Sample records for 18s rrna sequences

  1. Phylogeny of protostome worms derived from 18S rRNA sequences.


    Winnepenninckx, B; Backeljau, T; De Wachter, R


    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  2. Novel Acanthamoeba 18S rRNA gene sequence type from an environmental isolate.


    Magnet, A; Henriques-Gil, N; Galván-Diaz, A L; Izquiedo, F; Fenoy, S; del Aguila, C


    The free-living amoebae, Acanthamoeba, can act as opportunistic parasites on a wide range of vertebrates and are becoming a serious threat to human health due to the resistance of their cysts to harsh environmental conditions, disinfectants, some water treatment practices, and their ubiquitous distribution. Subgenus classification based on morphology is being replaced by a classification based on the sequences of the 18S rRNA gene with a total of 18 different genotypes (T1-T18). A new environmental strain of Acanthamoeba isolated from a waste water treatment plant is presented in this study as a candidate for the description of the novel genotype T19 after phylogenetic analysis.

  3. Origin of the Mesozoa inferred from 18S rRNA gene sequences.


    Pawlowski, J; Montoya-Burgos, J I; Fahrni, J F; Wüest, J; Zaninetti, L


    The phylum Mesozoa comprises small, simply organized wormlike parasites of marine invertebrates and is composed of two classes, the Rhombozoa and the Orthonectida. The origin of Mesozoa is uncertain; they are classically considered either as degenerate turbellarians or as primitive multicellular animals related to ciliated protists. In order to precisely determine the phylogenetic position of this group we sequenced the complete 18S rRNA gene of one rhombozoid, Dicyema sp., and one orthonectid, Rhopalura ophiocomae. The sequence analysis shows that the Mesozoa branch early in the animal evolution, closely to nematodes and myxozoans. Our data indicate probably separate origins of rhombozoids and orthonectids, suggesting that their placement in the same phylum needs to be revised.

  4. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.


    Yu, Y T; Nilsen, T W


    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  5. Metagenomic data of fungal internal transcribed Spacer and 18S rRNA gene sequences from Lonar lake sediment, India.


    Dudhagara, Pravin; Ghelani, Anjana; Bhavsar, Sunil; Bhatt, Shreyas


    The data in this article contains the sequences of fungal Internal Transcribed Spacer (ITS) and 18S rRNA gene from a metagenome of Lonar soda lake, India. Sequences were amplified using fungal specific primers, which amplified the amplicon lined between the 18S and 28S rRNA genes. Data were obtained using Fungal tag-encoded FLX amplicon pyrosequencing (fTEFAP) technique and used to analyze fungal profile by the culture-independent method. Primary analysis using PlutoF 454 pipeline suggests the Lonar lake mycobiome contained the 29 different fungal species. The raw sequencing data used to perform this analysis along with FASTQ file are located in the NCBI Sequence Read Archive (SRA) under accession No. SRX889598 (

  6. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).


    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B


    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  7. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).


    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B


    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data.

  8. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.


    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  9. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.


    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina


    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis.

  10. Molecular epidemiology of Theileria annulata and identification of 18S rRNA gene and ITS regions sequences variants in apparently healthy buffaloes and cattle in Pakistan.


    Khan, Muhammad Kasib; He, Lan; Hussain, Altaf; Azam, Sabita; Zhang, Wen-Jie; Wang, Li-Xia; Zhang, Qing-Li; Hu, Min; Zhou, Yan-Qin; Zhao, Junlong


    A molecular epidemiological survey was conducted to determine the prevalence of piroplasms in buffaloes and cattle from Sheikhupura and Okara districts of Punjab, Pakistan using reverse line blot (RLB) hybridization assay. The genetic diversity within 18S rRNA gene and ITS regions sequences of various obtained Theileria species (spp.) was also investigated. Briefly, 102 blood samples from buffaloes and cattle in the study districts were collected on blood collection cards and brought to the laboratory. DNA was extracted; the V4 hypervariable region of 18S rRNA was amplified and analyzed using RLB. Out of total samples analyzed, 61 (59.8%) were hybridized with Babesia/Theileria (B/T) genus-specific probe. Only one species of piroplasm was detected in buffaloes and cattle in study districts, i.e. Theileria (T.) annulata. Six samples only hybridized with B/T genus-specific and Theileria genus-specific probes but not with any species-specific probe indicating the presence of novel species or variants. The sequences of 18S rRNA gene and ITS regions of these six samples revealed the presence of T. annulata variants as confirmed through sequence identity estimation and phylogenetic analyses. Meanwhile, an unexpected sequence variation was observed within the 18S rRNA gene and ITS regions sequences of T. annulata identified in the present study. This is the first report on the simultaneous detection of species of piroplasms infecting buffaloes and cattle in Pakistan and molecular characterization of T. annulata 18S rRNA gene and ITS regions. The present study may address the new insights into the epidemiology of theileriosis which will help researches in designing control strategies and developing various molecular diagnostic tools at national level.

  11. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.


    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan


    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff.

  12. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.


    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan


    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. PMID:23205499

  13. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.


    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  14. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.


    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C


    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  15. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).


    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C


    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  16. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.


    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser


    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships.

  17. Phylogenetic relationships among Linguatula serrata isolates from Iran based on 18S rRNA and mitochondrial cox1 gene sequences.


    Ghorashi, Seyed Ali; Tavassoli, Mousa; Peters, Andrew; Shamsi, Shokoofeh; Hajipour, Naser


    The phylogenetic relationships among seven Linguatula serrata (L. serrata) isolates collected from cattle, goats, sheep, dogs and camels in different geographical locations of Iran were investigated using partial 18S ribosomal RNA (rRNA) and partial mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequences. The nucleotide sequences were analysed in order to determine the phylogenetic relationships between the isolates. Higher sequence diversity and intraspecies variation was observed in the cox1 gene compared to 18S rRNA sequences. Phylogenetic analysis of the cox1 gene placed all L. serrata isolates in a sister clade to L. arctica. The Mantel regression analysis revealed no association between genetic variations and host species or geographical location, perhaps due to the small sample size. However, genetic variations between L. serrata isolates in Iran and those isolated in other parts of the world may exist and could reveal possible evolutionary relationships. PMID:27149706

  18. Identification of protein-coding sequences using the hybridization of 18S rRNA and mRNA during translation.


    Xing, Chuanhua; Bitzer, Donald L; Alexander, Winser E; Vouk, Mladen A; Stomp, Anne-Marie


    We introduce a new approach in this article to distinguish protein-coding sequences from non-coding sequences utilizing a period-3, free energy signal that arises from the interactions of the 3'-terminal nucleotides of the 18S rRNA with mRNA. We extracted the special features of the amplitude and the phase of the period-3 signal in protein-coding regions, which is not found in non-coding regions, and used them to distinguish protein-coding sequences from non-coding sequences. We tested on all the experimental genes from Saccharomyces cerevisiae and Schizosaccharomyces pombe. The identification was consistent with the corresponding information from GenBank, and produced better performance compared to existing methods that use a period-3 signal. The primary tests on some fly, mouse and human genes suggests that our method is applicable to higher eukaryotic genes. The tests on pseudogenes indicated that most pseudogenes have no period-3 signal. Some exploration of the 3'-tail of 18S rRNA and pattern analysis of protein-coding sequences supported further our assumption that the 3'-tail of 18S rRNA has a role of synchronization throughout translation elongation process. This, in turn, can be utilized for the identification of protein-coding sequences.

  19. Identification of Theileria parva and Theileria sp. (buffalo) 18S rRNA gene sequence variants in the African Buffalo (Syncerus caffer) in southern Africa.


    Chaisi, Mamohale E; Sibeko, Kgomotso P; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C


    Theileria parva is the causative agent of Corridor disease in cattle in South Africa. The African buffalo (Syncerus caffer) is the reservoir host, and, as these animals are important for eco-tourism in South Africa, it is compulsory to test and certify them disease free prior to translocation. A T. parva-specific real-time polymerase chain reaction (PCR) test based on the small subunit ribosomal RNA (18S rRNA) gene is one of the tests used for the diagnosis of the parasite in buffalo and cattle in South Africa. However, because of the high similarity between the 18S rRNA gene sequences of T. parva and Theileria sp. (buffalo), the latter is also amplified by the real-time PCR primers, although it is not detected by the T. parva-specific hybridization probes. Preliminary sequencing studies have revealed a small number of sequence differences within the 18S rRNA gene in both species but the extent of this sequence variation is unknown. The aim of the current study was to sequence the 18S rRNA genes of T. parva and Theileria sp. (buffalo), and to determine whether all identified genotypes can be correctly detected by the real-time PCR assay. The reverse line blot (RLB) hybridization assay was used to identify T. parva and Theileria sp. (buffalo) positive samples from buffalo blood samples originating from the Kruger National Park, Hluhluwe-iMfolozi Park, the Greater Limpopo Transfrontier Park, and a private game ranch in the Hoedspruit area. T. parva and Theileria sp. (buffalo) were identified in 42% and 28%, respectively, of 252 samples, mainly as mixed infections. The full-length 18S rRNA gene of selected samples was amplified, cloned and sequenced. From a total of 20 sequences obtained, 10 grouped with previously published T. parva sequences from GenBank while 10 sequences grouped with a previously published Theileria sp. (buffalo) sequence. All these formed a monophyletic group with known pathogenic Theileria species. Our phylogenetic analyses confirm the

  20. Evaluation of nucleic acid sequence based amplification using fluorescence resonance energy transfer (FRET-NASBA) in quantitative detection of Aspergillus 18S rRNA.


    Park, Chulmin; Kwon, Eun-Young; Shin, Na-Young; Choi, Su-Mi; Kim, Si-Hyun; Park, Sun Hee; Lee, Dong-Gun; Choi, Jung-Hyun; Yoo, Jin-Hong


    We attempted to apply fluorescence resonance energy transfer technology to nucleic acid sequence-based amplification (FRET-NASBA) on the platform of the LightCycler system to detect Aspergillus species. Primers and probes for the Aspergillus 18S rRNA were newly designed to avoid overlapping with homologous sequences of human 18s rRNA. NASBA using molecular beacon (MB) showed non-specific results which have been frequently observed from controls, although it showed higher sensitivity (10(-2) amol) than the FRET. FRET-NASBA showed a sensitivity of 10(-1) amol and a high fidelity of reproducibility from controls. As FRET technology was successfully applied to the NASBA assay, it could contribute to diverse development of the NASBA assay. These results suggest that FRET-NASBA could replace previous NASBA techniques in the detection of Aspergillus.

  1. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.


    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi


    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area.

  2. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.


    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos


    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  3. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.


    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M


    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are

  4. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.


    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan


    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations.

  5. Fluorescent Oligonucleotide Probes for Clinical and Environmental Detection of Acanthamoeba and the T4 18S rRNA Gene Sequence Type

    PubMed Central

    Stothard, Diane R.; Hay, John; Schroeder-Diedrich, Jill M.; Seal, David V.; Byers, Thomas J.


    The first genus- and subgenus-specific fluorescent oligonucleotide probes for in situ staining of Acanthamoeba are described. Sequences of these phylogeny-based probes complement the 18S rRNA and the gene encoding it (18S rDNA). The genus-specific probe (GSP) is a fluorescein-labeled 22-mer specific for Acanthamoeba as shown here by its hybridization to growing trophozoites of all 12 known Acanthamoeba 18S rDNA sequence types and by its failure to hybridize with amoebae of two other genera (Hartmannella vermiformis and Balamuthia mandrillaris), two human cell lines, and two bacteria (Pseudomonas aeruginosa and Escherichia coli). The sequence type T4-specific probe (ST4P) is a rhodamine-labeled 30-mer specific for Acanthamoeba 18S rDNA sequence type T4, as shown here in hybridization tests with trophozoites of all 12 sequence types. T4 is the subgenus group associated most closely with Acanthamoeba keratitis (AK). GSP also was tested with corneal scrapings from 17 patients with a high index of clinical suspicion of AK plus 5 patient controls. GSP stained both trophozoites and cysts, although nonspecific cyst wall autofluorescence also was observed. Results could be obtained with GSP in 1 to 2 days, and based on results from cell culture tests, the probe correctly detected the presence or absence of Acanthamoeba in 21 of 24 specimens from the 22 patients. The use of GSP with cultured trophozoites and cysts from corneal scrapings has illustrated the suitability of using fluorescent oligonucleotide probes for identification of the genus Acanthamoeba in both environmental and clinical samples. In addition, the use of ST4P with cultured amoebae has indicated the potential of oligonucleotide probes for use in subgenus classification. PMID:10405422

  6. Molecular phylogenetic analysis of the coccidian cephalopod parasites Aggregata octopiana and Aggregata eberthi (Apicomplexa: Aggregatidae) from the NE Atlantic coast using 18S rRNA sequences.


    Castellanos-Martínez, Sheila; Pérez-Losada, Marcos; Gestal, Camino


    The coccidia genus Aggregata is responsible for intestinal coccidiosis in wild and cultivated cephalopods. Two coccidia species, Aggregata octopiana, (infecting the common octopus Octopus vulgaris), and A. eberthi, (infecting the cuttlefish Sepia officinalis), are identified in European waters. Extensive investigation of their morphology resulted in a redescription of A. octopiana in octopuses from the NE Atlantic Coast (NW Spain) thus clarifying confusing descriptions recorded in the past. The present study sequenced the 18S rRNA gene in A. octopiana and A. eberthi from the NE Atlantic coast in order to assess their taxonomic and phylogenetic status. Phylogenetic analyses revealed conspecific genetic differences (2.5%) in 18S rRNA sequences between A. eberthi from the Ria of Vigo (NW Spain) and the Adriatic Sea. Larger congeneric differences (15.9%) were observed between A. octopiana samples from the same two areas, which suggest the existence of two species. Based on previous morphological evidence, host specificity data, and new molecular phylogenetic analyses, we suggest that A. octopiana from the Ria of Vigo is the valid type species.

  7. Fast evolving 18S rRNA sequences from Solenogastres (Mollusca) resist standard PCR amplification and give new insights into mollusk substitution rate heterogeneity

    PubMed Central


    Background The 18S rRNA gene is one of the most important molecular markers, used in diverse applications such as molecular phylogenetic analyses and biodiversity screening. The Mollusca is the second largest phylum within the animal kingdom and mollusks show an outstanding high diversity in body plans and ecological adaptations. Although an enormous amount of 18S data is available for higher mollusks, data on some early branching lineages are still limited. Despite of some partial success in obtaining these data from Solenogastres, by some regarded to be the most "basal" mollusks, this taxon still remained problematic due to contamination with food organisms and general amplification difficulties. Results We report here the first authentic 18S genes of three Solenogastres species (Mollusca), each possessing a unique sequence composition with regions conspicuously rich in guanine and cytosine. For these GC-rich regions we calculated strong secondary structures. The observed high intra-molecular forces hamper standard amplification and appear to increase formation of chimerical sequences caused by contaminating foreign DNAs from potential prey organisms. In our analyses, contamination was avoided by using RNA as a template. Indication for contamination of previously published Solenogastres sequences is presented. Detailed phylogenetic analyses were conducted using RNA specific models that account for compensatory substitutions in stem regions. Conclusions The extreme morphological diversity of mollusks is mirrored in the molecular 18S data and shows elevated substitution rates mainly in three higher taxa: true limpets (Patellogastropoda), Cephalopoda and Solenogastres. Our phylogenetic tree based on 123 species, including representatives of all mollusk classes, shows limited resolution at the class level but illustrates the pitfalls of artificial groupings formed due to shared biased sequence composition. PMID:20214780

  8. U17/snR30 is a ubiquitous snoRNA with two conserved sequence motifs essential for 18S rRNA production.


    Atzorn, Vera; Fragapane, Paola; Kiss, Tamás


    Saccharomyces cerevisiae snR30 is an essential box H/ACA small nucleolar RNA (snoRNA) required for the processing of 18S rRNA. Here, we show that the previously characterized human, reptilian, amphibian, and fish U17 snoRNAs represent the vertebrate homologues of yeast snR30. We also demonstrate that U17/snR30 is present in the fission yeast Schizosaccharomyces pombe and the unicellular ciliated protozoan Tetrahymena thermophila. Evolutionary comparison revealed that the 3'-terminal hairpins of U17/snR30 snoRNAs contain two highly conserved sequence motifs, the m1 (AUAUUCCUA) and m2 (AAACCAU) elements. Mutation analysis of yeast snR30 demonstrated that the m1 and m2 elements are essential for early cleavages of the 35S pre-rRNA and, consequently, for the production of mature 18S rRNA. The m1 and m2 motifs occupy the opposite strands of an internal loop structure, and they are located invariantly 7 nucleotides upstream from the ACA box of U17/snR30 snoRNAs. U17/snR30 is the first identified box H/ACA snoRNA that possesses an evolutionarily conserved role in the nucleolytic processing of eukaryotic pre-rRNA.

  9. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.


    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric


    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  10. Intracellular Diversity of the V4 and V9 Regions of the 18S rRNA in Marine Protists (Radiolarians) Assessed by High-Throughput Sequencing

    PubMed Central

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric


    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment. PMID:25090095

  11. Genus Tetrastemma Ehrenberg, 1831 (Phylum Nemertea)--a natural group? Phylogenetic relationships inferred from partial 18S rRNA sequences.


    Strand, Malin; Sundberg, Per


    We investigated the monophyletic status of the hoplonemertean taxon Tetrastemma by reconstructing the phylogeny for 22 specimens assigned to this genus, together with another 25 specimens from closely related hoplonemertean genera. The phylogeny was based on partial 18S rRNA sequences using Bayesian and maximum likelihood analyses. The included Tetrastemma-species formed a well-supported clade, although the within-taxon relationships were unsettled. We conclude that the name Tetrastemma refers to a monophyletic taxon, but that it cannot be defined by morphological synapomorphies, and our results do not imply that all the over 100 species assigned to this genus belong to it. The results furthermore indicate that the genera Amphiporus and Emplectonema are non-monophyletic.

  12. Investigating microbial eukaryotic diversity from a global census: insights from a comparison of pyrotag and full-length sequences of 18S rRNA genes.


    Lie, Alle A Y; Liu, Zhenfeng; Hu, Sarah K; Jones, Adriane C; Kim, Diane Y; Countway, Peter D; Amaral-Zettler, Linda A; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Gast, Rebecca J; Caron, David A


    Next-generation DNA sequencing (NGS) approaches are rapidly surpassing Sanger sequencing for characterizing the diversity of natural microbial communities. Despite this rapid transition, few comparisons exist between Sanger sequences and the generally much shorter reads of NGS. Operational taxonomic units (OTUs) derived from full-length (Sanger sequencing) and pyrotag (454 sequencing of the V9 hypervariable region) sequences of 18S rRNA genes from 10 global samples were analyzed in order to compare the resulting protistan community structures and species richness. Pyrotag OTUs called at 98% sequence similarity yielded numbers of OTUs that were similar overall to those for full-length sequences when the latter were called at 97% similarity. Singleton OTUs strongly influenced estimates of species richness but not the higher-level taxonomic composition of the community. The pyrotag and full-length sequence data sets had slightly different taxonomic compositions of rhizarians, stramenopiles, cryptophytes, and haptophytes, but the two data sets had similarly high compositions of alveolates. Pyrotag-based OTUs were often derived from sequences that mapped to multiple full-length OTUs at 100% similarity. Thus, pyrotags sequenced from a single hypervariable region might not be appropriate for establishing protistan species-level OTUs. However, nonmetric multidimensional scaling plots constructed with the two data sets yielded similar clusters, indicating that beta diversity analysis results were similar for the Sanger and NGS sequences. Short pyrotag sequences can provide holistic assessments of protistan communities, although care must be taken in interpreting the results. The longer reads (>500 bp) that are now becoming available through NGS should provide powerful tools for assessing the diversity of microbial eukaryotic assemblages.

  13. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.


    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  14. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.


    Ishaq, Suzanne L; Wright, André-Denis G


    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  15. Phylogenetic position of phylum Nemertini, inferred from 18S rRNA sequences: molecular data as a test of morphological character homology.


    Turbeville, J M; Field, K G; Raff, R A


    Partial 18S rRNA sequence of the nemertine Cerebratulus lacteus was obtained and compared with those of coelomate metazoans and acoelomate platyhelminths to test whether nemertines share a most recent common ancestor with the platyhelminths, as traditionally has been implied, or whether nemertines lie within a protostome coelomate clade, as suggested by more recent morphological analyses. Maximum-parsimony analysis supports the inclusion of the nemertine within a protostome-coelomate clade that falls within a more inclusive coelomate clade. Bootstrap analysis indicates strong support for a monophyletic Coelomata composed of a deuterostome and protostome-coelomate clade. Support for a monophyletic protostome Coelomata is weak. Inference by distance analysis is consistent with that of maximum parsimony. Analysis of down-weighted paired sites by maximum parsimony reveals variation in topology only within the protostome-coelomate clade. The relationships among the protostome coelomates cannot be reliably inferred from the partial sequences, suggesting that coelomate protostomes diversified rapidly. Results with evolutionary parsimony are consistent with the inclusion of the nemertine in a coelomate clade. The molecular inference corroborates recent morphological character analyses that reveal no synapomorphies of nemertines and flatworms but instead suggest that the circulatory system and rhynchocoel of nemertines are homologous to coelomic cavities of protostome coelomates, thus supporting the corresponding hypothesis that nemertines belong within a protostome-coelomate clade. The sequence data provide an independent test of morphological character homology.

  16. Identification of Sarcocystis hominis-like (Protozoa: Sarcocystidae) cyst in water buffalo (Bubalus bubalis) based on 18S rRNA gene sequences.


    Yang, Z Q; Zuo, Y X; Ding, B; Chen, X W; Luo, J; Zhang, Y P


    DNA templates were extracted from isolates of Sarcocystis hominis-like cysts collected from cattle and water buffalo, as well as from Sarcocystis fusiformis cysts and Sarcocystis suihominis cysts. The 18S rRNA genes were amplified using DNA from a single cyst as the templates. Approximately 1,367-1,440 bp sequences were obtained. The sequence difference in isolates of Sarcocystis hominis-like cysts from water buffaloes, and isolates of S. hominis cysts from cattle were very low, only about 0.1%, much lower than the lowest value (1.7%) among different species. Combined with their morphological structure, these sequence data indicate that the 4 isolates from cattle and water buffalo might be the same species, i.e., S. hominis, suggesting that both cattle and water buffalo may serve as the intermediate hosts for this parasite. Apparently, this is the first report using a single cyst to do such work and is a useful way to distinguish the Sarcocystis cyst in an intermediate host that may be simultaneously infected by several different Sarcocystis species.

  17. Comparison of eukaryotic phytobenthic community composition in a polluted river by partial 18S rRNA gene cloning and sequencing.


    Dorigo, U; Bérard, A; Humbert, J F


    We compared the species composition in phytobenthic communities at different sampling sites in a small French river presenting polluted and unpolluted areas. For each sampling point, the total DNA was extracted and used to construct an 18S rRNA gene clone library after PCR amplification of a ca 400 bp fragment. Phytobenthic community composition was estimated by random sequencing of several clones per library. Most of the sequences corresponded to the Bacillariophyceae and Chlorophyceae groups. By combining phylogenetic and correspondence analyses, we showed that our molecular approach is able to estimate and compare the species composition at different sampling sites in order to assess the environmental impact of xenobiotics on phytobenthic communities. Changes in species composition of these communities were found, but no evident decrease in the diversity. We discuss the significance of these changes with regard to the existing level of pollution and their impact on the functionality of the ecosystem. Our findings suggest that it is now possible to use faster molecular methods (DGGE, ARISA.) to test large numbers of samples in the context of ecotoxicological studies, and thus to assess the impact of pollution in an aquatic ecosystem.

  18. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).


    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi


    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  19. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.


    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A


    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene.

  20. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.


    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A


    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. PMID:27084674

  1. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.


    Triadó-Margarit, Xavier; Casamayor, Emilio O


    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. PMID:26224512

  2. Phylogenetic analysis based on 18S rRNA gene sequences of Schellackia parasites (Apicomplexa: Lankesterellidae) reveals their close relationship to the genus Eimeria.


    Megía-Palma, R; Martínez, J; Merino, S


    In the present study we detected Schellackia haemoparasites infecting the blood cells of Lacerta schreiberi and Podarcis hispanica, two species of lacertid lizards from central Spain. The parasite morphometry, the presence of a refractile body, the type of infected blood cells, the kind of host species, and the lack of oocysts in the fecal samples clearly indicated these blood parasites belong to the genus Schellackia. Until now, the species of this genus have never been genetically characterized and its taxonomic position under the Lankesterellidae family is based on the lack of the exogenous oocyst stage. However, the phylogenetic analysis performed on the basis of the 18S rRNA gene sequence revealed that species of the genus Schellackia are clustered with Eimeria species isolated from a snake and an amphibian species but not with Lankesterella species. The phylogenetic analysis rejects that both genera share a recent common ancestor. Based on these results we suggest a revision of the taxonomic status of the family Lankesterellidae. PMID:23731491

  3. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.


    Triadó-Margarit, Xavier; Casamayor, Emilio O


    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities.

  4. Free-living protozoa in two unchlorinated drinking water supplies, identified by phylogenic analysis of 18S rRNA gene sequences.


    Valster, Rinske M; Wullings, Bart A; Bakker, Geo; Smidt, Hauke; van der Kooij, Dick


    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria, as well as pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies, using cultivation-independent molecular approaches. For this purpose, samples (<20 degrees C) of treated water, distributed water, and distribution system biofilms were collected from supply A, with a low concentration of natural organic matter (NOM) (<0.5 ppm of C), and from supply B, with a high NOM concentration (7.9 ppm of C). Eukaryotic communities were studied using terminal restriction fragment length polymorphism and clone library analyses of partial 18S rRNA gene fragments and a Hartmannella vermiformis-specific quantitative PCR (qPCR). In both supplies, highly diverse eukaryotic communities were observed, including free-living protozoa, fungi, and metazoa. Sequences of protozoa clustered with Amoebozoa (10 operational taxonomic units [OTUs]), Cercozoa (39 OTUs), Choanozoa (26 OTUs), Ciliophora (29 OTUs), Euglenozoa (13 OTUs), Myzozoa (5 OTUs), and Stramenopiles (5 OTUs). A large variety of protozoa were present in both supplies, but the estimated values for protozoan richness did not differ significantly. H. vermiformis was observed in both supplies but was not a predominant protozoan. One OTU with the highest similarity to Acanthamoeba polyphaga, an opportunistic human pathogen and a host for undesired bacteria, was observed in supply A. The high level of NOM in supply B corresponded with an elevated level of active biomass and with elevated concentrations of H. vermiformis in distributed water. Hence, the application of qPCR may be promising in elucidating the relationship between drinking water quality and the presence of specific protozoa.

  5. Loop-mediated isothermal amplification assay for detection of Histomonas meleagridis infection in chickens targeting the 18S rRNA sequences.


    Xu, Jinjun; Qu, Chanbao; Tao, Jianping


    Histomonas meleagridis is the causative agent of histomonosis, a disease of gallinaceous fowl characterized by necrotic typhlitis, hepatitis, and high mortality. To develop a rapid and sensitive method for specific detection of H. meleagridis, an assay based on loop-mediated isothermal amplification (LAMP) targeting the 18S rRNA gene was established. The detection limit of the LAMP assay was 10 copies for standard plasmids containing an 18S rRNA gene fragment, which was superior to that of a classical PCR method. Specificity tests revealed that there was no cross-reaction with other protozoa such as Trichomonas gallinae, Blastocytis sp, Tetratrichomonas gallinarum, Plasmodium gallinaceum, Toxoplasma gondii, Eimeria tenella, Leucocytozoon caulleryi and Leucocytozoon sabrazesi. The assay was evaluated for its diagnostic utility using liver and caeca samples collected from suspected field cases, the detection rate was 100 and 97.92%, respectively. These results indicate that the LAMP assay may be a useful tool for rapid detection and identification of H. meleagridis in poultry. PMID:24320623

  6. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern United States, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA gene (SSU rRNA). Howe...

  7. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.


    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek


    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied.

  8. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.


    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek


    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. PMID:24071560

  9. Protist 18S rRNA gene Sequence Analysis Reveals Multiple Sources of Organic Matter Contributing to Turbidity Maxima of the Columbia River Estuary

    SciTech Connect

    Herfort, Lydie; Peterson, Tawnya D.; McCue, Lee Ann; Zuber, Peter A.


    The Columbia River estuary is traditionally considered a detritus-based ecosystem fueled in summer by organic matter (OM) from expired freshwater diatoms. Since Estuarine Turbidity Maxima (ETM) are sites of accumulation and transformation of this phytoplankton-derived OM, to further characterize the ETM protist assemblage, we collected in August 2007 bottom waters throughout an ETM event, as well as surface water during the peak of bottom turbidity, and performed biogeochemical, microscopic and molecular (18S rRNA gene clone libraries) analyses. These data confirmed that the majority of the particulate OM in ETMs is derived from chlorophyll a-poor particulate organic carbon tagged by DNA too damaged to be detected by molecular analysis.

  10. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).


    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L


    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  11. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).


    Winnepenninckx, B M; Reid, D G; Backeljau, T


    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  12. ARC-1, a sequence element complementary to an internal 18S rRNA segment, enhances translation efficiency in plants when present in the leader or intercistronic region of mRNAs

    PubMed Central

    Akbergenov, R. Zh.; Zhanybekova, S. Sh.; Kryldakov, R. V.; Zhigailov, A.; Polimbetova, N. S.; Hohn, T.; Iskakov, B. K.


    The sequences of different plant viral leaders with known translation enhancer ability show partial complementarity to the central region of 18S rRNA. Such complementarity might serve as a means to attract 40S ribosomal subunits and explain in part the translation-enhancing property of these sequences. To verify this notion, we designed β-glucuronidase (GUS) mRNAs differing only in the nature of 10 nt inserts in the center of their 41 base leaders. These were complementary to consecutive domains of plant 18S rRNA. Sucrose gradient analysis revealed that leaders with inserts complementary to regions 1105–1114 and 1115–1124 (‘ARC-1’) of plant 18S rRNA bound most efficiently to the 40S ribosomal subunit after dissociation from 80S ribosomes under conditions of high ionic strength, a treatment known to remove translation initiation factors. Using wheat germ cell-free extracts, we could demonstrate that mRNAs with these leaders were translated more than three times more efficiently than a control lacking such a complementarity. Three linked copies of the insert enhanced translation of reporter mRNA to levels comparable with those directed by the natural translation enhancing leaders of tobacco mosaic virus and potato virus Y RNAs. Moreover, inserting the same leaders as intercistronic sequences in dicistronic mRNAs substantially increased translation of the second cistron, thereby revealing internal ribosome entry site activity. Thus, for plant systems, the complementary interaction between mRNA leader and the central region of 18S rRNA allows cap-independent binding of mRNA to the 43S pre-initiation complex without assistance of translation initiation factors. PMID:14718549

  13. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).


    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M


    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov.

  14. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.


    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter


    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  15. Polyamine stimulation of eEF1A synthesis based on the unusual position of a complementary sequence to 18S rRNA in eEF1A mRNA.


