Science.gov

Sample records for 18s rrna processing

  1. The ATPase hCINAP regulates 18S rRNA processing and is essential for embryogenesis and tumour growth

    PubMed Central

    Bai, Dongmei; Zhang, Jinfang; Li, Tingting; Hang, Runlai; Liu, Yong; Tian, Yonglu; Huang, Dadu; Qu, Linglong; Cao, Xiaofeng; Ji, Jiafu; Zheng, Xiaofeng

    2016-01-01

    Dysfunctions in ribosome biogenesis cause developmental defects and increased cancer susceptibility; however, the connection between ribosome assembly and tumorigenesis remains unestablished. Here we show that hCINAP (also named AK6) is required for human 18S rRNA processing and 40S subunit assembly. Homozygous CINAP−/− mice show embryonic lethality. The heterozygotes are viable and show defects in 18S rRNA processing, whereas no delayed cell growth is observed. However, during rapid growth, CINAP haploinsufficiency impairs protein synthesis. Consistently, hCINAP depletion in fast-growing cancer cells inhibits ribosome assembly and abolishes tumorigenesis. These data demonstrate that hCINAP reduction is a specific rate-limiting controller during rapid growth. Notably, hCINAP is highly expressed in cancers and correlated with a worse prognosis. Genome-wide polysome profiling shows that hCINAP selectively modulates cancer-associated translatome to promote malignancy. Our results connect the role of hCINAP in ribosome assembly with tumorigenesis. Modulation of hCINAP expression may be a promising target for cancer therapy. PMID:27477389

  2. Molecular diversity of eukaryotes in municipal wastewater treatment processes as revealed by 18S rRNA gene analysis.

    PubMed

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki

    2014-01-01

    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4-8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  3. Molecular diversity of eukaryotes in municipal wastewater treatment processes as revealed by 18S rRNA gene analysis.

    PubMed

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki

    2014-01-01

    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4-8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes.

  4. Molecular Diversity of Eukaryotes in Municipal Wastewater Treatment Processes as Revealed by 18S rRNA Gene Analysis

    PubMed Central

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki

    2014-01-01

    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4–8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  5. Structure of a human pre-40S particle points to a role for RACK1 in the final steps of 18S rRNA processing

    PubMed Central

    Larburu, Natacha; Montellese, Christian; O'Donohue, Marie-Françoise; Kutay, Ulrike; Gleizes, Pierre-Emmanuel; Plisson-Chastang, Célia

    2016-01-01

    Synthesis of ribosomal subunits in eukaryotes is a complex and tightly regulated process that has been mostly characterized in yeast. The discovery of a growing number of diseases linked to defects in ribosome biogenesis calls for a deeper understanding of these mechanisms and of the specificities of human ribosome maturation. We present the 19 Å resolution cryo-EM reconstruction of a cytoplasmic precursor to the human small ribosomal subunit, purified by using the tagged ribosome biogenesis factor LTV1 as bait. Compared to yeast pre-40S particles, this first three-dimensional structure of a human 40S subunit precursor shows noticeable differences with respect to the position of ribosome biogenesis factors and uncovers the early deposition of the ribosomal protein RACK1 during subunit maturation. Consistently, RACK1 is required for efficient processing of the 18S rRNA 3′-end, which might be related to its role in translation initiation. This first structural analysis of a human pre-ribosomal particle sets the grounds for high-resolution studies of conformational transitions accompanying ribosomal subunit maturation. PMID:27530427

  6. Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

    PubMed Central

    Zhang, Jun; McCann, Kathleen L.; Qiu, Chen; Gonzalez, Lauren E.; Baserga, Susan J.; Hall, Traci M. Tanaka

    2016-01-01

    Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C'-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease, Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins. PMID:27725644

  7. Mutation of EMG1 causing Bowen-Conradi syndrome results in reduced cell proliferation rates concomitant with G2/M arrest and 18S rRNA processing delay.

    PubMed

    Armistead, Joy; Hemming, Richard; Patel, Nehal; Triggs-Raine, Barbara

    2014-06-01

    Bowen-Conradi syndrome (BCS) is a lethal autosomal recessive disorder caused by a D86G substitution in the protein, Essential for Mitotic Growth 1 (EMG1). EMG1 is essential for 18S rRNA maturation and 40S ribosome biogenesis in yeast, but no studies of its role in ribosome biogenesis have been done in mammals. To assess the effect of the EMG1 mutation on cell growth and ribosomal biogenesis in humans, we employed BCS patient cells. The D86G substitution did not interfere with EMG1 nucleolar localization. In BCS patient lymphoblasts, cells accumulated in G2/M, resulting in reduced proliferation rates; however, patient fibroblasts showed normal proliferation. The rate of 18S rRNA processing was consistently delayed in patient cells, although this did not lead to a difference in the levels of 40S ribosomes, or a change in protein synthesis rates. These results demonstrate that as in yeast, EMG1 in mammals has a role in ribosome biogenesis. The obvious phenotype in lymphoblasts compared to fibroblasts suggests a greater need for EMG1 in rapidly dividing cells. Tissue-specific effects have been seen in other ribosomal biogenesis disorders, and it seems likely that the impact of EMG1 deficiency would be larger in the rapidly proliferating cells of the developing embryo.

  8. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  9. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  10. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  11. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  12. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  13. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  14. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  15. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  16. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  17. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  18. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  19. RRP5 is required for formation of both 18S and 5.8S rRNA in yeast.

    PubMed Central

    Venema, J; Tollervey, D

    1996-01-01

    Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S) are synthesized as a single precursor which is subsequently processed into the mature rRNAs by a complex series of cleavage and modification reactions. In the yeast Saccharomyces cerevisiae, the early pre-rRNA cleavages at sites A0, A1 and A2, required for the synthesis of 18S rRNA, are inhibited in strains lacking RNA or protein components of the U3, U14, snR10 and snR30 small nucleolar ribonucleoproteins (snoRNPs). The subsequent cleavage at site A3, required for formation of the major, short form of 5.8S rRNA, is carried out by another ribonucleoprotein, RNase MRP. A screen for mutations showing synthetic lethality with deletion of the non-essential snoRNA, snR10, identified a novel gene, RRP5, which is essential for viability and encodes a 193 kDa nucleolar protein. Genetic depletion of Rrp5p inhibits the synthesis of 18S rRNA and, unexpectedly, also of the major short form of 5.8S rRNA. Pre-rRNA processing is concomitantly impaired at sites A0, A1, A2 and A3. This distinctive phenotype makes Rrp5p the first cellular component simultaneously required for the snoRNP-dependent cleavage at sites A0, A1 and A2 and the RNase MRP-dependent cleavage at A3 and provides evidence for a close interconnection between these processing events. Putative RRP5 homologues from Caenorhabditis elegans and humans were also identified, suggesting that the critical function of Rrp5p is evolutionarily conserved. Images PMID:8896463

  20. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    PubMed Central

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89–95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73–5.04 μm) × 3.94 μm (3.50–4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  1. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus).

    PubMed

    Stenger, Brianna L S; Clark, Mark E; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W; Dyer, Neil W; Schultz, Jessie L; McEvoy, John M

    2015-06-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89-95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73-5.04 μm) × 3.94 μm (3.50-4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships.

  2. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.

    PubMed

    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C

    2014-08-01

    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  3. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  4. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  5. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  6. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  7. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta.

    PubMed

    Mackey, L Y; Winnepenninckx, B; De Wachter, R; Backeljau, T; Emschermann, P; Garey, J R

    1996-05-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

  8. Origin of the Mesozoa inferred from 18S rRNA gene sequences.

    PubMed

    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L

    1996-10-01

    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  9. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded.

  10. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  11. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.

    PubMed

    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J

    2010-03-01

    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  12. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  13. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.

    PubMed

    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun

    2011-02-01

    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  14. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  15. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis. PMID:26618590

  16. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  17. Human NAT10 Is an ATP-dependent RNA Acetyltransferase Responsible for N4-Acetylcytidine Formation in 18 S Ribosomal RNA (rRNA)*

    PubMed Central

    Ito, Satoshi; Horikawa, Sayuri; Suzuki, Tateki; Kawauchi, Hiroki; Tanaka, Yoshikazu; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Human N-acetyltransferase 10 (NAT10) is known to be a lysine acetyltransferase that targets microtubules and histones and plays an important role in cell division. NAT10 is highly expressed in malignant tumors, and is also a promising target for therapies against laminopathies and premature aging. Here we report that NAT10 is an ATP-dependent RNA acetyltransferase responsible for formation of N4-acetylcytidine (ac4C) at position 1842 in the terminal helix of mammalian 18 S rRNA. RNAi-mediated knockdown of NAT10 resulted in growth retardation of human cells, and this was accompanied by high-level accumulation of the 30 S precursor of 18 S rRNA, suggesting that ac4C1842 formation catalyzed by NAT10 is involved in rRNA processing and ribosome biogenesis. PMID:25411247

  18. Metabolism of 18S rRNA in rat liver cells in different functional states of protein-synthesizing apparatus

    SciTech Connect

    Chirkov, G.P.; Druzhinina, M.K.; Todorov, I.N.

    1986-04-10

    The ratio of the absolute radioactivities of 28S and 18S RNAs in the fractions of membrane-bound and free polysomes and the fraction of free rat liver ribosomes was studied under conditions of inhibition of translation by cycloheximide, insulin, and cAMP. It was found that insulin and cAMP, in contrast to cycloheximide, do not induce selective degradation of 18S rRNA. The results are discussed from the standpoint of the possible role of the phosphorylation of protein S6 in the degradation of the 40S ribosomal subunit.

  19. Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana.

    PubMed

    Sikorski, Pawel J; Zuber, Hélène; Philippe, Lucas; Sement, François M; Canaday, Jean; Kufel, Joanna; Gagliardi, Dominique; Lange, Heike

    2015-09-01

    The biosynthesis of ribosomal RNA and its incorporation into functional ribosomes is an essential and intricate process that includes production of mature ribosomal RNA from large precursors. Here, we analyse the contribution of the plant exosome and its co-factors to processing and degradation of 18S pre-RNAs in Arabidopsis thaliana. Our data show that, unlike in yeast and humans, an RRP6 homologue, the nucleolar exoribonuclease RRP6L2, and the exosome complex, together with RRP44, function in two distinct steps of pre-18S rRNA processing or degradation in Arabidopsis. In addition, we identify TRL (TRF4/5-like) as the terminal nucleotidyltransferase that is mainly responsible for oligoadenylation of rRNA precursors in Arabidopsis. We show that TRL is required for efficient elimination of the excised 5' external transcribed spacer and of 18S maturation intermediates that escaped 5' processing. Our data also suggest involvement of additional nucleotidyltransferases, including terminal uridylyltransferase(s), in modifying rRNA processing intermediates in plants.

  20. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.

    PubMed

    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas

    2015-09-01

    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (http://www.ncbi.nlm.nih.gov/sra/SRX889598).

  1. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  2. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  3. Identification of protein-coding sequences using the hybridization of 18S rRNA and mRNA during translation.

    PubMed

    Xing, Chuanhua; Bitzer, Donald L; Alexander, Winser E; Vouk, Mladen A; Stomp, Anne-Marie

    2009-02-01

    We introduce a new approach in this article to distinguish protein-coding sequences from non-coding sequences utilizing a period-3, free energy signal that arises from the interactions of the 3'-terminal nucleotides of the 18S rRNA with mRNA. We extracted the special features of the amplitude and the phase of the period-3 signal in protein-coding regions, which is not found in non-coding regions, and used them to distinguish protein-coding sequences from non-coding sequences. We tested on all the experimental genes from Saccharomyces cerevisiae and Schizosaccharomyces pombe. The identification was consistent with the corresponding information from GenBank, and produced better performance compared to existing methods that use a period-3 signal. The primary tests on some fly, mouse and human genes suggests that our method is applicable to higher eukaryotic genes. The tests on pseudogenes indicated that most pseudogenes have no period-3 signal. Some exploration of the 3'-tail of 18S rRNA and pattern analysis of protein-coding sequences supported further our assumption that the 3'-tail of 18S rRNA has a role of synchronization throughout translation elongation process. This, in turn, can be utilized for the identification of protein-coding sequences.

  4. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.

    PubMed

    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo

    2007-11-01

    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  5. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  6. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff.

  7. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. PMID:23205499

  8. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  9. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1

    PubMed Central

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L.J.

    2015-01-01

    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson–Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  10. Evaluating multiple alternative hypotheses for the origin of Bilateria: An analysis of 18S rRNA molecular evidence

    PubMed Central

    Collins, Allen G.

    1998-01-01

    Six alternative hypotheses for the phylogenetic origin of Bilateria are evaluated by using complete 18S rRNA gene sequences for 52 taxa. These data suggest that there is little support for three of these hypotheses. Bilateria is not likely to be the sister group of Radiata or Ctenophora, nor is it likely that Bilateria gave rise to Cnidaria or Ctenophora. Instead, these data reveal a close relationship between bilaterians, placozoans, and cnidarians. From this, several inferences can be drawn. Morphological features that previously have been identified as synapomorphies of Bilateria and Ctenophora, e.g., mesoderm, more likely evolved independently in each clade. The endomesodermal muscles of bilaterians may be homologous to the endodermal muscles of cnidarians, implying that the original bilaterian mesodermal muscles were myoepithelial. Placozoans should have a gastrulation stage during development. Of the three hypotheses that cannot be falsified with the 18S rRNA data, one is most strongly supported. This hypothesis states that Bilateria and Placozoa share a more recent common ancestor than either does to Cnidaria. If true, the simplicity of placozoan body architecture is secondarily derived from a more complex ancestor. This simplification may have occurred in association with a planula-type larva becoming reproductive before metamorphosis. If this simplification took place during the common history that placozoans share with bilaterians, then placozoan genes that contain a homeobox, such as Trox2, should be explored, for they may include the gene or genes most closely related to Hox genes of bilaterians. PMID:9860990

  11. First description of heterogeneity in 18S rRNA genes in the haploid genome of Cryptosporidium andersoni Kawatabi type.

    PubMed

    Ikarashi, Makoto; Fukuda, Yasuhiro; Honma, Hajime; Kasai, Kenji; Kaneta, Yoshiyasu; Nakai, Yutaka

    2013-09-01

    The Apicomplexan Cryptosporidium andersoni, is a species of gastric Cryptosporidium, is frequently detected in older calves and adult cattle. Genotyping analyses based on 18S ribosomal RNA gene sequences have been performed on a novel C. andersoni genotype, namely the Kawatabi type, and the oocysts were classified into two distinct groups genotypically: Type A (the sequence in GenBank) and Type B (with a thymine nucleotide insertion not in Type A). This study analyzed 3775 cattle at a slaughterhouse and 310 cattle at a farm using microscopy and found 175 Cryptosporidium-positive animals: 171 from the slaughterhouse and four from the farm, and all infecting parasites were determined to be C. andersoni from 18S rRNA gene sequences determined from fecal DNA. In genotyping analyses with single isolated oocysts, about a half of analyzed ones were clearly classified into well known two genotypes (Type A and B). In addition to these two known genotypes, we have detected some oocysts showing mixed signals of Types A and B in the electropherogram from the automated sequencer (the Type C genotype). To determine the genotypic composition of sporozoites carried by the Type C oocysts, we analyzed their 18S rRNA gene sequences using a single sporozoite isolation procedure. Some sporozoites were classified as either Type A or Type B. However, more than half of the analyzed isolated sporozoites showed a mixed signal identical to that of Type C oocysts, and both the Type A and B signals were surely detectable from such sporozoites after a cloning procedure. In conclusion, C. andersoni carries two different genotypes heterogeneously in its haploid genome.

  12. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.

    PubMed

    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W

    2008-05-01

    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  13. Phylogeny of intestinal ciliates, including Charonina ventriculi, and comparison of microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis.

    PubMed

    Kittelmann, Sandra; Devente, Savannah R; Kirk, Michelle R; Seedorf, Henning; Dehority, Burk A; Janssen, Peter H

    2015-04-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups.

  14. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.

    2015-01-01

    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  15. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).

    PubMed

    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B

    2004-03-01

    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  16. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).

    PubMed

    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B

    2004-03-01

    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data.

  17. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  18. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis.

  19. [Fragment of mRNA coding part that is complementary to region 1638-1650 of wheat 18S rRNA functions as a translational enhancer].

    PubMed

    Zhigaĭlov, A V; Babaĭlova, E S; Polimbetova, N S; Graĭfer, D M; Karpova, G G; Iskakov, B K

    2012-01-01

    Possible involvement of 18S rRNA fragment 1638-1650 including basements of the helices h44 and h28 and nucleotides of the ribosomal decoding site in the cap-independent translation initiation on plant ribosomes is studied. This rRNA fragment is shown to be accessible for complementary interactions within the 40S ribosomal subunit. It is found that the sequence complementary to the 18S rRNA fragment 1638-1650 is able to enhance efficiency of a reporter mRNA translation when placed just after the initiation codon. The results obtained indicate that in the course of the cap-independent translation initiation, complementary interactions can occur between mRNA coding sequence and 18S rRNA fragment in the region of the ribosomal decoding site.

  20. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.

    PubMed

    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás

    2004-02-01

    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  1. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations.

  2. [Molecular phylogeny of gastrotricha based on 18S rRNA genes comparison: rejection of hypothesis of relatedness with nematodes].

    PubMed

    Petrov, N B; Pegova, A N; Manylov, O G; Vladychenskaia, N S; Miuge, N S; Aleshin, V V

    2007-01-01

    Gastrotrichs are meiobenthic free-living aquatic worms whose phylogenetic and intra-group relationships remain unclear despite some attempts to resolve them on the base of morphology or molecules. In this study we analysed complete sequences of the 18S rRNA gene of 15 taxa (8 new and 7 published) to test numerous hypotheses on gastrotrich phylogeny and to verify whether controversial interrelationships from previous molecular data could be due to the short region available for analysis and the poor taxa sampling. Data were analysed using both maximum likelihood and Bayesian inference. Results obtained suggest that gastrotrichs, together with Gnathostomulida, Plathelminthes, Syndermata (Rotifera + Acanthocephala), Nemertea and Lophotrochozoa, comprise a clade Spiralia. Statistical tests reject phylogenetic hypotheses regarding Gastrotricha as close relatives of Nematoda and other Ecdysozoa or placing them at the base of bilaterian tree close to acoels and nemertodermatides. Within Gastrotricha, Chaetonotida and Macrodasyida comprise two well supported clades. Our analysis confirmed the monophyly of the Chaetonotidae and Xenotrichulidae within Chaetonida as well as Turbanellidae and Thaumastodermatidae within Macrodasyida. Mesodasys is a sister group of the Turbanellidae, and Lepidodasyidae appears to be a polyphyletic group as Cephalodasys forms a separate lineage at the base of macrodasyids, whereas Lepidodasys groups with Neodasys between Thaumastodermatidae and Turbanellidae. To infer a more reliable Gastrotricha phylogeny many species and additional genes should be involved in future analyses. PMID:17685227

  3. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.

    PubMed

    Fuerst, Paul A; Booton, Gregory C; Crary, Monica

    2015-01-01

    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved. PMID:25284310

  4. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.

    PubMed

    Fuerst, Paul A; Booton, Gregory C; Crary, Monica

    2015-01-01

    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved.

  5. [Molecular phylogeny of gastrotricha based on 18S rRNA genes comparison: rejection of hypothesis of relatedness with nematodes].

    PubMed

    Petrov, N B; Pegova, A N; Manylov, O G; Vladychenskaia, N S; Miuge, N S; Aleshin, V V

    2007-01-01

    Gastrotrichs are meiobenthic free-living aquatic worms whose phylogenetic and intra-group relationships remain unclear despite some attempts to resolve them on the base of morphology or molecules. In this study we analysed complete sequences of the 18S rRNA gene of 15 taxa (8 new and 7 published) to test numerous hypotheses on gastrotrich phylogeny and to verify whether controversial interrelationships from previous molecular data could be due to the short region available for analysis and the poor taxa sampling. Data were analysed using both maximum likelihood and Bayesian inference. Results obtained suggest that gastrotrichs, together with Gnathostomulida, Plathelminthes, Syndermata (Rotifera + Acanthocephala), Nemertea and Lophotrochozoa, comprise a clade Spiralia. Statistical tests reject phylogenetic hypotheses regarding Gastrotricha as close relatives of Nematoda and other Ecdysozoa or placing them at the base of bilaterian tree close to acoels and nemertodermatides. Within Gastrotricha, Chaetonotida and Macrodasyida comprise two well supported clades. Our analysis confirmed the monophyly of the Chaetonotidae and Xenotrichulidae within Chaetonida as well as Turbanellidae and Thaumastodermatidae within Macrodasyida. Mesodasys is a sister group of the Turbanellidae, and Lepidodasyidae appears to be a polyphyletic group as Cephalodasys forms a separate lineage at the base of macrodasyids, whereas Lepidodasys groups with Neodasys between Thaumastodermatidae and Turbanellidae. To infer a more reliable Gastrotricha phylogeny many species and additional genes should be involved in future analyses.

  6. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  7. Crystal Structure of Rcl1 an Essential Component of the Eukaryal pre-rRNA Processosome Implicated in 18s rRNA Biogenesis

    SciTech Connect

    T Tanaka; P Smith; S Shuman

    2011-12-31

    Rcl1 is an essential nucleolar protein required for U3 snoRNA-guided pre-rRNA processing at sites flanking the 18S rRNA sequence. A potential catalytic role for Rcl1 during pre-rRNA cleavage has been suggested based on its primary structure similarity to RNA 3'-terminal phosphate cyclase (Rtc) enzymes, which perform nucleotidyl transfer and phosphoryl transfer reactions at RNA ends. Here, we report the 2.6 {angstrom} crystal structure of a biologically active yeast Rcl1, which illuminates its modular 4-domain architecture and overall homology with RNA cyclases while revealing numerous local differences that account for why Rtcs possess metal-dependent adenylyltransferase activity and Rcls do not. A conserved oxyanion-binding site in Rcl1 was highlighted for possible catalytic or RNA-binding functions. However, the benign effects of mutations in and around the anion site on Rcl1 activity in vivo militate against such a role.

  8. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.

    PubMed

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi

    2015-12-01

    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage. PMID:26319789

  9. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.

    PubMed

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi

    2015-12-01

    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage.

  10. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  11. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    PubMed

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia.

  12. Molecular epidemiology of Theileria annulata and identification of 18S rRNA gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.

    PubMed

    Khan, Muhammad Kasib; He, Lan; Hussain, Altaf; Azam, Sabita; Zhang, Wen-Jie; Wang, Li-Xia; Zhang, Qing-Li; Hu, Min; Zhou, Yan-Qin; Zhao, Junlong

    2013-01-01

    A molecular epidemiological survey was conducted to determine the prevalence of piroplasms in buffaloes and cattle from Sheikhupura and Okara districts of Punjab, Pakistan using reverse line blot (RLB) hybridization assay. The genetic diversity within 18S rRNA gene and ITS regions sequences of various obtained Theileria species (spp.) was also investigated. Briefly, 102 blood samples from buffaloes and cattle in the study districts were collected on blood collection cards and brought to the laboratory. DNA was extracted; the V4 hypervariable region of 18S rRNA was amplified and analyzed using RLB. Out of total samples analyzed, 61 (59.8%) were hybridized with Babesia/Theileria (B/T) genus-specific probe. Only one species of piroplasm was detected in buffaloes and cattle in study districts, i.e. Theileria (T.) annulata. Six samples only hybridized with B/T genus-specific and Theileria genus-specific probes but not with any species-specific probe indicating the presence of novel species or variants. The sequences of 18S rRNA gene and ITS regions of these six samples revealed the presence of T. annulata variants as confirmed through sequence identity estimation and phylogenetic analyses. Meanwhile, an unexpected sequence variation was observed within the 18S rRNA gene and ITS regions sequences of T. annulata identified in the present study. This is the first report on the simultaneous detection of species of piroplasms infecting buffaloes and cattle in Pakistan and molecular characterization of T. annulata 18S rRNA gene and ITS regions. The present study may address the new insights into the epidemiology of theileriosis which will help researches in designing control strategies and developing various molecular diagnostic tools at national level.

  13. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  14. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

    PubMed

    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  15. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation.

    PubMed

    Malygin, Alexey A; Kossinova, Olga A; Shatsky, Ivan N; Karpova, Galina G

    2013-10-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES-rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors.

  16. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.

    PubMed

    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2011-12-15

    Theileria parva is the causative agent of Corridor disease in cattle in South Africa. The African buffalo (Syncerus caffer) is the reservoir host, and, as these animals are important for eco-tourism in South Africa, it is compulsory to test and certify them disease free prior to translocation. A T. parva-specific real-time polymerase chain reaction (PCR) test based on the small subunit ribosomal RNA (18S rRNA) gene is one of the tests used for the diagnosis of the parasite in buffalo and cattle in South Africa. However, because of the high similarity between the 18S rRNA gene sequences of T. parva and Theileria sp. (buffalo), the latter is also amplified by the real-time PCR primers, although it is not detected by the T. parva-specific hybridization probes. Preliminary sequencing studies have revealed a small number of sequence differences within the 18S rRNA gene in both species but the extent of this sequence variation is unknown. The aim of the current study was to sequence the 18S rRNA genes of T. parva and Theileria sp. (buffalo), and to determine whether all identified genotypes can be correctly detected by the real-time PCR assay. The reverse line blot (RLB) hybridization assay was used to identify T. parva and Theileria sp. (buffalo) positive samples from buffalo blood samples originating from the Kruger National Park, Hluhluwe-iMfolozi Park, the Greater Limpopo Transfrontier Park, and a private game ranch in the Hoedspruit area. T. parva and Theileria sp. (buffalo) were identified in 42% and 28%, respectively, of 252 samples, mainly as mixed infections. The full-length 18S rRNA gene of selected samples was amplified, cloned and sequenced. From a total of 20 sequences obtained, 10 grouped with previously published T. parva sequences from GenBank while 10 sequences grouped with a previously published Theileria sp. (buffalo) sequence. All these formed a monophyletic group with known pathogenic Theileria species. Our phylogenetic analyses confirm the

  17. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.

    PubMed

    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser

    2016-01-01

    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships.

  18. Evaluation of nucleic acid sequence based amplification using fluorescence resonance energy transfer (FRET-NASBA) in quantitative detection of Aspergillus 18S rRNA.

    PubMed

    Park, Chulmin; Kwon, Eun-Young; Shin, Na-Young; Choi, Su-Mi; Kim, Si-Hyun; Park, Sun Hee; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong

    2011-01-01

    We attempted to apply fluorescence resonance energy transfer technology to nucleic acid sequence-based amplification (FRET-NASBA) on the platform of the LightCycler system to detect Aspergillus species. Primers and probes for the Aspergillus 18S rRNA were newly designed to avoid overlapping with homologous sequences of human 18s rRNA. NASBA using molecular beacon (MB) showed non-specific results which have been frequently observed from controls, although it showed higher sensitivity (10(-2) amol) than the FRET. FRET-NASBA showed a sensitivity of 10(-1) amol and a high fidelity of reproducibility from controls. As FRET technology was successfully applied to the NASBA assay, it could contribute to diverse development of the NASBA assay. These results suggest that FRET-NASBA could replace previous NASBA techniques in the detection of Aspergillus.

  19. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.

    PubMed

    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser

    2016-01-01

    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships. PMID:27149706

  20. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area.

  1. Gene cloning of the 18S rRNA of an ancient viable moss from the permafrost of northeastern Siberia

    NASA Astrophysics Data System (ADS)

    Marsic, Damien; Hoover, Richard B.; Gilichinsky, David A.; Ng, Joseph D.

    1999-12-01

    A moss plant dating as much as 40,000 years old was collected from the permafrost of the Kolyma Lowlands of Northeastern Siberia. The plant tissue was revived and cultured for the extraction of its genomic DNA. Using the polymerase chain reaction technique, the 18S ribosomal RNA gene was cloned and its sequence studied. Comparative sequence analysis of the cloned ribosomal DNA to other known 18S RNA showed very high sequence identity and was revealed to be closest to the moss specie, Aulacomnium turgidum. The results of this study also show the ability of biological organisms to rest dormant in deep frozen environments where they can be revived and cultured under favorable conditions. This is significant in the notion that celestial icy bodies can be media to preserve biological function and genetic material during long term storage or transport.

  2. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    PubMed

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  3. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.

    PubMed

    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos

    2013-09-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  4. Polymorphism of genes coding for nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10 from other groups in the Rhizoctonia solani species complex.

    PubMed

    Liu, Z L; Domier, L L; Sinclair, J B

    1995-07-01

    DNA polymorphism in the 18S nuclear rRNA gene region was investigated by using 11 restriction endonucleases for 161 isolates of 25 intraspecific groups (ISGs) representing 11 reported anastomosis groups (AGs) of Rhizoctonia solani. A PCR-based restriction mapping method in which enzymatically amplified DNA fragments and subfragments were digested with one or two restriction enzymes was employed. Four types of DNA restriction maps of this region were constructed for these 25 ISGs. Map type I of the 18S rDNA region was represented by isolates of a majority of R. solani ISGs. Map types II and III, represented by ISG 2E and 9 isolates and 5C isolates, respectively, differed from map I by the absence of one (map type II) or two (map type III) restriction sites. Map type IV, represented by ISG 10A and B (or AG 10) isolates, showed significant restriction site variations, with five enzymes in this region compared with those of the remaining ISGs or AGs. Ten of the 25 restriction sites in the 18S rRNA gene region were informative and selected for analysis. Previously reported restriction maps of the 5.8S rRNA gene region, including the internal transcribed spacers, were aligned with each other, and 12 informative restriction sites were identified. These data were used alone and in combination to evaluate group relationships. Analyses derived from these data sets by maximum parsimony and likelihood methods showed that AG 10 isolates were distinct and distantly related to the majority isolates of the other AGs of this species complex.

