziewska-Harris, Anna; Miklisová, Dana; Blaňarová, Lucia; Mošanský, Ladislav; Bona, Martin; Stanko, Michal

    2016-09-01

    We investigated the diversity of Bartonella in Apodemus agrarius, an important rodent of peri-domestic habitats, which has spread into Europe in the past 1000 years. Spleen samples of 344 A. agrarius from Eastern Slovakia were screened for the presence of Bartonella spp. using 16S-23S rRNA internal transcribed spacer region and bacteria were detected in 9% of rodents. Based on sequencing of three housekeeping genes (gltA, rpoB and groEL) Bartonella genotypes were ascribed to the species typical for mice and voles: B. grahamii, B. taylorii and B. birtlesii. However, the study also confirmed presence of genotypes belonging to the B. clarridgeiae/B. rochalimae clade, and the B. elizabethae/B. tribocorum clade, which are not commonly found in woodland rodents. In addition, a potential recombination event between these two genotypes was noted, which highlights an important role of A. agrarius in shaping Bartonella diversity and evolution. PMID:27279125

  2. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  3. Impact of Polycarbonate Spacers on Resistive Plate Chamber Efficiencies

    NASA Astrophysics Data System (ADS)

    Mucia, Nicholas

    2008-10-01

    The PHENIX experiment at the Relativistic Heavy Ion Collider at Brookhaven National Laboratory will measure the flavor dependent quark and anti-quark polarizations in the proton through parity violating W-production. A new dedicated muon trigger spectrometer is being built to select high momentum muons from the decay of W bosons. The muon spectrometer relies on Resistive Plate Chambers (RPCs) developed for the CMS experiment at the Large Hadron Collider. PHENIX continues to pursue detailed studies of CMS RPC technology to ensure that these detectors will be optimally deployed and operated in PHENIX. In this poster we present two dimensional efficiency measurements with cosmic rays in RPC prototypes. In particular we have studied the impact polycarbonate spacers used to define the 2 mm wide RPC gas gaps have on the detector efficiency. We will present two dimensional efficiency measurements in the region adjacent to the spacers including the radial dependence of the efficiency with respect to the center of the spacer.

  4. Spacer effect on nanostructures and self-assembly in organogels via some bolaform cholesteryl imide derivatives with different spacers

    PubMed Central

    2013-01-01

    In this paper, new bolaform cholesteryl imide derivatives with different spacers were designed and synthesized. Their gelation behaviors in 23 solvents were investigated, and some of them were found to be low molecular mass organic gelators. The experimental results indicated that these as-formed organogels can be regulated by changing the flexible/rigid segments in spacers and organic solvents. Suitable combination of flexible/rigid segments in molecular spacers in the present cholesteryl gelators is favorable for the gelation of organic solvents. Scanning electron microscopy and atomic force microscopy observations revealed that the gelator molecules self-assemble into different aggregates, from wrinkle and belt to fiber with the change of spacers and solvents. Spectral studies indicated that there existed different H-bond formations between imide groups and assembly modes, depending on the substituent spacers in molecular skeletons. The present work may give some insight into the design and character of new organogelators and soft materials with special molecular structures. PMID:24083361

  5. Measurements and sensitivities of LWR in poly spacers

    NASA Astrophysics Data System (ADS)

    Ayal, Guy; Shauly, Eitan; Levi, Shimon; Siany, Amit; Adan, Ofer; Shacham-Diamand, Yosi

    2010-03-01

    LER and LWR have long been considered a primary issue in process development and monitoring. Development of a low power process flavors emphasizes the effect of LER, LWR on different aspects of the device. Gate level performance, particularly leakage current at the front end of line, resistance and reliability in the back-end layers. Traditionally as can be seen in many publications, for the front end of line the focus is mainly on Poly and Active area layers. Poly spacers contribution to the gate leakage, for example, is rarely discussed. Following our research done on sources of gate leakage, we found leakage current (Ioff) in some processes to be highly sensitive to changes in the width of the Poly spacers - even more strongly to the actual Poly gate CDs. Therefore we decided to measure Poly spacers LWR, its correlation to the LWR in the poly, and its sensitivity to changes in layout and OPC. In our last year publication, we defined the terms LLER (Local Line Edge Roughness) and LLWR (Local Line Width Roughness). The local roughness is measured as the 3-sigma value of the line edge/width in a 5-nm segment around the measurement point. We will use these terms in this paper to evaluate the Poly roughness impact on Poly spacer's roughness. A dedicated test chip was designed for the experiments, having various transistors layout configurations with different densities to cover the all range of process design rules. Applied Materials LER and LWR innovative algorithms were used to measure and characterize the spacer roughness relative to the distance from the active edges and from other spaces. To accurately measure all structures in a reasonable time, the recipes were automatically generated from CAD. On silicon, after poly spacers generation, the transistors no longer resemble the Poly layer CAD layout, their morphology is different compared with Photo/Etch traditional structures , and dimensions vary significantly. In this paper we present metrology and

  6. An intramedullary cement spacer in total hip arthroplasty .

    PubMed

    Deshmukh, R G; Thevarajan, K; Kok, C S; Sivapathasundaram, N; George, S V

    1998-02-01

    Revision arthroplasty of the hip is often complicated by infection, bone loss, and perioperative fracture of the femur. A simple, inexpensive spacer that keeps tissue planes intact and prevents soft tissue contracture during the interoperative period of a 2-stage revision is described. This can provide intramedullary support to a fractured or weak femur and enable local antibiotic delivery, as well as permit limited mobilization of the patient. It can be easily fabricated during surgery using universally available materials and can be tailored for specific requirements. Such a spacer was used in 5 cases. The experience is presented, and the technique and pitfalls are discussed. PMID:9526214

  7. Intragenomic Variation in the Internal Transcribed Spacer 1 Region of Dientamoeba fragilis as a Molecular Epidemiological Marker▿

    PubMed Central

    Bart, Aldert; van der Heijden, Harold M.; Greve, Sophie; Speijer, Dave; Landman, Wil J.; van Gool, Tom

    2008-01-01

    Dientamoeba fragilis is a parasite that has been recognized to be a causative agent of gastrointestinal symptoms. Because in most studies only some infected persons experience symptoms, it is possible that D. fragilis is a heterogeneous species with variants that display similar morphologies but different pathogenicities. The search for genetic variation in D. fragilis was based on the small-subunit rRNA gene, which was not found to be useful for molecular epidemiology. In this report, we describe the isolation and characterization of additional rRNA gene cluster sequences, the internal transcribed spacer 1 (ITS-1)-5.8S rRNA gene-ITS-2 region. For comparative purposes, we also isolated the ITS-1-5.8S rRNA gene-ITS-2 region of Histomonas meleagridis, a protozoan parasite of birds and a close relative of D. fragilis. This region was found to be highly variable, and 11 different alleles of the ITS-1 sequence could be identified. Variation in the ITS-1 region was found to be intragenomic, with up to four different alleles in a single isolate. So-called C profiles were produced from the ITS-1 repertoire of single isolates,. Analysis of the C profiles of isolates from nonrelated patients identified several clearly distinguishable strains of D. fragilis. Within families, it was shown that members can be infected with the same or different strains of D. fragilis. In conclusion, the ITS-1 region can serve as a molecular epidemiological tool for the subtyping of D. fragilis directly from feces. This may serve as a means of studying the transmission, geographical distribution, and relationships between strains and the pathogenicity of this parasite. PMID:18650356

  8. Identification of Medically Important Yeast Species by Sequence Analysis of the Internal Transcribed Spacer Regions

    PubMed Central

    Leaw, Shiang Ning; Chang, Hsien Chang; Sun, Hsiao Fang; Barton, Richard; Bouchara, Jean-Philippe; Chang, Tsung Chain

    2006-01-01

    Infections caused by yeasts have increased in previous decades due primarily to the increasing population of immunocompromised patients. In addition, infections caused by less common species such as Pichia, Rhodotorula, Trichosporon, and Saccharomyces spp. have been widely reported. This study extensively evaluated the feasibility of sequence analysis of the rRNA gene internal transcribed spacer (ITS) regions for the identification of yeasts of clinical relevance. Both the ITS1 and ITS2 regions of 373 strains (86 species), including 299 reference strains and 74 clinical isolates, were amplified by PCR and sequenced. The sequences were compared to reference data available at the GenBank database by using BLAST (basic local alignment search tool) to determine if species identification was possible by ITS sequencing. Since the GenBank database currently lacks ITS sequence entries for some yeasts, the ITS sequences of type (or reference) strains of 15 species were submitted to GenBank to facilitate identification of these species. Strains producing discrepant identifications between the conventional methods and ITS sequence analysis were further analyzed by sequencing of the D1-D2 domain of the large-subunit rRNA gene for species clarification. The rates of correct identification by ITS1 and ITS2 sequence analysis were 96.8% (361/373) and 99.7% (372/373), respectively. Of the 373 strains tested, only 1 strain (Rhodotorula glutinis BCRC 20576) could not be identified by ITS2 sequence analysis. In conclusion, identification of medically important yeasts by ITS sequencing, especially using the ITS2 region, is reliable and can be used as an accurate alternative to conventional identification methods. PMID:16517841

  9. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  10. CRISPR interference and priming varies with individual spacer sequences

    PubMed Central

    Xue, Chaoyou; Seetharam, Arun S.; Musharova, Olga; Severinov, Konstantin; J. Brouns, Stan J.; Severin, Andrew J.; Sashital, Dipali G.

    2015-01-01

    CRISPR–Cas (clustered regularly interspaced short palindromic repeats-CRISPR associated) systems allow bacteria to adapt to infection by acquiring ‘spacer’ sequences from invader DNA into genomic CRISPR loci. Cas proteins use RNAs derived from these loci to target cognate sequences for destruction through CRISPR interference. Mutations in the protospacer adjacent motif (PAM) and seed regions block interference but promote rapid ‘primed’ adaptation. Here, we use multiple spacer sequences to reexamine the PAM and seed sequence requirements for interference and priming in the Escherichia coli Type I-E CRISPR–Cas system. Surprisingly, CRISPR interference is far more tolerant of mutations in the seed and the PAM than previously reported, and this mutational tolerance, as well as priming activity, is highly dependent on spacer sequence. We identify a large number of functional PAMs that can promote interference, priming or both activities, depending on the associated spacer sequence. Functional PAMs are preferentially acquired during unprimed ‘naïve’ adaptation, leading to a rapid priming response following infection. Our results provide numerous insights into the importance of both spacer and target sequences for interference and priming, and reveal that priming is a major pathway for adaptation during initial infection. PMID:26586800

  11. Filter holder assembly having extended collar spacer ring

    DOEpatents

    Alvin, Mary Anne; Bruck, Gerald J.

    2002-01-01

    A filter holder assembly is provided that utilizes a fail-safe regenerator unit with an annular spacer ring having an extended metal collar for containment and positioning of a compliant ceramic gasket used in the assembly. The filter holder assembly is disclosed for use with advanced composite, filament wound, and metal candle filters.

  12. Trestle #1, detail of stringers and spacers on northeast end ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Trestle #1, detail of stringers and spacers on northeast end of deck. View to southwest - Promontory Route Railroad Trestles, S.P. Trestle 779.91, One mile southwest of junction of State Highway 83 and Blue Creek, Corinne, Box Elder County, UT

  13. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny

    PubMed Central

    Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

    2015-01-01

    Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951

  14. Structure of Intergenic Spacer IGS1 of Ribosomal Operon from Schistidium Mosses.

    PubMed

    Milyutina, I A; Ignatova, E A; Ignatov, M S; Goryunov, D V; Troitsky, A V

    2015-11-01

    The structure of the intergenic spacer 1 (IGS1) of the ribosomal operon from 12 species of Schistidium mosses was studied. In the IGS1 sequences of these species, three conserved regions and two areas of GC- and A-enriched repeats were identified. All of the studied mosses have a conserved pyrimidine-enriched motif at the 5'-end of IGS1. Species-specific nucleotide substitutions and insertions were found in the conserved areas. The repeated units contain single nucleotide substitutions that make unique the majority of repeated units. The positions of such repeats in IGS1 are species-specific, but their number can vary within the species and among operons of the same specimen. The comparison of IGS1 sequences from the Schistidium species and from representatives of ten other moss genera revealed the presence of common conserved motifs with similar localization. Presumably, these motifs are elements of termination of the pre-rRNA transcription and processing of rRNA. PMID:26615440

  15. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny.

    PubMed

    Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

    2015-01-01

    Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.

  16. Determination of internal transcribed spacer regions (ITS) in Trichomonas vaginalis isolates and differentiation among Trichomonas species.

    PubMed

    Ibáñez-Escribano, Alexandra; Nogal-Ruiz, Juan José; Arán, Vicente J; Escario, José Antonio; Gómez-Barrio, Alicia; Alderete, J F

    2014-04-01

    The nucleotide sequence of the 5.8S rRNA gene and the flanked internal transcribed spacer (ITS) regions of six Trichomonas vaginalis isolates with different metronidazole sensitivity and geographic origin were genotyped. A multiple sequence alignment was performed with different sequences of other isolates available at the GenBank/EMBL/DDBJ databases, which revealed 5 different sequence patterns. Although a stable mutation in position 66 of the ITS1 (C66T) was observed in 26% (9/34) of the T. vaginalis sequences analyzed, there was 99.7% ITS nucleotide sequence identity among isolates for this sequence. The nucleotide sequence variation among other species of the genus Trichomonas ranged from 3.4% to 9.1%. Surprisingly, the % identity between T. vaginalis and Pentatrichomonas hominis was ~83%. There was >40% divergence in the ITS sequence between T. vaginalis and Tritrichomonas spp., including Tritrichomonas augusta, Tritrichomonas muris, and Tritrichomonas nonconforma and with Tetratrichomonas prowazeki. Dendrograms grouped the trichomonadid sequences in robust clades according to their genera. The absence of nucleotide divergence in the hypervariable ITS regions between T. vaginalis isolates suggests the early divergence of the parasite. Importantly, these data show this ITS1-5.8S rRNA-ITS2 region suitable for inter-species differentiation.

  17. Characterization of Dermanyssus gallinae (Acarina: Dermanissydae) by sequence analysis of the ribosomal internal transcribed spacer regions.

    PubMed

    Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M

    2009-10-01

    In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.

  18. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny.

    PubMed

    Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

    2015-01-01

    Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951

  19. Determination of internal transcribed spacer regions (ITS) in Trichomonas vaginalis isolates and differentiation among Trichomonas species.

    PubMed

    Ibáñez-Escribano, Alexandra; Nogal-Ruiz, Juan José; Arán, Vicente J; Escario, José Antonio; Gómez-Barrio, Alicia; Alderete, J F

    2014-04-01

    The nucleotide sequence of the 5.8S rRNA gene and the flanked internal transcribed spacer (ITS) regions of six Trichomonas vaginalis isolates with different metronidazole sensitivity and geographic origin were genotyped. A multiple sequence alignment was performed with different sequences of other isolates available at the GenBank/EMBL/DDBJ databases, which revealed 5 different sequence patterns. Although a stable mutation in position 66 of the ITS1 (C66T) was observed in 26% (9/34) of the T. vaginalis sequences analyzed, there was 99.7% ITS nucleotide sequence identity among isolates for this sequence. The nucleotide sequence variation among other species of the genus Trichomonas ranged from 3.4% to 9.1%. Surprisingly, the % identity between T. vaginalis and Pentatrichomonas hominis was ~83%. There was >40% divergence in the ITS sequence between T. vaginalis and Tritrichomonas spp., including Tritrichomonas augusta, Tritrichomonas muris, and Tritrichomonas nonconforma and with Tetratrichomonas prowazeki. Dendrograms grouped the trichomonadid sequences in robust clades according to their genera. The absence of nucleotide divergence in the hypervariable ITS regions between T. vaginalis isolates suggests the early divergence of the parasite. Importantly, these data show this ITS1-5.8S rRNA-ITS2 region suitable for inter-species differentiation. PMID:24412628

  20. Structure of Intergenic Spacer IGS1 of Ribosomal Operon from Schistidium Mosses.

    PubMed

    Milyutina, I A; Ignatova, E A; Ignatov, M S; Goryunov, D V; Troitsky, A V

    2015-11-01

    The structure of the intergenic spacer 1 (IGS1) of the ribosomal operon from 12 species of Schistidium mosses was studied. In the IGS1 sequences of these species, three conserved regions and two areas of GC- and A-enriched repeats were identified. All of the studied mosses have a conserved pyrimidine-enriched motif at the 5'-end of IGS1. Species-specific nucleotide substitutions and insertions were found in the conserved areas. The repeated units contain single nucleotide substitutions that make unique the majority of repeated units. The positions of such repeats in IGS1 are species-specific, but their number can vary within the species and among operons of the same specimen. The comparison of IGS1 sequences from the Schistidium species and from representatives of ten other moss genera revealed the presence of common conserved motifs with similar localization. Presumably, these motifs are elements of termination of the pre-rRNA transcription and processing of rRNA.

  1. Performance Analysis and Test on the KAERI Devised Spacer Grids for PWRs

    NASA Astrophysics Data System (ADS)

    Song, Kee-Nam; Lee, Soo-Bum

    Spacer grid which is one of the most important structural components in a pressurized light water reactor fuel assembly supports the fuel rods laterally and vertically. Based on design experiences and by scrutinizing the design features of advanced nuclear fuels and the international patents of spacer grids, KAERI has devised its own spacer grid shapes and acquired patents. In this study, a performance evaluation on two new spacer grid shapes devised by KAERI was carried out from mechanical/structural and thermohydraulic view points. And also a performance evaluation on two commercial spacer grid shapes was carried out for the sake of a comparison. The comparisons included the spring characteristics, fuel rod vibration characteristics, fretting wear resistance, impact strength characteristics, CHF enhancement, and pressure drop level of the spacer grid shapes. The comparison results have shown that the performances of the new spacer grid shapes are better or at least not worse than those of the commercial spacer grid shapes.

  2. Effect of spacer layers on current-voltage characteristics of resonant-tunneling diode

    SciTech Connect

    Remnev, M. A. Kateev, I. Yu.; Elesin, V. F.

    2010-08-15

    Using the numerical solution to the Schroedinger equation, current-voltage characteristics of the resonant-tunneling diode with spacer layers were obtained. The dependences of the peak current of the resonant-tunneling diode on the emitter spacer width were plotted. It was shown that the peak current depends periodically on the emitter spacer width. The constructed electron density diagrams showed that the increase in the peak current is associated with the resonant level in the emitter spacer region.

  3. Patterns of variation in the intergenic spacers of ribosomal DNA in Drosophila melanogaster support a model for genetic exchanges during X-Y pairing.

    PubMed

    Polanco, C; González, A I; Dover, G A

    2000-07-01

    Detailed analysis of variation in intergenic spacer (IGS) and internal transcribed spacer (ITS) regions of rDNA drawn from natural populations of Drosophila melanogaster has revealed contrasting patterns of homogenization although both spacers are located in the same rDNA unit. On the basis of the role of IGS regions in X-Y chromosome pairing, we proposed a mechanism of single-strand exchanges at the IGS regions, which can explain the different evolutionary trajectories followed by the IGS and the ITS regions. Here, we provide data from the chromosomal distribution of selected IGS length variants, as well as the detailed internal structure of a large number of IGS regions obtained from specific X and Y chromosomes. The variability found in the different internal subrepeat regions of IGS regions isolated from X and Y chromosomes supports the proposed mechanism of genetic exchanges and suggests that only the "240" subrepeats are involved. The presence of a putative site for topoisomerase I at the 5' end of the 18S rRNA gene would allow for the exchange between X and Y chromosomes of some 240 subrepeats, the promoter, and the ETS region, leaving the rest of the rDNA unit to evolve along separate chromosomal lineages. The phenomenon of localized units (modules) of homogenization has implications for multigene family evolution in general.

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. Biomechanics of lateral interbody spacers: going wider for going stiffer.

    PubMed

    Pimenta, Luiz; Turner, Alexander W L; Dooley, Zachary A; Parikh, Rachit D; Peterson, Mark D

    2012-01-01

    This study investigates the biomechanical stability of a large interbody spacer inserted by a lateral approach and compares the biomechanical differences with the more conventional transforaminal interbody fusion (TLIF), with and without supplemental pedicle screw (PS) fixation. Twenty-four L2-L3 functional spinal units (FSUs) were tested with three interbody cage options: (i) 18 mm XLIF cage, (ii) 26 mm XLIF cage, and (iii) 11 mm TLIF cage. Each spacer was tested without supplemental fixation, and with unilateral and bilateral PS fixation. Specimens were subjected to multidirectional nondestructive flexibility tests to 7.5 N·m. The range of motion (ROM) differences were first examined within the same group (per cage) using repeated-measures ANOVA, and then compared between cage groups. The 26 mm XLIF cage provided greater stability than the 18 mm XLIF cage with unilateral PS and 11 mm TLIF cage with bilateral PS. The 18 mm XLIF cage with unilateral PS provided greater stability than the 11 mm TLIF cage with bilateral PS. This study suggests that wider lateral spacers are biomechanically stable and offer the option to be used with less or even no supplemental fixation for interbody lumbar fusion.

  6. Structural design feasibility study of Space Station long spacer truss

    NASA Technical Reports Server (NTRS)

    Armand, Sasan C.; Funk, Gregory P.; Dohogne, Caroline A.

    1994-01-01

    The structural design and configuration feasibility of the long spacer truss assembly that will be used as part of the Space Station Freedom is the focus of this study. The structural analysis discussed herein is derived from the transient loading events presented in the Space Transportation System Interface Control Document (STS ICD). The transient loading events are liftoff, landing, and emergency landing loads. Quasi-static loading events were neglected in this study since the magnitude of the quasi-static acceleration factors is lower than that of the transient acceleration factors. Structural analysis of the proposed configuration of the long spacer truss with four longerons indicated that negative safety margins are possible. As a result, configuration changes were proposed. The primary configuration change suggested was to increase the number of truss longerons to six. The six-longeron truss appears to be a more promising structure than the four-longeron truss because it offers a positive margin of safety and more volume in its second bay (BAY2). This additional volume can be used for resupply of some of the orbital replacement units (such as a battery box). Note that the design effort on the long spacer truss has not fully begun and that calculations and reports of the negative safety margins are, to date, based on concept only.

  7. Effects of interspinous spacers on lumbar degenerative disease.

    PubMed

    Zhou, Dong; Nong, Lu-Ming; DU, Rui; Gao, Gong-Ming; Jiang, Yu-Qing; Xu, Nan-Wei

    2013-03-01

    The present study aimed to evaluate the early effects of interspinous spacers on lumbar degenerative disease. The clinical outcomes of 23 patients with lumbar degenerative disease, treated using interspinous spacer implantation alone or combined with posterior lumbar fusion, were retrospectively studied and assessed with a visual analogue scale (VAS) and the Oswestry Disability Index (ODI). Pre-operative and post-operative interspinous distance, disc space height, foraminal width and height and segmental lordosis were determined. The early effects and complications associated with the interspinous spacers were recorded. The surgical procedures performed with the in-space treatment were easy and minimally invasive. The VAS scores and ODI were improved post-operatively compared with pre-operatively. Significant changes in the interspinous distance, disc space height, foraminal width and height and segmental lordosis were noted. In-space treatment for degenerative lumbar disease is easy and safe, with good early effects. The in-space system provides an alternative treatment for lumbar degenerative disease.

  8. Improving electricity production in tubular microbial fuel cells through optimizing the anolyte flow with spiral spacers.

    PubMed

    Zhang, Fei; Ge, Zheng; Grimaud, Julien; Hurst, Jim; He, Zhen

    2013-04-01

    The use of spiral spacers to create a helical flow for improving electricity generation in microbial fuel cells (MFCs) was investigated in both laboratory and on-site tests. The lab tests found that the MFC with the spiral spacers produced more electricity than the one without the spiral spacers at different recirculation rates or organic loading rates, likely due to the improved transport/distribution of ions and electron mediators instead of the substrates because the organic removal efficiency was not obviously affected by the presence of the spiral spacers. The energy production in the MFC with the spiral spacers reached 0.071 or 0.073 kWh/kg COD in either vertical or horizontal installment. The examination of the MFCs installed in an aeration tank of a municipal wastewater treatment plant confirmed the advantage of using the spiral spacers. Those results demonstrate that spiral spacers could be an effective approach to improve energy production in MFCs.

  9. Increased antibiotic release and equivalent biomechanics of a spacer cement without hard radio contrast agents.

    PubMed

    Bitsch, R G; Kretzer, J P; Vogt, S; Büchner, H; Thomsen, M N; Lehner, B

    2015-10-01

    We compared a novel calcium carbonate spacer cement (Copal® spacem) to well-established bone cements. Electron microscopic structure and elution properties of the antibiotics ofloxacin, vancomycin, clindamycin, and gentamicin were examined. A knee wear simulator model for articulating cement spacers was established. Mechanical tests for bending strength, flexural modulus, and compressive and fatigue strength were performed. The electron microscopic analysis showed a microporous structure of the spacer cement, and this promoted a significantly higher and longer antibiotic elution. All spacer cement specimens released the antibiotics for a period of up to 50days with the exception of the vancomycin loading. The spacer cement showed significantly less wear scars and fulfilled the ISO 5833 requirements. The newly developed spacer cement is a hydrophilic antibiotic carrier with an increased release. Cement without hard radio contrast agents can improve tribological behaviour of spacers, and this may reduce reactive wear particles and abrasive bone defects.

  10. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively.

  11. Detection of Mycoplasma canadense and Mycoplasma californicum in dairy cattle from Argentina.

    PubMed

    Tamiozzo, Pablo J; Estanguet, Abel A; Maito, Julia; Tirante, Liliana; Pol, Martin; Giraudo, José A

    2014-01-01

    Different species of Mycoplasma can affect bovine cattle, causing several diseases. PCR sequencing and further analysis of the 16S-23S rRNA ITS region have shown a significant interspecies variability among Mollicutes. Sixteen suspected isolates of Mycoplasma spp. obtained from milk samples from dairy herds were amplified (16S-23S rRNA ITS region). Fourteen out of those 16 suspected Mycoplasma spp. isolates were PCR-positive. To confirm the identity of Mycoplasma bovis, these 14 isolates were tested by another species-specific PCR. Seven of the isolates rendered a positive result. The products of 16S-23S rRNA ITS PCR from one isolate that was identified as M. bovis and from two other isolates, identified as non- M. bovis were randomly selected, sequenced and analyzed. The three sequences (A, B and C) showed 100% similarity with M. bovis, Mycoplasma canadense and Mycoplasma californicum respectively. PMID:25011595

  12. Development and characterization of 3D-printed feed spacers for spiral wound membrane systems.

    PubMed

    Siddiqui, Amber; Farhat, Nadia; Bucs, Szilárd S; Linares, Rodrigo Valladares; Picioreanu, Cristian; Kruithof, Joop C; van Loosdrecht, Mark C M; Kidwell, James; Vrouwenvelder, Johannes S

    2016-03-15

    Feed spacers are important for the impact of biofouling on the performance of spiral-wound reverse osmosis (RO) and nanofiltration (NF) membrane systems. The objective of this study was to propose a strategy for developing, characterizing, and testing of feed spacers by numerical modeling, three-dimensional (3D) printing of feed spacers and experimental membrane fouling simulator (MFS) studies. The results of numerical modeling on the hydrodynamic behavior of various feed spacer geometries suggested that the impact of spacers on hydrodynamics and biofouling can be improved. A good agreement was found for the modeled and measured relationship between linear flow velocity and pressure drop for feed spacers with the same geometry, indicating that modeling can serve as the first step in spacer characterization. An experimental comparison study of a feed spacer currently applied in practice and a 3D printed feed spacer with the same geometry showed (i) similar hydrodynamic behavior, (ii) similar pressure drop development with time and (iii) similar biomass accumulation during MFS biofouling studies, indicating that 3D printing technology is an alternative strategy for development of thin feed spacers with a complex geometry. Based on the numerical modeling results, a modified feed spacer with low pressure drop was selected for 3D printing. The comparison study of the feed spacer from practice and the modified geometry 3D printed feed spacer established that the 3D printed spacer had (i) a lower pressure drop during hydrodynamic testing, (ii) a lower pressure drop increase in time with the same accumulated biomass amount, indicating that modifying feed spacer geometries can reduce the impact of accumulated biomass on membrane performance. The combination of numerical modeling of feed spacers and experimental testing of 3D printed feed spacers is a promising strategy (rapid, low cost and representative) to develop advanced feed spacers aiming to reduce the impact of

  13. Development and characterization of 3D-printed feed spacers for spiral wound membrane systems.

    PubMed

    Siddiqui, Amber; Farhat, Nadia; Bucs, Szilárd S; Linares, Rodrigo Valladares; Picioreanu, Cristian; Kruithof, Joop C; van Loosdrecht, Mark C M; Kidwell, James; Vrouwenvelder, Johannes S

    2016-03-15

    Feed spacers are important for the impact of biofouling on the performance of spiral-wound reverse osmosis (RO) and nanofiltration (NF) membrane systems. The objective of this study was to propose a strategy for developing, characterizing, and testing of feed spacers by numerical modeling, three-dimensional (3D) printing of feed spacers and experimental membrane fouling simulator (MFS) studies. The results of numerical modeling on the hydrodynamic behavior of various feed spacer geometries suggested that the impact of spacers on hydrodynamics and biofouling can be improved. A good agreement was found for the modeled and measured relationship between linear flow velocity and pressure drop for feed spacers with the same geometry, indicating that modeling can serve as the first step in spacer characterization. An experimental comparison study of a feed spacer currently applied in practice and a 3D printed feed spacer with the same geometry showed (i) similar hydrodynamic behavior, (ii) similar pressure drop development with time and (iii) similar biomass accumulation during MFS biofouling studies, indicating that 3D printing technology is an alternative strategy for development of thin feed spacers with a complex geometry. Based on the numerical modeling results, a modified feed spacer with low pressure drop was selected for 3D printing. The comparison study of the feed spacer from practice and the modified geometry 3D printed feed spacer established that the 3D printed spacer had (i) a lower pressure drop during hydrodynamic testing, (ii) a lower pressure drop increase in time with the same accumulated biomass amount, indicating that modifying feed spacer geometries can reduce the impact of accumulated biomass on membrane performance. The combination of numerical modeling of feed spacers and experimental testing of 3D printed feed spacers is a promising strategy (rapid, low cost and representative) to develop advanced feed spacers aiming to reduce the impact of

  14. [CpcHID operon as a new tool for classification and identification of Arthrospira platensis strains].

    PubMed

    Yang, Ling-yong; Wang, Zhi-ping; Cao, Xue-cheng; Chen, Xiao-yan; Xu, Bu-jin; Li, Xue-bin; Huang, Hui

    2006-12-01

    Arthrospira is a photoautotrophic filamentous cyanobacterium belonging to the family Oscillatoriaceae, phylum Cyanophyta. Morphological criteria alone were inadequate for classification of Arthrospira . To develop new molecular markers, in this study, the cpcHID operon, 16S rRNA and 16S-23S rRNA internally transcribed spacer (ITS) of seven Arthrospira platensis strains, Sp-10, Sp-2, Sp-9, Sp-1, Sp-1ll, Sp-3 and Sp-5, were cloned and sequenced. And the results of bioinformatics and molecular phylogenetics analyses with BioEdit 7.0, Clustal X 1.81 and Phylip 3.65 were as follows: (1) The sequences of cpcHID operon, 16S rRNA and ITS from the seven strains were highly homologous to the each corresponding gene based on multiple pair-wise comparison. (2) The mean absolute deviation of the G + C content, the ratio of different sites and the genetic distance coefficient based on the sequences of cpcHID operon in the seven strains were generally greater than that based on 16S rRNA and ITS region. (3) The phylogenetic dendrogram based on the sequences of cpcHID operon was almost same with that based on the sequences of 16S rRNA and ITS region. Therefore, it revealed that cpcHID operon could be applied as a new molecular marker to classification and identification of cyanobacterium, and more appropriate for species or strains determination due to its abundant information. PMID:17302170

  15. Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting

    PubMed Central

    2014-01-01

    Background Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. Results We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. Conclusions We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference

  16. Impact of ZnO embedded feed spacer on biofilm development in membrane systems.

    PubMed

    Ronen, Avner; Semiat, Raphael; Dosoretz, Carlos G

    2013-11-01

    The concept of suppressing biofouling formation using an antibacterial feed spacer was investigated in a bench scale-cross flow system mimicking a spiral wound membrane configuration. An antibacterial composite spacer containing zinc oxide-nanoparticles was constructed by modification of a commercial polypropylene feed spacer using sonochemical deposition. The ability of the modified spacers to repress biofilm development on membranes was evaluated in flow-through cells simulating the flow conditions in commercial spiral wound modules. The experiments were performed at laminar flow (Re = 300) with a 200 kDa molecular weight cut off polysulfone ultrafiltration membrane using Pseudomonas putida S-12 as model biofilm bacteria. The modified spacers reduced permeate flux decrease at least by 50% compared to the unmodified spacers (control). The physical properties of the modified spacer and biofilm development were evaluated using high resolution/energy dispersive spectrometry-scanning electron microscopy, atomic force microscopy and confocal laser scanning microscopy imaging (HRSEM, EDS, AFM and CLSM). HRSEM images depicted significantly less bacteria attached to the membranes exposed to the modified spacer, mainly scattered and in a sporadic monolayer structure. AFM analysis indicated the influence of the modification on the spacer surface including a phase change on the upper surface. Dead-live staining assay by CLSM indicated that most of the bacterial cells attached on the membranes exposed to the modified spacer were dead in contrast to a developed biofilm which was predominant in the control samples.

  17. Chelate cooperativity and spacer length effects on the assembly thermodynamics and kinetics of divalent pseudorotaxanes.

    PubMed

    Jiang, Wei; Nowosinski, Karol; Löw, Nora L; Dzyuba, Egor V; Klautzsch, Fabian; Schäfer, Andreas; Huuskonen, Juhani; Rissanen, Kari; Schalley, Christoph A

    2012-01-25

    Homo- and heterodivalent crown-ammonium pseudorotaxanes with different spacers connecting the two axle ammonium binding sites have been synthesized and characterized by NMR spectroscopy and ESI mass spectrometry. The homodivalent pseudorotaxanes are investigated with respect to the thermodynamics of divalent binding and to chelate cooperativity. The shortest spacer exhibits a chelate cooperativity much stronger than that of the longer spacers. On the basis of crystal structure, this can be explained by a noninnocent spacer, which contributes to the binding strength in addition to the two binding sites. Already very subtle changes in the spacer length, i.e., the introduction of an additional methylene group, cause substantial changes in the magnitude of cooperative binding as expressed in the large differences in effective molarity. With a similar series of heterodivalent pseudorotaxanes, the spacer effects on the barrier for the intramolecular threading step has been examined with the result that the shortest spacer causes a strained transition structure and thus the second binding event occurs slower than that of the longer spacers. The activation enthalpies and entropies show clear trends. While the longer spacers reduce the enthalpic strain that is present in the transition state for the shortest member of the series, the longer spacers become entropically slightly more unfavorable because of conformational fixation of the spacer chain during the second binding event. These results clearly show the noninnocent spacers to complicate the analysis of multivalent binding. An approximate description which considers the binding sites to be connected just by a flexible chain turns out to be more a rough approximation than a good model. The second conclusion from the results presented here is that multivalency is expressed in both the thermodynamics and the kinetics in different ways. A spacer optimized for strong binding is suboptimal for fast pseudorotaxane formation.

  18. Molecular analysis of fungal populations in patients with oral candidiasis using internal transcribed spacer region.

    PubMed

    Ieda, Shinsuke; Moriyama, Masafumi; Takeshita, Toru; Takashita, Toru; Maehara, Takashi; Imabayashi, Yumi; Shinozaki, Shoichi; Tanaka, Akihiko; Hayashida, Jun-Nosuke; Furukawa, Sachiko; Ohta, Miho; Yamashita, Yoshihisa; Nakamura, Seiji

    2014-01-01

    Oral candidiasis is closely associated with changes in the oral fungal flora and is caused primarily by Candida albicans. Conventional methods of fungal culture are time-consuming and not always conclusive. However, molecular genetic analysis of internal transcribed spacer (ITS) regions of fungal rRNA is rapid, reproducible and simple to perform. In this study we examined the fungal flora in patients with oral candidiasis and investigated changes in the flora after antifungal treatment using length heterogeneity-polymerization chain reaction (LH-PCR) analysis of ITS regions. Fifty-two patients with pseudomembranous oral candidiasis (POC) and 30 healthy controls were included in the study. Fungal DNA from oral rinse was examined for fungal species diversity by LH-PCR. Fungal populations were quantified by real-time PCR and previously-unidentified signals were confirmed by nucleotide sequencing. Relationships between the oral fungal flora and treatment-resistant factors were also examined. POC patients showed significantly more fungal species and a greater density of fungi than control individuals. Sixteen fungi were newly identified. The fungal populations from both groups were composed predominantly of C. albicans, though the ratio of C. dubliniensis was significantly higher in POC patients than in controls. The diversity and density of fungi were significantly reduced after treatment. Furthermore, fungal diversity and the proportion of C. dubliniensis were positively correlated with treatment duration. These results suggest that C. dubliniensis and high fungal flora diversity might be involved in the pathogenesis of oral candidiasis. We therefore conclude that LH-PCR is a useful technique for diagnosing and assessing the severity of oral candidal infection.

  19. Enhancing Asthma Medication Delivery: Spacers and Valved Holding Chambers.

    PubMed

    Schoessler, Sally; Winders, Tonya

    2016-07-01

    Asthma is one of the most prevalent chronic diseases managed by school nurses, and its management often includes the administration of bronchodilators delivered via a metered dose inhaler (MDI). The use of an MDI requires coordination and mastery of steps that must be performed correctly and in the proper order. These steps are greatly enhanced, especially in the pediatric population, through the use of medical devices-spacers and valved holding chambers. The purpose of this article is to review the rationale and implications for the use of these devices in the school setting. PMID:27194239

  20. Hydrodynamic evidence in support of spacer regions in chromatin.

    PubMed

    Schmitz, K S; Shaw, B R

    1977-08-12

    Quasi-elastic light scattering and sedimentation velocity methods were used to study the hydrodynamic properties of purified dimer subunits obtained from partial digestion of chicken erythrocyte chromatin with staphylococcal nuclease. The experimental value of 1.87 +/- 0.08 X 10(-7) gram per second for the friction factor of these dimer subunits in low ionic strength buffer cannot be reasonably interpreted in terms of a contiguous sphere model. Analysis by means of an equivalent dimer method suggests that the spacer region accounts for a maximum of 19 percent of the friction properties of the dimer.

  1. A 500-ml plastic bottle: an effective spacer for children with asthma.

    PubMed

    Zar, Heather J; Asmus, Michael J; Weinberg, Eugene G

    2002-06-01

    Inhaled therapy using a metered-dose inhaler (MDI) with attached spacer has been increasingly recognized as the optimal method for delivering asthma medication for acute attacks and chronic prophylaxis. However, in developing countries the cost and availability of commercially produced spacers limit the use of MDI-spacer delivery systems. A 500-ml plastic bottle has been recently adapted to function as a spacer. This article reviews the current data on the efficacy of this bottle-spacer and discusses its advantages and limitations. It is concluded that a modified 500-ml plastic bottle is an effective spacer; modification and use of this device should be incorporated into international guidelines for the management of children with asthma.

  2. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.

    PubMed

    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W

    2008-05-01

    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  3. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  4. Delivery of beclomethasone dipropionate from a spacer device: what dose is available for inhalation?

    PubMed Central

    O'Callaghan, C.; Cant, M.; Robertson, C.

    1994-01-01

    BACKGROUND--It is common for inhaled steroids to be delivered through a large volume spacer device. Comparatively little is known about how this practice affects the dose of drug received by patients compared with drug delivered directly from a metered dose inhaler. METHODS--The amount of beclomethasone dipropionate, contained in particles of various size, available for inhalation from a 750 ml polycarbonate spacer (Volumatic) was determined by impinger measurement and high performance liquid chromatography. Three strengths of metered dose inhalers were studied (50 micrograms, 100 micrograms, and 250 micrograms/actuation). The effect of multiple actuations of beclomethasone dipropionate into a Volumatic spacer, and increasing residence times of drug within the spacer before inhalation, on the amount of drug available to the patient for inhalation was determined. RESULTS--The amount of beclomethasone dipropionate in particles < 5 microns when delivered by a spacer device or directly from a metered dose inhaler was similar. The total amount of beclomethasone dipropionate available for inhalation per actuation decreased by 20 micrograms with the 50 micrograms inhaler, 48 micrograms with the 100 micrograms inhaler, and 161 micrograms with the 250 micrograms inhaler, when given via the spacer compared with delivery directly from a metered dose inhaler. There was a progressive decrease in drug available for inhalation per actuation as the number of actuations into the spacer increased, for all strengths of beclomethasone dipropionate tested. A progressive decrease in drug recovered per actuation was also seen with increasing residence times of drug within the spacer before inhalation. CONCLUSIONS--Use of the spacer device significantly reduced the amount of nonrespirable beclomethasone dipropionate available for inhalation. The amount of beclomethasone dipropionate within respirable particles decreased considerably following multiple actuations into the spacer and with

  5. Cervical interfacet spacers and maintenance of cervical lordosis.

    PubMed

    Tan, Lee A; Straus, David C; Traynelis, Vincent C

    2015-05-01

    OBJECT The cervical interfacet spacer (CIS) is a relatively new technology that can increase foraminal height and area by facet distraction. These offer the potential to provide indirect neuroforaminal decompression while simultaneously enhancing fusion potential due to the relatively large osteoconductive surface area and compressive forces exerted on the grafts. These potential benefits, along with the relative ease of implantation during posterior cervical fusion procedures, make the CIS an attractive adjuvant in the management of cervical pathology. One concern with the use of interfacet spacers is the theoretical risk of inducing iatrogenic kyphosis. This work tests the hypothesis that interfacet spacers are associated with loss of cervical lordosis. METHODS Records from patients undergoing posterior cervical fusion at Rush University Medical Center between March 2011 and December 2012 were reviewed. The FacetLift CISs were used in all patients. Preoperative and postoperative radiographic data were reviewed and the Ishihara indices and cervical lordotic angles were measured and recorded. Statistical analyses were performed using STATA software. RESULTS A total of 64 patients were identified in whom 154 cervical levels were implanted with machined allograft interfacet spacers. Of these, 15 patients underwent anterior-posterior fusions, 4 underwent anterior-posterior-anterior fusions, and the remaining 45 patients underwent posterior-only fusions. In the 45 patients with posterior-only fusions, a total of 110 levels were treated with spacers. There were 14 patients (31%) with a single level treated, 16 patients (36%) with two levels treated, 5 patients (11%) with three levels treated, 5 patients (11%) with four levels treated, 1 patient (2%) with five levels treated, and 4 patients (9%) with six levels treated. Complete radiographic data were available in 38 of 45 patients (84%). On average, radiographic follow-up was obtained at 256.9 days (range 48-524 days

  6. Nanoparticle-Based Brachytherapy Spacers for Delivery of Localized Combined Chemoradiation Therapy

    SciTech Connect

    Kumar, Rajiv; Belz, Jodi; Markovic, Stacey; Jadhav, Tej; Fowle, William; Niedre, Mark; Cormack, Robert; Makrigiorgos, Mike G.; Sridhar, Srinivas

    2015-02-01

    Purpose: In radiation therapy (RT), brachytherapy-inert source spacers are commonly used in clinical practice to achieve high spatial accuracy. These implanted devices are critical technical components of precise radiation delivery but provide no direct therapeutic benefits. Methods and Materials: Here we have fabricated implantable nanoplatforms or chemoradiation therapy (INCeRT) spacers loaded with silica nanoparticles (SNPs) conjugated containing a drug, to act as a slow-release drug depot for simultaneous localized chemoradiation therapy. The spacers are made of poly(lactic-co-glycolic) acid (PLGA) as matrix and are physically identical in size to the commercially available brachytherapy spacers (5 mm × 0.8 mm). The silica nanoparticles, 250 nm in diameter, were conjugated with near infrared fluorophore Cy7.5 as a model drug, and the INCeRT spacers were characterized in terms of size, morphology, and composition using different instrumentation techniques. The spacers were further doped with an anticancer drug, docetaxel. We evaluated the in vivo stability, biocompatibility, and biodegradation of these spacers in live mouse tissues. Results: The electron microscopy studies showed that nanoparticles were distributed throughout the spacers. These INCeRT spacers remained stable and can be tracked by the use of optical fluorescence. In vivo optical imaging studies showed a slow diffusion of nanoparticles from the spacer to the adjacent tissue in contrast to the control Cy7.5-PLGA spacer, which showed rapid disintegration in a few days with a burst release of Cy7.5. The docetaxel spacers showed suppression of tumor growth in contrast to control mice over 16 days. Conclusions: The imaging with the Cy7.5 spacer and therapeutic efficacy with docetaxel spacers supports the hypothesis that INCeRT spacers can be used for delivering the drugs in a slow, sustained manner in conjunction with brachytherapy, in contrast to the rapid clearance of the drugs when

  7. Influence of hydrophobic and hydrophilic spacer-containing enzyme conjugates on functional parameters of steroid immunoassay.