    Terui, Yusuke; Sakamoto, Akihiko; Yoshida, Taketo; Kasahara, Takuma; Tomitori, Hideyuki; Higashi, Kyohei; Igarashi, Kazuei; Kashiwagi, Keiko


    It is thought that Shine-Dalgarno-like sequences, which exhibit complementarity to the nucleotide sequences at the 3'-end of 18S rRNA, are not present in eukaryotic mRNAs. However, complementary sequences consisting of more than 5 nucleotides to the 3'-end of 18S rRNA, i.e., a CR sequence, are present at -17 to -32 upstream from the initiation codon AUG in 18 mRNAs involved in protein synthesis except eEF1A mRNA. Thus, effects of the CR sequence in mRNAs and polyamines on protein synthesis were examined using control and polyamine-reduced FM3A and NIH3T3 cells. Polyamines did not stimulate protein synthesis encoded by 18 mRNAs possessing a normal CR sequence. When the CR sequence was deleted, protein synthetic activities decreased to less than 70% of intact mRNAs. In eEF1A mRNA, the CR sequence was located at -33 to -39 upstream from the initiation codon AUG, and polyamines stimulated eEF1A synthesis about threefold. When the CR sequence was shifted to -22 to -28 upstream from the AUG, eEF1A synthesis increased in polyamine-reduced cells and the degree of polyamine stimulation decreased greatly. The results indicate that the CR sequence exists in many eukaryotic mRNAs, and the location of a CR sequence in mRNAs influences polyamine stimulation of protein synthesis.

  16. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe


    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  17. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.


    Wu, Shu; Xiong, Jie; Yu, Yuhe


    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  18. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter


    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  19. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.


    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime


    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  20. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.


    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert


    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  1. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.


    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert


    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  2. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert


    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  3. Structural diversity of eukaryotic 18S rRNA and its impact on alignment and phylogenetic reconstruction.


    Xie, Qiang; Lin, Jinzhong; Qin, Yan; Zhou, Jianfu; Bu, Wenjun


    Ribosomal RNAs are important because they catalyze the synthesis of peptides and proteins. Comparative studies of the secondary structure of 18S rRNA have revealed the basic locations of its many length-conserved and length-variable regions. In recent years, many more sequences of 18S rDNA with unusual lengths have been documented in GenBank. These data make it possible to recognize the diversity of the secondary and tertiary structures of 18S rRNAs and to identify the length-conserved parts of 18S rDNAs. The longest 18S rDNA sequences of almost every known eukaryotic phylum were included in this study. We illustrated the bioinformatics-based structure to show that, the regions that are more length-variable, regions that are less length-variable, the splicing sites for introns, and the sites of A-minor interactions are mostly distributed in different parts of the 18S rRNA. Additionally, this study revealed that some length-variable regions or insertion positions could be quite close to the functional part of the 18S rRNA of Foraminifera organisms. The tertiary structure as well as the secondary structure of 18S rRNA can be more diverse than what was previously supposed. Besides revealing how this interesting gene evolves, it can help to remove ambiguity from the alignment of eukaryotic 18S rDNAs and to improve the performance of 18S rDNA in phylogenetic reconstruction. Six nucleotides shared by Archaea and Eukaryota but rarely by Bacteria are also reported here for the first time, which might further support the supposed origin of eukaryote from archaeans.

  4. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.


    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S


    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis. PMID:26618590

  5. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.


    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S


    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis.

  6. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.


    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  7. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  8. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.


    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M


    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  9. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.


    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M


    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded.

  10. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta.


    Mackey, L Y; Winnepenninckx, B; De Wachter, R; Backeljau, T; Emschermann, P; Garey, J R


    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

  11. Differential identification of Entamoeba spp. based on the analysis of 18S rRNA.


    Santos, Helena Lúcia Carneiro; Bandea, Rebecca; Martins, Luci Ana Fernandes; de Macedo, Heloisa Werneck; Peralta, Regina Helena Saramago; Peralta, Jose Mauro; Ndubuisi, Mackevin I; da Silva, Alexandre J


    Entamoeba histolytica is known to cause intestinal and extra-intestinal disease while the other Entamoeba species are not considered to be pathogenic. However, all Entamoeba spp. should be reported when identified in clinical samples. Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanii can be differentiated morphologically from E. histolytica, but some of their diagnostic morphologic features overlap. E. histolytica, Entamoeba dispar, and Entamoeba moshkovskii are morphologically identical but can be differentiated using molecular tools. We developed a polymerase chain reaction (PCR) procedure followed by DNA sequencing of specific regions of 18S rRNA gene to differentiate the Entamoeba spp. commonly found in human stools. This approach was used to analyze 45 samples from cases evaluated for the presence of Entamoeba spp. by microscopy and a real-time PCR method capable of differential detection of E. histolytica and E. dispar. Our results demonstrated an agreement of approximately 98% (45/44) between the real-time PCR for E. histolytica and E. dispar and the 18S rRNA analysis described here. Five previously negative samples by microscopy revealed the presence of E. dispar, E. hartmanii, or E. coli DNA. In addition, we were able to detect E. hartmanii in a stool sample that had been previously reported as negative for Entamoeba spp. by microscopy. Further microscopic evaluation of this sample revealed the presence of E. hartmanii cysts, which went undetected during the first microscopic evaluation. This PCR followed by DNA sequencing will be useful to refine the diagnostic detection of Entamoeba spp. in stool and other clinical specimens.

  12. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    PubMed Central

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.


    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89–95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73–5.04 μm) × 3.94 μm (3.50–4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  13. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus).


    Stenger, Brianna L S; Clark, Mark E; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W; Dyer, Neil W; Schultz, Jessie L; McEvoy, John M


    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89-95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73-5.04 μm) × 3.94 μm (3.50-4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships.

  14. Phylogeny of intestinal ciliates, including Charonina ventriculi, and comparison of microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis.


    Kittelmann, Sandra; Devente, Savannah R; Kirk, Michelle R; Seedorf, Henning; Dehority, Burk A; Janssen, Peter H


    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups.

  15. Phylogeny of Intestinal Ciliates, Including Charonina ventriculi, and Comparison of Microscopy and 18S rRNA Gene Pyrosequencing for Rumen Ciliate Community Structure Analysis

    PubMed Central

    Devente, Savannah R.; Kirk, Michelle R.; Seedorf, Henning; Dehority, Burk A.


    The development of high-throughput methods, such as the construction of 18S rRNA gene clone or pyrosequencing libraries, has allowed evaluation of ciliate community composition in hundreds of samples from the rumen and other intestinal habitats. However, several genera of mammalian intestinal ciliates have been described based only on morphological features and, to date, have not been identified using molecular methods. Here, we isolated single cells of one of the smallest but widely distributed intestinal ciliates, Charonina ventriculi, and sequenced its 18S rRNA gene. We verified the sequence in a full-cycle rRNA approach using fluorescence in situ hybridization and thereby assigned an 18S rRNA gene sequence to this species previously known only by its morphology. Based on its full-length 18S rRNA gene sequence, Charonina ventriculi was positioned within the phylogeny of intestinal ciliates in the subclass Trichostomatia. The taxonomic framework derived from this phylogeny was used for taxonomic assignment of trichostome ciliate 18S rRNA gene sequence data stemming from high-throughput amplicon pyrosequencing of rumen-derived DNA samples. The 18S rRNA gene-based ciliate community structure was compared to that obtained from microscopic counts using the same samples. Both methods allowed identification of dominant members of the ciliate communities and classification of the rumen ciliate community into one of the types first described by Eadie in 1962. Notably, each method is associated with advantages and disadvantages. Microscopy is a highly accurate method for evaluation of total numbers or relative abundances of different ciliate genera in a sample, while 18S rRNA gene pyrosequencing represents a valuable alternative for comparison of ciliate community structure in a large number of samples from different animals or treatment groups. PMID:25616800

  16. Cellular identity of an 18S rRNA gene sequence clade within the class Kinetoplastea: the novel genus Actuariola gen. nov. (Neobodonida) with description of the type species Actuariola framvarensis sp. nov.


    Stoeck, Thorsten; Schwarz, M V Julian; Boenigk, Jens; Schweikert, Michael; von der Heyden, Sophie; Behnke, Anke


    Environmental molecular surveys of microbial diversity have uncovered a vast number of novel taxonomic units in the eukaryotic tree of life that are exclusively known by their small-subunit (SSU) rRNA gene signatures. In this study, we reveal the cellular and taxonomic identity of a novel eukaryote SSU rRNA gene sequence clade within the Kinetoplastea. Kinetoplastea are ubiquitously distributed flagellated protists of high ecological and medical importance. We isolated an organism from the oxic-anoxic interface of the anoxic Framvaren Fjord (Norway), which branches within an unidentified kinetoplastean sequence clade. Ultrastructural studies revealed a typical cellular organization that characterized the flagellated isolate as a member of the order Neobodonida Vickerman 2004, which contains five genera. The isolate differed in several distinctive characters from Dimastigella, Cruzella, Rhynchobodo and Rhynchomonas. The arrangement of the microtubular rod that supports the apical cytostome and the cytopharynx differed from the diagnosis of the fifth described genus (Neobodo Vickerman 2004) within the order Neobodonida. On the basis of both molecular and microscopical data, a novel genus within the order Neobodonida, Actuariola gen. nov., is proposed. Here, we characterize its type species, Actuariola framvarensis sp. nov., and provide an in situ tool to access the organism in nature and study its ecology.

  17. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric


    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  18. [Fragment of mRNA coding part that is complementary to region 1638-1650 of wheat 18S rRNA functions as a translational enhancer].


    Zhigaĭlov, A V; Babaĭlova, E S; Polimbetova, N S; Graĭfer, D M; Karpova, G G; Iskakov, B K


    Possible involvement of 18S rRNA fragment 1638-1650 including basements of the helices h44 and h28 and nucleotides of the ribosomal decoding site in the cap-independent translation initiation on plant ribosomes is studied. This rRNA fragment is shown to be accessible for complementary interactions within the 40S ribosomal subunit. It is found that the sequence complementary to the 18S rRNA fragment 1638-1650 is able to enhance efficiency of a reporter mRNA translation when placed just after the initiation codon. The results obtained indicate that in the course of the cap-independent translation initiation, complementary interactions can occur between mRNA coding sequence and 18S rRNA fragment in the region of the ribosomal decoding site.

  19. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.


    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I


    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  20. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.


    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I


    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones.

  1. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central


    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  2. Cytogenetic analysis of the tamaraw (Bubalus mindorensis): a comparison of R-banded karyotype and chromosomal distribution of centromeric satellite DNAs, telomeric sequence, and 18S-28S rRNA genes with domestic water buffaloes.


    Tanaka, K; Matsuda, Y; Masangkay, J S; Solis, C D; Anunciado, R V; Kuro-o, M; Namikawa, T


    The karyotype of the tamaraw (Bubalus mindorensis, 2n = 46) was investigated by RBG-banding technique and compared with those of the river and the swamp cytotypes of domestic water buffalo (B. bubalis). The tamaraw karyotype consisted of 6 submetacentric and 16 acrocentric autosome pairs (NAA = 56), and X and Y chromosomes. The RBG-banded karyotype of the three taxa had a high degree of homology, and the tamaraw karyotype could be explained by a Robertsonian translocation between chromosomes 7 and 15 and by a telomere-centromere tandem fusion between chromosomes 4p and 12 of the standardized river buffalo cytotype (2n = 50, NAA = 58). The buffalo satellite I and II DNAs were localized to the centromeric regions of all the tamaraw chromosomes. The biarmed chromosome 2 of the tamaraw resulting from the fusion between chromosomes 7 and 15 of the standard contained much larger amounts of the satellite I DNA than the other biarmed chromosomes, suggesting that this chromosome was formed by a relatively recent Robertsonian fusion. The (TTAGGG)n telomeric sequence was specifically localized to the telomeric region of all the buffalo chromosomes. The 18S + 28S rDNA was localized to the telomeric regions of the chromosomes 5p, 7, 19, 21, and 22 of the tamaraw and of their homologous chromosomes in the river and swamp buffalo cytotypes.

  3. The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.


    Rubtsov, P M; Musakhanov, M M; Zakharyev, V M; Krayev, A S; Skryabin, K G; Bayev, A A


    The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.

  4. First description of heterogeneity in 18S rRNA genes in the haploid genome of Cryptosporidium andersoni Kawatabi type.


    Ikarashi, Makoto; Fukuda, Yasuhiro; Honma, Hajime; Kasai, Kenji; Kaneta, Yoshiyasu; Nakai, Yutaka


    The Apicomplexan Cryptosporidium andersoni, is a species of gastric Cryptosporidium, is frequently detected in older calves and adult cattle. Genotyping analyses based on 18S ribosomal RNA gene sequences have been performed on a novel C. andersoni genotype, namely the Kawatabi type, and the oocysts were classified into two distinct groups genotypically: Type A (the sequence in GenBank) and Type B (with a thymine nucleotide insertion not in Type A). This study analyzed 3775 cattle at a slaughterhouse and 310 cattle at a farm using microscopy and found 175 Cryptosporidium-positive animals: 171 from the slaughterhouse and four from the farm, and all infecting parasites were determined to be C. andersoni from 18S rRNA gene sequences determined from fecal DNA. In genotyping analyses with single isolated oocysts, about a half of analyzed ones were clearly classified into well known two genotypes (Type A and B). In addition to these two known genotypes, we have detected some oocysts showing mixed signals of Types A and B in the electropherogram from the automated sequencer (the Type C genotype). To determine the genotypic composition of sporozoites carried by the Type C oocysts, we analyzed their 18S rRNA gene sequences using a single sporozoite isolation procedure. Some sporozoites were classified as either Type A or Type B. However, more than half of the analyzed isolated sporozoites showed a mixed signal identical to that of Type C oocysts, and both the Type A and B signals were surely detectable from such sporozoites after a cloning procedure. In conclusion, C. andersoni carries two different genotypes heterogeneously in its haploid genome.

  5. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.


    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo


    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  6. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.


    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi


    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage. PMID:26319789

  7. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows.


    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi


    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage.

  8. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.


    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi


    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia.

  9. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    PubMed Central

    Dimasuay, Kris Genelyn B.; Lavilla, Orlie John Y.; Rivera, Windell L.


    Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation. PMID:23936631

  10. Evaluating multiple alternative hypotheses for the origin of Bilateria: An analysis of 18S rRNA molecular evidence

    PubMed Central

    Collins, Allen G.


    Six alternative hypotheses for the phylogenetic origin of Bilateria are evaluated by using complete 18S rRNA gene sequences for 52 taxa. These data suggest that there is little support for three of these hypotheses. Bilateria is not likely to be the sister group of Radiata or Ctenophora, nor is it likely that Bilateria gave rise to Cnidaria or Ctenophora. Instead, these data reveal a close relationship between bilaterians, placozoans, and cnidarians. From this, several inferences can be drawn. Morphological features that previously have been identified as synapomorphies of Bilateria and Ctenophora, e.g., mesoderm, more likely evolved independently in each clade. The endomesodermal muscles of bilaterians may be homologous to the endodermal muscles of cnidarians, implying that the original bilaterian mesodermal muscles were myoepithelial. Placozoans should have a gastrulation stage during development. Of the three hypotheses that cannot be falsified with the 18S rRNA data, one is most strongly supported. This hypothesis states that Bilateria and Placozoa share a more recent common ancestor than either does to Cnidaria. If true, the simplicity of placozoan body architecture is secondarily derived from a more complex ancestor. This simplification may have occurred in association with a planula-type larva becoming reproductive before metamorphosis. If this simplification took place during the common history that placozoans share with bilaterians, then placozoan genes that contain a homeobox, such as Trox2, should be explored, for they may include the gene or genes most closely related to Hox genes of bilaterians. PMID:9860990

  11. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing


    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  12. Molecular diversity of eukaryotes in municipal wastewater treatment processes as revealed by 18S rRNA gene analysis.


    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki


    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4-8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  13. Molecular diversity of eukaryotes in municipal wastewater treatment processes as revealed by 18S rRNA gene analysis.


    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki


    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4-8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes.

  14. Molecular Diversity of Eukaryotes in Municipal Wastewater Treatment Processes as Revealed by 18S rRNA Gene Analysis

    PubMed Central

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki


    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4–8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  15. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.


    Fuerst, Paul A; Booton, Gregory C; Crary, Monica


    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved. PMID:25284310

  16. Phylogenetic analysis and the evolution of the 18S rRNA gene typing system of Acanthamoeba.


    Fuerst, Paul A; Booton, Gregory C; Crary, Monica


    Species of Acanthamoeba were first described using morphological characters including cyst structure and cytology of nuclear division. More than 20 nominal species were proposed using these methods. Morphology, especially cyst shape and size, has proven to be plastic and dependent upon culture conditions. The DNA sequence of the nuclear small-subunit (18S) rRNA, the Rns gene, has become the most widely accepted method for rapid diagnosis and classification of Acanthamoeba. The Byers-Fuerst lab first proposed an Rns typing system in 1996. Subsequent refinements, with an increasing DNA database and analysis of diagnostic fragments within the gene, have become widely accepted by the Acanthamoeba research community. The development of the typing system, including its current state of implementation is illustrated by three cases: (i) the division between sequence types T13 and T16; (ii) the diversity within sequence supertype T2/T6, and (iii) verification of a new sequence type, designated T20. Molecular studies make clear the disconnection between phylogenetic relatedness and species names, as applied for the genus Acanthamoeba. Future reconciliation of genetic types with species names must become a priority, but the possible shortcomings of the use of a single gene when reconstructing the evolutionary history of the acanthamoebidae must also be resolved.

  17. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.


    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter


    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  18. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.


    Potvin, Marianne; Lovejoy, Connie


    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  19. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

  20. Metabolism of 18S rRNA in rat liver cells in different functional states of protein-synthesizing apparatus

    SciTech Connect

    Chirkov, G.P.; Druzhinina, M.K.; Todorov, I.N.


    The ratio of the absolute radioactivities of 28S and 18S RNAs in the fractions of membrane-bound and free polysomes and the fraction of free rat liver ribosomes was studied under conditions of inhibition of translation by cycloheximide, insulin, and cAMP. It was found that insulin and cAMP, in contrast to cycloheximide, do not induce selective degradation of 18S rRNA. The results are discussed from the standpoint of the possible role of the phosphorylation of protein S6 in the degradation of the 40S ribosomal subunit.

  1. [Molecular phylogeny of gastrotricha based on 18S rRNA genes comparison: rejection of hypothesis of relatedness with nematodes].


    Petrov, N B; Pegova, A N; Manylov, O G; Vladychenskaia, N S; Miuge, N S; Aleshin, V V


    Gastrotrichs are meiobenthic free-living aquatic worms whose phylogenetic and intra-group relationships remain unclear despite some attempts to resolve them on the base of morphology or molecules. In this study we analysed complete sequences of the 18S rRNA gene of 15 taxa (8 new and 7 published) to test numerous hypotheses on gastrotrich phylogeny and to verify whether controversial interrelationships from previous molecular data could be due to the short region available for analysis and the poor taxa sampling. Data were analysed using both maximum likelihood and Bayesian inference. Results obtained suggest that gastrotrichs, together with Gnathostomulida, Plathelminthes, Syndermata (Rotifera + Acanthocephala), Nemertea and Lophotrochozoa, comprise a clade Spiralia. Statistical tests reject phylogenetic hypotheses regarding Gastrotricha as close relatives of Nematoda and other Ecdysozoa or placing them at the base of bilaterian tree close to acoels and nemertodermatides. Within Gastrotricha, Chaetonotida and Macrodasyida comprise two well supported clades. Our analysis confirmed the monophyly of the Chaetonotidae and Xenotrichulidae within Chaetonida as well as Turbanellidae and Thaumastodermatidae within Macrodasyida. Mesodasys is a sister group of the Turbanellidae, and Lepidodasyidae appears to be a polyphyletic group as Cephalodasys forms a separate lineage at the base of macrodasyids, whereas Lepidodasys groups with Neodasys between Thaumastodermatidae and Turbanellidae. To infer a more reliable Gastrotricha phylogeny many species and additional genes should be involved in future analyses. PMID:17685227

  2. [Molecular phylogeny of gastrotricha based on 18S rRNA genes comparison: rejection of hypothesis of relatedness with nematodes].


    Petrov, N B; Pegova, A N; Manylov, O G; Vladychenskaia, N S; Miuge, N S; Aleshin, V V


    Gastrotrichs are meiobenthic free-living aquatic worms whose phylogenetic and intra-group relationships remain unclear despite some attempts to resolve them on the base of morphology or molecules. In this study we analysed complete sequences of the 18S rRNA gene of 15 taxa (8 new and 7 published) to test numerous hypotheses on gastrotrich phylogeny and to verify whether controversial interrelationships from previous molecular data could be due to the short region available for analysis and the poor taxa sampling. Data were analysed using both maximum likelihood and Bayesian inference. Results obtained suggest that gastrotrichs, together with Gnathostomulida, Plathelminthes, Syndermata (Rotifera + Acanthocephala), Nemertea and Lophotrochozoa, comprise a clade Spiralia. Statistical tests reject phylogenetic hypotheses regarding Gastrotricha as close relatives of Nematoda and other Ecdysozoa or placing them at the base of bilaterian tree close to acoels and nemertodermatides. Within Gastrotricha, Chaetonotida and Macrodasyida comprise two well supported clades. Our analysis confirmed the monophyly of the Chaetonotidae and Xenotrichulidae within Chaetonida as well as Turbanellidae and Thaumastodermatidae within Macrodasyida. Mesodasys is a sister group of the Turbanellidae, and Lepidodasyidae appears to be a polyphyletic group as Cephalodasys forms a separate lineage at the base of macrodasyids, whereas Lepidodasys groups with Neodasys between Thaumastodermatidae and Turbanellidae. To infer a more reliable Gastrotricha phylogeny many species and additional genes should be involved in future analyses.

  3. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.


    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  4. Nematode 18S rRNA gene is a reliable tool for environmental biosafety assessment of transgenic banana in confined field trials.


    Nakacwa, R; Kiggundu, A; Talwana, H; Namaganda, J; Lilley, C; Tushemereirwe, W; Atkinson, H


    Information on relatedness in nematodes is commonly obtained by DNA sequencing of the ribosomal internal transcribed spacer region. However, the level of diversity at this locus is often insufficient for reliable species differentiation. Recent findings suggest that the sequences of a fragment of the small subunit nuclear ribosomal DNA (18S rRNA or SSU), identify genera of soil nematodes and can also distinguish between species in some cases. A database of soil nematode genera in a Ugandan soil was developed using 18S rRNA sequences of individual nematodes from a GM banana confined field trial site at the National Agricultural Research Laboratories, Kawanda in Uganda. The trial was planted to evaluate transgenic bananas for resistance to black Sigatoka disease. Search for relatedness of the sequences gained with entries in a public genomic database identified a range of 20 different genera and sometimes distinguished species. Molecular markers were designed from the sequence information to underpin nematode faunal analysis. This approach provides bio-indicators for disturbance of the soil environment and the condition of the soil food web. It is being developed to support environmental biosafety analysis by detecting any perturbance by transgenic banana or other GM crops on the soil environment.

  5. RRP5 is required for formation of both 18S and 5.8S rRNA in yeast.

    PubMed Central

    Venema, J; Tollervey, D


    Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S) are synthesized as a single precursor which is subsequently processed into the mature rRNAs by a complex series of cleavage and modification reactions. In the yeast Saccharomyces cerevisiae, the early pre-rRNA cleavages at sites A0, A1 and A2, required for the synthesis of 18S rRNA, are inhibited in strains lacking RNA or protein components of the U3, U14, snR10 and snR30 small nucleolar ribonucleoproteins (snoRNPs). The subsequent cleavage at site A3, required for formation of the major, short form of 5.8S rRNA, is carried out by another ribonucleoprotein, RNase MRP. A screen for mutations showing synthetic lethality with deletion of the non-essential snoRNA, snR10, identified a novel gene, RRP5, which is essential for viability and encodes a 193 kDa nucleolar protein. Genetic depletion of Rrp5p inhibits the synthesis of 18S rRNA and, unexpectedly, also of the major short form of 5.8S rRNA. Pre-rRNA processing is concomitantly impaired at sites A0, A1, A2 and A3. This distinctive phenotype makes Rrp5p the first cellular component simultaneously required for the snoRNP-dependent cleavage at sites A0, A1 and A2 and the RNase MRP-dependent cleavage at A3 and provides evidence for a close interconnection between these processing events. Putative RRP5 homologues from Caenorhabditis elegans and humans were also identified, suggesting that the critical function of Rrp5p is evolutionarily conserved. Images PMID:8896463

  6. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.


    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F


    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  7. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.


    Rooney, Alejandro P


    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  8. The ATPase hCINAP regulates 18S rRNA processing and is essential for embryogenesis and tumour growth

    PubMed Central

    Bai, Dongmei; Zhang, Jinfang; Li, Tingting; Hang, Runlai; Liu, Yong; Tian, Yonglu; Huang, Dadu; Qu, Linglong; Cao, Xiaofeng; Ji, Jiafu; Zheng, Xiaofeng


    Dysfunctions in ribosome biogenesis cause developmental defects and increased cancer susceptibility; however, the connection between ribosome assembly and tumorigenesis remains unestablished. Here we show that hCINAP (also named AK6) is required for human 18S rRNA processing and 40S subunit assembly. Homozygous CINAP−/− mice show embryonic lethality. The heterozygotes are viable and show defects in 18S rRNA processing, whereas no delayed cell growth is observed. However, during rapid growth, CINAP haploinsufficiency impairs protein synthesis. Consistently, hCINAP depletion in fast-growing cancer cells inhibits ribosome assembly and abolishes tumorigenesis. These data demonstrate that hCINAP reduction is a specific rate-limiting controller during rapid growth. Notably, hCINAP is highly expressed in cancers and correlated with a worse prognosis. Genome-wide polysome profiling shows that hCINAP selectively modulates cancer-associated translatome to promote malignancy. Our results connect the role of hCINAP in ribosome assembly with tumorigenesis. Modulation of hCINAP expression may be a promising target for cancer therapy. PMID:27477389

  9. The contribution of DNA slippage to eukaryotic nuclear 18S rRNA evolution.


    Hancock, J M


    Six of 204 eukaryotic nuclear small-subunit ribosomal RNA sequences analyzed show a highly significant degree of clustering of short sequence motifs that indicates the fixation of products of replication slippage within them in their recent evolutionary history. A further 72 sequences show weaker indications of sequence repetition. Repetitive sequences in SSU rRNAs are preferentially located in variable regions and in particular in V4 and V7. The conserved region immediately 5' to V7 (C7) is also consistently repetitive. Whereas variable regions vary in length and appear to have evolved by the fixation of slippage products, C7 shows no indication of length variation. Repetition within C7 is therefore either not a consequence of slippage or reflects very ancient slippage events. The phylogenetic distribution of sequence simplicity in small-subunit rRNAs is patchy, being largely confined to the Mammalia, Apicomplexa, Tetrahymenidae, and Trypanosomatidae. The regions of the molecule associated with sequence simplicity vary with taxonomic grouping as do the sequence motifs undergoing slippage. Comparison of rates of insertion and substitution in a lineage within the genus Plasmodium confirms that both rates are higher in variable regions than in conserved regions. The insertion rate in variable regions is substantially lower than the substitution rate, suggesting that selection acts more strongly on slippage products than on point mutations in these regions. Patterns of coevolution between variable regions may reflect the consequences of selection acting on the incorporation of slippage-derived sequences across the gene.

  10. Molecular Phylogeny of Cypridoid Freshwater Ostracods (Crustacea: Ostracoda), Inferred from 18S and 28S rDNA Sequences.


    Hiruta, Shimpei F; Kobayashi, Norio; Katoh, Toru; Kajihara, Hiroshi


    With the aim of exploring phylogenetic relationships within Cypridoidea, the most species-rich superfamily among the podocopidan ostracods, we sequenced nearly the entire 18S rRNA gene (18S) and part of the 28S rRNA gene (28S) for 22 species in the order Podocopida, with representatives from all the major cypridoid families. We conducted phylogenetic analyses using the methods of maximum likelihood, minimum evolution, and Bayesian analysis. Our analyses showed monophyly for Cyprididae, one of the four families currently recognized in Cypridoidea. Candonidae turned out to be paraphyletic, and included three clades corresponding to the subfamilies Candoninae, Paracypridinae, and Cyclocypridinae. We propose restricting the name Candonidae s. str. to comprise what is now Candoninae, and raising Paracypridinae and Cyclocyprininae to family rank within the superfamily Cypridoidea.

  11. Evolutionary relationships among the eukaryotic crown taxa taking into account site-to-site rate variation in 18S rRNA.


    Van de Peer, Y; De Wachter, R


    In this study we constructed a bootstrapped distance tree of 500 small subunit ribosomal RNA sequences from organisms belonging to the so-called crown of eukaryote evolution. Taking into account the substitution rate of the individual nucleotides of the rRNA sequence alignment, our results suggest that (1) animals, true fungi, and choanoflagellates share a common origin: The branch joining these taxa is highly supported by bootstrap analysis (bootstrap support [BS] > 90%), (2) stramenopiles and alveolates are sister groups (BS = 75%), (3) within the alveolates, dinoflagellates and apicomplexans share a common ancestor BS > 95%), while in turn they both share a common origin with the ciliates (BS > 80%), and (4) within the stramenopiles, heterokont algae, hyphochytriomycetes, and oomycetes form a monophyletic grouping well supported by bootstrap analysis (BS > 85%), preceded by the well-supported successive divergence of labyrinthulomycetes and bicosoecids. On the other hand, many evolutionary relationships between crown taxa are still obscure on the basis of 18S rRNA. The branching order between the animal-fungal-choanoflagellates clade and the chlorobionts, the alveolates and stramenopiles, red algae, and several smaller groups of organisms remains largely unresolved.When among-site rate variation is not considered, the inferred tree topologies are inferior to those where the substitution rate spectrum for the 18S rRNA is taken into account. This is primarily indicated by the erroneous branching of fast-evolving sequences. Moreover, when different substitution rates among sites are not considered, the animals no longer appear as a monophyletic grouping in most distance trees.

  12. Gene cloning of the 18S rRNA of an ancient viable moss from the permafrost of northeastern Siberia

    NASA Astrophysics Data System (ADS)

    Marsic, Damien; Hoover, Richard B.; Gilichinsky, David A.; Ng, Joseph D.


    A moss plant dating as much as 40,000 years old was collected from the permafrost of the Kolyma Lowlands of Northeastern Siberia. The plant tissue was revived and cultured for the extraction of its genomic DNA. Using the polymerase chain reaction technique, the 18S ribosomal RNA gene was cloned and its sequence studied. Comparative sequence analysis of the cloned ribosomal DNA to other known 18S RNA showed very high sequence identity and was revealed to be closest to the moss specie, Aulacomnium turgidum. The results of this study also show the ability of biological organisms to rest dormant in deep frozen environments where they can be revived and cultured under favorable conditions. This is significant in the notion that celestial icy bodies can be media to preserve biological function and genetic material during long term storage or transport.