  5. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    PubMed

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  6. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data.

    PubMed

    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F; Glöckner, Frank Oliver; Reich, Marlis

    2015-01-01

    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  7. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data

    PubMed Central

    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F.; Glöckner, Frank Oliver; Reich, Marlis

    2015-01-01

    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  8. Molecular phylogenetic analysis of the coccidian cephalopod parasites Aggregata octopiana and Aggregata eberthi (Apicomplexa: Aggregatidae) from the NE Atlantic coast using 18S rRNA sequences.

    PubMed

    Castellanos-Martínez, Sheila; Pérez-Losada, Marcos; Gestal, Camino

    2013-08-01

    The coccidia genus Aggregata is responsible for intestinal coccidiosis in wild and cultivated cephalopods. Two coccidia species, Aggregata octopiana, (infecting the common octopus Octopus vulgaris), and A. eberthi, (infecting the cuttlefish Sepia officinalis), are identified in European waters. Extensive investigation of their morphology resulted in a redescription of A. octopiana in octopuses from the NE Atlantic Coast (NW Spain) thus clarifying confusing descriptions recorded in the past. The present study sequenced the 18S rRNA gene in A. octopiana and A. eberthi from the NE Atlantic coast in order to assess their taxonomic and phylogenetic status. Phylogenetic analyses revealed conspecific genetic differences (2.5%) in 18S rRNA sequences between A. eberthi from the Ria of Vigo (NW Spain) and the Adriatic Sea. Larger congeneric differences (15.9%) were observed between A. octopiana samples from the same two areas, which suggest the existence of two species. Based on previous morphological evidence, host specificity data, and new molecular phylogenetic analyses, we suggest that A. octopiana from the Ria of Vigo is the valid type species.

  9. Genetic identification of yeast 18S rRNA residues required for efficient recruitment of initiator tRNA(Met) and AUG selection.

    PubMed

    Dong, Jinsheng; Nanda, Jagpreet S; Rahman, Hafsa; Pruitt, Margaret R; Shin, Byung-Sik; Wong, Chi-Ming; Lorsch, Jon R; Hinnebusch, Alan G

    2008-08-15

    High-resolution structures of bacterial 70S ribosomes have provided atomic details about mRNA and tRNA binding to the decoding center during elongation, but such information is lacking for preinitiation complexes (PICs). We identified residues in yeast 18S rRNA critical in vivo for recruiting methionyl tRNA(i)(Met) to 40S subunits during initiation by isolating mutations that derepress GCN4 mRNA translation. Several such Gcd(-) mutations alter the A928:U1389 base pair in helix 28 (h28) and allow PICs to scan through the start codons of upstream ORFs that normally repress GCN4 translation. The A928U substitution also impairs TC binding to PICs in a reconstituted system in vitro. Mutation of the bulge G926 in h28 and certain other residues corresponding to direct contacts with the P-site codon or tRNA in bacterial 70S complexes confer Gcd(-) phenotypes that (like A928 substitutions) are suppressed by overexpressing tRNA(i)(Met). Hence, the nonconserved 928:1389 base pair in h28, plus conserved 18S rRNA residues corresponding to P-site contacts in bacterial ribosomes, are critical for efficient Met-tRNA(i)(Met) binding and AUG selection in eukaryotes.

  10. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences.

    PubMed

    Xu, Jinjun; Qu, Chanbao; Tao, Jianping

    2014-01-01

    Histomonas meleagridis is the causative agent of histomonosis, a disease of gallinaceous fowl characterized by necrotic typhlitis, hepatitis, and high mortality. To develop a rapid and sensitive method for specific detection of H. meleagridis, an assay based on loop-mediated isothermal amplification (LAMP) targeting the 18S rRNA gene was established. The detection limit of the LAMP assay was 10 copies for standard plasmids containing an 18S rRNA gene fragment, which was superior to that of a classical PCR method. Specificity tests revealed that there was no cross-reaction with other protozoa such as Trichomonas gallinae, Blastocytis sp, Tetratrichomonas gallinarum, Plasmodium gallinaceum, Toxoplasma gondii, Eimeria tenella, Leucocytozoon caulleryi and Leucocytozoon sabrazesi. The assay was evaluated for its diagnostic utility using liver and caeca samples collected from suspected field cases, the detection rate was 100 and 97.92%, respectively. These results indicate that the LAMP assay may be a useful tool for rapid detection and identification of H. meleagridis in poultry. PMID:24320623

  11. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.

    PubMed

    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H

    2013-10-01

    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment.

  12. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M

    1995-01-01

    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  13. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

    PubMed

    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

    2015-01-01

    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are

  14. Evolutionary relationships among the eukaryotic crown taxa taking into account site-to-site rate variation in 18S rRNA.

    PubMed

    Van de Peer, Y; De Wachter, R

    1997-12-01

    In this study we constructed a bootstrapped distance tree of 500 small subunit ribosomal RNA sequences from organisms belonging to the so-called crown of eukaryote evolution. Taking into account the substitution rate of the individual nucleotides of the rRNA sequence alignment, our results suggest that (1) animals, true fungi, and choanoflagellates share a common origin: The branch joining these taxa is highly supported by bootstrap analysis (bootstrap support [BS] > 90%), (2) stramenopiles and alveolates are sister groups (BS = 75%), (3) within the alveolates, dinoflagellates and apicomplexans share a common ancestor BS > 95%), while in turn they both share a common origin with the ciliates (BS > 80%), and (4) within the stramenopiles, heterokont algae, hyphochytriomycetes, and oomycetes form a monophyletic grouping well supported by bootstrap analysis (BS > 85%), preceded by the well-supported successive divergence of labyrinthulomycetes and bicosoecids. On the other hand, many evolutionary relationships between crown taxa are still obscure on the basis of 18S rRNA. The branching order between the animal-fungal-choanoflagellates clade and the chlorobionts, the alveolates and stramenopiles, red algae, and several smaller groups of organisms remains largely unresolved.When among-site rate variation is not considered, the inferred tree topologies are inferior to those where the substitution rate spectrum for the 18S rRNA is taken into account. This is primarily indicated by the erroneous branching of fast-evolving sequences. Moreover, when different substitution rates among sites are not considered, the animals no longer appear as a monophyletic grouping in most distance trees.

  15. Fast evolving 18S rRNA sequences from Solenogastres (Mollusca) resist standard PCR amplification and give new insights into mollusk substitution rate heterogeneity

    PubMed Central

    2010-01-01

    Background The 18S rRNA gene is one of the most important molecular markers, used in diverse applications such as molecular phylogenetic analyses and biodiversity screening. The Mollusca is the second largest phylum within the animal kingdom and mollusks show an outstanding high diversity in body plans and ecological adaptations. Although an enormous amount of 18S data is available for higher mollusks, data on some early branching lineages are still limited. Despite of some partial success in obtaining these data from Solenogastres, by some regarded to be the most "basal" mollusks, this taxon still remained problematic due to contamination with food organisms and general amplification difficulties. Results We report here the first authentic 18S genes of three Solenogastres species (Mollusca), each possessing a unique sequence composition with regions conspicuously rich in guanine and cytosine. For these GC-rich regions we calculated strong secondary structures. The observed high intra-molecular forces hamper standard amplification and appear to increase formation of chimerical sequences caused by contaminating foreign DNAs from potential prey organisms. In our analyses, contamination was avoided by using RNA as a template. Indication for contamination of previously published Solenogastres sequences is presented. Detailed phylogenetic analyses were conducted using RNA specific models that account for compensatory substitutions in stem regions. Conclusions The extreme morphological diversity of mollusks is mirrored in the molecular 18S data and shows elevated substitution rates mainly in three higher taxa: true limpets (Patellogastropoda), Cephalopoda and Solenogastres. Our phylogenetic tree based on 123 species, including representatives of all mollusk classes, shows limited resolution at the class level but illustrates the pitfalls of artificial groupings formed due to shared biased sequence composition. PMID:20214780

  16. Fluorescent Oligonucleotide Probes for Clinical and Environmental Detection of Acanthamoeba and the T4 18S rRNA Gene Sequence Type

    PubMed Central

    Stothard, Diane R.; Hay, John; Schroeder-Diedrich, Jill M.; Seal, David V.; Byers, Thomas J.

    1999-01-01

    The first genus- and subgenus-specific fluorescent oligonucleotide probes for in situ staining of Acanthamoeba are described. Sequences of these phylogeny-based probes complement the 18S rRNA and the gene encoding it (18S rDNA). The genus-specific probe (GSP) is a fluorescein-labeled 22-mer specific for Acanthamoeba as shown here by its hybridization to growing trophozoites of all 12 known Acanthamoeba 18S rDNA sequence types and by its failure to hybridize with amoebae of two other genera (Hartmannella vermiformis and Balamuthia mandrillaris), two human cell lines, and two bacteria (Pseudomonas aeruginosa and Escherichia coli). The sequence type T4-specific probe (ST4P) is a rhodamine-labeled 30-mer specific for Acanthamoeba 18S rDNA sequence type T4, as shown here in hybridization tests with trophozoites of all 12 sequence types. T4 is the subgenus group associated most closely with Acanthamoeba keratitis (AK). GSP also was tested with corneal scrapings from 17 patients with a high index of clinical suspicion of AK plus 5 patient controls. GSP stained both trophozoites and cysts, although nonspecific cyst wall autofluorescence also was observed. Results could be obtained with GSP in 1 to 2 days, and based on results from cell culture tests, the probe correctly detected the presence or absence of Acanthamoeba in 21 of 24 specimens from the 22 patients. The use of GSP with cultured trophozoites and cysts from corneal scrapings has illustrated the suitability of using fluorescent oligonucleotide probes for identification of the genus Acanthamoeba in both environmental and clinical samples. In addition, the use of ST4P with cultured amoebae has indicated the potential of oligonucleotide probes for use in subgenus classification. PMID:10405422

  17. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    SciTech Connect

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.

    2011-10-05

    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  18. Comparative analysis of eukaryotic marine microbial assemblages from 18S rRNA gene and gene transcript clone libraries by using different methods of extraction.

    PubMed

    Koid, Amy; Nelson, William C; Mraz, Amy; Heidelberg, Karla B

    2012-06-01

    Eukaryotic marine microbes play pivotal roles in biogeochemical nutrient cycling and ecosystem function, but studies that focus on the protistan biogeography and genetic diversity lag-behind studies of other microbes. 18S rRNA PCR amplification and clone library sequencing are commonly used to assess diversity that is culture independent. However, molecular methods are not without potential biases and artifacts. In this study, we compare the community composition of clone libraries generated from the same water sample collected at the San Pedro Ocean Time Series (SPOTs) station in the northwest Pacific Ocean. Community composition was assessed using different cell lysis methods (chemical and mechanical) and the extraction of different nucleic acids (DNA and RNA reverse transcribed to cDNA) to build Sanger ABI clone libraries. We describe specific biases for ecologically important phylogenetic groups resulting from differences in nucleic acid extraction methods that will inform future designs of eukaryotic diversity studies, regardless of the target sequencing platform planned.

  19. Genus Tetrastemma Ehrenberg, 1831 (Phylum Nemertea)--a natural group? Phylogenetic relationships inferred from partial 18S rRNA sequences.

    PubMed

    Strand, Malin; Sundberg, Per

    2005-10-01

    We investigated the monophyletic status of the hoplonemertean taxon Tetrastemma by reconstructing the phylogeny for 22 specimens assigned to this genus, together with another 25 specimens from closely related hoplonemertean genera. The phylogeny was based on partial 18S rRNA sequences using Bayesian and maximum likelihood analyses. The included Tetrastemma-species formed a well-supported clade, although the within-taxon relationships were unsettled. We conclude that the name Tetrastemma refers to a monophyletic taxon, but that it cannot be defined by morphological synapomorphies, and our results do not imply that all the over 100 species assigned to this genus belong to it. The results furthermore indicate that the genera Amphiporus and Emplectonema are non-monophyletic.

  20. Detection and discovery of crustacean parasites in blue crabs (Callinectes sapidus) by using 18S rRNA gene-targeted denaturing high-performance liquid chromatography.

    PubMed

    Troedsson, Christofer; Lee, Richard F; Walters, Tina; Stokes, Vivica; Brinkley, Karrie; Naegele, Verena; Frischer, Marc E

    2008-07-01

    Recently, we described a novel denaturing high-performance liquid chromatography (DHPLC) approach useful for initial detection and identification of crustacean parasites. Because this approach utilizes general primers targeted to conserved regions of the 18S rRNA gene, a priori genetic sequence information on eukaryotic parasites is not required. This distinction provides a significant advantage over specifically targeted PCR assays that do not allow for the detection of unknown or unsuspected parasites. However, initial field evaluations of the DHPLC assay suggested that because of PCR-biased amplification of dominant host genes it was not possible to detect relatively rare parasite genes in infected crab tissue. Here, we describe the use of a peptide nucleic acid (PNA) PCR hybridization blocking probe in association with DHPLC (PNA-PCR DHPLC) to overcome inherent PCR bias associated with amplification of rare target genes by use of generic primers. This approach was utilized to detect infection of blue crabs (Callinectes sapidus) by the parasitic dinoflagellate Hematodinium sp. Evaluation of 76 crabs caught in Wassaw Sound, GA, indicated a 97% correspondence between detection of the parasite by use of a specific PCR diagnostic assay and that by use of PNA-PCR DHPLC. During these studies, we discovered one crab with an association with a previously undescribed protist symbiont. Phylogenetic analysis of the amplified symbiont 18S rRNA gene indicated that it is most closely related to the free-living kinetoplastid parasite Procryptobia sorokini. To our knowledge, this is the first report of this parasite group in a decapod crab and of this organism exhibiting a presumably parasitic life history.

  1. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

    PubMed

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  2. Intracellular Diversity of the V4 and V9 Regions of the 18S rRNA in Marine Protists (Radiolarians) Assessed by High-Throughput Sequencing

    PubMed Central

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment. PMID:25090095

  3. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  4. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes.

  5. Simultaneous 16S and 18S rRNA fluorescence in situ hybridization (FISH) on LR White sections demonstrated in Vestimentifera (Siboglinidae) tubeworms.

    PubMed

    Schimak, Mario P; Toenshoff, Elena R; Bright, Monika

    2012-02-01

    Traditional morphological identification of invertebrate marine species is limited in early life history stages for many taxa. In this study, we demonstrate, by example of Vestimentiferan tubeworms (Siboglinidae, Polychaeta), that the simultaneous fluorescence in situ hybridization (FISH) of both eukaryotic host and bacterial symbiont cells is possible on a single semi-thin (1 μm) section. This allows the identification of host specimens to species level as well as offering visualization of bacteria distributed within the host tissue. Previously published 18S rRNA host-specific oligonucleotide probes for Riftia pachyptila, Tevnia jerichonana and a newly designed Oasisia alvinae probe, as well as a 16S rRNA probe targeting symbionts found in all host species, were applied. A number of standard fixation and hybridization parameters were tested and optimized for the best possible signal intensity and cellular resolution. Ethanol conserved samples embedded in LR White low viscosity resin yielded the best results with regard to both signal intensity and resolution. We show that extended storage times of specimens does not affect the quality of signals attained by FISH and use our protocol to identify morphologically unidentifiable tubeworm individuals from a small data set, conforming to previous findings in succession studies of the Siboglinidae family.

  6. Estimation of divergence times in litostomatean ciliates (Ciliophora: Intramacronucleata), using Bayesian relaxed clock and 18S rRNA gene.

    PubMed

    Vďačný, Peter

    2015-08-01

    The class Litostomatea comprises a diverse assemblage of free-living and endosymbiotic ciliates. To understand diversification dynamic of litostomateans, divergence times of their main groups were estimated with the Bayesian molecular dating, a technique allowing relaxation of molecular clock and incorporation of flexible calibration points. The class Litostomatea very likely emerged during the Cryogenian around 680 Mya. The origin of the subclass Rhynchostomatia is dated to about 415 Mya, while that of the subclass Haptoria to about 654 Mya. The order Pleurostomatida, emerging about 556 Mya, was recognized as the oldest group within the subclass Haptoria. The order Spathidiida appeared in the Paleozoic about 442 Mya. The three remaining haptorian orders evolved in the Paleozoic/Mesozoic periods: Didiniida about 419 Mya, Lacrymariida about 269 Mya, and Haptorida about 194 Mya. The subclass Trichostomatia originated from a spathidiid ancestor in the Mesozoic about 260 Mya. A further goal of this study was to investigate the impact of various settings on posterior divergence time estimates. The root placement and tree topology as well as the priors of the rate-drift model, birth-death process and nucleotide substitution rate, had no significant effect on calculation of posterior divergence time estimates. However, removal of calibration points could significantly change time estimates at some nodes.

  7. Structural and functional studies of Bud23-Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes.

    PubMed

    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L J

    2014-12-23

    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N(7)-methylguanosine (m(7)G) introduced at position 1575 on 18S rRNA by Bud23-Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23-Trm112 in the apo and S-adenosyl-L-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23-Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23-Trm112 binds precursor ribosomes at an early nucleolar stage, m(7)G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23-Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23-Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction.

  8. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.

    PubMed

    Triadó-Margarit, Xavier; Casamayor, Emilio O

    2015-12-01

    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. PMID:26224512

  9. Comparison of eukaryotic phytobenthic community composition in a polluted river by partial 18S rRNA gene cloning and sequencing.

    PubMed

    Dorigo, U; Bérard, A; Humbert, J F

    2002-11-01

    We compared the species composition in phytobenthic communities at different sampling sites in a small French river presenting polluted and unpolluted areas. For each sampling point, the total DNA was extracted and used to construct an 18S rRNA gene clone library after PCR amplification of a ca 400 bp fragment. Phytobenthic community composition was estimated by random sequencing of several clones per library. Most of the sequences corresponded to the Bacillariophyceae and Chlorophyceae groups. By combining phylogenetic and correspondence analyses, we showed that our molecular approach is able to estimate and compare the species composition at different sampling sites in order to assess the environmental impact of xenobiotics on phytobenthic communities. Changes in species composition of these communities were found, but no evident decrease in the diversity. We discuss the significance of these changes with regard to the existing level of pollution and their impact on the functionality of the ecosystem. Our findings suggest that it is now possible to use faster molecular methods (DGGE, ARISA.) to test large numbers of samples in the context of ecotoxicological studies, and thus to assess the impact of pollution in an aquatic ecosystem.

  10. Distance and Character-Based Evaluation of the V4 Region of the 18S rRNA Gene for the Identification of Diatoms (Bacillariophyceae)

    PubMed Central

    Luddington, Ian A.; Kaczmarska, Irena; Lovejoy, Connie

    2012-01-01

    DNA barcoding is a molecular tool that exploits a unique DNA sequence of a standardized gene or non-coding region for the species identification of unknown individuals. The investigation into a suitable barcode for diatoms is ongoing and there are several promising candidates including mitochondrial, plastidial and nuclear markers. We analyzed 272 sequences from 76 diatoms species in the orders Thalassiosirales, Lithodesmiales and Cymatosirales, using distance and character based approaches, to assess the applicability of a DNA barcode based on the hypervariable V4 region of the nuclear 18S rRNA gene. We show that the proposed V4 barcode separated ca. 97% of all centric diatom taxa tested using a threshold p-distance of 0.02 and that many problem pairs were further separated using a character based approach. The reliability of amplification, extensive reference library and variability seen in the V4 region make it the most promising candidate to date for a barcode marker for diatoms particularly when combined with DNA character analysis. PMID:23029169

  11. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  12. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  13. Phylogenetic position of phylum Nemertini, inferred from 18S rRNA sequences: molecular data as a test of morphological character homology.

    PubMed

    Turbeville, J M; Field, K G; Raff, R A

    1992-03-01

    Partial 18S rRNA sequence of the nemertine Cerebratulus lacteus was obtained and compared with those of coelomate metazoans and acoelomate platyhelminths to test whether nemertines share a most recent common ancestor with the platyhelminths, as traditionally has been implied, or whether nemertines lie within a protostome coelomate clade, as suggested by more recent morphological analyses. Maximum-parsimony analysis supports the inclusion of the nemertine within a protostome-coelomate clade that falls within a more inclusive coelomate clade. Bootstrap analysis indicates strong support for a monophyletic Coelomata composed of a deuterostome and protostome-coelomate clade. Support for a monophyletic protostome Coelomata is weak. Inference by distance analysis is consistent with that of maximum parsimony. Analysis of down-weighted paired sites by maximum parsimony reveals variation in topology only within the protostome-coelomate clade. The relationships among the protostome coelomates cannot be reliably inferred from the partial sequences, suggesting that coelomate protostomes diversified rapidly. Results with evolutionary parsimony are consistent with the inclusion of the nemertine in a coelomate clade. The molecular inference corroborates recent morphological character analyses that reveal no synapomorphies of nemertines and flatworms but instead suggest that the circulatory system and rhynchocoel of nemertines are homologous to coelomic cavities of protostome coelomates, thus supporting the corresponding hypothesis that nemertines belong within a protostome-coelomate clade. The sequence data provide an independent test of morphological character homology.

  14. Phylogenetic analysis based on 18S rRNA gene sequences of Schellackia parasites (Apicomplexa: Lankesterellidae) reveals their close relationship to the genus Eimeria.

    PubMed

    Megía-Palma, R; Martínez, J; Merino, S

    2013-08-01

    In the present study we detected Schellackia haemoparasites infecting the blood cells of Lacerta schreiberi and Podarcis hispanica, two species of lacertid lizards from central Spain. The parasite morphometry, the presence of a refractile body, the type of infected blood cells, the kind of host species, and the lack of oocysts in the fecal samples clearly indicated these blood parasites belong to the genus Schellackia. Until now, the species of this genus have never been genetically characterized and its taxonomic position under the Lankesterellidae family is based on the lack of the exogenous oocyst stage. However, the phylogenetic analysis performed on the basis of the 18S rRNA gene sequence revealed that species of the genus Schellackia are clustered with Eimeria species isolated from a snake and an amphibian species but not with Lankesterella species. The phylogenetic analysis rejects that both genera share a recent common ancestor. Based on these results we suggest a revision of the taxonomic status of the family Lankesterellidae. PMID:23731491

  15. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.

    PubMed

    Triadó-Margarit, Xavier; Casamayor, Emilio O

    2015-12-01

    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities.

  16. Identification of Sarcocystis hominis-like (Protozoa: Sarcocystidae) cyst in water buffalo (Bubalus bubalis) based on 18S rRNA gene sequences.

    PubMed

    Yang, Z Q; Zuo, Y X; Ding, B; Chen, X W; Luo, J; Zhang, Y P

    2001-08-01

    DNA templates were extracted from isolates of Sarcocystis hominis-like cysts collected from cattle and water buffalo, as well as from Sarcocystis fusiformis cysts and Sarcocystis suihominis cysts. The 18S rRNA genes were amplified using DNA from a single cyst as the templates. Approximately 1,367-1,440 bp sequences were obtained. The sequence difference in isolates of Sarcocystis hominis-like cysts from water buffaloes, and isolates of S. hominis cysts from cattle were very low, only about 0.1%, much lower than the lowest value (1.7%) among different species. Combined with their morphological structure, these sequence data indicate that the 4 isolates from cattle and water buffalo might be the same species, i.e., S. hominis, suggesting that both cattle and water buffalo may serve as the intermediate hosts for this parasite. Apparently, this is the first report using a single cyst to do such work and is a useful way to distinguish the Sarcocystis cyst in an intermediate host that may be simultaneously infected by several different Sarcocystis species.

  17. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  18. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene.

  19. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  20. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch.

    PubMed

    Mallatt, Jon; Giribet, Gonzalo

    2006-09-01

    This work expands on a study from 2004 by Mallatt, Garey, and Shultz [Mallatt, J.M., Garey, J.R., Shultz, J.W., 2004. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol. Phylogenet. Evol. 31, 178-191] that evaluated the phylogenetic relationships in Ecdysozoa (molting animals), especially arthropods. Here, the number of rRNA gene-sequences was effectively doubled for each major group of arthropods, and sequences from the phylum Kinorhyncha (mud dragons) were also included, bringing the number of ecdysozoan taxa to over 80. The methods emphasized maximum likelihood, Bayesian inference and statistical testing with parametric bootstrapping, but also included parsimony and minimum evolution. Prominent findings from our combined analysis of both genes are as follows. The fundamental subdivisions of Hexapoda (insects and relatives) are Insecta and Entognatha, with the latter consisting of collembolans (springtails) and a clade of proturans plus diplurans. Our rRNA-gene data provide the strongest evidence to date that the sister group of Hexapoda is Branchiopoda (fairy shrimps, tadpole shrimps, etc.), not Malacostraca. The large, Pancrustacea clade (hexapods within a paraphyletic Crustacea) divided into a few basic subclades: hexapods plus branchiopods; cirripedes (barnacles) plus malacostracans (lobsters, crabs, true shrimps, isopods, etc.); and the basally located clades of (a) ostracods (seed shrimps) and (b) branchiurans (fish lice) plus the bizarre pentastomids (tongue worms). These findings about Pancrustacea agree with a recent study by Regier, Shultz, and Kambic that used entirely different genes [Regier, J.C., Shultz, J.W., Kambic, R.E., 2005a. Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic. Proc. R. Soc. B 272, 395-401]. In Malacostraca, the stomatopod (mantis shrimp) was not at the base of the eumalacostracans

  1. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch.

    PubMed

    Mallatt, Jon; Giribet, Gonzalo

    2006-09-01

    This work expands on a study from 2004 by Mallatt, Garey, and Shultz [Mallatt, J.M., Garey, J.R., Shultz, J.W., 2004. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol. Phylogenet. Evol. 31, 178-191] that evaluated the phylogenetic relationships in Ecdysozoa (molting animals), especially arthropods. Here, the number of rRNA gene-sequences was effectively doubled for each major group of arthropods, and sequences from the phylum Kinorhyncha (mud dragons) were also included, bringing the number of ecdysozoan taxa to over 80. The methods emphasized maximum likelihood, Bayesian inference and statistical testing with parametric bootstrapping, but also included parsimony and minimum evolution. Prominent findings from our combined analysis of both genes are as follows. The fundamental subdivisions of Hexapoda (insects and relatives) are Insecta and Entognatha, with the latter consisting of collembolans (springtails) and a clade of proturans plus diplurans. Our rRNA-gene data provide the strongest evidence to date that the sister group of Hexapoda is Branchiopoda (fairy shrimps, tadpole shrimps, etc.), not Malacostraca. The large, Pancrustacea clade (hexapods within a paraphyletic Crustacea) divided into a few basic subclades: hexapods plus branchiopods; cirripedes (barnacles) plus malacostracans (lobsters, crabs, true shrimps, isopods, etc.); and the basally located clades of (a) ostracods (seed shrimps) and (b) branchiurans (fish lice) plus the bizarre pentastomids (tongue worms). These findings about Pancrustacea agree with a recent study by Regier, Shultz, and Kambic that used entirely different genes [Regier, J.C., Shultz, J.W., Kambic, R.E., 2005a. Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic. Proc. R. Soc. B 272, 395-401]. In Malacostraca, the stomatopod (mantis shrimp) was not at the base of the eumalacostracans

  2. Time-series of water column alkenones and 18S rRNA confirm that Uk'37 is a viable SST proxy in Narragansett Bay, RI

    NASA Astrophysics Data System (ADS)

    Salacup, J.; Theroux, S.; Herbert, T.; Prell, W. L.

    2011-12-01

    Alkenones, produced in the sunlit mixed layer by specific Haptophyte algae, are a well-established and widely-applied proxy for sea surface temperature (SST) in the world's open-oceans. However, the proxy's utility in estuarine environments remains largely untested. A reliable SST proxy is needed to identify the estuary's sensitivity and response to past and present global change because SST can exert strong control on stratification and circulation patterns, and thus oxygenation and ecosystem health, in these shallow basins. Knowing the estuaries response should help local managers and policy-makers plan mitigation and adaptation strategies. Additionally, the rapid deposition of both marine and terrestrial organic and inorganic material in estuarine systems makes them potential archives of high-resolution paleo-environmental information. A previous investigation of estuarine alkenones suggested that the Uk'37 proxy may be sensitive to the composition of the alkenone-producing Haptophyte population, which may be affected by local nutrient and fresh water fluxes. In particular, low-salinity coastal Haptophytes such as Isochrysis galbana may have a different relationship to SST than higher-salinity open-ocean Haptophytes and their presence may complicate interpretations of the Uk'37 proxy in estuaries. To better understand how the alkenone-based Uk'37 SST proxy is produced in estuarine systems, we present a two-year time-series (monthly-to-thrice-weekly resolution) of alkenone concentrations in particulate organic matter from Narragansett Bay. Alkenone concentrations are coupled with 18S ribosomal RNA (rRNA) measurements to identify the alkenone-producing population. Highest concentrations of alkenones are detected at different times in the upper and lower Bay such that the highest alkenone concentrations occur in the winter-spring (upper Bay) and summer/fall (lower Bay). This result is consistent with the established seasonal blooms and seasonal changes in nutrient

  3. Investigating microbial eukaryotic diversity from a global census: insights from a comparison of pyrotag and full-length sequences of 18S rRNA genes.