    PubMed

    Nara, Seema; Tripathi, Vinay; Chaube, Shail K; Rangari, Kiran; Singh, Harpal; Kariya, Kiran P; Shrivastav, Tulsidas G

    2008-02-01

    Introduction of spacers in coating steroid antigen or enzyme conjugates or immunogen is known to exert an influence on the sensitivity of steroid enzyme immunoassays. We have introduced hydrophobic and hydrophilic spacers between enzyme and steroid moieties and studied their effects on functional parameters of enzyme immunoassays, using cortisol as a model steroid. Cortisol-3-O-carboxymethyloxime-bovine serum albumin (F-3-O-CMO-BSA) was used as immunogen to raise the antiserum in New Zealand white rabbits. Three enzyme conjugates were prepared using cortisol-21-hemisuccinate (F-21-HS) as carboxylic derivative of cortisol and horseradish peroxidase (HRP) as an enzyme label. These were F-21-HS-HRP (without spacer), F-21-HS-adipic acid dihydrazide-HRP (adipic acid dihydrazide as hydrophobic spacer), and F-21-HS-urea-HRP (urea as hydrophilic spacer). The influence of hydrophobic and hydrophilic spacers on the functional parameters of assays such as lower detection limit, ED50, and specificity was studied with reference to enzyme conjugate without spacer. The results of the present investigation revealed that the presence of a hydrophilic spacer in the enzyme conjugate decreases the lower detection limit, decreases the ED50, and marginally improves the specificity of assays. These improvements in functional parameters of assays may be due to the decreased magnitude of the overall hydrophobic interactions existing between the spacer in enzyme conjugate and the antigen binding site of the antibody. PMID:18023401

  8. Nanoparticles based brachytherapy spacers for delivery of localized combined chemo-radiation therapy

    PubMed Central

    Kumar, Rajiv; Belz, Jodi; Markovic, Stacey; Jadhav, Tej; Fowle, William; Niedre, Mark; Cormack, Robert; Makrigiorgos, Mike G; Sridhar, Srinivas

    2015-01-01

    Purpose In radiation therapy (RT), brachytherapy inert source spacers are commonly used in clinical practice to achieve high spatial accuracy. These implanted devices are critical technical components of precise radiation delivery but provide no direct therapeutic benefits. Materials and Methods Here we have fabricated Implantable Nanoplatforms or Chemo-Radiation Therapy (INCeRT) spacers loaded with silica nanoparticles (SNPs) conjugated containing a drug, to act as a slow release drug depot for simultaneous localized chemo-radiation therapy. The spacers are made of poly(lactic-coglycolic) acid (PLGA) as matrix, were physically identical (size) to the commercially available brachytherapy spacers (5mm×0.8mm). The silica nanoparticles with diameter 250nm conjugated with near infrared fluorophore Cy7.5 as a model drug and the INCeRT spacers were characterized in terms of size, morphology and composition using different instrumentation techniques. The spacers were further doped with anticancer drug, docetaxel. We have evaluated the in vivo stability, biocompatibility and biodegradation of these spacers in live mouse tissues. Results The electron microscopy studies showed that nanoparticles were distributed throughout the spacers. These INCeRT spacers remained stable and can be tracked using optical fluorescence. In vivo optical imaging studies showed a slow diffusion of nanoparticles from the spacer to the adjacent tissue as opposed to the control Cy7.5-PLGA spacer which showed rapid disintegration in a few days with a burst release of Cy7.5. The docetaxel spacers showed suppression of tumor growth as opposed to control mice over 16 days. Conclusions The imaging with the Cy7.5-spacer and therapeutic efficacy with docetaxel-spacers supports the hypothesis that INCeRT spacers can be used for delivering the drugs in slow, sustained manner in conjunction with brachytherapy, as opposed to rapid clearance of the drugs when administered systemically. The results demonstrate

  9. 'Candidatus Phytoplasma balanitae' associated with witches' broom disease of Balanites triflora.

    PubMed

    Win, Nang Kyu Kyu; Lee, Seung-Yeol; Bertaccini, Assunta; Namba, Shigetou; Jung, Hee-Young

    2013-02-01

    A phytoplasma was identified in naturally infected wild Balanites triflora plants exhibiting typical witches' broom symptoms (Balanites witches' broom: BltWB) in Myanmar. The 16S rRNA gene sequence revealed that BltWB phytoplasma had the highest similarity to that of 'Candidatus Phytoplasma ziziphi' and it was also closely related to that of 'Candidatus Phytoplasma ulmi'. Phylogenetic analysis of the 16S rRNA gene sequences indicated that the BltWB phytoplasma clustered as a discrete subclade with Elm yellows phytoplasmas. RFLP analysis of the 16S rRNA gene including the 16S-23S spacer region differentiated the BltWB phytoplasma from 'Ca. P. ziziphi', 'Ca. P. ulmi' and 'Candidatus Phytoplasma trifolii'. Analysis of additional ribosomal protein (rp) and translocase protein (secY) gene sequences and phylogenetic analysis of BltWB showed that this phytoplasma was clearly distinguished from those of other 'Candidatus Phytoplasma' taxa. Taking into consideration the unique plant host and the restricted geographical occurrence in addition to the 16S rRNA gene sequence similarity, the BltWB phytoplasma is proposed to represent a novel taxon, 'Candidatus Phytoplasma balanitae'.

  10. CloVR-ITS: Automated internal transcribed spacer amplicon sequence analysis pipeline for the characterization of fungal microbiota

    PubMed Central

    2013-01-01

    Background Besides the development of comprehensive tools for high-throughput 16S ribosomal RNA amplicon sequence analysis, there exists a growing need for protocols emphasizing alternative phylogenetic markers such as those representing eukaryotic organisms. Results Here we introduce CloVR-ITS, an automated pipeline for comparative analysis of internal transcribed spacer (ITS) pyrosequences amplified from metagenomic DNA isolates and representing fungal species. This pipeline performs a variety of steps similar to those commonly used for 16S rRNA amplicon sequence analysis, including preprocessing for quality, chimera detection, clustering of sequences into operational taxonomic units (OTUs), taxonomic assignment (at class, order, family, genus, and species levels) and statistical analysis of sample groups of interest based on user-provided information. Using ITS amplicon pyrosequencing data from a previous human gastric fluid study, we demonstrate the utility of CloVR-ITS for fungal microbiota analysis and provide runtime and cost examples, including analysis of extremely large datasets on the cloud. We show that the largest fractions of reads from the stomach fluid samples were assigned to Dothideomycetes, Saccharomycetes, Agaricomycetes and Sordariomycetes but that all samples were dominated by sequences that could not be taxonomically classified. Representatives of the Candida genus were identified in all samples, most notably C. quercitrusa, while sequence reads assigned to the Aspergillus genus were only identified in a subset of samples. CloVR-ITS is made available as a pre-installed, automated, and portable software pipeline for cloud-friendly execution as part of the CloVR virtual machine package (http://clovr.org). Conclusion The CloVR-ITS pipeline provides fungal microbiota analysis that can be complementary to bacterial 16S rRNA and total metagenome sequence analysis allowing for more comprehensive studies of environmental and host-associated microbial

  11. Limitations and benefits of ARISA intra-genomic diversity fingerprinting.

    PubMed

    Popa, Radu; Popa, Rodica; Mashall, Matthew J; Nguyen, Hien; Tebo, Bradley M; Brauer, Suzanna

    2009-08-01

    Monitoring diversity changes and contamination in mixed cultures and simple microcosms is challenged by fast community structure dynamics, and the need for means allowing fast, cost-efficient and accurate identification of microorganisms at high phylogenetic resolution. The method we explored is a variant of Automated rRNA Intergenic Spacer Analysis based on Intra-Genomic Diversity Fingerprinting (ARISA-IGDF), and identifies phylotypes with multiple 16S-23S rRNA gene Intergenic Transcribed Spacers. We verified the effect of PCR conditions (annealing temperature, duration of final extension, number of cycles, group-specific primers and formamide) on ARISA-IGD fingerprints of 44 strains of Shewanella. We present a digitization algorithm and data analysis procedures needed to determine confidence in strain identification. Though using stringent PCR conditions and group-specific primers allow reasonably accurate identification of strains with three ARISA-IGD amplicons within the 82-1000 bp size range, ARISA-IGDF is best for phylotypes with >or=4 unambiguously different amplicons. This method allows monitoring the occurrence of culturable microbes and can be implemented in applications requiring high phylogenetic resolution, reproducibility, low cost and high throughput such as identifying contamination and monitoring the evolution of diversity in mixed cultures and low diversity microcosms and periodic screening of small microbial culture libraries. PMID:19538993

  12. Characterization of ISR region and development of a PCR assay for rapid detection of the fish pathogen Tenacibaculum soleae.

    PubMed

    López, Jose R; Hamman-Khalifa, Abdel M; Navas, José I; de la Herran, Roberto

    2011-11-01

    The aims of this work were to characterize the 16S-23S internal spacer region of the fish pathogen Tenacibaculum soleae and to develop a PCR assay for its identification and detection. All T. soleae strains tested displayed a single internal spacer region class, containing tRNA(I) (le) and tRNA(A) (la) genes; nevertheless, a considerable intraspecific heterogeneity was observed. However, this region proved to be useful for differentiation of T. soleae from related and non-related species. Species-specific primers were designed targeting the 16S rRNA gene and the internal spacer region region, yielding a 1555-bp fragment. Detection limit was of 1 pg DNA per reaction (< 30 bacterial cells) when using pure cultures. The detection level in the presence of DNA from fish or other bacteria was lower; however, 10 pg were detected at a target/background ratio of 1 : 10(5) . The PCR assay proved to be more sensitive than agar cultivation for the detection of T. soleae from naturally diseased fish, offering a useful tool for diagnosis and for understanding the epidemiology of this pathogen.

  13. Vibration of the Package of Rods Linked by Spacer Grids

    NASA Astrophysics Data System (ADS)

    Zeman, V.; Hlaváč, Z.

    This paper deals with modelling and vibration analysis of the large package of identical parallel rods which are linked by transverse springs (spacer grids) placed on several level spacings. The vibration of rods is caused by the support plate motion. The rod discretization by FEM is based on Rayleigh beam theory. With respect to cyclic and central package rod symmetry, the system is decomposed to identical revolved rod segments. The modal synthesis method with condensation of the rod segments is used for modelling and determination of steady forced vibration of the whole system. The presented method is the first step to modelling of the nuclear fuel assembly vibration caused by kinematical excitation determined by motion of the support plates which are part of the reactor core.

  14. Modified Open-door Laminoplasty Using Hydroxyapatite Spacers and Miniplates

    PubMed Central

    Jin, Sung-Won; Kim, Bum-Joon; Choi, Jong-Il; Ha, Sung-Kon; Kim, Sang-Dae; Lim, Dong-Jun

    2014-01-01

    Objective Cervical laminoplasty has been widely accepted as one of the major treatments for cervical myelopathy and various modifications and supplementary procedures have been devised to achieve both proper decompression and stability of the cervical spine. We present the retrospectively analyzed results of a modified unilateral open-door laminoplasty using hydroxyapatite (HA) spacers and malleable titanium miniplates. Methods From June 2008 to May 2012, among patients diagnosed with cervical spondylotic myelopathy and ossification of posterior longitudinal ligament, the patients who received laminoplasty were reviewed. Clinical outcome was assessed using Frankel grade and Japanese Orthopaedic Association score. The radiologic parameters were obtained from plain films, 3-dimensional computed tomography and magnetic resonance images. Results A total of 125 cervical laminae were operated in 38 patients. 11 patients received 4-level laminoplasty and 27 patients received 3-level laminoplasty. Postoperatively, the mean Frankel grade and JOA score were significantly improved from 3.97 to 4.55 and from 12.76 to 14.63, respectively (p<0.001). Radiologically, cervical curvature was worsened from 19.09 to 15.60 (p=0.025). The percentage of range of motion preservation was 73.32±22.39%. The axial dimension of the operated spinal canal was increased from 1.75 to 2.70 cm2 (p<0.001). Conclusion In the presenting study, unilateral open-door laminoplasty using HA spacers and miniplates appears to be a safe, rapid and easy procedure to obtain an immediate and rigid stabilization of the posterior elements of the cervical spine. This modified laminoplasty method showed effective expansion of the spinal canal and favorable clinical outcomes. PMID:25346767

  15. Single electron transistor with P-type sidewall spacer gates.

    PubMed

    Lee, Jung Han; Li, Dong Hua; Lee, Joung-Eob; Kang, Kwon-Chil; Kim, Kyungwan; Park, Byung-Gook

    2011-07-01

    A single-electron transistor (SET) is one of the promising solutions to overcome the scaling limit of the Metal-Oxide-Semiconductor Field Effect Transistor (MOSFET). Up to now, various kinds of SETs are being proposed and SETs with a dual gate (DG) structure using an electrical potential barrier have been demonstrated for room temperature operation. To operate DG-SETs, however, extra bias of side gates is necessary. It causes new problems that the electrode for side gates and the extra bias for electrical barrier increase the complexity in circuit design and operation power consumption, respectively. For the reason, a new mechanism using work function (WF) difference is applied to operate a SET at room temperature by three electrodes. Its structure consists of an undoped active region, a control gate, n-doped source/drain electrodes, and metal/silicide or p-type silicon side gates, and a SET with metal/silicide gates or p-type silicon gates forms tunnel barriers induced by work function between an undoped channel and grounded side gates. Via simulation, the effectiveness of the new mechanism is confirmed through various silicide materials that have different WF values. Furthermore, by considering the realistic conditions of the fabrication process, SET with p-type sidewall spacer gates was designed, and its brief fabrication process was introduced. The characteristics of its electrical barrier and the controllability of its control gate were also confirmed via simulation. Finally, a single-hole transistor with n-type sidewall spacer gates was designed. PMID:22121580

  16. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    PubMed

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  17. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.

    PubMed

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5'-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  18. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression

    PubMed Central

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5′-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  19. Ertapenem Articulating Spacer for the Treatment of Polymicrobial Total Knee Arthroplasty Infection.

    PubMed

    Radoicic, Dragan; Milanovic, Milomir; Marinkovic, Jugoslav; Radoicic, Danica

    2016-01-01

    Introduction. Periprosthetic joint infections (PJIs) are the primary cause of early failure of the total knee arthroplasty (TKA). Polymicrobial TKA infections are often associated with a higher risk of treatment failure. The aim of the study was to assess the efficacy of ertapenem loaded spacers in the treatment of polymicrobial PJI. Methods. There were 18 patients enrolled; nine patients with polymicrobial PJI treated with ertapenem loaded articulating spacers were compared to the group of 9 patients treated with vancomycin or ceftazidime loaded spacers. Results. Successful reimplantation with revision implants was possible in 66.67%. Ertapenem spacers were used in 6 cases in primary two-stage procedure and in 3 cases in secondary spacer exchange. Successful infection eradication was achieved in all cases; final reimplantation with revision knee arthroplasty implants was possible in 6 cases. Conclusion. Ertapenem can be successfully used as antimicrobial addition to the cement spacers in two-stage revision treatment of polymicrobial PJIs. However, this type of spacer may also be useful in the treatment of infections caused by monomicrobial extended spectrum beta-lactamases producing gram-negative bacilli. Further clinical studies are required to evaluate the efficacy and safety of ertapenem spacers in the treatment of polymicrobial and monomicrobial PJIs. PMID:27366173

  20. Patterning with amorphous carbon spacer for expanding the resolution limit of current lithography tool

    NASA Astrophysics Data System (ADS)

    Jung, Woo-Yung; Kim, Sang-Min; Kim, Choi-Dong; Sim, Guee-Hwang; Jeon, Sung-Min; Park, Sang-Wook; Lee, Byung-Seok; Park, Sung-Ki; Kim, Ji-Soo; Heon, Lee-Sang

    2007-03-01

    Double patterning technique using spacer which can avoid CD (Critical Dimension) uniformity problem mainly caused by overlay issue is one of the methods that could be applied to apply to manufacturing of memory devices. Though double exposure and etch technology (DEET) has comparative advantage in the number of process steps, it is required to dramatically improve overlay performance of current exposure tools for the realization of manufacturing. In this study, negative type-double pattering technique using spacer has been developed as the best way for the application of NAND flash memory device from the view point of CD uniformity and the number of mask layers used to complete double patterning. Negative type-double patterning technique using spacer consists of subsequent steps such as formation of poly line, spacer on sidewall of poly line, SOG gap fill into space between poly lines, SOG etch back, removal of spacer, and finally hard mask etch. We have used amorphous carbon as a spacer material to easily remove spacer from poly lines and adopted SOG material to easily fill in space between poly lines. When negative type-double patterning technique using spacer is applied to NAND flash memory device, we can expect that k1 factor of about 0.14~0.20 could be accomplished successfully.

  1. Transcriptional regulator-mediated activation of adaptation genes triggers CRISPR de novo spacer acquisition.

    PubMed

    Liu, Tao; Li, Yingjun; Wang, Xiaodi; Ye, Qing; Li, Huan; Liang, Yunxiang; She, Qunxin; Peng, Nan

    2015-01-01

    Acquisition of de novo spacer sequences confers CRISPR-Cas with a memory to defend against invading genetic elements. However, the mechanism of regulation of CRISPR spacer acquisition remains unknown. Here we examine the transcriptional regulation of the conserved spacer acquisition genes in Type I-A of Sulfolobus islandicus REY15A. Csa3a, a MarR-like transcription factor encoded by the gene located adjacent to csa1, cas1, cas2 and cas4 cluster, but on the reverse strand, was demonstrated to specifically bind to the csa1 and cas1 promoters with the imperfect palindromic sequence. Importantly, it was demonstrated that the transcription level of csa1, cas1, cas2 and cas4 was significantly enhanced in a csa3a-overexpression strain and, moreover, the Csa1 and Cas1 protein levels were increased in this strain. Furthermore, we demonstrated the hyperactive uptake of unique spacers within both CRISPR loci in the presence of the csa3a overexpression vector. The spacer acquisition process is dependent on the CCN PAM sequence and protospacer selection is random and non-directional. These results suggested a regulation mechanism of CRISPR spacer acquisition where a single transcriptional regulator senses the presence of an invading element and then activates spacer acquisition gene expression which leads to de novo spacer uptake from the invading element.

  2. Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination

    PubMed Central

    Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

    2016-01-01

    Background We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Methods Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Results Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Conclusions Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case

  3. Diversity of Salmonella Strains Isolated from the Aquatic Environment as Determined by Serotyping and Amplification of the Ribosomal DNA Spacer Regions

    PubMed Central

    Baudart, Julia; Lemarchand, Karine; Brisabois, Anne; Lebaron, Philippe

    2000-01-01

    Salmonella species are pathogenic bacteria often detected in sewage, freshwater, marine coastal water, and groundwater. Salmonella spp. can survive for long periods in natural waters, and the persistence of specific and epidemic strains is of great concern in public health. However, the diversity of species found in the natural environment remains unknown. The aim of this study was to investigate the diversity of Salmonella strains isolated from different natural aquatic systems within a Mediterranean coastal watershed (river, wastewater, and marine coastal areas). A total of 574 strains isolated from these natural environments were identified by both conventional serotyping and the ribosomal spacer-heteroduplex polymorphism (RS-HP) method (M. A. Jensen and N. Straus, PCR Methods Appl. 3:186–194, 1993). More than 40 different serotypes were found, and some serotypes probably mobilized from widespread animal-rearing activities were detected only during storm events. These serotypes may be good indicators of specific contamination sources. Furthermore, the RS-HP method based on the PCR amplification of the intergenic spacer region between the 16S and 23S rRNA genes can produce amplicon profiles allowing the discrimination of species at both serotype and intraserotype levels. This method represents a powerful tool that could be used for rapid typing of Salmonella isolates. PMID:10742240

  4. Diversity of Salmonella strains isolated from the aquatic environment as determined by serotyping and amplification of the ribosomal DNA spacer regions.

    PubMed

    Baudart, J; Lemarchand, K; Brisabois, A; Lebaron, P

    2000-04-01

    Salmonella species are pathogenic bacteria often detected in sewage, freshwater, marine coastal water, and groundwater. Salmonella spp. can survive for long periods in natural waters, and the persistence of specific and epidemic strains is of great concern in public health. However, the diversity of species found in the natural environment remains unknown. The aim of this study was to investigate the diversity of Salmonella strains isolated from different natural aquatic systems within a Mediterranean coastal watershed (river, wastewater, and marine coastal areas). A total of 574 strains isolated from these natural environments were identified by both conventional serotyping and the ribosomal spacer-heteroduplex polymorphism (RS-HP) method (M. A. Jensen and N. Straus, PCR Methods Appl. 3:186-194, 1993). More than 40 different serotypes were found, and some serotypes probably mobilized from widespread animal-rearing activities were detected only during storm events. These serotypes may be good indicators of specific contamination sources. Furthermore, the RS-HP method based on the PCR amplification of the intergenic spacer region between the 16S and 23S rRNA genes can produce amplicon profiles allowing the discrimination of species at both serotype and intraserotype levels. This method represents a powerful tool that could be used for rapid typing of Salmonella isolates.

  5. Molecular identification of isolated fungi from unopened containers of greek yogurt by DNA sequencing of internal transcribed spacer region.

    PubMed

    Sulaiman, Irshad M; Jacobs, Emily; Simpson, Steven; Kerdahi, Khalil

    2014-06-25

    In our previous study, we described the development of an internal transcribed spacer (ITS)1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli) causing foodborne disease in humans, and found negative for all of them.

  6. Additional data for a new Theileria sp. from China based on the sequences of ribosomal RNA internal transcribed spacers.

    PubMed

    Liu, Junlong; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Ma, Miling; Bai, Qi; Yin, Hong; Luo, Jianxun

    2013-02-01

    Theileria sinensis was recently isolated and named as an independent Theileria species that infects cattle in China. To date, this parasite has been described based on its morphology, transmission and molecular studies, indicating that it should be classified as a distinct species. To test the validity of this taxon, the two internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene were cloned and sequenced from three T. sinensis isolates. The complete ITS sequences were compared with those of other Theileria sp. available in GenBank. Phylogenetic analyses based on sequence data for the complete ITS sequences indicate that T. sinensis lies in a distinct clade that is separate from that of T. buffeli/orientalis and T. annulata. Sequence comparisons indicate that different T. sinensis isolates possess unique sizes of ITS1 and ITS2 as well as species-specific nucleotide sequences. This analysis provides new molecular data to support the classification of T. sinensis as a distinct species from other known Theileria spp. based on ITS sequences.

  7. Identification of internal transcribed spacer sequence motifs in truffles: a first step toward their DNA bar coding.

    PubMed

    El Karkouri, Khalid; Murat, Claude; Zampieri, Elisa; Bonfante, Paola

    2007-08-01

    This work presents DNA sequence motifs from the internal transcribed spacer (ITS) of the nuclear rRNA repeat unit which are useful for the identification of five European and Asiatic truffles (Tuber magnatum, T. melanosporum, T. indicum, T. aestivum, and T. mesentericum). Truffles are edible mycorrhizal ascomycetes that show similar morphological characteristics but that have distinct organoleptic and economic values. A total of 36 out of 46 ITS1 or ITS2 sequence motifs have allowed an accurate in silico distinction of the five truffles to be made (i.e., by pattern matching and/or BLAST analysis on downloaded GenBank sequences and directly against GenBank databases). The motifs considered the intraspecific genetic variability of each species, including rare haplotypes, and assigned their respective species from either the ascocarps or ectomycorrhizas. The data indicate that short ITS1 or ITS2 motifs (< or = 50 bp in size) can be considered promising tools for truffle species identification. A dot blot hybridization analysis of T. magnatum and T. melanosporum compared with other close relatives or distant lineages allowed at least one highly specific motif to be identified for each species. These results were confirmed in a blind test which included new field isolates. The current work has provided a reliable new tool for a truffle oligonucleotide bar code and identification in ecological and evolutionary studies. PMID:17601808

  8. Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

    PubMed Central

    Sulaiman, Irshad M.; Jacobs, Emily; Simpson, Steven; Kerdahi, Khalil

    2014-01-01

    In our previous study, we described the development of an internal transcribed spacer (ITS)1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli) causing foodborne disease in humans, and found negative for all of them. PMID:25438008

  9. Preliminary analysis and design optimization of the short spacer truss of Space Station Freedom

    NASA Technical Reports Server (NTRS)

    Gendy, A. S.; Patnaik, S. N.; Hopkins, D. A.; Berke, L.

    1993-01-01

    The analysis, dynamic simulation, and design optimization of the short spacer truss of the Space Station Freedom are presented in this report. The short spacer truss will be positioned between the integrated equipment assembly (IEA) and another truss, called the long spacer truss, in the Space Station Freedom. During its launch in the Space Shuttle, the truss will be subjected to considerable in-span distributed inertia loads due to shuttle accelerations. The short spacer truss, therefore, has been modeled as a space frame to account for flexural response. Several parameters have been assumed, since the design specifications are in the process of development; hence the results presented should be considered preliminary. However, the automated analysis and design capabilities that have been developed can readily be used to generate an optimum design of the short spacer truss once the actual specifications have been determined. This report includes static and dynamic analyses of the short spacer truss, which have been obtained with the linear elastic code LE-HOST (in these analyses, LE-HOST data files have been automated to facilitate their future use for different design specifications of the short spacer truss); the dynamic animation of the short spacer truss, which has been carried out by using the results of the dynamic analysis and a post-processing feature of the modeling code PATRAN; and the optimum-weight design of the spacer truss, which was obtained under prescribed stress, displacement, and frequency constraints by using the design code COMETBOARDS. Examination of the analysis and design results revealed that the design could be improved if the configuration of the short spacer truss were modified to a certain extent. A modified configuration, which may simplify fabrication, has been suggested. The performance of this configuration has been evaluated and was found to be satisfactory under both static and dynamic conditions.

  10. Polyetheretherketone (PEEK) Spacers for Anterior Cervical Fusion: A Retrospective Comparative Effectiveness Clinical Trial

    PubMed Central

    Lemcke, Johannes; Al-Zain, Ferass; Meier, Ullrich; Suess, Olaf

    2011-01-01

    Background: Anterior cervical decompression and fusion (ACDF) is the standard surgical treatment for radiculopathy and myelopathy. Polyetheretherketone (PEEK) has an elasticity similar to bone and thus appears well suited for use as the implant in ACDF procedures. The aim of this study is to examine the clinical and radiographic outcome of patients treated with standing alone PEEK spacers without bone morphogenic protein (BMP) or plating and to examine the influence of the different design of the two spacers on the rate of subsidence and dislocation. Methods: This retrospective comparative study reviewed 335 patients treated by ACDF in a specialized urban hospital for radiculopathy or myelopathy due to degenerative pathologies. The Intromed PEEK spacer was used in 181 patients from 3/2002 to 11/2004, and the AMT SHELL spacer was implanted in 154 patients from 4/2004 to 12/2007. The follow-up rate was 100% at three months post-op and 82.7% (277 patients) at one year. The patients were assessed with the Japanese Orthopedic Association (JOA) questionnaire and radiographically. Results: At the one-year follow-up there were 118/277 patients with an excellent clinical outcome on the JOA, 112/277 with a good outcome, 20/277 with a fair outcome, and 27/277 with a poor outcome. Subsidence was observed in 13.3% of patients with the Intromed spacer vs 8.4% of the patients with the AMT SHELL. Dislocation of the spacer was observed in 10 of the 181 patients with Intromed spacers but in none of the 154 patients with Shell spacers. Conclusion: The study demonstrates that ACDF with standing alone PEEK cages leads to excellent and good clinical outcomes. The differences we observed in the subsidence rate between the two spacers were not significant and cannot be related to a single design feature of the spacers. PMID:22016753

  11. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  12. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    PubMed Central

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  13. [Interspecific hybridization in the genus Paeonia (Paeoniaceae): polymorphic sites in transcribed spacers of the 45S rRNA genes as indicators of natural and artificial peony hybrids].

    PubMed

    Punina, E O; Machs, E M; Krapivskaia, E E; Kim, E S; Mordak, E V; Miakoshina, Iu A; Rodionov, A V

    2012-07-01

    The ITS1-5.8S rDNA-ITS2 regions of 33 accessions belonging to 16 species and five natural and garden interspecific hybrids of the genus Paeonia L. were sequenced. Chromatograms of the peony hybrids demonstrated the presence of the signals, corresponding to two different nucleotides at the positions differing in the parents, indicating that in the hybrids, no rDNA isogenization usually occurred, and they preserved rDNA of both parents. Analysis of these polymorphic sites (PS) showed that P. x majkoae was interspecific hybrid between P. tenuifolia and P. caucasica. The ITS of P. hybrida differs from ITS of P. x majkoae in 19 mutations. Because of this, P. x majkoae is definitely not synonymous to P. hybrida. Comparative analysis of ITS 1-5.8S rDNA-ITS2 showed that species diversity in section Paeonia was based on recombination as a result of intraspecific hybridization of three haplotype families. Specifically, haplotypes A, typical of the P. tenuifolia and P. anomala genomes, haplotypes B, typical of P. mlokosewitschii and P. obovata, and haplotypes of family C, currently represented in rDNA of diploid and tetraploid forms of some Caucasian and Mediterranean species. The ITS regions many diploid peonies contain no dimorphic sites, while P. oreogeton, P. cambessedesii, P. rhodia, and P. daurica carry from ten to 17 PS, and supposed to be the interspecific hybrids. Most of the tetraploid peonies contain from six to 18 PS in the ITS regions. These are alloploids with one of the parental genomes similar to that of P. mlokosewitschii (B1), or P. obovata (B3). The second parental genome in P. banatica, P. peregrina, and P. russii is represented by the genome, close to that of P. tenuifolia (A). P. macrophylla, P. mascula, P. coriacea, P. wittmanniana, and P. tomentosa carry genome of series B and genome of series C, which slightly resembles genome A.

  14. Molecular Characterization and Phylogeny of a Phytoplasma Associated with Phyllody Disease of toria (Brassica rapa L. subsp. dichotoma (Roxb.)) in India.

    PubMed

    Azadvar, M; Baranwal, V K

    2010-10-01

    Samples from toria plants (Brassica rapa L. subsp. dichotoma (Roxb.)) exhibiting phyllody, virescence, witches broom, extensive malformation of floral parts, formation of bladder like siliquae and flower sterility were collected from four different locations in India. Sequencing and phylogenetic analysis of the 16S rRNA, a part of 23S rRNA, partial sec A genes, rp gene and 16S-23S intergenic spacer region indicated that the phytoplasmas associated with toria phyllody (TP) symptoms were identical and belonged to 16SrIX phytoplasma Pigeon pea witches'-broom (PPWB) group. The iPhyClassifier generated virtual RFLP pattern of 1.25 kb 16S rDNA sequences indicated that TP phytoplasma belongs to 16SrIX-C phytoplasma subgroup. Complete 23S rRNA gene of TP phytoplasma had 2,787 nucleotides and is the first sequence of 16SrIX phytoplasma group. Restriction digestion of 16S rDNA and 23S rDNA PCR products has also shown that TP phytoplasmas from all the four locations in India were identical. Toria is a previously unreported host for a phytoplasma in16SrIX-C subgroup.

  15. High temporal but low spatial heterogeneity of bacterioplankton in the Chesapeake Bay.

    PubMed

    Kan, Jinjun; Suzuki, Marcelino T; Wang, Kui; Evans, Sarah E; Chen, Feng

    2007-11-01

    Compared to freshwater and the open ocean, less is known about bacterioplankton community structure and spatiotemporal dynamics in estuaries, particularly those with long residence times. The Chesapeake Bay is the largest estuary in the United States, but despite its ecological and economic significance, little is known about its microbial community composition. A rapid screening approach, ITS (internal transcribed spacer)-LH (length heterogeneity)-PCR, was used to screen six rRNA operon (16S rRNA-ITS-23S rRNA) clone libraries constructed from bacterioplankton collected in three distinct regions of the Chesapeake Bay over two seasons. The natural length variation of the 16S-23S rRNA gene ITS region, as well as the presence and location of tRNA-alanine coding regions within the ITS, was determined for 576 clones. Clones representing unique ITS-LH-PCR sizes were sequenced and identified. Dramatic shifts in bacterial composition (changes within subgroups or clades) were observed for the Alphaproteobacteria (Roseobacter clade, SAR11), Cyanobacteria (Synechococcus), and Actinobacteria, suggesting strong seasonal variation within these taxonomic groups. Despite large gradients in salinity and phytoplankton parameters, a remarkably homogeneous bacterioplankton community was observed in the bay in each season. Stronger seasonal, rather than spatial, variation of the bacterioplankton population was also supported by denaturing gradient gel electrophoresis and LH-PCR analyses, indicating that environmental parameters with stronger seasonal, rather than regional, dynamics, such as temperature, might determine bacterioplankton community composition in the Chesapeake Bay.

  16. Enhancing ligand-protein binding in affinity thermoprecipitation: elucidation of spacer effects

    PubMed

    Vaidya; Lele; Kulkarni; Mashelkar

    1999-08-20

    Copolymers of N-isopropylacrylamide and N-acryloyl amino acid spacers of varying chain length were synthesized. p-Aminobenzamidine (PABA) was chemically linked to the pendant carboxyl groups of these polymers to obtain thermoprecipitating affinity polymers. The inhibition constant (Ki) of these polymers for trypsin decreased, i. e., the efficiency of PABA-trypsin binding increased with increase in the spacer chain length. The polymer to which PABA was linked through a spacer of five methylene groups exhibited eleven times lower Ki than that of the polymer containing PABA without a spacer. Investigations on model inhibitors N-acyl-p-aminobenzamidines showed that this enhancement in trypsin binding by the polymers was due to the spacer as well as to microenvironmental effects. Recovery and specific activity of the trypsin recovered increased with the spacer chain length. Separation of trypsin from a mixture of trypsin and chymotrypsin was also enhanced with the spacer chain length. The inhibition constants of these affinity polymers were not adversely affected by the crowding effect. Copyright 1999 John Wiley & Sons, Inc. PMID:10397880

  17. Impact Analysis and Test for the Spacer Grid Assembly of a Nuclear Fuel Assembly

    NASA Astrophysics Data System (ADS)

    Song, Kee-Nam; Lee, Sang-Hoon; Lee, Soo-Bum

    A spacer grid assembly is one of the main structural components of the nuclear fuel assembly for a Pressurized light Water Reactor (PWR). The spacer grid assembly supports and aligns the fuel rods, guides the fuel assemblies past each other during a handling and, if needed, sustains lateral seismic loads. The ability of a spacer grid assembly to resist these lateral loads is usually characterized in terms of its dynamic and static crush strengths, which are acquired from tests. In this study, a finite element analysis on the dynamic crush strength of spacer grid assembly specimens is carried out. Comparisons show that the analysis results are in good agreement with the test results to within about a 30 % difference range. Therefore, we could predict the crush strength of a spacer grid assembly in advance, before performing a dynamic crush test. And also a parametric study on the crush strength of a spacer grid assembly is carried out by adjusting the weld penetration depth for a sub-sized spacer grid, which also shows a good agreement between the test and analysis results.

  18. Biofouling of spiral-wound nanofiltration and reverse osmosis membranes: a feed spacer problem.

    PubMed

    Vrouwenvelder, J S; Graf von der Schulenburg, D A; Kruithof, J C; Johns, M L; van Loosdrecht, M C M

    2009-02-01

    Biofouling was studied in full-scale and pilot-scale installations, test-rigs and membrane fouling monitors by conventional methods as well as Magnetic Resonance Imaging (MRI). Independent of permeate production, the feed spacer channel pressure drop and biomass concentration increased similarly in a nanofiltration pilot installation. In the presence of a feed spacer the absolute feed channel pressure drop increase caused by biomass accumulation was much higher than when a feed spacer was absent: in both spiral-wound nanofiltration and reverse osmosis systems biofouling is dominantly a feed spacer problem. This conclusion is based on (i) in-situ visual observations of the fouling accumulation, (ii) in-situ non-destructive observations of the fouling accumulation and velocity distribution profiles using MRI, and (iii) differences in pressure drop and biomass development in monitors with and without feed spacer. MRI studies showed that even a restricted biofilm accumulation on the feed channel spacer influenced the velocity distribution profile strongly. Biofouling control should be focused on the development of low fouling feed spacers and hydrodynamic conditions to restrict the impact of biomass accumulation on the feed channel pressure drop increase.

  19. Differential gene expression in Neurospora crassa cell types: heterogeneity and multiple copies of rRNA genes. Annual progress report, July 1981-June 1982

    SciTech Connect

    Dutta, S.K.

    1982-01-01

    The significant results obtained were as follows: (I) Multiple copies of isolated rRNA genes from N. crassa were tested for heterogeneity by rRNA: rDNA reassociation kinetics. More than 90% of rDNA copies were identical. The possible heterogeneity of a small fraction of rDNAs could not be attributed to inclusion of any tDNA sequences. (II) Two approaches to study gross differences between rRNA genes from N. crassa cell types-conidia, germinated conidia, and mycelia were undertaken. No difference was seen in either the restriction patterns nor the autoradiographs. Either gross differences between rDNAS of N. crassa cell types were not present or they were not detected by these two approaches. (III) Using similar DNA restriction analysis procedures, differences between closely related heterothallic and homothallic species of Neurospora were detected. (IV) Successful sequencing of 317 bases of the N. crassa slime mutant pMF2 clone which includes the 5.8S rDNA and it's flanking internal spacer regions was achieved. (ERB)

  20. Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana.

    PubMed

    Sikorski, Pawel J; Zuber, Hélène; Philippe, Lucas; Sement, François M; Canaday, Jean; Kufel, Joanna; Gagliardi, Dominique; Lange, Heike

    2015-09-01

    The biosynthesis of ribosomal RNA and its incorporation into functional ribosomes is an essential and intricate process that includes production of mature ribosomal RNA from large precursors. Here, we analyse the contribution of the plant exosome and its co-factors to processing and degradation of 18S pre-RNAs in Arabidopsis thaliana. Our data show that, unlike in yeast and humans, an RRP6 homologue, the nucleolar exoribonuclease RRP6L2, and the exosome complex, together with RRP44, function in two distinct steps of pre-18S rRNA processing or degradation in Arabidopsis. In addition, we identify TRL (TRF4/5-like) as the terminal nucleotidyltransferase that is mainly responsible for oligoadenylation of rRNA precursors in Arabidopsis. We show that TRL is required for efficient elimination of the excised 5' external transcribed spacer and of 18S maturation intermediates that escaped 5' processing. Our data also suggest involvement of additional nucleotidyltransferases, including terminal uridylyltransferase(s), in modifying rRNA processing intermediates in plants.

  1. Application of nanosilver surface modification to RO membrane and spacer for mitigating biofouling in seawater desalination.

    PubMed

    Yang, Hui-Ling; Lin, Justin Chun-Te; Huang, Chihpin

    2009-08-01

    Biofouling is one the most critical problems in seawater desalination plants and science has not yet found effective ways to control it. Silver compounds and ions are historically recognized for their effective antimicrobial activity. Nanosilver particles have been applied as a biocide in many aspects of disinfection, including healthcare products and water treatment. This study proposes an innovative biofouling control approach by surface modification of the RO membrane and spacer with nanosilver coating. A chemical reduction method was used for directly coating nanosilver particles on the membrane sheet and spacer. The surface-modified membrane and spacer were tested for their antifouling performance in a cross-flow flat-sheet membrane cell, which is a part of a pilot plant in Wukan desalination plant. The silver-coating membranes and spacers, along with an unmodified membrane sheet, were tested in the membrane cell and compared on the basis of their antifouling performance. Permeate flux decline and salt rejection was continuously monitored through the testing period. Meanwhile regrowth of microbial populations on the membrane cell was quantified by a unique microbial counting every three to four days. The results showed that both silver-coated membrane (Ag-cM) with uncoated spacer and silver-coated spacer (Ag-cS) with uncoated membrane performed better than the unmodified membrane and spacer (Un-MS), in terms of much slower decrease in permeate flux and TDS rejection. However, the effect of silver-coated spacer on antimicrobial activity was more lasting. In the silver-coated spacer test, there was almost no multiplication of cells detected on the membrane during the whole testing period. Besides, the cells adhering to the membrane seemed to lose their activity quickly. According to the RO performance and microbial growth morphology, the nanosilver coating technology is valuable for use in biofouling control in seawater desalination.

  2. Modulation of porphyrin photoluminescence by nanoscale spacers on silicon substrates

    NASA Astrophysics Data System (ADS)

    Fang, Y. C.; Zhang, Y.; Gao, H. Y.; Chen, L. G.; Gao, B.; He, W. Z.; Meng, Q. S.; Zhang, C.; Dong, Z. C.