  13. Comparative analysis of eukaryotic marine microbial assemblages from 18S rRNA gene and gene transcript clone libraries by using different methods of extraction.


    Koid, Amy; Nelson, William C; Mraz, Amy; Heidelberg, Karla B


    Eukaryotic marine microbes play pivotal roles in biogeochemical nutrient cycling and ecosystem function, but studies that focus on the protistan biogeography and genetic diversity lag-behind studies of other microbes. 18S rRNA PCR amplification and clone library sequencing are commonly used to assess diversity that is culture independent. However, molecular methods are not without potential biases and artifacts. In this study, we compare the community composition of clone libraries generated from the same water sample collected at the San Pedro Ocean Time Series (SPOTs) station in the northwest Pacific Ocean. Community composition was assessed using different cell lysis methods (chemical and mechanical) and the extraction of different nucleic acids (DNA and RNA reverse transcribed to cDNA) to build Sanger ABI clone libraries. We describe specific biases for ecologically important phylogenetic groups resulting from differences in nucleic acid extraction methods that will inform future designs of eukaryotic diversity studies, regardless of the target sequencing platform planned.

  14. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.


    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R


    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  15. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.


    French, C K; Fouts, D L; Manning, J E


    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  16. Crystal Structure of Rcl1 an Essential Component of the Eukaryal pre-rRNA Processosome Implicated in 18s rRNA Biogenesis

    SciTech Connect

    T Tanaka; P Smith; S Shuman


    Rcl1 is an essential nucleolar protein required for U3 snoRNA-guided pre-rRNA processing at sites flanking the 18S rRNA sequence. A potential catalytic role for Rcl1 during pre-rRNA cleavage has been suggested based on its primary structure similarity to RNA 3'-terminal phosphate cyclase (Rtc) enzymes, which perform nucleotidyl transfer and phosphoryl transfer reactions at RNA ends. Here, we report the 2.6 {angstrom} crystal structure of a biologically active yeast Rcl1, which illuminates its modular 4-domain architecture and overall homology with RNA cyclases while revealing numerous local differences that account for why Rtcs possess metal-dependent adenylyltransferase activity and Rcls do not. A conserved oxyanion-binding site in Rcl1 was highlighted for possible catalytic or RNA-binding functions. However, the benign effects of mutations in and around the anion site on Rcl1 activity in vivo militate against such a role.

  17. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).


    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I


    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  18. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).


    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I


    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  19. Detection and discovery of crustacean parasites in blue crabs (Callinectes sapidus) by using 18S rRNA gene-targeted denaturing high-performance liquid chromatography.


    Troedsson, Christofer; Lee, Richard F; Walters, Tina; Stokes, Vivica; Brinkley, Karrie; Naegele, Verena; Frischer, Marc E


    Recently, we described a novel denaturing high-performance liquid chromatography (DHPLC) approach useful for initial detection and identification of crustacean parasites. Because this approach utilizes general primers targeted to conserved regions of the 18S rRNA gene, a priori genetic sequence information on eukaryotic parasites is not required. This distinction provides a significant advantage over specifically targeted PCR assays that do not allow for the detection of unknown or unsuspected parasites. However, initial field evaluations of the DHPLC assay suggested that because of PCR-biased amplification of dominant host genes it was not possible to detect relatively rare parasite genes in infected crab tissue. Here, we describe the use of a peptide nucleic acid (PNA) PCR hybridization blocking probe in association with DHPLC (PNA-PCR DHPLC) to overcome inherent PCR bias associated with amplification of rare target genes by use of generic primers. This approach was utilized to detect infection of blue crabs (Callinectes sapidus) by the parasitic dinoflagellate Hematodinium sp. Evaluation of 76 crabs caught in Wassaw Sound, GA, indicated a 97% correspondence between detection of the parasite by use of a specific PCR diagnostic assay and that by use of PNA-PCR DHPLC. During these studies, we discovered one crab with an association with a previously undescribed protist symbiont. Phylogenetic analysis of the amplified symbiont 18S rRNA gene indicated that it is most closely related to the free-living kinetoplastid parasite Procryptobia sorokini. To our knowledge, this is the first report of this parasite group in a decapod crab and of this organism exhibiting a presumably parasitic life history.

  20. Human NAT10 Is an ATP-dependent RNA Acetyltransferase Responsible for N4-Acetylcytidine Formation in 18 S Ribosomal RNA (rRNA)*

    PubMed Central

    Ito, Satoshi; Horikawa, Sayuri; Suzuki, Tateki; Kawauchi, Hiroki; Tanaka, Yoshikazu; Suzuki, Takeo; Suzuki, Tsutomu


    Human N-acetyltransferase 10 (NAT10) is known to be a lysine acetyltransferase that targets microtubules and histones and plays an important role in cell division. NAT10 is highly expressed in malignant tumors, and is also a promising target for therapies against laminopathies and premature aging. Here we report that NAT10 is an ATP-dependent RNA acetyltransferase responsible for formation of N4-acetylcytidine (ac4C) at position 1842 in the terminal helix of mammalian 18 S rRNA. RNAi-mediated knockdown of NAT10 resulted in growth retardation of human cells, and this was accompanied by high-level accumulation of the 30 S precursor of 18 S rRNA, suggesting that ac4C1842 formation catalyzed by NAT10 is involved in rRNA processing and ribosome biogenesis. PMID:25411247

  1. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.


    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko


    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  2. Distance and Character-Based Evaluation of the V4 Region of the 18S rRNA Gene for the Identification of Diatoms (Bacillariophyceae)

    PubMed Central

    Luddington, Ian A.; Kaczmarska, Irena; Lovejoy, Connie


    DNA barcoding is a molecular tool that exploits a unique DNA sequence of a standardized gene or non-coding region for the species identification of unknown individuals. The investigation into a suitable barcode for diatoms is ongoing and there are several promising candidates including mitochondrial, plastidial and nuclear markers. We analyzed 272 sequences from 76 diatoms species in the orders Thalassiosirales, Lithodesmiales and Cymatosirales, using distance and character based approaches, to assess the applicability of a DNA barcode based on the hypervariable V4 region of the nuclear 18S rRNA gene. We show that the proposed V4 barcode separated ca. 97% of all centric diatom taxa tested using a threshold p-distance of 0.02 and that many problem pairs were further separated using a character based approach. The reliability of amplification, extensive reference library and variability seen in the V4 region make it the most promising candidate to date for a barcode marker for diatoms particularly when combined with DNA character analysis. PMID:23029169

  3. Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

    PubMed Central

    Thomas, Matthew C.; Selinger, L. Brent


    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

  4. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.


    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas


    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  5. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data.


    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F; Glöckner, Frank Oliver; Reich, Marlis


    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  6. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data

    PubMed Central

    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F.; Glöckner, Frank Oliver; Reich, Marlis


    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  7. Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

    PubMed Central

    Zhang, Jun; McCann, Kathleen L.; Qiu, Chen; Gonzalez, Lauren E.; Baserga, Susan J.; Hall, Traci M. Tanaka


    Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C'-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease, Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins. PMID:27725644

  8. Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam.


    Gatei, Wangeci; Greensill, Julie; Ashford, Richard W; Cuevas, Luis E; Parry, Christopher M; Cunliffe, Nigel A; Beeching, Nicholas J; Hart, C Anthony


    An 840-bp fragment of the 18S rRNA gene was used to identify Cryptosporidium spp. recovered from human immunodeficiency virus (HIV)-infected and -uninfected patients from Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. Initial identification was by Ziehl-Neelsen acid-fast staining. Confirmation was by nested PCR, targeting the most polymorphic region of the 18S rRNA gene. Genotyping was by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing. Among 63 isolates analyzed, four genotypes of Cryptosporidium were identified; 75% of the isolates were of the C. parvum human genotype, while the potentially zoonotic species were of the C. parvum bovine genotype (21.7%), the C. meleagridis genotype (1.6% [one isolate]), and the C. muris genotype (1.6% [one case]). HIV-infected individuals were more likely to have zoonotic genotypes than the HIV-uninfected individuals. Among the C. parvum group, strains clustered distinctly into either human or bovine genotypes regardless of the geographical origin, age, or HIV status of the patients. The intragenotypic variation observed in the C. parvum human genotype was extensive compared to that within the C. parvum bovine genotype group. The variation within genotypes was conserved in all geographical regions regardless of the patients' HIV status. The extensive diversity within genotypes at the 18S rRNA gene locus may limit its application to phylogenetic analyses.

  9. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation.


    Malygin, Alexey A; Kossinova, Olga A; Shatsky, Ivan N; Karpova, Galina G


    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES-rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors.

  10. Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana.


    Sikorski, Pawel J; Zuber, Hélène; Philippe, Lucas; Sement, François M; Canaday, Jean; Kufel, Joanna; Gagliardi, Dominique; Lange, Heike


    The biosynthesis of ribosomal RNA and its incorporation into functional ribosomes is an essential and intricate process that includes production of mature ribosomal RNA from large precursors. Here, we analyse the contribution of the plant exosome and its co-factors to processing and degradation of 18S pre-RNAs in Arabidopsis thaliana. Our data show that, unlike in yeast and humans, an RRP6 homologue, the nucleolar exoribonuclease RRP6L2, and the exosome complex, together with RRP44, function in two distinct steps of pre-18S rRNA processing or degradation in Arabidopsis. In addition, we identify TRL (TRF4/5-like) as the terminal nucleotidyltransferase that is mainly responsible for oligoadenylation of rRNA precursors in Arabidopsis. We show that TRL is required for efficient elimination of the excised 5' external transcribed spacer and of 18S maturation intermediates that escaped 5' processing. Our data also suggest involvement of additional nucleotidyltransferases, including terminal uridylyltransferase(s), in modifying rRNA processing intermediates in plants.

  11. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch.


    Mallatt, Jon; Giribet, Gonzalo


    This work expands on a study from 2004 by Mallatt, Garey, and Shultz [Mallatt, J.M., Garey, J.R., Shultz, J.W., 2004. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol. Phylogenet. Evol. 31, 178-191] that evaluated the phylogenetic relationships in Ecdysozoa (molting animals), especially arthropods. Here, the number of rRNA gene-sequences was effectively doubled for each major group of arthropods, and sequences from the phylum Kinorhyncha (mud dragons) were also included, bringing the number of ecdysozoan taxa to over 80. The methods emphasized maximum likelihood, Bayesian inference and statistical testing with parametric bootstrapping, but also included parsimony and minimum evolution. Prominent findings from our combined analysis of both genes are as follows. The fundamental subdivisions of Hexapoda (insects and relatives) are Insecta and Entognatha, with the latter consisting of collembolans (springtails) and a clade of proturans plus diplurans. Our rRNA-gene data provide the strongest evidence to date that the sister group of Hexapoda is Branchiopoda (fairy shrimps, tadpole shrimps, etc.), not Malacostraca. The large, Pancrustacea clade (hexapods within a paraphyletic Crustacea) divided into a few basic subclades: hexapods plus branchiopods; cirripedes (barnacles) plus malacostracans (lobsters, crabs, true shrimps, isopods, etc.); and the basally located clades of (a) ostracods (seed shrimps) and (b) branchiurans (fish lice) plus the bizarre pentastomids (tongue worms). These findings about Pancrustacea agree with a recent study by Regier, Shultz, and Kambic that used entirely different genes [Regier, J.C., Shultz, J.W., Kambic, R.E., 2005a. Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic. Proc. R. Soc. B 272, 395-401]. In Malacostraca, the stomatopod (mantis shrimp) was not at the base of the eumalacostracans

  12. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch.


    Mallatt, Jon; Giribet, Gonzalo


    This work expands on a study from 2004 by Mallatt, Garey, and Shultz [Mallatt, J.M., Garey, J.R., Shultz, J.W., 2004. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol. Phylogenet. Evol. 31, 178-191] that evaluated the phylogenetic relationships in Ecdysozoa (molting animals), especially arthropods. Here, the number of rRNA gene-sequences was effectively doubled for each major group of arthropods, and sequences from the phylum Kinorhyncha (mud dragons) were also included, bringing the number of ecdysozoan taxa to over 80. The methods emphasized maximum likelihood, Bayesian inference and statistical testing with parametric bootstrapping, but also included parsimony and minimum evolution. Prominent findings from our combined analysis of both genes are as follows. The fundamental subdivisions of Hexapoda (insects and relatives) are Insecta and Entognatha, with the latter consisting of collembolans (springtails) and a clade of proturans plus diplurans. Our rRNA-gene data provide the strongest evidence to date that the sister group of Hexapoda is Branchiopoda (fairy shrimps, tadpole shrimps, etc.), not Malacostraca. The large, Pancrustacea clade (hexapods within a paraphyletic Crustacea) divided into a few basic subclades: hexapods plus branchiopods; cirripedes (barnacles) plus malacostracans (lobsters, crabs, true shrimps, isopods, etc.); and the basally located clades of (a) ostracods (seed shrimps) and (b) branchiurans (fish lice) plus the bizarre pentastomids (tongue worms). These findings about Pancrustacea agree with a recent study by Regier, Shultz, and Kambic that used entirely different genes [Regier, J.C., Shultz, J.W., Kambic, R.E., 2005a. Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic. Proc. R. Soc. B 272, 395-401]. In Malacostraca, the stomatopod (mantis shrimp) was not at the base of the eumalacostracans

  13. Genotypic heterogeneity based on 18S-rRNA gene sequences among Acanthamoeba isolates from clinical samples in Italy.


    Di Cave, David; D' Alfonso, Rossella; Dussey Comlavi, Kodjo A; D' Orazi, Carlo; Monno, Rosa; Berrilli, Federica


    Acanthamoeba keratitis (AK) is an ocular disease caused by members of a genus of free-living amoebae and it is associated predominantly with contact lens (CL) use. This study reports 55 cases of AK diagnosed in Italy. Genotype identification was carried out by PCR assay followed by sequence analysis of the 18S rRNA gene using the genus specific primers JDP1 and JDP2. Genotype assignment was based on phenetic analysis of the ASA.S1 subset of the small-subunit rRNA gene sequences. The material has been collected at the Polyclinic Tor Vergata of Rome for a total of 19 isolates and at the Polyclinic Hospital of Bari (36 isolates). Thirty-three out of the 55 genetically characterized isolates were assigned to the genotype T4. Ten isolates were identified as belonging to the genotype T15 thus confirming the first association between the genotype T15 and human amoebic keratitis previously described from the same area. We underline the occurrence of the genotype T3 and T11 identified for the first time in the country.

  14. Use of 18S rRNA Gene-Based PCR Assay for Diagnosis of Acanthamoeba Keratitis in Non-Contact Lens Wearers in India

    PubMed Central

    Pasricha, Gunisha; Sharma, Savitri; Garg, Prashant; Aggarwal, Ramesh K.


    Identification of Acanthamoeba cysts and trophozoites in ocular tissues requires considerable expertise and is often time-consuming. An 18S rRNA gene-based PCR test, highly specific for the genus Acanthamoeba, has recently been reported in the molecular diagnosis of Acanthamoeba keratitis. This PCR assay was compared with conventional microbiological tests for the diagnosis of Acanthamoeba keratitis. In a pilot study, the PCR conditions with modifications were first tested on corneal scrapings from patients with culture-proven non-contact lens-related Acanthamoeba, bacterial, and fungal keratitis. This was followed by testing of corneal scrapings from 53 consecutive cases of microbial keratitis to determine sensitivity, specificity, and predictive values of the assay. All corneal scrapings from patients with proven Acanthamoeba keratitis showed a 463-bp amplicon, while no amplicon was obtained from patients with bacterial or fungal keratitis. Some of these amplified products were sequenced and compared with EMBL database reference sequences to validate these to be of Acanthamoeba origin. Out of 53 consecutive cases of microbial keratitis included for evaluating the PCR, 10 (18.9%) cases were diagnosed as Acanthamoeba keratitis on the basis of combined results of culture, smear, and PCR of corneal scrapings. Based on culture results as the “gold standard,” the sensitivity of PCR was the same as that of the smear (87.5%); however, the specificity and the positive and negative predictive values of PCR were marginally higher than the smear examination (97.8 versus 95.6%, 87.5 versus 77.8%, and 97.8 versus 97.7%) although the difference was not significant. This study confirms the efficacy of the PCR assay and is the first study to evaluate a PCR-based assay against conventional methods of diagnosis in a clinical setting. PMID:12843065

  15. 18S ribosomal DNA sequences provide insight into the phylogeny of patellogastropod limpets (Mollusca: Gastropoda).


    Yoon, Sook Hee; Kim, Won


    To investigate the phylogeny of Patellogastropoda, the complete 18S rDNA sequences of nine patellogastropod limpets Cymbula canescens (Gmelin, 1791), Helcion dunkeri (Krauss, 1848), Patella rustica Linnaeus, 1758, Cellana toreuma (Reeve, 1855), Cellana nigrolineata (Reeve, 1854), Nacella magellanica Gmelin, 1791, Nipponacmea concinna (Lischke, 1870), Niveotectura pallida (Gould, 1859), and Lottia dorsuosa Gould, 1859 were determined. These sequences were then analyzed along with the published 18S rDNA sequences of 35 gastropods, one bivalve, and one chiton species. Phylogenetic trees were constructed by maximum parsimony, maximum likelihood, and Bayesian inference. The results of our 18S rDNA sequence analysis strongly support the monophyly of Patellogastropoda and the existence of three subgroups. Of these, two subgroups, the Patelloidea and Acmaeoidea, are closely related, with branching patterns that can be summarized as [(Cymbula + Helcion) + Patella] and [(Nipponacmea + Lottia) + Niveotectura]. The remaining subgroup, Nacelloidea, emerges as basal and paraphyletic, while its genus Cellana is monophyletic. Our analysis also indicates that the Patellogastropoda have a sister relationship with the order Cocculiniformia within the Gastropoda. PMID:17464213

  16. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy


    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  17. Free-Living Protozoa in Two Unchlorinated Drinking Water Supplies, Identified by Phylogenic Analysis of 18S rRNA Gene Sequences▿ †

    PubMed Central

    Valster, Rinske M.; Wullings, Bart A.; Bakker, Geo; Smidt, Hauke; van der Kooij, Dick


    Free-living protozoan communities in water supplies may include hosts for Legionella pneumophila and other undesired bacteria, as well as pathogens. This study aimed at identifying free-living protozoa in two unchlorinated groundwater supplies, using cultivation-independent molecular approaches. For this purpose, samples (<20°C) of treated water, distributed water, and distribution system biofilms were collected from supply A, with a low concentration of natural organic matter (NOM) (<0.5 ppm of C), and from supply B, with a high NOM concentration (7.9 ppm of C). Eukaryotic communities were studied using terminal restriction fragment length polymorphism and clone library analyses of partial 18S rRNA gene fragments and a Hartmannella vermiformis-specific quantitative PCR (qPCR). In both supplies, highly diverse eukaryotic communities were observed, including free-living protozoa, fungi, and metazoa. Sequences of protozoa clustered with Amoebozoa (10 operational taxonomic units [OTUs]), Cercozoa (39 OTUs), Choanozoa (26 OTUs), Ciliophora (29 OTUs), Euglenozoa (13 OTUs), Myzozoa (5 OTUs), and Stramenopiles (5 OTUs). A large variety of protozoa were present in both supplies, but the estimated values for protozoan richness did not differ significantly. H. vermiformis was observed in both supplies but was not a predominant protozoan. One OTU with the highest similarity to Acanthamoeba polyphaga, an opportunistic human pathogen and a host for undesired bacteria, was observed in supply A. The high level of NOM in supply B corresponded with an elevated level of active biomass and with elevated concentrations of H. vermiformis in distributed water. Hence, the application of qPCR may be promising in elucidating the relationship between drinking water quality and the presence of specific protozoa. PMID:19465529

  18. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia.


    Shalchian-Tabrizi, Kamran; Kauserud, Håvard; Massana, Ramon; Klaveness, Dag; Jakobsen, Kjetill S


    Telonemia has recently been described as a new eukaryotic phylum with uncertain evolutionary origin. So far, only two Telonemia species, Telonema subtilis and Telonema antarcticum, have been described, but there are substantial variations in size and morphology among Telonema isolates and field observations, indicating a hidden diversity of Telonemia-like species and populations. In this study, we investigated the diversity and the global distribution of this group by analyzing 18S rDNA sequences from marine environmental clone libraries published in GenBank as well as several unpublished sequences from the Indian Ocean. Phylogenetic analyses of the identified sequences suggest that the Telonemia phylum includes several undescribed 18S rDNA phylotypes, probably corresponding to a number of different species and/or populations. The Telonemia phylotypes form two main groups, here referred to as Telonemia Groups 1 and 2. Some of the closely related sequences originate from separate oceans, indicating worldwide distributions of various Telonemia phylotypes, while other phylotypes seem to have limited geographical distribution. Further investigations of the evolutionary relationships within Telonemia should be conducted on isolated cultures of Telonema-like strains using multi-locus sequencing and morphological data. PMID:17196879

  19. Polymorphism of genes coding for nuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10 from other groups in the Rhizoctonia solani species complex.


    Liu, Z L; Domier, L L; Sinclair, J B


    DNA polymorphism in the 18S nuclear rRNA gene region was investigated by using 11 restriction endonucleases for 161 isolates of 25 intraspecific groups (ISGs) representing 11 reported anastomosis groups (AGs) of Rhizoctonia solani. A PCR-based restriction mapping method in which enzymatically amplified DNA fragments and subfragments were digested with one or two restriction enzymes was employed. Four types of DNA restriction maps of this region were constructed for these 25 ISGs. Map type I of the 18S rDNA region was represented by isolates of a majority of R. solani ISGs. Map types II and III, represented by ISG 2E and 9 isolates and 5C isolates, respectively, differed from map I by the absence of one (map type II) or two (map type III) restriction sites. Map type IV, represented by ISG 10A and B (or AG 10) isolates, showed significant restriction site variations, with five enzymes in this region compared with those of the remaining ISGs or AGs. Ten of the 25 restriction sites in the 18S rRNA gene region were informative and selected for analysis. Previously reported restriction maps of the 5.8S rRNA gene region, including the internal transcribed spacers, were aligned with each other, and 12 informative restriction sites were identified. These data were used alone and in combination to evaluate group relationships. Analyses derived from these data sets by maximum parsimony and likelihood methods showed that AG 10 isolates were distinct and distantly related to the majority isolates of the other AGs of this species complex.

  20. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.


    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas


    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  1. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks.


    Buse, Helen Y; Lu, Jingrang; Struewing, Ian T; Ashbolt, Nicholas J


    The goal of this study was to characterize microbial eukaryotes over a 12-month period to provide insight into the occurrence of potential bacterial predators and hosts in premise plumbing. Nearly 6,300 partial 18S rRNA gene sequences from 24 hot (36.9-39.0 °C) and cold (6.8-29.1 °C) drinking water samples were analyzed and classified into major eukaryotic groups. Each major group, consisting of free-living amoebae (FLA)/protozoa, algae, copepods, dinoflagellates, fungi, nematodes, and unique uncultured eukaryotic sequences, showed limited diversity dominated by a few distinct populations, which may be characteristic of oligotrophic environments. Changes in the relative abundance of predators such as nematodes, copepods, and FLA appear to be related to temperature and seasonal changes in water quality. Sequences nearly identical to FLA such as Hartmannella vermiformis, Echinamoeba thermarmum, Pseudoparamoeba pagei, Protacanthamoeba bohemica, Platyamoeba sp., and Vannella sp. were obtained. In addition to FLA, various copepods, rotifers, and nematodes have been reported to internalize viral and bacterial pathogens within drinking water systems thus potentially serving as transport hosts; implications of which are discussed further. Increasing the knowledge of eukaryotic occurrence and their relationship with potential pathogens should aid in assessing microbial risk associated with various eukaryotic organisms in drinking water.

  2. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.


    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H


    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  3. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.


    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W


    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  4. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.


    Sundberg, P; Turbeville, J M; Lindh, S


    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values.

  5. Genetic identification of yeast 18S rRNA residues required for efficient recruitment of initiator tRNA(Met) and AUG selection.


    Dong, Jinsheng; Nanda, Jagpreet S; Rahman, Hafsa; Pruitt, Margaret R; Shin, Byung-Sik; Wong, Chi-Ming; Lorsch, Jon R; Hinnebusch, Alan G


    High-resolution structures of bacterial 70S ribosomes have provided atomic details about mRNA and tRNA binding to the decoding center during elongation, but such information is lacking for preinitiation complexes (PICs). We identified residues in yeast 18S rRNA critical in vivo for recruiting methionyl tRNA(i)(Met) to 40S subunits during initiation by isolating mutations that derepress GCN4 mRNA translation. Several such Gcd(-) mutations alter the A928:U1389 base pair in helix 28 (h28) and allow PICs to scan through the start codons of upstream ORFs that normally repress GCN4 translation. The A928U substitution also impairs TC binding to PICs in a reconstituted system in vitro. Mutation of the bulge G926 in h28 and certain other residues corresponding to direct contacts with the P-site codon or tRNA in bacterial 70S complexes confer Gcd(-) phenotypes that (like A928 substitutions) are suppressed by overexpressing tRNA(i)(Met). Hence, the nonconserved 928:1389 base pair in h28, plus conserved 18S rRNA residues corresponding to P-site contacts in bacterial ribosomes, are critical for efficient Met-tRNA(i)(Met) binding and AUG selection in eukaryotes.

  6. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M


    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  7. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.


    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S


    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups. PMID:8896370

  8. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.


    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S


    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups.

  9. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1

    PubMed Central

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L.J.


    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson–Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  10. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter


    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  11. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.


    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter


    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes.

  12. Simultaneous 16S and 18S rRNA fluorescence in situ hybridization (FISH) on LR White sections demonstrated in Vestimentifera (Siboglinidae) tubeworms.


    Schimak, Mario P; Toenshoff, Elena R; Bright, Monika


    Traditional morphological identification of invertebrate marine species is limited in early life history stages for many taxa. In this study, we demonstrate, by example of Vestimentiferan tubeworms (Siboglinidae, Polychaeta), that the simultaneous fluorescence in situ hybridization (FISH) of both eukaryotic host and bacterial symbiont cells is possible on a single semi-thin (1 μm) section. This allows the identification of host specimens to species level as well as offering visualization of bacteria distributed within the host tissue. Previously published 18S rRNA host-specific oligonucleotide probes for Riftia pachyptila, Tevnia jerichonana and a newly designed Oasisia alvinae probe, as well as a 16S rRNA probe targeting symbionts found in all host species, were applied. A number of standard fixation and hybridization parameters were tested and optimized for the best possible signal intensity and cellular resolution. Ethanol conserved samples embedded in LR White low viscosity resin yielded the best results with regard to both signal intensity and resolution. We show that extended storage times of specimens does not affect the quality of signals attained by FISH and use our protocol to identify morphologically unidentifiable tubeworm individuals from a small data set, conforming to previous findings in succession studies of the Siboglinidae family.

  13. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.


    Gjerde, Bjørn


    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  14. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity.


    Moon-van der Staay, S Y; De Wachter, R; Vaulot, D


    Picoplankton--cells with a diameter of less than 3 microm--are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75 m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  15. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity

    NASA Astrophysics Data System (ADS)

    Moon-van der Staay, Seung Yeo; De WachterRDanielVaulot, RupertDe WachterR.Daniel


    Picoplankton-cells with a diameter of less than 3µm-are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  16. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.


    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D


    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.


    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...


    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...

  19. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R


    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  20. Structural and functional studies of Bud23-Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes.


    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L J


    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N(7)-methylguanosine (m(7)G) introduced at position 1575 on 18S rRNA by Bud23-Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23-Trm112 in the apo and S-adenosyl-L-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23-Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23-Trm112 binds precursor ribosomes at an early nucleolar stage, m(7)G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23-Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23-Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction.

  1. Structure of a human pre-40S particle points to a role for RACK1 in the final steps of 18S rRNA processing

    PubMed Central

    Larburu, Natacha; Montellese, Christian; O'Donohue, Marie-Françoise; Kutay, Ulrike; Gleizes, Pierre-Emmanuel; Plisson-Chastang, Célia


    Synthesis of ribosomal subunits in eukaryotes is a complex and tightly regulated process that has been mostly characterized in yeast. The discovery of a growing number of diseases linked to defects in ribosome biogenesis calls for a deeper understanding of these mechanisms and of the specificities of human ribosome maturation. We present the 19 Å resolution cryo-EM reconstruction of a cytoplasmic precursor to the human small ribosomal subunit, purified by using the tagged ribosome biogenesis factor LTV1 as bait. Compared to yeast pre-40S particles, this first three-dimensional structure of a human 40S subunit precursor shows noticeable differences with respect to the position of ribosome biogenesis factors and uncovers the early deposition of the ribosomal protein RACK1 during subunit maturation. Consistently, RACK1 is required for efficient processing of the 18S rRNA 3′-end, which might be related to its role in translation initiation. This first structural analysis of a human pre-ribosomal particle sets the grounds for high-resolution studies of conformational transitions accompanying ribosomal subunit maturation. PMID:27530427

  2. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.


    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi


    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  3. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.


    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  4. New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.


    Hu, Xiaozhong; Fan, Yangbo; Warren, Alan


    The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form. PMID:25948616

  5. New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.


    Hu, Xiaozhong; Fan, Yangbo; Warren, Alan


    The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.

  6. Time-series of water column alkenones and 18S rRNA confirm that Uk'37 is a viable SST proxy in Narragansett Bay, RI

    NASA Astrophysics Data System (ADS)

    Salacup, J.; Theroux, S.; Herbert, T.; Prell, W. L.


    Alkenones, produced in the sunlit mixed layer by specific Haptophyte algae, are a well-established and widely-applied proxy for sea surface temperature (SST) in the world's open-oceans. However, the proxy's utility in estuarine environments remains largely untested. A reliable SST proxy is needed to identify the estuary's sensitivity and response to past and present global change because SST can exert strong control on stratification and circulation patterns, and thus oxygenation and ecosystem health, in these shallow basins. Knowing the estuaries response should help local managers and policy-makers plan mitigation and adaptation strategies. Additionally, the rapid deposition of both marine and terrestrial organic and inorganic material in estuarine systems makes them potential archives of high-resolution paleo-environmental information. A previous investigation of estuarine alkenones suggested that the Uk'37 proxy may be sensitive to the composition of the alkenone-producing Haptophyte population, which may be affected by local nutrient and fresh water fluxes. In particular, low-salinity coastal Haptophytes such as Isochrysis galbana may have a different relationship to SST than higher-salinity open-ocean Haptophytes and their presence may complicate interpretations of the Uk'37 proxy in estuaries. To better understand how the alkenone-based Uk'37 SST proxy is produced in estuarine systems, we present a two-year time-series (monthly-to-thrice-weekly resolution) of alkenone concentrations in particulate organic matter from Narragansett Bay. Alkenone concentrations are coupled with 18S ribosomal RNA (rRNA) measurements to identify the alkenone-producing population. Highest concentrations of alkenones are detected at different times in the upper and lower Bay such that the highest alkenone concentrations occur in the winter-spring (upper Bay) and summer/fall (lower Bay). This result is consistent with the established seasonal blooms and seasonal changes in nutrient

  7. Chloroplast development at low temperatures requires a homolog of DIM1, a yeast gene encoding the 18S rRNA dimethylase.