    PubMed

    Lie, Alle A Y; Liu, Zhenfeng; Hu, Sarah K; Jones, Adriane C; Kim, Diane Y; Countway, Peter D; Amaral-Zettler, Linda A; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Gast, Rebecca J; Caron, David A

    2014-07-01

    Next-generation DNA sequencing (NGS) approaches are rapidly surpassing Sanger sequencing for characterizing the diversity of natural microbial communities. Despite this rapid transition, few comparisons exist between Sanger sequences and the generally much shorter reads of NGS. Operational taxonomic units (OTUs) derived from full-length (Sanger sequencing) and pyrotag (454 sequencing of the V9 hypervariable region) sequences of 18S rRNA genes from 10 global samples were analyzed in order to compare the resulting protistan community structures and species richness. Pyrotag OTUs called at 98% sequence similarity yielded numbers of OTUs that were similar overall to those for full-length sequences when the latter were called at 97% similarity. Singleton OTUs strongly influenced estimates of species richness but not the higher-level taxonomic composition of the community. The pyrotag and full-length sequence data sets had slightly different taxonomic compositions of rhizarians, stramenopiles, cryptophytes, and haptophytes, but the two data sets had similarly high compositions of alveolates. Pyrotag-based OTUs were often derived from sequences that mapped to multiple full-length OTUs at 100% similarity. Thus, pyrotags sequenced from a single hypervariable region might not be appropriate for establishing protistan species-level OTUs. However, nonmetric multidimensional scaling plots constructed with the two data sets yielded similar clusters, indicating that beta diversity analysis results were similar for the Sanger and NGS sequences. Short pyrotag sequences can provide holistic assessments of protistan communities, although care must be taken in interpreting the results. The longer reads (>500 bp) that are now becoming available through NGS should provide powerful tools for assessing the diversity of microbial eukaryotic assemblages.

  4. Free-living protozoa in two unchlorinated drinking water supplies, identified by phylogenic analysis of 18S rRNA gene sequences.

    PubMed

    Valster, Rinske M; Wullings, Bart A; Bakker, Geo; Smidt, Hauke; van der Kooij, Dick

    2009-07-01

    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria, as well as pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies, using cultivation-independent molecular approaches. For this purpose, samples (<20 degrees C) of treated water, distributed water, and distribution system biofilms were collected from supply A, with a low concentration of natural organic matter (NOM) (<0.5 ppm of C), and from supply B, with a high NOM concentration (7.9 ppm of C). Eukaryotic communities were studied using terminal restriction fragment length polymorphism and clone library analyses of partial 18S rRNA gene fragments and a Hartmannella vermiformis-specific quantitative PCR (qPCR). In both supplies, highly diverse eukaryotic communities were observed, including free-living protozoa, fungi, and metazoa. Sequences of protozoa clustered with Amoebozoa (10 operational taxonomic units [OTUs]), Cercozoa (39 OTUs), Choanozoa (26 OTUs), Ciliophora (29 OTUs), Euglenozoa (13 OTUs), Myzozoa (5 OTUs), and Stramenopiles (5 OTUs). A large variety of protozoa were present in both supplies, but the estimated values for protozoan richness did not differ significantly. H. vermiformis was observed in both supplies but was not a predominant protozoan. One OTU with the highest similarity to Acanthamoeba polyphaga, an opportunistic human pathogen and a host for undesired bacteria, was observed in supply A. The high level of NOM in supply B corresponded with an elevated level of active biomass and with elevated concentrations of H. vermiformis in distributed water. Hence, the application of qPCR may be promising in elucidating the relationship between drinking water quality and the presence of specific protozoa.

  5. Free-Living Protozoa in Two Unchlorinated Drinking Water Supplies, Identified by Phylogenic Analysis of 18S rRNA Gene Sequences▿ †

    PubMed Central

    Valster, Rinske M.; Wullings, Bart A.; Bakker, Geo; Smidt, Hauke; van der Kooij, Dick

    2009-01-01

    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria, as well as pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies, using cultivation-independent molecular approaches. For this purpose, samples (<20°C) of treated water, distributed water, and distribution system biofilms were collected from supply A, with a low concentration of natural organic matter (NOM) (<0.5 ppm of C), and from supply B, with a high NOM concentration (7.9 ppm of C). Eukaryotic communities were studied using terminal restriction fragment length polymorphism and clone library analyses of partial 18S rRNA gene fragments and a Hartmannella vermiformis-specific quantitative PCR (qPCR). In both supplies, highly diverse eukaryotic communities were observed, including free-living protozoa, fungi, and metazoa. Sequences of protozoa clustered with Amoebozoa (10 operational taxonomic units [OTUs]), Cercozoa (39 OTUs), Choanozoa (26 OTUs), Ciliophora (29 OTUs), Euglenozoa (13 OTUs), Myzozoa (5 OTUs), and Stramenopiles (5 OTUs). A large variety of protozoa were present in both supplies, but the estimated values for protozoan richness did not differ significantly. H. vermiformis was observed in both supplies but was not a predominant protozoan. One OTU with the highest similarity to Acanthamoeba polyphaga, an opportunistic human pathogen and a host for undesired bacteria, was observed in supply A. The high level of NOM in supply B corresponded with an elevated level of active biomass and with elevated concentrations of H. vermiformis in distributed water. Hence, the application of qPCR may be promising in elucidating the relationship between drinking water quality and the presence of specific protozoa. PMID:19465529

  6. Use of 18S rRNA Gene-Based PCR Assay for Diagnosis of Acanthamoeba Keratitis in Non-Contact Lens Wearers in India

    PubMed Central

    Pasricha, Gunisha; Sharma, Savitri; Garg, Prashant; Aggarwal, Ramesh K.

    2003-01-01

    Identification of Acanthamoeba cysts and trophozoites in ocular tissues requires considerable expertise and is often time-consuming. An 18S rRNA gene-based PCR test, highly specific for the genus Acanthamoeba, has recently been reported in the molecular diagnosis of Acanthamoeba keratitis. This PCR assay was compared with conventional microbiological tests for the diagnosis of Acanthamoeba keratitis. In a pilot study, the PCR conditions with modifications were first tested on corneal scrapings from patients with culture-proven non-contact lens-related Acanthamoeba, bacterial, and fungal keratitis. This was followed by testing of corneal scrapings from 53 consecutive cases of microbial keratitis to determine sensitivity, specificity, and predictive values of the assay. All corneal scrapings from patients with proven Acanthamoeba keratitis showed a 463-bp amplicon, while no amplicon was obtained from patients with bacterial or fungal keratitis. Some of these amplified products were sequenced and compared with EMBL database reference sequences to validate these to be of Acanthamoeba origin. Out of 53 consecutive cases of microbial keratitis included for evaluating the PCR, 10 (18.9%) cases were diagnosed as Acanthamoeba keratitis on the basis of combined results of culture, smear, and PCR of corneal scrapings. Based on culture results as the “gold standard,” the sensitivity of PCR was the same as that of the smear (87.5%); however, the specificity and the positive and negative predictive values of PCR were marginally higher than the smear examination (97.8 versus 95.6%, 87.5 versus 77.8%, and 97.8 versus 97.7%) although the difference was not significant. This study confirms the efficacy of the PCR assay and is the first study to evaluate a PCR-based assay against conventional methods of diagnosis in a clinical setting. PMID:12843065

  7. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied.

  8. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. PMID:24071560

  9. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  10. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M

    2014-12-01

    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov.

  11. ARC-1, a sequence element complementary to an internal 18S rRNA segment, enhances translation efficiency in plants when present in the leader or intercistronic region of mRNAs

    PubMed Central

    Akbergenov, R. Zh.; Zhanybekova, S. Sh.; Kryldakov, R. V.; Zhigailov, A.; Polimbetova, N. S.; Hohn, T.; Iskakov, B. K.

    2004-01-01

    The sequences of different plant viral leaders with known translation enhancer ability show partial complementarity to the central region of 18S rRNA. Such complementarity might serve as a means to attract 40S ribosomal subunits and explain in part the translation-enhancing property of these sequences. To verify this notion, we designed β-glucuronidase (GUS) mRNAs differing only in the nature of 10 nt inserts in the center of their 41 base leaders. These were complementary to consecutive domains of plant 18S rRNA. Sucrose gradient analysis revealed that leaders with inserts complementary to regions 1105–1114 and 1115–1124 (‘ARC-1’) of plant 18S rRNA bound most efficiently to the 40S ribosomal subunit after dissociation from 80S ribosomes under conditions of high ionic strength, a treatment known to remove translation initiation factors. Using wheat germ cell-free extracts, we could demonstrate that mRNAs with these leaders were translated more than three times more efficiently than a control lacking such a complementarity. Three linked copies of the insert enhanced translation of reporter mRNA to levels comparable with those directed by the natural translation enhancing leaders of tobacco mosaic virus and potato virus Y RNAs. Moreover, inserting the same leaders as intercistronic sequences in dicistronic mRNAs substantially increased translation of the second cistron, thereby revealing internal ribosome entry site activity. Thus, for plant systems, the complementary interaction between mRNA leader and the central region of 18S rRNA allows cap-independent binding of mRNA to the 43S pre-initiation complex without assistance of translation initiation factors. PMID:14718549

  12. Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

    PubMed Central

    Thomas, Matthew C.; Selinger, L. Brent

    2012-01-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

  13. Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam.

    PubMed

    Gatei, Wangeci; Greensill, Julie; Ashford, Richard W; Cuevas, Luis E; Parry, Christopher M; Cunliffe, Nigel A; Beeching, Nicholas J; Hart, C Anthony

    2003-04-01

    An 840-bp fragment of the 18S rRNA gene was used to identify Cryptosporidium spp. recovered from human immunodeficiency virus (HIV)-infected and -uninfected patients from Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. Initial identification was by Ziehl-Neelsen acid-fast staining. Confirmation was by nested PCR, targeting the most polymorphic region of the 18S rRNA gene. Genotyping was by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing. Among 63 isolates analyzed, four genotypes of Cryptosporidium were identified; 75% of the isolates were of the C. parvum human genotype, while the potentially zoonotic species were of the C. parvum bovine genotype (21.7%), the C. meleagridis genotype (1.6% [one isolate]), and the C. muris genotype (1.6% [one case]). HIV-infected individuals were more likely to have zoonotic genotypes than the HIV-uninfected individuals. Among the C. parvum group, strains clustered distinctly into either human or bovine genotypes regardless of the geographical origin, age, or HIV status of the patients. The intragenotypic variation observed in the C. parvum human genotype was extensive compared to that within the C. parvum bovine genotype group. The variation within genotypes was conserved in all geographical regions regardless of the patients' HIV status. The extensive diversity within genotypes at the 18S rRNA gene locus may limit its application to phylogenetic analyses.

  14. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    PubMed

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  15. TcBat a bat-exclusive lineage of Trypanosoma cruzi in the Panama Canal Zone, with comments on its classification and the use of the 18S rRNA gene for lineage identification.

    PubMed

    Pinto, C Miguel; Kalko, Elisabeth K V; Cottontail, Iain; Wellinghausen, Nele; Cottontail, Veronika M

    2012-08-01

    We report TcBat, a recently described genetic lineage of Trypanosoma cruzi, in fruit-eating bats Artibeus from Panama. Infections were common (11.6% prevalence), but no other T. cruzi cruzi genotypes were detected. Phylogenetic analyses show an unambiguous association with Brazilian TcBat, but raise questions about the phylogenetic placement of this genotype using the 18S rRNA gene alone. However, analyses with three concatenated genes (18S rRNA, cytb, and H2B) moderately support TcBat as sister to the discrete typing unit (DTU) TcI. We demonstrate that short fragments (>500 bp) of the 18S rRNA gene are useful for identification of DTUs of T. cruzi, and provide reliable phylogenetic signal as long as they are analyzed within a matrix with reference taxa containing additional informative genes. TcBat forms a very distinctive monophyletic group that may be recognized as an additional DTU within T. cruzi cruzi. PMID:22543008

  16. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae) based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    PubMed

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp) and 28S (the 5' end of 646-743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  17. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern United States, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA gene (SSU rRNA). Howe...

  18. Chloroplast development at low temperatures requires a homolog of DIM1, a yeast gene encoding the 18S rRNA dimethylase.

    PubMed Central

    Tokuhisa, J G; Vijayan, P; Feldmann, K A; Browse, J A

    1998-01-01

    Poikilothermic organisms require mechanisms that allow survival at chilling temperatures (2 to 15 degreesC). We have isolated chilling-sensitive mutants of Arabidopsis, a plant that is very chilling resistant, and are characterizing them to understand the genes involved in chilling resistance. The T-DNA-tagged mutant paleface1 (pfc1) grows normally at 22 degrees C but at 5 degrees C exhibits a pattern of chilling-induced chlorosis consistent with a disruption of chloroplast development. Genomic DNA flanking the T-DNA was cloned and used to isolate wild-type genomic and cDNA clones. The PFC1 transcript is present at a low level in wild-type plants and was not detected in pfc1 plants. Wild-type Arabidopsis expressing antisense constructs of PFC1 grew normally at 22 degrees C but showed chilling-induced chlorosis, confirming that the gene is essential for low-temperature development of chloroplasts. The deduced amino acid sequence of PFC1 has identity with rRNA methylases found in bacteria and yeast that modify specific adenosines of pre-rRNA transcripts. The pfc1 mutant does not have these modifications in the small subunit rRNA of the plastid. PMID:9596631

  19. New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.

    PubMed

    Hu, Xiaozhong; Fan, Yangbo; Warren, Alan

    2015-08-01

    The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form. PMID:25948616

  20. New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.

    PubMed

    Hu, Xiaozhong; Fan, Yangbo; Warren, Alan

    2015-08-01

    The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.

  1. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  2. Polyamine stimulation of eEF1A synthesis based on the unusual position of a complementary sequence to 18S rRNA in eEF1A mRNA.

    PubMed

    Terui, Yusuke; Sakamoto, Akihiko; Yoshida, Taketo; Kasahara, Takuma; Tomitori, Hideyuki; Higashi, Kyohei; Igarashi, Kazuei; Kashiwagi, Keiko

    2015-02-01

    It is thought that Shine-Dalgarno-like sequences, which exhibit complementarity to the nucleotide sequences at the 3'-end of 18S rRNA, are not present in eukaryotic mRNAs. However, complementary sequences consisting of more than 5 nucleotides to the 3'-end of 18S rRNA, i.e., a CR sequence, are present at -17 to -32 upstream from the initiation codon AUG in 18 mRNAs involved in protein synthesis except eEF1A mRNA. Thus, effects of the CR sequence in mRNAs and polyamines on protein synthesis were examined using control and polyamine-reduced FM3A and NIH3T3 cells. Polyamines did not stimulate protein synthesis encoded by 18 mRNAs possessing a normal CR sequence. When the CR sequence was deleted, protein synthetic activities decreased to less than 70% of intact mRNAs. In eEF1A mRNA, the CR sequence was located at -33 to -39 upstream from the initiation codon AUG, and polyamines stimulated eEF1A synthesis about threefold. When the CR sequence was shifted to -22 to -28 upstream from the AUG, eEF1A synthesis increased in polyamine-reduced cells and the degree of polyamine stimulation decreased greatly. The results indicate that the CR sequence exists in many eukaryotic mRNAs, and the location of a CR sequence in mRNAs influences polyamine stimulation of protein synthesis.

  3. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gjerde, Bjørn

    2013-10-01

    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  4. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0.

    PubMed

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5'-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site.

  5. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  6. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  7. Microbial diversities (16S and 18S rRNA gene pyrosequencing) and environmental pathogens within drinking water biofilms grown on the common premise plumbing materials unplasticized polyvinylchloride and copper.

    PubMed

    Buse, Helen Y; Lu, Jingrang; Lu, Xinxin; Mou, Xiaozhen; Ashbolt, Nicholas J

    2014-05-01

    Drinking water (DW) biofilm communities influence the survival of opportunistic pathogens, yet knowledge about the microbial composition of DW biofilms developed on common in-premise plumbing material is limited. Utilizing 16S and 18S rRNA gene pyrosequencing, this study characterized the microbial community structure within DW biofilms established on unplasticized polyvinyl chloride (uPVC) and copper (Cu) surfaces and the impact of introducing Legionella pneumophila (Lp) and Acanthamoeba polyphaga. Mature (> 1 year old) biofilms were developed before inoculation with sterilized DW (control, Con), Lp, or Lp and A. polyphaga (LpAp). Comparison of uPVC and Cu biofilms indicated significant differences between bacterial (P = 0.001) and eukaryotic (P < 0.01) members attributable to the unique presence of several family taxa: Burkholderiaceae, Characeae, Epistylidae, Goniomonadaceae, Paramoebidae, Plasmodiophoridae, Plectidae, Sphenomonadidae, and Toxariaceae within uPVC biofilms; and Enterobacteriaceae, Erythrobacteraceae, Methylophilaceae, Acanthamoebidae, and Chlamydomonadaceae within Cu biofilms. Introduction of Lp alone or with A. polyphaga had no effect on bacterial community profiles (P > 0.05) but did affect eukaryotic members (uPVC, P < 0.01; Cu, P = 0.001). Thus, established DW biofilms host complex communities that may vary based on substratum matrix and maintain consistent bacterial communities despite introduction of Lp, an environmental pathogen.

  8. Phylogenetic analysis of 18S rRNA and the mitochondrial genomes of the wombat, Vombatus ursinus, and the spiny anteater, Tachyglossus aculeatus: increased support for the Marsupionta hypothesis.

    PubMed

    Janke, Axel; Magnell, Ola; Wieczorek, Georg; Westerman, Michael; Arnason, Ulfur

    2002-01-01

    The monotremes, the duck-billed platypus and the echidnas, are characterized by a number of unique morphological characteristics, which have led to the common belief that they represent the living survivors of an ancestral stock of mammals. Analysis of new data from the complete mitochondrial (mt) genomes of a second monotreme, the spiny anteater, and another marsupial, the wombat, yielded clear support for the Marsupionta hypothesis. According to this hypothesis marsupials are more closely related to monotremes than to eutherians, consistent with a basal split between eutherians and marsupials/monotremes among extant mammals. This finding was also supported by analysis of new sequences from a nuclear gene--18S rRNA. The mt genome of the wombat shares some unique features with previously described marsupial mtDNAs (tRNA rearrangement, a missing tRNA(Lys), and evidence for RNA editing of the tRNA(Asp)). Molecular estimates of genetic divergence suggest that the divergence between the platypus and the spiny anteater took place approximately 34 million years before present (MYBP), and that between South American and Australian marsupials approximately 72 MYBP. PMID:11734900

  9. Characterization of Sarcocystis species in domestic animals using a PCR-RFLP analysis of variation in the 18S rRNA gene: a cost-effective and simple technique for routine species identification.

    PubMed

    Yang, Zhao-Qing; Li, Qing-Qing; Zuo, Yang-Xian; Chen, Xin-Wen; Chen, Yong-Jiu; Nie, Long; Wei, Chang-Gue; Zen, Jia-Shun; Attwood, S W; Zhang, Xue-Zheng; Zhang, Ya-Ping

    2002-01-01

    Thirteen restriction endonucleases were used to investigate nuclotide sequence variation in the 18S rRNA DNA of 88 individuals from ten Sarcocystis taxa collected as cysts from their intermediate hosts, swine, cattle and water buffalo. A DNA sequence of approximately 900 bp was used. A total of 26 electromorphs were detected. The electromorphs were sorted into seven different haplotypes that coincided with the six named species and an unidentified species from cattle. These findings support those of our morphological examinations, which suggested that the taxa resembling Sarcocystis hirsuta, S. hominis, both found in water buffalo, and S. sinensis found in cattle, are not new species but are in fact S. hirsuta and S. hominis as found in cattle, and S. sinensis as found in water buffalo; this finding supports the idea that these species can utilize both cattle and water buffalo as intermediate hosts and are not restricted to one or the other host group as previously thought. PCR-RFLP resolved by agarose gel electrophoresis is shown to be an easy and rapid method of discriminating between these species.

  10. A new set of primers directed to 18S rRNA gene for molecular identification of Cryptosporidium spp. and their performance in the detection and differentiation of oocysts shed by synanthropic rodents.

    PubMed

    Silva, Sheila O S; Richtzenhain, Leonardo J; Barros, Iracema N; Gomes, Alessandra M M C; Silva, Aristeu V; Kozerski, Noemila D; de Araújo Ceranto, Jaqueline B; Keid, Lara B; Soares, Rodrigo M

    2013-11-01

    Cryptosporidium spp. are cosmopolitan protozoa that infect fishes, reptiles, amphibians, birds and mammals. More than 20 species are recognized within this genus. Rodents are a group of abundant and ubiquitous organisms that have been considered reservoirs of Cryptosporidium for humans and livestock. The aim of this study was to design specific primers for the gene encoding 18S rRNA, potentially capable of amplifying any species or genotype of Cryptosporidium spp. and evaluate the diagnostic attributes of the nested-PCR based on such probes. The primers were designed to amplify the shortest segment as possible to maximize the sensitivity of the test, but preserving the discriminatory potential of the amplified sequences for phylogenetic inferences. The nested-PCR standardized in this study (nPCR-SH) was compared in terms of sensitivity with another similar assay (nPCR-XIAO) that has been largely used for the detection and identification of Cryptosporidium spp. worldwide. We also aimed to molecularly characterize samples of Cryptosporidum spp. isolated from synanthropic rodents using these probes. Forty-five rodents were captured in urban areas of the municipality of Umuarama, Paraná State, Brazil. Fecal samples were submitted to three molecular tests (nested-PCRs), two of them targeted to the 18S rDNA gene (nPCR-SH and nPCR-XIAO) and the third targeted to the gene encoding actin (nPCR-actin). The nPCR-SH was tested positive on samples of Cryptosporidum parvum, Cryptosporidum andersoni, Cryptosporidum meleagridis, Cryptosporidum hominis, Cryptosporidum canis, and Cryptosporidum serpentis. Sixteen samples of rodents were positive by nPCR-SH, six by nPCR-XIAO and five by nPCR-actin. Sequencing of amplified fragments allowed the identification of Cryptosporidum muris in three samples of Rattus rattus, and two genotypes of Cryptosporidium, the genotypes mouse II and III. Cryptosporidium genotype mouse II was found in one sample of Mus musculus and genotype mouse III

  11. Ribosome biogenesis requires a highly diverged XRN family 5'->3' exoribonuclease for rRNA processing in Trypanosoma brucei.

    PubMed

    Sakyiama, Joseph; Zimmer, Sara L; Ciganda, Martin; Williams, Noreen; Read, Laurie K

    2013-10-01

    Although biogenesis of ribosomes is a crucial process in all organisms and is thus well conserved, Trypanosoma brucei ribosome biogenesis, of which maturation of rRNAs is an early step, has multiple points of divergence. Our aim was to determine whether in the processing of the pre-rRNA precursor molecule, 5'→3' exoribonuclease activity in addition to endonucleolytic cleavage is necessary in T. brucei as in other organisms. Our approach initiated with the bioinformatic identification of a putative 5'→3' exoribonuclease, XRNE, which is highly diverged from the XRN2/Rat1 enzyme responsible for rRNA processing in other organisms. Tagging this protein in vivo allowed us to classify XRNE as nucleolar by indirect immunofluorescence and identify by copurification interacting proteins, many of which were ribosomal proteins, ribosome biogenesis proteins, and/or RNA processing proteins. To determine whether XRNE plays a role in ribosome biogenesis in procyclic form cells, we inducibly depleted the protein by RNA interference. This resulted in the generation of aberrant preprocessed 18S rRNA and 5' extended 5.8S rRNA, implicating XRNE in rRNA processing. Polysome profiles of XRNE-depleted cells demonstrated abnormal features including an increase in ribosome small subunit abundance, a decrease in large subunit abundance, and defects in polysome assembly. Furthermore, the 5' extended 5.8S rRNA in XRNE-depleted cells was observed in the large subunit, monosomes, and polysomes in this gradient. Therefore, the function of XRNE in rRNA processing, presumably due to exonucleolytic activity very early in ribosome biogenesis, has consequences that persist throughout all biogenesis stages.

  12. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  13. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  14. Phylogenetic Analysis of the Spider Mite Sub-Family Tetranychinae (Acari: Tetranychidae) Based on the Mitochondrial COI Gene and the 18S and the 5′ End of the 28S rRNA Genes Indicates That Several Genera Are Polyphyletic

    PubMed Central

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825–1,901 bp) and 28S (the 5′ end of 646–743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered. PMID:25289639

  15. [Region 1112-1123 in the central domain of 18S rRNA in 40S subunits of plant ribosomes: accessibility for complementary interactions and the functional role].

    PubMed

    Zhigaĭlov, A V; Graĭfer, D M; Babaĭlova, E S; Polimbetova, N S; Karpova, G G; Iskakov, B K

    2010-01-01

    The binding of the 18S RNA of the 40S subunits of wheat germ ribosomes to an oligodeoxyribonucleotide complementary to the 1112-1123 region of the central domain of this RNA molecule has been studied. The selective binding of this oligomer to the complementary RNA fragment and the inhibition of the translation of uncapped chimeric RNA containing enhancer sequences in the 5'-untranslated region upstream of the reporter sequence coding for beta-glucuronidase has been shown in a cell-free protein-synthesizing system. The use of a derivative of the aforementioned oligomer containing an alkylating group at the 5' end allowed for the demonstration that the 1112-1123 region of 18S RNA can form a heteroduplex with the complementary sequence of the oligomer. The data obtained show that the 1112-1123 region in loop 27 of the central domain of 18S RNA of 40S ribosomal subunits is exposed on the subunit surface and probably participates in the cap-independent binding of the subunits to mRNA due to the complementary interaction with the enhancer sequences.

  16. Cellular identity of an 18S rRNA gene sequence clade within the class Kinetoplastea: the novel genus Actuariola gen. nov. (Neobodonida) with description of the type species Actuariola framvarensis sp. nov.

    PubMed

    Stoeck, Thorsten; Schwarz, M V Julian; Boenigk, Jens; Schweikert, Michael; von der Heyden, Sophie; Behnke, Anke

    2005-11-01

    Environmental molecular surveys of microbial diversity have uncovered a vast number of novel taxonomic units in the eukaryotic tree of life that are exclusively known by their small-subunit (SSU) rRNA gene signatures. In this study, we reveal the cellular and taxonomic identity of a novel eukaryote SSU rRNA gene sequence clade within the Kinetoplastea. Kinetoplastea are ubiquitously distributed flagellated protists of high ecological and medical importance. We isolated an organism from the oxic-anoxic interface of the anoxic Framvaren Fjord (Norway), which branches within an unidentified kinetoplastean sequence clade. Ultrastructural studies revealed a typical cellular organization that characterized the flagellated isolate as a member of the order Neobodonida Vickerman 2004, which contains five genera. The isolate differed in several distinctive characters from Dimastigella, Cruzella, Rhynchobodo and Rhynchomonas. The arrangement of the microtubular rod that supports the apical cytostome and the cytopharynx differed from the diagnosis of the fifth described genus (Neobodo Vickerman 2004) within the order Neobodonida. On the basis of both molecular and microscopical data, a novel genus within the order Neobodonida, Actuariola gen. nov., is proposed. Here, we characterize its type species, Actuariola framvarensis sp. nov., and provide an in situ tool to access the organism in nature and study its ecology.

  17. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  18. Cytogenetic analysis of the tamaraw (Bubalus mindorensis): a comparison of R-banded karyotype and chromosomal distribution of centromeric satellite DNAs, telomeric sequence, and 18S-28S rRNA genes with domestic water buffaloes.

    PubMed

    Tanaka, K; Matsuda, Y; Masangkay, J S; Solis, C D; Anunciado, R V; Kuro-o, M; Namikawa, T

    2000-01-01

    The karyotype of the tamaraw (Bubalus mindorensis, 2n = 46) was investigated by RBG-banding technique and compared with those of the river and the swamp cytotypes of domestic water buffalo (B. bubalis). The tamaraw karyotype consisted of 6 submetacentric and 16 acrocentric autosome pairs (NAA = 56), and X and Y chromosomes. The RBG-banded karyotype of the three taxa had a high degree of homology, and the tamaraw karyotype could be explained by a Robertsonian translocation between chromosomes 7 and 15 and by a telomere-centromere tandem fusion between chromosomes 4p and 12 of the standardized river buffalo cytotype (2n = 50, NAA = 58). The buffalo satellite I and II DNAs were localized to the centromeric regions of all the tamaraw chromosomes. The biarmed chromosome 2 of the tamaraw resulting from the fusion between chromosomes 7 and 15 of the standard contained much larger amounts of the satellite I DNA than the other biarmed chromosomes, suggesting that this chromosome was formed by a relatively recent Robertsonian fusion. The (TTAGGG)n telomeric sequence was specifically localized to the telomeric region of all the buffalo chromosomes. The 18S + 28S rDNA was localized to the telomeric regions of the chromosomes 5p, 7, 19, 21, and 22 of the tamaraw and of their homologous chromosomes in the river and swamp buffalo cytotypes.

  19. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  20. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    PubMed

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  1. The human IGF1R IRES likely operates through a Shine-Dalgarno-like interaction with the G961 loop (E-site) of the 18S rRNA and is kinetically modulated by a naturally polymorphic polyU loop.

    PubMed

    Meng, Zheng; Jackson, Nateka L; Shcherbakov, Oleg D; Choi, Hyoungsoo; Blume, Scott W

    2010-05-15

    IGF1R is a proto-oncogene with potent mitogenic and antiapoptotic activities, and its expression must be tightly regulated to maintain normal cellular and tissue homeostasis. We previously demonstrated that translation of the human IGF1R mRNA is controlled by an internal ribosome entry site (IRES), and delimited the core functional IRES to a 90-nucleotide segment of the 5'-untranslated region positioned immediately upstream of the initiation codon. Here we have analyzed the sequence elements that contribute to the function of the core IRES. The Stem2/Loop2 sequence of the IRES exhibits near-perfect Watson-Crick complementarity to the G961 loop (helix 23b) of the 18S rRNA, which is positioned within the E-site on the platform of the 40S ribosomal subunit. Mutations that disrupt this complementarity have a negative impact on regulatory protein binding and dramatically decrease IRES activity, suggesting that the IGF1R IRES may recruit the 40S ribosome by a eukaryotic equivalent of the Shine-Dalgarno (mRNA-rRNA base-pairing) interaction. The homopolymeric Loop3 sequence of the IRES modulates accessibility and limits the rate of translation initiation mediated through the IRES. Two functionally distinct allelic forms of the Loop3 poly(U)-tract are prevalent in the human population, and it is conceivable that germ-line or somatic variations in this sequence could predispose individuals to development of malignancy, or provide a selectable growth advantage for tumor cells.