    2013-11-01

    We investigate photoluminescence (PL) properties of quasi-monolayered tetraphenyl porphyrin (TPP) molecules on silicon substrates modulated by three different nanoscale spacers: native oxide layer (NOL), hydrogen (H)-passivated layer, and Ag nanoparticle (AgNP) thin film, respectively. In comparison with the PL intensity from the TPP molecules on the NOL-covered silicon, the fluorescence intensity from the molecules on the AgNP-covered surface was greatly enhanced while that for the H-passivated surface was found dramatically suppressed. Time-resolved fluorescence spectra indicated shortened lifetimes for TPP molecules in both cases, but the decay kinetics is believed to be different. The suppressed emission for the H-passivated sample was attributed to the weaker decoupling effect of the monolayer of hydrogen atoms as compared to the NOL, leading to increased nonradiative decay rate; whereas the enhanced fluorescence with shortened lifetime for the AgNP-covered sample is attributed not only to the resonant excitation by local surface plasmons, but also to the increased radiative decay rate originating from the emission enhancement in plasmonic "hot-spots".

  3. Augmented Fixation With Biodegradable Subacromial Spacer After Repair of Massive Rotator Cuff Tear

    PubMed Central

    Bozkurt, Murat; Akkaya, Mustafa; Gursoy, Safa; Isik, Cetin

    2015-01-01

    Unsuccessful outcomes after repair of massive rotator cuff ruptures accompanied by muscle atrophy and fatty degeneration are frequently associated with inadequate management and secondary tears. We report the functional differences after rotator cuff rupture repair with a biodegradable spacer application. In these patients, rotator cuff rupture repair should provide coverage of the humeral head. Subsequently, acromioplasty should be performed to allow adequate space for the subacromial spacer. Thereafter measurement of the intra-articular space required for application of the biodegradable spacer is performed. Using this method can decrease the rate of tears by providing a safe subacromial space in cases of massive rotator cuff rupture. PMID:26697306

  4. Optimization of Radiation Therapy Techniques for Prostate Cancer With Prostate-Rectum Spacers: A Systematic Review

    SciTech Connect

    Mok, Gary; Benz, Eileen; Vallee, Jean-Paul; Miralbell, Raymond; Zilli, Thomas

    2014-10-01

    Dose-escalated radiation therapy for localized prostate cancer improves disease control but is also associated with worse rectal toxicity. A spacer placed between the prostate and rectum can be used to displace the anterior rectal wall outside of the high-dose radiation regions and potentially minimize radiation-induced rectal toxicity. This systematic review focuses on the published data regarding the different types of commercially available prostate-rectum spacers. Dosimetric results and preliminary clinical data using prostate-rectum spacers in patients with localized prostate cancer treated by curative radiation therapy are compared and discussed.

  5. Experimental Study of Two Phase Flow Behavior Past BWR Spacer Grids

    SciTech Connect

    Ratnayake, Ruwan K.; Hochreiter, L.E.; Ivanov, K.N.; Cimbala, J.M.

    2002-07-01

    Performance of best estimate codes used in the nuclear industry can be significantly improved by reducing the empiricism embedded in their constitutive models. Spacer grids have been found to have an important impact on the maximum allowable Critical Heat Flux within the fuel assembly of a nuclear reactor core. Therefore, incorporation of suitable spacer grids models can improve the critical heat flux prediction capability of best estimate codes. Realistic modeling of entrainment behavior of spacer grids requires understanding the different mechanisms that are involved. Since visual information pertaining to the entrainment behavior of spacer grids cannot possibly be obtained from operating nuclear reactors, experiments have to be designed and conducted for this specific purpose. Most of the spacer grid experiments available in literature have been designed in view of obtaining quantitative data for the purpose of developing or modifying empirical formulations for heat transfer, critical heat flux or pressure drop. Very few experiments have been designed to provide fundamental information which can be used to understand spacer grid effects and phenomena involved in two phase flow. Air-water experiments were conducted to obtain visual information on the two-phase flow behavior both upstream and downstream of Boiling Water Reactor (BWR) spacer grids. The test section was designed and constructed using prototypic dimensions such as the channel cross-section, rod diameter and other spacer grid configurations of a typical BWR fuel assembly. The test section models the flow behavior in two adjacent sub channels in the BWR core. A portion of a prototypic BWR spacer grid accounting for two adjacent channels was used with industrial mild steel rods for the purpose of representing the channel internals. Symmetry was preserved in this practice, so that the channel walls could effectively be considered as the channel boundaries. Thin films were established on the rod surfaces

  6. Titanium-copper-nitride coated spacers for two-stage revision of infected total hip endoprostheses

    PubMed Central

    Ellenrieder, Martin; Haenle, Maximilian; Lenz, Robert; Bader, Rainer; Mittelmeier, Wolfram

    2011-01-01

    Within the first two years after total hip arthroplasty implant-associated infection has become the second most common reason for a revision surgery. Two-stage implant exchange is frequently conducted using temporary spacers made of antibiotic-loaded cement in order to prevent a bacterial colonization on the spacer. Avoiding several disadvantages of cement spacers, a conventional hemi-endoprosthesis was equipped with a copper-containing implant coating for inhibition of bacterial biofilms. In the present paper details of this novel treatment concept are presented including a case report. PMID:22242097

  7. Apparatus and methods for aligning holes through wheels and spacers and stacking the wheels and spacers to form a turbine rotor

    DOEpatents

    Berry, Robert Randolph; Palmer, Gene David; Wilson, Ian David

    2000-01-01

    A gas turbine rotor stacking fixture includes upstanding bolts for reception in aligned bolt holes in superposed aft disk, wheels and spacers and upstanding alignment rods received in openings of the disk, wheels and spacers during the rotor stacking assembly. The axially registering openings enable insertion of thin-walled tubes circumferentially about the rim of the rotor, with tight tolerances to the openings to provide supply and return steam for cooling buckets. The alignment rods have radial dimensions substantially less than their dimensions in a circumferential direction to allow for radial opening misalignment due to thermal expansion, tolerance stack-up and wheel-to-spacer mismatch due to rabbet mechanical growth. The circumferential dimension of the alignment rods affords tightly toleranced alignment of the openings through which the cooling tubes are installed.

  8. A Real-Time PCR Method for Quantifying Viable Ascaris Eggs Using the First Internally Transcribed Spacer Region of Ribosomal DNA▿

    PubMed Central

    Pecson, Brian M.; Barrios, José Antonio; Johnson, David R.; Nelson, Kara L.

    2006-01-01

    Worldwide, 1.4 billion people are infected with the intestinal worm Ascaris lumbricoides. As a result, Ascaris eggs are commonly found in wastewater and sludges. The current microscopy method for detecting viable Ascaris eggs is time- and labor-intensive. The goal of this study was to develop a real-time quantitative PCR (qPCR) method to determine the levels of total and viable Ascaris eggs in laboratory solutions using the first internally transcribed spacer (ITS-1) region of ribosomal DNA (rDNA) and rRNA. ITS-1 rDNA levels were proportional to Ascaris egg cell numbers, increasing as eggs developed from single cells to mature larvae and ultimately reaching a constant level per egg. Treatments causing >99% inactivation (high heat, moderate heat, ammonia, and UV) eliminated this increase in ITS-1 rDNA levels and caused decreases that were dependent on the treatment type. By taking advantage of this difference in ITS-1 rDNA level between viable, larvated eggs and inactivated, single-celled eggs, qPCR results were used to develop inactivation profiles for the different treatments. No statistical difference from the standard microscopy method was found in 75% of the samples (12 of 16). ITS-1 rRNA was detected only in samples containing viable eggs, but the levels were more variable than rDNA levels and ITS-1 rRNA could not be used for quantification. The detection limit of the rDNA-based method was approximately one larvated egg or 90 single-celled eggs; the detection limit for the rRNA-based method was several orders of magnitude higher. The rDNA qPCR method is promising for both research and regulatory applications. PMID:17056687

  9. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  10. Method of forming a spacer for field emission flat panel displays

    SciTech Connect

    Bernhardt, A.F.; Contolini, R.J.

    1997-08-19

    Spacers are disclosed for applications such as field emission flat panel displays and vacuum microelectronics, and which involves the application of aerogel/xerogel technology to the formation of the spacer. In a preferred approach the method uses a mold and mold release agent wherein the gel precursor is a liquid which can be applied to the mold filling holes which expose the substrate (either the baseplate or the faceplate). A release agent is applied to the mold prior to precursor application to ease removal of the mold after formation of the dielectric spacer. The shrinkage of the gel during solvent extraction also improves mold removal. The final spacer material is a good dielectric, such as silica, secured to the substrate. 3 figs.

  11. Method of forming a spacer for field emission flat panel displays

    DOEpatents

    Bernhardt, Anthony F.; Contolini, Robert J.

    1997-01-01

    Spacers for applications such as field emission flat panel displays and vacuum microelectronics, and which involves the application of aerogel/xerogel technology to the formation of the spacer. In a preferred approach the method uses a mold and mold release agent wherein the gel precursor is a liquid which can be applied to the mold filling holes which expose the substrate (either the baseplate or the faceplate). A release agent is applied to the mold prior to precursor application to ease removal of the mold after formation of the dielectric spacer. The shrinkage of the gel during solvent extraction also improves mold removal. The final spacer material is a good dielectric, such as silica, secured to the substrate.

  12. CRISPR Spacer Arrays for Detection of Viral Signatures from Acidic Hot Springs

    NASA Astrophysics Data System (ADS)

    Snyder, J. C.; Bateson, M. M.; Suciu, D.; Young, M. J.

    2010-04-01

    Viruses are the most abundant life-like entities on the planet Earth. Using CRISPR spacer sequences, we have developed a microarray-based approach to detecting viral signatures in the acidic hot springs of Yellowstone.

  13. Spacer geometry and particle deposition in spiral wound membrane feed channels.

    PubMed

    Radu, A I; van Steen, M S H; Vrouwenvelder, J S; van Loosdrecht, M C M; Picioreanu, C

    2014-11-01

    Deposition of microspheres mimicking bacterial cells was studied experimentally and with a numerical model in feed spacer membrane channels, as used in spiral wound nanofiltration (NF) and reverse osmosis (RO) membrane systems. In-situ microscopic observations in membrane fouling simulators revealed formation of specific particle deposition patterns for different diamond and ladder feed spacer orientations. A three-dimensional numerical model combining fluid flow with a Lagrangian approach for particle trajectory calculations could describe very well the in-situ observations on particle deposition in flow cells. Feed spacer geometry, positioning and cross-flow velocity sensitively influenced the particle transport and deposition patterns. The deposition patterns were not influenced by permeate production. This combined experimental-modeling approach could be used for feed spacer geometry optimization studies for reduced (bio)fouling.

  14. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  15. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  16. Accurate, rapid taxonomic classification of fungal large-subunit rRNA genes.

    PubMed

    Liu, Kuan-Liang; Porras-Alfaro, Andrea; Kuske, Cheryl R; Eichorst, Stephanie A; Xie, Gary

    2012-03-01

    Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project.

  17. Magnetic properties of exchange-coupled PtFe/Fe films with spacer layers

    NASA Astrophysics Data System (ADS)

    Cui, W. B.; Liu, W.; Yang, F.; Li, D.; Delikanli, S.; Guo, S.; Gong, W. J.; Zhang, Z. D.

    2011-04-01

    The exchange coupling between PtFe and Fe in PtFe/Fe films with Cr2O3 or Cr2O3/Cu spacer layers is indirect and long range. Microstructures of as-deposited and annealed thin films are studied. Coercivity over 10 kOe is obtained in PtFe/Cr2O3(5 Å)/Fe(25 Å) films but decrease with thicker Cr2O3 spacer layer. Comparably, coercivity can be maintained at about 10 kOe if spacer layer is changed into Cr2O3(x Å)/Cu(5 Å) (5 Å ≤ x ≤ 25 Å). For a fixed total thickness of the spacer layers, the coercivity generally decreases with gradual replacement of Cr2O3 by Cu, indicating the different effects of spacer layers on mediating the exchange coupling between PtFe and Fe. Using Cr2O3 or Cr2O3/Cu as a spacer layer is a promising way for realizing exchange-coupled PtFe/Fe composite films.

  18. The nonsignaling extracellular spacer domain of chimeric antigen receptors is decisive for in vivo antitumor activity.

    PubMed

    Hudecek, Michael; Sommermeyer, Daniel; Kosasih, Paula L; Silva-Benedict, Anne; Liu, Lingfeng; Rader, Christoph; Jensen, Michael C; Riddell, Stanley R

    2015-02-01

    The use of synthetic chimeric antigen receptors (CAR) to redirect T cells to recognize tumor provides a powerful new approach to cancer immunotherapy; however, the attributes of CARs that ensure optimal in vivo tumor recognition remain to be defined. Here, we analyze the influence of length and composition of IgG-derived extracellular spacer domains on the function of CARs. Our studies demonstrate that CD19-CARs with a long spacer from IgG4 hinge-CH2-CH3 are functional in vitro but lack antitumor activity in vivo due to interaction between the Fc domain within the spacer and the Fc receptor-bearing myeloid cells, leading to activation-induced T-cell death. We demonstrate that in vivo persistence and antitumor effects of CAR-T cells with a long spacer can be restored by modifying distinct regions in the CH2 domain that are essential for Fc receptor binding. Our studies demonstrate that modifications that abrogate binding to Fc receptors are crucial for CARs in which a long spacer is obligatory for tumor recognition as shown here for a ROR1-specific CAR. These results demonstrate that the length and composition of the extracellular spacer domain that lacks intrinsic signaling function can be decisive in the design of CARs for optimal in vivo activity.

  19. The Effect of Spacer Morphology on the Aerosolization Performance of Metered-Dose Inhalers

    PubMed Central

    Momeni, Sepideh; Nokhodchi, Ali; Ghanbarzadeh, Saeed; Hamishehkar, Hamed

    2016-01-01

    Purpose: Respiratory drug delivery has been attracted great interest for the past decades, because of the high incidence of pulmonary diseases. However, despite its invaluable benefits, there are some major drawbacks in respiratory drug delivery, mainly due to the relatively high drug deposition in undesirable regions. One way to improve the efficiency of respiratory drug delivery through metered-dose inhalers (MDI) is placing a respiratory spacer between the inhaler exit and the mouth. The aim of this study was to assess the effect of type and shape of spacer on the aerosolization performance of MDIs. Methods: A commercial Beclomethasone Dipropionate (BDP) MDI alone or equipped with two different spacer devices (roller and pear type) widely distributed in the world pharmaceutical market was used. The effect of spacers was evaluated by calculating aerosolization indexes such as fine particle fraction (FPF), mass median aerodynamic diameters (MMAD) and geometric standard deviation (GSD) using the next generation impactor. Results: Although one of the spacers resulted in superior outcomes than the other one, but it was not statistically significant. Conclusion: The results confirmed that the type and shape of spacer did not substantially influence the aerosolization performance of MDIs. PMID:27478789

  20. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  1. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

    PubMed

    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  2. Structure and comparative analysis of the rDNA intergenic spacer of Brassica rapa. Implications for the function and evolution of the Cruciferae spacer.

    PubMed

    Da Rocha, P S; Bertrand, H

    1995-04-15

    The sequence of the intergenic spacer (IGS) of the Brassica rapa rDNA was determined and compared with those of other Cruciferae species. In the 3012-bp IGS, two segments of mostly unique sequence flank a 1.5-kb region consisting of two tandem arrays of repeats. A putative transcription initiation site (TIS) was identified by sequence comparison, 395 bp downstream from the repeat region. The intercalating segment displays unusual sequence patterns, and modelling of its topology predicts intrinsically bent DNA, with two elements of bending centered at positions -118 and -288 relative to the TIS. Comparative analysis of spacers from Cruciferae, revealed a common organization and high sequence similarity in their 5' and, particularly, 3' regions, whereas the repeat region upstream of TIS diverges rapidly. The conservation of structural elements, including the bent DNA upstream from the TIS, is discussed in light of their possible involvement in the IGS functions and structure of spacers in common ancestors. Examination of the Cruciferae spacers shows that, in addition to unequal crossover and gene conversion, insertional mutagenesis and replication slippage are molecular mechanisms significantly contributing to their evolution.

  3. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  4. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  5. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    PubMed

    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk

    2015-01-01

    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  6. Effect of Varying Layers of Two Die Spacers on Precementation Space of Full Coverage Restorations.

    PubMed

    Mule, Shivkumar A; Dange, Shankar P; Khalikar, Arun N; Vaidya, Smita P

    2014-12-01

    The purpose of this study was to evaluate and compare the effect of varying layers of two commercially available die spacers on pre-cementation space of full coverage restorations in vitro and in vivo. Seven dies were prepared for each of 15 subjects. On three dies 1, 2, 3 layers of Pico-fit and on other three dies 1, 2, 3 layers of Yeti die spacers applied, wax pattern fabricated, invested and cast. Metal copings seated in vitro on die without die spacer and on prepared tooth of respective subject with fit-checker. Thickness of fit checker was measured using micrometer at mid-axial, mid-occlusal and near finish line locations that provided pre-cementation space. Result of ANOVA tests suggested significant difference among groups with varying layers. There was no significant difference between pre-cementation space achieved with Pico-fit and Yeti die spacers. The r values suggested positive correlation between the respective pair of in vivo and in vitro groups. (1) There was significant difference between pre-cementation space at mid-axial and mid-occlusal sites achieved with 1, 2 and 3 layers of die spacers except between 1 and 2 layers and 1 and 3 layers at mid-occlusal site. (2) Pre-cementation space achieved with Pico-fit and Yeti die spacers did not differ significantly for same location, layers and in vitro and in vivo. (3) Pre-cementation space achieved in vitro was analogous to pre-cementation space achieved in vivo for respective location, layers and die spacer.

  7. Effects of spacer chain length of amino acid-based gemini surfactants on wormlike micelle formation.

    PubMed

    Sakai, Kenichi; Nomura, Kazuyuki; Shrestha, Rekha Goswami; Endo, Takeshi; Sakamoto, Kazutami; Sakai, Hideki; Abe, Masahiko

    2014-01-01

    We studied the effects of the spacer chain length of amino acid-based gemini surfactants on the formation of wormlike micelles in aqueous solutions. The surfactants used were synthesized by reacting dodecanoylglutamic acid anhydride with diamine compounds (ethylenediamine, pentanediamine, and octanediamine), and were abbreviated as 12-GsG-12 (s: the spacer chain length of 2, 5, and 8 methylene units). These surfactants yielded viscoelastic wormlike micellar solutions at pH 9 upon mixing with a cationic monomeric surfactant, hexadecyltrimethylammonium bromide (HTAB). We found that the rheological behavior was strongly dependent on the spacer chain length and HTAB concentration. When the shortest spacer chain analogue (12-G2G-12) was used, an increased HTAB concentration resulted in the following structural transformations of the micelles: (i) spherical or rodlike micelles; (ii) anionic wormlike micelles exhibiting a transient network structure; (iii) anionic wormlike micelles with a micellar branching or interconnected structure; and (iv) cationic wormlike micelles. Similarly, when the middle spacer chain analogue (12-G5G-12) was used, a structural transformation from anionic to cationic wormlike micelles occurs; however, molecular aggregates with a lower positive curvature were also formed in this transition region. When the longest spacer analogue (12-G8G-12) was used, the formation of cation-rich molecular aggregates was not observed. These transition behaviors were attributed to the packing geometry of the gemini surfactants with HTAB. Additionally, as the spacer chain length increased, the zero-shear viscosity in the anionic wormlike micellar region decreased, suggesting limited one-dimensional micellar growth of spherical, rodlike, or anionic wormlike micelles.

  8. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  9. Microcosm enrichment of biphenyl-degrading microbial communities from soils and sediments

    SciTech Connect

    Wagner-Doebler, I.; Bennasar, A.; Stroempl, C.; Bruemmer, I.; Eichner, C.; Grammel, I.; Moore, E.R.B.; Vancanneyt, M.

    1998-08-01

    A microcosm enrichment approach was employed to isolate bacteria which are representative of long-term biphenyl-adapted microbial communities. Growth of microorganisms was stimulated by incubating soil and sediment samples from polluted and nonpolluted sites with biphenyl crystals. After 6 months, stable population densities between 8 {times} 10{sup 9} and 2 {times} 10{sup 11} CFU/ml were established in the microcosms, and a large percentage of the organisms were able to grow on biphenyl-containing minimal medium plates. A total of 177 biphenyl-degrading strains were subsequently isolated and characterized by their ability to grow on biphenyl in liquid culture and to accumulate a yellow meta cleavage product when they were sprayed with dihydroxy-biphenyl. Isolates were identified by using a polyphasic approach, including fatty acid methyl ester (FAME) analysis, 16S rRNA gene sequence comparison, sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, and genomic fingerprinting based on sequence variability in the 16S-23S ribosomal DNA intergenic spacer region. In all of the microcosms, isolates identified as Rhodococcus opacus dominated the cultivable microbial community, comprising a cluster of 137 isolates with very similar FAME profiles (Euclidean distances, <10) and identical 16S rRNA gene sequences.

  10. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    PubMed

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy. PMID:26203886

  11. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    PubMed

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

  12. Identification of acetic acid bacteria in traditionally produced vinegar and mother of vinegar by using different molecular techniques.

    PubMed

    Yetiman, Ahmet E; Kesmen, Zülal

    2015-07-01

    Culture-dependent and culture-independent methods were combined for the investigation of acetic acid bacteria (AAB) populations in traditionally produced vinegars and mother of vinegar samples obtained from apple and grape. The culture-independent denaturing gradient gel electrophoresis (DGGE) analysis, which targeted the V7-V8 regions of the 16S rRNA gene, showed that Komagataeibacter hansenii and Komagataeibacter europaeus/Komagataeibacter xylinus were the most dominant species in almost all of the samples analyzed directly. The culture-independent GTG5-rep PCR fingerprinting was used in the preliminary characterization of AAB isolates and species-level identification was carried out by sequencing of the 16S rRNA gene, 16S-23S rDNA internally transcribed to the spacer (ITS) region and tuf gene. Acetobacter okinawensis was frequently isolated from samples obtained from apple while K. europaeus was identified as the dominant species, followed by Acetobacter indonesiensis in the samples originating from grape. In addition to common molecular techniques, real-time PCR intercalating dye assays, including DNA melting temperature (Tm) and high resolution melting analysis (HRM), were applied to acetic acid bacterial isolates for the first time. The target sequence of ITS region generated species-specific HRM profiles and Tm values allowed discrimination at species level.

  13. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    PubMed

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  14. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    PubMed

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life. PMID:23316189

  15. Cyanobacterial diversity and a new acaryochloris-like symbiont from Bahamian sea-squirts.

    PubMed

    López-Legentil, Susanna; Song, Bongkeun; Bosch, Manel; Pawlik, Joseph R; Turon, Xavier

    2011-01-01

    Symbiotic interactions between ascidians (sea-squirts) and microbes are poorly understood. Here we characterized the cyanobacteria in the tissues of 8 distinct didemnid taxa from shallow-water marine habitats in the Bahamas Islands by sequencing a fragment of the cyanobacterial 16S rRNA gene and the entire 16S-23S rRNA internal transcribed spacer region (ITS) and by examining symbiont morphology with transmission electron (TEM) and confocal microscopy (CM). As described previously for other species, Trididemnum spp. mostly contained symbionts associated with the Prochloron-Synechocystis group. However, sequence analysis of the symbionts in Lissoclinum revealed two unique clades. The first contained a novel cyanobacterial clade, while the second clade was closely associated with Acaryochloris marina. CM revealed the presence of chlorophyll d (chl d) and phycobiliproteins (PBPs) within these symbiont cells, as is characteristic of Acaryochloris species. The presence of symbionts was also observed by TEM inside the tunic of both the adult and larvae of L. fragile, indicating vertical transmission to progeny. Based on molecular phylogenetic and microscopic analyses, Candidatus Acaryochloris bahamiensis nov. sp. is proposed for this symbiotic cyanobacterium. Our results support the hypothesis that photosymbiont communities in ascidians are structured by host phylogeny, but in some cases, also by sampling location.

  16. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with descriptions of three new species.

    PubMed

    Johansen, Jeffrey R; Bohunická, Markéta; Lukešová, Alena; Hrčková, Kristýna; Vaccarino, Melissa A; Chesarino, Nicholas M

    2014-02-01

    Twenty-six strains morphologically identified as Cylindrospermum as well as the closely related taxon Cronbergia siamensis were examined microscopically as well as phylogenetically using sequence data for the 16S rRNA gene and the 16S-23S internal transcribed spacer (ITS) region. Phylogenetic analysis of the 16S rRNA revealed three distinct clades. The clade we designate as Cylindrospermum sensu stricto contained all five of the foundational species, C. maius, C. stagnale, C. licheniforme, C. muscicola, and C. catenatum. In addition to these taxa, three species new to science in this clade were described: C. badium, C. moravicum, and C. pellucidum. Our evidence indicated that Cronbergia is a later synonym of Cylindrospermum. The phylogenetic position of Cylindrospermum within the Nostocaceae was not clearly resolved in our analyses. Cylindrospermum is unusual among cyanobacterial genera in that the morphological diversity appears to be more evident than sequence divergence. Taxa were clearly separable using morphology, but had very high percent similarity among ribosomal sequences. Given the high diversity we noted in this study, we conclude that there is likely much more diversity remaining to be described in this genus. PMID:26988018

  17. Identification of acetic acid bacteria in traditionally produced vinegar and mother of vinegar by using different molecular techniques.

    PubMed

    Yetiman, Ahmet E; Kesmen, Zülal

    2015-07-01

    Culture-dependent and culture-independent methods were combined for the investigation of acetic acid bacteria (AAB) populations in traditionally produced vinegars and mother of vinegar samples obtained from apple and grape. The culture-independent denaturing gradient gel electrophoresis (DGGE) analysis, which targeted the V7-V8 regions of the 16S rRNA gene, showed that Komagataeibacter hansenii and Komagataeibacter europaeus/Komagataeibacter xylinus were the most dominant species in almost all of the samples analyzed directly. The culture-independent GTG5-rep PCR fingerprinting was used in the preliminary characterization of AAB isolates and species-level identification was carried out by sequencing of the 16S rRNA gene, 16S-23S rDNA internally transcribed to the spacer (ITS) region and tuf gene. Acetobacter okinawensis was frequently isolated from samples obtained from apple while K. europaeus was identified as the dominant species, followed by Acetobacter indonesiensis in the samples originating from grape. In addition to common molecular techniques, real-time PCR intercalating dye assays, including DNA melting temperature (Tm) and high resolution melting analysis (HRM), were applied to acetic acid bacterial isolates for the first time. The target sequence of ITS region generated species-specific HRM profiles and Tm values allowed discrimination at species level. PMID:25828705

  18. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history. PMID:27054834

  19. Acetic acid bacteria isolated from grapes of South Australian vineyards.

    PubMed

    Mateo, E; Torija, M J; Mas, A; Bartowsky, E J

    2014-05-16

    Acetic acid bacteria (AAB) diversity from healthy, mould-infected and rot-affected grapes collected from three vineyards of Adelaide Hills (South Australia) was analyzed by molecular typing and identification methods. Nine different AAB species were identified from the 624 isolates recovered: Four species from Gluconobacter genus, two from Asaia and one from Acetobacter were identified by the analysis of 16S rRNA gene and 16S-23S rRNA gene internal transcribed spacer. However, the identification of other isolates that were assigned as Asaia sp. and Ameyamaea chiangmaiensis required more analysis for a correct species classification. The species of Gluconobacter cerinus was the main one identified; while one genotype of Asaia siamensis presented the highest number of isolates. The number of colonies recovered and genotypes identified was strongly affected by the infection status of the grapes; the rot-affected with the highest number. However, the species diversity was similar in all the cases. High AAB diversity was detected with a specific genotype distribution for each vineyard.

  20. Aliterella atlantica gen. nov., sp. nov., and Aliterella antarctica sp. nov., novel members of coccoid Cyanobacteria.

    PubMed

    Rigonato, Janaina; Gama, Watson Arantes; Alvarenga, Danillo Oliveira; Branco, Luis Henrique Zanini; Brandini, Frederico Pereira; Genuário, Diego Bonaldo; Fiore, Marli Fatima

    2016-09-01

    Two Cyanobacteria isolated from South Atlantic Ocean continental shelf deep water and from a marine green algae inhabiting the Admiralty Bay, King George Island, Antarctica were investigated based on morphological and ultrastructural traits, phylogeny of 16S rRNA gene sequences, secondary structure of the 16S-23S internal transcribed spacer regions and phylogenomic analyses. The majority of these evaluations demonstrated that both strains differ from the genera of cyanobacteria with validly published names and, therefore, supported the description of the novel genus as Aliterella gen. nov. The identity and phylogeny of 16S rRNA gene sequences, together with the secondary structure of D1D1' and BoxB intergenic regions, further supported the two strains representing distinct species: Aliterella atlantica gen. nov., sp. nov. (type SP469036, strain CENA595T) and Aliterella antarctica sp. nov. (type SP469035, strain CENA408T). The phylogenomic analysis of A. atlantica sp. nov. CENA595T, based on 21 protein sequences, revealed that this genus belongs to the cyanobacterial order Chroococcidiopsidales. The isolation and cultivation of two geographically distant unicellular members of a novel cyanobacterial genus and the sequenced genome of the type strain bring new insights into the current classification of the coccoid group, and into the reconstruction of their evolutionary history.

  1. Cytomolecular Analysis of Ribosomal DNA Evolution in a Natural Allotetraploid Brachypodium hybridum and Its Putative Ancestors—Dissecting Complex Repetitive Structure of Intergenic Spacers

    PubMed Central

    Borowska-Zuchowska, Natalia; Kwasniewski, Miroslaw; Hasterok, Robert

    2016-01-01

    Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n = 30), which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n = 10) and B. stacei (2n = 20). Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs) from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level. PMID:27790225

  2. Development of an innovative spacer grid model utilizing computational fluid dynamics within a subchannel analysis tool

    NASA Astrophysics Data System (ADS)

    Avramova, Maria

    In the past few decades the need for improved nuclear reactor safety analyses has led to a rapid development of advanced methods for multidimensional thermal-hydraulic analyses. These methods have become progressively more complex in order to account for the many physical phenomena anticipated during steady state and transient Light Water Reactor (LWR) conditions. The advanced thermal-hydraulic subchannel code COBRA-TF (Thurgood, M. J. et al., 1983) is used worldwide for best-estimate evaluations of the nuclear reactor safety margins. In the framework of a joint research project between the Pennsylvania State University (PSU) and AREVA NP GmbH, the theoretical models and numerics of COBRA-TF have been improved. Under the name F-COBRA-TF, the code has been subjected to an extensive verification and validation program and has been applied to variety of LWR steady state and transient simulations. To enable F-COBRA-TF for industrial applications, including safety margins evaluations and design analyses, the code spacer grid models were revised and substantially improved. The state-of-the-art in the modeling of the spacer grid effects on the flow thermal-hydraulic performance in rod bundles employs numerical experiments performed by computational fluid dynamics (CFD) calculations. Because of the involved computational cost, the CFD codes cannot be yet used for full bundle predictions, but their capabilities can be utilized for development of more advanced and sophisticated models for subchannel-level analyses. A subchannel code, equipped with improved physical models, can be then a powerful tool for LWR safety and design evaluations. The unique contributions of this PhD research are seen as development, implementation, and qualification of an innovative spacer grid model by utilizing CFD results within a framework of a subchannel analysis code. Usually, the spacer grid models are mostly related to modeling of the entrainment and deposition phenomena and the heat

  3. The CRISPR RNA-guided surveillance complex in Escherichia coli accommodates extended RNA spacers

    PubMed Central

    Luo, Michelle L.; Jackson, Ryan N.; Denny, Steven R.; Tokmina-Lukaszewska, Monika; Maksimchuk, Kenneth R.; Lin, Wayne; Bothner, Brian; Wiedenheft, Blake; Beisel, Chase L.

    2016-01-01

    Bacteria and archaea acquire resistance to foreign genetic elements by integrating fragments of foreign DNA into CRISPR (clustered regularly interspaced short palindromic repeats) loci. In Escherichia coli, CRISPR-derived RNAs (crRNAs) assemble with Cas proteins into a multi-subunit surveillance complex called Cascade (CRISPR-associated complex for antiviral defense). Cascade recognizes DNA targets via protein-mediated recognition of a protospacer adjacent motif and complementary base pairing between the crRNA spacer and the DNA target. Previously determined structures of Cascade showed that the crRNA is stretched along an oligomeric protein assembly, leading us to ask how crRNA length impacts the assembly and function of this complex. We found that extending the spacer portion of the crRNA resulted in larger Cascade complexes with altered stoichiometry and preserved in vitro binding affinity for target DNA. Longer spacers also preserved the in vivo ability of Cascade to repress target gene expression and to recruit the Cas3 endonuclease for target degradation. Finally, longer spacers exhibited enhanced silencing at particular target locations and were sensitive to mismatches within the extended region. These findings demonstrate the flexibility of the Type I-E CRISPR machinery and suggest that spacer length can be modified to fine-tune Cascade activity. PMID:27174938

  4. Ternary DNA chip based on a novel thymine spacer group chemistry.

    PubMed

    Yang, Yanli; Yildiz, Umit Hakan; Peh, Jaime; Liedberg, Bo

    2015-01-01

    A novel thymine-based surface chemistry suitable for label-free electrochemical DNA detection is described. It involves a simple two-step sequential process: immobilization of 9-mer thymine-terminated probe DNAs followed by backfilling with 9-mer thymine-based spacers (T9). As compared to commonly used organic spacer groups like 2-mercaptoethanol, 3-mercapto-1-propanol and 6-mercapto-1-hexanol, the 9-mer thymine-based spacers offer a 10-fold improvement in discriminating between complementary and non-complementary target hybridization, which is due mainly to facilitated transport of the redox probes through the probe-DNA/T9 layers. Electrochemical measurements, complemented with Surface Plasmon Resonance (SPR) and Quartz Crystal Microbalance (QCM-D) binding analyses, reveal that optimum selectivity between complementary and non-complementary hybridization is obtained for a sensing surface prepared using probe-DNA and backfiller T9 at equimolar concentration (1:1). At this particular ratio, the probe-DNAs are preferentially oriented and easily accessible to yield a sensing surface with favorable hybridization and electron transfer characteristics. Our findings suggest that oligonucleotide-based spacer groups offer an attractive alternative to short organic thiol spacers in the design of future DNA biochips. PMID:25465760

  5. Influence of length and flexibility of spacers on the binding affinity of divalent ligands.

    PubMed

    Liese, Susanne; Netz, Roland R

    2015-01-01

    We present a quantitative model for the binding of divalent ligand-receptor systems. We study the influence of length and flexibility of the spacers on the overall binding affinity and derive general rules for the optimal ligand design. To this end, we first compare different polymeric models and determine the probability to simultaneously bind to two neighboring receptor binding pockets. In a second step the binding affinity of divalent ligands in terms of the IC50 value is derived. We find that a divalent ligand has the potential to bind more efficiently than its monovalent counterpart only, if the monovalent dissociation constant is lower than a critical value. This critical monovalent dissociation constant depends on the ligand-spacer length and flexibility as well as on the size of the receptor. Regarding the optimal ligand-spacer length and flexibility, we find that the average spacer length should be equal or slightly smaller than the distance between the receptor binding pockets and that the end-to-end spacer length fluctuations should be in the same range as the size of a receptor binding pocket.

  6. Influence of length and flexibility of spacers on the binding affinity of divalent ligands

    PubMed Central

    Liese, Susanne

    2015-01-01

    Summary We present a quantitative model for the binding of divalent ligand–receptor systems. We study the influence of length and flexibility of the spacers on the overall binding affinity and derive general rules for the optimal ligand design. To this end, we first compare different polymeric models and determine the probability to simultaneously bind to two neighboring receptor binding pockets. In a second step the binding affinity of divalent ligands in terms of the IC50 value is derived. We find that a divalent ligand has the potential to bind more efficiently than its monovalent counterpart only, if the monovalent dissociation constant is lower than a critical value. This critical monovalent dissociation constant depends on the ligand-spacer length and flexibility as well as on the size of the receptor. Regarding the optimal ligand-spacer length and flexibility, we find that the average spacer length should be equal or slightly smaller than the distance between the receptor binding pockets and that the end-to-end spacer length fluctuations should be in the same range as the size of a receptor binding pocket. PMID:26124882

  7. CFD study of isothermal water flow in rod bundle with split-type spacer grid

    NASA Astrophysics Data System (ADS)

    Batta, A.; Class, A. G.

    2014-06-01

    The design of rod bundles in nuclear application nowadays is assessed by CFD (computational fluid dynamics). The accuracy of CFD models need validation. Within the OECD/NEA benchmark MATiS-H (Measurement and Analysis of Turbulent Mixing in Sub-channels - Horizontal) a single-phase water flow in a 5x5 rod bundle is studied. In the benchmark, two types of spacer grids are tested, the swirl type and the split type, where the current study focuses on the split type spacer grid. Comparison of CFD results obtained at Karlsruhe Institut of Technology (KIT) with experimental results of KAERI (Korea Atomic Energy Research Institute) are presented. In the benchmark velocities components along selected lines downstream of the spacer grid are measured and compared to CFD results. The CFD code STAR CCM+ with the Realized k-ɛ model is used. Comparisons with experimental results show quantitative and qualitative agreement for the averaged values of velocity components. Comparisons of results to other benchmark partners using different modeling show that the selected mesh size and models for the analysis of the current case gives relatively accurate results. However, the used turbulent model (Realized k-ɛ does not capture the turbulent intensity correctly. Computation shows that the flow has very high mixing due to the spacer grid, which does not decay within the measurements domain (z/ DH =0-10 downstream of spacer grid). The same conclusion can be drawn from experimental data.

  8. Monobenzoporphyrins as Sensitizers for Dye-Sensitized Solar Cells: Observation of Significant Spacer-Group Effect.

    PubMed

    Jinadasa, R G Waruna; Li, Bihong; Schmitz, Benjamin; Kumar, Siddhartha; Hu, Yi; Kerr, Lei; Wang, Hong

    2016-08-23

    A series of monobenzoporphyrins (WH1-WH4) bearing different conjugated spacer groups were designed and synthesized as sensitizers for dye-sensitized solar cells. Although a phenyl spacer only has a minimal impact on the absorption bands of the monobenzoporphyrin, an ethynylphenyl (WH3) or a vinyl (WH4) spacer redshifts and broadens the absorption bands of the dyes to result in much enhanced light-harvesting ability. Dye-sensitized solar cells based on these monobenzoporphyrin dyes displayed remarkable differences in power conversion efficiencies (PCEs). The monobenzoporphyrin bearing no spacer (WH1) resulted in a PCE of only 0.5 %; in contrast, the monobenzoporphyrin bearing vinyl spacers (WH4) achieved a PCE of 5.2 %. The high efficiency of the WH4 cell is attributed to the higher light-harvesting ability, the lesser extent of aggregation on the TiO2 surface, and the more favorable electron-density distributions of the HOMO and LUMO for electron injection and collection. This work demonstrates the exceptional tunability of benzoporphyrins as sensitizers for dye-sensitized solar cells. PMID:27469616

  9. Adverse impact of feed channel spacers on the performance of pressure retarded osmosis.

    PubMed

    Kim, Yu Chang; Elimelech, Menachem

    2012-04-17

    This article analyzes the influence of feed channel spacers on the performance of pressure retarded osmosis (PRO). Unlike forward osmosis (FO), an important feature of PRO is the application of hydraulic pressure on the high salinity (draw solution) side to retard the permeating flow for energy conversion. We report the first observation of membrane deformation under the action of the high hydraulic pressure on the feed channel spacer and the resulting impact on membrane performance. Because of this observation, reverse osmosis and FO tests that are commonly used for measuring membrane transport properties (water and salt permeability coefficients, A and B, respectively) and the structural parameter (S) can no longer be considered appropriate for use in PRO analysis. To accurately predict the water flux as a function of applied hydraulic pressure difference and the resulting power density in PRO, we introduced a new experimental protocol that accounts for membrane deformation in a spacer-filled channel to determine the membrane properties (A, B, and S). PRO performance model predictions based on these determined A, B, and S values closely matched experimental data over a range of draw solution concentrations (0.5 to 2 M NaCl). We also showed that at high pressures feed spacers block the permeation of water through the membrane area in contact with the spacer, a phenomenon that we term the shadow effect, thereby reducing overall water flux. The implications of the results for power generation by PRO are evaluated and discussed.

  10. Monobenzoporphyrins as Sensitizers for Dye-Sensitized Solar Cells: Observation of Significant Spacer-Group Effect.

    PubMed

    Jinadasa, R G Waruna; Li, Bihong; Schmitz, Benjamin; Kumar, Siddhartha; Hu, Yi; Kerr, Lei; Wang, Hong

    2016-08-23

    A series of monobenzoporphyrins (WH1-WH4) bearing different conjugated spacer groups were designed and synthesized as sensitizers for dye-sensitized solar cells. Although a phenyl spacer only has a minimal impact on the absorption bands of the monobenzoporphyrin, an ethynylphenyl (WH3) or a vinyl (WH4) spacer redshifts and broadens the absorption bands of the dyes to result in much enhanced light-harvesting ability. Dye-sensitized solar cells based on these monobenzoporphyrin dyes displayed remarkable differences in power conversion efficiencies (PCEs). The monobenzoporphyrin bearing no spacer (WH1) resulted in a PCE of only 0.5 %; in contrast, the monobenzoporphyrin bearing vinyl spacers (WH4) achieved a PCE of 5.2 %. The high efficiency of the WH4 cell is attributed to the higher light-harvesting ability, the lesser extent of aggregation on the TiO2 surface, and the more favorable electron-density distributions of the HOMO and LUMO for electron injection and collection. This work demonstrates the exceptional tunability of benzoporphyrins as sensitizers for dye-sensitized solar cells.