    PubMed Central

    Tokuhisa, J G; Vijayan, P; Feldmann, K A; Browse, J A


    Poikilothermic organisms require mechanisms that allow survival at chilling temperatures (2 to 15 degreesC). We have isolated chilling-sensitive mutants of Arabidopsis, a plant that is very chilling resistant, and are characterizing them to understand the genes involved in chilling resistance. The T-DNA-tagged mutant paleface1 (pfc1) grows normally at 22 degrees C but at 5 degrees C exhibits a pattern of chilling-induced chlorosis consistent with a disruption of chloroplast development. Genomic DNA flanking the T-DNA was cloned and used to isolate wild-type genomic and cDNA clones. The PFC1 transcript is present at a low level in wild-type plants and was not detected in pfc1 plants. Wild-type Arabidopsis expressing antisense constructs of PFC1 grew normally at 22 degrees C but showed chilling-induced chlorosis, confirming that the gene is essential for low-temperature development of chloroplasts. The deduced amino acid sequence of PFC1 has identity with rRNA methylases found in bacteria and yeast that modify specific adenosines of pre-rRNA transcripts. The pfc1 mutant does not have these modifications in the small subunit rRNA of the plastid. PMID:9596631

  8. Characterization of Sarcocystis species in domestic animals using a PCR-RFLP analysis of variation in the 18S rRNA gene: a cost-effective and simple technique for routine species identification.


    Yang, Zhao-Qing; Li, Qing-Qing; Zuo, Yang-Xian; Chen, Xin-Wen; Chen, Yong-Jiu; Nie, Long; Wei, Chang-Gue; Zen, Jia-Shun; Attwood, S W; Zhang, Xue-Zheng; Zhang, Ya-Ping


    Thirteen restriction endonucleases were used to investigate nuclotide sequence variation in the 18S rRNA DNA of 88 individuals from ten Sarcocystis taxa collected as cysts from their intermediate hosts, swine, cattle and water buffalo. A DNA sequence of approximately 900 bp was used. A total of 26 electromorphs were detected. The electromorphs were sorted into seven different haplotypes that coincided with the six named species and an unidentified species from cattle. These findings support those of our morphological examinations, which suggested that the taxa resembling Sarcocystis hirsuta, S. hominis, both found in water buffalo, and S. sinensis found in cattle, are not new species but are in fact S. hirsuta and S. hominis as found in cattle, and S. sinensis as found in water buffalo; this finding supports the idea that these species can utilize both cattle and water buffalo as intermediate hosts and are not restricted to one or the other host group as previously thought. PCR-RFLP resolved by agarose gel electrophoresis is shown to be an easy and rapid method of discriminating between these species.

  9. Chromosomal localization and partial sequencing of the 18S and 28S ribosomal genes from Bradysia hygida (Diptera: Sciaridae).


    Gaspar, V P; Shimauti, E L T; Fernandez, M A


    In insects, ribosomal genes are usually detected in sex chromosomes, but have also or only been detected in autosomal chromosomes in some cases. Previous results from our research group indicated that in Bradysia hygida, nucleolus organizer regions were associated with heterochromatic regions of the autosomal C chromosome, using the silver impregnation technique. The present study confirmed this location of the ribosomal genes using fluorescence in situ hybridization analysis. This analysis also revealed the partial sequences of the 18S and 28S genes for this sciarid. The sequence alignment showed that the 18S gene has 98% identity to Corydalus armatus and 91% identity to Drosophila persimilis and Drosophila melanogaster. The partial sequence analysis of the 28S gene showed 95% identity with Bradysia amoena and 93% identity with Schwenckfeldina sp. These results confirmed the location of ribosomal genes of B. hygida in an autosomal chromosome, and the partial sequence analysis of the 18S and 28S genes demonstrated a high percentage of identity among several insect ribosomal genes.

  10. Phylogeny of the bodonid flagellates (Kinetoplastida) based on small-subunit rRNA gene sequences.


    Dolezel, D; Jirků, M; Maslov, D A; Lukes, J


    The phylogeny of kinetoplastid flagellates was investigated by determining the sequences of the small-subunit (18S) rRNA from Bodo designis, Bodo saltans K, Bodo saltans P, Bodo sorokini, Bodo sp. (cf. uncinatus), Cruzella marina, Cryptobia helicis, Dimastigella mimosa and Parabodo nitrophilus and analysing these data together with several previously obtained sequences. The root of the kinetoplastid tree was tentatively determined to be attached to the branch of B. designis and/or Cruzella marina. Within this topology, the suborder Trypanosomatina appears as a late-emerging monophyletic group, while the suborder Bodonina is paraphyletic. Within the bodonid subtree, the branches of parasitic organisms were intermingled with free-living ones, implying multiple transitions to parasitism. The tree indicates that the genera Cryptobia and Bodo are artificial taxa. In addition, the separation of the fish cryptobias and Trypanoplasma borreli as different genera was not supported.

  11. Isolation and cultivation of endosymbiotic algae from green hydra and phylogenetic analysis of 18S rDNA sequences.


    Kovacević, Goran; Franjević, Damjan; Jelencić, Biserka; Kalafatić, Mirjana


    Symbiotic associations are of wide significance in evolution and biodiversity. The green hydra is a typical example of endosymbiosis. In its gastrodermal myoepithelial cells it harbors the individuals of a unicellular green algae. Endosymbiotic algae from green hydra have been successfully isolated and permanently maintained in a stable clean lab culture for the first time. We reconstructed the phylogeny of isolated endosymbiotic algae using the 18S rRNA gene to clarify its current status and to validate the traditional inclusion of these endosymbiotic algae within the Chlorella genus. Molecular analyses established that different genera and species of unicellular green algae could be present as symbionts in green hydra, depending on the natural habitat of a particular strain of green hydra.

  12. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.


    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan


    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode.

  13. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  14. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  15. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.


    Herzog, M; Maroteaux, L


    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  16. Phylogenetic analysis of 18S rRNA and the mitochondrial genomes of the wombat, Vombatus ursinus, and the spiny anteater, Tachyglossus aculeatus: increased support for the Marsupionta hypothesis.


    Janke, Axel; Magnell, Ola; Wieczorek, Georg; Westerman, Michael; Arnason, Ulfur


    The monotremes, the duck-billed platypus and the echidnas, are characterized by a number of unique morphological characteristics, which have led to the common belief that they represent the living survivors of an ancestral stock of mammals. Analysis of new data from the complete mitochondrial (mt) genomes of a second monotreme, the spiny anteater, and another marsupial, the wombat, yielded clear support for the Marsupionta hypothesis. According to this hypothesis marsupials are more closely related to monotremes than to eutherians, consistent with a basal split between eutherians and marsupials/monotremes among extant mammals. This finding was also supported by analysis of new sequences from a nuclear gene--18S rRNA. The mt genome of the wombat shares some unique features with previously described marsupial mtDNAs (tRNA rearrangement, a missing tRNA(Lys), and evidence for RNA editing of the tRNA(Asp)). Molecular estimates of genetic divergence suggest that the divergence between the platypus and the spiny anteater took place approximately 34 million years before present (MYBP), and that between South American and Australian marsupials approximately 72 MYBP. PMID:11734900

  17. TcBat a bat-exclusive lineage of Trypanosoma cruzi in the Panama Canal Zone, with comments on its classification and the use of the 18S rRNA gene for lineage identification.


    Pinto, C Miguel; Kalko, Elisabeth K V; Cottontail, Iain; Wellinghausen, Nele; Cottontail, Veronika M


    We report TcBat, a recently described genetic lineage of Trypanosoma cruzi, in fruit-eating bats Artibeus from Panama. Infections were common (11.6% prevalence), but no other T. cruzi cruzi genotypes were detected. Phylogenetic analyses show an unambiguous association with Brazilian TcBat, but raise questions about the phylogenetic placement of this genotype using the 18S rRNA gene alone. However, analyses with three concatenated genes (18S rRNA, cytb, and H2B) moderately support TcBat as sister to the discrete typing unit (DTU) TcI. We demonstrate that short fragments (>500 bp) of the 18S rRNA gene are useful for identification of DTUs of T. cruzi, and provide reliable phylogenetic signal as long as they are analyzed within a matrix with reference taxa containing additional informative genes. TcBat forms a very distinctive monophyletic group that may be recognized as an additional DTU within T. cruzi cruzi. PMID:22543008

  18. A new set of primers directed to 18S rRNA gene for molecular identification of Cryptosporidium spp. and their performance in the detection and differentiation of oocysts shed by synanthropic rodents.


    Silva, Sheila O S; Richtzenhain, Leonardo J; Barros, Iracema N; Gomes, Alessandra M M C; Silva, Aristeu V; Kozerski, Noemila D; de Araújo Ceranto, Jaqueline B; Keid, Lara B; Soares, Rodrigo M


    Cryptosporidium spp. are cosmopolitan protozoa that infect fishes, reptiles, amphibians, birds and mammals. More than 20 species are recognized within this genus. Rodents are a group of abundant and ubiquitous organisms that have been considered reservoirs of Cryptosporidium for humans and livestock. The aim of this study was to design specific primers for the gene encoding 18S rRNA, potentially capable of amplifying any species or genotype of Cryptosporidium spp. and evaluate the diagnostic attributes of the nested-PCR based on such probes. The primers were designed to amplify the shortest segment as possible to maximize the sensitivity of the test, but preserving the discriminatory potential of the amplified sequences for phylogenetic inferences. The nested-PCR standardized in this study (nPCR-SH) was compared in terms of sensitivity with another similar assay (nPCR-XIAO) that has been largely used for the detection and identification of Cryptosporidium spp. worldwide. We also aimed to molecularly characterize samples of Cryptosporidum spp. isolated from synanthropic rodents using these probes. Forty-five rodents were captured in urban areas of the municipality of Umuarama, Paraná State, Brazil. Fecal samples were submitted to three molecular tests (nested-PCRs), two of them targeted to the 18S rDNA gene (nPCR-SH and nPCR-XIAO) and the third targeted to the gene encoding actin (nPCR-actin). The nPCR-SH was tested positive on samples of Cryptosporidum parvum, Cryptosporidum andersoni, Cryptosporidum meleagridis, Cryptosporidum hominis, Cryptosporidum canis, and Cryptosporidum serpentis. Sixteen samples of rodents were positive by nPCR-SH, six by nPCR-XIAO and five by nPCR-actin. Sequencing of amplified fragments allowed the identification of Cryptosporidum muris in three samples of Rattus rattus, and two genotypes of Cryptosporidium, the genotypes mouse II and III. Cryptosporidium genotype mouse II was found in one sample of Mus musculus and genotype mouse III

  19. Genetic differentiation of strongyloides stercoralis from two different climate zones revealed by 18S ribosomal DNA sequence comparison.


    Pakdee, Wallop; Thaenkham, Urusa; Dekumyoy, Paron; Sa-Nguankiat, Surapol; Maipanich, Wanna; Pubampen, Somchit


    Over 70 countries in tropical and subtropical zones are endemic areas for Strongyloides stercoralis, with a higher prevalence of the parasite often occurring in tropical regions compared to subtropical ones. In order to explore genetic variations of S. stercoralis form different climate zones, 18S ribosomal DNA of parasite specimens obtained from Thailand were sequenced and compared with those from Japan. The maximum likelihood indicates that S. stercoralis populations from these two different climate zones have genetically diverged. The genetic relationship between S. stercoralis populations is not related to the host species, but rather to moisture and temperature. These factors may directly drive genetic differentiation among isolated populations of S. stercoralis.

  20. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas


    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  1. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences.


    Oliveira, Claudio M G; Hübschen, Judith; Brown, Derek J F; Ferraz, Luiz C C B; Wright, Frank; Neilson, Roy


    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved.

  2. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences

    PubMed Central

    Oliveira, Claudio M. G.; Hübschen, Judith; Brown, Derek J. F.; Ferraz, Luiz C. C. B.; Wright, Frank; Neilson, Roy


    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved. PMID:19262801

  3. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae) based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.


    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo


    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp) and 28S (the 5' end of 646-743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  4. Phylogenetic relationships of Paradiclybothrium pacificum and Diclybothrium armatum (Monogenoidea: Diclybothriidae) inferred from 18S rDNA sequence data.


    Rozhkovan, Konstantin V; Shedko, Marina B


    The Diclybothriidae (Monogenoidea: Oligonchoinea) includes specific parasites of fishes assigned to the ancient order Acipenseriformes. Phylogeny of the Diclybothriidae is still unclear despite several systematic studies based on morphological characters. Together with the closely related Hexabothriidae represented by parasites of sharks and ray-fishes, the position of Diclybothriidae in different taxonomical systems has been matter of discussion. Here, we present the first molecular data on Diclybothriidae. The SSU rRNA gene was used to investigate the phylogenetic position of Paradiclybothrium pacificum and Diclybothrium armatum among the other Oligonchoinea. Complete nucleotide sequences of P. pacificum and D. armatum demonstrated high identity (98.53%) with no intraspecific sequence variability. Specimens of D. armatum were obtained from different hosts (Acipenser schrenckii and Huso dauricus); however, variation by host was not detected. The sequence divergence and phylogenetic trees data show that Diclybothriidae and Hexabothriidae are more closely related to each other than with other representatives of Oligonchoinea.

  5. Phylogeny of chloromonas (chlorophyceae): A study of 18S ribosomal RNA gene sequences

    SciTech Connect

    Buchheim, M.A.; Buchheim, J.A.; Chapman, R.L.


    The unicellular, biflagellate genus Chloromonas differs from its ally, Chlamydomonas, primarily by the absence of pyrenoids in the vegetative stage of the former. As with most green flagellate genera, little is known about phylogenetic affinities within and among Chloromonas species. Phylogenetic analyses of nuclear-encoded small-subunit ribosomal RNA gene sequences demonstrate that a sampling of five Chloromonas taxa, obtained from major culture collections, do not form a monophyletic group. However, only three of these isolates, Chloromonas clathrata, Chloromonas serbinowi, and Chloromonas rosae, are diagnosable morphologically as Chloromonas species by the absence of a pyrenoid in the vegetative stage. The three diagnosable Chloromonas taxa form an alliance with two pyrenoid-bearing chlamydomonads, Chlamydomonas augustae and Chlamydomonas macrostellata. With the exception of Chloromonas serbinowi, which represents the basal lineage within the clade, each of the diagnosable Chloromonas taxa and their pyrenoid-bearing Chlamydomonas allies were isolated originally from mountain soils, snow, or cold peat. These observations suggest that hibitat, independent of pyrenoid status, may be most closely linked to the natural history of this clade of chlamydomonad flagellates. 51 refs., 3 figs., 3 tabs.

  6. Phylogenetic affiliation of SSU rRNA genes generated by massively parallel sequencing: new insights into the freshwater protist diversity.


    Taib, Najwa; Mangot, Jean-François; Domaizon, Isabelle; Bronner, Gisèle; Debroas, Didier


    Recent advances in next-generation sequencing (NGS) technologies spur progress in determining the microbial diversity in various ecosystems by highlighting, for example, the rare biosphere. Currently, high-throughput pyrotag sequencing of PCR-amplified SSU rRNA gene regions is mainly used to characterize bacterial and archaeal communities, and rarely to characterize protist communities. In addition, although taxonomic assessment through phylogeny is considered as the most robust approach, similarity and probabilistic approaches remain the most commonly used for taxonomic affiliation. In a first part of this work, a tree-based method was compared with different approaches of taxonomic affiliation (BLAST and RDP) of 18S rRNA gene sequences and was shown to be the most accurate for near full-length sequences and for 400 bp amplicons, with the exception of amplicons covering the V5-V6 region. Secondly, the applicability of this method was tested by running a full scale test using an original pyrosequencing dataset of 18S rRNA genes of small lacustrine protists (0.2-5 µm) from eight freshwater ecosystems. Our results revealed that i) fewer than 5% of the operational taxonomic units (OTUs) identified through clustering and phylogenetic affiliation had been previously detected in lakes, based on comparison to sequence in public databases; ii) the sequencing depth provided by the NGS coupled with a phylogenetic approach allowed to shed light on clades of freshwater protists rarely or never detected with classical molecular ecology approaches; and iii) phylogenetic methods are more robust in describing the structuring of under-studied or highly divergent populations. More precisely, new putative clades belonging to Mamiellophyceae, Foraminifera, Dictyochophyceae and Euglenida were detected. Beyond the study of protists, these results illustrate that the tree-based approach for NGS based diversity characterization allows an in-depth description of microbial communities

  7. Molecular characterization and phylogeny of whipworm nematodes inferred from DNA sequences of cox1 mtDNA and 18S rDNA.


    Callejón, Rocío; Nadler, Steven; De Rojas, Manuel; Zurita, Antonio; Petrášová, Jana; Cutillas, Cristina


    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from the mitochondrial cytochrome c oxidase 1 (cox1) and ribosomal 18S genes. The taxa consisted of different described species and several host-associated isolates (undescribed taxa) of Trichuris collected from hosts from Spain. Sequence data from mitochondrial cox1 (partial gene) and nuclear 18S near-complete gene were analyzed by maximum likelihood and Bayesian inference methods, as separate and combined datasets, to evaluate phylogenetic relationships among taxa. Phylogenetic results based on 18S ribosomal DNA (rDNA) were robust for relationships among species; cox1 sequences delimited species and revealed phylogeographic variation, but most relationships among Trichuris species were poorly resolved by mitochondrial sequences. The phylogenetic hypotheses for both genes strongly supported monophyly of Trichuris, and distinct genetic lineages corresponding to described species or nematodes associated with certain hosts were recognized based on cox1 sequences. Phylogenetic reconstructions based on concatenated sequences of the two loci, cox1 (mitochondrial DNA (mtDNA)) and 18S rDNA, were congruent with the overall topology inferred from 18S and previously published results based on internal transcribed spacer sequences. Our results demonstrate that the 18S rDNA and cox1 mtDNA genes provide resolution at different levels, but together resolve relationships among geographic populations and species in the genus Trichuris.

  8. Morphology and 18S rDNA gene sequence of Blepharisma sinuosum Sawaya, 1940 (Ciliophora: Heterotrichea) from Brazil.


    Fernandes, Noemi Mendes; Dias, Roberto Júnio Pedroso; Senra, Marcus Vinicius Xavier; Soares, Carlos Augusto Gomes; da Silva Neto, Inácio Domingos


    The morphology and morphometric data of seven populations of Blepharisma sinuosum from southeastern Brazil were investigated. The description is based on live observations, protargol impregnation, and scanning electron microscopy. Blepharisma sinuosum measures 75-255μm in length and 25-93μm in width and has a spindle-shaped body, pink color, a single contractile vacuole located at the posterior end, 50 adoral membranelles, a conspicuous paroral, 17-35 somatic kineties, a moniliform macronucleus with 2-7 connected nodules, and 3-20 micronuclei. Morphological comparisons with similar species were performed and suggest that B. americanum is the junior synonym of B. sinuosum. The 18S rDNA gene sequence of B. sinuosum was obtained and compared with that of other Blepharisma species. The length and GC content of the obtained sequence is 1652bp and 47.03%, respectively, and has a very high structural similarity (99.9%) with the B. undulans sequence. The validity of the classification of Blepharisma species in morphonuclear subgenera is also discussed.

  9. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.


    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  10. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.


    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  11. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.


    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan


    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  12. Mutation of EMG1 causing Bowen-Conradi syndrome results in reduced cell proliferation rates concomitant with G2/M arrest and 18S rRNA processing delay.


    Armistead, Joy; Hemming, Richard; Patel, Nehal; Triggs-Raine, Barbara


    Bowen-Conradi syndrome (BCS) is a lethal autosomal recessive disorder caused by a D86G substitution in the protein, Essential for Mitotic Growth 1 (EMG1). EMG1 is essential for 18S rRNA maturation and 40S ribosome biogenesis in yeast, but no studies of its role in ribosome biogenesis have been done in mammals. To assess the effect of the EMG1 mutation on cell growth and ribosomal biogenesis in humans, we employed BCS patient cells. The D86G substitution did not interfere with EMG1 nucleolar localization. In BCS patient lymphoblasts, cells accumulated in G2/M, resulting in reduced proliferation rates; however, patient fibroblasts showed normal proliferation. The rate of 18S rRNA processing was consistently delayed in patient cells, although this did not lead to a difference in the levels of 40S ribosomes, or a change in protein synthesis rates. These results demonstrate that as in yeast, EMG1 in mammals has a role in ribosome biogenesis. The obvious phenotype in lymphoblasts compared to fibroblasts suggests a greater need for EMG1 in rapidly dividing cells. Tissue-specific effects have been seen in other ribosomal biogenesis disorders, and it seems likely that the impact of EMG1 deficiency would be larger in the rapidly proliferating cells of the developing embryo.

  13. Large-subunit rRNA sequence of the chytridiomycete Blastocladiella emersonii, and implications for the evolution of zoosporic fungi.


    Van der Auwera, G; De Wachter, R


    The 5.8S and 28S ribosomal RNA sequences of the chytridiomycete Blastocladiella emersonii were determined. These data were combined with 18S rRNA sequences in order to carry out a phylogenetic analysis based on distance matrix, parsimony, and maximum likelihood methods. The new data confirmed that chytridiomycetes are true fungi and not protists, as was already suggested on the basis of biochemical, ultrastructural, and 18S rRNA data. Within the fungal clade, B. emersonii formed the first line of divergence. The position of the fungi within the eukaryotic "crown" taxa was also reassessed, and the alveolate-stramenopile cluster appeared as their sister group. The stramenopiles also comprise a number of zoosporic fungi, which resemble chytridiomycetes in so many respects, e.g., production of motile spores, thallus morphology, and absorptive nutrition, that they have been classified together with them in the past. This suggests that the possible common ancestor of the fungi, stramenopiles, and alveolates may have been a zoosporic fungus, which would mean that zoosporic fungi are paraphyletic instead of polyphyletic as previously suggested.

  14. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  15. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  16. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.


    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A


    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  17. Phylogenetic affiliations of mesopelagic acantharia and acantharian-like environmental 18S rRNA genes off the southern California coast.


    Gilg, Ilana C; Amaral-Zettler, Linda A; Countway, Peter D; Moorthi, Stefanie; Schnetzer, Astrid; Caron, David A


    Incomplete knowledge of acantharian life cycles has hampered their study and limited our understanding of their role in the vertical flux of carbon and strontium. Molecular tools can help identify enigmatic life stages and offer insights into aspects of acantharian biology and evolution. We inferred the phylogenetic position of acantharian sequences from shallow water, as well as acantharian-like clone sequences from 500 and 880 m in the San Pedro Channel, California. The analyses included validated acantharian and polycystine sequences from public databases with environmental clone sequences related to acantharia and used Bayesian inference methods. Our analysis demonstrated strong support for two branches of unidentified organisms that are closely related to, but possibly distinct from the Acantharea. We also found evidence of acantharian sequences from mesopelagic environments branching within the chaunacanthid clade, although the morphology of these organisms is presently unknown. HRP-conjugated probes were developed to target Acantharea and phylotypes from Unidentified Clade 1 using Catalyzed Reporter Deposition Fluorescence In Situ Hybridization (CARD-FISH) on samples collected at 500 m. Our CARD-FISH experiments targeting phylotypes from an unidentified clade offer preliminary glimpses into the morphology of these protists, while a morphology for the aphotic acantharian lineages remains unknown at this time.

  18. [Region 1112-1123 in the central domain of 18S rRNA in 40S subunits of plant ribosomes: accessibility for complementary interactions and the functional role].


    Zhigaĭlov, A V; Graĭfer, D M; Babaĭlova, E S; Polimbetova, N S; Karpova, G G; Iskakov, B K


    The binding of the 18S RNA of the 40S subunits of wheat germ ribosomes to an oligodeoxyribonucleotide complementary to the 1112-1123 region of the central domain of this RNA molecule has been studied. The selective binding of this oligomer to the complementary RNA fragment and the inhibition of the translation of uncapped chimeric RNA containing enhancer sequences in the 5'-untranslated region upstream of the reporter sequence coding for beta-glucuronidase has been shown in a cell-free protein-synthesizing system. The use of a derivative of the aforementioned oligomer containing an alkylating group at the 5' end allowed for the demonstration that the 1112-1123 region of 18S RNA can form a heteroduplex with the complementary sequence of the oligomer. The data obtained show that the 1112-1123 region in loop 27 of the central domain of 18S RNA of 40S ribosomal subunits is exposed on the subunit surface and probably participates in the cap-independent binding of the subunits to mRNA due to the complementary interaction with the enhancer sequences.

  19. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.


    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  20. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbc L and 18S rDNA sequence data

    NASA Astrophysics Data System (ADS)

    Lin, Zhongheng; Shen, Songdong; Chen, Weizhou; Li, Huihui


    Chlorophyta species are common in the southern and northern coastal areas of China. In recent years, frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists. In this paper, we sequenced the 18S rDNA genes, the internal transcribed spacer (ITS) regions and the rbc L genes in seven organisms and obtained 536-566 bp long ITS sequences, 1 377-1 407 bp long rbc L sequences and 1 718-1 761 bp long partial 18S rDNA sequences. The GC base pair content was highest in the ITS regions and lowest in the rbc L genes. The sequencing results showed that the three Ulva prolifera (or U. pertusa) gene sequences from Qingdao and Nan'ao Island were identical. The ITS, 18S rDNA and rbc L genes in U. prolifera and U. pertusa from different sea areas in China were unchanged by geographic distance. U. flexuosa had the least evolutionary distance from U. californica in both the ITS regions (0.009) and the 18S rDNA (0.002). These data verified that Ulva and Enteromorpha are not separate genera.

  1. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan


    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  2. Phylogeny and systematics of demospongiae in light of new small-subunit ribosomal DNA (18S) sequences.


    Redmond, N E; Morrow, C C; Thacker, R W; Diaz, M C; Boury-Esnault, N; Cárdenas, P; Hajdu, E; Lôbo-Hajdu, G; Picton, B E; Pomponi, S A; Kayal, E; Collins, A G


    The most diverse and species-rich class of the phylum Porifera is Demospongiae. In recent years, the systematics of this clade, which contains more than 7000 species, has developed rapidly in light of new studies combining molecular and morphological observations. We add more than 500 new, nearly complete 18S sequences (an increase of more than 200%) in an attempt to further enhance understanding of the phylogeny of Demospongiae. Our study specifically targets representation of type species and genera that have never been sampled for any molecular data in an effort to accelerate progress in classifying this diverse lineage. Our analyses recover four highly supported subclasses of Demospongiae: Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha. Within Keratosa, neither Dendroceratida, nor its two families, Darwinellidae and Dictyodendrillidae, are monophyletic and Dictyoceratida is divided into two lineages, one predominantly composed of Dysideidae and the second containing the remaining families (Irciniidae, Spongiidae, Thorectidae, and Verticillitidae). Within Myxospongiae, we find Chondrosida to be paraphyletic with respect to the Verongida. We amend the latter to include species of the genus Chondrosia and erect a new order Chondrillida to contain remaining taxa from Chondrosida, which we now discard. Even with increased taxon sampling of Haploscleromorpha, our analyses are consistent with previous studies; however, Haliclona species are interspersed in even more clades. Haploscleromorpha contains five highly supported clades, each more diverse than previously recognized, and current families are mostly polyphyletic. In addition, we reassign Janulum spinispiculum to Haploscleromorpha and resurrect Reniera filholi as Janulum filholi comb. nov. Within the large clade Heteroscleromorpha, we confirmed 12 recently identified clades based on alternative data, as well as a sister-group relationship between the freshwater Spongillida and the family

  3. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.


    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  4. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.


    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide


    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata.

  5. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.


    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia


    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  6. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia


    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.


    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B


    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  8. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.


    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B


    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  9. Phylogenetic relationships of the enigmatic angiosperm family Podostemaceae inferred from 18S rDNA and rbcL sequence data.


    Soltis, D E; Mort, M E; Soltis, P S; Hibsch-Jetter, C; Zimmer, E A; Morgan, D


    The phylogenetic relationships of some angiosperm families have remained enigmatic despite broad phylogenetic analyses of rbcL sequences. One example is the aquatic family Podostemaceae, the relationships of which have long been controversial because of major morphological modifications associated with their aquatic habit. Podostemaceae have variously been associated with Piperaceae, Nepenthaceae, Polygonaceae, Caryophyllaceae, Scrophulariaceae, Rosaceae, Crassulaceae, and Saxifragaceae. Two recent analyses of rbcL sequences suggest a possible sister-group relationship of Podostemaceae to Crassulaceae (Saxifragales). However, the branch leading to Podostemaceae was long, and use of different outgroups resulted in alternative placements. We explored the phylogenetic relationships of Podostemaceae using 18S rDNA sequences and a combined rbcL + 18S rDNA matrix representing over 250 angiosperms. In analyses based on 18S rDNA data, Podostemaceae are not characterized by a long branch; the family consistently appears as part of a Malpighiales clade that also includes Malpighiaceae, Turneraceae, Passifloraceae, Salicaceae, Euphorbiaceae, Violaceae, Linaceae, Chrysobalanaceae, Trigoniaceae, Humiriaceae, and Ochnaceae. Phylogenetic analyses based on a combined 18S rDNA + rbcL data set (223 ingroup taxa) with basal angiosperms as the outgroup also suggest that Podostemaceae are part of a Malpighiales clade. These searches swapped to completion, and the shortest trees showed enhanced resolution and increased internal support compared to those based on 18S rDNA or rbcL alone. However, when Gnetales are used as the outgroup, Podostemaceae appear with members of the nitrogen fixing clade (e.g., Elaeagnaceae, Ulmaceae, Rhamnaceae, Cannabaceae, Moraceae, and Urticaceae). None of the relationships suggested here for Podostemaceae receives strong bootstrap support. Our analyses indicate that Podostemaceae are not closely allied with Crassulaceae or with other members of the

  10. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R


    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  11. Microbial diversities (16S and 18S rRNA gene pyrosequencing) and environmental pathogens within drinking water biofilms grown on the common premise plumbing materials unplasticized polyvinylchloride and copper.


    Buse, Helen Y; Lu, Jingrang; Lu, Xinxin; Mou, Xiaozhen; Ashbolt, Nicholas J


    Drinking water (DW) biofilm communities influence the survival of opportunistic pathogens, yet knowledge about the microbial composition of DW biofilms developed on common in-premise plumbing material is limited. Utilizing 16S and 18S rRNA gene pyrosequencing, this study characterized the microbial community structure within DW biofilms established on unplasticized polyvinyl chloride (uPVC) and copper (Cu) surfaces and the impact of introducing Legionella pneumophila (Lp) and Acanthamoeba polyphaga. Mature (> 1 year old) biofilms were developed before inoculation with sterilized DW (control, Con), Lp, or Lp and A. polyphaga (LpAp). Comparison of uPVC and Cu biofilms indicated significant differences between bacterial (P = 0.001) and eukaryotic (P < 0.01) members attributable to the unique presence of several family taxa: Burkholderiaceae, Characeae, Epistylidae, Goniomonadaceae, Paramoebidae, Plasmodiophoridae, Plectidae, Sphenomonadidae, and Toxariaceae within uPVC biofilms; and Enterobacteriaceae, Erythrobacteraceae, Methylophilaceae, Acanthamoebidae, and Chlamydomonadaceae within Cu biofilms. Introduction of Lp alone or with A. polyphaga had no effect on bacterial community profiles (P > 0.05) but did affect eukaryotic members (uPVC, P < 0.01; Cu, P = 0.001). Thus, established DW biofilms host complex communities that may vary based on substratum matrix and maintain consistent bacterial communities despite introduction of Lp, an environmental pathogen.