  2. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  3. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  4. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin.

  5. The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

    PubMed

    Rubtsov, P M; Musakhanov, M M; Zakharyev, V M; Krayev, A S; Skryabin, K G; Bayev, A A

    1980-12-11

    The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.

  6. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  7. IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies

    PubMed Central

    Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

    2016-01-01

    The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users’ own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org. PMID:27659943

  8. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    PubMed

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  9. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A

    1998-01-01

    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  10. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  11. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole

    2016-01-01

    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  12. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole

    2016-01-01

    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects. PMID:27672657

  13. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis

    PubMed Central

    Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian

    2016-01-01

    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  14. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    PubMed

    Wang, Shuai; Bai, Ge; Wang, Shu; Yang, Leiyun; Yang, Fen; Wang, Yi; Zhu, Jian-Kang; Hua, Jian

    2016-05-01

    Plants have varying abilities to tolerate chilling (low but not freezing temperatures), and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance. PMID:27138552

  15. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  16. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    PubMed

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  17. Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA.

    PubMed

    Wachi, M; Umitsuki, G; Shimizu, M; Takada, A; Nagai, K

    1999-06-01

    We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA. PMID:10362534

  18. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  19. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    PubMed

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  20. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    PubMed Central

    Dimasuay, Kris Genelyn B.; Lavilla, Orlie John Y.; Rivera, Windell L.

    2013-01-01

    Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation. PMID:23936631

  1. Technical considerations in the use of 18s rRNA in gene expression studies

    EPA Science Inventory

    Gene expression analysis is now commonly used in ecotoxicological studies to indicate exposure of an organism to xenobiotics. For example, the vitellogenin gene is used to diagnose exposure of fish to environmental estrogens. Reverse transcription polymerase chain reaction (RT-PC...

  2. The contribution of DNA slippage to eukaryotic nuclear 18S rRNA evolution.

    PubMed

    Hancock, J M

    1995-06-01

    Six of 204 eukaryotic nuclear small-subunit ribosomal RNA sequences analyzed show a highly significant degree of clustering of short sequence motifs that indicates the fixation of products of replication slippage within them in their recent evolutionary history. A further 72 sequences show weaker indications of sequence repetition. Repetitive sequences in SSU rRNAs are preferentially located in variable regions and in particular in V4 and V7. The conserved region immediately 5' to V7 (C7) is also consistently repetitive. Whereas variable regions vary in length and appear to have evolved by the fixation of slippage products, C7 shows no indication of length variation. Repetition within C7 is therefore either not a consequence of slippage or reflects very ancient slippage events. The phylogenetic distribution of sequence simplicity in small-subunit rRNAs is patchy, being largely confined to the Mammalia, Apicomplexa, Tetrahymenidae, and Trypanosomatidae. The regions of the molecule associated with sequence simplicity vary with taxonomic grouping as do the sequence motifs undergoing slippage. Comparison of rates of insertion and substitution in a lineage within the genus Plasmodium confirms that both rates are higher in variable regions than in conserved regions. The insertion rate in variable regions is substantially lower than the substitution rate, suggesting that selection acts more strongly on slippage products than on point mutations in these regions. Patterns of coevolution between variable regions may reflect the consequences of selection acting on the incorporation of slippage-derived sequences across the gene.

  3. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

  4. Comparison of ITS and 18S rDNA for estimating fungal diversity using PCR-DGGE.

    PubMed

    Liu, Jie; Yu, Yaoyao; Cai, Zhang; Bartlam, Mark; Wang, Yingying

    2015-09-01

    Both the internal transcribed spacer (ITS) region and 18S rRNA genes are broadly applied in molecular fingerprinting studies of fungi. However, the differences in those two ribosomal RNA regions are still largely unknown. In the current study, three sets of most suitable subunit ribosomes in ITS and 18S rRNA were compared using denaturing gradient gel electrophoresis (DGGE) under the optimum experimental conditions. Ten samples from both aquatic and soil environments were tested. The results revealed that the ITS region produced range-weighted richness in the range 36-361, which was significantly higher than that produced by 18S rDNA. There was a similar tendency in terms of the Shannon-Weaver diversity index and community dynamics in both water and soil samples. Samples from water and soil were better separated using ITS than 18S rDNA in principal component analysis of DGGE bands. Our study suggests that the ITS region is more precise and has more potential than 18S rRNA genes in fungal community analysis.

  5. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    PubMed

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci.

  6. Microbial community of salt crystals processed from Mediterranean seawater based on 16S rRNA analysis.

    PubMed

    Baati, Houda; Guermazi, Sonda; Gharsallah, Neji; Sghir, Abdelghani; Ammar, Emna

    2010-01-01

    Phylogenetic analysis of 16S rRNA was used to investigate for the first time the structure of the microbial community that inhabits salt crystals retrieved from the bottom of a solar saltern, located in the coastal area of the Mediterranean Sea (Sfax, Tunisia). This community lives in an extremely salty environment of 250-310 g/L total dissolved salt. A total of 78 bacterial 16S rRNA clone sequences making up to 21 operational taxonomic units (OTUs), determined by the DOTUR program to 97% sequence similarity, was analyzed. These OTUs were affiliated to Bacteroidetes (71.4% of OTUs), and gamma-Proteobacteria and alpha-Proteobacteria (equally represented by 14.2% of the OTUs observed). The archaeal community composition appeared more diverse with 68 clones, resulting in 44 OTUs, all affiliated with the Euryarchaeota phylum. Of the bacterial and archaeal clones showing <97% 16S rRNA sequence identity with sequences in public databases, 47.6% and 84.1% respectively were novel clones. Both rarefaction curves and diversity measurements (Simpson, Shannon-Weaver, Chao) showed a more diverse archaeal than bacterial community at the Tunisian solar saltern pond. The analysis of an increasing clone's number may reveal additional local diversity. PMID:20130693

  7. Analysis of mRNA decay and rRNA processing in Escherichia coli multiple mutants carrying a deletion in RNase III.

    PubMed Central

    Babitzke, P; Granger, L; Olszewski, J; Kushner, S R

    1993-01-01

    RNase III is an endonuclease involved in processing both rRNA and certain mRNAs. To help determine whether RNase III (rnc) is required for general mRNA turnover in Escherichia coli, we have created a deletion-insertion mutation (delta rnc-38) in the structural gene. In addition, a series of multiple mutant strains containing deficiencies in RNase II (rnb-500), polynucleotide phosphorylase (pnp-7 or pnp-200), RNase E (rne-1 or rne-3071), and RNase III (delta rnc-38) were constructed. The delta rnc-38 single mutant was viable and led to the accumulation of 30S rRNA precursors, as has been previously observed with the rnc-105 allele (P. Gegenheimer, N. Watson, and D. Apirion, J. Biol. Chem. 252:3064-3073, 1977). In the multiple mutant strains, the presence of the delta rnc-38 allele resulted in the more rapid decay of pulse-labeled RNA but did not suppress conditional lethality, suggesting that the lethality associated with altered mRNA turnover may be due to the stabilization of specific mRNAs. In addition, these results indicate that RNase III is probably not required for general mRNA decay. Of particular interest was the observation that the delta rnc-38 rne-1 double mutant did not accumulate 30S rRNA precursors at 30 degrees C, while the delta rnc-38 rne-3071 double mutant did. Possible explanations of these results are discussed. Images PMID:8416898

  8. mTOR signaling regulates the processing of pre-rRNA in human cells

    PubMed Central

    Iadevaia, Valentina; Zhang, Ze; Jan, Eric; Proud, Christopher G.

    2012-01-01

    Signaling through the mammalian target of rapamycin, complex 1 (mTORC1), positively regulates the transcription of ribosomal RNA (rRNA) and the synthesis of ribosomal proteins, thereby promoting the complex process of ribosome biogenesis. The major rRNAs are transcribed as a single precursor, which must be processed to create the 5.8S, 18S and 28S rRNAs. We used a new non-radioactive labeling approach to study the effects of rapamycin, an inhibitor of mTORC1, on rRNA synthesis. Rapamycin not only impaired synthesis of new 18S, 28S or 5S rRNA but also induced their decay. This prompted us to examine the effects of rapamycin on rRNA processing. We show that rapamycin also interferes with the processing events that generate 18S and 28S rRNA. rRNA transcription and processing occur in regions of the nucleus known as nucleoli. We find that the mTORC1 components raptor and mTOR are both present in nucleoli, where they may regulate rRNA maturation events. While rapamycin has no effect on overall nucleolar morphology or its proteome, it does induce loss of mTOR and raptor from them. These data show that mTORC1 is located in nucleoli where it acts to regulate events involved in ribosome biogenesis including the maturation of rRNA molecules. PMID:22121221

  9. Molecular Phylogeny of Cypridoid Freshwater Ostracods (Crustacea: Ostracoda), Inferred from 18S and 28S rDNA Sequences.

    PubMed

    Hiruta, Shimpei F; Kobayashi, Norio; Katoh, Toru; Kajihara, Hiroshi

    2016-04-01

    With the aim of exploring phylogenetic relationships within Cypridoidea, the most species-rich superfamily among the podocopidan ostracods, we sequenced nearly the entire 18S rRNA gene (18S) and part of the 28S rRNA gene (28S) for 22 species in the order Podocopida, with representatives from all the major cypridoid families. We conducted phylogenetic analyses using the methods of maximum likelihood, minimum evolution, and Bayesian analysis. Our analyses showed monophyly for Cyprididae, one of the four families currently recognized in Cypridoidea. Candonidae turned out to be paraphyletic, and included three clades corresponding to the subfamilies Candoninae, Paracypridinae, and Cyclocypridinae. We propose restricting the name Candonidae s. str. to comprise what is now Candoninae, and raising Paracypridinae and Cyclocyprininae to family rank within the superfamily Cypridoidea.

  10. Genome-wide analysis of small nucleolar RNAs of Leishmania major reveals a rich repertoire of RNAs involved in modification and processing of rRNA

    PubMed Central

    Eliaz, Dror; Doniger, Tirza; Tkacz, Itai Dov; Biswas, Viplov Kumar; Gupta, Sachin Kumar; Kolev, Nikolay G; Unger, Ron; Ullu, Elisabetta; Tschudi, Christian; Michaeli, Shulamit

    2015-01-01

    Trypanosomatids are protozoan parasites and the causative agent of infamous infectious diseases. These organisms regulate their gene expression mainly at the post-transcriptional level and possess characteristic RNA processing mechanisms. In this study, we analyzed the complete repertoire of Leishmania major small nucleolar (snoRNA) RNAs by performing RNA-seq analysis on RNAs that were affinity-purified using the C/D snoRNA core protein, SNU13, and the H/ACA core protein, NHP2. This study revealed a large collection of C/D and H/ACA snoRNAs, organized in gene clusters generally containing both snoRNA types. Abundant snoRNAs were identified and predicted to guide trypanosome-specific rRNA cleavages. The repertoire of snoRNAs was compared to that of the closely related Trypanosoma brucei, and 80% of both C/D and H/ACA molecules were found to have functional homologues. The comparative analyses elucidated how snoRNAs evolved to generate molecules with analogous functions in both species. Interestingly, H/ACA RNAs have great flexibility in their ability to guide modifications, and several of the RNA species can guide more than one modification, compensating for the presence of single hairpin H/ACA snoRNA in these organisms. Placing the predicted modifications on the rRNA secondary structure revealed hypermodification regions mostly in domains which are modified in other eukaryotes, in addition to trypanosome-specific modifications. PMID:25970223

  11. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  12. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).

    PubMed

    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I

    2005-12-01

    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  13. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).

    PubMed

    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I

    2005-12-01

    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  14. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  15. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    PubMed

    Tanaka, Ryusei; Hino, Akina; Tsai, Isheng J; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  16. Two F-18s in Autonomous Formation Flight

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This 32 second video clip shows two F-18s in NASA's Autonomous Formation Flight (AFF) program. The aircraft use smoke contrails to gather data on wingtip vortices. Flight research attempts to utilize the energy in the vortices for more efficient flight.

  17. Ptc6 Is Required for Proper Rapamycin-Induced Down-Regulation of the Genes Coding for Ribosomal and rRNA Processing Proteins in S. cerevisiae

    PubMed Central

    González, Asier; Casado, Carlos; Ariño, Joaquín; Casamayor, Antonio

    2013-01-01

    Ptc6 is one of the seven components (Ptc1-Ptc7) of the protein phosphatase 2C family in the yeast Saccharomyces cerevisiae. In contrast to other type 2C phosphatases, the cellular role of this isoform is poorly understood. We present here a comprehensive characterization of this gene product. Cells lacking Ptc6 are sensitive to zinc ions, and somewhat tolerant to cell-wall damaging agents and to Li+. Ptc6 mutants are sensitive to rapamycin, albeit to lesser extent than ptc1 cells. This phenotype is not rescued by overexpression of PTC1 and mutation of ptc6 does not reproduce the characteristic genetic interactions of the ptc1 mutation with components of the TOR pathway, thus suggesting different cellular roles for both isoforms. We show here that the rapamycin-sensitive phenotype of ptc6 cells is unrelated to the reported role of Pt6 in controlling pyruvate dehydrogenase activity. Lack of Ptc6 results in substantial attenuation of the transcriptional response to rapamycin, particularly in the subset of repressed genes encoding ribosomal proteins or involved in rRNA processing. In contrast, repressed genes involved in translation are Ptc6-independent. These effects cannot be attributed to the regulation of the Sch9 kinase, but they could involve modulation of the binding of the Ifh1 co-activator to specific gene promoters. PMID:23704987

  18. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends.

  19. Detection and characterization of fungal infections of Ammophila arenaria (marram grass) roots by denaturing gradient gel electrophoresis of specifically amplified 18s rDNA.

    PubMed Central

    Kowalchuk, G A; Gerards, S; Woldendorp, J W

    1997-01-01

    Marram grass (Ammophila arenaria L.), a sand-stabilizing plant species in coastal dune areas, is affected by a specific pathosystem thought to include both plant-pathogenic fungi and nematodes. To study the fungal component of this pathosystem, we developed a method for the cultivation-independent detection and characterization of fungi infecting plant roots based on denaturing gradient gel electrophoresis (DGGE) of specifically amplified DNA fragments coding for 18S rRNA (rDNA). A nested PCR strategy was employed to amplify a 569-bp region of the 18S rRNA gene, with the addition of a 36-bp GC clamp, from fungal isolates, from roots of test plants infected in the laboratory, and from field samples of marram grass roots from both healthy and degenerating stands from coastal dunes in The Netherlands. PCR products from fungal isolates were subjected to DGGE to examine the variation seen both between different fungal taxa and within a single species. DGGE of the 18S rDNA fragments could resolve species differences from fungi used in this study yet was unable to discriminate between strains of a single species. The 18S rRNA genes from 20 isolates of fungal species previously recovered from A. arenaria roots were cloned and partially sequenced to aid in the interpretation of DGGE data. DGGE patterns recovered from laboratory plants showed that this technique could reliably identify known plant-infecting fungi. Amplification products from field A. arenaria roots also were analyzed by DGGE, and the major bands were excised, reamplified, sequenced, and subjected to phylogenetic analysis. Some recovered 18S rDNA sequences allowed for phylogenetic placement to the genus level, whereas other sequences were not closely related to known fungal 18S rDNA sequences. The molecular data presented here reveal fungal diversity not detected in previous culture-based surveys. PMID:9327549

  20. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  1. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    PubMed

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  2. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  3. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    PubMed Central

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2015-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. PMID:25539917

  4. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria.

  5. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    PubMed

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  6. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.

    PubMed

    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S

    2003-11-01

    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  7. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    PubMed

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  8. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  9. Isolation and cultivation of endosymbiotic algae from green hydra and phylogenetic analysis of 18S rDNA sequences.

    PubMed

    Kovacević, Goran; Franjević, Damjan; Jelencić, Biserka; Kalafatić, Mirjana

    2010-01-01

    Symbiotic associations are of wide significance in evolution and biodiversity. The green hydra is a typical example of endosymbiosis. In its gastrodermal myoepithelial cells it harbors the individuals of a unicellular green algae. Endosymbiotic algae from green hydra have been successfully isolated and permanently maintained in a stable clean lab culture for the first time. We reconstructed the phylogeny of isolated endosymbiotic algae using the 18S rRNA gene to clarify its current status and to validate the traditional inclusion of these endosymbiotic algae within the Chlorella genus. Molecular analyses established that different genera and species of unicellular green algae could be present as symbionts in green hydra, depending on the natural habitat of a particular strain of green hydra.

  10. Genotypic heterogeneity based on 18S-rRNA gene sequences among Acanthamoeba isolates from clinical samples in Italy.

    PubMed

    Di Cave, David; D' Alfonso, Rossella; Dussey Comlavi, Kodjo A; D' Orazi, Carlo; Monno, Rosa; Berrilli, Federica

    2014-11-01

    Acanthamoeba keratitis (AK) is an ocular disease caused by members of a genus of free-living amoebae and it is associated predominantly with contact lens (CL) use. This study reports 55 cases of AK diagnosed in Italy. Genotype identification was carried out by PCR assay followed by sequence analysis of the 18S rRNA gene using the genus specific primers JDP1 and JDP2. Genotype assignment was based on phenetic analysis of the ASA.S1 subset of the small-subunit rRNA gene sequences. The material has been collected at the Polyclinic Tor Vergata of Rome for a total of 19 isolates and at the Polyclinic Hospital of Bari (36 isolates). Thirty-three out of the 55 genetically characterized isolates were assigned to the genotype T4. Ten isolates were identified as belonging to the genotype T15 thus confirming the first association between the genotype T15 and human amoebic keratitis previously described from the same area. We underline the occurrence of the genotype T3 and T11 identified for the first time in the country.

  11. Soil clone library analyses to evaluate specificity and selectivity of PCR primers targeting fungal 18S rDNA for denaturing-gradient gel electrophoresis (DGGE).

    PubMed

    Takada Hoshino, Yuko; Morimoto, Sho

    2010-01-01

    We evaluated the fungal specificity and detection bias of four fungal 18S rRNA gene (18S rDNA) primer sets for denaturing-gradient gel electrophoresis (DGGE). We constructed and compared clone libraries amplified from upland and paddy field soils with each primer set (1, NS1/GCFung; 2, FF390/FR1-GC; 3, NS1/FR1-GC; and 4, NS1/EF3 for the first PCR and NS1/FR1-GC for the second PCR). Primer set 4 (for nested PCR) showed the highest specificity for fungi but biased specific sequences. Sets 1, 2, and 3 (for single PCR) amplified non-fungal eukaryotic sequences (from 7 to 16% for upland soil and from 20 to 31% for paddy field soil) and produced libraries with similar distributions of fungal 18S rDNA sequences at both the phylum and the class level. Set 2 tended to amplify more diverse fungal sequences, maintaining higher specificity for fungi. In addition, clone analyses revealed differences among primer sets in the frequency of chimeras. In upland field soil, the libraries amplified with primer sets 3 and 4, which targeted long fragments, contained many chimeric 18S rDNA sequences (18% and 48%, respectively), while the libraries obtained with sets 1 and 2, which targeted short fragments, contained fewer chimeras (5% and 10%, respectively).

  12. PCR amplification of a multi-copy mitochondrial gene (cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S).

    PubMed

    Schreeg, Megan E; Marr, Henry S; Griffith, Emily H; Tarigo, Jaime L; Bird, David M; Reichard, Mason V; Cohn, Leah A; Levy, Michael G; Birkenheuer, Adam J

    2016-07-30

    Cytauxzoon felis is a tick-transmitted protozoan parasite that infects felids. Clinical disease caused by acute C. felis infection rapidly progresses in domestic cats, leading to high morbidity and mortality. Accurately diagnosing cytauxzoonosis as soon as possible during acute infection would allow for earlier initiation of antiprotozoal therapy which could lead to higher survival rates. Molecular detection of parasite rRNA genes (18S) by PCR has previously been shown to be a sensitive method of diagnosing C. felis infections. Based on evidence from related apicomplexan species, we hypothesized that C. felis mitochondrial genes would exist at higher copy numbers than 18S and would be a more sensitive diagnostic target. In this study we have designed a PCR assay targeting the C. felis mitochondrial gene cytochrome c oxidase subunit III (cox3). Herein we demonstrate that (1) the cox3 PCR can detect as low as 1 copy of DNA target and can detect C. felis in samples with known mitochondrial sequence heterogeneity, (2) cox3 copy number is increased relative to 18S in blood and tissue samples from acutely infected cats, and (3) the cox3 PCR is more sensitive than 18S PCR for detection of C. felis during early infections.

  13. DExD-box RNA-helicases in Listeria monocytogenes are important for growth, ribosomal maturation, rRNA processing and virulence factor expression

    PubMed Central

    Bäreclev, Caroline; Vaitkevicius, Karolis; Netterling, Sakura; Johansson, Jörgen

    2014-01-01

    RNA-helicases are proteins required for the unwinding of occluding secondary RNA structures, especially at low temperatures. In this work, we have deleted all 4 DExD-box RNA helicases in various combinations in the Gram-positive pathogen Listeria monocytogenes. Our results show that 3 out of 4 RNA-helicases were important for growth at low temperatures, whereas the effect was less prominent at 37°C. Over-expression of one RNA-helicase, Lmo1450, was able to overcome the reduced growth of the quadruple mutant strain at temperatures above 26°C, but not at lower temperatures. The maturation of ribosomes was affected in different degrees in the various strains at 20°C, whereas the effect was marginal at 37°C. This was accompanied by an increased level of immature 23S rRNA precursors in some of the RNA-helicase mutants at low temperatures. Although the expression of the PrfA regulated virulence factors ActA and LLO decreased in the quadruple mutant strain, this strain showed a slightly increased infection ability. Interestingly, even though the level of the virulence factor LLO was decreased in the quadruple mutant strain as compared with the wild-type strain, the hly-transcript (encoding LLO) was increased. Hence, our results could suggest a role for the RNA-helicases during translation. In this work, we show that DExD-box RNA-helicases are involved in bacterial virulence gene-expression and infection of eukaryotic cells. PMID:25590644

  14. Systematic use of universal 16S rRNA gene polymerase chain reaction (PCR) and sequencing for processing pleural effusions improves conventional culture techniques.

    PubMed

    Insa, Rosario; Marín, Mercedes; Martín, Adoración; Martín-Rabadán, Pablo; Alcalá, Luís; Cercenado, Emilia; Calatayud, Laura; Liñares, Josefina; Bouza, Emilio

    2012-03-01

    Conventional culture of pleural fluid samples frequently provides false-negative results. Universal polymerase chain reaction (PCR) of the 16S ribosomal ribonucleic acid (rRNA) gene (16S PCR) has proven useful in the diagnosis of various bacterial infections. We conducted a prospective study to assess the value of 16S PCR in the etiologic diagnosis of pleural effusion. All pleural fluid samples received for culture were also studied using 16S PCR. Positive samples were sequenced for identification. Clinical records and conventional culture results were analyzed to classify pleural fluid samples as infected or not infected. We studied 723 samples. We excluded 188 samples because they were obtained from a long-term chest tube, there was a diagnosis of mycobacterial infection, or there were insufficient data to classify the episode. Finally, 535 pleural fluid samples were analyzed. According to our criteria, 82 (15.3%) were infected and 453 (84.7%) were not infected. In the infected samples, 16S PCR was positive in 67 samples (81.7%) while conventional culture was positive in 45 (54.9%). There were 4 false positives with 16S PCR (0.9%) and 12 with culture (2.6%). The values for the etiologic diagnosis of bacterial pleural effusion of conventional culture compared with 16S PCR were as follows: sensitivity, 54.9%/81.7%; specificity, 97.4%/99.1%; positive predictive value, 76.3%/94.4%; negative predictive value, 92.6%/96.8%; and accuracy, 90.8%/96.5%.When compared with conventional culture, 16S PCR plus sequencing substantially improves the etiologic diagnosis of infectious pleural effusion. In our opinion, this technique should be added to the routine diagnostic armamentarium of clinical microbiology laboratories.

  15. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  16. Chemical footprinting reveals conformational changes of 18S and 28S rRNAs at different steps of translation termination on the human ribosome.

    PubMed

    Bulygin, Konstantin N; Bartuli, Yulia S; Malygin, Alexey A; Graifer, Dmitri M; Frolova, Ludmila Yu; Karpova, Galina G

    2016-02-01

    Translation termination in eukaryotes is mediated by release factors: eRF1, which is responsible for stop codon recognition and peptidyl-tRNA hydrolysis, and GTPase eRF3, which stimulates peptide release. Here, we have utilized ribose-specific probes to investigate accessibility of rRNA backbone in complexes formed by association of mRNA- and tRNA-bound human ribosomes with eRF1•eRF3•GMPPNP, eRF1•eRF3•GTP, or eRF1 alone as compared with complexes where the A site is vacant or occupied by tRNA. Our data show which rRNA ribose moieties are protected from attack by the probes in the complexes with release factors and reveal the rRNA regions increasing their accessibility to the probes after the factors bind. These regions in 28S rRNA are helices 43 and 44 in the GTPase associated center, the apical loop of helix 71, and helices 89, 92, and 94 as well as 18S rRNA helices 18 and 34. Additionally, the obtained data suggest that eRF3 neither interacts with the rRNA ribose-phosphate backbone nor dissociates from the complex after GTP hydrolysis. Taken together, our findings provide new information on architecture of the eRF1 binding site on mammalian ribosome at various translation termination steps and on conformational rearrangements induced by binding of the release factors.

  17. Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing.

    PubMed

    Falaleeva, Marina; Pages, Amadis; Matuszek, Zaneta; Hidmi, Sana; Agranat-Tamir, Lily; Korotkov, Konstantin; Nevo, Yuval; Eyras, Eduardo; Sperling, Ruth; Stamm, Stefan

    2016-03-22

    C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, and their best-understood function is to target the methyltransferase fibrillarin to rRNA (for example, SNORD27 performs 2'-O-methylation of A27 in 18S rRNA). Unexpectedly, we found a subset of SNORDs, including SNORD27, in soluble nuclear extract made under native conditions, where fibrillarin was not detected, indicating that a fraction of the SNORD27 RNA likely forms a protein complex different from canonical snoRNAs found in the insoluble nuclear fraction. As part of this previously unidentified complex,SNORD27 regulates the alternative splicing of the transcription factor E2F7p re-mRNA through direct RNA-RNA interaction without methylating the RNA, likely by competing with U1 small nuclear ribonucleoprotein (snRNP). Furthermore, knockdown of SNORD27 activates previously "silent" exons in several other genes through base complementarity across the entire SNORD27 sequence, not just the antisense boxes. Thus, some SNORDs likely function in both rRNA and pre-mRNA processing, which increases the repertoire of splicing regulators and links both processes. PMID:26957605

  18. Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing

    PubMed Central

    Falaleeva, Marina; Pages, Amadis; Matuszek, Zaneta; Hidmi, Sana; Agranat-Tamir, Lily; Korotkov, Konstantin; Nevo, Yuval; Sperling, Ruth; Stamm, Stefan

    2016-01-01

    C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, and their best-understood function is to target the methyltransferase fibrillarin to rRNA (for example, SNORD27 performs 2′-O-methylation of A27 in 18S rRNA). Unexpectedly, we found a subset of SNORDs, including SNORD27, in soluble nuclear extract made under native conditions, where fibrillarin was not detected, indicating that a fraction of the SNORD27 RNA likely forms a protein complex different from canonical snoRNAs found in the insoluble nuclear fraction. As part of this previously unidentified complex, SNORD27 regulates the alternative splicing of the transcription factor E2F7 pre-mRNA through direct RNA–RNA interaction without methylating the RNA, likely by competing with U1 small nuclear ribonucleoprotein (snRNP). Furthermore, knockdown of SNORD27 activates previously “silent” exons in several other genes through base complementarity across the entire SNORD27 sequence, not just the antisense boxes. Thus, some SNORDs likely function in both rRNA and pre-mRNA processing, which increases the repertoire of splicing regulators and links both processes. PMID:26957605

  19. Primary and secondary structure of the 18S ribosomal RNA of the bird spider Eurypelma californica and evolutionary relationships among eukaryotic phyla.

    PubMed

    Hendriks, L; Van Broeckhoven, C; Vandenberghe, A; Van de Peer, Y; De Wachter, R

    1988-10-15

    The primary structure of the 18S rRNA of the bird spider Eurypelma californica has been determined in the framework of a study of metazoan phylogeny on the basis of ribosomal RNA structure. A secondary-structure model was derived by comparison of the sequence with that of 43 other eukaryotic small-ribosomal-subunit RNA sequences presently available. This comparison allows a rather detailed secondary-structure pattern to be postulated for a eukaryote-specific area of highly variable sequence and length for which no consensus model has hitherto been attained. A dendrogram, reflecting evolutionary relationships among the 40 eukaryotic species of known 18S rRNA structure, was constructed by a matrix method selecting the best-fitting tree on the basis of a least-squares criterion. The tree shows an early divergence of a microsporidium, an euglenoid, kinetoplastids and a slime mold. Among the remaining species, two main clusters are distinguishable, one comprising the Ciliata, the other comprising Metazoa, green plants, fungi and several protists. Among the Metazoa, the three phyla presently investigated, viz. Chordata, Arthropoda and Nemathelminthes, are distinguishable as three separate lines of descent.

  20. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  1. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA.

  2. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks.