  11. Airflows after inhalation of terbutaline sulphate aerosol from a 750-ml spacer for four weeks.

    PubMed

    Eriksson, N E; Hidinger, K G; Rosenhall, L; Hagstad, H; Löfgren, L; Perk, J; Stiksa, G; Ström, K

    1986-01-01

    Terbutaline sulphate was administered to 40 adult asthmatic patients via an ordinary metered-dose inhaler (MDI) or one connected to a 750-ml spacer in an open, randomized, crossover study. Spirometry was obtained before the start of the study and again after four weeks of treatment with each inhaler. The patients recorded on a diary card the severity of their asthma symptoms and the peak expiratory flow rate (PEFR) in the morning before and after drug administration and in the evening. Preinhalation spirometric values were higher after four weeks with the 750-ml spacer than at the start of the study (P less than or equal to 0.05). Daily morning and evening PEFR values were higher after use of the 750-ml spacer than after use of the ordinary MDI (P less than 0.05). Daily symptom scores were generally low. A significantly better effect (P less than or equal to 0.05) with the 750-ml spacer was achieved only in daytime dyspnea. The investigators conclude that the attachment of a 750-ml spacer to an ordinary metered-dose inhaler can improve the efficacy of terbutaline sulphate in the long-term treatment of asthma. PMID:3698068

  12. New titanium spacer for cervical laminoplasty: initial clinical experience. Technical note.

    PubMed

    Tani, Satoshi; Suetsua, Futoshi; Mizuno, Junichi; Uchikado, Hisaaki; Nagashima, Hiroyasu; Akiyama, Masahiko; Isoshima, Akira; Ohashi, Hiroki; Hirano, Yoshitaka; Abe, Toshiaki

    2010-01-01

    Many commercially available hydroxyapatite (HA) spacers for cervical laminoplasty have been introduced but have disadvantages such as lack of plasticity, easy cracking, and occasional difficulty in fixation by sutures. Here we present the short-term results of a newly designed titanium spacer (Laminoplasty Basket) in open-door cervical laminoplasty, and evaluated clinically and radiologically. The titanium box-shaped spacer with two arms for fixation was easily inserted and fixed into the laminoplasty space with 4-mm or 5-mm length screws after the posterior cervical arch was repositioned for the canal expansion. Twenty-one patients with cervical myelopathy due to spondylosis or ossification of the longitudinal ligament or developmental narrow canal observed for more than 6 months postoperatively were enrolled in this study. The neurological condition of these patients improved from 9.4 points on the Japanese Orthopaedic Association scale preoperatively to 13.5 points at 6 months after surgery. Postoperative radiological evaluation showed no laminar closure or implant failure and cervical spine curvature was maintained. These results seemed to have no significant difference compared with those using HA spacers. This titanium spacer is a potential substitute for conventional HA or other similar devices in cervical laminoplasty. PMID:21206196

  13. Detection and characterization of spacer integration intermediates in type I-E CRISPR-Cas system.

    PubMed

    Arslan, Zihni; Hermanns, Veronica; Wurm, Reinhild; Wagner, Rolf; Pul, Ümit

    2014-07-01

    The adaptation against foreign nucleic acids by the CRISPR-Cas system (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated proteins) depends on the insertion of foreign nucleic acid-derived sequences into the CRISPR array as novel spacers by still unknown mechanism. We identified and characterized in Escherichia coli intermediate states of spacer integration and mapped the integration site at the chromosomal CRISPR array in vivo. The results show that the insertion of new spacers occurs by site-specific nicking at both strands of the leader proximal repeat in a staggered way and is accompanied by joining of the resulting 5'-ends of the repeat strands with the 3'-ends of the incoming spacer. This concerted cleavage-ligation reaction depends on the metal-binding center of Cas1 protein and requires the presence of Cas2. By acquisition assays using plasmid-located CRISPR array with mutated repeat sequences, we demonstrate that the primary sequence of the first repeat is crucial for cleavage of the CRISPR array and the ligation of new spacer DNA.

  14. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  15. Interference-driven spacer acquisition is dominant over naive and primed adaptation in a native CRISPR–Cas system

    PubMed Central

    Staals, Raymond H. J.; Jackson, Simon A.; Biswas, Ambarish; Brouns, Stan J. J.; Brown, Chris M.; Fineran, Peter C.

    2016-01-01

    CRISPR–Cas systems provide bacteria with adaptive immunity against foreign nucleic acids by acquiring short, invader-derived sequences called spacers. Here, we use high-throughput sequencing to analyse millions of spacer acquisition events in wild-type populations of Pectobacterium atrosepticum. Plasmids not previously encountered, or plasmids that had escaped CRISPR–Cas targeting via point mutation, are used to provoke naive or primed spacer acquisition, respectively. The origin, location and order of spacer acquisition show that spacer selection through priming initiates near the site of CRISPR–Cas recognition (the protospacer), but on the displaced strand, and is consistent with 3′–5′ translocation of the Cas1:Cas2-3 acquisition machinery. Newly acquired spacers determine the location and strand specificity of subsequent spacers and demonstrate that interference-driven spacer acquisition (‘targeted acquisition') is a major contributor to adaptation in type I-F CRISPR–Cas systems. Finally, we show that acquisition of self-targeting spacers is occurring at a constant rate in wild-type cells and can be triggered by foreign DNA with similarity to the bacterial chromosome. PMID:27694798

  16. Exchange coupling in hard/soft-magnetic multilayer films with non-magnetic spacer layers

    NASA Astrophysics Data System (ADS)

    Cui, W. B.; Liu, W.; Gong, W. J.; Liu, X. H.; Guo, S.; Yang, F.; Wang, Z. H.; Zhang, Z. D.

    2012-04-01

    The exchange coupling in textured HM/NM/α-Fe/NM/HM multilayer films (HM = NdFeB or PrFeB hard magnetic layers; NM = nonmagnetic Mo, Cu, and Cr layer) is shown to be indirect and long-range. The influences of thickness of NM spacer layer and HM layer, the material of HM phase and NM spacer layers, and the texture of HM layer, on the effective critical correlation length (Lexeff) and exchange-coupling between soft-magnetic (SM) and HM layers are investigated. A non-linear dependence of Lexeff on the thickness of NM spacer layer is observed. Magnetostatic interaction may lead to the observed non-linear dependence.

  17. Synthetically programmable nanoparticle superlattices using a hollow three-dimensional spacer approach

    SciTech Connect

    Auyeung, Evelyn; Cutler, Joshua I.; Macfarlane, Robert J.; Jones, Matthew R.; Wu, Jinsong; Liu, George; Zhang, Ke; Osberg, Kyle D.; Mirkin, Chad A.

    2013-04-08

    Crystalline nanoparticle arrays and superlattices with well-defined geometries can be synthesized by using appropriate electrostatic, hydrogen-bonding or biological recognition interactions. Although superlattices with many distinct geometries can be produced using these approaches, the library of achievable lattices could be increased by developing a strategy that allows some of the nanoparticles within a binary lattice to be replaced with 'spacer' entities that are constructed to mimic the behaviour of the nanoparticles they replace, even though they do not contain an inorganic core. The inclusion of these spacer entities within a known binary superlattice would effectively delete one set of nanoparticles without affecting the positions of the other set. Here, we show how hollow DNA nanostructures can be used as 'three-dimensional spacers' within nanoparticle superlattices assembled through programmable DNA interactions. We show that this strategy can be used to form superlattices with five distinct symmetries, including one that has never before been observed in any crystalline material.

  18. AA stacking, tribological and electronic properties of double-layer graphene with krypton spacer.

    PubMed

    Popov, Andrey M; Lebedeva, Irina V; Knizhnik, Andrey A; Lozovik, Yurii E; Potapkin, Boris V; Poklonski, Nikolai A; Siahlo, Andrei I; Vyrko, Sergey A

    2013-10-21

    Structural, energetic, and tribological characteristics of double-layer graphene with commensurate and incommensurate krypton spacers of nearly monolayer coverage are studied within the van der Waals-corrected density functional theory. It is shown that when the spacer is in the commensurate phase, the graphene layers have the AA stacking. For this phase, the barriers to relative in-plane translational and rotational motion and the shear mode frequency of the graphene layers are calculated. For the incommensurate phase, both of the barriers are found to be negligibly small. A considerable change of tunneling conductance between the graphene layers separated by the commensurate krypton spacer at their relative subangstrom displacement is revealed by the use of the Bardeen method. The possibility of nanoelectromechanical systems based on the studied tribological and electronic properties of the considered heterostructures is discussed.

  19. Identification of rickettsial isolates at the species level using multi-spacer typing

    PubMed Central

    Fournier, Pierre-Edouard; Raoult, Didier

    2007-01-01

    Background In order to estimate whether multi-spacer typing (MST), based on the sequencing of variable intergenic spacers, could serve for the identification of Rickettsia at the species level, we applied it to 108 rickettsial isolates or arthropod amplicons that include representatives of 23 valid Rickettsia species. Results MST combining the dksA-xerC, mppA-purC, and rpmE-tRNAfMet spacer sequences identified 61 genotypes, allowing the differentiation of each species by at least one distinct genotype. In addition, MST was discriminatory at the strain level in six species for which several isolates or arthropod amplicons were available. Conclusion MST proved to be a reproducible and high-resolution genotyping method allowing clear identification of rickettsial isolates at the species level and further additional differentiation of strains within some species. PMID:17662158

  20. Rotor bore and turbine rotor wheel/spacer heat exchange flow circuit

    DOEpatents

    Caruso, Philip M.; Eldrid, Sacheverel Quentin; Ladhani, Azad A.; DeMania, Alan Richard; Palmer, Gene David; Wilson, Ian David; Rathbun, Lisa Shirley; Akin, Robert Craig

    2002-01-01

    In a turbine having closed-circuit steam-cooling passages about the rim of the rotor during steady-state operation, compressor discharge air is supplied to the rotor bore for passage radially outwardly into the wheel space cavities between the wheels and spacers. Communicating slots and channels in the spacers and wheels at circumferentially spaced positions enable egress of the compressor discharge air into the hot gas flow path. At turbine startup, cooling air flows through the closed-circuit steam passages to cool the outer rim of the rotor while compressor discharge air pre-warms the wheels and spacers. At steady-state, cooling steam is supplied in the closed-circuit steam-cooling passages and compressor discharge air is supplied through the bore and into the wheel space cavities to cool the rotor.

  1. Custom Anatomical 3D Spacer for Temporomandibular Joint Resection and Reconstruction.

    PubMed

    Green, John Marshall; Lawson, Sarah T; Liacouras, Peter C; Wise, Edward M; Gentile, Michael A; Grant, Gerald Thomas

    2016-03-01

    Two cases are presented using a two-stage approach and a custom antibiotic spacer placement. Temporomandibular reconstruction can be very demanding and accomplished with a variety of methods in preparation of a total joint and ramus reconstruction with total joint prostheses (TMJ Concepts, Ventura, CA). Three-dimensional reconstructions from diagnostic computed tomography were used to establish a virtually planned resection which included the entire condyle-ramus complex. From these data, digital designs were used to manufacture molds to facilitate intraoperative fabrication of precise custom anatomic spacers from rapidly setting antibiotic-impregnated polymethyl methacrylate. Molds were manufactured using vat polymerization (stereolithography) with a photopolymer in the first case and powder bed fusion (electron beam melting) with Ti6AL4V for the second. Surgical methodology and the use of molds for intraoperative spacer fabrication for each case are discussed. PMID:26889353

  2. Necessity of the spacer peptide between CA and NC in the Rous sarcoma virus gag protein.

    PubMed

    Craven, R C; Leure-duPree, A E; Erdie, C R; Wilson, C B; Wills, J W

    1993-10-01

    A mutant of Rous sarcoma virus was constructed in which the nine amino acids that separate the CA and NC sequences in the Gag protein were deleted. The spacer peptide deletion mutant produced particles containing the normal complement of viral RNA and all of the viral proteins, including reverse transcriptase. Though electron microscopy revealed particles of normal morphology, the particles were noninfectious. The normally slow maturation of the CA protein, which involves cleavage of the spacer peptide from the carboxy terminus, was bypassed in this mutant, and the association between CA and the internal components of the core appears to have been disrupted. The results suggest that the spacer peptide has an essential role in directing folding and/or oligomerization of the CA subunits within the capsid structure.

  3. Stable inverted small molecular organic solar cells using a p-doped optical spacer.

    PubMed

    Lee, Sang-Hoon; Seo, Ji-Won; Lee, Jung-Yong

    2015-01-01

    We report inverted small molecular organic solar cells using a doped window layer as an optical spacer. The optical spacer was used to shift the optical field distribution inside the active layers, generating more charge carriers from sunlight. In this report, N,N,N',N'-tetrakis(4-methoxyphenyl)-benzidine (MeO-TPD) was doped with 2,2-(perfluoronaphthalene-2,6-diylidene)dimalononitrile (F6-TCNNQ), a p-type dopant material. P-doped MeO-TPD was adopted as an optical spacer because it has a large energy band gap, and its conductivity can be increased by several orders of magnitude through a doping process. As a result, a power conversion efficiency of 4.15% was achieved with the doped window layer of optimized thickness. Lastly, we present significantly improved stability of the inverted devices with the MeO-TPD layer. PMID:25407588

  4. Procedures for Generating CRISPR Mutants with Novel Spacers Acquired from Viruses or Plasmids.

    PubMed

    Dupuis, Marie-Ève; Barrangou, Rodolphe; Moineau, Sylvain

    2015-01-01

    CRISPR-Cas systems provide immunity in bacteria and archaea against nucleic acids in the form of viral genomes and plasmids, and influence their coevolution. The first main step of CRISPR-Cas activity is the immune adaptation through spacer(s) acquisition into an active CRISPR locus. This step is also mandatory for the final stage of CRISPR-Cas activity, namely interference. This chapter describes general procedures for studying the CRISPR adaptation step, accomplished by producing bacteriophage-insensitive mutants (BIMs) or plasmid-interfering mutants (PIMs) using various spacer acquisition analyses and experiments. Since each bacterial or archaeal species (and even strain) needs specific conditions to optimize the acquisition process, the protocols described below should be thought of as general guidelines and may not be applicable universally, without modification. Because Streptococcus thermophilus was used as the model system in the first published study on novel spacer acquisition and in many studies ever since, the protocols in this chapter describe specific conditions, media, and buffers that have been used with this microorganism. Details for other species will be given when possible, but readers should first evaluate the best growth and storage conditions for each bacterium-foreign element pair (named the procedure settings) and bear in mind the specificity and variability of CRISPR-Cas types and subtypes. Also, we suggest to be mindful of the fact that some CRISPR-Cas systems are not "naturally" active in terms of the ability to acquire novel CRISPR spacers, and that some systems may require specific conditions to induce the CRISPR-Cas activity for spacer acquisition.

  5. Flunisolide hydrofluoroalkane with integrated spacer for treating asthma: an updated review.

    PubMed

    Berger, William E; Tashkin, Donald P

    2015-01-01

    Flunisolide hydrofluoroalkane (HFA) with integrated spacer is the most recent reformulated inhaled corticosteroid (ICS) for asthma available in the United States. It is the only product that combines a corticosteroid extrafine aerosol with a built-in spacer. The potential clinical benefit of the flunisolide HFA formulation and its integrated spacer for treating persistent asthma was assessed through a comprehensive review of the published literature and data from the past 10 years focusing on (1) flunisolide, the molecule, and the impact of the HFA reformulation; (2) updated information on the anti-inflammatory response to flunisolide HFA, particularly in the distal airways; and (3) the usefulness of an integrated spacer. Flunisolide HFA was found effective and safe in clinical studies and comparable with the chlorofluorocarbon (CFC) formulation, but at about one-third the dose of flunisolide CFC, likely reflecting both the device and the particle size of the reformulated product. Compared with the CFC formulation, the extrafine aerosol and smaller particle size of flunisolide HFA substantially increased pulmonary deposition and decreased oropharyngeal deposition. The integrated spacer further enhanced the pulmonary/oropharyngeal deposition ratio. Examination of lung biopsy specimens indicated a favorable anti-inflammatory response to flunisolide HFA in peripheral airways. Pediatric studies showed no significant effects on growth. The data indicate that flunisolide HFA is a safe and effective maintenance therapy for asthma patients. The integrated spacer may provide an added advantage for patients, especially those who may be more likely to experience adverse effects of ICSs, both local and systemic, including children susceptible to adverse effects on growth. PMID:25635610

  6. Flunisolide hydrofluoroalkane with integrated spacer for treating asthma: an updated review.

    PubMed

    Berger, William E; Tashkin, Donald P

    2015-01-01

    Flunisolide hydrofluoroalkane (HFA) with integrated spacer is the most recent reformulated inhaled corticosteroid (ICS) for asthma available in the United States. It is the only product that combines a corticosteroid extrafine aerosol with a built-in spacer. The potential clinical benefit of the flunisolide HFA formulation and its integrated spacer for treating persistent asthma was assessed through a comprehensive review of the published literature and data from the past 10 years focusing on (1) flunisolide, the molecule, and the impact of the HFA reformulation; (2) updated information on the anti-inflammatory response to flunisolide HFA, particularly in the distal airways; and (3) the usefulness of an integrated spacer. Flunisolide HFA was found effective and safe in clinical studies and comparable with the chlorofluorocarbon (CFC) formulation, but at about one-third the dose of flunisolide CFC, likely reflecting both the device and the particle size of the reformulated product. Compared with the CFC formulation, the extrafine aerosol and smaller particle size of flunisolide HFA substantially increased pulmonary deposition and decreased oropharyngeal deposition. The integrated spacer further enhanced the pulmonary/oropharyngeal deposition ratio. Examination of lung biopsy specimens indicated a favorable anti-inflammatory response to flunisolide HFA in peripheral airways. Pediatric studies showed no significant effects on growth. The data indicate that flunisolide HFA is a safe and effective maintenance therapy for asthma patients. The integrated spacer may provide an added advantage for patients, especially those who may be more likely to experience adverse effects of ICSs, both local and systemic, including children susceptible to adverse effects on growth.

  7. New clustered regularly interspaced short palindromic repeat locus spacer pair typing method based on the newly incorporated spacer for Salmonella enterica.

    PubMed

    Li, Hao; Li, Peng; Xie, Jing; Yi, Shengjie; Yang, Chaojie; Wang, Jian; Sun, Jichao; Liu, Nan; Wang, Xu; Wu, Zhihao; Wang, Ligui; Hao, Rongzhang; Wang, Yong; Jia, Leili; Li, Kaiqin; Qiu, Shaofu; Song, Hongbin

    2014-08-01

    A clustered regularly interspaced short palindromic repeat (CRISPR) typing method has recently been developed and used for typing and subtyping of Salmonella spp., but it is complicated and labor intensive because it has to analyze all spacers in two CRISPR loci. Here, we developed a more convenient and efficient method, namely, CRISPR locus spacer pair typing (CLSPT), which only needs to analyze the two newly incorporated spacers adjoining the leader array in the two CRISPR loci. We analyzed a CRISPR array of 82 strains belonging to 21 Salmonella serovars isolated from humans in different areas of China by using this new method. We also retrieved the newly incorporated spacers in each CRISPR locus of 537 Salmonella isolates which have definite serotypes in the Pasteur Institute's CRISPR Database to evaluate this method. Our findings showed that this new CLSPT method presents a high level of consistency (kappa = 0.9872, Matthew's correlation coefficient = 0.9712) with the results of traditional serotyping, and thus, it can also be used to predict serotypes of Salmonella spp. Moreover, this new method has a considerable discriminatory power (discriminatory index [DI] = 0.8145), comparable to those of multilocus sequence typing (DI = 0.8088) and conventional CRISPR typing (DI = 0.8684). Because CLSPT only costs about $5 to $10 per isolate, it is a much cheaper and more attractive method for subtyping of Salmonella isolates. In conclusion, this new method will provide considerable advantages over other molecular subtyping methods, and it may become a valuable epidemiologic tool for the surveillance of Salmonella infections.

  8. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  9. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    PubMed

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H

    2013-10-01

    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment.

  10. Production Principles and Technological Development of Novel Woven Spacer Preforms and Integrated Stiffener Structures

    NASA Astrophysics Data System (ADS)

    Torun, Ahmet R.; Mountasir, Adil; Hoffmann, Gerald; Cherif, Chokri

    2013-06-01

    3D textile preforms offer a high potential to increase mechanical properties of composites and/or decrease manufacturing costs. Within the scope of this study, production principles were developed for complex spacer preforms and integrated stiffeners. These principles were applied through technological further development of the well-known face-to-face and terry weaving techniques. Various woven preforms were produced with Glass fibre/Polypropylene (GF/PP) Commingled yarns, however, the technology is suitable for any type of reinforcement yarns. U-shaped woven spacer preform was consolidated into a sandwich composite component for lightweight applications.

  11. Preference of temporary restorations and spacers: a survey of Diplomates of the American Board of Endodontists.

    PubMed

    Vail, Mychel Macapagal; Steffel, Charles L

    2006-06-01

    The purpose of this investigation was to survey Diplomates of the American Board of Endodontists to determine their preferences in temporary restorations used during and following endodontic therapy and if cotton pellets are used as spacers. The survey asked which primary temporary material was used in anterior and posterior teeth to close access openings. Also, the endodontists were asked if they preferred a double seal and if they used cotton pellets as spacers. Eighty percent (507 of 603) of the surveys were returned. Cavit was the temporary restoration of choice for both anterior and posterior teeth, 48% and 54%, respectively. The majority of Diplomates, 83%, placed a cotton pellet beneath the temporary restorations.

  12. Heterogeneous diversity of spacers within CRISPR (clustered regularly interspaced short palindromic repeats).

    PubMed

    He, Jiankui; Deem, Michael W

    2010-09-17

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  13. Heterogeneous Diversity of Spacers within CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)

    NASA Astrophysics Data System (ADS)

    He, Jiankui; Deem, Michael W.

    2010-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  14. Multilayer barrier films comprising nitrogen spacers between free-standing barrier layers

    NASA Astrophysics Data System (ADS)

    Granstrom, Jimmy Erik

    The air sensitivity of organic electronic devices has delayed the broad commercialization of the printed "plastics" electronics technology. The vacuum deposition methods used to fabricate multi-layers which fulfill the encapsulation requirements for plastic electronic devices are complex and expensive. Fully printed "plastic" electronics requires the development of encapsulation architectures which comprise solution deposited barriers and/or low-cost free-standing barrier films based on polymers, e.g. poly ethylene terephthalate (PET). One way to reach this goal is the insertion of contaminant-free (e.g. pure N2) gas-phase spacers between free-standing barrier films in a multilayer structure. The spacers themselves do not exhibit any barrier properties (diffusion of gas permeants in a gas phase is orders of magnitude faster than in a solid), but they delay the attainment of steady state. The spacer also reduces the chemical potential gradient across downstream barrier layers during the transient regime, reducing permeation rate to the device. Furthermore, if sorption is not fully equilibrated and introduces a kinetic barrier to transport, the additional sorption and desorption steps needed for permeant to reach the device may also slow the steady-state permeation rate. Encapsulation architectures utilizing both single-matrix (without nitrogen spacers) and multiple-matrix structures (with nitrogen spacers) were fabricated in this study, including Russian Doll structures utilizing pairs of free-standing barrier films and epoxy seals separated by nitrogen spacers. This structure enables the use of low-cost epoxy to attach two or more free-standing barrier films to a substrate with improved barrier performance. The performance of various Russian Doll encapsulations was evaluated with the calcium thin film optical transmission test, showing improved performance of the Russian doll configuration relative to a non-nested barrier/spacer architecture, and demonstrating that

  15. Role of the conjugated spacer in the optimization of second-order nonlinear chromophores

    NASA Astrophysics Data System (ADS)

    Pérez-Moreno, Javier; Clays, Koen; Kuzyk, Mark G.

    2009-08-01

    We investigate the role of the conjugated spacer in the optimization of the first hyperpolarizability of organic chromophores. We propose a novel strategy for the optimization of the first hyperpolarizability that is based on the variation of the degree of conjugation for the bridge that separates the donor and acceptors at the end of push-pull type chromophores. The correlation between the type of conjugated spacer and the experimental nonlinear performance of the chromophores is investigated and interpreted in the context of the quantum limits.

  16. Hole-transfer induced energy transfer in perylene diimide dyads with a donor-spacer-acceptor motif.

    PubMed

    Kölle, Patrick; Pugliesi, Igor; Langhals, Heinz; Wilcken, Roland; Esterbauer, Andreas J; de Vivie-Riedle, Regina; Riedle, Eberhard

    2015-10-14

    We investigate the photoinduced dynamics of perylene diimide dyads based on a donor-spacer-acceptor motif with polyyne spacers of varying length by pump-probe spectroscopy, time resolved fluorescence, chemical variation and quantum chemistry. While the dyads with pyridine based polyyne spacers undergo energy transfer with near-unity quantum efficiency, in the dyads with phenyl based polyyne spacers the energy transfer efficiency drops below 50%. This suggests the presence of a competing electron transfer process from the spacer to the energy donor as the excitation sink. Transient absorption spectra, however, reveal that the spacer actually mediates the energy transfer dynamics. The ground state bleach features of the polyyne spacers appear due to the electron transfer decay with the same time constant present in the rise of the ground state bleach and stimulated emission of the perylene energy acceptor. Although the electron transfer process initially quenches the fluorescence of the donor it does not inhibit energy transfer to the perylene energy acceptor. The transient signatures reveal that electron and energy transfer processes are sequential and indicate that the donor-spacer electron transfer state itself is responsible for the energy transfer. Through the introduction of a Dexter blocker unit into the spacer we can clearly exclude any through bond Dexter-type energy transfer. Ab initio calculations on the donor-spacer and the donor-spacer-acceptor systems reveal the existence of a bright charge transfer state that is close in energy to the locally excited state of the acceptor. Multipole-multipole interactions between the bright charge transfer state and the acceptor state enable the energy transfer. We term this mechanism coupled hole-transfer FRET. These dyads represent a first example that shows how electron transfer can be connected to energy transfer for use in novel photovoltaic and optoelectronic devices. PMID:26347443

  17. Identification of Clinically Relevant Fungi and Prototheca Species by rRNA Gene Sequencing and Multilocus PCR Coupled with Electrospray Ionization Mass Spectrometry

    PubMed Central

    Wang, Rui-Ying; Li, Li; Cao, Ya-Hui; Chen, Yan-Qiong; Zhao, Hua-Zhen; Zhang, Qiang-Qiang; Wu, Ji-Qin; Weng, Xin-Hua; Cheng, Xun-Jia; Zhu, Li-Ping

    2014-01-01

    Background Multilocus PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) is a new strategy for pathogen identification, but information about its application in fungal identification remains sparse. Methods One-hundred and twelve strains and isolates of clinically important fungi and Prototheca species were subjected to both rRNA gene sequencing and PCR/ESI-MS. Three regions of the rRNA gene were used as targets for sequencing: the 5′ end of the large subunit rRNA gene (D1/D2 region), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 regions). Microbial identification (Micro ID), acquired by combining results of phenotypic methods and rRNA gene sequencing, was used to evaluate the results of PCR/ESI-MS. Results For identification of yeasts and filamentous fungi, combined sequencing of the three regions had the best performance (species-level identification rate of 93.8% and 81.8% respectively). The highest species-level identification rate was achieved by sequencing of D1/D2 for yeasts (92.2%) and ITS2 for filamentous fungi (75.8%). The two Prototheca species could be identified to species level by D1/D2 sequencing but not by ITS1 or ITS2. For the 102 strains and isolates within the coverage of PCR/ESI-MS identification, 87.3% (89/102) achieved species-level identification, 100% (89/89) of which were concordant to Micro ID on species/complex level. The species-level identification rates for yeasts and filamentous fungi were 93.9% (62/66) and 75% (27/36) respectively. Conclusions rRNA gene sequencing provides accurate identification information, with the best results obtained by a combination of ITS1, ITS2 and D1/D2 sequencing. Our preliminary data indicated that PCR/ESI-MS method also provides a rapid and accurate identification for many clinical relevant fungi. PMID:24835205

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  19. Polymorphism of genes coding for nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10 from other groups in the Rhizoctonia solani species complex.

    PubMed

    Liu, Z L; Domier, L L; Sinclair, J B

    1995-07-01

    DNA polymorphism in the 18S nuclear rRNA gene region was investigated by using 11 restriction endonucleases for 161 isolates of 25 intraspecific groups (ISGs) representing 11 reported anastomosis groups (AGs) of Rhizoctonia solani. A PCR-based restriction mapping method in which enzymatically amplified DNA fragments and subfragments were digested with one or two restriction enzymes was employed. Four types of DNA restriction maps of this region were constructed for these 25 ISGs. Map type I of the 18S rDNA region was represented by isolates of a majority of R. solani ISGs. Map types II and III, represented by ISG 2E and 9 isolates and 5C isolates, respectively, differed from map I by the absence of one (map type II) or two (map type III) restriction sites. Map type IV, represented by ISG 10A and B (or AG 10) isolates, showed significant restriction site variations, with five enzymes in this region compared with those of the remaining ISGs or AGs. Ten of the 25 restriction sites in the 18S rRNA gene region were informative and selected for analysis. Previously reported restriction maps of the 5.8S rRNA gene region, including the internal transcribed spacers, were aligned with each other, and 12 informative restriction sites were identified. These data were used alone and in combination to evaluate group relationships. Analyses derived from these data sets by maximum parsimony and likelihood methods showed that AG 10 isolates were distinct and distantly related to the majority isolates of the other AGs of this species complex.

  20. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  1. Joint perpendicular anisotropy and strong interlayer exchange coupling in systems with thin vanadium spacers

    SciTech Connect

    Devolder, T. Le Goff, A.; Eimer, S.; Adam, J.-P.

    2015-04-28

    We study the influence of the insertion of a vanadium spacer layer between an FeCoB layer and a [Co/Ni] multilayer in an MgO substrate-based system mimicking the reference system of a perpendicular anisotropy magnetic tunnel junction. The anisotropy of the [Co/Ni] multilayer gradually improves with the vanadium thicknesses t, up to an optimized state for t = 8 Å, with little influence of the thermal annealing. The interlayer exchange coupling is ferromagnetic and very strong for t≤6 Å. It can be adjusted by thermal treatment at t = 8 Å from no coupling in the as-grown state to more than 2 mJ/m{sup 2} after 250 °C annealing. For this spacer thickness, the magnetic properties are consistent with the occurrence of a bcc (001) to an fcc (111) crystalline structure transition at the vanadium spacer. The remaining interlayer exchange coupling at t = 8 Å is still substantially higher than the one formerly obtained with a Tantalum spacer, which holds promise for further optimization of the reference layers of tunnel junctions meant for magnetic random access memories.

  2. Influence of the spacer on the inhibitory effect of different polycarbophil-protease inhibitor conjugates.

    PubMed

    Marschütz, M K; Veronese, F M; Bernkop-Schnürch, A

    2001-09-01

    Within the present study various polycarbophil (PCP)-serine protease inhibitor conjugates were synthesized and the influence of different spacers on their inhibitory efficacy was evaluated in vitro. Results demonstrated that 4.2+/-0.15 units (n=3; +/-SD) of alpha-chymotrypsin were inhibited by 50% utilizing 0.86% (w/v) of a PCP-tetramethylenediamine (TMDA)-chymostatin 20:1 conjugate. In contrast, only 0.6+/-0.05 units (n=3; +/-SD) of alpha-chymotrypsin were inhibited by a corresponding PCP-poly(ethylene glycol) (PEG)-chymostatin conjugate. Inhibitory effects of PCP-TMDA-antipain and -elastatinal conjugates towards trypsin and elastase, respectively, were also significantly higher (P<0.05) than those of corresponding PCP-PEG-inhibitor conjugates. Hence, the great impact of the molecular size as well as the structure of the spacer on resulting polymer-inhibitor conjugates could be demonstrated. The small and rigid C4-spacer TMDA (molecular weight (MW) 161.1) was thereby shown to be highly advantageous over a long, hydrophilic and flexible PEG-diamine spacer (MW 3400). Results obtained should provide helpful basic knowledge for the development of mucoadhesive polymer-inhibitor conjugates used as auxiliary agents for the oral administration of peptide drugs.

  3. Plane wave scattering from a plasmonic nanowire array spacer-separated from a plasmonic film

    NASA Astrophysics Data System (ADS)

    Thomas, Arun; Trivedi, Rahul; Dhawan, Anuj

    2016-06-01

    In this paper, we present a theoretical analysis of the electromagnetic response of a plasmonic nanowire-spacer-plasmonic film system. The analytical solution presented in this paper is a full-wave solution, which is used to compute the fields scattered by the plasmonic nanostructure system on illumination by a plane electromagnetic wave. The physical structure comprises of an array of plasmonic nanowires made of a plasmonic metal such as gold or silver placed over a plasmonic film of the same material and separated from it by a dielectric spacer such as silica or alumina. Such a nanostructure exhibits a spectrum that is extremely sensitive to various geometric and electromagnetic parameters such as spacer thickness and spacer refractive index, which makes it favourable for various sensing applications such as chemical and biological sensing, strain sensing, position sensing, vibration sensing, and thickness sensing. We report a comparison of our analytical solution with a numerical rigorous coupled wave analysis of the same structure with the plasmonic medium being treated as local in nature.

  4. Novel mutation in spacer region of POLG associated with ataxia neuropathy spectrum and gastroparesis.

    PubMed

    Bostan, Alionka; Glibert, Gerald; Dachy, Bernard; Dan, Bernard

    2012-09-25

    Clinical expression of POLG mutations is largely variable. We present a patient with a new mutation in spacer region of mitochondrial polymerase gamma protein (P765T). The clinical picture is characterized by the presence of sensory-ataxic neuropathy, ophthalmoplegia, dysarthria and gastroparesis, which had not been previously observed in ataxia neuropathy spectrum. PMID:22805437

  5. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  6. Velocity and turbulence distributions in wall subchannels of a road bundle in three axial planes downstream of a spacer grid

    NASA Astrophysics Data System (ADS)

    Rehme, K.

    1987-03-01

    The velocity, turbulence, and temperature distributions in nuclear fuel element bundles of nuclear reactors were investigated. The mean velocity, the wall shear stresses, and the turbulence were measured in two wall subchannels of a rod bundle of four parallel rods, arranged in a rectangular channel, for three axial planes. A spacer grid was inserted in the rod bundle, for ratios between the distance spacer grid/measuring plane and the hydraulic diameter (LIDh) of 40.4, 32.8 and 16.9. The Reynolds number was 145,000. The results show that the distributions of the velocity and the turbulence are affected by the spacer grid, already for LIDh = 40.4. The effects of the spacer grid increase with decreasing distance to the spacer grid.

  7. Removed antibiotic-impregnated cement spacers in two-stage revision joint arthroplasty do not show biofilm formation in vivo.

    PubMed

    Griffin, Justin W; Guillot, Stacey J; Redick, Jan A; Browne, James A

    2012-12-01

    Use of antibiotic-impregnated spacers is common in the two-stage approach to treatment of periprosthetic joint infection despite the lack of information regarding in vivo performance of these implants. Antibiotic elution levels likely often fall below the minimal inhibitory concentration need to inhibit bacterial growth, raising concern that the spacers themselves may provide a potential attachment site for biofilm formation. Advanced microscopy was used in this study to evaluate the surface characteristics of antibiotic-eluting spacers collected at the time of prosthesis reimplantation from 6 patients undergoing two-stage treatment for an infected total joint arthroplasty. Scanning electron microscopy and confocal scanning microscopy of the removed spacers revealed modest fibrous matrix formation and inflammatory cells with no biofilm or bacteria detected. This study supports the continued use of antibiotic spacers in the treatment of periprosthetic joint infection.

  8. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    USGS Publications Warehouse

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  9. Sequence analysis of the internal transcribed spacer 2 (ITS2) from Philornis seguyi (García, 1952) and Philornis torquans (Nielsen, 1913) (Diptera: Muscidae).

    PubMed

    Monje, Lucas D; Quiroga, Martín; Manzoli, Darío; Couri, Márcia S; Silvestri, Leonardo; Venzal, José M; Cuervo, Pablo; Beldomenico, Pablo M

    2013-09-01

    Philornis Meinert, 1890 (Diptera: Muscidae) is a genus of Neotropical dipterans that parasitise birds. The currently used external morphological characters to distinguish between species within this genus present some limitations. We used the second internal transcribed spacer region (ITS2) of the rRNA gene as a molecular marker to differentiate adult specimens of Philornis identified morphologically as Philornis torquans and Philornis seguyi from different localities. Specimens identified as P. seguyi from Magdalena (Buenos Aires Province) showed an ITS2 sequence different from that for P. torquans, whereas all other specimens of P. seguyi had sequences identical to those for P. torquans. These findings do not necessarily confirm that specimens from Magdalena indeed belong to P. seguyi, nor that P. seguyi is a valid species. Instead, they alert us about the potential for species misidentification when using morphological characters alone. The use of molecular approaches to aid the identification of Philornis spp. will shed light on the systematics of this group. P. torquans is reported for the first time in Mendoza Province and Uruguay.

  10. Genotyping of Trichomonas vaginalis isolates in Iran by using single stranded conformational polymorphism-PCR technique and internal transcribed spacer regions.

    PubMed

    Matini, M; Rezaeian, M; Mohebali, M; Maghsood, A H; Rabiee, S; Rahimi-Foroushani, A; Fallah, M; Miahipour, A; Rezaie, S

    2012-12-01

    Infection with Trichomonas vaginalis, the causative agent of human urogenital infection, is the most prevalent nonviral sexually transmitted disease worldwide. In spite of the high prevalence and medical importance of trichomoniasis, there is little knowledge about genetic epidemiology and genetic characterisation of this parasite. For this purpose, a Single Stranded Conformation Polymorphism-PCR (SSCP-PCR) typing method was conducted for Iranian T. vaginalis isolates using 5.8s ribosomal gene (rRNA gene) and the flanking internal transcribed spacer (ITS) regions. Nine hundred and fifty vaginal swab samples were examined in which 50 (5.3%) samples were parasitologically positive and used for molecular identification based on SSCP-PCR and nucleotide sequence analyses. Results of the SSCP analysis showed two distinct reproducible banding patterns (I, II) which were confirmed by nucleotide sequence analysis in the ITS1 regions. Frequencies of the SSCP banding patterns I and II were 84% (42/50) and 16% (8/50), respectively. In conclusion, SSCP-PCR analysis provided a reliable and sensitive method for strain genotyping of T. vaginalis based on the ITS1/5.8s/ITS2 region. This finding may help us gain more information about correlation between genetic properties and biological features of this parasite. PMID:23202606

  11. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans.

    PubMed

    Muller, Laura K; Lorch, Jeffrey M; Lindner, Daniel L; O'Connor, Michael; Gargas, Andrea; Blehert, David S

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was qualified further by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research. PMID:22962349

  12. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  13. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  14. Hydrogel Spacer Prospective Multicenter Randomized Controlled Pivotal Trial: Dosimetric and Clinical Effects of Perirectal Spacer Application in Men Undergoing Prostate Image Guided Intensity Modulated Radiation Therapy

    SciTech Connect

    Mariados, Neil; Sylvester, John; Shah, Dhiren; Karsh, Lawrence; Hudes, Richard; Beyer, David; Kurtzman, Steven; Bogart, Jeffrey; Hsi, R. Alex; Kos, Michael; Ellis, Rodney; Logsdon, Mark; Zimberg, Shawn; Forsythe, Kevin; Zhang, Hong; Soffen, Edward; Francke, Patrick; Mantz, Constantine; Rossi, Peter; DeWeese, Theodore; and others

    2015-08-01

    Purpose: Perirectal spacing, whereby biomaterials are placed between the prostate and rectum, shows promise in reducing rectal dose during prostate cancer radiation therapy. A prospective multicenter randomized controlled pivotal trial was performed to assess outcomes following absorbable spacer (SpaceOAR system) implantation. Methods and Materials: Overall, 222 patients with clinical stage T1 or T2 prostate cancer underwent computed tomography (CT) and magnetic resonance imaging (MRI) scans for treatment planning, followed with fiducial marker placement, and were randomized to receive spacer injection or no injection (control). Patients received postprocedure CT and MRI planning scans and underwent image guided intensity modulated radiation therapy (79.2 Gy in 1.8-Gy fractions). Spacer safety and impact on rectal irradiation, toxicity, and quality of life were assessed throughout 15 months. Results: Spacer application was rated as “easy” or “very easy” 98.7% of the time, with a 99% hydrogel placement success rate. Perirectal spaces were 12.6 ± 3.9 mm and 1.6 ± 2.0 mm in the spacer and control groups, respectively. There were no device-related adverse events, rectal perforations, serious bleeding, or infections within either group. Pre-to postspacer plans had a significant reduction in mean rectal V70 (12.4% to 3.3%, P<.0001). Overall acute rectal adverse event rates were similar between groups, with fewer spacer patients experiencing rectal pain (P=.02). A significant reduction in late (3-15 months) rectal toxicity severity in the spacer group was observed (P=.04), with a 2.0% and 7.0% late rectal toxicity incidence in the spacer and control groups, respectively. There was no late rectal toxicity greater than grade 1 in the spacer group. At 15 months 11.6% and 21.4% of spacer and control patients, respectively, experienced 10-point declines in bowel quality of life. MRI scans at 12 months verified spacer absorption. Conclusions: Spacer

  15. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  16. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  17. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  18. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  19. Effect of multiple actuations, delayed inhalation and antistatic treatment on the lung bioavailability of salbutamol via a spacer device.

    PubMed Central

    Clark, D. J.; Lipworth, B. J.

    1996-01-01

    BACKGROUND: The aim of this study was to extend previous in vitro observations regarding the effects of multiple actuations of aerosols into spacer devices, delayed inhalation, and antistatic treatment of spacer devices on the amount of drug delivered for inhalation. An in vivo study of lung bioavailability of salbutamol from a large volume (Volumatic) spacer was conducted. METHODS: Ten healthy volunteers of mean age 20.5 years with a mean forced expiratory volume in one second of 112.1% predicted were studied in a randomised single blind (investigator blind) crossover study. 1200 micrograms of salbutamol was given with mouth rinsing (100 micrograms/puff) on four study days: single puffs via spacer, multiple puffs via spacer (3 x 4 puffs), single puffs with 20 second delay before inhalation via spacer, and single puffs via an antistatic treated spacer. All spacers, including those treated with antistatic, were prewashed prior to each study day. Measurements of lung bioavailability were made at five, 10, and 20 minutes after inhalation to determine peak (Cmax) and average (Cav) plasma salbutamol levels. Systemic beta 2 responses including finger tremor, heart rate, and plasma potassium levels were also evaluated. RESULTS: Single puffs from the spacer produced higher plasma salbutamol levels and greater systemic beta 2 responses than either multiple puffs or single puffs with delayed inhalation for a 1200 micrograms dose. For Cmax this amounted to a 1.93-fold (95% CI 1.68 to 2.19) greater lung bioavailability for single puffs than for multiple puffs and a 1.80-fold (95% CI 1.59 to 2.00) greater lung bioavailability for single puffs than for single puffs with a 20 second delay. Comparison of the normal and antistatic treated spacers (both prewashed) revealed differences for Cmax with levels 1.23-fold (95% CI 1.04 to 1.41) greater for the normal spacer. CONCLUSIONS: Delayed inhalation from a Volumatic spacer and the use of multiple puffs results in a considerable

  20. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  1. An experimental study on the effect of spacer on concentration polarization in a long channel reverse osmosis membrane cell.

    PubMed

    Mo, H; Ng, H Y

    2010-01-01

    This study was to experimentally investigate the performance and organic fouling behaviour in a 1-m long RO membrane channel with or without spacer for desalting. It was found that local permeate flux distributed heterogeneously along the long membrane channel without a spacer inserted due to exponential growth of concentration polarization, which also resulted in decreasing salt rejection and increasing organic fouling along the membrane channel in the downstream direction. This heterogeneity could be lessened by inserting a spacer into the channel, which mitigated concentration polarization due to the enhanced turbulence caused by a spacer, especially at the downstream portion of the channel. However, in the upstream of the channel, inserting a spacer exerted an additional vertical resistance which might counteract the effect of concentration polarization mitigation by a spacer and caused a lower permeate flux. This suggests that it is necessary to consider the integral effect of spacer for designing an RO membrane module and an overall RO system in order to prevent extra resistance, reduce concentration polarization and membrane fouling. PMID:20389001

  2. A comparative evaluation of application techniques of a paint-on die spacer in grooves: an in vitro study.

    PubMed

    Vaishali, K; Prasad, D Krishna; Shetty, Manoj

    2013-12-01

    The use of paint-on die spacer to improve the seating of casting has become quite popular in the recent years. The generally accepted range of paint-on die spacer is approximately 20-40 μm, which suggests a range of tolerance. The painting of the retentive grooves with die spacer has always been a subject of debate. The primary purpose of this study was to determine if there was a tendency for the paint-on die spacer to accumulate in grooves of tooth preparation in sufficient thickness to exceed this accepted range of tolerance when applied using two different techniques. Eight die stone blocks with three grooves each were prepared. Half the samples were painted in unidirectional method and the other halves were painted using the haphazard method of application. The thickness of the die spacer was measured at different positions using 200× magnification and the mean and standard deviations were calculated. On analysis it was seen that the thickness of the paint-on die spacer in grooves was in the range of 20-40 μm for unidirectional method of application, whereas in haphazard method of application the thickness of the paint-on die spacer was in the range of 28-132 μm. From the above study it was concluded that the method of application influenced the thickness of the paint-on die spacer. The recommended thickness of the die spacer was achieved on unidirectional method of application.