  12. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.


    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  13. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.


    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C


    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  14. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.


    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  15. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.


    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng


    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  16. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences.


    Li, LüYan; Huang, QiaoJuan; Wu, ShuHui; Lin, Duan; Chen, JiaHui; Chen, YueQin


    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  17. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.


    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.


    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin


    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  20. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    PubMed Central

    Pettersson, B; Johansson, K E; Uhlén, M


    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing was performed in both directions. One previously unclassified avian mycoplasma was found to belong to the Mycoplasma lipophilum cluster of the hominis group. Microheterogeneities were discovered in the rRNA operons of Mycoplasma mycoides subsp. mycoides (SC type), confirming the existence of two different rRNA operons. The 16S rRNA sequence of M. mycoides subsp. capri was identical to that of M. mycoides subsp. mycoides (type SC), except that no microheterogeneities were revealed. Furthermore, automated solid-phase DNA sequencing was used to identify a mycoplasmal contamination of a cell culture as Mycoplasma hyorhinis, which proved to be very difficult by conventional methods. The results suggest that the direct solid-phase DNA sequencing procedure is a powerful tool for identification of mycoplasmas and is also useful in taxonomic studies. Images PMID:7521158

  1. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.


    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  2. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  3. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.


    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C


    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  4. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.


    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C


    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  5. Reconstructing the Phylogeny of Capsosiphon fulvescens (Ulotrichales, Chlorophyta) from Korea Based on rbcL and 18S rDNA Sequences

    PubMed Central

    Sun, Sang-Mi; Yang, Seung Hwan


    Capsosiphon fulvescens is a filamentous green algae in the class Ulvophyceae. It has been consumed as food with unique flavor and soft texture to treat stomach disorders and hangovers, and its economic value justifies studying its nutritional and potential therapeutic effects. In contrast to these applications, only a few taxonomic studies have been conducted on C. fulvescens. In particular, classification and phylogenetic relationships of the C. fulvescens below the order level are controversial. To determine its phylogenetic position in the class, we used rbcL and 18S rDNA sequences as molecular markers to construct phylogenetic trees. The amplified rbcL and 18S rDNA sequences from 4 C. fulvescens isolates (Jindo, Jangheung, Wando, and Koheung, Korea) were used for phylogenetic analysis by employing three different phylogenetic methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The rbcL phylogenetic tree showed that all taxa in the order Ulvales were clustered as a monophyletic group and resolved the phylogenetic position of C. fulvescens in the order Ulotrichales. The significance of our study is that the 18S rDNA phylogenetic tree shows the detailed taxonomic position of C. fulvescens. In our result, C. fulvescens is inferred as a member of Ulotrichaceae, along with Urospora and Acrosiphonia. PMID:27190985

  6. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.


    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G


    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  7. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.


    Choi, Y C; Busch, H


    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  8. Comparative study of the validity of three regions of the 18S-rRNA gene for massively parallel sequencing-based monitoring of the planktonic eukaryote community.


    Tanabe, Akifumi S; Nagai, Satoshi; Hida, Kohsuke; Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Takano, Yoshihito; Katakura, Seiji


    The nuclear 18S-rRNA gene has been used as a metabarcoding marker in massively parallel sequencing (MPS)-based environmental surveys for plankton biodiversity research. However, different hypervariable regions have been used in different studies, and their utility has been debated among researchers. In this study, detailed investigations into 18S-rRNA were carried out; we investigated the effective number of sequences deposited in international nucleotide sequence databases (INSDs), the amplification bias, and the amplicon sequence variability among the three variable regions, V1-3, V4-5 and V7-9, using in silico polymerase chain reaction (PCR) amplification based on INSDs. We also examined the primer universality and the taxonomic identification power, using MPS-based environmental surveys in the Sea of Okhotsk, to determine which region is more useful for MPS-based monitoring. The primer universality was not significantly different among the three regions, but the number of sequences deposited in INSDs was markedly larger for the V4-5 region than for the other two regions. The sequence variability was significantly different, with the highest variability in the V1-3 region, followed by the V7-9 region, and the lowest variability in the V4-5 region. The results of the MPS-based environmental surveys showed significantly higher identification power in the V1-3 and V7-9 regions than in the V4-5 region, but no significant difference was detected between the V1-3 and V7-9 regions. We therefore conclude that the V1-3 region will be the most suitable for future MPS-based monitoring of natural eukaryote communities, as the number of sequences deposited in INSDs increases.

  9. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.


    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia


    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  10. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.


    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia


    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  11. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.


    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D


    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  12. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.


    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  13. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.


    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  14. Use of Subgenic 18S Ribosomal DNA PCR and Sequencing for Genus and Genotype Identification of Acanthamoebae from Humans with Keratitis and from Sewage Sludge

    PubMed Central

    Schroeder, Jill M.; Booton, Gregory C.; Hay, John; Niszl, Ingrid A.; Seal, David V.; Markus, Miles B.; Fuerst, Paul A.; Byers, Thomas J.


    This study identified subgenic PCR amplimers from 18S rDNA that were (i) highly specific for the genus Acanthamoeba, (ii) obtainable from all known genotypes, and (iii) useful for identification of individual genotypes. A 423- to 551-bp Acanthamoeba-specific amplimer ASA.S1 obtained with primers JDP1 and JDP2 was the most reliable for purposes i and ii. A variable region within this amplimer also identified genotype clusters, but purpose iii was best achieved with sequencing of the genotype-specific amplimer GTSA.B1. Because this amplimer could be obtained from any eukaryote, axenic Acanthamoeba cultures were required for its study. GTSA.B1, produced with primers CRN5 and 1137, extended between reference bp 1 and 1475. Genotypic identification relied on three segments: bp 178 to 355, 705 to 926, and 1175 to 1379. ASA.S1 was obtained from single amoeba, from cultures of all known 18S rDNA genotypes, and from corneal scrapings of Scottish patients with suspected Acanthamoeba keratitis (AK). The AK PCR findings were consistent with culture results for 11 of 15 culture-positive specimens and detected Acanthamoeba in one of nine culture-negative specimens. ASA.S1 sequences were examined for 6 of the 11 culture-positive isolates and were most closely associated with genotypic cluster T3-T4-T11. A similar distance analysis using GTSA.B1 sequences identified nine South African AK-associated isolates as genotype T4 and three isolates from sewage sludge as genotype T5. Our results demonstrate the usefulness of 18S ribosomal DNA PCR amplimers ASA.S1 and GTSA.B1 for Acanthamoeba-specific detection and reliable genotyping, respectively, and provide further evidence that T4 is the predominant genotype in AK. PMID:11326011

  15. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    PubMed Central

    Jenior, Matthew L.; Koumpouras, Charles C.; Westcott, Sarah L.; Highlander, Sarah K.


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  16. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.


    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting. PMID:27069806

  17. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.


    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K


    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  18. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A


    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  19. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington


    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  20. An rRNA variable region has an evolutionarily conserved essential role despite sequence divergence.

    PubMed Central

    Sweeney, R; Chen, L; Yao, M C


    Regions extremely variable in size and sequence occur at conserved locations in eukaryotic rRNAs. The functional importance of one such region was determined by gene reconstruction and replacement in Tetrahymena thermophila. Deletion of the D8 region of the large-subunit rRNA inactivates T. thermophila rRNA genes (rDNA): transformants containing only this type of rDNA are unable to grow. Replacement with an unrelated sequence of similar size or a variable region from a different position in the rRNA also inactivated the rDNA. Mutant rRNAs resulting from such constructs were present only in precursor forms, suggesting that these rRNAs are deficient in either processing or stabilization of the mature form. Replacement with D8 regions from three other organisms restored function, even though the sequences are very different. Thus, these D8 regions share an essential functional feature that is not reflected in their primary sequences. Similar tertiary structures may be the quality these sequences share that allows them to function interchangeably. Images PMID:8196658

  1. The human IGF1R IRES likely operates through a Shine-Dalgarno-like interaction with the G961 loop (E-site) of the 18S rRNA and is kinetically modulated by a naturally polymorphic polyU loop.


    Meng, Zheng; Jackson, Nateka L; Shcherbakov, Oleg D; Choi, Hyoungsoo; Blume, Scott W


    IGF1R is a proto-oncogene with potent mitogenic and antiapoptotic activities, and its expression must be tightly regulated to maintain normal cellular and tissue homeostasis. We previously demonstrated that translation of the human IGF1R mRNA is controlled by an internal ribosome entry site (IRES), and delimited the core functional IRES to a 90-nucleotide segment of the 5'-untranslated region positioned immediately upstream of the initiation codon. Here we have analyzed the sequence elements that contribute to the function of the core IRES. The Stem2/Loop2 sequence of the IRES exhibits near-perfect Watson-Crick complementarity to the G961 loop (helix 23b) of the 18S rRNA, which is positioned within the E-site on the platform of the 40S ribosomal subunit. Mutations that disrupt this complementarity have a negative impact on regulatory protein binding and dramatically decrease IRES activity, suggesting that the IGF1R IRES may recruit the 40S ribosome by a eukaryotic equivalent of the Shine-Dalgarno (mRNA-rRNA base-pairing) interaction. The homopolymeric Loop3 sequence of the IRES modulates accessibility and limits the rate of translation initiation mediated through the IRES. Two functionally distinct allelic forms of the Loop3 poly(U)-tract are prevalent in the human population, and it is conceivable that germ-line or somatic variations in this sequence could predispose individuals to development of malignancy, or provide a selectable growth advantage for tumor cells.

  2. Detecting possibly saturated positions in 18S and 28S sequences and their influence on phylogenetic reconstruction of Annelida (Lophotrochozoa).


    Struck, Torsten H; Nesnidal, Maximilian P; Purschke, Günter; Halanych, Kenneth M


    Phylogenetic reconstructions may be hampered by multiple substitutions in nucleotide positions obliterating signal, a phenomenon called saturation. Traditionally, plotting ti/tv ratios against genetic distances has been used to reveal saturation by assessing when ti/tv stabilizes at 1. However, interpretation of results and assessment of comparability between different data sets or partitions are rather subjective. Herein, we present the new C factor, which quantifies convergence of ti/tv ratios, thus allowing comparability. Furthermore, we introduce a comparative value for homoplasy, the O/E ratio, based on alterations of tree length. Simulation studies and an empirical example, based on annelid rRNA-gene sequences, show that the C factor correlates with noise, tree length and genetic distance and therefore is a proxy for saturation. The O/E ratio correlates with the C factor, which does not provide an intrinsic threshold of exclusion, and thus both together can objectively guide decisions to exclude saturated nucleotide positions. However, analyses also showed that, for reconstructing annelid phylogeny using Maximum Likelihood, an increase in numbers of positions improves tree reconstruction more than does the exclusion of saturated positions.

  3. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.


    Verrier, S B; Jean-Jean, O


    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  4. Ultrastructure and 18S rDNA sequence analysis of Wobblia lunata gen. et sp. nov., a new heterotrophic flagellate (Stramenopiles, Incertae sedis).


    Moriya, M; Nakayama, T; Inouye, I


    A new heterotrophic flagellate Wobblia lunata gen. et sp. nov. is described. This organism usually attaches to the substratum showing a wobbling motion, and sometimes glides on the substratum or swims freely in the medium. W. lunata has various features characteristic of the stramenopiles. These include a hairy flagellum with tripartite tubular hairs, a mitochondrion with tubular cristae, arrangement of flagellar apparatus components and a double helix in the flagellar transition zone. W. lunata shares a double helix with heterotrophic stramenopiles, including Developayella elegans, oomycetes, hyphochytrids, opalinids and proteromonads, and could be placed in the phylum Bigyra Cavalier-Smith. However, from 18S rDNA tree analysis, these organisms form two distantly-related clades in the stramenopiles, and Wobblia appears at the base of the stramenopiles. Evaluation of morphological features and comparison of 18S rDNA sequences indicate that W. lunata is a member of the stramenopiles, but it is distinct from any other stramenopiles so far described. Its phylogenetic position within the stramenopiles is uncertain and therefore W. lunata is described as a stramenopile incertae sedis. PMID:10896132

  5. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  6. The 18S rDNA sequence of Synchytrium endobioticum and its utility in microarrays for the simultaneous detection of fungal and viral pathogens of potato.


    Abdullahi, Ismail; Koerbler, Marianne; Stachewicz, Hans; Winter, Stephan


    Resting spores extracted from wart (Synchytrium endobioticum)-infected potato tubers were used for DNA extraction and amplification of 18S rDNA. Analysis of the cloned, sequenced fragment revealed high similarity to members of the Chytridiomycota. Using this information, specific oligonucleotide probes were designed and arrayed onto glass slides for detection of the pathogen. Viral sequence information available in the databank was retrieved, or new viral sequences were generated, and used to design probes for specific detection of important quarantine viruses of potato. To determine the sensitivity and specificity of the oligonucleotide probes, total RNA from infected plants was reverse transcribed, labelled with Cyanine 5, and hybridised with the microarray. A significant number of the oligonucleotide probes exhibited high specificity to S. endobioticum, Andean potato latent virus, Andean potato mottle virus, Potato black ringspot virus, and Potato spindle tuber viroid. Hybridisation signals of sub-arrays within slides were reproducible (r = 0.79) with a high correlation coefficient of hybridisation repetitions (0.73). Our results demonstrate the potential of microarray-based hybridisation for identification of multiple pathogen targets, which will find application in quarantine laboratories, where parallel testing for diverse pathogens is essential. PMID:15800764

  7. The Role of 16S rRNA Gene Sequencing in Confirmation of Suspected Neonatal Sepsis.


    El Gawhary, Somaia; El-Anany, Mervat; Hassan, Reem; Ali, Doaa; El Gameel, El Qassem


    Different molecular assays for the detection of bacterial DNA in the peripheral blood represented a diagnostic tool for neonatal sepsis. We targeted to evaluate the role of 16S rRNA gene sequencing to screen for bacteremia to confirm suspected neonatal sepsis (NS) and compare with risk factors and septic screen testing. Sixty-two neonates with suspected NS were enrolled. White blood cells count, I/T ratio, C-reactive protein, blood culture and 16S rRNA sequencing were performed. Blood culture was positive in 26% of cases, and PCR was positive in 26% of cases. Evaluation of PCR for the diagnosis of NS showed sensitivity 62.5%, specificity 86.9%, PPV 62.5%, NPV 86.9% and accuracy of 79.7%. 16S rRNA PCR increased the sensitivity of detecting bacterial DNA in newborns with signs of sepsis from 26 to 35.4%, and its use can be limited to cases with the most significant risk factors and positive septic screen.

  8. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.


    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath


    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  9. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.


    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C


    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  10. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.


    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C


    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  11. Comparison of two approaches for the classification of 16S rRNA gene sequences.


    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan


    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods.

  12. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.


    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  13. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.


    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M


    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  14. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr


    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  15. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences.


    Yarza, Pablo; Yilmaz, Pelin; Pruesse, Elmar; Glöckner, Frank Oliver; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Whitman, William B; Euzéby, Jean; Amann, Rudolf; Rosselló-Móra, Ramon


    Publicly available sequence databases of the small subunit ribosomal RNA gene, also known as 16S rRNA in bacteria and archaea, are growing rapidly, and the number of entries currently exceeds 4 million. However, a unified classification and nomenclature framework for all bacteria and archaea does not yet exist. In this Analysis article, we propose rational taxonomic boundaries for high taxa of bacteria and archaea on the basis of 16S rRNA gene sequence identities and suggest a rationale for the circumscription of uncultured taxa that is compatible with the taxonomy of cultured bacteria and archaea. Our analyses show that only nearly complete 16S rRNA sequences give accurate measures of taxonomic diversity. In addition, our analyses suggest that most of the 16S rRNA sequences of the high taxa will be discovered in environmental surveys by the end of the current decade.

  16. Phylogenetic Analysis of the Spider Mite Sub-Family Tetranychinae (Acari: Tetranychidae) Based on the Mitochondrial COI Gene and the 18S and the 5′ End of the 28S rRNA Genes Indicates That Several Genera Are Polyphyletic

    PubMed Central

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo


    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825–1,901 bp) and 28S (the 5′ end of 646–743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered. PMID:25289639

  17. Virtual metagenome reconstruction from 16S rRNA gene sequences.


    Okuda, Shujiro; Tsuchiya, Yuki; Kiriyama, Chiho; Itoh, Masumi; Morisaki, Hisao


    Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive. Here we describe a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing. We demonstrate this approach using 16S rRNA gene sequences obtained from denaturing gradient gel electrophoresis analysis, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations. Furthermore, we validate a virtual metagenome using a published metagenome for cocoa bean fermentation samples, and show that metagenomes reconstructed from biofilm formation samples allow for the study of the gene pool dynamics that are necessary for biofilm growth.

  18. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.


    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  19. Primer and platform effects on 16S rRNA tag sequencing


    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  20. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  1. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.


    Soni, Dharmendra Kumar; Dubey, Suresh Kumar


    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  2. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  3. Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  4. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.


    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  5. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences.


    Wright, Erik S; Yilmaz, L Safak; Noguera, Daniel R


    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (

  6. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.


    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C


    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  7. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.


    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa


    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  8. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa


    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  9. Strategy for microbiome analysis using 16S rRNA gene sequence analysis on the Illumina sequencing platform.


    Ram, Jeffrey L; Karim, Aos S; Sendler, Edward D; Kato, Ikuko


    Understanding the identity and changes of organisms in the urogenital and other microbiomes of the human body may be key to discovering causes and new treatments of many ailments, such as vaginosis. High-throughput sequencing technologies have recently enabled discovery of the great diversity of the human microbiome. The cost per base of many of these sequencing platforms remains high (thousands of dollars per sample); however, the Illumina Genome Analyzer (IGA) is estimated to have a cost per base less than one-fifth of its nearest competitor. The main disadvantage of the IGA for sequencing PCR-amplified 16S rRNA genes is that the maximum read-length of the IGA is only 100 bases; whereas, at least 300 bases are needed to obtain phylogenetically informative data down to the genus and species level. In this paper we describe and conduct a pilot test of a multiplex sequencing strategy suitable for achieving total reads of > 300 bases per extracted DNA molecule on the IGA. Results show that all proposed primers produce products of the expected size and that correct sequences can be obtained, with all proposed forward primers. Various bioinformatic optimization of the Illumina Bustard analysis pipeline proved necessary to extract the correct sequence from IGA image data, and these modifications of the data files indicate that further optimization of the analysis pipeline may improve the quality rankings of the data and enable more sequence to be correctly analyzed. The successful application of this method could result in an unprecedentedly deep description (800,000 taxonomic identifications per sample) of the urogenital and other microbiomes in a large number of samples at a reasonable cost per sample. PMID:21361774

  10. CATCh, an ensemble classifier for chimera detection in 16S rRNA sequencing studies.


    Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen; Monsieurs, Pieter


    In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

  11. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.


    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  12. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing

    PubMed Central

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan


    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  13. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA.

    PubMed Central

    Weller, R; Weller, J W; Ward, D M


    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences from three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type. Images PMID:1711832

  14. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    SciTech Connect

    Weller, R.; Ward, D.M. ); Weller, J.W. )


    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  15. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.


    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V


    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences. PMID:25523504

  16. The feline oral microbiome: a provisional 16S rRNA gene based taxonomy with full-length reference sequences.


    Dewhirst, Floyd E; Klein, Erin A; Bennett, Marie-Louise; Croft, Julie M; Harris, Stephen J; Marshall-Jones, Zoe V


    The human oral microbiome is known to play a significant role in human health and disease. While less well studied, the feline oral microbiome is thought to play a similarly important role. To determine roles oral bacteria play in health and disease, one first has to be able to accurately identify bacterial species present. 16S rRNA gene sequence information is widely used for molecular identification of bacteria and is also useful for establishing the taxonomy of novel species. The objective of this research was to obtain full 16S rRNA gene reference sequences for feline oral bacteria, place the sequences in species-level phylotypes, and create a curated 16S rRNA based taxonomy for common feline oral bacteria. Clone libraries were produced using "universal" and phylum-selective PCR primers and DNA from pooled subgingival plaque from healthy and periodontally diseased cats. Bacteria in subgingival samples were also cultivated to obtain isolates. Full-length 16S rDNA sequences were determined for clones and isolates that represent 171 feline oral taxa. A provisional curated taxonomy was developed based on the position of each taxon in 16S rRNA phylogenetic trees. The feline oral microbiome curated taxonomy and 16S rRNA gene reference set will allow investigators to refer to precisely defined bacterial taxa. A provisional name such as "Propionibacterium sp. feline oral taxon FOT-327" is an anchor to which clone, strain or GenBank names or accession numbers can point. Future next-generation-sequencing studies of feline oral bacteria will be able to map reads to taxonomically curated full-length 16S rRNA gene sequences.

  17. Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.


    Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V


    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  18. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    PubMed Central

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.


    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  19. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.


    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  20. CLUSTOM: a novel method for clustering 16S rRNA next generation sequences by overlap minimization.


    Hwang, Kyuin; Oh, Jeongsu; Kim, Tae-Kyung; Kim, Byung Kwon; Yu, Dong Su; Hou, Bo Kyeng; Caetano-Anollés, Gustavo; Hong, Soon Gyu; Kim, Kyung Mo


    The recent nucleic acid sequencing revolution driven by shotgun and high-throughput technologies has led to a rapid increase in the number of sequences for microbial communities. The availability of 16S ribosomal RNA (rRNA) gene sequences from a multitude of natural environments now offers a unique opportunity to study microbial diversity and community structure. The large volume of sequencing data however makes it time consuming to assign individual sequences to phylotypes by searching them against public databases. Since ribosomal sequences have diverged across prokaryotic species, they can be grouped into clusters that represent operational taxonomic units. However, available clustering programs suffer from overlap of sequence spaces in adjacent clusters. In natural environments, gene sequences are homogenous within species but divergent between species. This evolutionary constraint results in an uneven distribution of genetic distances of genes in sequence space. To cluster 16S rRNA sequences more accurately, it is therefore essential to select core sequences that are located at the centers of the distributions represented by the genetic distance of sequences in taxonomic units. Based on this idea, we here describe a novel sequence clustering algorithm named CLUSTOM that minimizes the overlaps between adjacent clusters. The performance of this algorithm was evaluated in a comparative exercise with existing programs, using the reference sequences of the SILVA database as well as published pyrosequencing datasets. The test revealed that our algorithm achieves higher accuracy than ESPRIT-Tree and mothur, few of the best clustering algorithms. Results indicate that the concept of an uneven distribution of sequence distances can effectively and successfully cluster 16S rRNA gene sequences. The algorithm of CLUSTOM has been implemented both as a web and as a standalone command line application, which are available at

  1. Filtering and ranking techniques for automated selection of high-quality 16S rRNA gene sequences.


    De Smet, Wim; De Loof, Karel; De Vos, Paul; Dawyndt, Peter; De Baets, Bernard


    StrainInfo has augmented its type strain and species/subspecies passports with a recommendation for a high-quality 16S rRNA gene sequence available from the public sequence databases. These recommendations are generated by an automated pipeline that collects all candidate 16S rRNA gene sequences for a prokaryotic type strain, filters out low-quality sequences and retains a high-quality sequence from the remaining pool. Due to thorough automation, recommendations can be renewed daily using the latest updates of the public sequence databases and the latest species descriptions. We discuss the quality criteria constructed to filter and rank available 16S rRNA gene sequences, and show how a partially ordered set (poset) ranking algorithm can be applied to solve the multi-criteria ranking problem of selecting the best candidate sequence. The proof of concept of the recommender system is validated by comparing the results of automated selection with an expert selection made in the All-Species Living Tree Project. Based on these validation results, the pipeline may reliably be applied for non-type strains and developed further for the automated selection of housekeeping genes.

  2. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.


    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin


    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  3. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.


    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike


    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type.

  4. First report of neonatal bacteremia caused by "Haemophilus quentini" diagnosed by 16S rRNA gene sequencing, Italy.


    Giufrè, Maria; Cardines, Rita; Degl'Innocenti, Roberto; Cerquetti, Marina


    We report the first case of neonatal bacteremia caused by a "Haemophilus quentini" isolate in Italy. The isolate was differentiated from H. influenzae by 16S rRNA sequencing and was characterized by comparison with the wild-type "H. quentini" CCUG 36167. Both isolates carried substitutions in penicillin-binding protein 3 but were susceptible to aminopenicillins.

  5. Phylogenetic analyses among octocorals (Cnidaria): mitochondrial and nuclear DNA sequences (lsu-rRNA, 16S and ssu-rRNA, 18S) support two convergent clades of branching gorgonians.


    Armando Sánchez, Juan; Lasker, Howard R; Taylor, Derek J


    Gorgonian octocorals lack corroborated hypotheses of phylogeny. This study reconstructs genealogical relationships among some octocoral species based on published DNA sequences from the large ribosomal subunit of the mitochondrial RNA (lsu-rRNA, 16S: 524bp and 21 species) and the small subunit of the nuclear RNA (ssu-rRNA, 18S: 1815bp and 13 spp) using information from insertions-deletions (INDELS) and the predicted secondary structure of the lsu-rRNA (16S). There were seven short (3-10bp) INDELS in the 18S with consistent phylogenetic information. The INDELS in the 16S corresponded to informative signature sequences homologous to the G13 helix found in Escherichia coli. We found two main groups of gorgonian octocorals using a maximum parsimony analysis of the two genes. One group corresponds to deep-water taxa including species from the suborders Calcaxonia and Scleraxonia characterized by an enlargement of the G13 helix. The second group has species from Alcyoniina, Holaxonia and again Scleraxonia characterized by insertions in the 18S. Gorgonian corals, branching colonies with a gorgonin-containing flexible multilayered axis (Holaxonia and Calcaxonia), do not form a monophyletic group. These corroborated results from maternally inherited (16S) and biparentally inherited (18S) genes support a hypothesis of independent evolution of branching in the two octocoral clades.

  6. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.


    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio


    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  7. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  8. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  9. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  10. An improved amplification and sequencing strategy for phylogenetic studies using the mitochondrial large subunit rRNA gene.


    Parker, A; Kornfield, I


    Numerous molecular systematic studies have employed variation in the mitochondrial large subunit (16s) rRNA gene to infer patterns of relationship among species and higher taxa. The primers most commonly employed in 16s rRNA amplification and sequencing bracket an approximately 600 bp portion of this gene. However, most of the informative variation occurs within a 200 bp subset of this segment. We describe a novel primer pair designed to amplify this variable region in a wide range of taxa, allowing broader application and considerable streamlining of data acquisition for studies using this gene.

  11. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.


    Weller, R; Ward, D M


    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  12. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing.


    Díez, B; Pedrós-Alió, C; Massana, R


    Very small eukaryotic organisms (picoeukaryotes) are fundamental components of marine planktonic systems, often accounting for a significant fraction of the biomass and activity in a system. Their identity, however, has remained elusive, since the small cells lack morphological features for identification. We determined the diversity of marine picoeukaryotes by sequencing cloned 18S rRNA genes in five genetic libraries from North Atlantic, Southern Ocean, and Mediterranean Sea surface waters. Picoplankton were obtained by filter size fractionation, a step that excluded most large eukaryotes and recovered most picoeukaryotes. Genetic libraries of eukaryotic ribosomal DNA were screened by restriction fragment length polymorphism analysis, and at least one clone of each operational taxonomic unit (OTU) was partially sequenced. In general, the phylogenetic diversity in each library was rather great, and each library included many different OTUs and members of very distantly related phylogenetic groups. Of 225 eukaryotic clones, 126 were affiliated with algal classes, especially the Prasinophyceae, the Prymnesiophyceae, the Bacillariophyceae, and the Dinophyceae. A minor fraction (27 clones) was affiliated with clearly heterotrophic organisms, such as ciliates, the chrysomonad Paraphysomonas, cercomonads, and fungi. There were two relatively abundant novel lineages, novel stramenopiles (53 clones) and novel alveolates (19 clones). These lineages are very different from any organism that has been isolated, suggesting that there are previously unknown picoeukaryotes. Prasinophytes and novel stramenopile clones were very abundant in all of the libraries analyzed. These findings underscore the importance of attempts to grow the small eukaryotic plankton in pure culture.

  13. Morphology, morphogenesis and small subunit rRNA gene sequence of a soil hypotrichous ciliate, Perisincirra paucicirrata (Ciliophora, Kahliellidae), from the shoreline of the Yellow River, North China.


    Li, Fengchao; Xing, Yi; Li, Jiamei; Al-Rasheid, Khaled A S; He, Songke; Shao, Chen


    The morphology, morphogenesis, and 18S rRNA gene sequence of a soil hypotrichous ciliate Perisincirra paucicirrata, isolated from north China, were investigated. Perisincirra paucicirrata differs from its congeners in: (1) having a body length to width ratio in vivo of 4:1, (2) its adoral zone occupying between 15% and 25% of the total body length, and (3) the presence of two parabuccal cirri, three left (with 10-16 cirri each) and two right marginal rows (with 14-24 cirri each), and three dorsal kineties. Our study offers a first attempt to begin to map the morphogenetic processes of the genus, which are mainly characterised by the following: the formation of four frontal ventral transverse anlagens for each daughter cell, with the proter's anlage I originating from the reorganised anterior part of the parental paroral; the paroral and endoral anlage developed from the reorganised old endoral and do not contribute the first frontal cirrus; the frontoventral transverse anlage I contributing the left frontal cirrus; anlage II generating the middle frontal and the buccal cirri; anlage III developing the right frontal cirrus and the anterior parabuccal cirrus; and anlage IV contributing the posterior parabuccal cirrus. As an additional contribution, we judge that the inner one or the two right rows of P. kahli and P. longicirrata are marginal rows. Phylogenetic analysis based on SSU rDNA sequences suggests that Perisincirra is related to sporadotrichids, but provides no credible evidence for its taxonomic position.

  14. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.


    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil


    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci.

  15. Phylogenetic position of the genus Cyrtostrombidium, with a description of Cyrtostrombidium paralongisomum nov. spec. and a redescription of Cyrtostrombidium longisomum Lynn & Gilron, 1993 (Protozoa, Ciliophora) based on live observation, protargol impregnation, and 18S rDNA sequences.


    Tsai, Sheng-Fang; Chen, Wei-Ting; Chiang, Kuo-Ping


    We redescribe Cyrtostrombidium longisomum Lynn & Gilron, 1993, the type species of the genus Cyrtostrombidium, and describe the new species Cyrtostrombidium paralongisomum n. sp. using live observation, protargol staining and molecular data. The morphological characters of these two species are clearly distinct, i.e., dikinetid numbers in the girdle and ventral kineties; however, it is difficult to separate them by 18S rDNA sequences because they differ by only 8 bp, indicating that 18S rDNA sequences are insufficient for separating different species in the genus Cyrtostrombidium. We not only observed the position of the oral primordium in the genus Cyrtostrombidium but also observed a possibly homoplasious trait, a dorsal split in the girdle kinety, in (1) Apostrombidium, (2) Varistrombidium, and (3) Cyrtostrombidium/Williophrya. This partially supports the hypothesis of somatic ciliary pattern evolution recently put forth by Agatha and Strüder-Kypke.