    PubMed

    Buse, Helen Y; Lu, Jingrang; Struewing, Ian T; Ashbolt, Nicholas J

    2013-09-01

    The goal of this study was to characterize microbial eukaryotes over a 12-month period to provide insight into the occurrence of potential bacterial predators and hosts in premise plumbing. Nearly 6,300 partial 18S rRNA gene sequences from 24 hot (36.9-39.0 °C) and cold (6.8-29.1 °C) drinking water samples were analyzed and classified into major eukaryotic groups. Each major group, consisting of free-living amoebae (FLA)/protozoa, algae, copepods, dinoflagellates, fungi, nematodes, and unique uncultured eukaryotic sequences, showed limited diversity dominated by a few distinct populations, which may be characteristic of oligotrophic environments. Changes in the relative abundance of predators such as nematodes, copepods, and FLA appear to be related to temperature and seasonal changes in water quality. Sequences nearly identical to FLA such as Hartmannella vermiformis, Echinamoeba thermarmum, Pseudoparamoeba pagei, Protacanthamoeba bohemica, Platyamoeba sp., and Vannella sp. were obtained. In addition to FLA, various copepods, rotifers, and nematodes have been reported to internalize viral and bacterial pathogens within drinking water systems thus potentially serving as transport hosts; implications of which are discussed further. Increasing the knowledge of eukaryotic occurrence and their relationship with potential pathogens should aid in assessing microbial risk associated with various eukaryotic organisms in drinking water.

  3. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.

    PubMed

    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H

    2000-10-01

    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  4. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  5. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  6. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    PubMed

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  7. Phylogenetic affiliations of mesopelagic acantharia and acantharian-like environmental 18S rRNA genes off the southern California coast.

    PubMed

    Gilg, Ilana C; Amaral-Zettler, Linda A; Countway, Peter D; Moorthi, Stefanie; Schnetzer, Astrid; Caron, David A

    2010-04-01

    Incomplete knowledge of acantharian life cycles has hampered their study and limited our understanding of their role in the vertical flux of carbon and strontium. Molecular tools can help identify enigmatic life stages and offer insights into aspects of acantharian biology and evolution. We inferred the phylogenetic position of acantharian sequences from shallow water, as well as acantharian-like clone sequences from 500 and 880 m in the San Pedro Channel, California. The analyses included validated acantharian and polycystine sequences from public databases with environmental clone sequences related to acantharia and used Bayesian inference methods. Our analysis demonstrated strong support for two branches of unidentified organisms that are closely related to, but possibly distinct from the Acantharea. We also found evidence of acantharian sequences from mesopelagic environments branching within the chaunacanthid clade, although the morphology of these organisms is presently unknown. HRP-conjugated probes were developed to target Acantharea and phylotypes from Unidentified Clade 1 using Catalyzed Reporter Deposition Fluorescence In Situ Hybridization (CARD-FISH) on samples collected at 500 m. Our CARD-FISH experiments targeting phylotypes from an unidentified clade offer preliminary glimpses into the morphology of these protists, while a morphology for the aphotic acantharian lineages remains unknown at this time.

  8. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  9. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  10. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  11. Molecular typing of sand fly species (Diptera, Psychodidae, Phlebotominae) from areas endemic for Leishmaniasis in Ecuador by PCR-RFLP of 18S ribosomal RNA gene.

    PubMed

    Terayama, Yoshimi; Kato, Hirotomo; Gomez, Eduardo A; Uezato, Hiroshi; Calvopiña, Manuel; Iwata, Hiroyuki; Hashiguchi, Yoshihisa

    2008-09-01

    Surveillance of the distribution of sand fly species is important for prediction of the risk and expansion of Leishmania infection in endemic and surrounding areas. In the present study, a simple and reliable method of typing New World Lutzomyia species circulating in endemic areas in Ecuador was established by using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique. PCR-RFLP of 18S ribosomal RNA (rRNA) genes with the restriction enzyme AfaI and subsequently HinfI successfully identified seven sand fly species in nine endemic areas in Ecuador. Although intraspecific genetic-diversity affecting the RFLP-patterns was detected in a species, the patterns were species specific. The method promises to be a powerful tool for the classification of New World Lutzomyia species.

  12. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    PubMed

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc.

  13. Apoptosis induced by methylazoxymethanol in developing rat cerebellum: organization of the cell nucleus and its relationship to DNA and rRNA degradation.

    PubMed

    Lafarga, M; Lerga, A; Andres, M A; Polanco, J I; Calle, E; Berciano, M T

    1997-07-01

    We present a cytological and biochemical study of the cell death of granule cell precursors in developing rat cerebellum following treatment with the cytotoxic agent methylazoxymethanol (MAM) during the first postnatal week. The density of apoptotic figures per square millimeter progressively increases after 6, 12, 24 and 44 h of treatment, whereas cells immunoreactive for proliferating cell nuclear antigen tend to disappear in the external granular layer (EGL). DNA migration on gel electrophoresis reveals a typical ladder pattern of internucleosomal cleavage following MAM treatment, whereas gel electrophoresis of rRNA shows a conspicuous degradation of both 28S and 18S rRNAs. Ultrastructural analysis has revealed the alterations of structures containing chromatin and ribonucleoprotein (RNP) in dying cells of the EGL. The typical granular beaded configuration of the condensed chromatin changes to a denser, more homogeneous texture suggesting nucleosomal disruption. The reorganization of RNP nuclear domains is reflected by the appearance of dispersed nucleoplasmic RNP particles and the formation of a coiled-body-like structure. However, typical nuclear domains involved in the splicing of RNAs, namely interchromatin granule clusters and typical "coiled bodies", are not found in apoptotic cells. Intranuclear bundles of filaments have also been detected. In the cytoplasm, the presence of dispersed single ribosomes is an initial sign of apoptosis. The massive dispersion and disruption of ribosomes detected after 24 h and 44 h of MAM treatment is reflected by the degradation of both 28S and 18s rRNAs. These results show that MAM treatment provides a useful experimental model for the study of apoptosis in the developing central nervous system. The organization of the cell nucleus in cells undergoing apoptosis clearly reflects a disruption of the nuclear compartments involved in transcription and the processing and transport of RNA and is related to the patterns of DNA and

  14. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  15. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  16. Molecular Organization of the 25S–18S rDNA IGS of Fagus sylvatica and Quercus suber: A Comparative Analysis

    PubMed Central

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5′-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5′-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5′-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  17. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    PubMed

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family.

  18. Aligned 18S for Zoraptera (Insecta): phylogenetic position and molecular evolution.

    PubMed

    Yoshizawa, Kazunori; Johnson, Kevin P

    2005-11-01

    The order Zoraptera (angel insects) is one of the least known insect groups, containing only 32 extant species. The phylogenetic position of Zoraptera is poorly understood, but it is generally thought to be closely related to either Paraneoptera (hemipteroid orders: booklice, lice, thrips, and bugs), Dictyoptera (blattoid orders: cockroaches, termites, and mantis), or Embioptera (web spinners). We inferred the phylogenetic position of Zoraptera by analyzing nuclear 18S rDNA sequences, which we aligned according to a secondary structure model. Maximum likelihood and Bayesian analyses both supported a close relationship between Zoraptera and Dictyoptera with relatively high posterior probability. The 18S sequences of Zoraptera exhibited several unusual properties: (1) a dramatically increased substitution rate, which resulted in very long branches; (2) long insertions at helix E23; and (3) modifications of secondary structures at helices 12 and 18.

  19. “Invisible” silver and gold in supergene digenite (Cu1.8S)

    NASA Astrophysics Data System (ADS)

    Reich, Martin; Chryssoulis, Stephen L.; Deditius, Artur; Palacios, Carlos; Zúñiga, Alejandro; Weldt, Magdalena; Alvear, Macarena

    2010-11-01

    Despite its potential economic and environmental importance, the study of trace metals in supergene (secondary) Cu-sulfides has been seriously overlooked in the past decades. In this study, the concentration and mineralogical form of "invisible" precious metals (Ag, Au) and metalloids (As, Sb, Se, Te) in supergene digenite (Cu 1.8S) from various Cu deposits in the Atacama Desert of northern Chile, the world's premier Cu province, were determined in detail using a combination of microanalytical techniques. Secondary ion mass spectrometry (SIMS) and electron microprobe analyzer (EMPA) measurements reveal that, apart from hosting up to ˜11,000 ppm Ag, supergene digenite can incorporate up to part-per-million contents of Au (˜6 ppm) and associated metalloids such as As (˜300 ppm), Sb (˜60 ppm), Se (˜96 ppm) and Te (˜18 ppm). SIMS analyses of trace metals show that Ag and Au concentrations strongly correlate with As in supergene digenite, defining wedge-shaped zones in Ag-As and Au-As log-log spaces. SIMS depth profiling and high-resolution transmission electron microscopy (HRTEM) observations reveal that samples with anomalously high Ag/As (>˜30) and Au/As (>˜0.03) ratios plot above the wedge zones and contain nanoparticles of metallic Ag and Au, while samples with lower ratios contain Ag and Au that is structurally bound to the Cu-sulfide matrix. The Ag-Au-As relations reported in this study strongly suggest that the incorporation of precious metals in Cu-sulfides formed under supergene, low-temperature conditions respond to the incorporation of a minor component, in this case As. Therefore, As might play a significant role by increasing the solubility of Ag and Au in supergene digenite and controlling the formation and occurrence of Ag and Au nanoparticles. Considering the fact that processes of supergene enrichment in Cu deposits can be active from tens of millions of years (e.g. Atacama Desert), we conclude that supergene digenite may play a previously

  20. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  1. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  2. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  3. 18S ribosomal DNA sequences provide insight into the phylogeny of patellogastropod limpets (Mollusca: Gastropoda).

    PubMed

    Yoon, Sook Hee; Kim, Won

    2007-02-28

    To investigate the phylogeny of Patellogastropoda, the complete 18S rDNA sequences of nine patellogastropod limpets Cymbula canescens (Gmelin, 1791), Helcion dunkeri (Krauss, 1848), Patella rustica Linnaeus, 1758, Cellana toreuma (Reeve, 1855), Cellana nigrolineata (Reeve, 1854), Nacella magellanica Gmelin, 1791, Nipponacmea concinna (Lischke, 1870), Niveotectura pallida (Gould, 1859), and Lottia dorsuosa Gould, 1859 were determined. These sequences were then analyzed along with the published 18S rDNA sequences of 35 gastropods, one bivalve, and one chiton species. Phylogenetic trees were constructed by maximum parsimony, maximum likelihood, and Bayesian inference. The results of our 18S rDNA sequence analysis strongly support the monophyly of Patellogastropoda and the existence of three subgroups. Of these, two subgroups, the Patelloidea and Acmaeoidea, are closely related, with branching patterns that can be summarized as [(Cymbula + Helcion) + Patella] and [(Nipponacmea + Lottia) + Niveotectura]. The remaining subgroup, Nacelloidea, emerges as basal and paraphyletic, while its genus Cellana is monophyletic. Our analysis also indicates that the Patellogastropoda have a sister relationship with the order Cocculiniformia within the Gastropoda. PMID:17464213

  4. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.

    PubMed

    Andersen, R A; Brett, R W; Potter, D; Sexton, J P

    1998-02-01

    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  5. Microbial community dynamics in manure composts based on 16S and 18S rDNA T-RFLP profiles.

    PubMed

    Tiquia, S M

    2005-10-01

    Compost processing is assumed to be related to the microbial communities present. However, methods that will evaluate these relationships are not well understood. In this study, terminal restriction fragment length polymorphism (T-RFLP) analysis was used to evaluate the diversity of PCR-amplified bacterial 16S and fungal 18S rDNA communities from manure composts at different stages of composting (initial [day 0], thermophilic [day 24], and mature [day 104]). Results showed that the bacterial and fungal community profiles changed over the composting process, with bacterial communities showing a higher diversity compared with the fungal communities. During the thermophilic stage (day 24), the diversity of the bacterial communities increased, while the fungal communities decreased. As the compost reached maturity (day 104), a reverse pattern was observed between the diversity of bacterial and fungal communities. That is, the 18S rDNA T-RFLP-based diversity indices increased, while the 16S rDNA T-RFLP-based diversity decreased. Differences in temperature profiles at different stages of composting impacted the chemical properties and the diversity of the microbial communities. The day 104 compost (mature) had lower water, organic matter and C contents and higher C and OM loss compared with the day 0 (initial) and day 24 (thermophilic) composts, which affected the diversity of the microbial communities. The results presented here demonstrated that distinctive community patterns from manure composts could be rapidly generated using T-RFLP analysis. The succession of peaks in combination of increasing and decreasing peak heights at different stage of composting indicates the high potential of T-RFLP technique to monitor the dynamics of microbial communities, and their variation qualitatively and quantitatively.

  6. Transcription and processing of ribosomal RNAs from maize mitochondria

    SciTech Connect

    Maloney, A.P.

    1986-01-01

    In order to gain insight into the expression of genes in higher plant mitochondria, the transcription of the three ribosomal-RNA genes of the maize mitochondria was investigated. The 5' and 3' ends of the 5S and 18S rRNAs, whose genes are 113 bp apart on the mitochondrial DNA, were defined using S/sub 1/ analysis. S/sub 1/ analysis and extensive hybridizational experiments demonstrated that the 18S and 5 S share several large transcripts. Nearly all of these rare cotranscripts include flanking sequence from both ends of the 18S + 5S complex. A model is proposed for the processing of the large transcripts into the mature rRNAs. Transcription of 26S rRNA was shown to occur from the strand opposite the transcribed strand of the 18S and 5S genes. Northern and S/sub 1/ nuclease analysis demonstrated the existence of 2 precursors of 26S rRNA. All the mature and precursor RNAs identified by S/sub 1/ analysis begin primarily with A residues, and exhibit 5' terminal heterogeneity of several nucleotides; all but one possess the sequence AAUC in their first few 5' nucleotides. Mitochondrial RNA, treated either with (alpha-/sup 32/P)GTP and guanylyl transferase to construct a radioactive methylated-GTP cap at the 5' ends of unprocessed RNAs, or with polynucleotide kinase and (gamma-/sup 32/P)ATP to label the 5' ends of processed RNAs, was hybridized to different fragments of mitochondrial genes. These experiments showed that the mature and precursor rRNAs detected in S/sub 1/ analysis are processed, not primary transcripts, suggesting that the 5' end similarity of all these RNAs is functionally significant in recognition of processing sites in vivo.

  7. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    PubMed

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  8. Plastid 16S rRNA Gene Diversity among Eukaryotic Picophytoplankton Sorted by Flow Cytometry from the South Pacific Ocean

    PubMed Central

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J.; Vaulot, Daniel

    2011-01-01

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image. PMID:21552558

  9. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    PubMed

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values.

  10. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  11. SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing

    PubMed Central

    Chen, Sifan; Blank, Maximilian Felix; Iyer, Aishwarya; Huang, Bingding; Wang, Lin; Grummt, Ingrid; Voit, Renate

    2016-01-01

    SIRT7 is an NAD+-dependent protein deacetylase with important roles in ribosome biogenesis and cell proliferation. Previous studies have established that SIRT7 is associated with RNA polymerase I, interacts with pre-ribosomal RNA (rRNA) and promotes rRNA synthesis. Here we show that SIRT7 is also associated with small nucleolar RNP (snoRNPs) that are involved in pre-rRNA processing and rRNA maturation. Knockdown of SIRT7 impairs U3 snoRNA dependent early cleavage steps that are necessary for generation of 18S rRNA. Mechanistically, SIRT7 deacetylates U3-55k, a core component of the U3 snoRNP complex, and reversible acetylation of U3-55k modulates the association of U3-55k with U3 snoRNA. Deacetylation by SIRT7 enhances U3-55k binding to U3 snoRNA, which is a prerequisite for pre-rRNA processing. Under stress conditions, SIRT7 is released from nucleoli, leading to hyperacetylation of U3-55k and attenuation of pre-rRNA processing. The results reveal a multifaceted role of SIRT7 in ribosome biogenesis, regulating both transcription and processing of rRNA. PMID:26867678

  12. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia.

    PubMed

    Shalchian-Tabrizi, Kamran; Kauserud, Håvard; Massana, Ramon; Klaveness, Dag; Jakobsen, Kjetill S

    2007-04-01

    Telonemia has recently been described as a new eukaryotic phylum with uncertain evolutionary origin. So far, only two Telonemia species, Telonema subtilis and Telonema antarcticum, have been described, but there are substantial variations in size and morphology among Telonema isolates and field observations, indicating a hidden diversity of Telonemia-like species and populations. In this study, we investigated the diversity and the global distribution of this group by analyzing 18S rDNA sequences from marine environmental clone libraries published in GenBank as well as several unpublished sequences from the Indian Ocean. Phylogenetic analyses of the identified sequences suggest that the Telonemia phylum includes several undescribed 18S rDNA phylotypes, probably corresponding to a number of different species and/or populations. The Telonemia phylotypes form two main groups, here referred to as Telonemia Groups 1 and 2. Some of the closely related sequences originate from separate oceans, indicating worldwide distributions of various Telonemia phylotypes, while other phylotypes seem to have limited geographical distribution. Further investigations of the evolutionary relationships within Telonemia should be conducted on isolated cultures of Telonema-like strains using multi-locus sequencing and morphological data. PMID:17196879

  13. METAXA2: improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data.

    PubMed

    Bengtsson-Palme, Johan; Hartmann, Martin; Eriksson, Karl Martin; Pal, Chandan; Thorell, Kaisa; Larsson, Dan Göran Joakim; Nilsson, Rolf Henrik

    2015-11-01

    The ribosomal rRNA genes are widely used as genetic markers for taxonomic identification of microbes. Particularly the small subunit (SSU; 16S/18S) rRNA gene is frequently used for species- or genus-level identification, but also the large subunit (LSU; 23S/28S) rRNA gene is employed in taxonomic assignment. The METAXA software tool is a popular utility for extracting partial rRNA sequences from large sequencing data sets and assigning them to an archaeal, bacterial, nuclear eukaryote, mitochondrial or chloroplast origin. This study describes a comprehensive update to METAXA - METAXA2 - that extends the capabilities of the tool, introducing support for the LSU rRNA gene, a greatly improved classifier allowing classification down to genus or species level, as well as enhanced support for short-read (100 bp) and paired-end sequences, among other changes. The performance of METAXA2 was compared to other commonly used taxonomic classifiers, showing that METAXA2 often outperforms previous methods in terms of making correct predictions while maintaining a low misclassification rate. METAXA2 is freely available from http://microbiology.se/software/metaxa2/. PMID:25732605

  14. Proteins associated with rRNA in the Escherichia coli ribosome.

    PubMed

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  15. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  16. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  17. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups. PMID:8896370

  18. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  19. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919).

  20. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups.

  1. Chromosome Mapping of 18S Ribosomal RNA Genes in Eleven Hypostomus Species (Siluriformes, Loricariidae): Diversity Analysis of the Sites.

    PubMed

    Rubert, Marceléia; da Rosa, Renata; Zawadzki, Claudio H; Mariotto, Sandra; Moreira-Filho, Orlando; Giuliano-Caetano, Lucia

    2016-08-01

    We investigated the chromosomal distribution of 18S ribosomal DNA (rDNA) in different populations of 11 species of Hypostomus collected in important Brazilian basins, namely South Atlantic, Upper Paraná, and Paraguay applying the fluorescence in situ hybridization (FISH). Hypostomus cochliodon, Hypostomus commersoni, Hypostomus hermanni, Hypostomus regani, Hypostomus albopunctatus, Hypostomus paulinus, Hypostomus aff. paulinus, Hypostomus iheringii, and Hypostomus mutucae presented multiple 18S rDNA sites while Hypostomus strigaticeps and Hypostomus nigromaculatus exhibited a single pair of chromosomes with 18S rDNA sites. The studied species presented variations in the number and position of these sites. The results accomplished were similar to those obtained by the analysis of AgNORs, revealing the same interspecific variability. Each species exhibited distinctive patterns of AgNOR and 18S rDNA distribution, which can be considered cytogenetic markers in each species of the genus and help improve the discussions on the phylogeny of the group.

  2. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  3. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  4. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  5. Use of rRNA gene restriction patterns to evaluate lactic acid bacterium contamination of vacuum-packaged sliced cooked whole-meat product in a meat processing plant.

    PubMed Central

    Björkroth, K J; Korkeala, H J

    1997-01-01

    Molecular typing was applied to an in-plant lactic acid bacterium (LAB) contamination analysis of a vacuum-packaged sliced cooked whole-meat product. A total of 982 LAB isolates from the raw mass, product, and the environment at different production stages were screened by restriction endonuclease (EcoRI and HindIII) analysis. rRNA gene restriction patterns were further determined for different strains obtained from each source. These patterns were used for recognizing the spoilage-causing LAB strains from the product on the sell-by day and tracing the sources and sites of spoilage LAB contamination during the manufacture. LAB typing resulted in 71 different ribotypes, of which 27 were associated with contamination routes. Raw material was distinguished as the source of the major spoilage strains. Contamination of the product surfaces after cooking was shown to be airborne. The removal of the product from the cooking forms was localized as a major site of airborne LAB contamination. Food handlers and some surfaces in contact with the product during the manufacture were also contaminated with the spoilage strains. Some LAB strains were also able to resist cooking in the core of the product bar. These strains may have an effect on the product shelf life by contaminating the slicing machine. The air in the slicing department and adjacent cold room contained very few LAB. Surface-mediated contamination was detected during the slicing and packaging stages. Food handlers also carried strains later found in the packaged product. Molecular typing provided useful information revealing the LAB contamination sources and sites of this product. The production line will be reorganized in accordance with these results to reduce spoilage LAB contamination. PMID:9023922

  6. Use of rRNA gene restriction patterns to evaluate lactic acid bacterium contamination of vacuum-packaged sliced cooked whole-meat product in a meat processing plant.

    PubMed

    Björkroth, K J; Korkeala, H J

    1997-02-01

    Molecular typing was applied to an in-plant lactic acid bacterium (LAB) contamination analysis of a vacuum-packaged sliced cooked whole-meat product. A total of 982 LAB isolates from the raw mass, product, and the environment at different production stages were screened by restriction endonuclease (EcoRI and HindIII) analysis. rRNA gene restriction patterns were further determined for different strains obtained from each source. These patterns were used for recognizing the spoilage-causing LAB strains from the product on the sell-by day and tracing the sources and sites of spoilage LAB contamination during the manufacture. LAB typing resulted in 71 different ribotypes, of which 27 were associated with contamination routes. Raw material was distinguished as the source of the major spoilage strains. Contamination of the product surfaces after cooking was shown to be airborne. The removal of the product from the cooking forms was localized as a major site of airborne LAB contamination. Food handlers and some surfaces in contact with the product during the manufacture were also contaminated with the spoilage strains. Some LAB strains were also able to resist cooking in the core of the product bar. These strains may have an effect on the product shelf life by contaminating the slicing machine. The air in the slicing department and adjacent cold room contained very few LAB. Surface-mediated contamination was detected during the slicing and packaging stages. Food handlers also carried strains later found in the packaged product. Molecular typing provided useful information revealing the LAB contamination sources and sites of this product. The production line will be reorganized in accordance with these results to reduce spoilage LAB contamination.

  7. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity.

    PubMed

    Moon-van der Staay, S Y; De Wachter, R; Vaulot, D

    2001-02-01

    Picoplankton--cells with a diameter of less than 3 microm--are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75 m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  8. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity

    NASA Astrophysics Data System (ADS)

    Moon-van der Staay, Seung Yeo; De WachterRDanielVaulot, RupertDe WachterR.Daniel

    2001-02-01

    Picoplankton-cells with a diameter of less than 3µm-are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  9. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  10. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  11. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.

    PubMed

    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J

    2000-09-01

    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  12. Radiolaria Divided into Polycystina and Spasmaria in Combined 18S and 28S rDNA Phylogeny

    PubMed Central

    Dolven, Jane K.; Ose, Randi F.; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R.; Shalchian-Tabrizi, Kamran

    2011-01-01

    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis. PMID:21853146

  13. Radiolaria divided into Polycystina and Spasmaria in combined 18S and 28S rDNA phylogeny.

    PubMed

    Krabberød, Anders K; Bråte, Jon; Dolven, Jane K; Ose, Randi F; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R; Shalchian-Tabrizi, Kamran

    2011-01-01

    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis.

  14. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

    PubMed

    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi

    1999-10-01

    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  15. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  16. Comparative physical mapping of the 18S-5.8S-26S rDNA in three sorghum species.

    PubMed

    Sang, Y; Liang, G H

    2000-10-01

    The physical locations of the 18S-5.8S-26S rDNA sequences were examined in three sorghum species by fluorescence in situ hybridization (FISH) using biotin-labeled heterologous 18S-5.8S-26S rDNA probe (pTa71). Each 18S-5.8S-26S rDNA locus occurred at two sites on the chromosomes in Sorghum bicolor (2n = 20) and S. versicolor (2n = 10), but at four sites on the chromosomes of S. halepense (2n = 40) and the tetraploid S. versicolor (2n = 20). Positions of the rDNA loci varied from the interstitial to terminal position among the four accessions of the three sorghum species. The rDNA data are useful for investigation of chromosome evolution and phylogeny. This study excluded S. versicolor as the possible progenitor of S. bicolor.

  17. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  18. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  19. Morphology, morphogenesis and small subunit rRNA gene sequence of a soil hypotrichous ciliate, Perisincirra paucicirrata (Ciliophora, Kahliellidae), from the shoreline of the Yellow River, North China.

    PubMed

    Li, Fengchao; Xing, Yi; Li, Jiamei; Al-Rasheid, Khaled A S; He, Songke; Shao, Chen

    2013-01-01

    The morphology, morphogenesis, and 18S rRNA gene sequence of a soil hypotrichous ciliate Perisincirra paucicirrata, isolated from north China, were investigated. Perisincirra paucicirrata differs from its congeners in: (1) having a body length to width ratio in vivo of 4:1, (2) its adoral zone occupying between 15% and 25% of the total body length, and (3) the presence of two parabuccal cirri, three left (with 10-16 cirri each) and two right marginal rows (with 14-24 cirri each), and three dorsal kineties. Our study offers a first attempt to begin to map the morphogenetic processes of the genus, which are mainly characterised by the following: the formation of four frontal ventral transverse anlagens for each daughter cell, with the proter's anlage I originating from the reorganised anterior part of the parental paroral; the paroral and endoral anlage developed from the reorganised old endoral and do not contribute the first frontal cirrus; the frontoventral transverse anlage I contributing the left frontal cirrus; anlage II generating the middle frontal and the buccal cirri; anlage III developing the right frontal cirrus and the anterior parabuccal cirrus; and anlage IV contributing the posterior parabuccal cirrus. As an additional contribution, we judge that the inner one or the two right rows of P. kahli and P. longicirrata are marginal rows. Phylogenetic analysis based on SSU rDNA sequences suggests that Perisincirra is related to sporadotrichids, but provides no credible evidence for its taxonomic position.

  20. Large-subunit rRNA sequence of the chytridiomycete Blastocladiella emersonii, and implications for the evolution of zoosporic fungi.

    PubMed

    Van der Auwera, G; De Wachter, R

    1996-11-01

    The 5.8S and 28S ribosomal RNA sequences of the chytridiomycete Blastocladiella emersonii were determined. These data were combined with 18S rRNA sequences in order to carry out a phylogenetic analysis based on distance matrix, parsimony, and maximum likelihood methods. The new data confirmed that chytridiomycetes are true fungi and not protists, as was already suggested on the basis of biochemical, ultrastructural, and 18S rRNA data. Within the fungal clade, B. emersonii formed the first line of divergence. The position of the fungi within the eukaryotic "crown" taxa was also reassessed, and the alveolate-stramenopile cluster appeared as their sister group. The stramenopiles also comprise a number of zoosporic fungi, which resemble chytridiomycetes in so many respects, e.g., production of motile spores, thallus morphology, and absorptive nutrition, that they have been classified together with them in the past. This suggests that the possible common ancestor of the fungi, stramenopiles, and alveolates may have been a zoosporic fungus, which would mean that zoosporic fungi are paraphyletic instead of polyphyletic as previously suggested.

  1. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  2. Molecular characterization of nuclear small subunit (18S)-rDNA pseudogenes in a symbiotic dinoflagellate (Symbiodinium, Dinophyta).

    PubMed

    Santos, Scott R; Kinzie, Robert A; Sakai, Kazuhiko; Coffroth, Mary Alice

    2003-01-01

    For the dinoflagellates, an important group of single-cell protists, some nuclear rDNA phylogenetic studies have reported the discovery of rDNA pseudogenes. However, it is unknown if these aberrant molecules are confined to free-living taxa or occur in other members of the group. We have cultured a strain of symbiotic dinoflagellate, belonging to the genus Symbiodinium, which produces three distinct amplicons following PCR for nuclear small subunit (18S) rDNA genes. These amplicons contribute to a unique restriction fragment length polymorphism pattern diagnostic for this particular strain. Sequence analyses revealed that the largest amplicon was the expected region of 18S-rDNA, while the two smaller amplicons are Symbiodinium nuclear 18S-rDNA genes that contain single long tracts of nucleotide deletions. Reverse transcription (RT)-PCR experiments did not detect RNA transcripts of these latter genes, suggesting that these molecules represent the first report of nuclear 18S-rDNA pseudogenes from the genome of Symbiodinium. As in the free-living dinoflagellates, nuclear rDNA pseudogenes are effective indicators of unique Symbiodinium strains. Furthermore, the evolutionary pattern of dinoflagellate nuclear rDNA pseudogenes appears to be unique among organisms studied to date, and future studies of these unusual molecules will provide insight on the cellular biology and genomic evolution of these protists.

  3. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCEAE) TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...

  4. PHYLOGENETIC RELATIONSHIP OF ALEXANDRIUM MONILATUM (DINOPHYCAE)TO OTHER ALEXANDRIUM SPECIES BASED ON 18S RIBOSOMAL RNA GENE SEQUENCES

    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...

  5. Origin and evolution of paralogous rRNA gene clusters within the flatworm family Dugesiidae (Platyhelminthes, Tricladida).