  3. Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov.

    PubMed

    Safni, Irda; Cleenwerck, Ilse; De Vos, Paul; Fegan, Mark; Sly, Lindsay; Kappler, Ulrike

    2014-09-01

    The Ralstonia solanacearum species complex has long been recognized as a group of phenotypically diverse strains that can be subdivided into four phylotypes. Using a polyphasic taxonomic approach on an extensive set of strains, this study provides evidence for a taxonomic and nomenclatural revision of members of this complex. Data obtained from phylogenetic analysis of 16S-23S rRNA ITS gene sequences, 16S-23S rRNA intergenic spacer (ITS) region sequences and partial endoglucanase (egl) gene sequences and DNA-DNA hybridizations demonstrate that the R. solanacearum species complex comprises three genospecies. One of these includes the type strain of Ralstonia solanacearum and consists of strains of R. solanacearum phylotype II only. The second genospecies includes the type strain of Ralstonia syzygii and contains only phylotype IV strains. This genospecies is subdivided into three distinct groups, namely R. syzygii, the causal agent of Sumatra disease on clove trees in Indonesia, R. solanacearum phylotype IV strains isolated from different host plants mostly from Indonesia, and strains of the blood disease bacterium (BDB), the causal agent of the banana blood disease, a bacterial wilt disease in Indonesia that affects bananas and plantains. The last genospecies is composed of R. solanacearum strains that belong to phylotypes I and III. As these genospecies are also supported by phenotypic data that allow the differentiation of the three genospecies, the following taxonomic proposals are made: emendation of the descriptions of Ralstonia solanacearum and Ralstonia syzygii and descriptions of Ralstonia syzygii subsp. nov. (type strain R 001(T) = LMG 10661(T) = DSM 7385(T)) for the current R. syzygii strains, Ralstonia syzygii subsp. indonesiensis subsp. nov. (type strain UQRS 464(T) = LMG 27703(T) = DSM 27478(T)) for the current R. solanacearum phylotype IV strains, Ralstonia syzygii subsp. celebesensis subsp. nov. (type strain UQRS 627(T

  4. Comparison of conventional paint-on die spacers and those used with the all-ceramic restorations.

    PubMed

    Campbell, S D

    1990-02-01

    The study compared the thickness of conventional (Tru-Fit and Belle de St. Claire) and all-ceramic (Dicor and Cerestore) die spacers. Three coats of Tru-Fit, two coats of Belle de St. Claire, and two coats of Cerestore die spacers provided a 25 microns thickness. A single coat of the Dicor spacer resulted in a 37 microns layer. A significantly thinner layer occurred at the convex occlusal line angles for all of the materials tested. This could impede the flow of the luting agent at the time of cementation. PMID:2406424

  5. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis.

    PubMed

    Laroucau, Karine; Trichereau, Alain; Vorimore, Fabien; Mahé, Anne-Marie

    2007-03-31

    In a previous study we described the use of a new set of PCR primers (CpsiA/CpsiB) specific of the conserved pmp-family genes of Chlamydophila abortus as an efficient tool for the detection of these bacteria in ruminants including also preliminary results on avian strains. In this work, the use of this set of primers was extended to representative strains of the six major avian serovars (serovars A-F) and to field isolates of C. psittaci. For all the studied representative strains, using purified genomic DNA as a template, CpsiA/CpsiB primers allowed, as observed for C. abortus, a minimal 10-fold PCR signal increase compared to the one observed with ompA specific primers. In comparison to primers targeting the 16S-23S rRNA intergenic spacer, similar or increased sensitivity was observed depending on the strain. All the field isolates were amplified with CpsiA/CpsiB primers. On clinical samples, our primers are the best among those tested for detection of C. psittaci by simple conventional PCR. RFLP experiments performed using PCR fragments amplified with the CpsiA/CpsiB primers gave promising results demonstrating that these primers may provide an interesting tool for molecular typing when the bacterium cannot be grown from pathological samples.

  6. Nisin-producing organisms during traditional 'Fior di latte' cheese-making monitored by multiplex-PCR and PFGE analyses.

    PubMed

    Moschetti, G; Blaiotta, G; Villani, F; Coppola, S

    2001-01-22

    In this work we studied using different molecular methods the population dynamics of nisin-producing organisms and the persistence of such organisms within a complex ecosystem, 'Fior di latte' cheese, a traditional high-moisture pasta filata cheese. Using the primers targeting the eubacterial 16S-23S rRNA spacer region, together with those amplifying the nisA or nisZ gene, we were able to provide a rapid species identification of the isolates. Inhibitors of Lactococcus lactis subsp. lactis DSM 20481T used as indicator occurred during the whole process of cheese manufacture as a significant part of lactic microflora; however, only 12 among 109 isolates of bacteriocin producers were nisin producers. Amplification of the nisA or nisZ gene, using DNA extracted directly from dairy samples as templates, showed that the nisin structural gene was detected during cheese-making from milk samples up to the end of curd ripening but not in the final cheese. In order to monitor nisin-producing strains during cheese manufacturing, the 12 Lactococcus lactis nis+ strains were analysed by low frequency restriction fragment and PFGE. Nine isolates among the 12 nisin-producers exhibited an unique and distinct DNA banding pattern and are considered to be genetically diverse. The other three isolates from curd after ripening showed the same restriction pattern and could be the same strain. In fact, it was also isolated 2 months after the first analysis of cheese-making of 'Fior di latte'.

  7. Expanding the mycobacterial diversity of metalworking fluids (MWFs): evidence showing MWF colonization by Mycobacterium abscessus.

    PubMed

    Kapoor, Renuka; Yadav, Jagjit S

    2012-02-01

    Nontuberculous mycobacteria (NTM) have been associated with hypersensitivity pneumonitis in machinists. Only two species of NTM, namely Mycobacterium immunogenum and Mycobacterium chelonae, have been reported thus far to have the ability to colonize contaminated metalworking fluids (MWFs). Here, we report, for the first time, the presence and characterization (phenotypic and genotypic) of a third species, Mycobacterium abscessus, colonizing these harsh alkaline machining fluids. Two Mycobacterium morphotypes, smooth (S) and rough (R), were isolated (two isolates each) from an in-use industrial MWFs. Biocide susceptibility analysis using triclosan as a model yielded the same minimal inhibitory concentration for the two morphotypes. PCR-restriction analysis-based speciation of the morphotypes confirmed their identity as M. abscessus. Genotyping based on partial DNA sequences corresponding to the variable regions of the hsp65 gene and 16S-23S rRNA operon internal transcribed spacer region and randomly amplified polymorphic DNA-PCR analysis showed that both morphotypes belong to a single genotype. In addition, we isolated and confirmed two novel mycobacterial genotypes, one each of M. immunogenum and M. chelonae from additional in-use MWF screening. Taken together, this study expands the known mycobacterial species- and strain-diversity colonizing MWF. Furthermore, the study emphasizes the need for including M. abscessus species in the existing mycobacterial screening of contaminated MWF. PMID:22092754

  8. The analysis of core and symbiotic genes of rhizobia nodulating Vicia from different continents reveals their common phylogenetic origin and suggests the distribution of Rhizobium leguminosarum strains together with Vicia seeds.

    PubMed

    Alvarez-Martínez, Estela R; Valverde, Angel; Ramírez-Bahena, Martha Helena; García-Fraile, Paula; Tejedor, Carmen; Mateos, Pedro F; Santillana, Nery; Zúñiga, Doris; Peix, Alvaro; Velázquez, Encarna

    2009-08-01

    In this work, we analysed the core and symbiotic genes of rhizobial strains isolated from Vicia sativa in three soils from the Northwest of Spain, and compared them with other Vicia endosymbionts isolated in other geographical locations. The analysis of rrs, recA and atpD genes and 16S-23S rRNA intergenic spacer showed that the Spanish strains nodulating V. sativa are phylogenetically close to those isolated from V. sativa and V. faba in different European, American and Asian countries forming a group related to Rhizobium leguminosarum. The analysis of the nodC gene of strains nodulating V. sativa and V. faba in different continents showed they belong to a phylogenetically compact group indicating that these legumes are restrictive hosts. The results of the nodC gene analysis allow the delineation of the biovar viciae showing a common phylogenetic origin of V. sativa and V. faba endosymbionts in several continents. Since these two legume species are indigenous from Europe, our results suggest a world distribution of strains from R. leguminosarum together with the V. sativa and V. faba seeds and a close coevolution among chromosome, symbiotic genes and legume host in this Rhizobium-Vicia symbiosis.

  9. Caldora penicillata gen. nov., comb. nov. (cyanobacteria), a pantropical marine species with biomedical relevance.

    PubMed

    Engene, Niclas; Tronholm, Ana; Salvador-Reyes, Lilibeth A; Luesch, Hendrik; Paul, Valerie J

    2015-08-01

    Many tropical marine cyanobacteria are prolific producers of bioactive secondary metabolites with ecological relevance and promising pharmaceutical applications. One species of chemically rich, tropical marine cyanobacteria that was previously identified as Symploca hydnoides or Symploca sp. corresponds to the traditional taxonomic definition of Phormidium penicillatum. In this study, we clarified the taxonomy of this biomedically and ecologically important cyanobacterium by comparing recently collected specimens with the original type material and the taxonomic description of P. penicillatum. Molecular phylogenetic analyses of the 16S rRNA gene and the 16S-23S internal transcribed spacer regions showed that P. penicillatum formed an independent clade sister to the genus Symploca, and distantly related to Phormidium and Lyngbya. We propose the new genus Caldora for this clade, with Caldora penicillata comb. nov. as the type species and designate as the epitype the recently collected strain FK13-1. Furthermore, the production of bioactive secondary metabolites among various geographically dispersed collections of C. penicillata showed that this species consistently produced the metabolite dolastatin 10 and/or the related compound symplostatin 1, which appear to be robust autapomorphic characters and chemotaxonomic markers for this taxon. PMID:26327714

  10. Diversity and antimicrobial properties of lactic acid bacteria isolated from rhizosphere of olive trees and desert truffles of Tunisia.

    PubMed

    Fhoula, Imene; Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota.

  11. Detection of Campylobacter jejuni in rectal swab samples from Rousettus amplexicaudatus in the Philippines

    PubMed Central

    HATTA, Yuki; OMATSU, Tsutomu; TSUCHIAKA, Shinobu; KATAYAMA, Yukie; TANIGUCHI, Satoshi; MASANGKAY, Joseph S; PUENTESPINA, Roberto; ERES, Eduardo; COSICO, Edison; UNE, Yumi; YOSHIKAWA, Yasuhiro; MAEDA, Ken; KYUWA, Shigeru; MIZUTANI, Tetsuya

    2016-01-01

    Bats are the second diversity species of mammals and widely distributed in the world. They are thought to be reservoir and vectors of zoonotic pathogens. However, there is scarce report of the evidence of pathogenic bacteria kept in bats. The precise knowledge of the pathogenic bacteria in bat microbiota is important for zoonosis control. Thus, metagenomic analysis targeting the V3-V4 region of the 16S rRNA of the rectal microbiota in Rousettus amplexicaudatus was performed using high throughput sequencing. The results revealed that 103 genera of bacteria including Camplyobacter were detected. Campylobacter was second predominant genus, and Campylobacter coli and Campylobacter jejuni were identified in microbiome of R. amplexicaudatus. Campylobacteriosis is one of the serious bacterial diarrhea in human, and the most often implicated species as the causative agent of campylobacteriosis is C. jejuni. Therefore, we investigated the prevalence of C. jejuni in 91 wild bats with PCR. As a result of PCR assay targeted on 16S-23S intergenic spacer, partial genome of C. jejuni was detected only in five R. amplexicaudatus. This is the first report that C. jejuni was detected in bat rectal swab samples. C. jejuni is the most common cause of campylobacteriosis in humans, transmitted through water and contact with livestock animals. This result indicated that R. amplexicaudatus may be a carrier of C. jejuni. PMID:27109214

  12. Use of a DNA Microarray for Detection and Identification of Bacterial Pathogens Associated with Fishery Products▿

    PubMed Central

    Cao, Boyang; Li, Rongrong; Xiong, Songjin; Yao, Fangfang; Liu, Xiangqian; Wang, Min; Feng, Lu; Wang, Lei

    2011-01-01

    We established a microarray for the simultaneous detection and identification of diverse putative pathogens often associated with fishery products by targeting specific genes of Listeria monocytogenes, Salmonella, Shigella, Staphylococcus aureus, Streptococcus pyogenes, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, and Yersinia enterocolitica and the 16S-23S rRNA gene internal transcribed spacer (ITS) region of Proteus mirabilis and Proteus vulgaris. The microarray contained 26 specific probes and was tested against a total of 123 target bacterial strains that included 55 representative strains, 68 clinical isolates, and 45 strains of other bacterial species that belonged to 8 genera and 34 species, and it was shown to be specific and reproducible. A detection sensitivity of 10 ng DNA or 10 CFU/ml for pure cultures of each target organism demonstrated that the assay was highly sensitive and reproducible. Mock and real fishery product samples were tested by the microarray, and the accuracy was 100%. The DNA microarray method described in this communication is specific, sensitive, and reliable and has several advantages over traditional methods of bacterial culture and antiserum agglutination assays. PMID:21965411

  13. Mycoplasma corogypsi-associated polyarthritis and tenosynovitis in black vultures (Coragyps atratus).

    PubMed

    Van Wettere, A J; Ley, D H; Scott, D E; Buckanoff, H D; Degernes, L A

    2013-03-01

    Three wild American black vultures (Coragyps atratus) were presented to rehabilitation centers with swelling of multiple joints, including elbows, stifles, hocks, and carpal joints, and of the gastrocnemius tendons. Cytological examination of the joint fluid exudate indicated heterophilic arthritis. Radiographic examination in 2 vultures demonstrated periarticular soft tissue swelling in both birds and irregular articular surfaces with subchondral bone erosion in both elbows in 1 bird. Prolonged antibiotic therapy administered in 2 birds did not improve the clinical signs. Necropsy and histological examination demonstrated a chronic lymphoplasmacytic arthritis involving multiple joints and gastrocnemius tenosynovitis. Articular lesions varied in severity and ranged from moderate synovitis and cartilage erosion and fibrillation to severe synovitis, diffuse cartilage ulceration, subchondral bone loss and/or sclerosis, pannus, synovial cysts, and epiphyseal osteomyelitis. No walled bacteria were observed or isolated from the joints. However, mycoplasmas polymerase chain reactions were positive in at least 1 affected joint from each bird. Mycoplasmas were isolated from joints of 1 vulture that did not receive antibiotic therapy. Sequencing of 16S rRNA gene amplicons from joint samples and the mycoplasma isolate identified Mycoplasma corogypsi in 2 vultures and was suggestive in the third vulture. Mycoplasma corogypsi identification was confirmed by sequencing the 16S-23S intergenic spacer region of mycoplasma isolates. This report provides further evidence that M. corogypsi is a likely cause of arthritis and tenosynovitis in American black vultures. Cases of arthritis and tenosynovitis in New World vultures should be investigated for presence of Mycoplasma spp, especially M. corogypsi.

  14. Bartonella melophagi in Melophagus ovinus (sheep ked) collected from sheep in northern Oromia, Ethiopia.

    PubMed

    Kumsa, Bersissa; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-01-01

    Melophagus ovinus (sheep ked) is one of the most common ectoparasites that contributes to enormous economic losses in the productivity of sheep in many countries. The present study was conducted from January 2012 to July 2013 on M. ovinus collected from sheep at three sites in Ethiopia. Of the sheep studied, 65.7% (88/134) were infested with M. ovinus. The prevalence of M. ovinus was 76% (76/100), 47% (8/17) and 23.5% (4/17) at the Kimbibit, Chacha and Shano sites, respectively. An overall number of 229 M. ovinus specimens (138 females, 86 males and five pupae) and 554 M. ovinus specimens (272 females, 282 males) were collected from young and adult sheep, respectively. Bartonella DNA was detected in 89% (694/783) of M. ovinus using a quantitative Bartonella genus-specific PCR assay targeting the 16S/23S rRNA intergenic spacer region. The sequencing of the PCR products of fragments of the gltA and rpoB genes showed 99.6-100% and 100% homology, respectively, with B. melophagi. Statistically significant variation was not noted in the overall prevalence of Bartonella DNA between female and male M. ovinus. All of the sheep infested with M. ovinus 100% (88/88) harbored at least one M. ovinus specimen that contained Bartonella DNA. This study highlights that B. melophagi in M. ovinus from sheep in highlands in Ethiopia possibly has certain zoonotic importance.

  15. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    PubMed

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  16. Diversity and Antimicrobial Properties of Lactic Acid Bacteria Isolated from Rhizosphere of Olive Trees and Desert Truffles of Tunisia

    PubMed Central

    Najjari, Afef; Turki, Yousra; Jaballah, Sana; Boudabous, Abdelatif; Ouzari, Hadda

    2013-01-01

    A total of 119 lactic acid bacteria (LAB) were isolated, by culture-dependant method, from rhizosphere samples of olive trees and desert truffles and evaluated for different biotechnological properties. Using the variability of the intergenic spacer 16S-23S and 16S rRNA gene sequences, the isolates were identified as the genera Lactococcus, Pediococcus, Lactobacillus, Weissella, and Enterococcus. All the strains showed proteolytic activity with variable rates 42% were EPS producers, while only 10% showed the ability to grow in 9% NaCl. In addition, a low rate of antibiotic resistance was detected among rhizospheric enterococci. Furthermore, a strong antibacterial activity against plant and/or pathogenic bacteria of Stenotrophomonas maltophilia, Pantoea agglomerans, Pseudomonas savastanoi, the food-borne Staphylococcus aureus, and Listeria monocytogenes was recorded. Antifungal activity evaluation showed that Botrytis cinerea was the most inhibited fungus followed by Penicillium expansum, Verticillium dahliae, and Aspergillus niger. Most of the active strains belonged to the genera Enterococcus and Weissella. This study led to suggest that environmental-derived LAB strains could be selected for technological application to control pathogenic bacteria and to protect food safety from postharvest deleterious microbiota. PMID:24151598

  17. Nisin-producing organisms during traditional 'Fior di latte' cheese-making monitored by multiplex-PCR and PFGE analyses.

    PubMed

    Moschetti, G; Blaiotta, G; Villani, F; Coppola, S

    2001-01-22

    In this work we studied using different molecular methods the population dynamics of nisin-producing organisms and the persistence of such organisms within a complex ecosystem, 'Fior di latte' cheese, a traditional high-moisture pasta filata cheese. Using the primers targeting the eubacterial 16S-23S rRNA spacer region, together with those amplifying the nisA or nisZ gene, we were able to provide a rapid species identification of the isolates. Inhibitors of Lactococcus lactis subsp. lactis DSM 20481T used as indicator occurred during the whole process of cheese manufacture as a significant part of lactic microflora; however, only 12 among 109 isolates of bacteriocin producers were nisin producers. Amplification of the nisA or nisZ gene, using DNA extracted directly from dairy samples as templates, showed that the nisin structural gene was detected during cheese-making from milk samples up to the end of curd ripening but not in the final cheese. In order to monitor nisin-producing strains during cheese manufacturing, the 12 Lactococcus lactis nis+ strains were analysed by low frequency restriction fragment and PFGE. Nine isolates among the 12 nisin-producers exhibited an unique and distinct DNA banding pattern and are considered to be genetically diverse. The other three isolates from curd after ripening showed the same restriction pattern and could be the same strain. In fact, it was also isolated 2 months after the first analysis of cheese-making of 'Fior di latte'. PMID:11205941

  18. Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

    PubMed

    Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X

    2016-02-01

    Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish.

  19. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  20. Synthesis, Characterization and Biological Studies of New Linear Thermally Stable Schiff Base Polymers with Flexible Spacers.

    PubMed

    Qureshi, Farah; Khuhawar, Muhammad Yar; Jahangir, Taj Muhammad; Channar, Abdul Hamid

    2016-01-01

    Five new linear Schiff base polymers having azomethine structures, ether linkages and extended aliphatic chain lengths with flexible spacers were synthesized by polycondensation of dialdehyde (monomer) with aliphatic and aromatic diamines. The formation yields of monomer and polymers were obtained within 75-92%. The polymers with flexible spacers of n-hexane were somewhat soluble in acetone, chloroform, THF, DMF and DMSO on heating. The monomer and polymers were characterized by melting point, elemental microanalysis, FT-IR, (1)HNMR, UV-Vis spectroscopy, thermogravimetry (TG), differential thermal analysis (DTA), fluorescence emission, scanning electron microscopy (SEM) and viscosities and thermodynamic parameters measurements of their dilute solutions. The studies supported formation of the monomer and polymers and on the basis of these studies their structures have been assigned. The synthesized polymers were tested for their antibacterial and antifungal activities.

  1. Direct CRISPR spacer acquisition from RNA by a natural reverse transcriptase-Cas1 fusion protein.

    PubMed

    Silas, Sukrit; Mohr, Georg; Sidote, David J; Markham, Laura M; Sanchez-Amat, Antonio; Bhaya, Devaki; Lambowitz, Alan M; Fire, Andrew Z

    2016-02-26

    CRISPR systems mediate adaptive immunity in diverse prokaryotes. CRISPR-associated Cas1 and Cas2 proteins have been shown to enable adaptation to new threats in type I and II CRISPR systems by the acquisition of short segments of DNA (spacers) from invasive elements. In several type III CRISPR systems, Cas1 is naturally fused to a reverse transcriptase (RT). In the marine bacterium Marinomonas mediterranea (MMB-1), we showed that a RT-Cas1 fusion protein enables the acquisition of RNA spacers in vivo in a RT-dependent manner. In vitro, the MMB-1 RT-Cas1 and Cas2 proteins catalyze the ligation of RNA segments into the CRISPR array, which is followed by reverse transcription. These observations outline a host-mediated mechanism for reverse information flow from RNA to DNA. PMID:26917774

  2. Spacer/Linker Based Synthesis and Biological Evaluation of Mutual Prodrugs as Antiinflammatory Agents

    PubMed Central

    Velingkar, V. S.; Jain, D. R.; Ahire, D. C.

    2010-01-01

    Mutual prodrugs of some antiinflammatory agents were synthesized with the aim of improving the therapeutic index through prevention of gastrointestinal complications and to check the efficiency of release of the parent drug in presence of spacer. These mutual prodrugs were synthesized by direct condensation method using dicyclohexyl carbodiimide as a coupling agent and glycine as a spacer. The title compounds were characterized by spectral techniques and the release of the parent drug from mutual prodrug was studied in two different non-enzymatic buffer solutions at pH 1.2, pH 7.4 and in 80% human plasma. All mutual prodrugs exhibited encouraging hydrolysis profile in 80% human plasma. Biological activity of title compounds was studied by carrageenan-induced paw edema method. From the results obtained, it was concluded that these compounds retain the antiinflammatory action. PMID:21694998

  3. Effect of spacer layer on the magnetization dynamics of permalloy/rare-earth/permalloy trilayers

    SciTech Connect

    Luo, Chen Yin, Yuli; Zhang, Dong; Jiang, Sheng; Yue, Jinjin; Zhai, Ya; Du, Jun; Zhai, Hongru

    2015-05-07

    The permalloy/rare-earth/permalloy trilayers with different types (Gd and Nd) and thicknesses of spacer layer are investigated using frequency dependence of ferromagnetic resonance (FMR) measurements at room temperature, which shows different behaviors with different rare earth spacer layers. By fitting the frequency dependence of the FMR resonance field and linewidth, we find that the in-plane uniaxial anisotropy retains its value for all samples, the perpendicular anisotropy remains almost unchanged for different thickness of Gd layer but the values are tailored by different thicknesses of Nd layer. The Gilbert damping is almost unchanged with different thicknesses of Gd; however, the Gilbert damping is significantly enhanced from 8.4×10{sup −3} to 20.1×10{sup −3} with 6 nm of Nd and then flatten out when the Nd thickness rises above 6 nm.

  4. Synthesis, Characterization and Biological Studies of New Linear Thermally Stable Schiff Base Polymers with Flexible Spacers.

    PubMed

    Qureshi, Farah; Khuhawar, Muhammad Yar; Jahangir, Taj Muhammad; Channar, Abdul Hamid

    2016-01-01

    Five new linear Schiff base polymers having azomethine structures, ether linkages and extended aliphatic chain lengths with flexible spacers were synthesized by polycondensation of dialdehyde (monomer) with aliphatic and aromatic diamines. The formation yields of monomer and polymers were obtained within 75-92%. The polymers with flexible spacers of n-hexane were somewhat soluble in acetone, chloroform, THF, DMF and DMSO on heating. The monomer and polymers were characterized by melting point, elemental microanalysis, FT-IR, (1)HNMR, UV-Vis spectroscopy, thermogravimetry (TG), differential thermal analysis (DTA), fluorescence emission, scanning electron microscopy (SEM) and viscosities and thermodynamic parameters measurements of their dilute solutions. The studies supported formation of the monomer and polymers and on the basis of these studies their structures have been assigned. The synthesized polymers were tested for their antibacterial and antifungal activities. PMID:26970795

  5. Sequence variation in the ribosomal DNA internal transcribed spacer of Tridacna crocea.

    PubMed

    Yu, E T; Juinio-Meñez, M A; Monje, V D

    2000-11-01

    DNA-based genetic markers are needed to augment existing allozyme markers in the assessment of genetic diversity of wild giant clam populations. The dearth of polymorphic mitochondrial DNA regions amplified from known universal polymerase chain reaction (PCR) primers has led us to search other regions of the genome for viable sources of DNA polymorphism. We have designed tridacnid-specific PCR primers for the amplification of internal transcribed spacer regions. Sequences of the first internal transcribed spacer segment (ITS-1) revealed very high polymorphism, showing 29% variation arising from base substitutions alone. Preliminary restriction analysis of the ITS regions using 8 restriction enzymes revealed cryptic changes in the DNA sequence. These mutations are promising as marker tools for differentiating geographically separated populations. Such variation in the ITS region can possibly be used for population genetic analysis.

  6. The effect of charge-reversal amphiphile spacer composition on DNA and siRNA delivery

    PubMed Central

    Zhang, Xiao-Xiang; Prata, Carla A. H.; McIntosh, Thomas J.; Barthélémy, Philippe; Grinstaff, Mark W.

    2010-01-01

    A series of charge-reversal amphiphiles with different spacers separating the head group from the hydrophobic chains are described for delivery of DNA and siRNA. Among them, the amphiphiles possessing a glycine spacer (e.g., B-GlyGly) showed effective DNA transfection in CHO and NIH 3T3 cells as well as siRNA gene knockdown in HepG2 and UASMC cells. Ethidium bromide quenching assays revealed that DNA was released the fastest from the lipoplex of B-GlyGly in the presence of esterase. Also, X-ray diffraction results indicated that the DNA was located between the adjacent lipid bilayers in the lipoplex of B-GlyGly. These distinct features appear to be required for high transfection activity. PMID:20433165

  7. Analysis of sound absorption of tuck spacer fabrics to reduce automotive noise

    NASA Astrophysics Data System (ADS)

    Dias, Tilak; Monaragala, Ravindra; Needham, Peter; Lay, Edward

    2007-08-01

    Textiles are widely used in the automotive industry to provide both comfort to the passengers and an aesthetic appearance to the automotive interior. They can also be used to reduce automotive interior noise, which can make automotive travel safer and more comfortable. Knitted fabrics are used widely in automotive upholstery; however, the sound absorbency of a single layer of a knitted fabric is inadequate for the reduction of automotive interior noise. This paper investigates the sound absorbency of a novel knitted spacer fabric, which can be used in automotive upholstery and has the potential for greater sound absorbency than a conventional plain knitted fabric and its derivatives. The spacer fabric is modelled as a porous sound absorber and its sound absorbency is studied with regard to its structural parameters.

  8. Enhanced spin-torque in double tunnel junctions using a nonmagnetic-metal spacer

    SciTech Connect

    Chen, C. H.; Cheng, Y. H.; Ko, C. W.; Hsueh, W. J.

    2015-10-12

    This study proposes an enhancement in the spin-transfer torque of a magnetic tunnel junction (MTJ) designed with double-barrier layer structure using a nonmagnetic metal spacer, as a replacement for the ferromagnetic material, which is traditionally used in these double-barrier stacks. Our calculation results show that the spin-transfer torque and charge current density of the proposed double-barrier MTJ can be as much as two orders of magnitude larger than the traditional double-barrier one. In other words, the proposed double-barrier MTJ has a spin-transfer torque that is three orders larger than that of the single-barrier stack. This improvement may be attributed to the quantum-well states that are formed in the nonmagnetic metal spacer and the resonant tunneling mechanism that exists throughout the system.

  9. Synthesis of photoresponsive cholesterol-based azobenzene organogels: dependence on different spacer lengths.

    PubMed

    Ren, Yuchun; Wang, Bin; Zhang, Xiuqing

    2015-01-01

    A series of azobenzene-cholesterol organogel compounds (M 0 -M 12 ) with different spacers were designed and synthesized. The molecular structures were confirmed by (1)H NMR and (13)C NMR spectroscopy. The rapid and reversible photoresponsive properties of the compounds were investigated by UV-vis spectroscopy. Their thermal phase behaviors were studied by DSC. The length of the spacer plays a crucial role in the gelation. Compound M 6 is the only one that can gelate in ethanol, isopropanol and 1-butanol and the reversible gel-sol transitions are also investigated. To obtain visual insight into the microstructure of the gels, the typical structures of the xerogels were studied by SEM. Morphologies of the aggregates change from flower-like, network and rod with different sizes. By using IR and XRD characterization, it is found that intermolecular H-bonding, the solvents and van der Waals interaction are the main contributions to the specific superstructure.

  10. Differentiation of Enterococcus faecium from Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus strains by PCR and dot-blot hybridisation.

    PubMed

    Langa, S; Fernández, A; Martín, R; Reviriego, C; Marín, M L; Fernández, L; Rodríguez, J M

    2003-12-01

    Variations in length and sequence of the 16S/23S spacer region of Enterococcus faecium provided the basis for development of simple PCR and dot-blot hybridisation assays that enabled the differentiation of potentially probiotic Enterococcus faecium strains from Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus. Such assays may be useful for differentiation of yoghurt starter cultures and enterococcal strains when they are simultaneously present in probiotic food products.

  11. Effect of siloxane spacer length on organosilicon bi-quaternary ammonium amphiphiles.

    PubMed

    Hao, Chuanming; Cui, Yuezhi; Yang, Pengfei; Zhang, Huayong; Mao, Dejiang; Cui, Xiao; Li, Junying

    2015-04-01

    A series of organosilicon Bola-form bi-quaternary ammonium amphiphiles, [OH5C3(C2H5)2N+-(CH2)3-Si(CH2)3-O-(Si(CH3)2O)n-Si(CH2)3⋯(CH2)3-N+(C2H5)2C3H5O]Cl2- (SinN2Cl2, n=0, 4, 6, 8), with the same headgroups and different length of hydrophobic linkage has been synthesized. The critical micelle concentration (CMC) of each amphiphiles was determined by equilibrium surface tension. With the increased length of hydrophobic siloxane spacer, the CMC values follow the order of Si8N2Cl2spacer and its internal oxygen atom, which make the molecular stretch free. The antimicrobial property of Si4N2Cl2 is more effective than others below the concentration of CMC, while the antimicrobial property of Si8N2Cl2 is more effective above the concentration of CMC, which indicated that both the adsorbability in formation of micellar and the hydrophobicity arising from the different length of siloxane spacer are important to inhibit microbe. Moreover, their wetting ability has been characterized by contact angles on various material surfaces. It shows that the higher weight of lipophilic siloxane spacer leads to lower contact angels.

  12. Treatment of persistent extraarticular infection using a temporary cement spacer on the tibia after ACL reconstruction.

    PubMed

    Jung, Kwang Am; Lee, Soo Chan; Song, Moon Bok; Lee, Choon Key

    2008-01-01

    Postoperative infection after anterior cruciate ligament (ACL) reconstruction is an uncommon but serious complication. Although several treatments for intraarticular infection have been reported, no report has been recorded on the treatment of persistent extraarticular infections. The authors experienced reconstructed graft removal due to a refractory extraarticular infection on tibia. Early ACL reimplantation was performed using a temporary cement spacer containing antibiotics and a irradiated bone patellar tendon bone allograft.

  13. Molecular Identification of Two Strains of Phellinus sp. by Internal Transcribed Spacer Sequence Analysis

    PubMed Central

    2011-01-01

    Two species of cultivated Phellinus sp. were identified as P. baumii by internal transcribed spacer (ITS) sequence analysis. The fruit bodies of the examined strains were similar to those of naturally occurring strains, having a bracket-like form, yellow-to-orange color, and poroid hymenial surfaces. The DNA sequences of ITS region of both strains showed a homology of 99% with ITS1 to ITS2 sequences of P. (Inonotus) baumii strain PB0806. PMID:22783119

  14. Numerical study on the effect of design parameters and spacers on RPC signal and timing properties

    NASA Astrophysics Data System (ADS)

    Jash, A.; Majumdar, N.; Mukhopadhyay, S.; Saha, S.; Chattopadhyay, S.

    2016-09-01

    Numerical calculations have been performed to understand the reason for the observed non-uniform response of a Resistive Plate Chamber (RPC) in a few critical regions such as near edge spacers and corners of the device. In this context, the signal from a RPC due to the passage of muons through different regions has been computed. Also, a simulation of RPC timing properties is presented along with the effect of the applied field, gas mixture and geometrical components.

  15. Indirect adaptive stabilization of a large, flexible, spinning spacering Simulation studies

    NASA Technical Reports Server (NTRS)

    Hamm, A. L.; Johnson, C. R., Jr.

    1979-01-01

    A recently formulated approach to the adaptive control of distributed systems combines the simultaneous identification and control philosophy of indirect adaptive control with a modal expansion description of distributed systems. The regulation of a large, flexible, spinning spacering, one half of a dual momentum control device proposed for attitude control of large space systems, provides the example upon which the capabilities of such a synthesis method are tested via simulation.

  16. Treatment of persistent extraarticular infection using a temporary cement spacer on the tibia after ACL reconstruction.

    PubMed

    Jung, Kwang Am; Lee, Soo Chan; Song, Moon Bok; Lee, Choon Key

    2008-01-01

    Postoperative infection after anterior cruciate ligament (ACL) reconstruction is an uncommon but serious complication. Although several treatments for intraarticular infection have been reported, no report has been recorded on the treatment of persistent extraarticular infections. The authors experienced reconstructed graft removal due to a refractory extraarticular infection on tibia. Early ACL reimplantation was performed using a temporary cement spacer containing antibiotics and a irradiated bone patellar tendon bone allograft. PMID:17899003

  17. Plastic bottles as spacers for a pressurized metered-dose inhaler: in vitro characteristics.

    PubMed

    Kissoon, N; Teelucksingh, S; Blake, K V; Kesser, B; Murphy, S P; Geller, D

    2001-09-01

    Homemade spacer devices are commonly used by children with asthma to improve aerosol deposition from pressurized metered dose inhalers (pMDI); however, the efficacy and efficiency of these devices are not fully characterized. We determined the quality of fine particle fraction (< 4.7 microns) and ultrafine particle fraction (< 3.3 microns) of three bottles (from 280 ml to 500 ml) commonly used as spacers in Trinidad and Tobago and compared their performance to the commercially available valved holding chamber (OpT) and pMDI. These data were obtained in vitro using a cascade impactor. All 3 bottles and the OpT were similar (p > 0.05) in reducing the amount of albuterol emitted as large particles (> 4.7 microns) to less than 10 micrograms. The different sized bottles (from 280 ml to 500 ml) produced identical quantities of albuterol in the fine particle and ultrafine particle ranges (p > 0.05). All of the sample bottle spacers emitted a higher amount (p < 0.002) of fine and ultrafine particles than the OpT and pMDI alone. The OpT resulted in a significantly higher fraction of fine particles (p < 0.05) and a greater quantity of drug (p < 0.05) in the ultrafine range as compared to the MDI only. The sizes of particles obtained from the bottle spacers are those that have a high probability of reaching the lower airway; however, the clinical relevance of these findings remains to be determined. PMID:11769021

  18. Accuracy of Different Putty-Wash Impression Techniques with Various Spacer Thickness

    PubMed Central

    Arora, Aman; Singh, Vijay Pratap

    2012-01-01

    ABSTRACT One of the most important steps is accurate impression making for fabrication of fixed partial denture. The two different putty-wash techniques that are commonly used are: (1) Putty-wash one-step technique, (2) putty-wash two-step technique. A uniform wash space is needed for an accurate impression. Nissan et al recommended the use of two-step technique for accurate impression making as there is uniform wash space for the light body material to polymerize. The aim of the present study was to compare the accuracy of stone casts obtained from different putty-wash impression techniques using various spacer thickness. The critical factor that influences the accuracy of putty-wash impression techniques is the controlled wash bulk which is absent in one-step putty-wash impression technique and with polyethylene spacer was used. How to cite this article: Chugh A, Arora A, Singh VP. Accuracy of Different Putty-Wash Impression Techniques with Various Spacer Thickness. Int J Clin Pediatr Dent 2012;5(1):33-38. PMID:25206132

  19. [The use of SPACER in the surgical treatment of periendoprosthetic hip infections--own experience].

    PubMed

    Zieńczuk, Witold; Janowiec, Sebastian; Bednarenko, Marcin

    2015-01-01

    The work presents the results of the treatment of 6 patients with periendoprosthetic hip infection with the use of the spacer in the Orthopaetic-Traumatic Ward between 01. 09. 2010 and 31. 12. 2013. Each case of infection was treated in two stages. In the first stage, the primary endoprothesis and inflammatory site were removed, and SPACER was implanted. In the second stage, after subsidence of clinical and laboratory symptoms of infection, the surgery was performed involving exchange of the SPACER to a revisory endoprothesis . All the patients were administered Vancomicine intravenously from the day of surgery until the results of bacterial culture were obtained. Then the antibiotic was given intravenously according to the antibiogram for 10 days; in case of negative culture, the therapy with Vancmicinewas continued for 10 days. This was followed by the administration of an oral antibiotic according to antibiogram for 6 weeks, and in case of negative culture, Biseptol 2 x 960 mg was given also for 6 weeks. The second stage of the procedure was carried out between the third and sixth month after the first surgery. In 5 patients inflammatory condition subsided, and a functional result was assessed by the patients as good. In one case inflammation did not heal and the patient remains with "hanging hip"; the result of the treatment was assessed as bad. PMID:26827556

  20. Plane wave scattering from a plasmonic nanowire array spacer-separated from a plasmonic film

    NASA Astrophysics Data System (ADS)

    Thomas, Arun; Trivedi, Rahul; Dhawan, Anuj

    2016-06-01

    In this paper, we present a theoretical analysis of the electromagnetic response of a plasmonic nanowire–spacer–plasmonic film system. The analytical solution presented in this paper is a full-wave solution, which is used to compute the fields scattered by the plasmonic nanostructure system on illumination by a plane electromagnetic wave. The physical structure comprises of an array of plasmonic nanowires made of a plasmonic metal such as gold or silver placed over a plasmonic film of the same material and separated from it by a dielectric spacer such as silica or alumina. Such a nanostructure exhibits a spectrum that is extremely sensitive to various geometric and electromagnetic parameters such as spacer thickness and spacer refractive index, which makes it favourable for various sensing applications such as chemical and biological sensing, strain sensing, position sensing, vibration sensing, and thickness sensing. We report a comparison of our analytical solution with a numerical rigorous coupled wave analysis of the same structure with the plasmonic medium being treated as local in nature.

  1. Effects of water-soluble spacers on the hydrophobic association of fluorocarbon modified polyacrylamide

    SciTech Connect

    Hwang, F.S.; Hogen-Esch, T.E.

    1993-12-31

    A number of acrylamide-acrylate copolymers were synthesized in which the acrylate (CH{sub 2}=CHCOO(CH{sub 2}CH{sub 2}O){sub n}R{sub t}) is hydrophobic on account of the presence of a 1,1-dihydroperfluorooctyl group (R{sub F}) connected to the acrylate via a-(CH{sub 2}CH{sub 2}O){sub n} hydrophobic spacer (n=0-3). Copolymerization of the two comonomers was carried out in aqueous media in the presence of potassium perfluoro octanoate and acetone (10 vol%) and was initiated by sodium metabisufite and ammonium persulfate at 50{degrees}C. The Brookfield viscosities measured at 0.4 sec{sup {minus}1} as a function of comonomer molar content gave bell-shaped curves having maxima at .10-.15 mole% comonomer except for the comonomer without hydrophilic spacer (n=0) where the maximum is at .60 mole%. The viscosity maxima of the copolymers are quite dependent on the value of n giving the highest viscosities at n=3 (45,000 cp) that decreases value of n. The increased effectiveness of the longer spacers is attributed to decreased intermolecular excluded volume effects in the formation of the polymer assemblies.

  2. Accuracy of different putty-wash impression techniques with various spacer thickness.

    PubMed

    Chugh, Anshul; Arora, Aman; Singh, Vijay Pratap

    2012-01-01

    One of the most important steps is accurate impression making for fabrication of fixed partial denture. The two different putty-wash techniques that are commonly used are: (1) Putty-wash one-step technique, (2) putty-wash two-step technique. A uniform wash space is needed for an accurate impression. Nissan et al recommended the use of two-step technique for accurate impression making as there is uniform wash space for the light body material to polymerize. The aim of the present study was to compare the accuracy of stone casts obtained from different putty-wash impression techniques using various spacer thickness. The critical factor that influences the accuracy of putty-wash impression techniques is the controlled wash bulk which is absent in one-step putty-wash impression technique and with polyethylene spacer was used. How to cite this article: Chugh A, Arora A, Singh VP. Accuracy of Different Putty-Wash Impression Techniques with Various Spacer Thickness. Int J Clin Pediatr Dent 2012;5(1):33-38.