  16. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  17. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  18. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  19. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].


    Petrov, N B; Vladychenskaia, N S


    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  20. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.


    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R


    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms.

  1. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  2. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.


    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  3. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.


    Garcia-Mazcorro, Jose F


    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  4. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.


    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna


    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  5. Species-level identification of staphylococci isolated from bovine mastitis in Brazil using partial 16S rRNA sequencing.


    Lange, Carla C; Brito, Maria A V P; Reis, Daniele R L; Machado, Marco A; Guimarães, Alessandro S; Azevedo, Ana L S; Salles, Érica B; Alvim, Mariana C T; Silva, Fabiana S; Meurer, Igor R


    Staphylococci isolated from bovine milk and not classified as Staphylococcus aureus represent a heterogeneous group of microorganisms that are frequently associated with bovine mastitis. The identification of these microorganisms is important, although it is difficult and relatively costly. Genotypic methods add precision in the identification of Staphylococcus species. In the present study, partial 16S rRNA sequencing was used for the species identification of coagulase-positive and coagulase-negative staphylococci isolated from bovine mastitis. Two hundred and two (95%) of the 213 isolates were successfully identified at the species level. The assigning of an isolate to a particular species was based on ≥99% identity with 16S rRNA sequences deposited in GenBank. The identified isolates belonged to 13 different Staphylococcus species; Staphylococcus chromogenes, S. aureus and Staphylococcus epidermidis were the most frequently identified species. Eight isolates could not be assigned to a single species, as the obtained sequences showed 99% or 100% similarity to sequences from two or three different Staphylococcus species. The relatedness of these isolates with the other isolates and reference strains was visualized using a cladogram. In conclusion, 16S rRNA sequencing was an objective and accurate method for the proper identification of Staphylococcus species isolated from bovine mastitis. Additional target genes could be used in non-conclusive cases for the species-level identification of these microorganisms. PMID:25704228

  6. Phylogenetic diversity of bacterial symbionts of Solemya hosts based on comparative sequence analysis of 16S rRNA genes.

    PubMed Central

    Krueger, D M; Cavanaugh, C M


    The bacterial endosymbionts of two species of the bivalve genus Solemya from the Pacific Ocean, Solemya terraeregina and Solemya pusilla, were characterized. Prokaryotic cells resembling gram-negative bacteria were observed in the gills of both host species by transmission electron microscopy. The ultrastructure of the symbiosis in both host species is remarkably similar to that of all previously described Solemya spp. By using sequence data from 16S rRNA, the identity and evolutionary origins of the S. terraeregina and S. pusilla symbionts were also determined. Direct sequencing of PCR-amplified products from host gill DNA with primers specific for Bacteria 16S rRNA genes gave a single, unambiguous sequence for each of the two symbiont species. In situ hybridization with symbiont-specific oligonucleotide probes confirmed that these gene sequences belong to the bacteria residing in the hosts gills. Phylogenetic analyses of the 16S rRNA gene sequences by both distance and parsimony methods identify the S. terraeregina and S. pusilla symbionts as members of the gamma subdivision of the Proteobacteria. In contrast to symbionts of other bivalve families, which appear to be monophyletic, the S. terraeregina and S. pusilla symbionts share a more recent common ancestry with bacteria associating endosymbiotically with bivalves of the superfamily Lucinacea than with other Solemya symbionts (host species S. velum, S. occidentalis, and S. reidi). Overall, the 16S rRNA gene sequence data suggest that the symbionts of Solemya hosts represent at least two distinct bacterial lineages within the gamma-Proteobacteria. While it is increasingly clear that all extant species of Solemya live in symbiosis with specific bacteria, the associations appear to have multiple evolutionary origins. PMID:8979342

  7. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    SciTech Connect

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja


    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  8. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.


    Wei, Ze-Gang; Zhang, Shao-Wu


    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users.

  9. MtHc: a motif-based hierarchical method for clustering massive 16S rRNA sequences into OTUs.


    Wei, Ze-Gang; Zhang, Shao-Wu


    The recent sequencing revolution driven by high-throughput technologies has led to rapid accumulation of 16S rRNA sequences for microbial communities. Clustering short sequences into operational taxonomic units (OTUs) is an initial crucial process in analyzing metagenomic data. Although many methods have been proposed for OTU inferences, a major challenge is the balance between inference accuracy and computational efficiency. To address these challenges, we present a novel motif-based hierarchical method (namely MtHc) for clustering massive 16S rRNA sequences into OTUs with high clustering accuracy and low memory usage. Suppose all the 16S rRNA sequences can be used to construct a complete weighted network, where sequences are viewed as nodes, each pair of sequences is connected by an imaginary edge, and the distance of a pair of sequences represents the weight of the edge. MtHc consists of three main phrases. First, heuristically search the motif that is defined as n-node sub-graph (in the present study, n = 3, 4, 5), in which the distance between any two nodes is less than a threshold. Second, use the motif as a seed to form candidate clusters by computing the distances of other sequences with the motif. Finally, hierarchically merge the candidate clusters to generate the OTUs by only calculating the distances of motifs between two clusters. Compared with the existing methods on several simulated and real-life metagenomic datasets, we demonstrate that MtHc has higher clustering performance, less memory usage and robustness for setting parameters, and that it is more effective to handle the large-scale metagenomic datasets. The MtHC software can be freely download from for academic users. PMID:25912934

  10. Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers

    PubMed Central

    Hansson, Ingrid; Persson, Marianne; Svensson, Linda; Engvall, Eva Olsson; Johansson, Karl-Erik


    Background Campylobacter is the most commonly reported bacterial cause of enteritis in humans in the EU Member States and other industrialized countries. One significant source of infection is broilers and consumption of undercooked broiler meat. Campylobacter jejuni is the Campylobacter sp. predominantly found in infected humans and colonized broilers. Sequence analysis of the 16S rRNA gene is very useful for identification of bacteria to genus and species level. The objectives in this study were to determine the degree of intraspecific variation in the 16S rRNA genes of C. jejuni and C. coli and to determine whether the 16S rRNA sequence types correlated with genotypes generated by PFGE analysis of SmaI restricted genomic DNA of the strains. Methods The 16S rRNA genes of 45 strains of C. jejuni and two C. coli strains isolated from broilers were sequenced and compared with 16S rRNA sequences retrieved from the Ribosomal Database Project or GenBank. The strains were also genotyped by PFGE after digestion with SmaI. Results Sequence analyses of the 16S rRNA genes revealed nine sequence types of the Campylobacter strains and the similarities between the different sequence types were in the range 99.6–99.9%. The number of nucleotide substitutions varied between one and six among the nine 16S rRNA sequence types. One of the nine 16S rRNA sequence profiles was common to 12 of the strains from our study and two of these were identified as Campylobacter coli by PCR/REA. The other 10 strains were identified as Campylobacter jejuni. Five of the nine sequence types were also found among the Campylobacter sequences deposited in GenBank. The three 16S rRNA genes in the analysed strains were identical within each individual strain for all 47 strains. Conclusion C. jejuni and C. coli seem to lack polymorphisms in their 16S rRNA gene, but phylogenetic analysis based on 16S rRNA sequences was not always sufficient for differentiation between C. jejuni and C. coli. The strains

  11. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    PubMed Central

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.


    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

  12. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.


    Distel, D L; Lane, D J; Olsen, G J; Giovannoni, S J; Pace, B; Pace, N R; Stahl, D A; Felbeck, H


    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis [C. R. Woese, Microbiol. Rev. 51: 221-271, 1987]). Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species. PMID:3286609

  13. Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences.


    Kuhnert, P; Capaul, S E; Nicolet, J; Frey, J


    The sequences of the 16S rRNA genes (rrs genes) of Clostridium chauvoei, the causative agent of blackleg in cattle, and the phenotypically related organism Clostridium septicum were determined. After amplification of 1,507-bp PCR fragments from the corresponding rrs genes, the sequences were determined in a single round of sequencing by using conserved region primers. A sequence similarity analysis of the sequences revealed the close phylogenetic relationship of C. chauvoei and C. septicum in Clostridium cluster I (M. D. Collins, P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994), which includes Clostridium carnis, Clostridium perfringens, Clostridium botulinum, and Clostridium tetani. We found that 99.3% of the nucleotides in the genes of C. chauvoei and C. septicum are identical.

  14. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.


    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa


    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product. PMID:26925607

  15. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.


    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa


    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  16. Description of an unusual Neisseria meningitidis isolate containing and expressing Neisseria gonorrhoeae-Specific 16S rRNA gene sequences.


    Walcher, Marion; Skvoretz, Rhonda; Montgomery-Fullerton, Megan; Jonas, Vivian; Brentano, Steve


    An apparently rare Neisseria meningitidis isolate containing one copy of a Neisseria gonorrhoeae 16S rRNA gene is described herein. This isolate was identified as N. meningitidis by biochemical identification methods but generated a positive signal with Gen-Probe Aptima assays for the detection of Neisseria gonorrhoeae. Direct 16S rRNA gene sequencing of the purified isolate revealed mixed bases in signature regions that allow for discrimination between N. meningitidis and N. gonorrhoeae. The mixed bases were resolved by sequencing individually PCR-amplified single copies of the genomic 16S rRNA gene. A total of 121 discrete sequences were obtained; 92 (76%) were N. meningitidis sequences, and 29 (24%) were N. gonorrhoeae sequences. Based on the ratio of species-specific sequences, the N. meningitidis strain seems to have replaced one of its four intrinsic 16S rRNA genes with the gonococcal gene. Fluorescence in situ hybridization (FISH) probes specific for meningococcal and gonococcal rRNA were used to demonstrate the expression of the rRNA genes. Interestingly, the clinical isolate described here expresses both N. meningitidis and N. gonorrhoeae 16S rRNA genes, as shown by positive FISH signals with both probes. This explains why the probes for N. gonorrhoeae in the Gen-Probe Aptima assays cross-react with this N. meningitidis isolate. The N. meningitidis isolate described must have obtained N. gonorrhoeae-specific DNA through interspecies recombination.

  17. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.


    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau


    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  18. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  19. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  20. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.


    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia


    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  1. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.


    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M


    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  2. Comparison of MALDI-TOF MS, Housekeeping Gene Sequencing, and 16S rRNA Gene Sequencing for Identification of Aeromonas Clinical Isolates

    PubMed Central

    Shin, Hee Bong; Yoon, Jihoon; Lee, Yangsoon; Kim, Myung Sook


    Purpose The genus Aeromonas is a pathogen that is well known to cause severe clinical illnesses, ranging from gastroenteritis to sepsis. Accurate identification of A. hydrophila, A. caviae, and A. veronii is important for the care of patients. However, species identification remains difficult using conventional methods. The aim of this study was to compare the accuracy of different methods of identifying Aeromonas at the species level: a biochemical method, matrix-assisted laser desorption ionization mass spectrometry-time of flight (MALDI-TOF MS), 16S rRNA sequencing, and housekeeping gene sequencing (gyrB, rpoB). Materials and Methods We analyzed 65 Aeromonas isolates recovered from patients at a university hospital in Korea between 1996 and 2012. The isolates were recovered from frozen states and tested using the following four methods: a conventional biochemical method, 16S rRNA sequencing, housekeeping gene sequencing with phylogenetic analysis, and MALDI-TOF MS. Results The conventional biochemical method and 16S rRNA sequencing identified Aeromonas at the genus level very accurately, although species level identification was unsatisfactory. MALDI-TOF MS system correctly identified 60 (92.3%) isolates at the species level and an additional four (6.2%) at the genus level. Overall, housekeeping gene sequencing with phylogenetic analysis was found to be the most accurate in identifying Aeromonas at the species level. Conclusion The most accurate method of identification of Aeromonas to species level is by housekeeping gene sequencing, although high cost and technical difficulty hinder its usage in clinical settings. An easy-to-use identification method is needed for clinical laboratories, for which MALDI-TOF MS could be a strong candidate. PMID:25684008

  3. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.


    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  4. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

    SciTech Connect

    Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren


    Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g. Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.

  5. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers.


    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P < 0.05). Taxonomic classification accuracy was also greater in the near full-length read. UniFrac distance matrices using jackknifed UPGMA clustering also noted differences between the communities. These data support the consensus that longer reads result in a finer phylogenetic resolution that may not be achieved by shorter 16S rRNA gene fragments. Our work on the cattle rumen bacterial community demonstrates that utilizing near full-length 16S reads may be useful in conducting a more thorough study, or for developing a niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  6. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.


    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  7. Detection and characterization of fungal infections of Ammophila arenaria (marram grass) roots by denaturing gradient gel electrophoresis of specifically amplified 18s rDNA.

    PubMed Central

    Kowalchuk, G A; Gerards, S; Woldendorp, J W


    Marram grass (Ammophila arenaria L.), a sand-stabilizing plant species in coastal dune areas, is affected by a specific pathosystem thought to include both plant-pathogenic fungi and nematodes. To study the fungal component of this pathosystem, we developed a method for the cultivation-independent detection and characterization of fungi infecting plant roots based on denaturing gradient gel electrophoresis (DGGE) of specifically amplified DNA fragments coding for 18S rRNA (rDNA). A nested PCR strategy was employed to amplify a 569-bp region of the 18S rRNA gene, with the addition of a 36-bp GC clamp, from fungal isolates, from roots of test plants infected in the laboratory, and from field samples of marram grass roots from both healthy and degenerating stands from coastal dunes in The Netherlands. PCR products from fungal isolates were subjected to DGGE to examine the variation seen both between different fungal taxa and within a single species. DGGE of the 18S rDNA fragments could resolve species differences from fungi used in this study yet was unable to discriminate between strains of a single species. The 18S rRNA genes from 20 isolates of fungal species previously recovered from A. arenaria roots were cloned and partially sequenced to aid in the interpretation of DGGE data. DGGE patterns recovered from laboratory plants showed that this technique could reliably identify known plant-infecting fungi. Amplification products from field A. arenaria roots also were analyzed by DGGE, and the major bands were excised, reamplified, sequenced, and subjected to phylogenetic analysis. Some recovered 18S rDNA sequences allowed for phylogenetic placement to the genus level, whereas other sequences were not closely related to known fungal 18S rDNA sequences. The molecular data presented here reveal fungal diversity not detected in previous culture-based surveys. PMID:9327549

  8. Comparison of Traditional Phenotypic Identification Methods with Partial 5′ 16S rRNA Gene Sequencing for Species-Level Identification of Nonfermenting Gram-Negative Bacilli▿

    PubMed Central

    Cloud, Joann L.; Harmsen, Dag; Iwen, Peter C.; Dunn, James J.; Hall, Gerri; LaSala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L.; Mellmann, Alexander


    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5′ 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB. PMID:20164273

  9. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau


    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  10. Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.

    PubMed Central

    Lange, T S; Borovjagin, A V; Gerbi, S A


    U8 small nucleolar RNA (snoRNA) is essential for metazoan ribosomal RNA (rRNA) processing in nucleoli. The sequences and structural features in Xenopus U8 snoRNA that are required for its nucleolar localization were analyzed. Fluorescein-labeled U8 snoRNA was injected into Xenopus oocyte nuclei, and fluorescence microscopy of nucleolar preparations revealed that wild-type Xenopus U8 snoRNA localized to nucleoli, regardless of the presence or nature of the 5' cap on the injected U8 snoRNA. Nucleolar localization was observed when loops or stems in the 5' portion of U8 that are critical for U8 snoRNA function in rRNA processing were mutated. Therefore, sites of interaction in U8 snoRNA that potentially tether it to pre-rRNA are not essential for nucleolar localization of U8. Boxes C and D are known to be nucleolar localization elements (NoLEs) for U8 snoRNA and other snoRNAs of the Box C/D family. However, the spatial relationship of Box C to Box D was not crucial for U8 nucleolar localization, as demonstrated here by deletion of sequences in the two stems that separate them. These U8 mutants can localize to nucleoli and function in rRNA processing as well. The single-stranded Cup region in U8, adjacent to evolutionarily conserved Box C, functions as a NoLE in addition to Boxes C and D. Cup is unique to U8 snoRNA and may help bind putative protein(s) needed for nucleolar localization. Alternatively, Cup may help to retain U8 snoRNA within the nucleolus. PMID:9671052

  11. Nucleotide sequence of the 16S - 23S spacer region in an rRNA gene cluster from tobacco chloroplast DNA.

    PubMed Central

    Takaiwa, F; Sugiura, M


    The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from tobacco chloroplasts has been determined. The spacer region is 2080 bp long and encodes tRNAIle and tRNAAla genes which contain intervening sequences of 707 bp and 710 bp, respectively. Strong homology between the two intervening sequences is observed. These spacer tRNAs are synthesized as part of an 8.2 kb precursor molecule containing 16S and 23S rRNA sequences. Images PMID:6281739

  12. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.


    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad


    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species. PMID:25313278

  13. Evaluation of 16SpathDB 2.0, an automated 16S rRNA gene sequence database, using 689 complete bacterial genomes.


    Teng, Jade L L; Ho, Tom C C; Yeung, Ronald S Y; Wong, Annette Y P; Wang, Haiyin; Chen, Chen; Fung, Kitty S C; Lau, Susanna K P; Woo, Patrick C Y


    Interpretation of 16S rRNA sequences is a difficult problem faced by clinical microbiologists and technicians. In this study, we evaluated the updated 16SpathDB 2.0 database, using 689 16S rRNA sequences from 689 complete genomes of medically important bacteria. Among these 689 16S rRNA sequences, none was wrongly identified, with 35.8% reported as a single bacterial species having >98% identity with the query sequence (category 1), 63.9% reported as more than 1 bacterial species having >98% identity with the query sequence (category 2), 0.3% reported to the genus level (category 3), and none reported as no match (category 4). For the 16S rRNA sequences of non-duplicated bacterial species reported as category 1 or 2, the percentage of bacterial species reported as category 1 was significantly higher for anaerobic Gram-positive/Gram-negative bacteria than aerobic/facultative anaerobic Gram-positive/Gram-negative bacteria. 16SpathDB 2.0 is a user-friendly and accurate database for 16S rRNA sequence interpretation in clinical laboratories.

  14. Automatic identification of large collections of protein-coding or rRNA sequences.


    Arigon, Anne-Muriel; Perrière, Guy; Gouy, Manolo


    The number of available genomic sequences is growing very fast, due to the development of massive sequencing techniques. Sequence identification is needed and contributes to the assessment of gene and species evolutionary relationships. Automated bioinformatics tools are thus necessary to carry out these identification operations in an accurate and fast way. We developed HoSeqI (Homologous Sequence Identification), a software environment allowing this kind of automated sequence identification using homologous gene family databases. HoSeqI is accessible through a Web interface ( allowing to identify one or several sequences and to visualize resulting alignments and phylogenetic trees. We also implemented another application, MultiHoSeqI, to quickly add a large set of sequences to a family database in order to identify them, to update the database, or to help automatic genome annotation. Lately, we developed an application, ChiSeqI (Chimeric Sequence Identification), to automate the processes of identification of bacterial 16S ribosomal RNA sequences and of detection of chimeric sequences.

  15. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences.


    Dorsch, M; Lane, D; Stackebrandt, E


    The inter- and intrageneric relationships of the genus Vibrio were investigated by performing a comparative analysis of the 16S rRNAs of 10 species, including four pathogenic representatives. The results of immunological and 5S rRNA studies were confirmed in that the genus is a neighboring taxon of the family Enterobacteriaceae. With regard to the intrageneric structure, Vibrio alginolyticus, Vibrio campbellii, Vibrio natriegens, Vibrio harveyi, Vibrio proteolyticus, Vibrio parahaemolyticus, and Vibrio vulnificus form the core of the genus, while Vibrio (Listonella) anguillarum, Vibrio diazotrophicus, and Vibrio hollisae are placed on the outskirts of the genus. Variable regions around positions 80, 180, and 450 could be used as target sites for genus- and species-specific oligonucleotide probes and polymerase chain reaction primers to be used in molecular identification.

  16. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images.


    Stoeck, Thorsten; Fowle, William H; Epstein, Slava S


    Each year, thousands of new protistan 18S rRNA sequences are detected in environmental samples. Many of these sequences are molecular signatures of new protistan species, classes, and/or kingdoms that have never been seen before. The main goal of this study was to enable visualization of these novel organisms and to conduct quality ultrastructural examination. We achieved this goal by modifying standard procedures for cell fixation, fluorescence in situ hybridization, and scanning electron microscopy (SEM) and by making these methodologies work in concert. As a result, the same individual cell can now be detected by 18S rRNA-targeted fluorochrome-labeled probes and then viewed by SEM to reveal its diagnostic morphological characteristics. The method was successfully tested on a wide range of protists (alveolates, stramenopiles, kinetoplastids, and cryptomonads). The new methodology thus opens a way for fine microscopy studies of many organisms previously known exclusively by their 18S rRNA sequences.

  17. Phylogeny of some mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group.


    Pettersson, B; Uhlén, M; Johansson, K E


    Almost complete (> 96%) 16S rRNA sequences from nine ruminant mycoplasmas have been determined by solid-phase DNA sequencing. Polymorphisms were found in four of the 16S rRNA sequences, which indicated the existence of two different rRNA operons. Seven polymorphisms were found in Mycoplasma agalatiae, three were found in Mycoplasma bovis, one was found in Mycoplasma alkalescens, and one was found in Mycoplasma bovirhinis. The sequence data were used for construction of phylogenetic trees. All but one of the ruminant mycoplasmas sequenced in this work clustered in the hominis group. A close relationship was found between M. agalactiae and M. bovis, with a 99% nucleotide similarity between their 16S rRNA sequences. They were also found to be members of the Mycoplasma lipophilum cluster of the hominis group. Furthermore, the 16S rRNA comparisons showed that Mycoplasma alkalescens and Mycoplasma canadense are closely related (> 98.5%), and these species were found to cluster in the Mycoplasma hominis cluster of the hominis group. Interestingly, M. bovirhinis grouped in a new phylogenetic cluster of the hominis group. The new cluster, which was supported by bootstrap percentage values, signature nucleotide analysis, and higher-order structural elements, was named the Mycoplasma synoviae cluster. Mycoplasma bovoculi, Mycoplasma conjunctivae, and Mycoplasma ovipneumoniae clustered in the Mycoplasma neurolyticum cluster of the hominis group. Mycoplasma alvi clustered with Mycoplasma pirum in the M. pneumoniae cluster of the pneumoniae group.

  18. Phylogenetic position of foraminifera inferred from LSU rRNA gene sequences.


    Pawlowski, J; Bolivar, I; Guiard-Maffia, J; Gouy, M


    A 5'-terminal region of 1600-1800 base pairs was amplified, cloned, and sequenced in the large subunit rDNA (LSU rDNA) of four species of foraminifera. These sequences were compared with the homologous regions of 16 eukaryotic taxa in order to establish the phylogenetic position of foraminifera. Analysis of 610 unambiguously aligned bases shows that foraminifera branch closely to plasmodial and cellular slime molds in the middle of the eukaryotic tree--that is, much earlier than suggested by the fossil record. These data, the first DNA sequences reported for foraminifera, will help analyze this class of protists and the early evolution of eukaryotes.

  19. The sequence of Methanospirillum hungatei 23S rRNA confirms the specific relationship between the extreme halophiles and the Methanomicrobiales

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Ching, A.; Stetter, K. O.; Woese, C. R.


    We have determined the sequence of the 23S rRNA from the methanogenic archaeon Methanospirillum hungatei. This is the first such sequence from a member of the Methanomicrobiales. Moreover, it brings additional evidence to bear on the possible specific relationship between this particular group of methanogens and the extreme halophiles. Such evidence is critical in that several new (and relatively untested) methods of phylogenetic inference have lead to the controversial conclusion that the extreme halophiles are either not related to the archaea, or are only peripherally so. Analysis of the Methanospirillum hungatei 23S rRNA sequence shows the Methanomicrobiales are indeed a sister group of the extreme halophiles, further strengthening the conclusions reached from analysis of 16S rRNA sequences.

  20. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.


    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  1. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences

    PubMed Central

    Langille, Morgan G. I.; Zaneveld, Jesse; Caporaso, J. Gregory; McDonald, Daniel; Knights, Dan; Reyes, Joshua A.; Clemente, Jose C.; Burkepile, Deron E.; Vega Thurber, Rebecca L.; Knight, Rob; Beiko, Robert G.; Huttenhower, Curtis


    Profiling phylogenetic marker genes, such as the 16S rRNA gene, is a key tool for studies of microbial communities but does not provide direct evidence of a community’s functional capabilities. Here we describe PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States), a computational approach to predict the functional composition of a metagenome using marker gene data and a database of reference genomes. PICRUSt uses an extended ancestral-state reconstruction algorithm to predict which gene families are present and then combines gene families to estimate the composite metagenome. Using 16S information, PICRUSt recaptures key findings from the Human Microbiome Project and accurately predicts the abundance of gene families in host-associated and environmental communities, with quantifiable uncertainty. Our results demonstrate that phylogeny and function are sufficiently linked that this ‘predictive metagenomic’ approach should provide useful insights into the thousands of uncultivated microbial communities for which only marker gene surveys are currently available. PMID:23975157

  2. Spatiotemporal analysis of bacterial diversity in sediments of Sundarbans using parallel 16S rRNA gene tag sequencing.


    Basak, Pijush; Majumder, Niladri Shekhar; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Chakraborty, Arpita; SenGupta, Sohan; Roy, Arunava; Mukherjee, Arghya; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The influence of temporal and spatial variations on the microbial community composition was assessed in the unique coastal mangrove of Sundarbans using parallel 16S rRNA gene pyrosequencing. The total sediment DNA was extracted and subjected to the 16S rRNA gene pyrosequencing, which resulted in 117 Mbp of data from three experimental stations. The taxonomic analysis of the pyrosequencing data was grouped into 24 different phyla. In general, Proteobacteria were the most dominant phyla with predominance of Deltaproteobacteria, Alphaproteobacteria, and Gammaproteobacteria within the sediments. Besides Proteobacteria, there are a number of sequences affiliated to the following major phyla detected in all three stations in both the sampling seasons: Actinobacteria, Bacteroidetes, Planctomycetes, Acidobacteria, Chloroflexi, Cyanobacteria, Nitrospira, and Firmicutes. Further taxonomic analysis revealed abundance of micro-aerophilic and anaerobic microbial population in the surface layers, suggesting anaerobic nature of the sediments in Sundarbans. The results of this study add valuable information about the composition of microbial communities in Sundarbans mangrove and shed light on possible transformations promoted by bacterial communities in the sediments. PMID:25256302

  3. Molecular phylogenetics in 2D: ITS2 rRNA evolution and sequence-structure barcode from Veneridae to Bivalvia.


    Salvi, Daniele; Mariottini, Paolo


    In this study, we analyzed the nuclear ITS2 rRNA primary sequence and secondary structure in Veneridae and comparatively with 20 Bivalvia taxa to test the phylogenetic resolution of this marker and its suitability for molecular diagnosis at different taxonomic levels. Maximum likelihood and Bayesian trees based on primary sequences were congruent with (profile-) neighbor-joining trees based on a combined model of sequence-structure evolution. ITS2 showed higher resolution below the subfamily level, providing a phylogenetic signal comparable to (mitochondrial/nuclear) gene fragments 2-5 times longer. Structural elements of the ITS2 folding, such as specific mismatch pairing and compensatory base changes, provided further support for the monophyly of some groups and for their phylogenetic relationships. Veneridae ITS2 folding is structured in six domains (DI-VI) and shows five striking sequence-structure features. Two of them, the Basal and Apical STEMs, are common to Bivalvia, while the presence of both the Branched STEM and the Y/R stretches occurs in five superfamilies of the two Heterodonta orders Myoida and Veneroida, thus questioning their reciprocal monophyly. Our results validated the ITS2 as a suitable marker for venerids phylogenetics and taxonomy, and underlined the significance of including secondary structure information for both applications at several systematic levels within bivalves.

  4. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.


    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree


    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans.

  5. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.


    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert


    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes.

  6. Molecular phylogeny of the Heterotrichea (Ciliophora, Postciliodesmatophora) based on small subunit rRNA gene sequences.


    Schmidt, Stephanie L; Foissner, Wilhelm; Schlegel, Martin; Bernhard, Detlef


    A comprehensive molecular analysis of the phylogenetic relationships within the Heterotrichea including all described families is still lacking. For this reason, the complete nuclear small subunit (SSU) rDNA was sequenced from further representatives of the Blepharismidae and the Stentoridae. In addition, the SSU rDNA of a new, undescribed species of the genus Condylostomides (Condylostomatidae) was sequenced. The detailed phylogenetic analyses revealed a consistent branching pattern: while the terminal branches are generally well resolved, the basal relationships remain unsolved. Moreover, the data allow some conclusions about the macronuclear evolution within the genera Blepharisma, Stentor, and Spirostomum suggesting that a single, compact macronucleus represents the ancestral state. PMID:17669161

  7. 16S rRNA gene sequencing is a non-culture method of defining the specific bacterial etiology of ventilator-associated pneumonia.


    Xia, Li-Ping; Bian, Long-Yan; Xu, Min; Liu, Ying; Tang, Ai-Ling; Ye, Wen-Qin


    Ventilator-associated pneumonia (VAP) is an acquired respiratory tract infection following tracheal intubation. The most common hospital-acquired infection among patients with acute respiratory failure, VAP is associated with a mortality rate of 20-30%. The standard bacterial culture method for identifying the etiology of VAP is not specific, timely, or accurate in identifying the bacterial pathogens. This study used 16S rRNA gene metagenomic sequencing to identify and quantify the pathogenic bacteria in lower respiratory tract and oropharyngeal samples of 55 VAP patients. Sequencing of the 16S rRNA gene has served as a valuable tool in bacterial identification, particularly when other biochemical, molecular, or phenotypic identification techniques fail. In this study, 16S rRNA gene sequencing was performed in parallel with the standard bacterial culture method to identify and quantify bacteria present in the collected patient samples. Sequence analysis showed the colonization of multidrug-resistant strains in VAP secretions. Further, this method identified Prevotella, Proteus, Aquabacter, and Sphingomonas bacterial genera that were not detected by the standard bacterial culture method. Seven categories of bacteria, Streptococcus, Neisseria, Corynebacterium, Acinetobacter, Staphylococcus, Pseudomonas and Klebsiella, were detectable by both 16S rRNA gene sequencing and standard bacterial culture methods. Further, 16S rRNA gene sequencing had a significantly higher sensitivity in detecting Streptococcus and Pseudomonas when compared to standard bacterial culture. Together, these data present 16S rRNA gene sequencing as a novel VAP diagnosis tool that will further enable pathogen-specific treatment of VAP.

  8. [Cloning and sequencing of 16S rRNA gene of Phytoplasma CWB1 strain associated with cactus witches' broom].