    PubMed

    Carranza, S; Baguñà, J; Riutort, M

    1999-08-01

    Analysis of the 18S rDNA sequences of five species of the family Dugesiidae (phylum Platyhelminthes, suborder Tricladida, infraorder Paludicola) and eight species belonging to families Dendrocoelidae and Planaridae and to the infraorder Maricola showed that members of the family Dugesiidae have two types of 18S rDNA genes, while the rest of the species have only one. The duplication event also affected the ITS-1, 5.8S, ITS-2 region and probably the 28S gene. The mean divergence value between the type I and the type II sequences is 9% and type II 18S rDNA genes are evolving 2.3 times more rapidly than type I. The evolutionary rates of type I and type II genes were calibrated from biogeographical data, and an approximate date for the duplication event of 80-120 million years ago was calculated. The type II gene was shown, by RT-PCR, to be transcribed in adult individuals of Schmidtea polychroa, though at very low levels. This result, together with the fact that most of the functionally important positions for small-subunit rRNA in prokaryotes have been conserved, indicates that the type II gene is probably functional.

  6. Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: possible consequences for population fingerprinting of complex microbial communities.

    PubMed

    Huys, Geert; Vanhoutte, Tom; Joossens, Marie; Mahious, Amal S; De Brandt, Evie; Vermeire, Severine; Swings, Jean

    2008-06-01

    The main aim of this study was to evaluate the specificity of three commonly used 16S rRNA gene-based polymerase chain reaction (PCR) primer sets for bacterial community analysis of samples contaminated with eukaryotic DNA. The specificity of primer sets targeting the V3, V3-V5, and V6-V8 hypervariable regions of the 16S rRNA gene was investigated in silico and by community fingerprinting of human and fish intestinal samples. Both in silico and PCR-based analysis revealed cross-reactivity of the V3 and V3-V5 primers with the 18S rRNA gene of human and sturgeon. The consequences of this primer anomaly were illustrated by denaturing gradient gel electrophoresis (DGGE) profiling of microbial communities in human feces and mixed gut of Siberian sturgeon. DGGE profiling indicated that the cross-reactivity of 16S rRNA gene primers with nontarget eukaryotic DNA might lead to an overestimation of bacterial biodiversity. This study has confirmed previous sporadic indications in literature indicating that several commonly applied 16S rRNA gene primer sets lack specificity toward bacteria in the presence of eukaryotic DNA. The phenomenon of cross-reactivity is a potential source of systematic error in all biodiversity studies where no subsequent analysis of individual community amplicons by cloning and sequencing is performed.

  7. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  8. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  9. Phylogenetic affiliation of SSU rRNA genes generated by massively parallel sequencing: new insights into the freshwater protist diversity.

    PubMed

    Taib, Najwa; Mangot, Jean-François; Domaizon, Isabelle; Bronner, Gisèle; Debroas, Didier

    2013-01-01

    Recent advances in next-generation sequencing (NGS) technologies spur progress in determining the microbial diversity in various ecosystems by highlighting, for example, the rare biosphere. Currently, high-throughput pyrotag sequencing of PCR-amplified SSU rRNA gene regions is mainly used to characterize bacterial and archaeal communities, and rarely to characterize protist communities. In addition, although taxonomic assessment through phylogeny is considered as the most robust approach, similarity and probabilistic approaches remain the most commonly used for taxonomic affiliation. In a first part of this work, a tree-based method was compared with different approaches of taxonomic affiliation (BLAST and RDP) of 18S rRNA gene sequences and was shown to be the most accurate for near full-length sequences and for 400 bp amplicons, with the exception of amplicons covering the V5-V6 region. Secondly, the applicability of this method was tested by running a full scale test using an original pyrosequencing dataset of 18S rRNA genes of small lacustrine protists (0.2-5 µm) from eight freshwater ecosystems. Our results revealed that i) fewer than 5% of the operational taxonomic units (OTUs) identified through clustering and phylogenetic affiliation had been previously detected in lakes, based on comparison to sequence in public databases; ii) the sequencing depth provided by the NGS coupled with a phylogenetic approach allowed to shed light on clades of freshwater protists rarely or never detected with classical molecular ecology approaches; and iii) phylogenetic methods are more robust in describing the structuring of under-studied or highly divergent populations. More precisely, new putative clades belonging to Mamiellophyceae, Foraminifera, Dictyochophyceae and Euglenida were detected. Beyond the study of protists, these results illustrate that the tree-based approach for NGS based diversity characterization allows an in-depth description of microbial communities

  10. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  11. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  12. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  13. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    PubMed

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species. PMID:26003987

  14. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    PubMed

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  15. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  16. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  17. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  18. Chromosomal localization and partial sequencing of the 18S and 28S ribosomal genes from Bradysia hygida (Diptera: Sciaridae).

    PubMed

    Gaspar, V P; Shimauti, E L T; Fernandez, M A

    2014-03-26

    In insects, ribosomal genes are usually detected in sex chromosomes, but have also or only been detected in autosomal chromosomes in some cases. Previous results from our research group indicated that in Bradysia hygida, nucleolus organizer regions were associated with heterochromatic regions of the autosomal C chromosome, using the silver impregnation technique. The present study confirmed this location of the ribosomal genes using fluorescence in situ hybridization analysis. This analysis also revealed the partial sequences of the 18S and 28S genes for this sciarid. The sequence alignment showed that the 18S gene has 98% identity to Corydalus armatus and 91% identity to Drosophila persimilis and Drosophila melanogaster. The partial sequence analysis of the 28S gene showed 95% identity with Bradysia amoena and 93% identity with Schwenckfeldina sp. These results confirmed the location of ribosomal genes of B. hygida in an autosomal chromosome, and the partial sequence analysis of the 18S and 28S genes demonstrated a high percentage of identity among several insect ribosomal genes.

  19. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  20. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  1. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  2. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  3. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  4. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    PubMed

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  5. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    PubMed

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  6. Genetic differentiation of strongyloides stercoralis from two different climate zones revealed by 18S ribosomal DNA sequence comparison.

    PubMed

    Pakdee, Wallop; Thaenkham, Urusa; Dekumyoy, Paron; Sa-Nguankiat, Surapol; Maipanich, Wanna; Pubampen, Somchit

    2012-11-01

    Over 70 countries in tropical and subtropical zones are endemic areas for Strongyloides stercoralis, with a higher prevalence of the parasite often occurring in tropical regions compared to subtropical ones. In order to explore genetic variations of S. stercoralis form different climate zones, 18S ribosomal DNA of parasite specimens obtained from Thailand were sequenced and compared with those from Japan. The maximum likelihood indicates that S. stercoralis populations from these two different climate zones have genetically diverged. The genetic relationship between S. stercoralis populations is not related to the host species, but rather to moisture and temperature. These factors may directly drive genetic differentiation among isolated populations of S. stercoralis.

  7. Evolutionary dynamics and preferential expression of homeologous 18S-5.8S-26S nuclear ribosomal genes in natural and artificial glycine allopolyploids.

    PubMed

    Joly, Simon; Rauscher, Jason T; Sherman-Broyles, Susan L; Brown, A H D; Doyle, Jeff J

    2004-07-01

    Polyploidy is an important evolutionary process in plants, but much remains to be learned about the evolution of gene expression in polyploids. Evolution and expression of the 18S-5.8S-26S ribosomal gene family was investigated at homeologous loci in the Glycine subgenus Glycine perennial soybean polyploid complex, which consists of several diploid genomes that have formed allopolyploids in various combinations, often recurrently. A semiquantitative PCR method targeting the internal transcribed spacer (ITS) of the 18S-5.8S-26S nuclear ribosomal DNA (nrDNA) was used to survey the ratio between homeologous repeats in polyploid genomes and to test for preferential expression of homeologous nrDNA loci. Most natural polyploids possess one predominant nrDNA homeolog in their genome. Analysis of F2 segregation in an artificial cross suggested that in some plants, most or all repeats at one homeologous locus have been lost, whereas in other plants two loci remain, but both have been homogenized by concerted evolution. In most natural allopolyploids harboring a relatively balanced ratio of homeologs, one homeolog was expressed preferentially, but in the majority of plants, low levels of transcription could be detected from the other homeolog. Individuals within some tetraploid taxa varied as to which homeolog was expressed preferentially. In some plants, the degree of preferential expression also varied among tissues. Preferential expression was absent in synthetic polyploids and in some artificial diploid hybrids, suggesting that nucleolar dominance is not necessarily a direct result of hybridization or polyploidization. The establishment of preferential expression in Glycine allopolyploids appears to be either stochastic within lineages or genotype specific. PMID:15084677

  8. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  9. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent.

  10. Silenced rRNA genes are activated and substitute for partially eliminated active homeologs in the recently formed allotetraploid, Tragopogon mirus (Asteraceae).

    PubMed

    Dobešová, E; Malinská, H; Matyášek, R; Leitch, A R; Soltis, D E; Soltis, P S; Kovařík, A

    2015-03-01

    To study the relationship between uniparental rDNA (encoding 18S, 5.8S and 26S ribosomal RNA) silencing (nucleolar dominance) and rRNA gene dosage, we studied a recently emerged (within the last 80 years) allotetraploid Tragopogon mirus (2n=24), formed from the diploid progenitors T. dubius (2n=12, D-genome donor) and T. porrifolius (2n=12, P-genome donor). Here, we used molecular, cytogenetic and genomic approaches to analyse rRNA gene activity in two sibling T. mirus plants (33A and 33B) with widely different rRNA gene dosages. Plant 33B had ~400 rRNA genes at the D-genome locus, which is typical for T. mirus, accounting for ~25% of total rDNA. We observed characteristic expression dominance of T. dubius-origin genes in all organs. Its sister plant 33A harboured a homozygous macrodeletion that reduced the number of T. dubius-origin genes to about 70 copies (~4% of total rDNA). It showed biparental rDNA expression in root, flower and callus, but not in leaf where D-genome rDNA dominance was maintained. There was upregulation of minor rDNA variants in some tissues. The RNA polymerase I promoters of reactivated T. porrifolius-origin rRNA genes showed reduced DNA methylation, mainly at symmetrical CG and CHG nucleotide motifs. We hypothesise that active, decondensed rDNA units are most likely to be deleted via recombination. The silenced homeologs could be used as a 'first reserve' to ameliorate mutational damage and contribute to evolutionary success of polyploids. Deletion and reactivation cycles may lead to bidirectional homogenisation of rRNA arrays in the long term. PMID:25537492

  11. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences.

    PubMed

    Oliveira, Claudio M G; Hübschen, Judith; Brown, Derek J F; Ferraz, Luiz C C B; Wright, Frank; Neilson, Roy

    2004-06-01

    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved.

  12. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences

    PubMed Central

    Oliveira, Claudio M. G.; Hübschen, Judith; Brown, Derek J. F.; Ferraz, Luiz C. C. B.; Wright, Frank; Neilson, Roy

    2004-01-01

    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved. PMID:19262801

  13. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  14. Optical and electrical stability of viral-templated copper sulfide (Cu{sub 1.8}S) films

    SciTech Connect

    Shahriar Zaman, Mohammed; Bernard Grajeda, Gabriel; Haberer, Elaine D.

    2014-04-14

    The optical and electrical stabilities of viral-templated non-stoichiometric copper sulfide, digenite (Cu{sub 1.8}S) films were investigated. The films were composed of large agglomerates of randomly aligned Cu{sub 1.8}S-coated M13 filamentous phage. Free carrier optical absorption associated with localized surface plasmon resonance (LSPR) was observed in the near infrared spectral region, and the films were electrically active, displaying a linear current-voltage relationship. Under ambient conditions, the magnitude of the LSPR absorption increased, following a power law relationship with time, and the electrical resistance of viral-templated films decreased significantly. In contrast, the resistance of films stored under low oxygen, low humidity conditions experienced a smaller reduction in electrical resistance. Changes in optical and electrical film properties under ambient conditions were associated with an increase in free carrier concentration within the copper chalcogenide material due to oxygen exposure. X-ray photoelectron spectroscopy was used to relate this increase in free carrier concentration to compositional changes on the viral-templated material surface.

  15. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  16. Genetic diversity of Cryptosporidium in fish at the 18S and actin loci and high levels of mixed infections.

    PubMed

    Yang, Rongchang; Palermo, Cindy; Chen, Linda; Edwards, Amanda; Paparini, Andrea; Tong, Kaising; Gibson-Kueh, Susan; Lymbery, Alan; Ryan, Una

    2015-12-15

    Cryptosporidium is an enteric parasite that infects humans and a wide range of animals. Relatively little is known about the epidemiology and taxonomy of Cryptosporidium in fish. In the present study, a total of 775 fish, belonging to 46 species and comprising ornamental fish, marine fish and freshwater fish were screened for the prevalence of Cryptosporidium by PCR. The overall prevalence of Cryptosporidium in fish was 5.3% (41/775), with prevalences ranging from 1.5 to 100% within individual host species. Phylogenetic analysis of these Cryptosporidium isolates as well as 14 isolates from previous studies indicated extensive genetic diversity as well as evidence for mixed infections. At the 18S locus the following species were identified; Cryptosporidium molnari-like genotype (n=14), Cryptosporidium huwi (n=8), piscine genotype 2 (n=4), piscine genotype 3-like (n=1), piscine genotype 4 (n=2), piscine genotype 5 (n=13), piscine genotype 5-like (n=1) and five novel genotypes (n=5). At the actin locus, species identification agreed with the 18S locus for only 52.3% of isolates sequenced, indicating high levels of mixed infections. Future studies will need to employ both morphological characterization and deep sequencing amplicon-based technologies to better understand the epidemiological and phylogenetic relationships of piscine-derived Cryptosporidium species and genotypes, particularly when mixed infections are detected.

  17. Genetic diversity of Cryptosporidium in fish at the 18S and actin loci and high levels of mixed infections.

    PubMed

    Yang, Rongchang; Palermo, Cindy; Chen, Linda; Edwards, Amanda; Paparini, Andrea; Tong, Kaising; Gibson-Kueh, Susan; Lymbery, Alan; Ryan, Una

    2015-12-15

    Cryptosporidium is an enteric parasite that infects humans and a wide range of animals. Relatively little is known about the epidemiology and taxonomy of Cryptosporidium in fish. In the present study, a total of 775 fish, belonging to 46 species and comprising ornamental fish, marine fish and freshwater fish were screened for the prevalence of Cryptosporidium by PCR. The overall prevalence of Cryptosporidium in fish was 5.3% (41/775), with prevalences ranging from 1.5 to 100% within individual host species. Phylogenetic analysis of these Cryptosporidium isolates as well as 14 isolates from previous studies indicated extensive genetic diversity as well as evidence for mixed infections. At the 18S locus the following species were identified; Cryptosporidium molnari-like genotype (n=14), Cryptosporidium huwi (n=8), piscine genotype 2 (n=4), piscine genotype 3-like (n=1), piscine genotype 4 (n=2), piscine genotype 5 (n=13), piscine genotype 5-like (n=1) and five novel genotypes (n=5). At the actin locus, species identification agreed with the 18S locus for only 52.3% of isolates sequenced, indicating high levels of mixed infections. Future studies will need to employ both morphological characterization and deep sequencing amplicon-based technologies to better understand the epidemiological and phylogenetic relationships of piscine-derived Cryptosporidium species and genotypes, particularly when mixed infections are detected. PMID:26527238

  18. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.

    PubMed

    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G

    2014-08-01

    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general.

  19. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  20. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    PubMed

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  1. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  2. A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA.

    PubMed

    Nishimura, Kenji; Ashida, Hiroki; Ogawa, Taro; Yokota, Akiho

    2010-09-01

    In plant chloroplasts, the ribosomal RNA (rRNA) of the large subunit of the ribosome undergoes post-maturation fragmentation processing. This processing consists of site-specific cleavage that generates gapped, discontinuous rRNA molecules. However, the molecular mechanism underlying introduction of the gap structure (the 'hidden break') is poorly understood. Here, we found that the DEAD box protein RH39 plays a key role in introduction of the hidden break into the 23S rRNA in Arabidopsis chloroplasts. Genetic screening for an Arabidopsis plant with a drastically reduced level of ribulose-1,5-bisphosphate carboxylase/oxygenase identified an RH39 mutant. The levels of other chloroplast-encoded photosynthetic proteins were also severely reduced. The reductions were not due to a failure of transcription, but rather inefficiency in translation. RNA gel blotting revealed incomplete fragmentation of 23S rRNA in chloroplasts during maturation. In vitro analysis with recombinant RH39 suggested that the protein binds to the adjacent sequence upstream of the hidden break site to exert its function. We propose a molecular mechanism for the RH39-mediated fragmentation processing of 23S rRNA in chloroplasts.

  3. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    PubMed

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  4. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    PubMed

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population.

  5. Molecular characterization and phylogeny of whipworm nematodes inferred from DNA sequences of cox1 mtDNA and 18S rDNA.

    PubMed

    Callejón, Rocío; Nadler, Steven; De Rojas, Manuel; Zurita, Antonio; Petrášová, Jana; Cutillas, Cristina

    2013-11-01

    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from the mitochondrial cytochrome c oxidase 1 (cox1) and ribosomal 18S genes. The taxa consisted of different described species and several host-associated isolates (undescribed taxa) of Trichuris collected from hosts from Spain. Sequence data from mitochondrial cox1 (partial gene) and nuclear 18S near-complete gene were analyzed by maximum likelihood and Bayesian inference methods, as separate and combined datasets, to evaluate phylogenetic relationships among taxa. Phylogenetic results based on 18S ribosomal DNA (rDNA) were robust for relationships among species; cox1 sequences delimited species and revealed phylogeographic variation, but most relationships among Trichuris species were poorly resolved by mitochondrial sequences. The phylogenetic hypotheses for both genes strongly supported monophyly of Trichuris, and distinct genetic lineages corresponding to described species or nematodes associated with certain hosts were recognized based on cox1 sequences. Phylogenetic reconstructions based on concatenated sequences of the two loci, cox1 (mitochondrial DNA (mtDNA)) and 18S rDNA, were congruent with the overall topology inferred from 18S and previously published results based on internal transcribed spacer sequences. Our results demonstrate that the 18S rDNA and cox1 mtDNA genes provide resolution at different levels, but together resolve relationships among geographic populations and species in the genus Trichuris.

  6. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    PubMed

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans. PMID:26085946

  7. Phylogenetic relationships of Paradiclybothrium pacificum and Diclybothrium armatum (Monogenoidea: Diclybothriidae) inferred from 18S rDNA sequence data.

    PubMed

    Rozhkovan, Konstantin V; Shedko, Marina B

    2015-10-01

    The Diclybothriidae (Monogenoidea: Oligonchoinea) includes specific parasites of fishes assigned to the ancient order Acipenseriformes. Phylogeny of the Diclybothriidae is still unclear despite several systematic studies based on morphological characters. Together with the closely related Hexabothriidae represented by parasites of sharks and ray-fishes, the position of Diclybothriidae in different taxonomical systems has been matter of discussion. Here, we present the first molecular data on Diclybothriidae. The SSU rRNA gene was used to investigate the phylogenetic position of Paradiclybothrium pacificum and Diclybothrium armatum among the other Oligonchoinea. Complete nucleotide sequences of P. pacificum and D. armatum demonstrated high identity (98.53%) with no intraspecific sequence variability. Specimens of D. armatum were obtained from different hosts (Acipenser schrenckii and Huso dauricus); however, variation by host was not detected. The sequence divergence and phylogenetic trees data show that Diclybothriidae and Hexabothriidae are more closely related to each other than with other representatives of Oligonchoinea.

  8. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  9. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  10. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  11. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  12. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  13. Smoke generators show the twisting paths of wingtip vortices behind two NASA Dryden F/A-18's used in

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Smoke generators show the twisting paths of wingtip vortices behind two NASA Dryden F/A-18's used in the Autonomous Formation Flight (AFF) program during flight #743. The lead aircraft, F-18 #845 (NASA Dryden's Systems Research Aircraft), piloted by Craig Bomben, is followed closely by another F-18, #847, piloted by Dick Ewers. A vortex is a spiraling current of air emanating from aircraft wingtips as they fly. By mapping the vortex pattern and using sophisticated software to put the trailing aircraft in the optimum location, the energy of the vortex could result in fuel savings for the follower aircraft of 15 percent or more. Autonomous Formation Flight (AFF) is intended to allow an aircraft to fly in close formation over long distances using advanced positioning and controls technology. It utilizes Global Positioning System satellites and inertial navigation systems to position two or more aircraft in formation, with an accuracy of a few inches. This capability is expected to yield fuel efficiency improvements.

  14. Morphology and 18S rDNA gene sequence of Blepharisma sinuosum Sawaya, 1940 (Ciliophora: Heterotrichea) from Brazil.

    PubMed

    Fernandes, Noemi Mendes; Dias, Roberto Júnio Pedroso; Senra, Marcus Vinicius Xavier; Soares, Carlos Augusto Gomes; da Silva Neto, Inácio Domingos

    2013-11-01

    The morphology and morphometric data of seven populations of Blepharisma sinuosum from southeastern Brazil were investigated. The description is based on live observations, protargol impregnation, and scanning electron microscopy. Blepharisma sinuosum measures 75-255μm in length and 25-93μm in width and has a spindle-shaped body, pink color, a single contractile vacuole located at the posterior end, 50 adoral membranelles, a conspicuous paroral, 17-35 somatic kineties, a moniliform macronucleus with 2-7 connected nodules, and 3-20 micronuclei. Morphological comparisons with similar species were performed and suggest that B. americanum is the junior synonym of B. sinuosum. The 18S rDNA gene sequence of B. sinuosum was obtained and compared with that of other Blepharisma species. The length and GC content of the obtained sequence is 1652bp and 47.03%, respectively, and has a very high structural similarity (99.9%) with the B. undulans sequence. The validity of the classification of Blepharisma species in morphonuclear subgenera is also discussed.

  15. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  16. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  17. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C

    1994-01-01

    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  18. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae.

    PubMed

    Thota, Swarna Gowri; Unnikannan, C P; Thampatty, Sitalakshmi R; Manorama, R; Bhandari, Rashna

    2015-02-15

    Ribosome biogenesis is an essential cellular process regulated by the metabolic state of a cell. We examined whether inositol pyrophosphates, energy-rich derivatives of inositol that act as metabolic messengers, play a role in ribosome synthesis in the budding yeast, Saccharomyces cerevisiae. Yeast strains lacking the inositol hexakisphosphate (IP6) kinase Kcs1, which is required for the synthesis of inositol pyrophosphates, display increased sensitivity to translation inhibitors and decreased protein synthesis. These phenotypes are reversed on expression of enzymatically active Kcs1, but not on expression of the inactive form. The kcs1Δ yeast cells exhibit reduced levels of ribosome subunits, suggesting that they are defective in ribosome biogenesis. The rate of rRNA synthesis, the first step of ribosome biogenesis, is decreased in kcs1Δ yeast strains, suggesting that RNA polymerase I (Pol I) activity may be reduced in these cells. We determined that the Pol I subunits, A190, A43 and A34.5, can accept a β-phosphate moiety from inositol pyrophosphates to undergo serine pyrophosphorylation. Although there is impaired rRNA synthesis in kcs1Δ yeast cells, we did not find any defect in recruitment of Pol I on rDNA, but observed that the rate of transcription elongation was compromised. Taken together, our findings highlight inositol pyrophosphates as novel regulators of rRNA transcription.

  19. Rare Events of Intragenus and Intraspecies Horizontal Transfer of the 16S rRNA Gene.

    PubMed

    Tian, Ren-Mao; Cai, Lin; Zhang, Wei-Peng; Cao, Hui-Luo; Qian, Pei-Yuan

    2015-07-27

    Horizontal gene transfer (HGT) of operational genes has been widely reported in prokaryotic organisms. However, informational genes such as those involved in transcription and translation processes are very difficult to be horizontally transferred, as described by Woese's complexity hypothesis. Here, we analyzed all of the completed prokaryotic genome sequences (2,143 genomes) in the NCBI (National Center for Biotechnology Information) database, scanned for genomes with high intragenomic heterogeneity of 16S rRNA gene copies, and explored potential HGT events of ribosomal RNA genes based on the phylogeny, genomic organization, and secondary structures of the ribosomal RNA genes. Our results revealed 28 genomes with relatively high intragenomic heterogeneity of multiple 16S rRNA gene copies (lowest pairwise identity <98.0%), and further analysis revealed HGT events and potential donors of the heterogeneous copies (such as HGT from Chlamydia suis to Chlamydia trachomatis) and mutation events of some heterogeneous copies (such as Streptococcus suis JS14). Interestingly, HGT of the 16S rRNA gene only occurred at intragenus or intraspecies levels, which is quite different from the HGT of operational genes. Our results improve our understanding regarding the exchange of informational genes.

  20. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-01

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. PMID:26776729

  1. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  2. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  3. Outside-in recrystallization of ZnS-Cu1.8 S hollow spheres with interdispersed lattices for enhanced visible light solar hydrogen generation.

    PubMed

    Zhu, Ting; Nuo Peh, Connor Kang; Hong, Minghui; Ho, Ghim Wei

    2014-09-01

    For the first time an earth-abundant and nontoxic ZnS-Cu(1.8) S hybrid photocatalyst has been engineered with well-defined nanosheet hollow structures by a template-engaged method. In contrast to conventional surface coupling and loading, the unique outside-in recrystallization promotes co-precipitation of ZnS and Cu(1.8) S into homogeneous interdispersed lattices, hence forming a hybrid semiconductor with visible responsive photocatalytic activity. The as-derived ZnS-Cu(1.8) S semiconductor alloy is tailored into a hierarchical hollow structure to provide readily accessible porous shells and interior spaces for effective ion transfer/exchange. Notably, this synergistic morphology, interface and crystal lattice engineering, aim towards the design of novel nanocatalysts for various sustainable environmental and energy applications.

  4. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    PubMed

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  5. Gradual reduction in rRNA transcription triggers p53 acetylation and apoptosis via MYBBP1A.

    PubMed

    Kumazawa, Takuya; Nishimura, Kazuho; Katagiri, Naohiro; Hashimoto, Sayaka; Hayashi, Yuki; Kimura, Keiji

    2015-06-05

    The nucleolus, whose primary function is ribosome biogenesis, plays an essential role in p53 activation. Ribosome biogenesis is inhibited in response to cellular stress and several nucleolar proteins translocate from the nucleolus to the nucleoplasm, where they activate p53. In this study, we analysed precisely how impaired ribosome biogenesis regulates the activation of p53 by depleting nucleolar factors involved in rRNA transcription or rRNA processing. Nucleolar RNA content decreased when rRNA transcription was inhibited. In parallel with the reduced levels of nucleolar RNA content, the nucleolar protein Myb-binding protein 1 A (MYBBP1A) translocated to the nucleoplasm and increased p53 acetylation. The acetylated p53 enhanced p21 and BAX expression and induced apoptosis. In contrast, when rRNA processing was inhibited, MYBBP1A remained in the nucleolus and nonacetylated p53 accumulated, causing cell cycle arrest at the G1 phase by inducing p21 but not BAX. We propose that the nucleolus functions as a stress sensor to modulate p53 protein levels and its acetylation status, determining cell fate between cell cycle arrest and apoptosis by regulating MYBBP1A translocation.

  6. Phylogeny and systematics of demospongiae in light of new small-subunit ribosomal DNA (18S) sequences.

    PubMed

    Redmond, N E; Morrow, C C; Thacker, R W; Diaz, M C; Boury-Esnault, N; Cárdenas, P; Hajdu, E; Lôbo-Hajdu, G; Picton, B E; Pomponi, S A; Kayal, E; Collins, A G

    2013-09-01

    The most diverse and species-rich class of the phylum Porifera is Demospongiae. In recent years, the systematics of this clade, which contains more than 7000 species, has developed rapidly in light of new studies combining molecular and morphological observations. We add more than 500 new, nearly complete 18S sequences (an increase of more than 200%) in an attempt to further enhance understanding of the phylogeny of Demospongiae. Our study specifically targets representation of type species and genera that have never been sampled for any molecular data in an effort to accelerate progress in classifying this diverse lineage. Our analyses recover four highly supported subclasses of Demospongiae: Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha. Within Keratosa, neither Dendroceratida, nor its two families, Darwinellidae and Dictyodendrillidae, are monophyletic and Dictyoceratida is divided into two lineages, one predominantly composed of Dysideidae and the second containing the remaining families (Irciniidae, Spongiidae, Thorectidae, and Verticillitidae). Within Myxospongiae, we find Chondrosida to be paraphyletic with respect to the Verongida. We amend the latter to include species of the genus Chondrosia and erect a new order Chondrillida to contain remaining taxa from Chondrosida, which we now discard. Even with increased taxon sampling of Haploscleromorpha, our analyses are consistent with previous studies; however, Haliclona species are interspersed in even more clades. Haploscleromorpha contains five highly supported clades, each more diverse than previously recognized, and current families are mostly polyphyletic. In addition, we reassign Janulum spinispiculum to Haploscleromorpha and resurrect Reniera filholi as Janulum filholi comb. nov. Within the large clade Heteroscleromorpha, we confirmed 12 recently identified clades based on alternative data, as well as a sister-group relationship between the freshwater Spongillida and the family

  7. Comparative evaluation of the nested ITS PCR against the 18S PCR-RFLP in a survey of bovine trypanosomiasis in Kwale County, Kenya.

    PubMed

    Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan

    2016-09-01

    We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05). PMID:27423733

  8. Comparative evaluation of the nested ITS PCR against the 18S PCR-RFLP in a survey of bovine trypanosomiasis in Kwale County, Kenya.

    PubMed

    Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan

    2016-09-01

    We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05).