  3. Heat transfer enhancement with mixing vane spacers using the field synergy principle

    NASA Astrophysics Data System (ADS)

    Yang, Lixin; Zhou, Mengjun; Tian, Zihao

    2016-08-01

    The single-phase heat transfer characteristics in a PWR fuel assembly are important. Many investigations attempt to obtain the heat transfer characteristics by studying the flow features in a 5´5 rod bundle with a spacer grid. The field synergy principle is used to discuss the mechanism of heat transfer enhancement using mixing vanes according to computational fluid dynamics results, including a spacer grid without mixing vanes, one with a split mixing vane, and one with a separate mixing vane. The results show that the field synergy principle is feasible to explain the mechanism of heat transfer enhancement in a fuel assembly. The enhancement in subchannels is more effective than on the rod's surface. If the pressure loss is ignored, the performance of the split mixing vane is superior to the separate mixing vane based on the enhanced heat transfer. Increasing the blending angle of the split mixing vane improves heat transfer enhancement, the maximum of which is 7.1%. Increasing the blending angle of the separate mixing vane did not significantly enhance heat transfer in the rod bundle, and even prevented heat transfer at a blending angle of 50°. This finding testifies to the feasibility of predicting heat transfer in a rod bundle with a spacer grid by field synergy, and upon comparison with analyzed flow features only, the field synergy method may provide more accurate guidance for optimizing the use of mixing vanes.

  4. Design, Synthesis and Hydrolytic Behavior of Mutual Prodrugs of NSAIDs with Gabapentin Using Glycol Spacers

    PubMed Central

    Mahdi, Monther Faisal; Alsaad, Hiba Najeh

    2012-01-01

    The free –COOH present in NSAIDs is thought to be responsible for the GI irritation associated with all traditional NSAIDs. Exploitation of mutual prodrugs is an approach wherein the NSAID is covalently bounded to a second pharmacologically active carrier/drug with the ultimate aim of reducing the gastric irritation. In this study some NSAIDs were conjugated with gabapentin via ester bonds using glycol spacers with the expectation of reducing gastric adverse effects and obtaining synergistic analgesic effects. The kinetics of ester hydrolysis were studied in two different non enzymatic buffer solutions at pH 1.2 and 7.4, as well as in 80% human plasma using HPLC with chloroform -methanol as mobile phase. Compounds 9a–c with ethylene glycol spacers showed significant stability at buffer solutions with half lives ranging from about 8–25 h, while the underwent a reasonable plasma hydrolysis (49%–88%) in 2 h. Compound 9d with a propylene glycol spacer shows a higher rate of enzymatic hydrolysis than the corresponding ethylene glycol compound 9c. The result of compounds 9a-c indicate that these compounds may be stable during their passage through the GIT until reaching the blood circulation. PMID:24281258

  5. Transport and deposition of pharmaceutical particles in three commercial spacer-MDI combinations.

    PubMed

    Yazdani, A; Normandie, M; Yousefi, M; Saidi, M S; Ahmadi, G

    2014-11-01

    Respiratory drug delivery has been under the research spotlight for the past few decades, mainly due to the high incidence of pulmonary diseases and the fact that this type of delivery offers the highest efficiency for treatment. Despite its invaluable benefits, there are some major drawbacks to respiratory drug delivery, the most important of which being poor delivery efficiency and relatively high drug deposition in undesirable regions, such as the mouth cavity. One way to improve the efficiency of respiratory drug delivery with metered-dose inhalers is placing a respiratory spacer between the inhaler exit and the mouth. It is argued that high drug deposition in the immediate airways of the respiratory system is strongly affected by relatively high initial momentum of pharmaceutical particles leaving the inhaler. A respiratory spacer, however, can provide an expansion region in which the initial momentum of particles can subside. As a result, particles enter the patient׳s oral cavity more gradually and are more likely to reach the desired regions. In this study, the effectiveness of using three commercial spacers paired with a commercial inhaler is examined through numerical investigation of fluid flow and particle transport phenomena. Particles ranging from 1 to 50 µm in diameter are tracked using a Lagrangian point of view and fluid flow fields are resolved using the LRN k-ω turbulence model. A novel particle injection method is introduced and is demonstrated to be able to adequately capture the effects of particle initial momentum. Lastly, a few design suggestions are made.

  6. Structure and variation of human ribosomal DNA: the external transcribed spacer and adjacent regions.

    PubMed Central

    Wilson, G N; Szura, L L; Rushford, C; Jackson, D; Erickson, J

    1982-01-01

    A group of human ribosomal DNA (rDNA) recombinants that include the probable site for initiation of transcription have been examined for sequence polymorphism. A detailed restriction map of one rDNA insert was constructed using plasmid subclones and end-labeled segments. Comparison of 16 similar rDNA inserts by restriction and heteroduplex analysis demonstrated striking conservation of the external transcribed spacer and 18S gene regions, but defined a region where restriction sites for the enzymes Sma I, Hpa II, and Hha I become frequent or variable. This region extends for about 400--800 base pairs (bp) at the left end of the rDNA insert and is postulated to contain nontranscribed spacer sequences. The use of cloned rDNA segments as probes for the restriction analysis of genomic rDNA has demonstrated certain fixed sites in the nontranscribed spacer that do not vary significantly among different individuals or tumor cell lines. In contrast, restriction with the enzyme Sal I reveals several variable fragments, one of which has been found only in a retinoblastoma cell line. Images Fig. 6 Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:6282117

  7. Visible light dynamical diffraction in a 1-D photonic crystal-based interferometer with an extremely thin spacer layer

    NASA Astrophysics Data System (ADS)

    Prudnikov, I. R.

    2016-01-01

    Properties of light diffraction in a Fabry-Pérot-like interferometer composed of two 1-D photonic crystals and a nanometer-thick spacer layer are analytically investigated. It is shown that the resonant enhancement of light wave intensity in such a layer is possible because of light dynamical diffraction from the photonic crystals of the interferometer. Numerical simulations of (i) light reflectivity and transmittance curves of the interferometer having an ultra-thin spacer layer (its thickness changes from less than 1 nm to about 10 nm) and (ii) the resonant distribution of the light wave intensity in the vicinity of the layer are performed. Based on the numerical simulations, potentialities for the determination of the structural parameters (e.g., thicknesses and refraction indexes) of ultra-thin spacer films are discussed. A difference is found to appear in resonant intensity enhancements inside the ultra-thin spacer layers between s- and p-polarized light waves.

  8. Binding of 12-s-12 dimeric surfactants to calf thymus DNA: Evaluation of the spacer length influence.

    PubMed

    Sarrión, Beatriz; Bernal, Eva; Martín, Victoria Isabel; López-López, Manuel; López-Cornejo, Pilar; García-Calderón, Margarita; Moyá, María Luisa

    2016-08-01

    Several cationic dimeric surfactants have shown high affinity towards DNA. Bis-quaternary ammonium salts (m-s-m) have been the most common type of dimeric surfactants investigated and it is generally admitted that those that posses a short spacer (s≤3) show better efficiency to bind or compact DNA. However, experimental results in this work show that 12-s-12 surfactants with long spacers make the surfactant/ctDNA complexation more favorable than those with short spacers. A larger contribution of the hydrophobic interactions, which control the binding Gibbs energy, as well as a higher average charge of the surfactant molecules bound to the nucleic acid, which favors the electrostatic attractions, could explain the experimental observations. Dimeric surfactants with intermediate spacer length seem to be the less efficient for DNA binding.

  9. Modifying exchange-spring behavior of CoPt/NiFe bilayer by inserting a Pt or Ru spacer

    SciTech Connect

    Hsu, Jen-Hwa Tsai, C. L.; Lee, C.-M.; Saravanan, P.

    2015-05-07

    We herein explore the possibility of obtaining tunable tilted magnetic anisotropy in ordered-CoPt (5 nm)/NiFe(t{sub NiFe}) bilayers through modifying their exchange spring behavior by inserting Pt and Ru-spacers. The tuning process of tilt angle magnetization of NiFe-layer was systematically investigated by varying the Pt or Ru thickness (t{sub Pt} or t{sub Ru}) from 0 to 8 nm at different thicknesses of NiFe (t{sub NiFe} = 1.5, 4.0, and 6.0 nm). Polar magneto-optic Kerr effect (p-MOKE) studies reveal that the bilayers grown in absence of spacers exhibit almost a rectangular hysteresis loop. With the insertion of Pt-spacer, the loop becomes more and more tilted as t{sub Pt} increases; whereas, in the case of Ru-spacer, the nature of the loops is not simply changing in one direction. The estimated SQR{sub ⊥} (= θ{sub r}/θ{sub s}) values from the p-MOKE loops are found to monotonically decrease with increasing t{sub Pt} when t{sub Pt} ≦ 4 nm. In contrast, in the case of Ru-spacer, an oscillatory behavior for the SQR{sub ⊥} values is apparent when t{sub Ru} ≦ 4 nm. As a result, an oscillatory tilted angle of NiFe spin configuration was obtained in the case of Ru-spacer; while a decoupling effect was prominent for the Pt-spacer. The results of present study reveal that the insertion of Pt and Ru-spacers as an appropriate means for realizing tunable tilted magnetic anisotropy in the CoPt/NiFe exchange springs.

  10. Postfusion magnetic resonance imaging artifacts caused by a titanium, cobalt-chromium-molybdenum, and carbon intervertebral disc spacer.

    PubMed

    Ernstberger, Thorsten; Heidrich, Gabert

    2007-04-01

    Intervertebral spacers for anterior spine fusion are made of different materials, such as titanium and CoCrMo-alloys or carbon fiber reinforced polymers (CFRP). Implant-related susceptibility artifacts can decrease the quality of magnetic resonance imaging (MRI) scans. This cadaveric study aimed to demonstrate the extent that implant-related MRI artifacting affects the postfusion differentiation of the spinal canal (SC) and intervertebral disc space (IDS). In 6 cadaveric porcine spines, we evaluated the postimplantation MRI scans of a titanium, CoCrMo-spacer and CFRP-spacer that differed in shape and surface qualities. A spacer made of human cortical bone was used as a control. A defined evaluation unit was divided into regions of interest (ROI) to characterize the SC and IDS. Considering 15 different MRI sequences read independently by an interobserver-validated team of specialists artifact-affected image quality of the median MRI slice was rated on a score of 0-1-2-3. A maximum score of 15 points for the SC and 9 points for the IDS (100%) was possible. Turbo spin echo sequences produced the best scores for both spacers and the control. Only the control achieved a score of 100%. For the IDS the CoCrMo-spacer, titanium and CFRP-spacer maximally scored 0%, 0% and 74%, for the SC 60%, 80% and 99%, respectively. By using favored T1 TSE sequences the CFRP-spacer represented clear advantages in postfusion spinal imaging. Independent of artifact dimensions the used scoring system allowed us to create an implant-related ranking of MRI scan quality in reference to the bone control.

  11. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  12. A Rationale for Going Back to the Future: Use of Disposable Spacers for Pressurised Metered Dose Inhalers.

    PubMed

    Sanders, Mark; Bruin, Ronald

    2015-01-01

    The introduction of pressurised metered dose inhalers (MDIs) in the mid-1950s completely transformed respiratory treatment. Despite decades of availability and healthcare support and development of teaching aids and devices to promote better use, poor pMDI user technique remains a persistent issue. The main pMDI user aid is the spacer/valved holding chamber (VHC) device. Spacer/chamber features (size, shape, configuration, construction material, and hygiene considerations) can vie with clinical effectiveness (to deliver the same dose as a correctly used pMDI), user convenience, cost, and accessibility. Unsurprisingly, improvised, low-cost alternatives (plastic drink bottles, paper cups, and paper towel rolls) have been pressed into seemingly effective service. A UK law change permitting schools to hold emergency inhalers and spacers has prompted a development project to design a low-cost, user-friendly, disposable, and recyclable spacer. This paper spacer requires neither preuse priming nor washing, and has demonstrated reproducible lung delivery of salbutamol sulphate pMDI, comparable to an industry-standard VHC, an alternative paperboard VHC, and pMDI alone. This new device appears to perform better than these other VHC devices at the low flow rates thought achievable by paediatric patients. The data suggest that this disposable spacer may have a place in the single-use emergency setting. PMID:26491563

  13. The non-signaling extracellular spacer domain of chimeric antigen receptors is decisive for in vivo antitumor activity

    PubMed Central

    Hudecek, Michael; Sommermeyer, Daniel; Kosasih, Paula L.; Silva-Benedict, Anne; Liu, Lingfeng; Rader, Christoph; Jensen, Michael C.; Riddell, Stanley R.

    2015-01-01

    The use of synthetic chimeric antigen receptors (CAR) to redirect T cells to recognize tumor provides a powerful new approach to cancer immunotherapy; however the attributes of CARs that ensure optimal in vivo tumor recognition remain to be defined. Here, we analyze the influence of length and composition of IgG-derived extracellular spacer domains on the function of CARs. Our studies demonstrate that CD19-CARs with a long spacer from IgG4 hinge-CH2-CH3 are functional in vitro but lack antitumor activity in vivo due to interaction between the Fc domain within the spacer and the Fc receptor-bearing myeloid cells, leading to activation-induced T-cell death. We demonstrate that in vivo persistence and antitumor effects of CAR-T-cells with a long spacer can be restored by modifying distinct regions in the CH2 domain that are essential for Fc receptor binding. Our studies demonstrate that modifications that abrogate binding to Fc receptors are crucial for CARs in which a long spacer is obligatory for tumor recognition as shown here for a ROR1-specific CAR. These results demonstrate that the length and composition of the extracellular spacer domain that lacks intrinsic signaling function can be decisive in the design of CARs for optimal in vivo activity. PMID:25212991

  14. A Rationale for Going Back to the Future: Use of Disposable Spacers for Pressurised Metered Dose Inhalers

    PubMed Central

    Sanders, Mark; Bruin, Ronald

    2015-01-01

    The introduction of pressurised metered dose inhalers (MDIs) in the mid-1950s completely transformed respiratory treatment. Despite decades of availability and healthcare support and development of teaching aids and devices to promote better use, poor pMDI user technique remains a persistent issue. The main pMDI user aid is the spacer/valved holding chamber (VHC) device. Spacer/chamber features (size, shape, configuration, construction material, and hygiene considerations) can vie with clinical effectiveness (to deliver the same dose as a correctly used pMDI), user convenience, cost, and accessibility. Unsurprisingly, improvised, low-cost alternatives (plastic drink bottles, paper cups, and paper towel rolls) have been pressed into seemingly effective service. A UK law change permitting schools to hold emergency inhalers and spacers has prompted a development project to design a low-cost, user-friendly, disposable, and recyclable spacer. This paper spacer requires neither preuse priming nor washing, and has demonstrated reproducible lung delivery of salbutamol sulphate pMDI, comparable to an industry-standard VHC, an alternative paperboard VHC, and pMDI alone. This new device appears to perform better than these other VHC devices at the low flow rates thought achievable by paediatric patients. The data suggest that this disposable spacer may have a place in the single-use emergency setting. PMID:26491563

  15. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.

    PubMed

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments.

  16. Microdiversity of deep-sea Bacillales isolated from Tyrrhenian sea sediments as revealed by ARISA, 16S rRNA gene sequencing and BOX-PCR fingerprinting.

    PubMed

    Ettoumi, Besma; Guesmi, Amel; Brusetti, Lorenzo; Borin, Sara; Najjari, Afef; Boudabous, Abdellatif; Cherif, Ameur

    2013-01-01

    With respect to their terrestrial relatives, marine Bacillales have not been sufficiently investigated. In this report, the diversity of deep-sea Bacillales, isolated from seamount and non-seamount stations at 3,425 to 3,580 m depth in the Tyrrhenian Sea, was investigated using PCR fingerprinting and 16S rRNA sequence analysis. The isolate collection (n=120) was de-replicated by automated ribosomal intergenic spacer analysis (ARISA), and phylogenetic diversity was analyzed by 16S rRNA gene sequencing of representatives of each ARISA haplotype (n=37). Phylogenetic analysis of isolates showed their affiliation to six different genera of low G+C% content Gram-positive Bacillales: Bacillus, Staphylococcus, Exiguobacterium, Paenibacillus, Lysinibacillus and Terribacillus. Bacillus was the dominant genus represented by the species B. licheniformis, B. pumilus, B. subtilis, B. amyloliquefaciens and B. firmus, typically isolated from marine sediments. The most abundant species in the collection was B. licheniformis (n=85), which showed seven distinct ARISA haplotypes with haplotype H8 being the most dominant since it was identified by 63 isolates. The application of BOX-PCR fingerprinting to the B. licheniformis sub-collection allowed their separation into five distinct BOX genotypes, suggesting a high level of intraspecies diversity among marine B. licheniformis strains. This species also exhibited distinct strain distribution between seamount and non-seamount stations and was shown to be highly prevalent in non-seamount stations. This study revealed the great microdiversity of marine Bacillales and contributes to understanding the biogeographic distribution of marine bacteria in deep-sea sediments. PMID:24005887

  17. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  18. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  19. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  20. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  1. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  2. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  3. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  4. Diversity in a Polymicrobial Community Revealed by Analysis of Viromes, Endolysins and CRISPR Spacers

    PubMed Central

    Treangen, Todd J.; Koren, Sergey; Pop, Mihai; Bhaya, Devaki

    2016-01-01

    The polymicrobial biofilm communities in Mushroom and Octopus Spring in Yellowstone National Park (YNP) are well characterized, yet little is known about the phage populations. Dominant species, Synechococcus sp. JA-2-3B'a(2–13), Synechococcus sp. JA-3-3Ab, Chloroflexus sp. Y-400-fl, and Roseiflexus sp. RS-1, contain multiple CRISPR-Cas arrays, suggesting complex interactions with phage predators. To analyze phage populations from Octopus Spring biofilms, we sequenced a viral enriched fraction. To assemble and analyze phage metagenomic data, we developed a custom module, VIRITAS, implemented within the MetAMOS framework. This module bins contigs into groups based on tetranucleotide frequencies and CRISPR spacer-protospacer matching and ORF calling. Using this pipeline we were able to assemble phage sequences into contigs and bin them into three clusters that corroborated with their potential host range. The virome contained 52,348 predicted ORFs; some were clearly phage-like; 9319 ORFs had a recognizable Pfam domain while the rest were hypothetical. Of the recognized domains with CRISPR spacer matches, was the phage endolysin used by lytic phage to disrupt cells. Analysis of the endolysins present in the thermophilic cyanophage contigs revealed a subset of characterized endolysins as well as a Glyco_hydro_108 (PF05838) domain not previously associated with sequenced cyanophages. A search for CRISPR spacer matches to all identified phage endolysins demonstrated that a majority of endolysin domains were targets. This strategy provides a general way to link host and phage as endolysins are known to be widely distributed in bacteriophage. Endolysins can also provide information about host cell wall composition and have the additional potential to be used as targets for novel therapeutics. PMID:27611571

  5. Diversity in a Polymicrobial Community Revealed by Analysis of Viromes, Endolysins and CRISPR Spacers.

    PubMed

    Davison, Michelle; Treangen, Todd J; Koren, Sergey; Pop, Mihai; Bhaya, Devaki

    2016-01-01

    The polymicrobial biofilm communities in Mushroom and Octopus Spring in Yellowstone National Park (YNP) are well characterized, yet little is known about the phage populations. Dominant species, Synechococcus sp. JA-2-3B'a(2-13), Synechococcus sp. JA-3-3Ab, Chloroflexus sp. Y-400-fl, and Roseiflexus sp. RS-1, contain multiple CRISPR-Cas arrays, suggesting complex interactions with phage predators. To analyze phage populations from Octopus Spring biofilms, we sequenced a viral enriched fraction. To assemble and analyze phage metagenomic data, we developed a custom module, VIRITAS, implemented within the MetAMOS framework. This module bins contigs into groups based on tetranucleotide frequencies and CRISPR spacer-protospacer matching and ORF calling. Using this pipeline we were able to assemble phage sequences into contigs and bin them into three clusters that corroborated with their potential host range. The virome contained 52,348 predicted ORFs; some were clearly phage-like; 9319 ORFs had a recognizable Pfam domain while the rest were hypothetical. Of the recognized domains with CRISPR spacer matches, was the phage endolysin used by lytic phage to disrupt cells. Analysis of the endolysins present in the thermophilic cyanophage contigs revealed a subset of characterized endolysins as well as a Glyco_hydro_108 (PF05838) domain not previously associated with sequenced cyanophages. A search for CRISPR spacer matches to all identified phage endolysins demonstrated that a majority of endolysin domains were targets. This strategy provides a general way to link host and phage as endolysins are known to be widely distributed in bacteriophage. Endolysins can also provide information about host cell wall composition and have the additional potential to be used as targets for novel therapeutics. PMID:27611571

  6. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  7. Ilizarov bone transport combined with antibiotic cement spacer for infected tibial nonunion

    PubMed Central

    Peng, Jing; Min, Li; Xiang, Zhou; Huang, Fuguo; Tu, Chongqi; Zhang, Hui

    2015-01-01

    Purpose: To evaluate the curative effect of Ilizarov bone transport combined with antibiotic cement spacer for infected tibial nonunion with bone defect. Methods: We retrospectively reviewed the outcomes of 58 patients with infected tibial nonunion from January 2008 to March 2011 at our institution. Patients were treated with complete debridement, radical sequestrectomy, antibiotic cement spacer implantation, bone transport using the Ilizarov external fixator, and soft tissue reconstruction. Clinical efficacy was assessed using Paley’s grading system and patient satisfaction at the last follow-up. Results: Follow-up ranged from 24 to 63 months (average, 31.6 months). Mean size of the tibial defect was 9.2 cm (range, 6-15 cm). The soft tissue defect was closed successfully in all cases. Patients eventually achieved union with a mean bone union index of 1.2 months/cm at an average of 10.6 months (range, 8-31 months). In terms of Paley grade, 30 patients had excellent results, 23 good, and 5 fair. Functional results were excellent in 28 patients, good in 18, and fair in 12. Thirty-five patients felt extremely satisfied, 18 satisfied, and 5 acceptable with the functional outcome. Complications included pin site infection in 18 cases, limb length discrepancy less than 1.5 cm in 10, knee stiffness in 5, equinus deformity in 4, infectious recurrence in 1 and pin breakage in 1. There was no refracture at the reconstruction site. Conclusion: Ilizarov bone transport combined with antibiotic cement spacer is a versatile and effective method for treatment of infected tibial nonunion. PMID:26309700

  8. Molecular design of spacer-N-linked sialoglycopolypeptide as polymeric inhibitors against influenza virus infection.

    PubMed

    Ogata, Makoto; Hidari, Kazuya I P J; Kozaki, Wataru; Murata, Takeomi; Hiratake, Jun; Park, Enoch Y; Suzuki, Takashi; Usui, Taichi

    2009-07-13

    A series of spacer-N-linked glycopolymers carrying long/short α2,3/6 sialylated glycan were designed as polymeric inhibitors of influenza virus. Lactose (Lac) and N-acetyllactosamine (LN: Galβ1,4GlcNAc) were first converted to spacer-N-linked disaccharide glycosides, followed by consecutive enzymatic addition of GlcNAc and Gal residues to the glycosides. The resulting spacer-N-linked glycosides with di-, tetra-, and hexasaccharides carrying a Lac, LN, lacto-N-neotetraose (LNnT: Galβ1,4GlcNAcβ1,3Galβ1,4Glc), and LNβ1,3LNnT were coupled to the carboxy group of γ-polyglutamic acid (γ-PGA) and enzymatically converted to glycopolypeptides carrying α2,3/6 sialylated glycans. The interactions of a series of sialoglycopolypeptides with avian and human influenza virus strains were investigated using a hemagglutination inhibition assay. The avian virus A/Duck/HongKong/313/4/78 (H5N3) bound specifically, regardless of the structure of the asialo portion. In contrast, human virus A/Aichi/2/68 (H3N2) bound preferentially to long α2,6sialylated glycans with penta- or heptasaccharides in a glycan length-dependent manner. Furthermore, the Sambucus sieboldiana (SNA) lectin was also useful as a model of human virus hemagglutinin (HA) for understanding the carbohydrate binding properties, because the recognition motifs of the inner sugar in the receptor were very similar.

  9. Current–voltage characteristics of organic heterostructure devices with insulating spacer layers

    SciTech Connect

    Yin, Sun; Nie, Wanyi; Mohite, Aditya D.; Saxena, Avadh; Smith, Darryl L.; Ruden, P. Paul

    2015-05-14

    The dark current density in donor/acceptor organic planar heterostructure devices at a given forward voltage bias can either increase or decrease when an insulating spacer layer is added between the donor and acceptor layers. The dominant current flow process in these systems involves the formation and subsequent recombination of interfacial exciplex states. If the exciplex recombination rate limits current flow, an insulating interface layer decreases the dark current. However, if the exciplex formation rate limits the current, an insulating interface layer may increase the dark current. As a result, we present a device model to describe this behavior, and we discuss relevant experimental data.

  10. Graphene-based thin film supercapacitor with graphene oxide as dielectric spacer

    NASA Astrophysics Data System (ADS)

    Liu, Jinzhang; Galpaya, Dilini; Notarianni, Marco; Yan, Cheng; Motta, Nunzio

    2013-08-01

    Thin film supercapacitors are produced by using electrochemically exfoliated graphene (G) and wet-chemically produced graphene oxide (GO). Either G/GO/G stacked film or sole GO film are sandwiched by two Au films to make devices, where GO is the dielectric spacer. The addition of graphene film can increase the capacitance about two times, compared to the simple Au electrode. It is found that the GO film has very high dielectric constant, accounting for the high capacitance. AC measurement reveals that the relative permittivity of GO is in the order of 104 within the frequency range of 0.1-70 Hz.

  11. Current–voltage characteristics of organic heterostructure devices with insulating spacer layers

    DOE PAGES

    Yin, Sun; Nie, Wanyi; Mohite, Aditya D.; Saxena, Avadh; Smith, Darryl L.; Ruden, P. Paul

    2015-05-14

    The dark current density in donor/acceptor organic planar heterostructure devices at a given forward voltage bias can either increase or decrease when an insulating spacer layer is added between the donor and acceptor layers. The dominant current flow process in these systems involves the formation and subsequent recombination of interfacial exciplex states. If the exciplex recombination rate limits current flow, an insulating interface layer decreases the dark current. However, if the exciplex formation rate limits the current, an insulating interface layer may increase the dark current. As a result, we present a device model to describe this behavior, and wemore » discuss relevant experimental data.« less

  12. Magnetotransport properties of spin-valve structures with Mg spacer layers

    NASA Astrophysics Data System (ADS)

    Martinez-Boubeta, C.; Ferrante, Y.; Parkin, S. S. P.

    2015-01-01

    A theoretical prediction by Wang et al. [Phys. Rev. B 82, 054405 (2010)] suggests the preferential transmission of majority-spin states with Δ1 symmetry across a magnesium interlayer in Fe/Mg/MgO/Fe based magnetic tunnel junctions. Here, we report experiments to probe this question in CoFe/Mg/CoFe structures. We find that the strength of the interlayer coupling decays exponentially with increasing the spacer thickness, however, a non-monotonic variation of the magnetoresistance as a function of the Mg layer is observed. These data may help revisit the role of the insertion of a Mg interface layer in MgO-based devices.

  13. Spacer defined double patterning for (sub-)20nm half pitch single damascene structures

    NASA Astrophysics Data System (ADS)

    Versluijs, Janko; Siew, Yong Kong; Kunnen, Eddy; Vangoidsenhoven, Diziana; Demuynck, Steven; Wiaux, Vincent; Dekkers, Harold; Beyer, Gerald

    2011-04-01

    The spacer defined double patterning (SDDP) approach for 20nm half pitch (HP) single damascene Cu interconnect structures using immersion lithography is being reviewed. Final results on wafer will be shown, focusing on critical double patterning topics such as CD & overlay budget and line edge roughness (LER); and their impact on the electrical functioning of the back-end-of-line test structures. The feasibility of extending the SDDP technique down to 15nm HP structures is also discussed. The 30nm line/space structures patterned in resist, required as a starting point for this exercise, will be patterned using EUV lithography.

  14. Mycoplasmas hyorhinis in different regions of cuba. diagnosis

    PubMed Central

    Lobo, Evelyn; Poveda, Carlos; Gupta, Rakesh; Suarez, Alejandro; Hernández, Yenney; Ramírez, Ana; Poveda, José B.

    2011-01-01

    M. hyorhinis is considered one of the etiological agents of arthritis in sucking pigs, but recently as seen, some strains can produce pneumonia that could not be distinguished from the mycoplasmosis caused by M. hyopneumoniae. The study was conducted to research the presence of Mycoplasma hyorhinis (M. hyorhinis ) in different regions of the country from exudates of pig lungs with typical EP lesions. Exudates from 280 pig lungs with typical EP lesions were studied using molecular techniques such as PCR, real time PCR and amplification of the 16S-23S rRNA. It was detected that the 66% of the samples studied resulted positive to M. hyorhinis, and the presence of this species was detected in all the provinces. Amplification and studies on the intergenic region 16S-23S of M. hyorhinis rRNA demonstrated the existing variability among strains of a same species. This study is the first report on M. hyorhinis detection in Cuba. PMID:24031686

  15. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  16. Differential gene expression in neurospora crassa cell types: amplification of rRNA genes. Progress report, July 1979-30 June 1980

    SciTech Connect

    Dutta, S.K.

    1980-01-01

    The significant results obtained during 1979 to 1980 of the current research program are as follows: (1) the differential rRNA gene amplification in germinated conidia of N.crassa was confirmed. N.crassa rDNAs showed differences in degrees of homology with isolated DNAs from other Neurospora species which could be due to heterogeneity in internal spacers. Studies with N.crassa rDNA clones were initiated to study their heterogeneities. The organization of the Institutional Biohazard Committee (IBC) for Recombinant DNA research was completed and necessary certifications for the laboratory and the workers were obtained in accordance with the P/sub 2/EK/sub 1/ containment regulation of N.I.H. Known 17S and 26S N.crassa rDNA probes are being used to detect differences, if any, in restriction cleavage sites in rDNAs of different cell types and developmental mutants of N.crassa. DNAs from these N.crassa cells are restricted with EcoR/sub 1/ and Hind III and cleaved fragments separated by gel electrophoresis are transferred into nitrocellulose papers. Experiments are underway now to see if there are any changes in cleavage sites by annealing with /sup 32/P or /sup 3/H-17S or 26S rDNA probes followed by autoradiography.

  17. Molecular confirmation of Trichomonas gallinae and other parabasalids from Brazil using the 5.8S and ITS-1 rRNA regions.

    PubMed

    Ecco, Roselene; Preis, Ingred S; Vilela, Daniel A R; Luppi, Marcela M; Malta, Marcelo C C; Beckstead, Robert B; Stimmelmayr, Raphaela; Stimmelmayer, Raphaela; Gerhold, Richard W

    2012-11-23

    Clinical, gross, and histopathology lesions and molecular characterization of Trichomonas spp. infection were described in two striped owls (Asio (Rhinoptynx) clamator), one American kestrel (Falco sparverius), two green-winged saltators (Saltator similis), and in a toco toucan (Ramphastos toco) from Brazil. These birds presented clinical signs including emaciation, ruffled feathers, abundant salivation and open mouth breathing presumably due to abundant caseous material. Gross lesions were characterized by multifocal yellow friable plaques on the surface of the tongue, pharynx and/or caseous masses partially occluding the laryngeal entrance. In the owls, the caseous material extended into the mandibular muscles and invaded the sinuses of the skull. Histopathologically, marked necrotic and inflammatory lesions were associated with numerous round to oval, pale eosinophilic structures (6-10μm) with basophilic nuclei, consistent with trichomonads. Organisms similar to those described above also were found in the liver of the two green-winged saltators. To the authors' knowledge, this is the first report of trichomonosis in a striped owl and a toco toucan. Sequence analysis of the Trichomonas spp. internal transcribed spacer 1 (ITS-1) region and partial 5.8S of the ribosomal RNA (rRNA) disclosed significant genetic diversity. Two sequences had 100% identity to Trichomonas gallinae, whereas two sequences had a 99% and 92% identity to a Trichomonas vaginalis-like sequence, respectively. One sequence (green-winged saltator 502-08) had a 100% identity to a newly recognized genus Simplicomonas. PMID:22749289

  18. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  19. On-chip FRET Graphene Oxide Aptasensor: Quantitative Evaluation of Enhanced Sensitivity by Aptamer with a Double-stranded DNA Spacer.

    PubMed

    Ueno, Yuko; Furukawa, Kazuaki; Tin, Andrew; Hibino, Hiroki

    2015-01-01

    We propose a molecular design for a biomolecular probe to realize an on-chip graphene oxide (GO) aptasensor with enhanced sensitivity. Here, GO works as an excellent acceptor for fluorescence resonance energy transfer. We inserted a rigid double-stranded DNA as a spacer between the GO surface and the aptamer sequence to extend the distance between a fluorescence dye and the GO surface during molecular recognition. We examined the dependence of the sensitivity on the length of the spacer quantitatively by using a 2×2 linear-array aptasensor. We used the modified aptamer with 10 and 30 base pair (bp) double-stranded DNA spacers. The signal with a 30bp-spacer was about twice as strong that with a 10bp-spacer as regards both thrombin and prostate specific antigen detections. The improvement in the sensitivity was supported by a model calculation that estimated the effect of spacer length on fluorescence recovery efficiency. PMID:26353952

  20. Molecular identification of a new phytoplasma associated with alfalfa witches'-broom in oman.

    PubMed

    Khan, A J; Botti, S; Al-Subhi, A M; Gundersen-Rindal, D E; Bertaccini, A F

    2002-10-01

    ABSTRACT Alfalfa (Medicago sativa) plants showing witches'-broom symptoms typical of phytoplasmas were observed from Al-Batinah, Al-Sharqiya, Al-Bureimi, and interior regions of the Sultanate of Oman. Phytoplasmas were detected from all symptomatic samples by the specific amplification of their 16S-23S rRNA gene. Polymerase chain reaction (PCR), utilizing phytoplasma-specific universal primer pairs, consistently amplified a product of expected lengths when DNA extract from symptomatic samples was used as template. Asymptomatic plant samples and the negative control yielded no amplification. Restriction fragment length polymorphism profiles of PCR-amplified 16S-23S rDNA of alfalfa using the P1/P7 primer pair identified phytoplasmas belonging to peanut witches'-broom group (16SrII or faba bean phyllody). Restriction enzyme profiles showed that the phytoplasmas detected in all 300 samples belonged to the same ribosomal group. Extensive comparative analyses on P1/P7 amplimers of 20 phytoplasmas with Tru9I, Tsp509I, HpaII, TaqI, and RsaI clearly indicated that this phytoplasma is different from all the other phytoplasmas employed belonging to subgroup 16SrII, except tomato big bud phytoplasma from Australia, and could be therefore classified in subgroup 16SrII-D. The alfalfa witches'-broom (AlfWB) phytoplasma P1/P7 PCR product was sequenced directly after cloning and yielded a 1,690-bp product. The homology search showed 99% similarity (1,667 of 1,690 base identity) with papaya yellow crinkle (PapayaYC) phytoplasma from New Zealand. A phylogenetic tree based on 16S plus spacer regions sequences of 35 phytoplasmas, mainly from the Southern Hemisphere, showed that AlfWB is a new phytoplasma species, with closest relationships to PapayaYC phytoplasmas from New Zealand and Chinese pigeon pea witches'-broom phytoplasmas from Taiwan but distinguishable from them considering the different associated plant hosts and the extreme geographical isolation.

  1. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  2. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  3. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  4. Anti-cas spacers in orphan CRISPR4 arrays prevent uptake of active CRISPR-Cas I-F systems.

    PubMed

    Almendros, Cristóbal; Guzmán, Noemí M; García-Martínez, Jesús; Mojica, Francisco J M

    2016-01-01

    Archaea and bacteria harbour clustered regularly interspaced short palindromic repeats (CRISPR) loci. These arrays encode RNA molecules (crRNA), each containing a sequence of a single repeat-intervening spacer. The crRNAs guide CRISPR-associated (Cas) proteins to cleave nucleic acids complementary to the crRNA spacer, thus interfering with targeted foreign elements. Notably, pre-existing spacers may trigger the acquisition of new spacers from the target molecule by means of a primed adaptation mechanism. Here, we show that naturally occurring orphan CRISPR arrays that contain spacers matching sequences of the cognate (absent) cas genes are able to elicit both primed adaptation and direct interference against genetic elements carrying those genes. Our findings show the existence of an anti-cas mechanism that prevents the transfer of a fully equipped CRISPR-Cas system. Hence, they suggest that CRISPR immunity may be undesired by particular prokaryotes, potentially because they could limit possibilities for gaining favourable sequences by lateral transfer. PMID:27573106

  5. Impact of Asymmetric Dual-k Spacer in the Underlap Regions of Sub 20 nm NMOSFET with Gate Stack

    NASA Astrophysics Data System (ADS)

    Chakraborty, Shramana; Dasgupta, Arpan; Das, Rahul; Kundu, Atanu; Sarkar, Chandan K.

    2016-10-01

    This paper shows the systematic study of underlap double gate (U-DG) NMOSFETs with Gate Stack (GS) under the influence of dual-k spacers at the different underlap regions. In highly scaled devices, underlap is used at the Source and Drain side so as to reduce the short channel effects (SCE's) but at the cost of low on current (ION) and increased channel resistance. The high-k spacers are used to counter this problem. The ION is improved but at the cost of highly enhanced parasitic capacitances. This paper explores the possibility of using asymmetric dual-k spacer at the source underlap side so as to counter the shortcomings of high-k spacers in highly scaled devices on the basis of analog parameters: ION, gm, gm/ID, and intrinsic gain, gmRo and RF performance in terms of parasitic gate capacitance (Cgs, Cgd and Cgg),gate to source/drain resistances (Rgs and Rgd), transport delay (τm), the unity current gain cut-off frequency (fT) and the maximum frequency of oscillation (fmax). A single stage amplifier performance is also analyzed where it has been seen that the asymmetric dual-k spacer at the source underlap side gives better performance as compared to the other devices under comparison.

  6. Highly Efficient White Organic Light-Emitting Diodes with Ultrathin Emissive Layers and a Spacer-Free Structure

    NASA Astrophysics Data System (ADS)

    Wu, Shengfan; Li, Sihua; Sun, Qi; Huang, Chenchao; Fung, Man-Keung

    2016-05-01

    Ultrathin emissive layers (UEMLs) of phosphorescent materials with a layer thickness of less than 0.3 nm were introduced for high-efficiency organic light-emitting diodes (OLEDs). All the UEMLs for white OLEDs can be prepared without the use of interlayers or spacers. Compared with devices fabricated with interlayers inserted in-between the UEMLs, our spacer-free structure not only significantly improves device efficiency, but also simplifies the fabrication process, thus it has a great potential in lowering the cost of OLED panels. In addition, its spacer-free structure decreases the number of interfaces which often introduce unnecessary energy barriers in these devices. In the present work, UEMLs of red, green and blue-emitting phosphorescent materials and yellow and blue phosphorescent emitters are utilized for the demonstration of spacer-free white OLEDs. Upon optimization of the device structure, we demonstrated spacer-free and simple-structured white-emitting OLEDs with a good device performance. The current and power efficiencies of our white-emitting devices are as high as 56.0 cd/A and 55.5 lm/W, respectively. These efficiencies are the highest ever reported for OLEDs fabricated with the UEML approach.

  7. Use of a New Knee Prosthesis as an Articulating Spacer in Two-Stage Revision of Infected Total Knee Arthroplasty

    PubMed Central

    Fabrin, Jesper; Poulsen, Klaus; Schroder, Henrik Morville

    2016-01-01

    Purpose To report our experience with two-stage revision using a new femoral component (NFC) spacer (Depuy Synthes) as an articulating spacer. Materials and Methods In this retrospective study, we reviewed 22 two-stage revisions that were performed using an NFC spacer in 22 patients suspected of having an infected total knee arthroplasty (TKA) from December 2010 to March 2013. The result was considered successful when eradication of infection was achieved using only one NFC spacer. Results The average time from primary TKA to the first stage procedure was 29.1 months and the average time from the first stage procedure until the final second stage procedure was 12.7 weeks. The average range of motion increased from 82° preoperatively to 104° postoperatively. The American Knee Society Knee score increased from 29.3 points to 66 points. The Function score increased from 29.5 points to 64 points. Four cases were reinfected after two-stage revision. The mean follow-up was 37.6 months. Conclusions The new articulating spacer showed promising short-term results both with regard to eradication of infection and functional improvement. PMID:27595079

  8. Highly Efficient White Organic Light-Emitting Diodes with Ultrathin Emissive Layers and a Spacer-Free Structure

    PubMed Central

    Wu, Shengfan; Li, Sihua; Sun, Qi; Huang, Chenchao; Fung, Man-Keung

    2016-01-01

    Ultrathin emissive layers (UEMLs) of phosphorescent materials with a layer thickness of less than 0.3 nm were introduced for high-efficiency organic light-emitting diodes (OLEDs). All the UEMLs for white OLEDs can be prepared without the use of interlayers or spacers. Compared with devices fabricated with interlayers inserted in-between the UEMLs, our spacer-free structure not only significantly improves device efficiency, but also simplifies the fabrication process, thus it has a great potential in lowering the cost of OLED panels. In addition, its spacer-free structure decreases the number of interfaces which often introduce unnecessary energy barriers in these devices. In the present work, UEMLs of red, green and blue-emitting phosphorescent materials and yellow and blue phosphorescent emitters are utilized for the demonstration of spacer-free white OLEDs. Upon optimization of the device structure, we demonstrated spacer-free and simple-structured white-emitting OLEDs with a good device performance. The current and power efficiencies of our white-emitting devices are as high as 56.0 cd/A and 55.5 lm/W, respectively. These efficiencies are the highest ever reported for OLEDs fabricated with the UEML approach. PMID:27170543

  9. Pyrocarbon spacer as a trapezium replacement for arthritis of the trapeziometacarpal joint; a follow-up study of 60 cases.

    PubMed

    Szalay, Gabor; Meyer, Christof; Scheufens, Tanja; Schnettler, Reinhard; Christ, Ralph; Schleicher, Iris

    2013-12-01

    Rhizarthrosis is the most common degenerative joint disease of the hand, affecting about 10% of the population. We report our results with trapezium replacement using a pyrocarbon spacer. Between January 2005 and April 2010, 70 patients underwent trapeziectomy with interposition of a pyrocarbon spacer. Sixty patients were examined at an average follow-up of 23.6 (5-64) months after the operation. Six (8.6%) of the 70 implanted pyrocarbon spacers dislocated. Based on the assessment scale devised by Buck-Gramcko, 19 patients achieved a very good outcome (31.6%), 31 patients (51.6%) had a good outcome, six results were satisfactory (10%) and four patients (6.6%) had a poor result. In this study, trapeziectomy and implantation of a pyrocarbon spacer achieved good or very good results in 83.2% of cases. The high cost of the implant and the observed rate of spacer dislocation should however be considered critically. While the short-term results of this method are encouraging, long-term outcomes will show whether this technique can keep up with the good results of suspension arthroplasty.

  10. Unexpected Temperature Behavior of Polyethylene Glycol Spacers in Copolymer Dendrimers in Chloroform

    PubMed Central

    Markelov, Denis A.; Matveev, Vladimir V.; Ingman, Petri; Nikolaeva, Marianna N.; Penkova, Anastasia V.; Lahderanta, Erkki; Boiko, Natalia I.; Chizhik, Vladimir I.