    Cai, H; Li, F; Kong, B; Chen, H


    A 1.5 kb DNA fragment was amplified in DNA samples extracted from Opuntia salmiana porm showed witches'-broom symptom. The result indicates the existence of phytoplasma associated with this disease and this phytoplasma was designated as CWB1. The amplified fragment was ligated to pGEM-T easy vector and then transformed into JM109 strain of E. coli. Cloned DNA fragments were verified by PCR, restriction endonuclease (EcoRI) digestion and sequence analysis. The result revealed that the 16S rRNA gene of CWB1 consists of 1489 bp and shared 99.7% homology with Faba bean phyllody which belongs to phytoplasma 16S rII-C subgroup. So we can classify this strain into phytoplasma 16S rII-C subgroup. PMID:12552825

  9. rRNA fragmentation induced by a yeast killer toxin.


    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm


    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  10. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.


    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A


    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses.

  11. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.


    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo


    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  12. Identification of Lactobacillus Isolates from the Gastrointestinal Tract, Silage, and Yoghurt by 16S-23S rRNA Gene Intergenic Spacer Region Sequence Comparisons

    PubMed Central

    Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Ng, J.; Munro, K.; Alatossava, T.


    Lactobacillus isolates were identified by PCR amplification and sequencing of the region between the 16S and 23S rRNA genes (spacer region). The sequences obtained from the isolates were compared to those of reference strains held in GenBank. A similarity of 97.5% or greater was considered to provide identification. To check the reliability of the method, the V2-V3 region of the 16S rRNA gene was amplified and sequenced in the case of isolates whose spacer region sequences were less than 99% similar to that of a reference strain. Confirmation of identity was obtained in all instances. Spacer region sequencing provided rapid and accurate identification of Lactobacillus isolates obtained from gastrointestinal, yoghurt, and silage samples. It had an advantage over 16S V2-V3 sequence comparisons because it distinguished between isolates of Lactobacillus casei and Lactobacillus rhamnosus. PMID:10473450

  13. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K


    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  14. Phylogenetic relationships of Indian caecilians (Amphibia: Gymnophiona) inferred from mitochondrial rRNA gene sequences.


    Wilkinson, Mark; A Sheps, Jonathan; Oommen, Oommen V; Cohen, Bernard L


    India has a diverse caecilian fauna, including representatives of three of the six currently recognized families, the Caeciliidae, Ichthyophiidae, the endemic Uraeotyphlidae, but previous molecular phylogenetic studies of caecilians have not included sequences for any Indian caecilians. Partial 12S and 16S mitochondrial gene sequences were obtained for a single representative of each of the caecilian families found in India and aligned against previously reported sequences for 13 caecilian species. The resulting alignment (16 taxa, 1200 sites, of which 288 cannot be aligned unambiguously) was analyzed using parsimony, maximum-likelihood, and distance methods. As judged by bootstrap proportions, decay indices, and leaf stabilities, well-supported relationships of the Indian caecilians are recovered from the alignment. The data (1) corroborate the hypothesis, based on morphology, that the Uraeotyphlidae and Ichthyophiidae are sister taxa, (2) recover a monophyletic Ichthyophiidae, including Indian and South East Asian representatives, and (3) place the Indian caeciliid Gegeneophis ramaswamii as the sister group of the caeciliid caecilians of the Seychelles. Rough estimates of divergence times suggest an origin of the Uraeotyphlidae and Ichthyophiidae while India was isolated from Laurasia and Africa and are most consistent with an Indian origin of these families and subsequent dispersal of ichthyophiids into South East Asia.

  15. Phylogeny of trichomonads inferred from small-subunit rRNA sequences.


    Gunderson, J; Hinkle, G; Leipe, D; Morrison, H G; Stickel, S K; Odelson, D A; Breznak, J A; Nerad, T A; Müller, M; Sogin, M L


    Small subunit (16S-like) ribosomal RNA sequences were obtained from representatives of all four families constituting the order Trichomonadida. Comparative sequence analysis revealed that the Trichomonadida are a monophyletic lineage and a deep branch of the eukaryotic tree. Relative to the early divergent eukaryotic assemblages the branching pattern within the Trichomonadida is very shallow. This pattern suggests the Trichomonadida radiated recently, perhaps in conjunction with their animal hosts. From a morphological perspective the Devescovinidae and Calonymphidae are considered more derived than the Monocercomonadidae and Trichomonadidae. Molecular trees inferred by distance, parsimony and likelihood techniques consistently show the Devescovinidae and Calonymphidae are the earliest diverging lineages within the Trichomonadida, however bootstrap values do not strongly support a particular branching order. In an analysis of all known 16S-like ribosomal RNA sequences, the Trichomonadida share most recent common ancestry with unidentified protists from the hindgut of the termite Reticulitermes flavipes. The position of two putative free-living trichomonads in the tree is indicative of derivation from symbionts rather than direct descent from some free-living ancestral trichomonad.

  16. Phylogenetic relationships of Indian caecilians (Amphibia: Gymnophiona) inferred from mitochondrial rRNA gene sequences.


    Wilkinson, Mark; A Sheps, Jonathan; Oommen, Oommen V; Cohen, Bernard L


    India has a diverse caecilian fauna, including representatives of three of the six currently recognized families, the Caeciliidae, Ichthyophiidae, the endemic Uraeotyphlidae, but previous molecular phylogenetic studies of caecilians have not included sequences for any Indian caecilians. Partial 12S and 16S mitochondrial gene sequences were obtained for a single representative of each of the caecilian families found in India and aligned against previously reported sequences for 13 caecilian species. The resulting alignment (16 taxa, 1200 sites, of which 288 cannot be aligned unambiguously) was analyzed using parsimony, maximum-likelihood, and distance methods. As judged by bootstrap proportions, decay indices, and leaf stabilities, well-supported relationships of the Indian caecilians are recovered from the alignment. The data (1) corroborate the hypothesis, based on morphology, that the Uraeotyphlidae and Ichthyophiidae are sister taxa, (2) recover a monophyletic Ichthyophiidae, including Indian and South East Asian representatives, and (3) place the Indian caeciliid Gegeneophis ramaswamii as the sister group of the caeciliid caecilians of the Seychelles. Rough estimates of divergence times suggest an origin of the Uraeotyphlidae and Ichthyophiidae while India was isolated from Laurasia and Africa and are most consistent with an Indian origin of these families and subsequent dispersal of ichthyophiids into South East Asia. PMID:12099794

  17. A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq

    PubMed Central

    Darling, Aaron E.


    Background The bacterial 16S rRNA gene has historically been used in defining bacterial taxonomy and phylogeny. However, there are currently no high-throughput methods to sequence full-length 16S rRNA genes present in a sample with precision. Results We describe a method for sequencing near full-length 16S rRNA gene amplicons using the high throughput Illumina MiSeq platform and test it using DNA from human skin swab samples. Proof of principle of the approach is demonstrated, with the generation of 1,604 sequences greater than 1,300 nt from a single Nano MiSeq run, with accuracy estimated to be 100-fold higher than standard Illumina reads. The reads were chimera filtered using information from a single molecule dual tagging scheme that boosts the signal available for chimera detection. Conclusions This method could be scaled up to generate many thousands of sequences per MiSeq run and could be applied to other sequencing platforms. This has great potential for populating databases with high quality, near full-length 16S rRNA gene sequences from under-represented taxa and environments and facilitates analyses of microbial communities at higher resolution. PMID:27688981

  18. A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq

    PubMed Central

    Darling, Aaron E.


    Background The bacterial 16S rRNA gene has historically been used in defining bacterial taxonomy and phylogeny. However, there are currently no high-throughput methods to sequence full-length 16S rRNA genes present in a sample with precision. Results We describe a method for sequencing near full-length 16S rRNA gene amplicons using the high throughput Illumina MiSeq platform and test it using DNA from human skin swab samples. Proof of principle of the approach is demonstrated, with the generation of 1,604 sequences greater than 1,300 nt from a single Nano MiSeq run, with accuracy estimated to be 100-fold higher than standard Illumina reads. The reads were chimera filtered using information from a single molecule dual tagging scheme that boosts the signal available for chimera detection. Conclusions This method could be scaled up to generate many thousands of sequences per MiSeq run and could be applied to other sequencing platforms. This has great potential for populating databases with high quality, near full-length 16S rRNA gene sequences from under-represented taxa and environments and facilitates analyses of microbial communities at higher resolution.

  19. Analysis of the primary sequence and secondary structure of the unusually long SSU rRNA of the soil bug, Armadillidium vulgare.


    Choe, C P; Hancock, J M; Hwang, U W; Kim, W


    The complete nucleotide sequence of the SSU rRNA gene from the soil bug, Armadillidium vulgare (Crustacea, Isopoda), was determined. It is 3214 bp long, with a GC content of 56.3%. It is not only the longest SSU rRNA gene among Crustacea but also longer than any other SSU rRNA gene except that of the strepsipteran insect, Xenos vesparum (3316 bp). The unusually long sequence of this species is explained by the long sequences of variable regions V4 and V7, which make up more than half of the total length. RT-PCR analysis of these two regions showed that the long sequences also exist in the mature rRNA and sequence simplicity analysis revealed the presence of slippage motifs in these two regions. The putative secondary structure of the rRNA is typical for eukaryotes except for the length and shape variations of the V2, V4, V7, and V9 regions. Each of the V2, V4, and V7 regions was elongated, while the V9 region was shortened. In V2, two bulges, located between helix 8 and helix 9 and between helix 9 and helix 10, were elongated. In V4, stem E23-3 was dramatically expanded, with several small branched stems. In V7, stem 43 was branched and expanded. Comparisons with the unusually long SSU rRNAs of other organisms imply that the increase in total length of SSU rRNA is due mainly to expansion in the V4 and V7 regions. PMID:10594181

  20. Polymerase chain reaction using 16S rRNA gene sequences distinguishes the two biovars of Ureaplasma urealyticum.

    PubMed Central

    Robertson, J A; Vekris, A; Bebear, C; Stemke, G W


    Several fundamental phenotypic and genotypic differences have separated strains of the genital mycoplasma Ureaplasma urealyticum into two clusters or biovars. However, the lack of an easily performed and unambiguous test to discriminate between them has hampered investigation of the relationship between these biovars and disease. We determined the 16S rRNA nucleotide sequence of U. urealyticum 27, the serovar 3 standard and representative of the parvo biovar (serovars 1, 3, 6, and 14). This sequence was compared with the published sequence of U. urealyticum T960, which is the type strain and the serovar 8 standard and is representative of the T960 biovar which is composed of the 10 intervening serovars. Homology between the two sequences was 98.8%; differences were exploited to provide primers for biovar-specific polymerase chain reactions (PCRs). The results of these reactions placed all 14 serovar standard strains into the correct biovar. The PCRs were also applied to 10 cloned and 8 noncloned isolates that had been serotyped earlier. For 16 of them, we deduced their biovars from the serotyping data and then confirmed them by PCR. One unpredictable isolate and one nonserotypeable isolate were also classified as to biovar. Thus, we have developed a method for biotyping U. urealyticum that is applicable to both laboratory-adapted strains and wild-type isolates and that is appropriate for testing large numbers of clinical isolates. The amplification by the T960 biovar PCR protocol of DNAs from ureaplasmas of animals and certain Mycoplasma species suggested that the parvo biovar has diverged from the mainstream of the evolution of this clade. Images PMID:7681846

  1. Cellular identification of a novel uncultured marine stramenopile (MAST-12 Clade) small-subunit rRNA gene sequence from a norwegian estuary by use of fluorescence in situ hybridization-scanning electron microscopy.


    Kolodziej, Karolina; Stoeck, Thorsten


    Revealing the cellular identity of organisms behind environmental eukaryote rRNA gene sequences is a major objective in microbial diversity research. We sampled an estuarine oxygen-depleted microbial mat in southwestern Norway and retrieved an 18S rRNA gene signature that branches in the MAST-12 clade, an environmental marine stramenopile clade. Detailed phylogenetic analyses revealed that MAST-12 branches among the heterotrophic stramenopiles as a sister of the free-living Bicosoecida and the parasitic genus Blastocystis. Specific sequence signatures confirmed a relationship to these two groups while excluding direct assignment. We designed a specific oligonucleotide probe for the target sequence and detected the corresponding organism in incubation samples using fluorescence in situ hybridization (FISH). Using the combined FISH-scanning electron microscopy approach (T. Stoeck, W. H. Fowle, and S. S. Epstein, Appl. Environ. Microbiol. 69:6856-6863, 2003), we determined the morphotype of the target organism among the very diverse possible morphologies of the heterotrophic stramenopiles. The unpigmented cell is spherical and about 5 mum in diameter and possesses a short flagellum and a long flagellum, both emanating anteriorly. The long flagellum bears mastigonemes in a characteristic arrangement, and its length (30 mum) distinguishes the target organism from other recognized heterotrophic stramenopiles. The short flagellum is naked and often directed posteriorly. The organism possesses neither a lorica nor a stalk. The morphological characteristics that we discovered should help isolate a representative of a novel stramenopile group, possibly at a high taxonomic level, in order to study its ultrastructure, physiological capabilities, and ecological role in the environment. PMID:17293516

  2. Cellular identification of a novel uncultured marine stramenopile (MAST-12 Clade) small-subunit rRNA gene sequence from a norwegian estuary by use of fluorescence in situ hybridization-scanning electron microscopy.


    Kolodziej, Karolina; Stoeck, Thorsten


    Revealing the cellular identity of organisms behind environmental eukaryote rRNA gene sequences is a major objective in microbial diversity research. We sampled an estuarine oxygen-depleted microbial mat in southwestern Norway and retrieved an 18S rRNA gene signature that branches in the MAST-12 clade, an environmental marine stramenopile clade. Detailed phylogenetic analyses revealed that MAST-12 branches among the heterotrophic stramenopiles as a sister of the free-living Bicosoecida and the parasitic genus Blastocystis. Specific sequence signatures confirmed a relationship to these two groups while excluding direct assignment. We designed a specific oligonucleotide probe for the target sequence and detected the corresponding organism in incubation samples using fluorescence in situ hybridization (FISH). Using the combined FISH-scanning electron microscopy approach (T. Stoeck, W. H. Fowle, and S. S. Epstein, Appl. Environ. Microbiol. 69:6856-6863, 2003), we determined the morphotype of the target organism among the very diverse possible morphologies of the heterotrophic stramenopiles. The unpigmented cell is spherical and about 5 mum in diameter and possesses a short flagellum and a long flagellum, both emanating anteriorly. The long flagellum bears mastigonemes in a characteristic arrangement, and its length (30 mum) distinguishes the target organism from other recognized heterotrophic stramenopiles. The short flagellum is naked and often directed posteriorly. The organism possesses neither a lorica nor a stalk. The morphological characteristics that we discovered should help isolate a representative of a novel stramenopile group, possibly at a high taxonomic level, in order to study its ultrastructure, physiological capabilities, and ecological role in the environment.

  3. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.


    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H


    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  4. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung


    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB ( based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  5. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers.


    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L


    Amplicon sequencing utilizing next-generation platforms has significantly transformed how research is conducted, specifically microbial ecology. However, primer and sequencing platform biases can confound or change the way scientists interpret these data. The Pacific Biosciences RSII instrument may also preferentially load smaller fragments, which may also be a function of PCR product exhaustion during sequencing. To further examine theses biases, data is provided from 16S rRNA rumen community analyses. Specifically, data from the relative phylum-level abundances for the ruminal bacterial community are provided to determine between-sample variability. Direct sequencing of metagenomic DNA was conducted to circumvent primer-associated biases in 16S rRNA reads and rarefaction curves were generated to demonstrate adequate coverage of each amplicon. PCR products were also subjected to reduced amplification and pooling to reduce the likelihood of PCR product exhaustion during sequencing on the Pacific Biosciences platform. The taxonomic profiles for the relative phylum-level and genus-level abundance of rumen microbiota as a function of PCR pooling for sequencing on the Pacific Biosciences RSII platform were provided. For more information, see "Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers" P.R. Myer, M. Kim, H.C. Freetly, T.P.L. Smith (2016) [1]. PMID:27508263

  6. First report on the bacterial diversity in the distal gut of dholes (Cuon alpinus) by using 16S rRNA gene sequences analysis.


    Chen, Lei; Zhang, Honghai; Liu, Guangshuai; Sha, Weilai


    The aim of this study was to investigate the bacterial community in the distal gut of dholes (Cuon alpinus) based on the analysis of bacterial 16S rRNA gene sequences. Fecal samples were collected from five healthy unrelated dholes captured from Qilian Mountain in Gansu province of China. The diversity of the fecal bacteria community was investigated by constructing a polymerase chain reaction (PCR)-amplified 16S rRNA gene clone library. Bacterial 16S rRNA gene was amplified by using universal bacterial primers 27F and 1492R. A total of 275 chimera-free near full length 16S rRNA gene sequences were collected, and 78 non-redundant bacteria phylotypes (operational taxonomical units, OTUs) were identified according to the 97 % sequence similarity. Forty-two OTUs (53.8 %) showed less than 98 % sequence similarity to 16S rRNA gene sequences reported previously. Phylogenetic analysis demonstrated that dhole bacterial community comprised five different phyla, with the majority of sequences being classified within the phylum Bacteroidetes (64.7 %), followed by Firmicutes (29.8 %), Fusobacteria (4.7 %),Proteobacteria (0.4 %), and Actinobacteria (0.4 %). The only order Bacteroidales in phylum Bacteroidetes was the most abundant bacterial group in the intestinal bacterial community of dholes. Firmicutes and Bacteroidetes were the two most diverse bacterial phyla with 46.2 and 44.9 % of OTUs contained, respectively. Bacteroidales and Clostridiales were the two most diverse bacterial orders that contained 44.9 and 39.7 % of OTUs, respectively. PMID:26423781

  7. First report on the bacterial diversity in the distal gut of dholes (Cuon alpinus) by using 16S rRNA gene sequences analysis.


    Chen, Lei; Zhang, Honghai; Liu, Guangshuai; Sha, Weilai


    The aim of this study was to investigate the bacterial community in the distal gut of dholes (Cuon alpinus) based on the analysis of bacterial 16S rRNA gene sequences. Fecal samples were collected from five healthy unrelated dholes captured from Qilian Mountain in Gansu province of China. The diversity of the fecal bacteria community was investigated by constructing a polymerase chain reaction (PCR)-amplified 16S rRNA gene clone library. Bacterial 16S rRNA gene was amplified by using universal bacterial primers 27F and 1492R. A total of 275 chimera-free near full length 16S rRNA gene sequences were collected, and 78 non-redundant bacteria phylotypes (operational taxonomical units, OTUs) were identified according to the 97 % sequence similarity. Forty-two OTUs (53.8 %) showed less than 98 % sequence similarity to 16S rRNA gene sequences reported previously. Phylogenetic analysis demonstrated that dhole bacterial community comprised five different phyla, with the majority of sequences being classified within the phylum Bacteroidetes (64.7 %), followed by Firmicutes (29.8 %), Fusobacteria (4.7 %),Proteobacteria (0.4 %), and Actinobacteria (0.4 %). The only order Bacteroidales in phylum Bacteroidetes was the most abundant bacterial group in the intestinal bacterial community of dholes. Firmicutes and Bacteroidetes were the two most diverse bacterial phyla with 46.2 and 44.9 % of OTUs contained, respectively. Bacteroidales and Clostridiales were the two most diverse bacterial orders that contained 44.9 and 39.7 % of OTUs, respectively.

  8. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote small sub-unit rRNA sequences with curated taxonomy.


    Guillou, Laure; Bachar, Dipankar; Audic, Stéphane; Bass, David; Berney, Cédric; Bittner, Lucie; Boutte, Christophe; Burgaud, Gaétan; de Vargas, Colomban; Decelle, Johan; Del Campo, Javier; Dolan, John R; Dunthorn, Micah; Edvardsen, Bente; Holzmann, Maria; Kooistra, Wiebe H C F; Lara, Enrique; Le Bescot, Noan; Logares, Ramiro; Mahé, Frédéric; Massana, Ramon; Montresor, Marina; Morard, Raphael; Not, Fabrice; Pawlowski, Jan; Probert, Ian; Sauvadet, Anne-Laure; Siano, Raffaele; Stoeck, Thorsten; Vaulot, Daniel; Zimmermann, Pascal; Christen, Richard


    The interrogation of genetic markers in environmental meta-barcoding studies is currently seriously hindered by the lack of taxonomically curated reference data sets for the targeted genes. The Protist Ribosomal Reference database (PR(2), provides a unique access to eukaryotic small sub-unit (SSU) ribosomal RNA and DNA sequences, with curated taxonomy. The database mainly consists of nuclear-encoded protistan sequences. However, metazoans, land plants, macrosporic fungi and eukaryotic organelles (mitochondrion, plastid and others) are also included because they are useful for the analysis of high-troughput sequencing data sets. Introns and putative chimeric sequences have been also carefully checked. Taxonomic assignation of sequences consists of eight unique taxonomic fields. In total, 136 866 sequences are nuclear encoded, 45 708 (36 501 mitochondrial and 9657 chloroplastic) are from organelles, the remaining being putative chimeric sequences. The website allows the users to download sequences from the entire and partial databases (including representative sequences after clustering at a given level of similarity). Different web tools also allow searches by sequence similarity. The presence of both rRNA and rDNA sequences, taking into account introns (crucial for eukaryotic sequences), a normalized eight terms ranked-taxonomy and updates of new GenBank releases were made possible by a long-term collaboration between experts in taxonomy and computer scientists.

  9. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.


    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes


    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  10. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.


    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes


    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products. PMID:26898909

  11. Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.


    Flynn, A N; Lyndon, C A; Church, D L


    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

  12. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)


    Tremblay, Julien [DOE JGI


    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  13. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.


    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar


    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9. PMID:25871924

  14. Analysis of partial sequences of genes coding for 16S rRNA of actinomycetes isolated from Casuarina equisetifolia nodules in Mexico.

    PubMed Central

    Niner, B M; Brandt, J P; Villegas, M; Marshall, C R; Hirsch, A M; Valdés, M


    Filamentous bacteria isolated from surface-sterilized nodules of Casuarina equisetifolia trees in México were capable of reducing acetylene, a diagnostic test for nitrogenase, but were unable to nodulate their host. Analysis of partial 16S rRNA gene sequences suggests that the Mexican isolates are not Frankia strains but members of a novel clade. PMID:8702297

  15. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect

    Tremblay, Julien


    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  16. Phylogeny and evolutionary genetics of Frankia strains based on 16S rRNA and nifD-K gene sequences.


    Mishra, Arun Kumar; Singh, Pawan Kumar; Singh, Prashant; Singh, Anumeha; Singh, Satya Shila; Srivastava, Amrita; Srivastava, Alok Kumar; Sarma, Hridip Kumar


    16S rRNA and nifD-nifK sequences were used to study the molecular phylogeny and evolutionary genetics of Frankia strains isolated from Hippöphae salicifolia D. Don growing at different altitudes (ecologically classified as riverside and hillside isolates) of the Eastern Himalayan region of North Sikkim, India. Genetic information for the small subunit rRNA (16S rRNA) revealed that the riverside Frankia isolates markedly differed from the hillside isolates suggesting that the riverside isolates are genetically compact. Further, for enhanced resolutions, the partial sequence of nifD (3' end), nifK (5' end) and nifD-K IGS region have been investigated. The sequences obtained, failed to separate riverside isolates and hillside isolates, thus suggesting a possible role of genetic transfer events either from hillside to riverside or vice versa. The evolutionary genetic analyses using evogenomic extrapolations of gene sequence data obtained from 16S rRNA and nifD-K provided differing equations with the pace of evolution being more appropriately, intermediate. Values of recombination frequency (R), nucleotide diversity per site (Pi), and DNA divergence estimates supported the existence of an intermixed zone where spatial isolations occurred in sync with the temporal estimates. J. Basic Microbiol. 2015, 54, 1-9.

  17. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.


    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  18. Relationships between parasitoid wasps (Hymenoptera: Braconidae: Opiinae), fruit flies (Diptera: Tephritidae) and their host plants based on 16S rRNA, 12S rRNA, and ND1 gene sequences

    NASA Astrophysics Data System (ADS)

    Ibrahim, N. J.; Md-Zain, B. M.; Yaakop, S.


    Opiinae is among the l0 largest subfamilies under the family Braconidae. Opiines species have great potential as natural enemies against fruit fly pests. Before using them as a biological control agent, construction of the phylogenetic trees could facilitate in the molecular identification of individual species and their relationships among members of the Opiines, as well as between Opiines and their host plants. Larval specimens of tephritids were collected from four crop species at five localities throughout the Peninsular Malaysia. A total of 44 specimens of opiines had successfully emerged from the hosts, fruit fly larvae. The DNA sequences of 12S and 16S rRNA were obtained for the braconids while the mitochondrial ND1 sequences were obtained for the tephritids species through polymerase chain reaction. Maximum Parsimony and Bayesian trees were constructed by using PAUP 4.0b10 and MrBayes 3.1.2 to identify the relationships among the taxa. This study illustrates the phylogenetic relationships among parasitoid opiines collected and reared from parasitized fruit flies. The phylogenetic trees constructed based on the mitochondrial 12S and 16S rRNA sequences exhibited similar topology and sequence divergence. The opiines were divided into several clades and subclades according to the genus and species. Each clade also was supported by the similar host plants with high support values. However, their pests were not specific, except for Bactrocera cucurbitae. This study has reconfirmed the associations between Opiinae, tephritids, and host plants based on molecular data.

  19. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.


    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S


    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers. PMID:22183948

  20. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes.


    Baker, Brett J; Hugenholtz, Philip; Dawson, Scott C; Banfield, Jillian F


    During a molecular phylogenetic survey of extremely acidic (pH < 1), metal-rich acid mine drainage habitats in the Richmond Mine at Iron Mountain, Calif., we detected 16S rRNA gene sequences of a novel bacterial group belonging to the order Rickettsiales in the Alphaproteobacteria. The closest known relatives of this group (92% 16S rRNA gene sequence identity) are endosymbionts of the protist Acanthamoeba. Oligonucleotide 16S rRNA probes were designed and used to observe members of this group within acidophilic protists. To improve visualization of eukaryotic populations in the acid mine drainage samples, broad-specificity probes for eukaryotes were redesigned and combined to highlight this component of the acid mine drainage community. Approximately 4% of protists in the acid mine drainage samples contained endosymbionts. Measurements of internal pH of the protists showed that their cytosol is close to neutral, indicating that the endosymbionts may be neutrophilic. The endosymbionts had a conserved 273-nucleotide intervening sequence (IVS) in variable region V1 of their 16S rRNA genes. The IVS does not match any sequence in current databases, but the predicted secondary structure forms well-defined stem loops. IVSs are uncommon in rRNA genes and appear to be confined to bacteria living in close association with eukaryotes. Based on the phylogenetic novelty of the endosymbiont sequences and initial culture-independent characterization, we propose the name "Candidatus Captivus acidiprotistae." To our knowledge, this is the first report of an endosymbiotic relationship in an extremely acidic habitat.

  1. High-throughput 16S rRNA gene sequencing reveals alterations of mouse intestinal microbiota after radiotherapy.


    Kim, Young Suk; Kim, Jinu; Park, Soo-Je


    The mammalian gastrointestinal tract harbors a highly complex microbial community that comprises hundreds of different types of bacterial cells. The gastrointestinal microbiota plays an important role in the function of the host intestine. Most cancer patients undergoing pelvic irradiation experience side effects such as diarrhea; however, little is currently known about the effects of irradiation on the microorganisms colonizing the mucosal surfaces of the gastrointestinal tract. The aim of this study was to investigate the effects of gamma irradiation on the compositions of the large and small intestinal microbiotas. The gut microbiotas in control mice and mice receiving irradiation treatment were characterized by high-throughput sequencing of the bacterial 16S rRNA gene. Irradiation treatment induced significant alterations in the bacterial compositions of the large and small intestines at the genus level. Unexpectedly, irradiation treatment increased the number of operational taxonomic units in the small intestine but not the large intestine. In particular, irradiation treatment increased the level of the genera Alistipes in the large intestine and increased the level of the genus Corynebacterium in the small intestine. By contrast, compared with that in the corresponding control group, the level of the genera Prevotella was lower in the irradiated large intestine, and the level of the genera Alistipes was lower in the irradiated small intestine. Overall, the data presented here reveal the potential microbiological effects of pelvic irradiation on the gastrointestinal tracts of cancer patients.

  2. Major adaptive radiation in neritopsine gastropods estimated from 28S rRNA sequences and fossil records.


    Kano, Yasunori; Chiba, Satoshi; Kase, Tomoki


    A well-supported phylogeny of the Neritopsina, a gastropod superorder archaic in origin, radiated ecologically and diverse in morphology, is reconstructed based on partial 28S rRNA sequences. The result (Neritopsidae (Hydrocenidae (Helicinidae + Neritiliidae) (Neritidae + Phenacolepadidae))) is highly congruent with the fossil records and the character distribution of reproductive tracts in extant taxa. We suggest that the Neritopsina originated in subtidal shallow waters, invaded the land and became fully terrestrial at least three times in different clades, by the extinct Dawsonellidae in the Late Palaeozoic and by the Helicinidae and Hydrocenidae in the Mesozoic. Invasion of fresh- and brackish waters is prevalent among the Neritopsina as the Jurassic and freshwater ancestory is most probable for helicinids. The Phenacolepadidae, a group exclusively inhabiting dysoxic environments, colonized deep-sea hydrothermal vents and seeps in the Late Cretaceous or Early Cenozoic. Submarine caves have served as refuges for the archaic Neritopsidae since the Early to Middle Cenozoic, and the marine neritopsine slug Titiscania represents a highly specialized but relatively recent offshoot of this family. The Neritiliidae is another clade to be found utilizing submarine caves as shelter by the Oligocene; once adapted to the completely dark environment, but some neritiliids have immigrated to surface freshwater habitats. PMID:12495489

  3. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.


    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H


    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

  4. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring.


    Vierheilig, J; Savio, D; Ley, R E; Mach, R L; Farnleitner, A H; Reischer, G H


    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multi-compartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems.

  5. DNA-based classification and sequence heterogeneities in the 16S rRNA genes of Lactobacillus casei/paracasei and related species.