  9. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbc L and 18S rDNA sequence data

    NASA Astrophysics Data System (ADS)

    Lin, Zhongheng; Shen, Songdong; Chen, Weizhou; Li, Huihui

    2013-01-01

    Chlorophyta species are common in the southern and northern coastal areas of China. In recent years, frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists. In this paper, we sequenced the 18S rDNA genes, the internal transcribed spacer (ITS) regions and the rbc L genes in seven organisms and obtained 536-566 bp long ITS sequences, 1 377-1 407 bp long rbc L sequences and 1 718-1 761 bp long partial 18S rDNA sequences. The GC base pair content was highest in the ITS regions and lowest in the rbc L genes. The sequencing results showed that the three Ulva prolifera (or U. pertusa) gene sequences from Qingdao and Nan'ao Island were identical. The ITS, 18S rDNA and rbc L genes in U. prolifera and U. pertusa from different sea areas in China were unchanged by geographic distance. U. flexuosa had the least evolutionary distance from U. californica in both the ITS regions (0.009) and the 18S rDNA (0.002). These data verified that Ulva and Enteromorpha are not separate genera.

  10. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    PubMed

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata.

  11. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan

    2016-01-01

    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  12. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  13. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  14. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

    2015-01-01

    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  15. Phylogenetic relationships of the enigmatic angiosperm family Podostemaceae inferred from 18S rDNA and rbcL sequence data.

    PubMed

    Soltis, D E; Mort, M E; Soltis, P S; Hibsch-Jetter, C; Zimmer, E A; Morgan, D

    1999-03-01

    The phylogenetic relationships of some angiosperm families have remained enigmatic despite broad phylogenetic analyses of rbcL sequences. One example is the aquatic family Podostemaceae, the relationships of which have long been controversial because of major morphological modifications associated with their aquatic habit. Podostemaceae have variously been associated with Piperaceae, Nepenthaceae, Polygonaceae, Caryophyllaceae, Scrophulariaceae, Rosaceae, Crassulaceae, and Saxifragaceae. Two recent analyses of rbcL sequences suggest a possible sister-group relationship of Podostemaceae to Crassulaceae (Saxifragales). However, the branch leading to Podostemaceae was long, and use of different outgroups resulted in alternative placements. We explored the phylogenetic relationships of Podostemaceae using 18S rDNA sequences and a combined rbcL + 18S rDNA matrix representing over 250 angiosperms. In analyses based on 18S rDNA data, Podostemaceae are not characterized by a long branch; the family consistently appears as part of a Malpighiales clade that also includes Malpighiaceae, Turneraceae, Passifloraceae, Salicaceae, Euphorbiaceae, Violaceae, Linaceae, Chrysobalanaceae, Trigoniaceae, Humiriaceae, and Ochnaceae. Phylogenetic analyses based on a combined 18S rDNA + rbcL data set (223 ingroup taxa) with basal angiosperms as the outgroup also suggest that Podostemaceae are part of a Malpighiales clade. These searches swapped to completion, and the shortest trees showed enhanced resolution and increased internal support compared to those based on 18S rDNA or rbcL alone. However, when Gnetales are used as the outgroup, Podostemaceae appear with members of the nitrogen fixing clade (e.g., Elaeagnaceae, Ulmaceae, Rhamnaceae, Cannabaceae, Moraceae, and Urticaceae). None of the relationships suggested here for Podostemaceae receives strong bootstrap support. Our analyses indicate that Podostemaceae are not closely allied with Crassulaceae or with other members of the

  16. The NIP7 protein is required for accurate pre-rRNA processing in human cells.

    PubMed

    Morello, Luis G; Hesling, Cédric; Coltri, Patrícia P; Castilho, Beatriz A; Rimokh, Ruth; Zanchin, Nilson I T

    2011-01-01

    Eukaryotic ribosome biogenesis requires the function of a large number of trans-acting factors which interact transiently with the nascent pre-rRNA and dissociate as the ribosomal subunits proceed to maturation and export to the cytoplasm. Loss-of-function mutations in human trans-acting factors or ribosome components may lead to genetic syndromes. In a previous study, we have shown association between the SBDS (Shwachman-Bodian-Diamond syndrome) and NIP7 proteins and that downregulation of SBDS in HEK293 affects gene expression at the transcriptional and translational levels. In this study, we show that downregulation of NIP7 affects pre-rRNA processing, causing an imbalance of the 40S/60S subunit ratio. We also identified defects at the pre-rRNA processing level with a decrease of the 34S pre-rRNA concentration and an increase of the 26S and 21S pre-rRNA concentrations, indicating that processing at site 2 is particularly slower in NIP7-depleted cells and showing that NIP7 is required for maturation of the 18S rRNA. The NIP7 protein is restricted to the nuclear compartment and co-sediments with complexes with molecular masses in the range of 40S-80S, suggesting an association to nucleolar pre-ribosomal particles. Downregulation of NIP7 affects cell proliferation, consistently with an important role for NIP7 in rRNA biosynthesis in human cells.

  17. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  18. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples.

    PubMed

    Parada, Alma E; Needham, David M; Fuhrman, Jed A

    2016-05-01

    Microbial community analysis via high-throughput sequencing of amplified 16S rRNA genes is an essential microbiology tool. We found the popular primer pair 515F (515F-C) and 806R greatly underestimated (e.g. SAR11) or overestimated (e.g. Gammaproteobacteria) common marine taxa. We evaluated marine samples and mock communities (containing 11 or 27 marine 16S clones), showing alternative primers 515F-Y (5'-GTGYCAGCMGCCGCGGTAA) and 926R (5'-CCGYCAATTYMTTTRAGTTT) yield more accurate estimates of mock community abundances, produce longer amplicons that can differentiate taxa unresolvable with 515F-C/806R, and amplify eukaryotic 18S rRNA. Mock communities amplified with 515F-Y/926R yielded closer observed community composition versus expected (r(2)  = 0.95) compared with 515F-Y/806R (r(2)  ∼ 0.5). Unexpectedly, biases with 515F-Y/806R against SAR11 in field samples (∼4-10-fold) were stronger than in mock communities (∼2-fold). Correcting a mismatch to Thaumarchaea in the 515F-C increased their apparent abundance in field samples, but not as much as using 926R rather than 806R. With plankton samples rich in eukaryotic DNA (> 1 μm size fraction), 18S sequences averaged ∼17% of all sequences. A single mismatch can strongly bias amplification, but even perfectly matched primers can exhibit preferential amplification. We show that beyond in silico predictions, testing with mock communities and field samples is important in primer selection.

  19. Analysis, optimization and verification of Illumina-generated 16S rRNA gene amplicon surveys.

    PubMed

    Nelson, Michael C; Morrison, Hilary G; Benjamino, Jacquelynn; Grim, Sharon L; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  20. Analysis, Optimization and Verification of Illumina-Generated 16S rRNA Gene Amplicon Surveys

    PubMed Central

    Nelson, Michael C.; Morrison, Hilary G.; Benjamino, Jacquelynn; Grim, Sharon L.; Graf, Joerg

    2014-01-01

    The exploration of microbial communities by sequencing 16S rRNA genes has expanded with low-cost, high-throughput sequencing instruments. Illumina-based 16S rRNA gene sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs, higher accuracy and greater throughput. Although recent reports suggest that Illumina and 454 pyrosequencing provide similar beta diversity measures, it remains to be demonstrated that pre-existing 454 pyrosequencing workflows can transfer directly from 454 to Illumina MiSeq sequencing by simply changing the sequencing adapters of the primers. In this study, we modified 454 pyrosequencing primers targeting the V4-V5 hyper-variable regions of the 16S rRNA gene to be compatible with Illumina sequencers. Microbial communities from cows, humans, leeches, mice, sewage, and termites and a mock community were analyzed by 454 and MiSeq sequencing of the V4-V5 region and MiSeq sequencing of the V4 region. Our analysis revealed that reference-based OTU clustering alone introduced biases compared to de novo clustering, preventing certain taxa from being observed in some samples. Based on this we devised and recommend an analysis pipeline that includes read merging, contaminant filtering, and reference-based clustering followed by de novo OTU clustering, which produces diversity measures consistent with de novo OTU clustering analysis. Low levels of dataset contamination with Illumina sequencing were discovered that could affect analyses that require highly sensitive approaches. While moving to Illumina-based sequencing platforms promises to provide deeper insights into the breadth and function of microbial diversity, our results show that care must be taken to ensure that sequencing and processing artifacts do not obscure true microbial diversity. PMID:24722003

  1. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  2. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  3. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  4. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.

    2013-01-01

    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  5. Reconstructing the Phylogeny of Capsosiphon fulvescens (Ulotrichales, Chlorophyta) from Korea Based on rbcL and 18S rDNA Sequences

    PubMed Central

    Sun, Sang-Mi; Yang, Seung Hwan

    2016-01-01

    Capsosiphon fulvescens is a filamentous green algae in the class Ulvophyceae. It has been consumed as food with unique flavor and soft texture to treat stomach disorders and hangovers, and its economic value justifies studying its nutritional and potential therapeutic effects. In contrast to these applications, only a few taxonomic studies have been conducted on C. fulvescens. In particular, classification and phylogenetic relationships of the C. fulvescens below the order level are controversial. To determine its phylogenetic position in the class, we used rbcL and 18S rDNA sequences as molecular markers to construct phylogenetic trees. The amplified rbcL and 18S rDNA sequences from 4 C. fulvescens isolates (Jindo, Jangheung, Wando, and Koheung, Korea) were used for phylogenetic analysis by employing three different phylogenetic methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The rbcL phylogenetic tree showed that all taxa in the order Ulvales were clustered as a monophyletic group and resolved the phylogenetic position of C. fulvescens in the order Ulotrichales. The significance of our study is that the 18S rDNA phylogenetic tree shows the detailed taxonomic position of C. fulvescens. In our result, C. fulvescens is inferred as a member of Ulotrichaceae, along with Urospora and Acrosiphonia. PMID:27190985

  6. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences.

    PubMed

    Li, LüYan; Huang, QiaoJuan; Wu, ShuHui; Lin, Duan; Chen, JiaHui; Chen, YueQin

    2008-12-01

    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  7. The conservation of number and location of 18S sites indicates the relative stability of rDNA in species of Pentatomomorpha (Heteroptera).

    PubMed

    Bardella, Vanessa Bellini; Fernandes, Thiago; Vanzela, André Luís Laforga

    2013-07-01

    Fluorescent in situ hybridization (FISH) with rDNA probes has been used for comparative cytogenetics studies in different groups of organisms. Although heteropterans are a large suborder within Hemiptera, studies using rDNA are limited to the infraorder Cimicomorpha, in which rDNA sites are present in the autosomes or sex chromosomes. We isolated and sequenced a conserved 18S rDNA region of Antiteuchus tripterus (Pentatomidae) and used it as a probe against chromosomes of 25 species belonging to five different families of Pentatomomorpha. The clone pAt05, with a length of 736 bp, exhibited a conserved stretch of 590 bp. FISH analysis with the probe pAt05 always demonstrated hybridization signals in sub-terminal positions, except for Euschistus heros. Apparently, there is a tendency for 18S rDNA sites to locate in autosomes, except for Leptoglossus gonagra and Euryophthalmus rufipennis, which showed signals in the m- and sex chromosomes, respectively. Although FISH has produced evidence that rearrangements are involved in rDNA repositioning, whether in different autosomes or between sex and m-chromosomes, we have no conclusive evidence of what were the pathways of these rearrangements based on the evolutionary history of the species studied here. Nevertheless, the diversity in the number of species analyzed here showed a tendency of 18S rDNA to remain among the autosomes.

  8. Three stage cultivation process of facultative strain of Chlorella sorokiniana for treating dairy farm effluent and lipid enhancement.

    PubMed

    Hena, S; Fatihah, N; Tabassum, S; Ismail, N

    2015-09-01

    Reserve lipids of microalgae are promising for biodiesel production. However, economically feasible and sustainable energy production from microalgae requires optimization of cultivation conditions for both biomass yield and lipid production of microalgae. Biomass yield and lipid production in microalgae are a contradictory problem because required conditions for both targets are different. Simultaneously, the mass cultivation of microalgae for biofuel production also depends extremely on the performance of the microalgae strains used. In this study a green unicellular microalgae Chlorella sorokiniana (DS6) isolated from the holding tanks of farm wastewater treatment plant using multi-step screening and acclimation procedures was found high-lipid producing facultative heterotrophic microalgae strain capable of growing on dairy farm effluent (DFE) for biodiesel feedstock and wastewater treatment. Morphological features and the phylogenetic analysis for the 18S rRNA identified the isolated strains. A novel three stage cultivation process of facultative strain of C. sorokiniana was examined for lipid production. PMID:26043271

  9. Three stage cultivation process of facultative strain of Chlorella sorokiniana for treating dairy farm effluent and lipid enhancement.

    PubMed

    Hena, S; Fatihah, N; Tabassum, S; Ismail, N

    2015-09-01

    Reserve lipids of microalgae are promising for biodiesel production. However, economically feasible and sustainable energy production from microalgae requires optimization of cultivation conditions for both biomass yield and lipid production of microalgae. Biomass yield and lipid production in microalgae are a contradictory problem because required conditions for both targets are different. Simultaneously, the mass cultivation of microalgae for biofuel production also depends extremely on the performance of the microalgae strains used. In this study a green unicellular microalgae Chlorella sorokiniana (DS6) isolated from the holding tanks of farm wastewater treatment plant using multi-step screening and acclimation procedures was found high-lipid producing facultative heterotrophic microalgae strain capable of growing on dairy farm effluent (DFE) for biodiesel feedstock and wastewater treatment. Morphological features and the phylogenetic analysis for the 18S rRNA identified the isolated strains. A novel three stage cultivation process of facultative strain of C. sorokiniana was examined for lipid production.

  10. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  11. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  12. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  13. RAP, the sole octotricopeptide repeat protein in Arabidopsis, is required for chloroplast 16S rRNA maturation.

    PubMed

    Kleinknecht, Laura; Wang, Fei; Stübe, Roland; Philippar, Katrin; Nickelsen, Jörg; Bohne, Alexandra-Viola

    2014-02-01

    The biogenesis and activity of chloroplasts in both vascular plants and algae depends on an intracellular network of nucleus-encoded, trans-acting factors that control almost all aspects of organellar gene expression. Most of these regulatory factors belong to the helical repeat protein superfamily, which includes tetratricopeptide repeat, pentatricopeptide repeat, and the recently identified octotricopeptide repeat (OPR) proteins. Whereas green algae express many different OPR proteins, only a single orthologous OPR protein is encoded in the genomes of most land plants. Here, we report the characterization of the only OPR protein in Arabidopsis thaliana, RAP, which has previously been implicated in plant pathogen defense. Loss of RAP led to a severe defect in processing of chloroplast 16S rRNA resulting in impaired chloroplast translation and photosynthesis. In vitro RNA binding and RNase protection assays revealed that RAP has an intrinsic and specific RNA binding capacity, and the RAP binding site was mapped to the 5' region of the 16S rRNA precursor. Nucleoid localization of RAP was shown by transient green fluorescent protein import assays, implicating the nucleoid as the site of chloroplast rRNA processing. Taken together, our data indicate that the single OPR protein in Arabidopsis is important for a basic process of chloroplast biogenesis.

  14. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA.

    PubMed

    Wang, Minshi; Parshin, Andrey V; Shcherbik, Natalia; Pestov, Dimitri G

    2015-07-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5'-truncated 5.8S rRNA, which we named 5.8SC. The 5' exoribonuclease Xrn2 is involved in the generation of both 5.8S(C) and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8S(C) rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes.

  15. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.

    2015-01-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  16. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    PubMed

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  17. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  19. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  20. Rrp5 Binding at Multiple Sites Coordinates Pre-rRNA Processing and Assembly

    PubMed Central

    Lebaron, Simon; Segerstolpe, Åsa; French, Sarah L.; Dudnakova, Tatiana; de lima Alves, Flavia; Granneman, Sander; Rappsilber, Juri; Beyer, Ann L.; Wieslander, Lars; Tollervey, David

    2013-01-01

    Summary In vivo UV crosslinking identified numerous preribosomal RNA (pre-rRNA) binding sites for the large, highly conserved ribosome synthesis factor Rrp5. Intramolecular complementation has shown that the C-terminal domain (CTD) of Rrp5 is required for pre-rRNA cleavage at sites A0–A2 on the pathway of 18S rRNA synthesis, whereas the N-terminal domain (NTD) is required for A3 cleavage on the pathway of 5.8S/25S rRNA synthesis. The CTD was crosslinked to sequences flanking A2 and to the snoRNAs U3, U14, snR30, and snR10, which are required for cleavage at A0–A2. The NTD was crosslinked to sequences flanking A3 and to the RNA component of ribonuclease MRP, which cleaves site A3. Rrp5 could also be directly crosslinked to several large structural proteins and nucleoside triphosphatases. A key role in coordinating preribosomal assembly and processing was confirmed by chromatin spreads. Following depletion of Rrp5, cotranscriptional cleavage was lost and preribosome compaction greatly reduced. PMID:24239293

  1. Use of Subgenic 18S Ribosomal DNA PCR and Sequencing for Genus and Genotype Identification of Acanthamoebae from Humans with Keratitis and from Sewage Sludge

    PubMed Central

    Schroeder, Jill M.; Booton, Gregory C.; Hay, John; Niszl, Ingrid A.; Seal, David V.; Markus, Miles B.; Fuerst, Paul A.; Byers, Thomas J.

    2001-01-01

    This study identified subgenic PCR amplimers from 18S rDNA that were (i) highly specific for the genus Acanthamoeba, (ii) obtainable from all known genotypes, and (iii) useful for identification of individual genotypes. A 423- to 551-bp Acanthamoeba-specific amplimer ASA.S1 obtained with primers JDP1 and JDP2 was the most reliable for purposes i and ii. A variable region within this amplimer also identified genotype clusters, but purpose iii was best achieved with sequencing of the genotype-specific amplimer GTSA.B1. Because this amplimer could be obtained from any eukaryote, axenic Acanthamoeba cultures were required for its study. GTSA.B1, produced with primers CRN5 and 1137, extended between reference bp 1 and 1475. Genotypic identification relied on three segments: bp 178 to 355, 705 to 926, and 1175 to 1379. ASA.S1 was obtained from single amoeba, from cultures of all known 18S rDNA genotypes, and from corneal scrapings of Scottish patients with suspected Acanthamoeba keratitis (AK). The AK PCR findings were consistent with culture results for 11 of 15 culture-positive specimens and detected Acanthamoeba in one of nine culture-negative specimens. ASA.S1 sequences were examined for 6 of the 11 culture-positive isolates and were most closely associated with genotypic cluster T3-T4-T11. A similar distance analysis using GTSA.B1 sequences identified nine South African AK-associated isolates as genotype T4 and three isolates from sewage sludge as genotype T5. Our results demonstrate the usefulness of 18S ribosomal DNA PCR amplimers ASA.S1 and GTSA.B1 for Acanthamoeba-specific detection and reliable genotyping, respectively, and provide further evidence that T4 is the predominant genotype in AK. PMID:11326011

  2. Rapid Detection of Mutations in the 23S rRNA Gene of Helicobacter pylori That Confers Resistance to Clarithromycin Treatment to the Bacterium

    PubMed Central

    Matsumura, Masayuki; Hikiba, Yoko; Ogura, Keiji; Togo, Goichi; Tsukuda, Izumi; Ushikawa, Kenji; Shiratori, Yasushi; Omata, Masao

    2001-01-01

    We developed a new method capable of detecting point mutations in the 23S rRNA gene of Helicobacter pylori using a LightCycler. Our method can detect a mutation in this gene in less than 1 h and can process many samples at once, thereby contributing to the selection of patients suitable for clarithromycin-based therapy. PMID:11158129

  3. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  4. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  5. Ultrastructure and 18S rDNA sequence analysis of Wobblia lunata gen. et sp. nov., a new heterotrophic flagellate (Stramenopiles, Incertae sedis).

    PubMed

    Moriya, M; Nakayama, T; Inouye, I

    2000-05-01

    A new heterotrophic flagellate Wobblia lunata gen. et sp. nov. is described. This organism usually attaches to the substratum showing a wobbling motion, and sometimes glides on the substratum or swims freely in the medium. W. lunata has various features characteristic of the stramenopiles. These include a hairy flagellum with tripartite tubular hairs, a mitochondrion with tubular cristae, arrangement of flagellar apparatus components and a double helix in the flagellar transition zone. W. lunata shares a double helix with heterotrophic stramenopiles, including Developayella elegans, oomycetes, hyphochytrids, opalinids and proteromonads, and could be placed in the phylum Bigyra Cavalier-Smith. However, from 18S rDNA tree analysis, these organisms form two distantly-related clades in the stramenopiles, and Wobblia appears at the base of the stramenopiles. Evaluation of morphological features and comparison of 18S rDNA sequences indicate that W. lunata is a member of the stramenopiles, but it is distinct from any other stramenopiles so far described. Its phylogenetic position within the stramenopiles is uncertain and therefore W. lunata is described as a stramenopile incertae sedis. PMID:10896132

  6. Karyotype diversity of four species of the incertae sedis group (Characidae) from different hydrographic basins: analysis of AgNORs, CMA3 and 18S rDNA.

    PubMed

    Mendes, M M; da Rosa, R; Giuliano-Caetano, L; Dias, A L

    2011-01-01

    A large number of genera in the tropical fish family Characidae are incertae sedis. Cytogenetic analysis was made of four of these species: Astyanax eigenmanniorum, Deuterodon stigmaturus, Hyphessobrycon luetkenii, and H. anisitsi, collected from various hydrographic basins: hydrographic system from Laguna dos Patos/RS, Tramandaí basin/RS and Tibagi River basin/PR. The first two species were collected in their type locality in the State of Rio Grande do Sul. The 2n = 48 karyotype was observed only in A. eigenmanniorum, while the other species had 2n = 50 chromosomes, with different karyotypic formulas. There was weak heterochromatin staining in the pericentromeric region of A. eigenmanniorum, D. stigmaturus and H. luetkenni chromosomes. In H. anisitsi, heterochromatin appeared to be more abundant and distributed in the pericentromeric and terminal regions of the chromosomes; three pairs showed more evident heterochromatic blocks. There were multiple Ag-NORs in all populations, visualized by FISH with an 18S rDNA probe. While D. stigmaturus and H. luetkenii had conserved AgNOR, CMA3 and 18S rDNA sites, the other two species showed intra- and interindividual variation at these sites. The karyotype variability was high, as is common in this group of fish. Different species arising from isolated hydrographic basins maintain an elevated level of karyotype differentiation, mainly with respect to chromosome structure, heterochromatin distribution and rDNA localization. This is the first report with cytogenetic data for D. stigmaturus and H. luetkenii. PMID:22179995

  7. Evolutionary relationships between 15 Plasmodium species from new and old world primates (including humans): an 18S rDNA cladistic analysis.

    PubMed

    Leclerc, M C; Hugot, J P; Durand, P; Renaud, F

    2004-12-01

    We present a new phylogenetic analysis of 15 primate Plasmodium species based on 18S rDNA sequences including new sequences of Plasmodium coatneyi, P. fieldi, P. gonderi, P. hylobati and P. simium. The results are discussed in the context of the parasite host species and their geographical distribution. Contrary to other phylogenies constructed with this 18S rDNA molecule, we observed that the topology of phylogenetic trees was not affected either by the quality of the nucleotide matrices, or by the species present in the outgroup. This analysis showed the following. (1) The polyphyly of human Plasmodium is confirmed. (2) The monophyly of Plasmodium from Old World monkeys is confirmed by the new added sequences and P. gonderi, an African species, possibly could be at the root of this group. (3) The most parsimonious biogeographical hypothesis is that P. vivax originated in Asia; thus, its related species P. simium appears to be derived through a transfer from the human P. vivax to New World monkey species in South America. (4) Sampling efforts of non-human primate Plasmodium could permit improvement of the knowledge of primate Plasmodium phylogeny and also consideration of the risks of malaria emergence from monkey reservoirs.

  8. Phylogenetic Analysis of Rhinosporidium seeberi’s 18S Small-Subunit Ribosomal DNA Groups This Pathogen among Members of the Protoctistan Mesomycetozoa Clade

    PubMed Central

    Herr, Roger A.; Ajello, Libero; Taylor, John W.; Arseculeratne, Sarath N.; Mendoza, Leonel

    1999-01-01

    For the past 100 years the phylogenetic affinities of Rhinosporidium seeberi have been controversial. Based on its morphological features, it has been classified as a protozoan or as a member of the kingdom Fungi. We have amplified and sequenced nearly a full-length 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence from R. seeberi. Using phylogenetic analysis, by parsimony and distance methods, of R. seeberi’s 18S SSU rDNA and that of other eukaryotes, we found that this enigmatic pathogen of humans and animals clusters with a novel group of fish parasites referred to as the DRIP clade (Dermocystidium, rossete agent, Ichthyophonus, and Psorospermium), near the animal-fungal divergence. Our phylogenetic analyses also indicate that R. seeberi is the sister taxon of the two Dermocystidium species used in this study. This molecular affinity is remarkable since members of the genus Dermocystidium form spherical structures in infected hosts, produce endospores, have not been cultured, and possess mitochondria with flat cristae. With the addition of R. seeberi to this clade, the acronym DRIP is no longer appropriate. We propose to name this monophyletic clade Mesomycetozoa to reflect the group’s phylogenetic association within the Eucarya. PMID:10449446

  9. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  10. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  11. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  12. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  13. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  14. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  15. 18S rDNA analysis of alkenone-producing haptophyte(s) preserved in surface sediments of Lake Toyoni, Japan

    NASA Astrophysics Data System (ADS)

    McColl, J. L.; Couto, J.; Bendle, J. A.; Henderson, A. C.; Seki, O.; Phoenix, V. R.; Toney, J. L.

    2013-12-01

    Alkenones (long chain ketones) are readily preserved in sedimentary archives and have the potential to provide quantitative reconstructions of past water temperature. Alkenones are produced by a limited number of haptophyte algae in the marine and also some lacustrine systems. However, lakes are heterogeneous: an individual lake will have a unique combination of ecological conditions, haptophyte species and seasonal alkenone production that contributes to the sedimentary record. Haptophyte algae species have different sensitivities to temperature; therefore identifying the alkenone producer(s) prior to down-core temperature reconstructions is critical before selecting the most appropriate temperature calibration. We present a study from Lake Toyoni, a freshwater lake in Hokkaido, Japan that has alkenones preserved in surface sediments. The aim of this study is to identify the alkenone producer(s) within the lake using 18S rDNA analyses. Preserved rDNA of planktonic phototrophic algae was extracted from surface sediments of Lake Toyoni and phylogenetic analyses of the rDNA sequences suggest alkenones are produced by a single haptophyte within the class Prymnesiophyceae (order Isochrysidales). The Lake Toyoni alkenone-producer shares a distinct phylotype with a haptophyte reported from water filter samples collected in Lake BrayaSø, Greenland (D'Andrea et al., 2006). Similarity between the 18S rDNA sequences from Lake Toyoni and Lake BrayaSø provides a basis for applying (and updating) the Greenland lake temperature calibration. Applying this temperature calibration (T°C = 40.8 [UK37] + 31.8, R2=0.96; n=34) to the surface sediment alkenone unsaturation index from Lake Toyoni gives an estimated lake surface temperature (LST) of 8°C. This is in line with observed LST at Lake Toyoni, which ranges between 7 - 22°C (Apr 2011 to Nov 2011). The occurrence and identification of a single alkenone producer in Lake Toyoni means problems posed by a mixture of haptophytes in

  16. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  17. [Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].

    PubMed

    Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

    2004-01-01

    18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

  18. Slow molecular evolution in 18S rDNA, rbcL and nad5 genes of mosses compared with higher plants.

    PubMed

    Stenøien, H K

    2008-03-01

    The evolutionary potential of bryophytes (mosses, liverworts and hornworts) has been debated for decades. Fossil record and biogeographical distribution patterns suggest very slow morphological evolution and the retainment of several ancient traits since the split with vascular plants some 450 million years ago. Many have argued that bryophytes may evolve as rapidly as higher plants on the molecular level, but this hypothesis has not been tested so far. Here, it is shown that mosses have experienced significantly lower rates of molecular evolution than higher plants within 18S rDNA (nuclear), rbcL (chloroplast) and nad5 (mitochondrial) genes. Mosses are on an average evolving 2-3 times slower than ferns, gymnosperms and angiosperms; and also green algae seem to be evolving faster than nonvascular plants. These results support the observation of a general correlation between morphological and molecular evolutionary rates in plants and also show that mosses are 'evolutionary sphinxes' regarding both morphological and molecular evolutionary potential.

  19. First record of metacestodes of Mesocestoides sp. in the common starling (Sturnus vulgaris) in Europe, with an 18S rDNA characterisation of the isolate.

    PubMed

    Literák, Ivan; Olson, Peter D; Georgiev, Boyko B; Spakulová, Marta

    2004-03-01

    Metacestodes of Mesocestoides sp. were recorded from Sturnus vulgaris (Passeriformes: Stumidae) in the Czech Republic in April 2002. They were found in a cutaneous cyst and in the thoracic region of the body cavity of the bird. This is the first record of metacestodes of Mesocestoides sp. in this host species in Europe as well as the first finding of the formation of a cutaneous cyst provoked by this parasite. Additional specimens from Apodemus agrarius (Mammalia: Rodentia) from Bulgaria and Lacerta agilis (Reptilia: Squamata) from the Czech Republic were compared with that from S. vulgaris. Sequence data from the V4 variable region (18S rDNA) were used to compare genetic variability among these and previously characterized isolates of Mesocestoides spp. A number of distinct clades were recognized, with metacestodes from L. agilis showing the highest degree of relative divergence. PMID:15139376

  20. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    PubMed

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  1. Uneven seasonal distribution of Babesia canis and its two 18S rDNA genotypes in questing Dermacentor reticulatus ticks in urban habitats.