    2016-01-01

    We have studied copolymer dendrimer structure: carbosilane dendrimers with terminal phenylbenzoate mesogenic groups attached by poly(ethylene) glycol (PEG) spacers. In this system PEG spacers are additional tuning to usual copolymer structure: dendrimer with terminal mesogenic groups. The dendrimer macromolecules were investigated in a dilute chloroform solution by 1H NMR methods (spectra and relaxations). It was found that the PEG layer in G = 5 generations dendrimer is “frozen” at high temperatures (above 260 K), but it unexpectedly becomes “unfrozen” at temperatures below 250 K (i.e., melting when cooling). The transition between these two states occurs within a small temperature range (~10 K). Such a behavior is not observed for smaller dendrimer generations (G = 1 and 3). This effect is likely related to the low critical solution temperature (LCST) of PEG and is caused by dendrimer conformations, in which the PEG group concentration in the layer increases with growing G. We suppose that the unusual behavior of PEG fragments in dendrimers will be interesting for practical applications such as nanocontainers or nanoreactors. PMID:27052599

  11. Role of spacer length in interaction between novel gemini imidazolium surfactants and Rhizopus oryzae lipase.

    PubMed

    Adak, Sunita; Datta, Sougata; Bhattacharya, Santanu; Banerjee, Rintu

    2015-11-01

    An insight into the effects of new ionic liquid-type gemini imidazolium cationic surfactants on the structure and function of the lipases is of prime importance for their potential application. Changes in the activity, stability and structure of Rhizopus oryzae lipase in the presence of novel gemini surfactants, [C16-3-C16im]Br2 and [C16-12-C16im]Br2 were probed in the present study. Surfactant with shorter spacer length, [C16-3-C16im]Br2 was found to be better in improving the hydrolytic activity and thermal stability of the lipase. For both the surfactants, activation was concentration dependent. CD spectroscopy results showed a decrease in α-helix and an increase in β-sheet content in the presence of these surfactants. A higher structural change observed in presence of [C16-12-C16im]Br2 correlated with lower enzyme activity. Isothermal titration calorimetric studies showed the binding to be spontaneous in nature based on sequential two site binding model. The forces involved in binding were found to differ for the two surfactants proving that the spacer length is an important factor which governs the interaction. These surfactants could be used as promising components both in enzyme modification and media engineering for attaining the desired goals in biocatalytic reactions.

  12. Analysis of high-k spacer on symmetric underlap DG-MOSFET with Gate Stack architecture

    NASA Astrophysics Data System (ADS)

    Das, Rahul; Chakraborty, Shramana; Dasgupta, Arpan; Dutta, Arka; Kundu, Atanu; Sarkar, Chandan K.

    2016-09-01

    This paper shows the systematic study of underlap double gate (U-DG) NMOSFETs with Gate Stack (GS) under the influence of high-k spacers. In highly scaled devices, underlap is used at the Source and Drain side so as to reduce the short channel effects (SCE's), however, it significantly reduces the on current due to the increased channel resistance. To overcome these drawbacks, the use of high-k spacers is projected as one of the remedies. In this paper, the analog performance of the devices is studied on the basis of parameters like transconductance (gm), transconductance generation factor (gm/Id) and intrinsic gain (gmro). The RF performance is analyzed on the merits of intrinsic capacitance (Cgd, Cgs), resistance (Rgd, Rgs), transport delay (τm), inductance (Lsd), cutoff frequency (fT), and the maximum frequency of oscillation (fmax). The circuit performance of the devices are studied by implementing the device as the driver MOSFET in a Single Stage Common Source Amplifier. The Gain Bandwidth Product (GBW) has been analyzed from the frequency response of the circuit.

  13. Use of an endoscopic surgical spacer during laparoscopic pancreatic tumor enucleation.

    PubMed

    Nakamura, Yoshiharu; Matsumoto, Satoshi; Uchida, Eiji; Tajiri, Takashi; Jo, Yoshio; Inoue, Toshiki

    2010-04-01

    A number of recent reports have highlighted the usefulness of laparoscopic surgery for pancreatic surgery; however, the procedure is not yet standard because of its technical challenges. Using an endoscopic surgical spacer (SECUREA) that we developed, we performed laparoscopic enucleation of a pancreatic tumor in a patient with pancreatic mucinous cystadenoma. The SECUREA is a polyurethane sponge with a radiopaque marker. It is elliptic-cylindrical and measures 6.5 cm on the major axis, 3.5 cm on the minor axis, and 2 cm in height. Herein, we report the intraoperative findings and examine the usefulness of SECUREA for laparoscopic enucleation. The spacer was introduced into the abdominal cavity through a 12-mm trocar, and was grasped with forceps to isolate or extend organs and tissues, thereby ensuring a safe and relatively uncontaminated surgical field. In addition, the high absorptiveness and water-holding capacity of the sponge facilitated removal of exudate, which created a clearer operative field and reduced the technical challenges of drainage manipulation. Indeed, replacement of the sponge was unnecessary because it returned to its original state after the liquid it contained had been aspirated. Our findings suggest that the SECUREA increases safety and reduces the technical difficulties of laparoscopic enucleation. PMID:20453423

  14. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology

    PubMed Central

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K. P.; Woo, Patrick C. Y.

    2015-01-01

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10–49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n = 2), Pichia (Candida) norvegensis (n = 2), Candida tropicalis (n = 1) and Saccharomyces cerevisiae (n = 1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study. PMID:26506340

  15. Cationic gemini surfactants with cleavable spacer: chemical hydrolysis, biodegradation, and toxicity.

    PubMed

    Tehrani-Bagha, A R; Holmberg, K; van Ginkel, C G; Kean, M

    2015-07-01

    The paper describes synthesis and characterization of a new type of cationic gemini surfactant, which has dodecyl tails and a spacer that contains an ester bond. The nomenclature used to describe the structure is 12Q2OCO1Q12, with Q being a quaternary ammonium group and the numbers indicating the number of methylene or methyl groups. Due to the close proximity to the two quaternary ammonium groups, the ester bond is very stable on the acid side and very labile already at slightly alkaline conditions. The hydrolysis products are two single chain surfactants (i.e. 12Q2OH and 12Q1COOH) which are less surface active than the intact gemini surfactant. 12Q2OCO1Q12 was found to be readily biodegradable, i.e. it gave more than 60% biodegradation after 28 days. This is interesting because similar gemini surfactants but with ester bonds in the tails instead of the spacer, have previously been found not to be readily biodegradable. The gemini surfactant was found to be toxic to aquatic organisms (ErC50 value of 0.27 mg/l), although less toxic than the two hydrolysis products.

  16. Origin and relationships of Saintpaulia (Gesneriaceae) based on ribosomal DNA internal transcribed spacer (ITS) sequences.

    PubMed

    Moller, M; Cronk, Q

    1997-07-01

    Phylogenetic relationships of eight species of Saintpaulia H. Wendl., 19 species of Streptocarpus Lindl. (representing all major growth forms within the genus), and two outgroups (Haberlea rhodopensis Friv., Chirita spadiciformis W. T. Wang) were examined using comparative nucleotide sequences from the two internal transcribed spacers (ITS) of nuclear ribosomal DNA. The length of the ITS 1 region ranged from 228 to 249 base pairs (bp) and the ITS 2 region from 196 to 245 bp. Pairwise sequence divergence across both spacers for ingroup and outgroup species ranged from 0 to 29%. Streptocarpus is not monophyletic, and Saintpaulia is nested within Streptocarpus subgenus Streptocarpella. Streptocarpus subgenus Streptocarpus is monophyletic. The ITS sequence data demonstrate that the unifoliate Streptocarpus species form a clade, and are also characterized by a unique 47-bp deletion in ITS 2. The results strongly support the monophyly of (1) Saintpaulia, and (2) Saintpaulia plus the African members of the subgenus Streptocarpella of Streptocarpus. The data suggest the evolution of Saintpaulia from Streptocarpus subgenus Streptocarpella. The differences in flower and vegetative characters are probably due to ecological adaptation leading to a relatively rapid radiation of Saintpaulia. PMID:21708650

  17. Impact of Alkyl Spacer Length on Aggregation Pathways in Kinetically Controlled Supramolecular Polymerization.

    PubMed

    Ogi, Soichiro; Stepanenko, Vladimir; Thein, Johannes; Würthner, Frank

    2016-01-20

    We have investigated the kinetic and thermodynamic supramolecular polymerizations of a series of amide-functionalized perylene bisimide (PBI) organogelator molecules bearing alkyl spacers of varied lengths (ethylene to pentylene chains, PBI-1-C2 to PBI-1-C5) between the amide and PBI imide groups. These amide-functionalized PBIs form one-dimensional fibrous nanostructures as the thermodynamically favored states in solvents of low polarity. Our in-depth studies revealed, however, that the kinetic behavior of their supramolecular polymerization is dependent on the spacer length. Propylene- and pentylene-tethered PBIs follow a similar polymerization process as previously observed for the ethylene-tethered PBI. Thus, the monomers of these PBIs are kinetically trapped in conformationally restricted states through intramolecular hydrogen bonding between the amide and imide groups. In contrast, the intramolecularly hydrogen-bonded monomers of butylene-tethered PBI spontaneously self-assemble into nanoparticles, which constitute an off-pathway aggregate state with regard to the thermodynamically stable fibrous supramolecular polymers obtained. Thus, for this class of π-conjugated system, an unprecedented off-pathway aggregate with high kinetic stability could be realized for the first time by introducing an alkyl linker of optimum length (C4 chain) between the amide and imide groups. Our current system with an energy landscape of two competing nucleated aggregation pathways is applicable to the kinetic control over the supramolecular polymerization by the seeding approach. PMID:26699283

  18. π-Spacer effect in dithiafulvenyl-π-phenothiazine dyes for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofeng; Gou, Faliang; Zhao, Dongning; Shi, Jian; Gao, Hong; Zhu, Zhenping; Jing, Huanwang

    2016-08-01

    New dithiafulvenyl-π-phenothiazine dyes have been devised and prepared for dye-sensitized solar cells. Various π-spacers have been successfully introduced into the skeleton of dithiafulvenyl and phenothiazine unit to generate novel D-π-D-A dyes (DPP-1 ∼ 4). All dyes have been characterized with NMR, HRMS, UV-vis and fluorescence spectra, and taken into cyclic voltammetry measurements. The devices of new dyes have been determined by photoelectrochemical experiments (IV, IPCE and EIS), in which, solar cell of DPP-4 with biphenyl ring π-spacer enhances obviously its photoelectric conversion efficiency to 7.66% reaching 94% of N719-based standard cell and displays good long-term stability with quasi-solid-state electrolyte. Density functional theory (DFT) calculations of new dyes provide further insight into the molecular geometries and the impacts of the torsion angles on their photovoltaic performance. Large dihedral angles in DPP dyes induce good charge separation for efficient unidirectional flow of electron from donor to acceptor.

  19. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    PubMed

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  20. Spacer engineered Trigate SOI TFET: An investigation towards harsh temperature environment applications

    NASA Astrophysics Data System (ADS)

    Mallikarjunarao; Ranjan, Rajeev; Pradhan, K. P.; Artola, L.; Sahu, P. K.

    2016-09-01

    In this paper, a novel N-channel Tunnel Field Effect Transistor (TFET) i.e., Trigate Silicon-ON-Insulator (SOI) N-TFET with high-k spacer is proposed for better Sub-threshold swing (SS) and OFF-state current (IOFF) by keeping in mind the sensitivity towards temperature. The proposed model can achieve a Sub-threshold swing less than 35 mV/decade at various temperatures, which is desirable for designing low power CTFET for digital circuit applications. In N-TFET source doping has a significant effect on the ON-state current (ION) level; therefore more electrons will tunnel from source to channel region. High-k Spacer i.e., HfO2 is used to enhance the device performance and also it avoids overlapping of transistors in an integrated circuits (IC's). We have designed a reliable device by performing the temperature analysis on Transfer characteristics, Drain characteristics and also on various performance metrics like ON-state current (ION), OFF-state current (IOFF), ION/IOFF, Trans-conductance (gm), Trans-conductance Generation Factor (TGF), Sub-threshold Swing (SS) to observe the applications towards harsh temperature environment.

  1. Spacer parity dependence of photoinduced effects in liquid-crystalline dimers

    NASA Astrophysics Data System (ADS)

    Prasad, S. Krishna; Sandhya, K. L.; Nair, Geetha G.; Hiremath, Uma S.; Yelamaggad, C. V.

    2002-07-01

    Liquid crystals composed of photoactive groups like azobenzene are promising materials for optical switching and image storage applications. When exposed to ultraviolet radiation, such materials are known to induce a transition from a liquid-crystalline nematic phase, in which the azo molecules are in the trans form to an isotropic liquid phase when the azo molecules take the cis form. We report the observation of the influence of the parity and length of the flexible spacer of photoactive liquid-crystalline dimers in a guest host system on the photoinduced nematic-isotropic transition. A remarkable feature observed is that in this system, in which the guest dimers are present only in a small concentration (4.8 weight %) the odd-even parity of the spacer results in a striking alternation of the magnitude of the photoinduced shift in the nematic-isotropic transition temperature. Further, it is demonstrated that the shape of the photoactive molecule in its all-trans configuration can be used as a convenient tool to control the photoinduced shift in the nematic-isotropic transition temperature.

  2. Secondary structure models for the internal transcribed spacer (ITS) region 1 from symbiotic dinoflagellates.

    PubMed

    Thornhill, Daniel J; Lord, Jenna B

    2010-07-01

    Ribosomal genes and their spacers have been extensively utilized to examine the biodiversity and phylogenetics of protists. Among these, the internal transcribed spacer regions 1 and 2 (ITS1 and ITS2) are known to form secondary structures that are critically important for proper processing of the pre-rRNA into mature ribosomes. Although the secondary structure of ITS2 has been widely investigated, considerably less is known about ITS1 and its secondary structure. Here, secondary structures of the ITS1 were modeled for 46 ITS "types" from Symbiodinium, a diverse dinoflagellate genus that forms symbioses with many protists and metazoans, using comparative phylogenetic and minimum free energy approaches. The predicted ITS1 secondary structures for each Symbiodinium "type" were highly stable (DeltaG=-46.40 to -85.30 kcal mol(-1) at 37 degrees C) and consisted of an open loop with five helices separated by single-stranded regions. Several structural characteristics were conserved within monophyletic sub-groups, providing additional support for the predicted structures and the relationships within this genus. Finally, the structures were applied to identify potential pseudogenes from five Symbiodinium ITS1 datasets. Consequently, ITS1 secondary structures are useful in understanding the biology and phylogenetics, as well as recognizing and excluding questionable sequences from datasets, of protists such as Symbiodinium.

  3. π-Spacer effect in dithiafulvenyl-π-phenothiazine dyes for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofeng; Gou, Faliang; Zhao, Dongning; Shi, Jian; Gao, Hong; Zhu, Zhenping; Jing, Huanwang

    2016-08-01

    New dithiafulvenyl-π-phenothiazine dyes have been devised and prepared for dye-sensitized solar cells. Various π-spacers have been successfully introduced into the skeleton of dithiafulvenyl and phenothiazine unit to generate novel D-π-D-A dyes (DPP-1 ∼ 4). All dyes have been characterized with NMR, HRMS, UV-vis and fluorescence spectra, and taken into cyclic voltammetry measurements. The devices of new dyes have been determined by photoelectrochemical experiments (IV, IPCE and EIS), in which, solar cell of DPP-4 with biphenyl ring π-spacer enhances obviously its photoelectric conversion efficiency to 7.66% reaching 94% of N719-based standard cell and displays good long-term stability with quasi-solid-state electrolyte. Density functional theory (DFT) calculations of new dyes provide further insight into the molecular geometries and the impacts of the torsion angles on their photovoltaic performance. Large dihedral angles in DPP dyes induce good charge separation for efficient unidirectional flow of electron from donor to acceptor.

  4. Inhaled beclomethasone dipropionate administered through a new spacer device: a controlled clinical study.

    PubMed

    Vecchiet, L; Pieralisi, G; Ambrosi, L; Di Lorenzo, L; Cantini, L

    1996-01-01

    This 4-week, randomized, parallel-group study compared the efficacy and safety of a metered-dose inhaler equipped with a new spacer device (Jet spacer) with those of a standard actuator in the administration of inhaled beclomethasone dipropionate (0.5 mg twice daily) in 66 adults with chronic obstructive pulmonary disease (COPD) who were responsive to beta 2-agonists. Lung function values, symptom scores, and daily consumption of a beta 2-agonist determined efficacy. At baseline and after treatment, levels of morning serum and 24-hour urinary cortisol were measured in half of the patients (one center). Ease of use of the two devices was expressed by patients at the final visit. Lung function values and clinical symptoms improved in both groups (P < .01 at the final visit); the Jet group reported a better outcome (P < .05 between groups) than the standard-actuator group for predicted normal values of forced expiratory volume in 1 second, forced vital capacity, and bronchial noises. Salbutamol consumption decreased in both groups. One patient in the Jet group and 5 patients in the standard-actuator group reported adverse reactions. No significant between-group differences were found in plasma and urinary cortisol levels. The Jet device was judged easier to use (P < .05 between groups) than the standard actuator. In conclusion, the jet device was more effective than a standard actuator in reducing local adverse reactions to inhaled beclomethasone dipropionate in adults with COPD, with a better efficacy profile.

  5. Thermal Performance Testing of Cryogenic Multilayer Insulation with Silk Net Spacers

    NASA Astrophysics Data System (ADS)

    Johnson, W. L.; Frank, D. J.; Nast, T. C.; Fesmire, J. E.

    2015-12-01

    Early comprehensive testing of cryogenic multilayer insulation focused on the use of silk netting as a spacer material. Silk netting was used for multiple test campaigns that were designed to provide baseline thermal performance estimates for cryogenic insulation systems. As more focus was put on larger systems, the cost of silk netting became a deterrent and most aerospace insulation firms were using Dacron (or polyester) netting spacers by the early 1970s. In the midst of the switch away from silk netting there was no attempt to understand the difference between silk and polyester netting, though it was widely believed that the silk netting provided slightly better performance. Without any better reference for thermal performance data, the silk netting performance correlations continued to be used. In order to attempt to quantify the difference between the silk netting and polyester netting, a brief test program was developed. The silk netting material was obtained from Lockheed Martin and was tested on the Cryostat-100 instrument in three different configurations, 20 layers with both single and double netting and 10 layers with single netting only. The data show agreement within 15 - 30% with the historical silk netting based correlations and show a substantial performance improvement when compared to previous testing performed using polyester netting and aluminum foil/fiberglass paper multilayer insulation. Additionally, the data further reinforce a recently observed trend that the heat flux is not directly proportional to the number of layers installed on a system.

  6. Effect of electrostatic charge, flow, delay and multiple actuations on the in vitro delivery of salbutamol from different small volume spacers for infants.

    PubMed Central

    Wildhaber, J. H.; Devadason, S. G.; Eber, E.; Hayden, M. J.; Everard, M. L.; Summers, Q. A.; LeSouëf, P. N.

    1996-01-01

    BACKGROUND: A study was undertaken to determine the influences of electrostatic charge, flow, delay, and multiple actuations on the in vitro delivery of salbutamol generated by a pressurised metered dose inhaler (pMDI) from small volume spacers used in infants. METHODS: Ten actuations from a salbutamol pMDI were drawn at different flow rates after either single or multiple actuations, with or without delay, through either static or reduced static spacers. An ionic detergent was used to reduce the charge of plastic spacers (Babyhaler, Babyspacer, Aerochamber, Nebuhaler). Electrostatic charge was measured using an electrometer. A multistage liquid impinger was used to determine the particle size distribution of the output of the pMDI through the spacers. RESULTS: Electrostatic charge on the surface of plastic spacers had the greatest influence on delivery, causing a decrease in drug delivery. Reducing charge by coating the surface with ionic detergent resulted in an increase of 46.5-71.1% (p < 0.001) in small (< 6.8 microns) particle delivery from small volume plastic spacers. Lower flow, delay, and multiple actuations resulted in decreased delivery from static spacers. Lower flow resulted in a decrease of 15% in small (< 9.6 microns) particle delivery. Delay and multiple actuations resulted in a decrease of 40.7% and 76.0%, respectively, in small (< 6.8 microns) particle delivery. The influences of lower flow, delay, and multiple actuations were greatly reduced or even eliminated by reducing charge. However, multiple actuations still resulted in a significant decreased delivery (p < 0.05). The reduced static Nebuhaler had a higher delivery than all small volume spacers. CONCLUSIONS: Electrostatic charge has a major influence on the delivery of salbutamol from small volume spacers. Using a metal spacer or ionic detergent coating of plastic spacers resulted in no or reduced charge and hence in improved delivery. Lower flow, delay, and multiple actuations played a

  7. Whole-Genome Sequence of Rummeliibacillus stabekisii Strain PP9 Isolated from Antarctic Soil

    PubMed Central

    da Mota, Fábio Faria; Vollú, Renata Estebanez; Jurelevicius, Diogo

    2016-01-01

    The whole genome of Rummeliibacillus stabekisii PP9, isolated from a soil sample from Antarctica, consists of a circular chromosome of 3,412,092 bp and a circular plasmid of 8,647 bp, with 3,244 protein-coding genes, 12 copies of the 16S-23S-5S rRNA operon, 101 tRNA genes, and 6 noncoding RNAs (ncRNAs). PMID:27231360

  8. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  9. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  10. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes.

    PubMed

    Fritz, G N

    1998-03-01

    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  11. Current-perpendicular-to-the-plane giant magnetoresistance in spin-valves with AgSn alloy spacers

    SciTech Connect

    Read, J. C.; Nakatani, T. M.; Smith, Neil; Choi, Y.-S.; York, B. R.; Brinkman, E.; Childress, J. R.

    2015-07-28

    We investigate the use of AgSn alloys as the spacer layer in current-perpendicular-to-the-plane magnetoresistance devices. Alloying with Sn increases resistivity but results in a reasonably long (>10 nm) spin-diffusion length, so large magnetoresistance can be achieved with thin AgSn spacers. Compared to Ag thin films, AgSn forms smaller grain sizes, reduced roughness, and exhibits less interdiffusion upon annealing, resulting in decreased interlayer magnetic coupling in exchange biased spin-valves. AgSn also shows improved corrosion resistance compared to Ag, which is advantageous for nanofabrication, including magnetic recording head sensors. Combining a AgSn spacer with Co-based Heusler alloy ferromagnet in an exchange biased, polycrystalline trilayer thinner than 12 nm results in magnetoresistance values up to 15% at room temperature.

  12. Dose-reducing effect of Lipowitz metal-embedded spacers in interstitial brachytherapy for carcinoma of the mobile tongue.

    PubMed

    Fujita, M; Hirokawa, Y; Tamamoto, M; Kashiwado, K; Akagi, Y; Kashimoto, K; Wada, T

    1994-06-01

    Dose-reducing effects of spacers with and without a Lipowitz metal plate for the purpose of decreasing osteoradionecrosis after interstitial brachytherapy for tongue cancers were examined experimentally and clinically. The thicker the sample or spacer and the thicker the metal plate, the greater was the dose reduction achieved. A more marked dose reduction was achieved with iridium than with radium because of lower gamma ray energy of iridium. Iridium has been used widely as a radioactive source for interstitial brachytherapy. It was concluded therefore that a metal plate should be used as a shield into the spacer in interstitial brachytherapy both to reduce the radiation dose to surrounding normal tissues and to help prevent osteoradionecrosis. PMID:8065721

  13. Current-perpendicular-to-the-plane giant magnetoresistance in spin-valves with AgSn alloy spacers

    NASA Astrophysics Data System (ADS)

    Read, J. C.; Nakatani, T. M.; Smith, Neil; Choi, Y.-S.; York, B. R.; Brinkman, E.; Childress, J. R.

    2015-07-01

    We investigate the use of AgSn alloys as the spacer layer in current-perpendicular-to-the-plane magnetoresistance devices. Alloying with Sn increases resistivity but results in a reasonably long (>10 nm) spin-diffusion length, so large magnetoresistance can be achieved with thin AgSn spacers. Compared to Ag thin films, AgSn forms smaller grain sizes, reduced roughness, and exhibits less interdiffusion upon annealing, resulting in decreased interlayer magnetic coupling in exchange biased spin-valves. AgSn also shows improved corrosion resistance compared to Ag, which is advantageous for nanofabrication, including magnetic recording head sensors. Combining a AgSn spacer with Co-based Heusler alloy ferromagnet in an exchange biased, polycrystalline trilayer thinner than 12 nm results in magnetoresistance values up to 15% at room temperature.

  14. In vitro comparison of the amount of salbutamol available for inhalation from different formulations used with different spacer devices.

    PubMed

    Barry, P W; O'Callaghan, C

    1997-06-01

    Metered-dose inhalers (MDIs) are currently being reformulated to contain hydrofluoroalkanes (HFAs), which do not damage the Earth's ozone layer. As different formulations of inhaled drugs may behave differently when used with spacer devices, we wished to determine the amount of salbutamol available for inhalation from a conventional metered-dose inhaler (Ventolin) and a new HFA-containing formulation (Airomir), when used with two different spacers. A glass multistage liquid impinger was used to determine the amount of salbutamol delivered from the inhalers used with the Aerochamber and the Nebuhaler spacer devices. High speed video-recordings of inhaler actuation into air were made, and the speed of the aerosol and the aerosol cloud volume were measured. More salbutamol in small particles (<5 microm) was delivered from the Airomir MDI than the Ventolin MDI, when used with the Aerochamber (40.4 (95% confidence interval (95% CI) 31.2-49.6) versus 19.5 (19.0-20.0) microg) and the Nebuhaler (42.1 (36.3-47.9) versus 24.6 (23.3-25.8) microg). The aerosol cloud from the Airomir MDI was slower than the Ventolin aerosol, and 60 ms after actuation had travelled 186 mm, whereas the Ventolin aerosol had travelled 320 mm. At the same time, the Airomir aerosol occupied a smaller volume than the Ventolin MDI (251 (213-288) versus 695 (608-782) cm3). The hydrofluoroalkane formulation delivers more salbutamol than the conventional formulation when used either with the Aerochamber or Nebuhaler spacer. This may be because less drug is deposited in the spacer from the hydrofluoroalkane formulation, which is emitted from the metered-dose inhaler at a slower speed and occupies a smaller volume than the conventional formulation. The observed difference in drug delivery may be important for patients changing formulations, and in severe asthma, where high doses of salbutamol may be administered through a spacer.

  15. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  16. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  17. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  18. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  19. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  20. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  1. Relative bioavailability of salbutamol to the lung following inhalation using metered dose inhalation methods and spacer devices.

    PubMed Central

    Hindle, M.; Chrystyn, H.

    1994-01-01

    BACKGROUND--Inhalation aids do not require coordination between actuation of a metered dose inhaler (MDI) with inspiration and reduce oropharyngeal impaction. The delivery of salbutamol to the lung and systemic availability following inhalation with three commonly used spacers and an open mouth technique have been evaluated using a simple noninvasive technique based on urinary excretion 30 minutes and 24 hours after the dose. METHODS--Ten healthy subjects inhaled, on randomised study days, 4 x 100 micrograms from a Ventolin MDI and, subsequently, with the aid of a Volumatic, Bricanyl Spacer, and Nebuhaler spacer device. In addition, an open mouth inhaler technique was evaluated. Urine samples were collected 0-30 minutes and 0.5-24 hours after inhalation. From these samples the relative bioavailability to the lung (urinary salbutamol excretion 30 minutes after dosing) and the systemic bioavailability of the dose (24 hour urinary excretion of salbutamol and its metabolite) for each inhalation method was obtained. RESULTS--The mean (SD) urinary excretion of salbutamol 30 minutes after inhalation using the MDI alone and with the Volumatic, Bricanyl Spacer, Nebuhaler, and open mouth technique was 2.83 (0.78)%, 3.37 (0.69)%, 4.09 (0.91)%, 4.34 (1.60)%, and 3.49 (0.98)%, respectively, expressed as a percentage of the nominal dose. The nebuhaler and Bricanyl Spacer spacer devices were found to increase the relative bioavailability of salbutamol to the lung compared with the MDI alone. Compared with the MDI the inhalation aid increases were much greater than the intra-individual variability of the urinary excretion method. In 11 individuals who each repeated the same inhalation procedure on four separate occasions, the mean (SD) coefficient of variation was 8.24 (2.36)%. The mean (SD) 24 hour urinary excretion of salbutamol and its metabolites was 26.6 (6.79), 27.0 (7.95), and 55.6 (9.74)% of the salbutamol dose for the Volumatic, Nebuhaler, and MDI, respectively. Similar

  2. The spacer arm length in cell-penetrating peptides influences chitosan/siRNA nanoparticle delivery for pulmonary inflammation treatment

    NASA Astrophysics Data System (ADS)

    Jeong, Eun Ju; Choi, Moonhwan; Lee, Jangwook; Rhim, Taiyoun; Lee, Kuen Yong

    2015-11-01

    Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length between a cell-penetrating peptide (CPP) and a nanoparticle could be critical to enhancing the cellular uptake as well as the gene silencing efficiency of conventional chitosan/siRNA nanoparticles. A peptide consisting of nine arginine units (R9) was used as a CPP, and the spacer arm length was controlled by varying the number of glycine units between the peptide (R9Gn) and the nanoparticle (n = 0, 4, and 10). Various physicochemical characteristics of R9Gn-chitosan/siRNA nanoparticles were investigated in vitro. Increasing the spacing arm length did not significantly affect the complex formation between R9Gn-chitosan and siRNA. However, R9G10-chitosan was much more effective in delivering genes both in vitro and in vivo compared with non-modified chitosan (without the peptide) and R9-chitosan (without the spacer arm). Chitosan derivatives modified with oligoarginine containing a spacer arm can be considered as potential delivery vehicles for various genes.Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length between a cell-penetrating peptide (CPP) and a nanoparticle could be critical to enhancing the cellular uptake as well as the gene silencing efficiency of conventional chitosan/siRNA nanoparticles. A peptide consisting of nine arginine units (R9) was used as a CPP, and the spacer arm length was controlled by varying the number of glycine units between the peptide (R9Gn) and the nanoparticle (n = 0, 4, and 10). Various physicochemical characteristics of

  3. Design and synthesis of novel hydrophilic spacers for the reduction of nonspecific binding proteins on affinity resins.

    PubMed

    Shiyama, Takaaki; Furuya, Minoru; Yamazaki, Akira; Terada, Tomohiro; Tanaka, Akito

    2004-06-01

    Tubulin and actin often bind nonspecifically to affinity chromatography resins, complicating research toward identifying the cellular targets. Reduction of nonspecific binding proteins is important for success in finding such targets. We herein disclose the design, synthesis, and effectiveness in reduction of nonspecific binding proteins, of novel hydrophilic spacers (2-5), which were introduced between matrices and a ligand. Among them, tartaric acid derivative (5) exhibited the most effective reduction of nonspecific binding proteins, whilst maintaining binding of the target protein. Introduction of 5 on TOYOPEARL reduced tubulin and actin by almost 65% and 90% compared to that without the hydrophilic spacer, respectively, with effective binding to the target protein, FKBP12.

  4. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  5. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  6. Marine mesocosm bacterial colonisation of volcanic ash

    NASA Astrophysics Data System (ADS)

    Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

    2015-04-01

    Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

  7. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  8. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Study of electrical properties of silica glasses, intended for FED spacers, under electron irradiation

    NASA Astrophysics Data System (ADS)

    Fakhfakh, S.; Jbara, O.; Belhaj, M.; Rondot, S.; Mouze, D.; Fakhfakh, Z.

    2008-11-01

    The charge properties, under electron irradiation, of three types of glasses are studied by employing scanning electron microscope (SEM) associated with the technique called the electrostatic influence method. The experimental conditions are closed to those of typical field emission display (FED) operation. To determine the amount of trapped charges during and after electron irradiation, a special arrangement adapted to the SEM was used. This arrangement allows displacement and leakage currents to be simultaneously measured. The secondary electron emission yield during electron irradiation is also deduced. The trapping ability of each glass is analyzed taking into account the regulation mechanisms involved under electron irradiation. Finally useful indications permitting an adequate selection of glasses that may be used as FED spacers are deduced.

  11. Selection of enzymes for terminal restriction fragment length polymorphism analysis of fungal internally transcribed spacer sequences.

    PubMed

    Alvarado, Pablo; Manjón, Jose L

    2009-07-01

    Terminal restriction fragment length polymorphism (TRFLP) profiling of the internally transcribed spacer (ITS) ribosomal DNA of unknown fungal communities is currently unsupported by a broad-range enzyme-choosing rationale. An in silico study of terminal fragment size distribution was therefore performed following virtual digestion (by use of a set of commercially available 135 type IIP restriction endonucleases) of all published fungal ITS sequences putatively annealing to primers ITS1 and ITS4. Different diversity measurements were used to rank primer-enzyme pairs according to the richness and evenness that they showed. Top-performing pairs were hierarchically clustered to test for data dependency. The enzyme set composed of MaeII, BfaI, and BstNI returned much better results than randomly chosen enzyme sets in computer simulations and is therefore recommended for in vitro TRFLP profiling of fungal ITSs.

  12. CFD prediction of flow and phase distribution in fuel assemblies with spacers

    SciTech Connect

    Anglart, H.; Nylund, O.; Kurul, N.

    1995-09-01

    This paper is concerned with the modeling and computation of multi-dimensional two-phase flows in BWR fuel assemblies. The modeling principles are presented based on using a two-fluid model in which lateral interfacial effects are accounted for. This model has been used to evaluate the velocity fields of both vapor and liquid phases, as well as phase distribution, between fuel elements in geometries similar to BWR fuel bundles. Furthermore, this model has been used to predict, in a detailed mechanistic manner, the effects of spacers on flow and phase distribution between, and pressure drop along, fuel elements. The related numerical simulations have been performed using a CFD computer code, CFDS-FLOW3D.

  13. High initiation rates at the ribosomal gene promoter do not depend upon spacer transcription

    SciTech Connect

    Labhart, P.; Reeder, R.H. )

    1989-05-01

    We report experiments that test the model that in Xenopus laevis, RNA polymerase I is handed over in a conservative fashion from the T3 terminator to the adjacent gene promoter. We have introduced transcription-terminating lesions into the ribosomal DNA repeat by irradiating cultured cells with ultraviolet light. We used isolated nuclei to measure the effect of such lesions on transcription. UV damage sufficient to prevent all elongating RNA polymerase from reaching T3 from upstream had no adverse effect on the density of RNA polymerase at the very 5' end of the gene. We conclude that high rates of transcription initiation at the gene promoter do not depend upon polymerase passing from one repeat to the next or on polymerase initiating at the spacer promoters.

  14. Bulk FinFETs with body spacers for improving fin height variation

    NASA Astrophysics Data System (ADS)

    Wei, Xing; Zhu, Huilong; Zhang, Yanbo; Zhao, Chao

    2016-08-01

    A novel FinFET structure with body spacers in sub fin (BSSF) is proposed to improve the fin height variation produced in the manufacturing processes. Device simulation results are presented to show the electrical variations improvement. The effective fin height (Heff) of FinFETs with BSSF is well controlled because it only depends on the silicon epi layer thickness (TSi). Taking advantage of the precisely controlled epitaxy process, Heff uniformity of FinFETs with BSSF is much better than conventional bulk FinFETs. Benefit from the smaller Heff variation, FinFETs with BSSF show much smaller electrical characteristics variation. For n-FinFETs, the Ion variation improves from 33.46% for conventional bulk FinFETs to 8.05% for FinFETs with BSSF. Additionally, manufacturing of FinFETs with BSSF is compatible with that of the state-of-the-art bulk FinFETs, promising for its applications in massive production.

  15. Direct CRISPR spacer acquisition from RNA by a natural reverse-transcriptase-Cas1 fusion protein

    PubMed Central

    Sidote, David J.; Markham, Laura M.; Sanchez-Amat, Antonio; Bhaya, Devaki; Lambowitz, Alan M.; Fire, Andrew Z.

    2016-01-01

    CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) systems mediate adaptive immunity in diverse prokaryotes. CRISPR-associated Cas1 and Cas2 proteins have been shown to enable adaptation to new threats in Type I and II CRISPR systems by the acquisition of short segments of DNA (“spacers”) from invasive elements. In several Type III CRISPR systems, Cas1 is naturally fused to a reverse transcriptase (RT). In the marine bacterium Marinomonas mediterranea (MMB-1), we show that an RT-Cas1 fusion enables the acquisition of RNA spacers in vivo in an RT-dependent manner. In vitro, the MMB-1 RT-Cas1 and Cas2 proteins catalyze ligation of RNA segments into the CRISPR array, followed by reverse transcription. These observations outline a host-mediated mechanism for reverse information flow from RNA to DNA. PMID:26917774

  16. Switchable wavelength-selective and diffuse metamaterial absorber/emitter with a phase transition spacer layer

    SciTech Connect

    Wang, Hao; Yang, Yue; Wang, Liping

    2014-08-18

    We numerically demonstrate a switchable metamaterial absorber/emitter by thermally turning on or off the excitation of magnetic resonance upon the phase transition of vanadium dioxide (VO{sub 2}). Perfect absorption peak exists around the wavelength of 5 μm when the excitation of magnetic resonance is supported with the insulating VO{sub 2} spacer layer. The wavelength-selective absorption is switched off when the magnetic resonance is disabled with metallic VO{sub 2} that shorts the top and bottom metallic structures. The resonance wavelength can be tuned with different geometry, and the switchable metamaterial exhibits diffuse behaviors at oblique angles. The results would facilitate the design of switchable metamaterials for active control in energy and sensing applications.

  17. A Numerical Analysis on the Local Deformation of a Spacer Grid Structure for Nuclear Fuel Cells

    NASA Astrophysics Data System (ADS)

    Jang, Myung-Geun; Na, Geum Ju; Shin, Hyunho; Kim, Jong-Bong

    2016-08-01

    The result of a preliminary numerical investigation on local deformation characteristics of a multi-layered spacer-grid structure with five guide tubes is reported based on implicit finite element analysis. For the numerical analysis, displacements of top and bottom cross sections of each guide tube in a single-layer model were constrained while a lateral displacement was imposed on the single layer. Unlike the impact hammer test that is generally employed to characterize the deformation characteristics of the space-grid structure, the buckling phenomenon occurs locally in this study; it takes place at the inner grids around each tube and the degree of bucking is more apparent for tubes near the lateral surface where the lateral displacement was imposed.

  18. Magnetotransport properties of spin-valve structures with Mg spacer layers

    SciTech Connect

    Martinez-Boubeta, C.; Ferrante, Y.; Parkin, S. S. P.

    2015-01-19

    A theoretical prediction by Wang et al. [Phys. Rev. B 82, 054405 (2010)] suggests the preferential transmission of majority-spin states with Δ{sub 1} symmetry across a magnesium interlayer in Fe/Mg/MgO/Fe based magnetic tunnel junctions. Here, we report experiments to probe this question in CoFe/Mg/CoFe structures. We find that the strength of the interlayer coupling decays exponentially with increasing the spacer thickness, however, a non-monotonic variation of the magnetoresistance as a function of the Mg layer is observed. These data may help revisit the role of the insertion of a Mg interface layer in MgO-based devices.

  19. Babesia gibsoni internal transcribed spacer 1 region is highly conserved amongst isolates from dogs across Japan

    PubMed Central

    LIU, Mingming; CAO, Shinuo; VUDRIKO, Patrick; SUZUKI, Hiroshi; SOMA, Takehisa; XUAN, Xuenan

    2016-01-01

    Babesia gibsoni is a tick-borne apicomplexan parasite of dogs that often causes fever and hemolytic anemia with highly variable clinical outcome. In this study, we sequenced the 254bp Internal Transcribed Spacer 1 region (ITS1) of 54 B. gibsoni isolates from 14 different geographical regions of Japan. The 54 isolates shared high sequence identity with each other and with B. gibsoni isolates reported in GenBank database (97.2–100%). Consistent with previous reports, phylogenetic analysis showed that B. gibsoni isolates from Japan formed the same clade with those from U.S.A., Australia, India and Taiwan. Our finding indicates that B. gibsoni ITS1 region is highly conserved among isolates from dogs in Japan, making it a useful genetic marker for molecular epidemiology of the parasite. PMID:26806537

  20. Conotoxins containing nonnatural backbone spacers: cladistic-based design, chemical synthesis, and improved analgesic activity.

    PubMed

    Green, Brad R; Catlin, Philip; Zhang, Min-Min; Fiedler, Brian; Bayudan, Wendi; Morrison, Alex; Norton, Raymond S; Smith, Brian J; Yoshikami, Doju; Olivera, Baldomero M; Bulaj, Grzegorz

    2007-04-01

    Disulfide-rich neurotoxins from venomous animals continue to provide compounds with therapeutic potential. Minimizing neurotoxins often results in removal of disulfide bridges or critical amino acids. To address this drug-design challenge, we explored the concept of disulfide-rich scaffolds consisting of isostere polymers and peptidic pharmacophores. Flexible spacers, such as amino-3-oxapentanoic or 6-aminohexanoic acids, were used to replace conformationally constrained parts of a three-disulfide-bridged conotoxin, SIIIA. The peptide-polymer hybrids, polytides, were designed based on cladistic identification of nonconserved loci in related peptides. After oxidative folding, the polytides appeared to be better inhibitors of sodium currents in dorsal root ganglia and sciatic nerves in mice. Moreover, the polytides appeared to be significantly more potent and longer-lasting analgesics in the inflammatory pain model in mice, when compared to SIIIA. The resulting polytides provide a promising strategy for transforming disulfide-rich peptides into therapeutics.

  1. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  2. Development of ligase-assisted spacer addition for the measurement of microsatellites.

    PubMed

    Brockhurst, V; Barnard, R; Wolter, L; Giffard, P; Timms, P

    2001-07-01

    Conventional methods for detecting differences in microsatellite repeat lengths rely on electrophoretic fractionation on long denaturing polyacrylamide gels, a time-consuming and labor-intensive method. Therefore, there is a need for the development of new and rapid approaches to routinely detect such length polymorphisms. The advent of techniques allowing the coupling of DNA molecules to solid surfaces has provided new prospects in the area of mutation detection. We describe here the development and optimization of the ligase-assisted spacer addition (LASA) method, a novel and rapid procedure based on an ELISA format to measure microsatellite repeat lengths. The LASA assay was successfully applied to a set of 11 bird samples to assess its capabilities as a genotyping method. PMID:11464526

  3. The effect of anterior proton beams in the setting of a prostate-rectum spacer

    SciTech Connect

    Christodouleas, John P.; Tang, Shikui; Susil, Robert C.; McNutt, Todd R.; Song, Danny Y.; Bekelman, Justin; Deville, Curtiland; Vapiwala, Neha; DeWeese, Theodore L.; Lu, Hsiao-Ming; Both, Stefan

    2013-10-01

    Studies suggest that anterior beams with in vivo range verification would improve rectal dosimetry in proton therapy for prostate cancer. We investigated whether prostate-rectum spacers would enhance or diminish the benefits of anterior proton beams in these treatments. Twenty milliliters of hydrogel was injected between the prostate and rectum of a cadaver using a transperineal approach. Computed tomography (CT) and magnetic resonance (MR) images were used to generate 7 uniform scanning (US) and 7 single-field uniform dose pencil-beam scanning (PBS) plans with different beam arrangements. Pearson correlations were calculated between rectal, bladder, and femoral head dosimetric outcomes and beam arrangement anterior scores, which characterize the degree to which dose is delivered anteriorly. The overall quality of each plan was compared using a virtual dose-escalation study. For US plans, rectal mean dose was inversely correlated with anterior score, but for PBS plans there was no association between rectal mean dose and anterior score. For both US and PBS plans, full bladder and empty bladder mean doses were correlated with anterior scores. For both US and PBS plans, femoral head mean doses were inversely correlated with anterior score. For US plans and a full bladder, 4 beam arrangements that included an anterior beam tied for the highest maximum prescription dose (MPD). For US plans and an empty bladder, the arrangement with 1 anterior and 2 anterior oblique beams achieved the highest MPD in the virtual dose-escalation study. The dose-escalation study did not differentiate beam arrangements for PBS. All arrangements in the dose-escalation study were limited by bladder constraints except for the arrangement with 2 posterior oblique beams. The benefits of anterior proton beams in the setting of prostate-rectum spacers appear to be proton modality dependent and may not extend to PBS.