    PubMed

    Hornok, Sándor; Kartali, Kitti; Takács, Nóra; Hofmann-Lehmann, Regina

    2016-07-01

    It has been reported from cities in Central Europe that clinical cases of canine babesiosis are most frequent in spring time, despite the fact that the peak activity of Dermacentor reticulatus (the vector of Babesia canis) is during autumn. The present study was initiated to evaluate the seasonal distribution of B. canis-infected D. reticulatus ticks in this context. In two habitats of Budapest 852 D. reticulatus adults were collected between August, 2014 and June, 2015. Among the molecularly analysed 413 ticks 8.2% were PCR positive for piroplasms. Both formerly reported 18S rDNA genotypes of B. canis: ("A" and "B") were identified. In habitat-1 B. canis-infected ticks were detected only in spring. Similarly, in habitat-2 B. canis-infected ticks occurred significantly more frequently during winter and spring than in the autumn (24.6% vs. 1.4%), and their monthly distribution showed significant negative correlation with tick size. The prevalence of infected ticks was the highest (43.5%) in late February. In addition, a month-dependent time-shift was noted in the appearance of the two B. canis 18S rDNA genotypes: the less pathogenic "A" predominating earlier, and the more pathogenic "B" later. It is known from literature that D. reticulatus individuals that moult to adult in the spring are smaller in size. Thus, the above results suggest that in urban habitats the occurrence of B. canis-infected ticks (or their questing activity) is more likely, when there are freshly emerged adults in the population, i.e. early in the questing season. It was also observed that the temporal distribution of D. reticulatus ticks carrying different B. canis genotypes was not random. PMID:27009915

  2. Comparative study of the validity of three regions of the 18S-rRNA gene for massively parallel sequencing-based monitoring of the planktonic eukaryote community.

    PubMed

    Tanabe, Akifumi S; Nagai, Satoshi; Hida, Kohsuke; Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Takano, Yoshihito; Katakura, Seiji

    2016-03-01

    The nuclear 18S-rRNA gene has been used as a metabarcoding marker in massively parallel sequencing (MPS)-based environmental surveys for plankton biodiversity research. However, different hypervariable regions have been used in different studies, and their utility has been debated among researchers. In this study, detailed investigations into 18S-rRNA were carried out; we investigated the effective number of sequences deposited in international nucleotide sequence databases (INSDs), the amplification bias, and the amplicon sequence variability among the three variable regions, V1-3, V4-5 and V7-9, using in silico polymerase chain reaction (PCR) amplification based on INSDs. We also examined the primer universality and the taxonomic identification power, using MPS-based environmental surveys in the Sea of Okhotsk, to determine which region is more useful for MPS-based monitoring. The primer universality was not significantly different among the three regions, but the number of sequences deposited in INSDs was markedly larger for the V4-5 region than for the other two regions. The sequence variability was significantly different, with the highest variability in the V1-3 region, followed by the V7-9 region, and the lowest variability in the V4-5 region. The results of the MPS-based environmental surveys showed significantly higher identification power in the V1-3 and V7-9 regions than in the V4-5 region, but no significant difference was detected between the V1-3 and V7-9 regions. We therefore conclude that the V1-3 region will be the most suitable for future MPS-based monitoring of natural eukaryote communities, as the number of sequences deposited in INSDs increases.

  3. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    PubMed

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  4. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  5. Sampling of intestinal microbiota and targeted amplification of bacterial 16S rRNA genes for microbial ecologic analysis.

    PubMed

    Tong, Maomeng; Jacobs, Jonathan P; McHardy, Ian H; Braun, Jonathan

    2014-11-03

    Dysbiosis of host-associated commensal microbiota is emerging as an important factor in risk and phenotype of immunologic, metabolic, and behavioral diseases. Accurate analysis of microbial composition and functional state in humans or mice requires appropriate collection and pre-processing of biospecimens. Methods to sample luminal and mucosal microbiota from human or mouse intestines and to profile microbial phylogenetic composition using 16S rRNA sequencing are presented here. Data generated using the methods in this unit can be used for downstream quantitative analysis of microbial ecology.

  6. Sampling of intestinal microbiota and targeted amplification of bacterial 16S rRNA genes for microbial ecologic analysis

    PubMed Central

    Tong, Maomeng; Jacobs, Jonathan P.; McHardy, Ian H.; Braun, Jonathan

    2015-01-01

    Dysbiosis of host-associated commensal microbiota is emerging as an important factor in risk and phenotype of immunologic, metabolic, and behavioral diseases. Appropriate collection and pre-processing of biospecimens from humans or mice is necessary for accurate analysis of microbial composition and functional state. Methods to sample intestinal luminal and mucosal microbiota from humans and mice, and to profile microbial phylogenetic composition using 16S rRNA sequencing are presented here. Data generated using this protocol can be used for downstream quantitative analysis of microbial ecology. PMID:25367129

  7. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  8. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  9. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  10. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  11. Involvement of the transcriptional factor E2F1 in the regulation of the rRNA promoter

    SciTech Connect

    Ayrault, Olivier; Andrique, Laetitia; Seite, Paule . E-mail: paule.seite@univ-poitiers.fr

    2006-04-15

    p16{sup INK4a}-pRB-E2F and ARF-MDM2-p53 are two major tumor suppressor networks involved in cell proliferation control. The nucleolar ARF protein binds to MDM2 to activate the growth suppressive functions of p53, but can also exert its tumor suppressor activity independently of p53, through mechanisms involving other regulators: in that manner, p14{sup ARF} has been shown to inhibit the transcriptional activity of E2F1 in vitro, suggesting that the two pathways intersect with one another. More recently, ARF has been shown to inhibit ribosomal RNA processing, and to specifically interact with the rRNA promoter, suggesting a role in the regulation of both maturation and transcription processes. We show here that E2F1 can bind the rRNA promoter and modulate its activity through the interaction with two E2F1-binding sequences we have identified. The regulation of ribosome biogenesis appears as a major p53-independent process, which involves both ARF and E2F1 to control cell proliferation.

  12. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  13. Domain I of 23S rRNA competes with a paused transcription complex for ribosomal protein L4 of Escherichia coli.

    PubMed Central

    Zengel, J M; Lindahl, L

    1993-01-01

    Ribosomal protein L4 of Escherichia coli regulates expression of its own eleven gene S10 operon both by inhibiting translation and by stimulating premature termination of transcription. Both regulatory processes presumably involve L4 recognition of the S10 leader RNA. To help define L4's regulatory target, we have investigated the protein's cognate target on 23S rRNA. Binding of L4 to various fragments of the 23S rRNA was monitored by determining their ability to sequester L4 in an in vitro transcription system and thereby eliminate the protein's effect on transcription. Using this approach we identified a region of about 110 bases within domain I of 23S rRNA which binds L4. A two base deletion within this region, close to the base to which L4 has been cross-linked in intact 50S subunits, eliminates L4 binding. These results also confirm the prediction of the autogenous control model, that L4 bound to its target on rRNA is not active in regulating transcription of the S10 operon. Images PMID:7685080

  14. [Differentiation of Bos grunniens, Bos Taurus, and Bubalus from meat products mixture based on mitochondrion 12S rRNA gene].

    PubMed

    Chen, Dong; Bai, Fan; Zhou, Ming-Liang; Zhang, Xiang-Yu; Wu, Deng-Jun

    2008-08-01

    Mitochondrial DNA sequence is highly conserved within species. Gene 12S rRNA is able to endure degeneration and high temperature, which allows identification of feedstuff, fresh meat, processed meat, and traceability. In the present study, three unique restriction sites were detected in the fragments of mitochondrial 12S rRNA gene regions amplified with universal primer, which were able to distinguish Bos grunniens, Bos. taurus, and Bubalus in fresh meat and processed meat mixture. The fragment of yak was digested to 134 bp and 318 bp, scalper 134 bp and 318 bp, and buffalo 86 bp and 367 bp. The specific locus and digestion were verified by sequencing analysis. There was no difference between PCR amplification products from various treatments at different temperatures (i.e., 100, 120, 140, 160, and 180). However, the sig-nal was weak at 120 and above. This method is simple, fast and cheap in identification of fresh meat and processed meat.

  15. The nuclear phenotypic plasticity observed in fish during rRNA regulation entails Cajal bodies dynamics

    SciTech Connect

    Alvarez, Marco; Nardocci, Gino; Thiry, Marc; Alvarez, Rodrigo; Reyes, Mauricio; Molina, Alfredo; Vera, M. Ines . E-mail: mvera@unab.cl

    2007-08-17

    Cajal bodies (CBs) are small mobile organelles found throughout the nucleoplasm of animal and plant cells. The dynamics of these organelles involves interactions with the nucleolus. The later has been found to play a substantial role in the compensatory response that evolved in eurythermal fish to adapt to the cyclic seasonal habitat changes, i.e., temperature and photoperiod. Contrary to being constitutive, rRNA synthesis is dramatically regulated between summer and winter, thus affecting ribosomal biogenesis which plays a central role in the acclimatization process. To examine whether CBs, up to now, never described in fish, were also sustaining the phenotypic plasticity observed in nuclei of fish undergoing seasonal acclimatization, we identified these organelles both, by transmission electronic microscopy and immunodetection with the marker protein p80-coilin. We found transcripts in all tissues analyzed. Furthermore we assessed that p80-coilin gene expression was always higher in summer-acclimatized fish when compared to that adapted to the cold season, indicating that p80-coilin expression is modulated upon seasonal acclimatization. Concurrently, CBs were more frequently found in summer-acclimatized carp which suggests that the organization of CBs is involved in adaptive processes and contribute to the phenotypic plasticity of fish cell nuclei observed concomitantly with profound reprogramming of nucleolar components and regulation of ribosomal rRNAs.

  16. Molecular detection of adulteration in chicken products based on mitochondrial 12S rRNA gene.

    PubMed

    Abuzinadah, Osama H A; Yacoub, Haitham Ahmed; El Ashmaoui, Hassan M; Ramadan, Hassan A I

    2015-06-01

    The aim of this study is to detect the fraudulent in chicken products constitutes in order to protect consumers in Saudi Arabia from illegal substitutions. Two different approaches were used in this study, direct sequencing of specific fragments of amplified mitochondrial 12S rRNA gene in addition to species-specific PCR primers for confirmation of the obtained Blast search results. The results showed that all processed chicken products were identified as chicken (Gallus gallus) by 90-98% homology depending on obtained sequence quality. Samples labeled with chicken luncheon (samples tested in this study) were identified as turkey meat (Meleagris gallopavo) by 98% homology, suggesting adulteration with inedible parts of turkey in chicken luncheon ingredients. The results showed also that not only chicken luncheon was mixed with inedible parts of turkey but also all chicken products tested in this study (chicken balls, chicken burger, chicken sausage and chicken mined meat) contained this turkey meat. Applying methods used in this study could be useful for accurate and rapid identification of commercial processed meat.

  17. Reevaluation of the evolutionary position of opalinids based on 18S rDNA, and alpha- and beta-tubulin gene phylogenies.

    PubMed

    Nishi, Akane; Ishida, Ken-ichiro; Endoh, Hiroshi

    2005-06-01

    Opalinids are enigmatic endosymbiotic protists principally found in the large intestine of anuran amphibians. They are multinucleates and uniformly covered with numerous flagella (or cilia). Their appearance is somewhat similar to that of ciliates, leading to opalinid's initial classification as ciliates, or later as protociliates. However, on the basis of their monomorphic nuclei, absence of a ciliate-like life cycle characterized by conjugation, and an interkinetal fission mode, opalinids were subsequently transferred in the zooflagellates. As several common ultrastructural characteristics shared with proteromonads were elucidated, in particular of the flagellar base, such as their double-stranded flagellar helix, an alliance with proteromonads was widely accepted. Thus, opalinids are currently favored to be placed in the class Opalinea, within the heterokont kingdom Chromista. However, the question of their classification has not been fully resolved, because of a lack of molecular information. Here, we report their phylogenetic position inferred from 18S rDNA, and alpha- and beta-tubulin gene sequences. The 18S rDNA tree gives the opalinids an ancestral position in heterokonts, together with proteromonads, as suggested by the morphological studies. In great contrast, alpha- and beta-tubulin gene analyses suggest an affiliation of opalinids to alveolates, not to heterokonts. However, the AU test implies that opalinids are not closely related with any of other three phyla in the alveolates, suggesting an occupation of an ancestral position within the alveolates. Based on the present molecular information, in particular rDNA phylogeny, and the ultrastructural character of the double helix common to heterokonts, we conclude that opalinids would have a common origin with heterokonts, although analyses based on two tubulin genes do not as yet completely deny a possible placement outside heterokonts. The ambiguity of the evolutionary position shown by the discrepancy

  18. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  19. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  20. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  1. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  2. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  3. Molecular phylogenetic studies of Brassica, rorippa, arabidopsis and allied genera based on the internal transcribed spacer region of 18S-25S rDNA.

    PubMed

    Yang, Y W; Lai, K N; Tai, P Y; Ma, D P; Li, W H

    1999-12-01

    The phylogenetic relationships of nine genera in four tribes of the family Brassicaceae were estimated from the sequences of the internal transcribed spacer region (ITS) of the 18S-25S nuclear ribosomal DNA. The entire ITS region of 16 accessions belonging to 10 species of seven genera was sequenced. Eight published sequences of Brassicaceae were also used. A total of 27 sequences were included in this study; four of them were found to be pseudogenes. Both the neighbor-joining and the parsimony trees suggest that the nine genera can be divided into three groups: (1) Arabidopsis, Cardaminopsis, Capsella, and Lepidium; (2) Rorippa and Cardamine; and (3) Brassica, Sinapis, and Raphanus. In contradiction to the proposal that Cardaminopsis and Arabidopsis be put into an expanded tribe Arabideae, our data show that these two genera are more closely related to Capsella and Lepidium (tribe Lepidieae) than to Rorippa and Cardamine (tribe Arabideae). Further, our data show that within the tribe Brassiceae, Raphanus is more closely related to B. nigra than to the B. oleracea/B. rapa clade. This result is in agreement with the nuclear data obtained in several studies, but is in conflict with the RFLP data of mitochondrial and chloroplast DNA. As pointed out by previous authors, it is possible that Raphanus is a hybrid between the B. nigra and B. oleracea/B. rapa lineages with the latter as the maternal parent.

  4. Use of the polymerase chain reaction assay for the detection of Babesia odocoilei 18S ribosomal RNA in formalin-fixed tissues.

    PubMed

    Lockerbie, Betty P; Bollinger, Trent K; Burgess, Hilary J

    2014-06-10

    The effect of fixation and storage conditions on the performance of polymerase chain reaction (PCR) assays for Babesia odocoilei were examined using 3 different primer sets targeting the eukaryotic 18S ribosomal RNA gene, with variably sized products of 1,723 base pairs (bp), 483 bp, and 306 bp. All primer sets performed well on fresh-frozen tissue, and storage for 1 year at -20°C did not affect PCR performance. Formalin fixation markedly affected the amplicon length that could be amplified. However, DNA was successfully amplified after storage in formalin for 2 months using the primer set with a 483-bp product, and up to 6 months using the primer set with a 306-bp product. The latter primer set successfully differentiated B. odocoilei and Babesia microti DNA; however, further evaluation is required to confirm its specificity. Treatment of tissues with formic acid, at concentrations typically used to denature prions, degraded the DNA and made it unsuitable for PCR testing.

  5. Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.

    PubMed

    Simon-Blecher, N; Huchon, D; Achituv, Y

    2007-09-01

    The traditional phylogeny of the coral-inhabiting barnacles, the Pyrgomatidae, is based on morphological characteristics, mainly of the hard parts. It has been difficult to establish the phylogenetic relationships among Pyrgomatidae because of the apparent convergence of morphological characteristics, and due to the use of non-cladistic systematics, which emphasize ancestor-descendant relationships rather than sister-clade relationships. We used partial sequences of two mithochondrial genes, 12S rDNA and 16S rDNA, and a nuclear gene, 18S rDNA, to infer the molecular phylogeny of the pyrgomatids. Our phylogenetic results allowed us to reject previous classifications of Pyrgomatidae based on morphological characteristics. Our results also suggested the possibility of paraphyly of the Pyrgomatidae. The hydrocoral barnacle Wanella is not found on the same clade as the other pyrgomatids, but rather, with the free-living balanids. The basal position of Megatrema and Ceratoconcha is supported. The archeaobalanid Armatobalanus is grouped with Cantellius at the base of the Indo-Pacific pyrgomatines. Fusion of the shell plate and modification of the opercular valves are homoplasious features that occurred more than three times on different clades. The monophyly of the "Savignium" group, comprising four nominal genera, is also not supported, and the different taxa are placed on different clades.

  6. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    PubMed

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected.

  7. This unique view, looking directly up at two NASA Dryden F/A-18's used in the Autonomous Formation F

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Smoke generators show the twisting paths of wingtip vortices behind two NASA Dryden F/A-18's used in the Autonomous Formation Flight (AFF) program during flight #743. The lead aircraft, F-18 #845 (NASA Dryden's Systems Research Aircraft), piloted by Craig Bomben, is followed closely by another F-18, #847, piloted by Dick Ewers. A vortex is a spiraling current of air emanating from aircraft wingtips as they fly. By mapping the vortex pattern and using sophisticated software to put the trailing aircraft in the optimum location, the energy of the vortex could result in fuel savings for the follower aircraft of 15 percent or more. Autonomous Formation Flight (AFF) is intended to allow an aircraft to fly in close formation over long distances using advanced positioning and controls technology. It utilizes Global Positioning System satellites and inertial navigation systems to position two or more aircraft in formation, with an accuracy of a few inches. This capability is expected to yield fuel efficiency improvements.

  8. The 18S rDNA sequence of Synchytrium endobioticum and its utility in microarrays for the simultaneous detection of fungal and viral pathogens of potato.

    PubMed

    Abdullahi, Ismail; Koerbler, Marianne; Stachewicz, Hans; Winter, Stephan

    2005-08-01

    Resting spores extracted from wart (Synchytrium endobioticum)-infected potato tubers were used for DNA extraction and amplification of 18S rDNA. Analysis of the cloned, sequenced fragment revealed high similarity to members of the Chytridiomycota. Using this information, specific oligonucleotide probes were designed and arrayed onto glass slides for detection of the pathogen. Viral sequence information available in the databank was retrieved, or new viral sequences were generated, and used to design probes for specific detection of important quarantine viruses of potato. To determine the sensitivity and specificity of the oligonucleotide probes, total RNA from infected plants was reverse transcribed, labelled with Cyanine 5, and hybridised with the microarray. A significant number of the oligonucleotide probes exhibited high specificity to S. endobioticum, Andean potato latent virus, Andean potato mottle virus, Potato black ringspot virus, and Potato spindle tuber viroid. Hybridisation signals of sub-arrays within slides were reproducible (r = 0.79) with a high correlation coefficient of hybridisation repetitions (0.73). Our results demonstrate the potential of microarray-based hybridisation for identification of multiple pathogen targets, which will find application in quarantine laboratories, where parallel testing for diverse pathogens is essential. PMID:15800764

  9. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.

    PubMed

    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M

    2004-09-01

    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  10. The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of Pre-rRNA processing factors.

    PubMed

    Tafforeau, Lionel; Zorbas, Christiane; Langhendries, Jean-Louis; Mullineux, Sahra-Taylor; Stamatopoulou, Vassiliki; Mullier, Romain; Wacheul, Ludivine; Lafontaine, Denis L J

    2013-08-22

    Mature ribosomal RNAs (rRNAs) are produced from polycistronic precursors following complex processing. Precursor (pre)-rRNA processing has been extensively characterized in yeast and was assumed to be conserved in humans. We functionally characterized 625 nucleolar proteins in HeLa cells and identified 286 required for processing, including 74 without a yeast homolog. For selected candidates, we demonstrated that pre-rRNA processing defects are conserved in different cell types (including primary cells), defects are not due to activation of a p53-dependent nucleolar tumor surveillance pathway, and they precede cell-cycle arrest and apoptosis. We also investigated the exosome's role in processing internal transcribed spacers (ITSs) and report that 3' end maturation of 18S rRNA involves EXOSC10/Rrp6, a yeast ITS2 processing factor. We conclude that human cells adopt unique strategies and recruit distinct trans-acting factors to carry out essential processing steps, posing fundamental implications for understanding ribosomopathies at the molecular level and developing effective therapeutic agents. PMID:23973377

  11. Localization of rRNA genes in the nuclear space of Calliphora erythrocephala Mg. nurse cells during polytenization.

    PubMed

    Kokhanenko, Alina; Anan'ina, Tatyana; Stegniy, Vladimir

    2014-01-01

    Multicolor 3D fluorescence in situ hybridization was used to study arrangement of rRNA genes in Calliphora erythrocephala nurse cell nuclei with different levels of polyteny. It has been shown that the rRNA genes are exclusively localized to chromosome 6, suggesting that chromosome 6 is the only C. erythrocephala chromosome responsible for nucleolar formation. We have also described changes in localization of ribosomal genes within the chromosome territory during polytenization, namely, that rDNA signals are detected in the peripheral region of chromosome territory starting from the stage of polytene chromosomes. In addition, it has emerged that large nucleolus associated with chromosome 6 starts to develop in the central nuclear region in the C. erythrocephala nurse cell nuclei at the stage of a primary reticular structure. The central position and nucleolar structure are retained at the stages when chromosome 6 occupies the central position, that is, at the stages of polytene and bloblike chromosomes. When the nucleus restores a reticular structure but at a higher polyteny level, the displacement of chromosome 6 to the nuclear periphery is accompanied by disruption of the large nucleolus into micronucleoli. The micronucleoli are distributed in the nuclear space retaining their association with the nucleolar-organizing regions of chromosome 6. Thus, our data suggest that the large-scale alterations in the organization of chromosome 6 and the nucleolus during polytenization are the correlated processes directly dependent on the rRNA gene activity. The earlier described dynamics of nucleolar-organizing chromosome territory and nucleolus in the nuclear space is likely to be associated with the change in the total expression activity of the nucleus, which complies with the hypothesis on the correlation between spatial nuclear organization and expression regulation of genetic material.

  12. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.

    PubMed

    Wei, Ze-Gang; Zhang, Shao-Wu

    2015-07-01

    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users.

  13. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.

    PubMed

    Wei, Ze-Gang; Zhang, Shao-Wu

    2015-07-01

    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users. PMID:25912934

  14. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  15. Pyrosequencing of mcrA and archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen communities in anaerobic digesters.

    PubMed

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng; Lee, Patrick K H

    2015-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield.

  16. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing.

    PubMed

    Díez, B; Pedrós-Alió, C; Massana, R

    2001-07-01

    Very small eukaryotic organisms (picoeukaryotes) are fundamental components of marine planktonic systems, often accounting for a significant fraction of the biomass and activity in a system. Their identity, however, has remained elusive, since the small cells lack morphological features for identification. We determined the diversity of marine picoeukaryotes by sequencing cloned 18S rRNA genes in five genetic libraries from North Atlantic, Southern Ocean, and Mediterranean Sea surface waters. Picoplankton were obtained by filter size fractionation, a step that excluded most large eukaryotes and recovered most picoeukaryotes. Genetic libraries of eukaryotic ribosomal DNA were screened by restriction fragment length polymorphism analysis, and at least one clone of each operational taxonomic unit (OTU) was partially sequenced. In general, the phylogenetic diversity in each library was rather great, and each library included many different OTUs and members of very distantly related phylogenetic groups. Of 225 eukaryotic clones, 126 were affiliated with algal classes, especially the Prasinophyceae, the Prymnesiophyceae, the Bacillariophyceae, and the Dinophyceae. A minor fraction (27 clones) was affiliated with clearly heterotrophic organisms, such as ciliates, the chrysomonad Paraphysomonas, cercomonads, and fungi. There were two relatively abundant novel lineages, novel stramenopiles (53 clones) and novel alveolates (19 clones). These lineages are very different from any organism that has been isolated, suggesting that there are previously unknown picoeukaryotes. Prasinophytes and novel stramenopile clones were very abundant in all of the libraries analyzed. These findings underscore the importance of attempts to grow the small eukaryotic plankton in pure culture.

  17. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  18. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    PubMed

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  19. Pol I Transcription and Pre-rRNA Processing Are Coordinated in a Transcription-dependent Manner in Mammalian Cells

    PubMed Central

    Kopp, K.; Gasiorowski, J. Z.; Chen, D.; Gilmore, R.; Norton, J. T.; Wang, C.; Leary, D. J.; Chan, E.K.L.; Dean, D. A.

    2007-01-01

    Pre-rRNA synthesis and processing are key steps in ribosome biogenesis. Although recent evidence in yeast suggests that these two processes are coupled, the nature of their association is unclear. In this report, we analyze the coordination between rDNA transcription and pre-rRNA processing in mammalian cells. We found that pol I transcription factor UBF interacts with pre-rRNA processing factors as analyzed by immunoprecipitations, and the association depends on active rRNA synthesis. In addition, injections of plasmids containing the human rDNA promoter and varying lengths of 18S rDNA into HeLa nuclei show that pol I transcription machinery can be recruited to rDNA promoters regardless of the product that is transcribed, whereas subgroups of pre-rRNA processing factors are recruited to plasmids only when specific pre-rRNA fragments are produced. Our observations suggest a model for sequential recruitment of pol I transcription factors and pre-rRNA processing factors to elongating pre-rRNA on an as-needed basis rather than corecruitment to sites of active transcription. PMID:17108330

  20. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  1. rRNA suppressor of a eukaryotic translation initiation factor 5B/initiation factor 2 mutant reveals a binding site for translational GTPases on the small ribosomal subunit.

    PubMed

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G; Maher, Kathryn N; Lorsch, Jon R; Dever, Thomas E

    2009-02-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit.

  2. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  3. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  4. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  5. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  6. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  7. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  8. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  9. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.

    PubMed

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5'-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  10. The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression

    PubMed Central

    Pan, Wen-An; Tsai, Hsin-Yue; Wang, Shun-Chang; Hsiao, Michael; Wu, Pei-Yu; Tsai, Ming-Daw

    2015-01-01

    Ribosome biogenesis governs protein synthesis. NIFK is transactivated by c-Myc, the key regulator of ribosome biogenesis. The biological function of human NIFK is not well established, except that it has been shown to interact with Ki67 and NPM1. Here we report that NIFK is required for cell cycle progression and participates in the ribosome biogenesis via its RNA recognition motif (RRM). We show that silencing of NIFK inhibits cell proliferation through a reversible p53-dependent G1 arrest, possibly by induction of the RPL5/RPL11-mediated nucleolar stress. Mechanistically it is the consequence of impaired maturation of 28S and 5.8S rRNA resulting from inefficient cleavage of internal transcribed spacer (ITS) 1, a critical step in the separation of pre-ribosome to small and large subunits. Complementation of NIFK silencing by mutants shows that RNA-binding ability of RRM is essential for the pre-rRNA processing and G1 progression. More specifically, we validate that the RRM of NIFK preferentially binds to the 5′-region of ITS2 rRNA likely in both sequence specific and secondary structure dependent manners. Our results show how NIFK is involved in cell cycle progression through RRM-dependent pre-rRNA maturation, which could enhance our understanding of the function of NIFK in cell proliferation, and potentially also cancer and ribosomopathies. PMID:25826659

  11. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  12. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  13. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  14. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  15. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  16. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  17. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    PubMed

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  18. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  19. Phylogenetic analyses among octocorals (Cnidaria): mitochondrial and nuclear DNA sequences (lsu-rRNA, 16S and ssu-rRNA, 18S) support two convergent clades of branching gorgonians.

    PubMed

    Armando Sánchez, Juan; Lasker, Howard R; Taylor, Derek J

    2003-10-01

    Gorgonian octocorals lack corroborated hypotheses of phylogeny. This study reconstructs genealogical relationships among some octocoral species based on published DNA sequences from the large ribosomal subunit of the mitochondrial RNA (lsu-rRNA, 16S: 524bp and 21 species) and the small subunit of the nuclear RNA (ssu-rRNA, 18S: 1815bp and 13 spp) using information from insertions-deletions (INDELS) and the predicted secondary structure of the lsu-rRNA (16S). There were seven short (3-10bp) INDELS in the 18S with consistent phylogenetic information. The INDELS in the 16S corresponded to informative signature sequences homologous to the G13 helix found in Escherichia coli. We found two main groups of gorgonian octocorals using a maximum parsimony analysis of the two genes. One group corresponds to deep-water taxa including species from the suborders Calcaxonia and Scleraxonia characterized by an enlargement of the G13 helix. The second group has species from Alcyoniina, Holaxonia and again Scleraxonia characterized by insertions in the 18S. Gorgonian corals, branching colonies with a gorgonin-containing flexible multilayered axis (Holaxonia and Calcaxonia), do not form a monophyletic group. These corroborated results from maternally inherited (16S) and biparentally inherited (18S) genes support a hypothesis of independent evolution of branching in the two octocoral clades.

  20. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  1. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  2. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  3. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  4. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  5. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  6. Emerging concepts on microbial processes in the bathypelagic ocean - ecology, biogeochemistry, and genomics

    NASA Astrophysics Data System (ADS)

    Nagata, Toshi; Tamburini, Christian; Arístegui, Javier; Baltar, Federico; Bochdansky, Alexander B.; Fonda-Umani, Serena; Fukuda, Hideki; Gogou, Alexandra; Hansell, Dennis A.; Hansman, Roberta L.; Herndl, Gerhard J.; Panagiotopoulos, Christos; Reinthaler, Thomas; Sohrin, Rumi; Verdugo, Pedro; Yamada, Namiha; Yamashita, Youhei; Yokokawa, Taichi; Bartlett, Douglas H.

    2010-08-01

    This paper synthesizes recent findings regarding microbial distributions and processes in the bathypelagic ocean (depth >1000 m). Abundance, production and respiration of prokaryotes reflect supplies of particulate and dissolved organic matter to the bathypelagic zone. Better resolution of carbon fluxes mediated by deep microbes requires further testing on the validity of conversion factors. Archaea, especially marine Crenarchaeota Group I, are abundant in deep waters where they can fix dissolved inorganic ca