  4. Adrenal suppression with inhaled budesonide and fluticasone propionate given by large volume spacer to asthmatic children.

    PubMed Central

    Clark, D. J.; Clark, R. A.; Lipworth, B. J.

    1996-01-01

    BACKGROUND: The aim of this study was to compare the systemic bioactivity of inhaled budesonide (B) and fluticasone propionate (F), each given by large volume spacer, on a microgram equivalent basis in asthmatic children. METHODS: Ten stable asthmatic children of mean age 11 years and forced expiratory volume in one second (FEV1) 81.6% predicted, who were receiving treatment with < or = 400 micrograms/day of inhaled corticosteroid, were studied in a placebo controlled single blind (investigator blind) randomised crossover design comparing single doses of inhaled budesonide and fluticasone propionate 400 micrograms, 800 micrograms, and 1250 micrograms. Doses were given at 20.00 hours with mouth rinsing and an overnight 12 hour urine sample was collected for estimation of free cortisol and creatinine excretion. RESULTS: The results of overnight 12 hour urinary cortisol output (nmol/12 hours) showed suppression with all doses of fluticasone propionate (as geometric means): F400 micrograms (11.99), F800 micrograms (6.49), F1250 micrograms (7.00) compared with placebo (24.43), whereas budesonide caused no suppression at any dose. A comparison of the drugs showed that there were differences at 800 micrograms and 1250 micrograms levels for urinary cortisol: B800 micrograms versus F800 micrograms (2.65-fold, 95% CI 1.26 to 5.58), B1250 micrograms versus F1250 micrograms (2.94-fold, 95% CI 1.67 to 5.15). The results for the cortisol/creatinine ratio were similar to that of urinary cortisol, with fluticasone causing suppression at all doses and with differences between the drugs at 800 micrograms and 1250 micrograms. CONCLUSIONS: Single doses of inhaled fluticasone produce greater systemic bioactivity than budesonide when given by large volume spacer on a microgram equivalent basis in asthmatic children. The systemic bioactivity of fluticasone, like budesonide, is due mainly to lung bioavailability. PMID:8984708

  5. Controlling the Biomimetic Implant Interface: Modulating Antimicrobial Activity by Spacer Design

    NASA Astrophysics Data System (ADS)

    Wisdom, Cate; Vanoosten, Sarah Kay; Boone, Kyle W.; Khvostenko, Dmytro; Arnold, Paul M.; Snead, Malcolm L.; Tamerler, Candan

    2016-08-01

    Surgical site infection is a common cause of post-operative morbidity, often leading to implant loosening, ultimately requiring revision surgery, increased costs and worse surgical outcomes. Since implant failure starts at the implant surface, creating and controlling the bio-material interface will play a critical role in reducing infection while improving host cell-to-implant interaction. Here, we engineered a biomimetic interface based upon a chimeric peptide that incorporates a titanium binding peptide (TiBP) with an antimicrobial peptide (AMP) into a single molecule to direct binding to the implant surface and deliver an antimicrobial activity against S. mutans and S. epidermidis, two bacteria which are linked with clinical implant infections. To optimize antimicrobial activity, we investigated the design of the spacer domain separating the two functional domains of the chimeric peptide. Lengthening and changing the amino acid composition of the spacer resulted in an improvement of minimum inhibitory concentration by a three-fold against S. mutans. Surfaces coated with the chimeric peptide reduced dramatically the number of bacteria, with up to a nine-fold reduction for S. mutans and a 48-fold reduction for S. epidermidis. Ab initio predictions of antimicrobial activity based on structural features were confirmed. Host cell attachment and viability at the biomimetic interface were also improved compared to the untreated implant surface. Biomimetic interfaces formed with this chimeric peptide offer interminable potential by coupling antimicrobial and improved host cell responses to implantable titanium materials, and this peptide based approach can be extended to various biomaterials surfaces.

  6. Photocurrent enhancement in diketopyrrolopyrrole solar cells by manipulating dipolar anchoring terminals on alkyl-chain spacers.

    PubMed

    Tang, Ailing; Lu, Zhenhuan; Bai, Shuming; Huang, Jianhua; Chen, Yuxia; Shi, Qiang; Zhan, Chuanlang; Yao, Jiannian

    2014-03-01

    We chose DPP-BDT-DPP {DPP=diketopyrrolopyrrole, BDT=4,8-di-[2-(2-ethylhexyl)-thienyl]benzo[1,2-b:4,5-b']dithiophene} as a model backbone and varied the anchoring groups [C5 H11 , COOCH3 , and SiCH3 (OSiCH3 )2 ] terminated on the N-substituted alkyl-chain spacer of the DPP units to study the effect of anchoring terminals on the morphology of blend film and on the device performances of bulk heterojunction solar cells. By replacing the nonpolar C5 H11 anchoring terminal with the polar COOCH3 anchoring terminal leads to an enhancement in the short-circuit current density (Jsc ) (4.62 vs. 9.32 mA cm(-2) ), whereas the value of Jsc sharply decreases to 0.45 mA cm(-2) if the C5 H11 anchoring terminal is replaced by a SiCH3 (OSiCH3 )2 group. The changes in Jsc are associated with changes in the π-π stacking distance (3.39→3.34 Å vs. 3.39→3.45 Å) and the phase size (50→20 nm vs. 50→>250 nm) through alteration of the anchoring group from C5 H11 to COOCH3 versus from C5 H11 to SiCH3 (OSiCH3 )2 . Interestingly, the anchoring terminals bring about drastic changes in molecular orientations, which result in different out-of-plane hole transport. This is the first time this effect has been systemically demonstrated to improve photocurrent generation by manipulating the dipolar anchoring groups terminated on the alkyl-chain spacer.

  7. Influence of different length spacers containing enzyme conjugate on functional parameters of progesterone ELISA.

    PubMed

    Shrivastav, Tulsidas G; Chaube, Shail K; Kariya, Kiran P; Prasad, Pramod K V; Kumar, Dinesh

    2013-01-01

    In steroid enzyme immunoassay (EIA), there is an increase or decrease of labeled steroid recognition by antibody due to homologous and heterologous combinations of enzyme conjugate with immunogen that affects sensitivity of the assay. We have introduced three to 18 atomic length linkers between enzyme and steroid moieties and studied their effects on functional parameters such as sensitivity, ED(50), and specificity of progesterone enzyme immunoassays. Progesterone-3-carboxymethyloxime-bovine serum albumin (P-3-CMO-BSA) was used as an immunogen to raise the antiserum in New Zealand white rabbits. Five enzyme conjugates were prepared using 17-α-hydroxy-progesterone-3-carboxymethyloxime (17-α-OH-P-3-CMO) as carboxylic derivative of 17-α-hydroxy-progesterone and horseradish peroxidase (HRP) as label. These were 17-α-OH-P-3-CMO-HRP, 17-α-OH-P-3-CMO-urea-HRP (17-α-OH-P-3-CMO-U-HRP), 17-α-OH-P-3-CMO-ehylenediamine-HRP (17-α-OH-P-3-CMO-EDA-HRP), 17-α-OH-P-3-CMO-carbohydrazide-HRP (17-α-OH-P-3-CMO-CH-HRP), and 17-α-OH-P-3-CMO-adipic acid dihydrazide-6-aminocaproic acid-HRP (17-α-OH-P-3-CMO-ADH-6ACA-HRP). The influence of different atomic length linkers on sensitivity, ED(50), and specificity were studied with reference to label without linker. The results of the present investigation revealed that the incorporation of ADH-6ACA spacer in 17-α-hydroxy-progesterone-enzyme conjugate improved the sensitivity in antigen plus bridge heterologous EIA system. The presence of spacer in enzyme conjugate improved the sensitivity and specificity (cross-reactivity) in some antigen plus bridge heterologous assay of progesterone. PMID:23323985

  8. Enterococcus species composition determined by capillary electrophoresis of the groESL gene spacer region DNA.

    PubMed

    Yasuda, M; Paar, J; Doolittle, M; Brochi, J; Pancorbo, O C; Tang, R J; Stoner, R E; Shiaris, M P

    2010-07-01

    Marine recreational beaches are monitored for fecal contamination by Enterococcus spp. (ENT) counts. Although different ENT species in the environment tend to thrive in and originate from distinct hosts, the current monitoring method does not differentiate among species. Time-consuming isolation-based species identification precludes routine analysis of environmental ENT communities. Therefore, an isolation-independent DNA fingerprinting method was developed to characterize environmental ENT communities using DNA length polymorphism of the spacer region between the groES and groEL genes common to most ENT species. Capillary electrophoresis resulted in distinct peak sizes of PCR products that carried polymorphic groESL spacers (300-335 bp in length) among 8 different ENT species (Enterococcus avium, Enterococcus gallinarum, Enterococcus casseliflavus, Enterococcus mundtii, Enterococcus hirae, Enterococcus faecium, Enterococcus durans, and Enterococcus faecalis). Distortions in true species ratios observed in electropherograms were caused by PCR biases arising in a mixed ENT community DNA template. E. faecalis was overestimated and E. avium and E. faecium were underestimated compared to the original species ratios in the mixed community. The PCR product bias was constant between species, so good approximation of the species ratio in ENT communities is possible. In environmental samples, a high percentage of E. faecalis (96%) together with high total ENT counts were observed in samples collected from a sewer line and from several sites in a storm drain system where sewage leaks were suspected. In contrast, samples with <400 CFU 100 ml-1 ENT were either dominated by E. mundtii or had 4 or more ENT species. The latter ENT community profiles are considered to be signatures of enterococci rarely associated with animals with low or of non-fecal origin.

  9. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  10. Poly(dG) spacers lead to increased surface coverage of DNA probes: an XPS study of oligonucleotide binding to zirconium phosphonate modified surfaces.

    PubMed

    Lane, Sarah M; Monot, Julien; Petit, Marc; Tellier, Charles; Bujoli, Bruno; Talham, Daniel R

    2008-07-15

    A spacer is often employed between the surface linking group and the probe sequence to improve the performance of DNA microarrays. Previous work demonstrated that a consecutive stretch of guanines as a spacer increased target capture during hybridization relative to probes with either no spacer or a similar stretch of one of the other nucleotides. Using zirconium phosphonate modified surfaces with 5'-phosphorylated ssDNA probes, the present study compares the surface coverage of ssDNA probes containing either a poly(dG) spacer or a poly(dA) spacer. Surface coverages are quantified by XPS using a modified overlayer model. The results show that after treatment to mimic conditions of the passivation and hybridization steps the probe with the poly(dG) spacer has about twice the surface coverage as the probe with the poly(dA) spacer, indicating that increased target capture is due to higher probe coverage. When monitoring the surface coverage after each rinsing step, it is observed that the probe with the poly(dA) spacer is more susceptible to rinsing, suggesting the interaction with the surface is different for the two probes. It is suggested that the formation of G quadruplexes causes an increased avidity of the probe for the zirconium phosphonate surface.

  11. Enhancement of the superconducting transition temperature of FeSe by intercalation of a molecular spacer layer

    NASA Astrophysics Data System (ADS)

    Burrard-Lucas, Matthew; Free, David G.; Sedlmaier, Stefan J.; Wright, Jack D.; Cassidy, Simon J.; Hara, Yoshiaki; Corkett, Alex J.; Lancaster, Tom; Baker, Peter J.; Blundell, Stephen J.; Clarke, Simon J.

    2013-01-01

    The discovery of high-temperature superconductivity in a layered iron arsenide has led to an intensive search to optimize the superconducting properties of iron-based superconductors by changing the chemical composition of the spacer layer between adjacent anionic iron arsenide layers. Superconductivity has been found in iron arsenides with cationic spacer layers consisting of metal ions (for example, Li+, Na+, K+, Ba2+) or PbO- or perovskite-type oxide layers, and also in Fe1.01Se (ref. ) with neutral layers similar in structure to those found in the iron arsenides and no spacer layer. Here we demonstrate the synthesis of Lix(NH2)y(NH3)1-yFe2Se2 (x~0.6 y~0.2), with lithium ions, lithium amide and ammonia acting as the spacer layer between FeSe layers, which exhibits superconductivity at 43(1) K, higher than in any FeSe-derived compound reported so far. We have determined the crystal structure using neutron powder diffraction and used magnetometry and muon-spin rotation data to determine the superconducting properties. This new synthetic route opens up the possibility of further exploitation of related molecular intercalations in this and other systems to greatly optimize the superconducting properties in this family.

  12. Effect of the spacer group nature on the optical and electrical properties of confined poly( p-phenylene vinylene) derivatives

    NASA Astrophysics Data System (ADS)

    Benzarti-Ghédira, Maha; Zahou, Imen; Hrichi, Haikel; Jaballah, Nejmeddine; Ben Chaâbane, Rafik; Majdoub, Mustapha; Ben Ouada, Hafedh

    2015-09-01

    This study is an investigation about the effect of chemical modification on the morphological, optical and electrical properties of semiconducting organic thin films. Two confined poly( p-phenylene vinylene) (PPV)-type polymers containing different spacer groups were studied: P1 has an isopropylidene spacer group and P2 with hexafluoroisopropylidene spacer. The UV-Vis absorption and PL analysis showed a stronger π- π interaction in the P1 film; in P2, the π-stacking is limited by the introduction of a bulky trifluoromethyl (CF3) groups on the spacer units. The P2 exhibits a better film quality as illustrated by the atomic force microscopy. The HOMO and LUMO energy levels and electrochemical band gap of the polymers were determinate by the cyclic voltammetry. The electrical properties of ITO/PPV derivative/Al diodes were investigated by means of current-voltage and show a space-charge-limited current conduction mechanism with higher mobility in the P2 thin layer. The impedance spectra of the devices can be discussed in terms of an equivalent circuit model designed as a parallel resistance ( R p) and capacitance ( C p) network in series with a resistance.

  13. Bradyrhizobium neotropicale sp. nov., isolated from effective nodules of Centrolobium paraense.

    PubMed

    Zilli, Jerri E; Baraúna, Alexandre C; da Silva, Krisle; De Meyer, Sofie E; Farias, Eliane N C; Kaminski, Paulo E; da Costa, Ismaele B; Ardley, Julie K; Willems, Anne; Camacho, Natália N; Dourado, Fernanda dos S; O'Hara, Graham

    2014-12-01

    Root nodule bacteria were isolated from Centrolobium paraense Tul. grown in soils from the Amazon region, State of Roraima (Brazil). 16S rRNA gene sequence analysis of seven strains (BR 10247(T), BR 10296, BR 10297, BR 10298, BR 10299, BR 10300 and BR 10301) placed them in the genus Bradyrhizobium with the closest neighbours being the type strains of Bradyrhizobium paxllaeri (98.8 % similarity), Bradyrhizobium icense (98.8 %), Bradyrhizobium lablabi (98.7 %), Bradyrhizobium jicamae (98.6 %), Bradyrhizobium elkanii (98.6 %), Bradyrhizobium pachyrhizi (98.6 %) and Bradyrhizobium retamae (98.3 %). This high similarity, however, was not confirmed by the intergenic transcribed spacer (ITS) 16S-23S rRNA region sequence analysis nor by multi-locus sequence analysis. Phylogenetic analyses of five housekeeping genes (dnaK, glnII, gyrB, recA and rpoB) revealed Bradyrhizobium iriomotense EK05(T) ( = LMG 24129(T)) to be the most closely related type strain (95.7 % sequence similarity or less). Chemotaxonomic data, including fatty acid profiles [major components being C16 : 0 and summed feature 8 (18 : 1ω6c/18 : 1ω7c)], DNA G+C content, slow growth rate and carbon compound utilization patterns, supported the placement of the novel strains in the genus Bradyrhizobium. Results of DNA-DNA relatedness studies and physiological data (especially carbon source utilization) differentiated the strains from the closest recognized species of the genus Bradyrhizobium. Symbiosis-related genes for nodulation (nodC) and nitrogen fixation (nifH) placed the novel species in a new branch within the genus Bradyrhizobium. Based on the current data, these seven strains represent a novel species for which the name Bradyrhizobium neotropicale sp. nov. is proposed. The type strain is BR 10247(T) ( = HAMBI 3599(T)).

  14. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and high-resolution melt real-time PCR as diagnostic methods.

    PubMed

    Gutiérrez, Ricardo; Morick, Danny; Gross, Ifat; Winkler, Ronen; Abdeen, Ziad; Harrus, Shimon

    2013-12-01

    To determine the occurrence of feline bartonellosis in Israel, blood samples were collected from 179 stray and 155 domestic cats from 18 cities or villages in central and northcentral Israel. Samples were screened for Bartonella infection by culture isolation and molecular detection using high-resolution melt (HRM) real-time PCR assay targeting the 16S-23S rRNA internal transcribed spacer (ITS). All positive samples were confirmed by two additional HRM real-time PCR assays targeting two fragments of the β-subunit of RNA polymerase (rpoB) and the 16S rRNA genes. The prevalence of Bartonella spp. infection in the general tested population was 25.1% (84/334). A higher prevalence was detected in the stray (30.7%; 55/179) than the domestic cats (18.7%; 29/155). Bartonella henselae, Bartonella clarridgeiae, and Bartonella koehlerae were highly prevalent in both cat populations, however their distribution among the two populations varied significantly (p=0.016). B. clarridgeiae and B. koehlerae were found to be more prevalent in stray than domestic cats, whereas B. henselae was evenly distributed. Co-infection with two or more different Bartonella spp. was determined in 2.1% (7) of the cats. The ITS HRM real-time PCR assay used in this study was shown to have a greater screening power than bacterial isolation, detecting 94.0% (79/84) compared to 35.7% (30/84), respectively, of all positive samples. The high prevalence of these zoonotic Bartonella species, coupled with the overpopulation of stray cats, and increased numbers of domestic cats in the major urban centers in Israel represent a significant threat for the public health in this country.

  15. Bradyrhizobium pachyrhizi sp. nov. and Bradyrhizobium jicamae sp. nov., isolated from effective nodules of Pachyrhizus erosus.

    PubMed

    Ramírez-Bahena, Martha Helena; Peix, Alvaro; Rivas, Raúl; Camacho, María; Rodríguez-Navarro, Dulce N; Mateos, Pedro F; Martínez-Molina, Eustoquio; Willems, Anne; Velázquez, Encarna

    2009-08-01

    Several strains isolated from the legume Pachyrhizus erosus were characterized on the basis of diverse genetic, phenotypic and symbiotic approaches. These novel strains formed two groups closely related to Bradyrhizobium elkanii according to their 16S rRNA gene sequences. Strains PAC48T and PAC68T, designated as the type strains of these two groups, presented 99.8 and 99.1% similarity, respectively, in their 16S rRNA gene sequences with respect to B. elkanii USDA 76T. In spite of these high similarity values, the analysis of additional phylogenetic markers such as atpD and glnII genes and the 16S-23S intergenic spacer (ITS) showed that strains PAC48T and PAC68T represented two separate novel species of the genus Bradyrhizobium with B. elkanii as their closest relative. Phenotypic differences among the novel strains isolated from Pachyrhizus and B. elkanii were found regarding the assimilation of carbon sources and antibiotic resistance. All these differences were congruent with DNA-DNA hybridization analysis which revealed 21% genetic relatedness between strains PAC48T and PAC68T and 46% and 25%, respectively, between these strains and B. elkanii LMG 6134T. The nodD and nifH genes of strains PAC48T and PAC68T were phylogenetically divergent from those of bradyrhizobia species that nodulate soybean. Soybean was not nodulated by the novel Pachyrhizus isolates. Based on the genotypic and phenotypic data obtained in this study, the new strains represent two novel species for which the names Bradyrhizobium pachyrhizi sp. nov. (type strain PAC48T=LMG 24246T=CECT 7396T) and Bradyrhizobium jicamae sp. nov. (type strain PAC68T=LMG 24556T=CECT 7395T) are proposed. PMID:19567584

  16. Effect of incubation temperature on the detection of thermophilic campylobacter species from freshwater beaches, nearby wastewater effluents, and bird fecal droppings.

    PubMed

    Khan, Izhar U H; Hill, Stephen; Nowak, Eva; Edge, Thomas A

    2013-12-01

    This large-scale study compared incubation temperatures (37°C versus 42°C) to study the detection of thermophilic Campylobacter species, including Campylobacter jejuni, C. coli, and C. lari, in various surface water samples and bird fecal droppings around Hamilton Harbor, Lake Ontario. The putative culture isolates obtained from incubation temperatures of 37 and 42°C were confirmed by Campylobacter genus- and species-specific triplex PCR assays targeting the 16S rRNA gene and the 16S-23S rRNA gene internal transcribed spacer (ITS) region. A total of 759 water, wastewater, and bird fecal dropping samples were tested. Positive amplification reactions for the genus Campylobacter were found for 454 (60%) samples incubated at 37°C, compared to 258 (34%) samples incubated at 42°C. C. jejuni (16%) and C. lari (12%) were detected significantly more frequently at the 42°C incubation temperature than at 37°C (8% and 5%, respectively). In contrast, significantly higher rates of C. coli (14%) and other Campylobacter spp. (36%) were detected at the 37°C incubation temperature than at 42°C (8% and 7%, respectively). These results were consistent across surface water, wastewater, and bird fecal dropping samples. At times, Campylobacter spp. were recovered and detected at 37°C (3% for C. jejuni, 10% for C. coli, and 3% for C. lari) when the same samples incubated at 42°C were negative. A significantly higher rate of other Campylobacter spp. was detected only at 37°C (32%) than only at 42°C (3%). These results indicate that incubation temperature can significantly influence the culturability and detection of thermophilic and other fastidious Campylobacter spp. and that a comprehensive characterization of the Campylobacter spp. in surface water, wastewaters, or bird fecal droppings will require incubation at both 37 and 42°C.

  17. Inter- and intraspecies identification of Bartonella (Rochalimaea) species.

    PubMed

    Roux, V; Raoult, D

    1995-06-01

    Species of the genus Rochalimaea, recently renamed Bartonella, are of a growing medical interest. Bartonella quintana was reported as the cause of trench fever, endocarditis, and bacillary angiomatosis. B. henselae has been implicated in symptoms and infections of human immunodeficiency virus-infected patients, such as fever, endocarditis, and bacillary angiomatosis, and is involved in the etiology of cat scratch disease. Such a wide spectrum of infections makes it necessary to obtain an intraspecies identification tool in order to perform epidemiological studies. B. vinsonii, B. elizabethae, seven isolates of B. quintana, and four isolates of B. henselae were studied by pulsed-field gel electrophoresis (PFGE) after restriction with the infrequently cutting endonucleases NotI, EagI, and SmaI. Specific profiles were obtained for each of the four Bartonella species. Comparison of genomic fingerprints of isolates of the same species showed polymorphism in DNA restriction patterns, and a specific profile was obtained for each isolate. A phylogenetic analysis of the B. quintana isolates was obtained by using the Dice coefficient, UPGMA (unweighted pair-group method of arithmetic averages), and Package Philip programming. Amplification by PCR and subsequent sequencing using an automated laser fluorescent DNA sequencer (Pharmacia) was performed on the intergenic spacer region (ITS) between the 16 and 23S rRNA genes. It was found that each B. henselae isolate had a specific sequence, while the B. quintana isolates fell into only two groups. When endonuclease restriction analysis of the ITS PCR product was done, three enzymes, TaqI, HindIII, and HaeIII, allowed species identification of Bartonella spp. Restriction fragment length polymorphism after PCR amplification of the 16S-23S rRNA gene ITS may be useful for rapid species identification, and PFGE could be an efficient method for isolate identification.

  18. A panel of real-time PCR assays for specific detection of three phytoplasmas from the apple proliferation group.

    PubMed

    Nikolić, Petra; Mehle, Natasa; Gruden, Kristina; Ravnikar, Maja; Dermastia, Marina

    2010-10-01

    We report here on the development of combination of assays for fast, reliable, specific and sensitive detection and discrimination of 'Candidatus Phytoplasma mali', 'Ca. P. prunorum' and 'Ca. P. pyri' from the 16Sr-X (apple proliferation - AP) group. These phytoplasmas are causal agents of diseases of fruit trees within the family Rosaceae, namely apple proliferation (AP), European stone fruit yellows (ESFY) and pear decline (PD). The designed panel of assays uses TaqMan minor groove binder probes (MGB). It comprises the same set of primers and specific probes for species-specific amplification within the 16S-23S rRNA intergenic spacer region, a set of primers and probes for amplification of the 16S ribosomal DNA region for the universal phytoplasma detection, and an additional set of primers and probe for 18S rRNA as an endogenous quality control of DNA extraction. The performance characteristics of the panel were evaluated. The advantages of new assays were shown in a comparative study with the conventional PCR, which proved their higher sensitivity combined with three-fold shorter time of testing process; and in comparison with two reported multiplex real-time PCR assays for detection of 'Ca. P. mali' or 'Ca. P. pyri'. New panel of assays were tested on the DNA samples of 'Ca. P. mali', 'Ca. P. prunorum', 'Ca. P. pyri', other phytoplasmas and other bacteria isolated from plant material. Additionally, 198 symptomatic and asymptomatic fruit tree field samples collecting during several growing seasons were tested with new assays as well. The results of this study indicate that the combination of three specific assays may be applied in routine phytoplasma surveys and in the certification programs.

  19. Pantanalinema gen. nov. and Alkalinema gen. nov.: novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes.

    PubMed

    Vieira Vaz, Marcelo Gomes Marçal; Genuário, Diego Bonaldo; Andreote, Ana Paula Dini; Malone, Camila Francieli Silva; Sant'Anna, Célia Leite; Barbiero, Laurent; Fiore, Marli Fátima

    2015-01-01

    The genus Leptolyngbya Anagnostidis & Komárek (1988) was described from a set of strains identified as 'LPP-group B'. The morphology within this group is not particularly informative and underestimates the group's genetic diversity. In the present study, two new pseudanabaenacean genera related to Leptolyngbya morphotypes, Pantanalinema gen. nov. and Alkalinema gen. nov., are described under the provisions of the International Code of Nomenclature for Algae, Fungi and Plants, based on a polyphasic approach. Pantanalinema gen. nov. (type species Pantanalinema rosaneae sp. nov.) has sheaths and trichomes with slight gliding motility, which distinguish this genus from Alkalinema gen. nov. (type species Alkalinema pantanalense sp. nov.), which possesses trichomes arranged in an ornate (interwoven) pattern. 16S rRNA gene sequences of strains of Pantanalinema and Alkalinema exhibited low identity to each other (≤91.6 %) and to other sequences from known pseudanabaenacean genera (≤94.3 and 93.7 %, respectively). In a phylogenetic reconstruction, six sequences from strains of Pantanalinema and four from strains of Alkalinema formed two separate and robust clades (99 % bootstrap value), with the genera Oculatella and Phormidesmis, respectively, as the closest related groups. 16S-23S rRNA intergenic spacer sequences and secondary structures of strains of Pantanalinema and Alkalinema did not correspond to any previous descriptions. The strains of Pantanalinema and Alkalinema were able to survive and produce biomass at a range of pH (pH 4-11) and were also able to alter the culture medium to pH values ranging from pH 8.4 to 9.9. These data indicate that cyanobacterial communities in underexplored environments, such as the Pantanal wetlands, are promising sources of novel taxa.

  20. Uneven distribution of Halobacillus trueperi species in arid natural saline systems of Southern Tunisian Sahara.

    PubMed

    Guesmi, Amel; Ettoumi, Besma; El Hidri, Darine; Essanaa, Jihene; Cherif, Hanene; Mapelli, Francesca; Marasco, Ramona; Rolli, Eleonora; Boudabous, Abdellatif; Cherif, Ameur

    2013-11-01

    The genetic diversity of a collection of 336 spore-forming isolates recovered from five salt-saturated brines and soils (Chott and Sebkhas) mainly located in the hyper-arid regions of the southern Tunisian Sahara has been assessed. Requirements and abilities for growth at a wide range of salinities\\ showed that 44.3 % of the isolates were extremely halotolerant, 23 % were moderate halotolerant, and 32.7 % were strict halophiles, indicating that they are adapted to thrive in these saline ecosystems. A wide genetic diversity was documented based on 16S-23S rRNA internal transcribed spacer fingerprinting profiles (ITS) and 16S rRNA gene sequences that clustered the strains into seven genera: Bacillus, Gracilibacillus, Halobacillus, Oceanobacillus, Paenibacillus, Pontibacillus, and Virgibacillus. Halobacillus trueperi was the most encountered species in all the sites and presented a large intraspecific diversity with a multiplicity of ITS types. The most frequent ITS type included 42 isolates that were chosen for assessing of the intraspecific diversity by BOX-PCR fingerprinting. A high intraspecific microdiversity was documented by 14 BOX-PCR genotypes whose distribution correlated with the strain geographic origin. Interestingly, H. trueperi isolates presented an uneven geographic distribution among sites with the highest frequency of isolation from the coastal sites, suggesting a marine rather than terrestrial origin of the strains. The high frequency and diversity of H. trueperi suggest that it is a major ecosystem-adapted microbial component of the Tunisian Sahara harsh saline systems of marine origin. PMID:23949950

  1. Comparison of genospecies and antimicrobial resistance profiles of isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex from various clinical specimens.

    PubMed

    Tien, Ni; You, Bang-Jau; Chang, Hui-Lan; Lin, Hsiu-Shen; Lee, Chin-Yi; Chung, Tung-Ching; Lu, Jang-Jih; Chang, Chao-Chin

    2012-12-01

    This study was conducted to compare the prevalences of antimicrobial resistance profiles of clinical isolates in the Acinetobacter calcoaceticus-Acinetobacter baumannii complex from sterile and nonsterile sites and to further study the relationship of antimicrobial resistance profiles and genospecies by amplified rRNA gene restriction analysis (ARDRA). A total of 1,381 isolates were tested with 12 different antibiotics to show their antimicrobial susceptibility profiles. A total of 205 clinical isolates were further analyzed by ARDRA of the intergenic spacer (ITS) region of the 16S-23S rRNA gene. It was found that the overall percentage of isolates from nonsterile sites (urine, sputum, pus, or catheter tip) that were resistant to the 12 antibiotics tested was significantly higher than that of isolates from sterile sites (cerebrospinal fluid [CSF], ascites fluid, and bloodstream) (46% versus 22%; P < 0.05). After ARDRA, it was found that 97% of the 62 isolates resistant to all antibiotics tested were the A. baumannii genospecies, which was identified in only 31% of the isolates susceptible to all antibiotics tested. More genospecies diversity was identified in the isolates susceptible to all antibiotics tested, including genospecies of 13TU (34%), genotype 3 (29%), and A. calcoaceticus (5%). Furthermore, as 91% (10/11) of the isolates from CSF were susceptible to all antibiotics tested, the A. calcoaceticus-A. baumannii complex isolates with multidrug resistance could be less invasive than the more susceptible isolates. This study also indicated current emergence of carbapenem-, fluoroquinolone-, aminoglycoside-, and cephalosporin-resistant A. calcoaceticus-A. baumannii complex isolates in Taiwan.

  2. Oligonucleotide array-based identification of species in the Acinetobacter calcoaceticus-A. baumannii complex in isolates from blood cultures and antimicrobial susceptibility testing of the isolates.

    PubMed

    Ko, Wen-Chien; Lee, Nan-Yao; Su, Siou Cing; Dijkshoorn, Lenie; Vaneechoutte, Mario; Wang, Li-Rong; Yan, Jin-Jou; Chang, Tsung Chain

    2008-06-01

    Acinetobacter calcoaceticus, A. baumannii, Acinetobacter genomic species (gen. sp.) 3, and Acinetobacter gen. sp. 13TU, which are included in the A. calcoaceticus-A. baumannii complex, are difficult to distinguish by phenotypic methods. An array with six oligonucleotide probes based on the 16S-23S rRNA gene intergenic spacer (ITS) region was developed to differentiate species in the A. calcoaceticus-A. baumannii complex. Validation of the array with a reference collection of 52 strains of the A. calcoaceticus-A. baumannii complex and 137 strains of other species resulted in an identification sensitivity and specificity of 100%. By using the array, the species distribution of 291 isolates of the A. calcoaceticus-A. baumannii complex from patients with bacteremia were determined to be A. baumannii (221 strains [75.9%]), Acinetobacter gen. sp. 3 (67 strains [23.0%]), Acinetobacter gen. sp. 13TU (2 strains [0.7%]), and unidentified Acinetobacter sp. (1 strain [0.3%]). The identification accuracy of the array for 12 randomly selected isolates from patients with bacteremia was further confirmed by sequence analyses of the ITS region and the 16S rRNA gene. Antimicrobial susceptibility testing of the 291 isolates from patients with bacteremia revealed that A. baumannii strains were less susceptible to antimicrobial agents than Acinetobacter gen. sp. 3. All Acinetobacter gen. sp. 3 strains were susceptible to ampicillin-sulbactam, imipenem, and meropenem; but only 67.4%, 90%, and 86% of the A. baumannii strains were susceptible to ampicillin-sulbactam, imipenem, and meropenem, respectively. The observed significant variations in antimicrobial susceptibility among different species in the A. calcoaceticus-A. baumannii complex emphasize that the differentiation of species within the complex is relevant from a clinical-epidemiological point of view.

  3. Preventing Complications from High-Dose Rate Brachytherapy when Treating Mobile Tongue Cancer via the Application of a Modular Lead-Lined Spacer

    PubMed Central

    Murakami, Shumei; Verdonschot, Rinus G.; Kakimoto, Naoya; Sumida, Iori; Fujiwara, Masateru; Ogawa, Kazuhiko; Furukawa, Souhei

    2016-01-01

    Purpose To point out the advantages and drawbacks of high-dose rate brachytherapy in the treatment of mobile tongue cancer and indicate the clinical importance of modular lead-lined spacers when applying this technique to patients. Methods First, all basic steps to construct the modular spacer are shown. Second, we simulate and evaluate the dose rate reduction for a wide range of spacer configurations. Results With increasing distance to the source absorbed doses dropped considerably. Significantly more shielding was obtained when lead was added to the spacer and this effect was most pronounced on shorter (i.e. more clinically relevant) distances to the source. Conclusions The modular spacer represents an important addition to the planning and treatment stages of mobile tongue cancer using HDR-ISBT. PMID:27128434

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  5. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  7. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  8. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  9. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  10. Experimental and numerical characterization of the water flow in spacer-filled channels of spiral-wound membranes.

    PubMed

    Bucs, Szilard S; Linares, Rodrigo Valladares; Marston, Jeremy O; Radu, Andrea I; Vrouwenvelder, Johannes S; Picioreanu, Cristian

    2015-12-15

    Micro-scale flow distribution in spacer-filled flow channels of spiral-wound membrane modules was determined with a particle image velocimetry system (PIV), aiming to elucidate the flow behaviour in spacer-filled flow channels. Two-dimensional water velocity fields were measured in a flow cell (representing the feed spacer-filled flow channel of a spiral wound reverse osmosis membrane module without permeate production) at several planes throughout the channel height. At linear flow velocities (volumetric flow rate per cross-section of the flow channel considering the channel porosity, also described as crossflow velocities) used in practice (0.074 and 0.163 m·s(-1)) the recorded flow was laminar with only slight unsteadiness in the upper velocity limit. At higher linear flow velocity (0.3 m·s(-1)) the flow was observed to be unsteady and with recirculation zones. Measurements made at different locations in the flow cell exhibited very similar flow patterns within all feed spacer mesh elements, thus revealing the same hydrodynamic conditions along the length of the flow channel. Three-dimensional (3-D) computational fluid dynamics simulations were performed using the same geometries and flow parameters as the experiments, based on steady laminar flow assumption. The numerical results were in good agreement (0.85-0.95 Bray-Curtis similarity) with the measured flow fields at linear velocities of 0.074 and 0.163 m·s(-1), thus supporting the use of model-based studies in the optimization of feed spacer geometries and operational conditions of spiral wound membrane systems. PMID:26433778

  11. Experimental and numerical characterization of the water flow in spacer-filled channels of spiral-wound membranes.

    PubMed

    Bucs, Szilard S; Linares, Rodrigo Valladares; Marston, Jeremy O; Radu, Andrea I; Vrouwenvelder, Johannes S; Picioreanu, Cristian

    2015-12-15

    Micro-scale flow distribution in spacer-filled flow channels of spiral-wound membrane modules was determined with a particle image velocimetry system (PIV), aiming to elucidate the flow behaviour in spacer-filled flow channels. Two-dimensional water velocity fields were measured in a flow cell (representing the feed spacer-filled flow channel of a spiral wound reverse osmosis membrane module without permeate production) at several planes throughout the channel height. At linear flow velocities (volumetric flow rate per cross-section of the flow channel considering the channel porosity, also described as crossflow velocities) used in practice (0.074 and 0.163 m·s(-1)) the recorded flow was laminar with only slight unsteadiness in the upper velocity limit. At higher linear flow velocity (0.3 m·s(-1)) the flow was observed to be unsteady and with recirculation zones. Measurements made at different locations in the flow cell exhibited very similar flow patterns within all feed spacer mesh elements, thus revealing the same hydrodynamic conditions along the length of the flow channel. Three-dimensional (3-D) computational fluid dynamics simulations were performed using the same geometries and flow parameters as the experiments, based on steady laminar flow assumption. The numerical results were in good agreement (0.85-0.95 Bray-Curtis similarity) with the measured flow fields at linear velocities of 0.074 and 0.163 m·s(-1), thus supporting the use of model-based studies in the optimization of feed spacer geometries and operational conditions of spiral wound membrane systems.

  12. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  13. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  14. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  15. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  16. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  17. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  18. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  19. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  20. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  1. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  2. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  3. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  4. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  5. Intensity Modulated Proton and Photon Therapy for Early Prostate Cancer With or Without Transperineal Injection of a Polyethylen Glycol Spacer: A Treatment Planning Comparison Study

    SciTech Connect

    Weber, Damien C.; Zilli, Thomas; Vallee, Jean Paul; Rouzaud, Michel; Miralbell, Raymond; Cozzi, Luca

    2012-11-01

    Purpose: Rectal toxicity is a serious adverse effect in early-stage prostate cancer patients treated with curative radiation therapy (RT). Injecting a spacer between Denonvilliers' fascia increases the distance between the prostate and the anterior rectal wall and may thus decrease the rectal radiation-induced toxicity. We assessed the dosimetric impact of this spacer with advanced delivery RT techniques, including intensity modulated RT (IMRT), volumetric modulated arc therapy (VMAT), and intensity modulated proton beam RT (IMPT). Methods and Materials: Eight prostate cancer patients were simulated for RT with or without spacer. Plans were computed for IMRT, VMAT, and IMPT using the Eclipse treatment planning system using both computed tomography spacer+ and spacer- data sets. Prostate {+-} seminal vesicle planning target volume [PTV] and organs at risk (OARs) dose-volume histograms were calculated. The results were analyzed using dose and volume metrics for comparative planning. Results: Regardless of the radiation technique, spacer injection decreased significantly the rectal dose in the 60- to 70-Gy range. Mean V{sub 70Gy} and V{sub 60Gy} with IMRT, VMAT, and IMPT planning were 5.3 {+-} 3.3%/13.9 {+-} 10.0%, 3.9 {+-} 3.2%/9.7 {+-} 5.7%, and 5.0 {+-} 3.5%/9.5 {+-} 4.7% after spacer injection. Before spacer administration, the corresponding values were 9.8 {+-} 5.4% (P=.012)/24.8 {+-} 7.8% (P=.012), 10.1 {+-} 3.0% (P=.002)/17.9 {+-} 3.9% (P=.003), and 9.7 {+-} 2.6% (P=.003)/14.7% {+-} 2.7% (P=.003). Importantly, spacer injection usually improved the PTV coverage for IMRT. With this technique, mean V{sub 70.2Gy} (P=.07) and V{sub 74.1Gy} (P=0.03) were 100 {+-} 0% to 99.8 {+-} 0.2% and 99.1 {+-} 1.2% to 95.8 {+-} 4.6% with and without Spacer, respectively. As a result of spacer injection, bladder doses were usually higher but not significantly so. Only IMPT managed to decrease the rectal dose after spacer injection for all dose levels, generally with no observed

  6. Outcome of total knee replacement following explantation and cemented spacer therapy

    PubMed Central

    Ghanem, Mohamed; Zajonz, Dirk; Bollmann, Juliane; Geissler, Vanessa; Prietzel, Torsten; Moche, Michael; Roth, Andreas; Heyde, Christoph-E.; Josten, Christoph

    2016-01-01

    Background: Infection after total knee replacement (TKR) is one of the serious complications which must be pursued with a very effective therapeutic concept. In most cases this means revision arthroplasty, in which one-setting and two-setting procedures are distinguished. Healing of infection is the conditio sine qua non for re-implantation. This retrospective work presents an assessment of the success rate after a two-setting revision arthroplasty of the knee following periprosthetic infection. It further considers drawing conclusions concerning the optimal timing of re-implantation. Patients and methods: A total of 34 patients have been enclosed in this study from September 2005 to December 2013. 35 re-implantations were carried out following explantation of total knee and implantation of cemented spacer. The patient’s group comprised of 53% (18) males and 47% (16) females. The average age at re-implantation time was 72.2 years (ranging from 54 to 85 years). We particularly evaluated the microbial spectrum, the interval between explantation and re-implantation, the number of surgeries that were necessary prior to re-implantation as well as the postoperative course. Results: We reported 31.4% (11) reinfections following re-implantation surgeries. The number of the reinfections declined with increasing time interval between explantation and re-implantation. Patients who developed reinfections were operated on (re-implantation) after an average of 4.47 months. Those patients with uncomplicated course were operated on (re-implantation) after an average of 6.79 months. Nevertheless, we noticed no essential differences in outcome with regard to the number of surgeries carried out prior to re-implantation. Mobile spacers proved better outcome than temporary arthrodesis with intramedullary fixation. Conclusion: No uniform strategy of treatment exists after peri-prosthetic infections. In particular, no optimal timing can be stated concerning re-implantation. Our data

  7. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nu