    Vásquez, Alejandra; Molin, Göran; Pettersson, Bertil; Antonsson, Martin; Ahrné, Siv


    The sequence differences within the 16S rRNA genes of Lactobacillus casei/paracasei and related species, Lactobacillus zeae and Lactobacillus rhamnosus, were investigated. Thirty-seven strains of mostly human or cheese origin were grouped by restriction endonuclease analysis (REA) of the total chromosomal DNA and by temporal temperature gradient gel electrophoresis (TTGE) of PCR-amplified 16S rRNA gene fragments. REA verified that all strains were genomically unique and singled out three major clusters, one L. rhamnosus-cluster and two clusters containing L. paracasei strains. The groups obtained by TTGE corresponded with one exception to the REA-clusters. In the TTGE clustering all L. paracasei strains formed one general group with one TTGE-band in common, and this group was sub-divided into five subgroups due to the presence of more than one TTGE-band in four of the subgroups. The occurrence of multiple TTGE-bands was investigated by amplifying and cloning of the 16S rRNA genes from the strains showing this phenomenon, thereby 12 clones from each strain were sequenced, demonstrating polymorphisms in almost all the cases. Subjecting the clones displaying sequence variations to TTGE as well as sequencing of 16S rDNA revealed by ribotyping of the strains, verified the presence of polymorphisms within the 16S rRNA genes. The migration characteristic of amplified DNA from a single clone corresponded to a specific band in the TTGE-pattern of the strain from which the clone originated. Southern blot hybridisation with a 16S rDNA probe demonstrated the presence of at least five 16S rRNA genes in L. casei/paracasei. A higher degree of variable positions than previously reported was observed in the 16S rRNA gene fragments of the members in the complex. Sequence comparison between the 16S rRNA gene copies of L. casei (CCUG 21451T) and L. zeae (CCUG 35515T) demonstrated that the two species shared almost the same sequence in some copies while the others were more different

  6. Sequence and conservation of a rRNA and tRNAVal mitochondrial gene fragment from Penaeus californiensis and comparison with Penaeus vannamei and Penaeus stylirostris.


    Gutiérrez-Millán, Luis Enrique; Peregrino-Uriarte, Alma Beatriz; Sotelo-Mundo, Rogerio; Vargas-Albores, Francisco; Yepiz-Plascencia, Gloria


    Penaeus californiensis is an important species for shrimp fisheries in the Pacific Ocean and has recently been described as a potential cultured species, mainly through the winter season in subtropical regions. A fragment of the mitochondrial 12S rRNA-tRNAVal-16S rRNA genes from P. californiensis was sequenced and compared with the corresponding regions from Penaeus vannamei and Penaeus stylirostris. Purified mitochondrial DNA was used for polymerase chain reaction amplification with primers for 12S and 16S rRNA genes. A 1379 +/- 1-bp fragment was obtained, including 90% 16S rRNA, tRNAVal, and a portion of 12S rRNA, cloned, and sequenced. Genetic distances were calculated according to the Kimura 2-parameter distance model, and maximum-likelihood analysis was applied with 1000 bootstrap replications. Sequence identity of P. californiensis with both P. vannamei and P. stylirostris was 0.88, while for P. vannamei and P. stylirostris the identity was 0.92. Maximum-likelihood analysis grouped P. vannamei and P. stylirostris separately from P. californiensis.

  7. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.


    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  8. Sequence determination of rRNA genes of pathogenic Vibrio species and whole-cell identification of Vibrio vulnificus with rRNA-targeted oligonucleotide probes.


    Aznar, R; Ludwig, W; Amann, R I; Schleifer, K H


    A comparative analysis of seven new 16S rRNA gene sequences of pathogenic Vibrio species with previously published vibrio sequences confirmed that Vibrio vulnificus represents a group that is not closely related to the core organisms of the genus Vibrio. In addition, we found that V. vulnificus, Listonella (Vibrio) anguillarum and Vibrio diazotrophicus branch off separately from the core group. A comparison of the 16S rRNA gene sequences of V. vulnificus strains belonging to biotypes 1 and 2 revealed that the sequences of all but four biotype 1 strains were identical to each other but slightly different (17 bases) from the sequences of the rest of the V. vulnificus strains investigated. In addition, the sequences of variable regions of the 23S rRNA genes of Vibrio fluvialis, Vibrio furnissii, Vibrio harveyi, Vibrio cholerae, and V. vulnificus C7184 and TW1 were determined, aligned, and compared with all available bacterial 23S rRNA sequences in order to search for specific target sites. As a result, four oligonucleotide probes specific for V. vulnificus were synthesized, and the specificities of these probes were evaluated by dot blot hybridization to membrane-bound RNAs from 21 V. vulnificus strains, 13 strains belonging to other Vibrio species, 61 strains belonging to species that are members of the alpha, beta, and gamma subclasses of the Proteobacteria, and 3 eucaryotic microorganisms. Two probes hybridized with all of the V. vulnificus strains tested, and the other two probes distinguished V. vulnificus biotype 1 strains from all other organisms. In situ identification of V. vulnificus by using tetramethylrhodamine- or fluorescein-labelled oligonucleotides is now possible.

  9. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.


    Tan, M K


    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  10. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  11. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  12. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.


    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S


    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  13. Guidelines for interpretation of 16S rRNA gene sequence-based results for identification of medically important aerobic Gram-positive bacteria.


    Woo, Patrick C Y; Teng, Jade L L; Wu, Jeff K L; Leung, Fion P S; Tse, Herman; Fung, Ami M Y; Lau, Susanna K P; Yuen, Kwok-Yung


    This study is believed to be the first to provide guidelines for facilitating interpretation of results based on full and 527 bp 16S rRNA gene sequencing and MicroSeq databases used for identifying medically important aerobic Gram-positive bacteria. Overall, full and 527 bp 16S rRNA gene sequencing can identify 24 and 40 % of medically important Gram-positive cocci (GPC), and 21 and 34 % of medically important Gram-positive rods (GPR) confidently to the species level, whereas the full-MicroSeq and 500-MicroSeq databases can identify 15 and 34 % of medically important GPC and 14 and 25 % of medically important GPR confidently to the species level. Among staphylococci, streptococci, enterococci, mycobacteria, corynebacteria, nocardia and members of Bacillus and related taxa (Paenibacillus, Brevibacillus, Geobacillus and Virgibacillus), the methods and databases are least useful for identification of staphylococci and nocardia. Only 0-2 and 2-13 % of staphylococci, and 0 and 0-10 % of nocardia, can be confidently and doubtfully identified, respectively. However, these methods and databases are most useful for identification of Bacillus and related taxa, with 36-56 and 11-14 % of Bacillus and related taxa confidently and doubtfully identified, respectively. A total of 15 medically important GPC and 18 medically important GPR that should be confidently identified by full 16S rRNA gene sequencing are not included in the full-MicroSeq database. A total of 9 medically important GPC and 21 medically important GPR that should be confidently identified by 527 bp 16S rRNA gene sequencing are not included in the 500-MicroSeq database. 16S rRNA gene sequence results of Gram-positive bacteria should be interpreted with basic phenotypic tests results. Additional biochemical tests or sequencing of additional gene loci are often required for definitive identification. To improve the usefulness of the MicroSeq databases, bacterial species that can be confidently identified by 16S rRNA

  14. Megraft: A software package to graft ribosomal small subunit (16S/18S) fragments onto full-length sequences for accurate species richness and sequencing depth analysis in pyrosequencing-length metagenomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Metagenomic libraries represent subsamples of the total DNA found at a study site and offer unprecedented opportunities to study ecological and functional aspects of microbial communities. To examine the depth of the sequencing effort, rarefaction analysis of the ribosomal small sub-unit (SSU/16S/18...

  15. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.


    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  16. Role of Universal 16S rRNA Gene PCR and Sequencing in Diagnosis of Prosthetic Joint Infection

    PubMed Central

    Garcia-Lechuz, J. M.; Alonso, P.; Villanueva, M.; Alcalá, L.; Gimeno, M.; Cercenado, E.; Sánchez-Somolinos, M.; Radice, C.; Bouza, E.


    The etiological diagnosis of prosthetic joint infection (PJI) requires the isolation of microorganisms from periprosthetic samples. Microbiological cultures often yield false-positive and false-negative results. 16S rRNA gene PCR combined with sequencing (16SPCR) has proven useful for diagnosing various infections. We performed a prospective study to compare the utility of this approach with that of culture to diagnose PJI using intraoperative periprosthetic samples. We analyzed 176 samples from 40 patients with PJI and 321 samples from 82 noninfected patients using conventional culture and 16SPCR. Three statistical studies were undertaken following a previously validated mathematical model: sample-to-sample analysis, calculation of the number of samples to be studied, and calculation of the number of positive samples necessary to diagnose PJI. When only the number of positive samples is taken into consideration, a 16SPCR-positive result in one sample has good specificity and positive predictive value for PJI (specificity, 96.3%; positive predictive value, 91.7%; and likelihood ratio [LR], 22), while 3 positive cultures with the same microorganism are necessary to achieve similar specificity. The best combination of results for 16SPCR was observed when 5 samples were studied and the same microorganism was detected in 2 of them (sensitivity, 94%; specificity, 100%; and LR, 69.62). The results for 5 samples with 2 positive cultures were 96% and 82%, respectively, and the likelihood ratio was 1.06. 16SPCR is more specific and has a better positive predictive value than culture for diagnosis of PJI. A positive 16SPCR result is largely suggestive of PJI, even when few samples are analyzed; however, culture is generally more sensitive. PMID:22170934

  17. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.


    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho


    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters.

  18. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo


    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  19. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa

    PubMed Central

    Schwarz, Norbert Georg; Hahn, Andreas; Boahen, Kennedy; Sarpong, Nimako; Adu-Sarkodie, Yaw; Halbgewachs, Eva; Marks, Florian; von Kalckreuth, Vera; Poppert, Sven; Loderstaedt, Ulrike; May, Jürgen; Hagen, Ralf Matthias


    Background The quality of microbiological diagnostic procedures depends on pre-analytic conditions. We compared the results of 16S rRNA gene PCR and sequencing from automatically incubated blood culture materials from tropical Ghana with the results of cultural growth after automated incubation. Methods Real-time 16S rRNA gene PCR and subsequent sequencing were applied to 1500 retained blood culture samples of Ghanaian patients admitted to a hospital with an unknown febrile illness after enrichment by automated culture. Results Out of all 1500 samples, 191 were culture-positive and 98 isolates were considered etiologically relevant. Out of the 191 culture-positive samples, 16S rRNA gene PCR and sequencing led to concordant results in 65 cases at species level and an additional 62 cases at genus level. PCR was positive in further 360 out of 1309 culture-negative samples, sequencing results of which suggested etiologically relevant pathogen detections in 62 instances, detections of uncertain relevance in 50 instances, and DNA contamination due to sample preparation in 248 instances. In two instances, PCR failed to detect contaminants from the skin flora that were culturally detectable. Pre-analytical errors caused many Enterobacteriaceae to be missed by culture. Conclusions Potentially correctable pre-analytical conditions and not the fastidious nature of the bacteria caused most of the discrepancies. Although 16S rRNA gene PCR and sequencing in addition to culture led to an increase in detections of presumably etiologically relevant blood culture pathogens, the application of this procedure to samples from the tropics was hampered by a high contamination rate. Careful interpretation of diagnostic results is required. PMID:26270631

  20. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing.


    Zhou, Jiemin; Zhou, Xuemei; Li, Yuguang; Xing, Jianmin


    Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  1. Bacterial characterization of Beijing drinking water by flow cytometry and MiSeq sequencing of the 16S rRNA gene.


    Liu, Tingting; Kong, Weiwen; Chen, Nan; Zhu, Jing; Wang, Jingqi; He, Xiaoqing; Jin, Yi


    Flow cytometry (FCM) and 16S rRNA gene sequencing data are commonly used to monitor and characterize microbial differences in drinking water distribution systems. In this study, to assess microbial differences in drinking water distribution systems, 12 water samples from different sources water (groundwater, GW; surface water, SW) were analyzed by FCM, heterotrophic plate count (HPC), and 16S rRNA gene sequencing. FCM intact cell concentrations varied from 2.2 × 10(3) cells/mL to 1.6 × 10(4) cells/mL in the network. Characteristics of each water sample were also observed by FCM fluorescence fingerprint analysis. 16S rRNA gene sequencing showed that Proteobacteria (76.9-42.3%) or Cyanobacteria (42.0-3.1%) was most abundant among samples. Proteobacteria were abundant in samples containing chlorine, indicating resistance to disinfection. Interestingly, Mycobacterium, Corynebacterium, and Pseudomonas, were detected in drinking water distribution systems. There was no evidence that these microorganisms represented a health concern through water consumption by the general population. However, they provided a health risk for special crowd, such as the elderly or infants, patients with burns and immune-compromised people exposed by drinking. The combined use of FCM to detect total bacteria concentrations and sequencing to determine the relative abundance of pathogenic bacteria resulted in the quantitative evaluation of drinking water distribution systems. Knowledge regarding the concentration of opportunistic pathogenic bacteria will be particularly useful for epidemiological studies.

  2. Identification of Clinically Relevant Fungi and Prototheca Species by rRNA Gene Sequencing and Multilocus PCR Coupled with Electrospray Ionization Mass Spectrometry

    PubMed Central

    Wang, Rui-Ying; Li, Li; Cao, Ya-Hui; Chen, Yan-Qiong; Zhao, Hua-Zhen; Zhang, Qiang-Qiang; Wu, Ji-Qin; Weng, Xin-Hua; Cheng, Xun-Jia; Zhu, Li-Ping


    Background Multilocus PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) is a new strategy for pathogen identification, but information about its application in fungal identification remains sparse. Methods One-hundred and twelve strains and isolates of clinically important fungi and Prototheca species were subjected to both rRNA gene sequencing and PCR/ESI-MS. Three regions of the rRNA gene were used as targets for sequencing: the 5′ end of the large subunit rRNA gene (D1/D2 region), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 regions). Microbial identification (Micro ID), acquired by combining results of phenotypic methods and rRNA gene sequencing, was used to evaluate the results of PCR/ESI-MS. Results For identification of yeasts and filamentous fungi, combined sequencing of the three regions had the best performance (species-level identification rate of 93.8% and 81.8% respectively). The highest species-level identification rate was achieved by sequencing of D1/D2 for yeasts (92.2%) and ITS2 for filamentous fungi (75.8%). The two Prototheca species could be identified to species level by D1/D2 sequencing but not by ITS1 or ITS2. For the 102 strains and isolates within the coverage of PCR/ESI-MS identification, 87.3% (89/102) achieved species-level identification, 100% (89/89) of which were concordant to Micro ID on species/complex level. The species-level identification rates for yeasts and filamentous fungi were 93.9% (62/66) and 75% (27/36) respectively. Conclusions rRNA gene sequencing provides accurate identification information, with the best results obtained by a combination of ITS1, ITS2 and D1/D2 sequencing. Our preliminary data indicated that PCR/ESI-MS method also provides a rapid and accurate identification for many clinical relevant fungi. PMID:24835205

  3. Soil clone library analyses to evaluate specificity and selectivity of PCR primers targeting fungal 18S rDNA for denaturing-gradient gel electrophoresis (DGGE).


    Takada Hoshino, Yuko; Morimoto, Sho


    We evaluated the fungal specificity and detection bias of four fungal 18S rRNA gene (18S rDNA) primer sets for denaturing-gradient gel electrophoresis (DGGE). We constructed and compared clone libraries amplified from upland and paddy field soils with each primer set (1, NS1/GCFung; 2, FF390/FR1-GC; 3, NS1/FR1-GC; and 4, NS1/EF3 for the first PCR and NS1/FR1-GC for the second PCR). Primer set 4 (for nested PCR) showed the highest specificity for fungi but biased specific sequences. Sets 1, 2, and 3 (for single PCR) amplified non-fungal eukaryotic sequences (from 7 to 16% for upland soil and from 20 to 31% for paddy field soil) and produced libraries with similar distributions of fungal 18S rDNA sequences at both the phylum and the class level. Set 2 tended to amplify more diverse fungal sequences, maintaining higher specificity for fungi. In addition, clone analyses revealed differences among primer sets in the frequency of chimeras. In upland field soil, the libraries amplified with primer sets 3 and 4, which targeted long fragments, contained many chimeric 18S rDNA sequences (18% and 48%, respectively), while the libraries obtained with sets 1 and 2, which targeted short fragments, contained fewer chimeras (5% and 10%, respectively).

  4. Phylogenetic affinities of Diplonema within the Euglenozoa as inferred from the SSU rRNA gene and partial COI protein sequences.


    Maslov, D A; Yasuhira, S; Simpson, L


    In order to shed light on the phylogenetic position of diplonemids within the phylum Euglenozoa, we have sequenced small subunit rRNA (SSU rRNA) genes from Diplonema (syn. Isonema) papillatum and Diplonema sp. We have also analyzed a partial sequence of the mitochondrial gene for cytochrome c oxidase subunit I from D. papillatum. With both markers, the maximum likelihood method favored a closer grouping of diplonemids with kinetoplastids, while the parsimony and distance suggested a closer relationship of diplonemids with euglenoids. In each case, the differences between the best tree and the alternative trees were small. The frequency of codon usage in the partial D. papillatum COI was different from both related groups; however, as is the case in kinetoplastids but not in Euglena, both the non-canonical UGA codon and the canonical UGG codon were used to encode tryptophan in Diplonema. PMID:10724517

  5. PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rDNA complexity.


    Espejo, R T; Feijóo, C G; Romero, J; Vásquez, M


    Analysis of the 16S rRNA genes retrieved directly from different environments has proven to be a powerful tool that has greatly expanded our knowledge of microbial diversity and phylogeny. It is shown here that sequence similarity between 80 and 100% among 16S rDNAs can be estimated by the electrophoretic migration of their heteroduplexes. This was measured by hybridization and electrophoresis in polyacrylamide gels of the product obtained after PCR amplification of almost the entire 16S rRNA gene from different bacterial species. These heteroduplexes were also observed after amplification of samples containing DNA from two or more bacterial species and a procedure was applied to identify reliably heteroduplexes among the amplification products. The electrophoretic migration of the heteroduplexes observed after PCR was used to detect the presence of 16S rDNAs with different sequences in DNA extracted from both a mixture of two bacterial species and samples containing a natural bacterial community.

  6. Application of 16S rRNA, cytochrome b and control region sequences for understanding the phylogenetic relationships in Oryx species.


    Khan, H A; Arif, I A; Al Homaidan, A A; Al Farhan, A H


    The present study reports the application of mitochondrial markers for the molecular phylogeny of Oryx species, including the Arabian oryx (AO), scimitar-horned oryx (SHO) and plains oryx (PO), using the Addax as an outgroup. Sequences of three molecular markers, 16S rRNA, cytochrome b and a control region, for the above four taxa were aligned and the topologies of respective phylogenetic trees were compared. All these markers clearly differentiated the genus Addax from Oryx. However, for species-level grouping, while 16S rRNA and cytochrome b produced similar phylogeny (SHO grouped with PO), the control region grouped SHO with AO. Further studies are warranted to generate more sequencing data, apply multiple bioinformatics tools and to include relevant nuclear markers for phylogenetic analysis of Oryx species. PMID:19224456

  7. Characterization of the rDNA unit and sequence analysis of the small subunit rRNA and 5.8S rRNA genes from Tritrichomonas foetus.


    Chakrabarti, D; Dame, J B; Gutell, R R; Yowell, C A


    The ribosomal RNA gene unit of the protozoan parasite Tritrichomonas foetus has been cloned and analyzed. Southern blot analysis of the genomic DNA showed that the ribosomal RNA gene unit is organized as a tandem head to tail repeat with a unit length of 6 kb. By Northern analysis a primary transcript of 5.8 kb was detected. Copy number analysis showed the presence of 12 copies of the ribosomal RNA gene unit. The lengths of the small subunit ribosomal RNA and 5.8S ribosomal RNA are 1571 bp and 159 bp, respectively, as determined by sequence analysis. The T. foetus small subunit ribosomal RNA sequence is one of the shortest eukaryotic small subunit rRNA sequences, similar in length to those from 2 other amitochondrial protists. Although shorter than the majority of the eukaryotic small subunit ribosomal RNAs, this sequence maintains the primary and secondary structure common to all eukaryotic small subunit ribosomal RNA structures, while truncating sequences found within the eukaryotic variable regions. The length of the large subunit ribosomal RNA was measured at 2.5 kb.

  8. Identification of Bacteria in Formalin-Fixed, Paraffin-Embedded Heart Valve Tissue via 16S rRNA Gene Nucleotide Sequencing

    PubMed Central

    Imrit, Kavita; Goldfischer, Michael; Wang, Jie; Green, Jaime; Levine, Jerome; Lombardo, Joseph; Hong, Tao


    We applied 16S rRNA gene sequencing to identify bacterial species present in formalin-fixed, paraffin-embedded heart valve tissue. In 40% (12/30) of the cases, we were able to identify the bacterium to the species-genus level. For more recent cases (≤4 years), the success rate was significantly improved, to 70% (P < 0.001). PMID:16825394

  9. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.


    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  10. Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. [Calyptogena magnifica; Bathymodiolus thermophilus; Lucinoma annulata; Lucinoma aequizonata; Codakia orbicularis

    SciTech Connect

    Distel, D.L.; Lane, D.J.; Olsen, G.J.; Giovannoni, S.J.; Pace, B.; Pace, N.R.; Stahl, D.A.; Felbeck, H.


    The 16S rRNAs from the bacterial endosymbionts of six marine invertebrates from diverse environments were isolated and partially sequenced. These symbionts included the trophosome symbiont of Riftia pachyptila, the gill symbionts of Calyptogena magnifica and Bathymodiolus thermophilus (from deep-sea hydrothermal vents), and the gill symbionts of Lucinoma annulata, Lucinoma aequizonata, and Codakia orbicularis (from relatively shallow coastal environments). Only one type of bacterial 16S rRNA was detected in each symbiosis. Using nucleotide sequence comparisons, we showed that each of the bacterial symbionts is distinct from the others and that all fall within a limited domain of the gamma subdivision of the purple bacteria (one of the major eubacterial divisions previously defined by 16S rRNA analysis. Two host specimens were analyzed in five of the symbioses; in each case, identical bacterial rRNA sequences were obtained from conspecific host specimens. These data indicate that the symbioses examined are species specific and that the symbiont species are unique to and invariant within their respective host species.

  11. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.


    Holmberg, L; Nygård, O


    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  12. Phylogenetic reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA, and NADH1 genes: implications for classification, biogeography, and the evolution of web building behavior.


    Murphy, Nicholas P; Framenau, Volker W; Donnellan, Stephen C; Harvey, Mark S; Park, Yung-Chul; Austin, Andrew D


    Current knowledge of the evolutionary relationships amongst the wolf spiders (Araneae: Lycosidae) is based on assessment of morphological similarity or phylogenetic analysis of a small number of taxa. In order to enhance the current understanding of lycosid relationships, phylogenies of 70 lycosid species were reconstructed by parsimony and Bayesian methods using three molecular markers; the mitochondrial genes 12S rRNA, NADH1, and the nuclear gene 28S rRNA. The resultant trees from the mitochondrial markers were used to assess the current taxonomic status of the Lycosidae and to assess the evolutionary history of sheet-web construction in the group. The results suggest that a number of genera are not monophyletic, including Lycosa, Arctosa, Alopecosa, and Artoria. At the subfamilial level, the status of Pardosinae needs to be re-assessed, and the position of a number of genera within their respective subfamilies is in doubt (e.g., Hippasa and Arctosa in Lycosinae and Xerolycosa, Aulonia and Hygrolycosa in Venoniinae). In addition, a major clade of strictly Australasian taxa may require the creation of a new subfamily. The analysis of sheet-web building in Lycosidae revealed that the interpretation of this trait as an ancestral state relies on two factors: (1) an asymmetrical model favoring the loss of sheet-webs and (2) that the suspended silken tube of Pirata is directly descended from sheet-web building. Paralogous copies of the nuclear 28S rRNA gene were sequenced, confounding the interpretation of the phylogenetic analysis and suggesting that a cautionary approach should be taken to the further use of this gene for lycosid phylogenetic analysis.

  13. High-throughput amplicon sequencing of rRNA genes requires a copy number correction to accurately reflect the effects of management practices on soil nematode community structure.


    Darby, B J; Todd, T C; Herman, M A


    Nematodes are abundant consumers in grassland soils, but more sensitive and specific methods of enumeration are needed to improve our understanding of how different nematode species affect, and are affected by, ecosystem processes. High-throughput amplicon sequencing is used to enumerate microbial and invertebrate communities at a high level of taxonomic resolution, but the method requires validation against traditional specimen-based morphological identifications. To investigate the consistency between these approaches, we enumerated nematodes from a 25-year field experiment using both morphological and molecular identification techniques in order to determine the long-term effects of annual burning and nitrogen enrichment on soil nematode communities. Family-level frequencies based on amplicon sequencing were not initially consistent with specimen-based counts, but correction for differences in rRNA gene copy number using a genetic algorithm improved quantitative accuracy. Multivariate analysis of corrected sequence-based abundances of nematode families was consistent with, but not identical to, analysis of specimen-based counts. In both cases, herbivores, fungivores and predator/omnivores generally were more abundant in burned than nonburned plots, while bacterivores generally were more abundant in nonburned or nitrogen-enriched plots. Discriminate analysis of sequence-based abundances identified putative indicator species representing each trophic group. We conclude that high-throughput amplicon sequencing can be a valuable method for characterizing nematode communities at high taxonomic resolution as long as rRNA gene copy number variation is accounted for and accurate sequence databases are available. PMID:24103081

  14. High-throughput amplicon sequencing of rRNA genes requires a copy number correction to accurately reflect the effects of management practices on soil nematode community structure.


    Darby, B J; Todd, T C; Herman, M A


    Nematodes are abundant consumers in grassland soils, but more sensitive and specific methods of enumeration are needed to improve our understanding of how different nematode species affect, and are affected by, ecosystem processes. High-throughput amplicon sequencing is used to enumerate microbial and invertebrate communities at a high level of taxonomic resolution, but the method requires validation against traditional specimen-based morphological identifications. To investigate the consistency between these approaches, we enumerated nematodes from a 25-year field experiment using both morphological and molecular identification techniques in order to determine the long-term effects of annual burning and nitrogen enrichment on soil nematode communities. Family-level frequencies based on amplicon sequencing were not initially consistent with specimen-based counts, but correction for differences in rRNA gene copy number using a genetic algorithm improved quantitative accuracy. Multivariate analysis of corrected sequence-based abundances of nematode families was consistent with, but not identical to, analysis of specimen-based counts. In both cases, herbivores, fungivores and predator/omnivores generally were more abundant in burned than nonburned plots, while bacterivores generally were more abundant in nonburned or nitrogen-enriched plots. Discriminate analysis of sequence-based abundances identified putative indicator species representing each trophic group. We conclude that high-throughput amplicon sequencing can be a valuable method for characterizing nematode communities at high taxonomic resolution as long as rRNA gene copy number variation is accounted for and accurate sequence databases are available.

  15. Western immunoblot analysis of Haemobartonella muris and comparison of 16S rRNA gene sequences of H. muris, H. felis, and Eperythrozoon suis.

    PubMed Central

    Rikihisa, Y; Kawahara, M; Wen, B; Kociba, G; Fuerst, P; Kawamori, F; Suto, C; Shibata, S; Futohashi, M


    Infectious agents were isolated from the spleens of three wild mice (Apodemus argenteus) by intraperitoneal inoculation of the spleen homogenate into laboratory mice. The laboratory mice developed clinical signs and splenomegaly, and three isolates were maintained by passage in mice. Tetracyclines were effective in preventing infection of mice with these agents, but streptomycin and penicillin were ineffective. The agents did not grow in bacterial growth media or chicken embryos. In smears of blood from infected mice stained by the Giemsa or the indirect immunofluorescence method, numerous organisms were found on the surfaces of erythrocytes. Electron microscopy revealed cell wall-less pleomorphic cocci of 350 to 700 nm in diameter. On the basis of these results, the isolates were identified as Haemobartonella muris. There was no antigenic cross-reactivity with Rickettsia or Ehrlichia spp. or other related organisms. Western immunoblot analysis of three strains of H. muris with mouse antisera to H. muris revealed identical major antigens of 118, 65, 53, 45, and 40 kDa. By heteroduplex analysis of the three PCR-amplified segments of the 16S rRNA genes, the three strains of H. muris were found to be identical. The 16S rRNA genes of one of the H. muris strains, four strains of H. felis, and two strains of Eperythrozoon suis were sequenced and compared. The sequences of two strains of H. felis from cats in California were identical, as were the sequences of a strain from a cat in Ohio and a strain from a cat in Florida, but the similarity of sequences between the California and the Ohio-Florida strains was only 85%. The sequence of an H. muris strain was unique and was more closely related to that of the Ohio-Florida strain of H. felis (89%) than to that of the California strain of H. felis (84%). The sequence of E. suis from a pig in Illinois was identical to that from another pig from Taiwan. The similarity of the 16S rRNA gene sequence of E. suis with those of three

  16. Diversity and distribution of subterranean bacteria in groundwater at Oklo in Gabon, Africa, as determined by 16S rRNA gene sequencing.


    Pedersen, K; Arlinger, J; Hallbeck, L; Pettersson, C


    This paper describes how ground water was sampled, DNA extracted, amplified and cloned and how information available in the ribosomal 16S rRNA gene was used for mapping diversity and distribution of subterranean bacteria in groundwater at the Bangombé site in the Oklo region. The results showed that this site was inhabited by a diversified population of bacteria. Each borehole was dominated by species that did not dominate in any of the other boreholes; a result that probably reflects documented differences in the geochemical environment. Two of the sequences obtained were identified at genus level to represent Acinetobacter and Zoogloea, but most of the 44 sequences found were only distantly related to species in the DNA database. The deepest borehole, BAX01 (105 m), had the highest number of bacteria and also total organic carbon (TOC). This borehole harboured only Proteobacteria beta group sequences while sequences related to Proteobacteria beta, gamma and delta groups and Gram-positive bacteria were found in the other four boreholes. Two of the boreholes, BAX02 (34 m) and BAX04 (10 m) had many 16S rRNA gene sequences in common and also had similar counts of bacteria, content of TOC, pH and equal conductivity, suggesting a hydraulic connection between them.

  17. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  18. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.


    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  19. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo


    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  20. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.


    Hong, Jin-Kyung; Kim, Hye-Jin; Cho, Jae-Chang


    Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb) archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7%) belonged to the MG-I and SCG, which together contained most (93.9%) of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and <1% tolerance to non-target taxa, indicating high specificity. To validate this result experimentally, PCRs were performed with THAUM-494 in combination with a universal archaeal primer (ARC917R or 1017FAR) and DNAs from five environmental samples to construct clone libraries. THAUM-494 showed a satisfactory specificity in empirical studies, as expected from the in silico results. Phylogenetic analysis of 859 cloned sequences obtained from 10 clone libraries revealed that >95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and

  1. Internal Transcribed Spacer rRNA Gene-Based Phylogenetic Reconstruction Using Algorithms with Local and Global Sequence Alignment for Black Yeasts and Their Relatives

    PubMed Central

    Caligiorne, R. B.; Licinio, P.; Dupont, J.; de Hoog, G. S.


    Sequences of rRNA gene internal transcribed spacer (ITS) of a standard set of black yeast-like fungal pathogens were compared using two methods: local and global alignments. The latter is based on DNA-walk divergence analysis. This method has become recently available as an algorithm (DNAWD program) which converts sequences into three-dimensional walks. The walks are compared with, or fit to, each other generating global alignments. The DNA-walk geometry defines a proper metric used to create a distance matrix appropriated for phylogenetic reconstruction. In this work, the analyses were carried out for species currently classified in Capronia, Cladophialophora, Exophiala, Fonsecaea, Phialophora, and Ramichloridium. Main groups were verified by small-subunit rRNA gene data. DNAWD applied to ITS2 alone enabled species recognition as well as phylogenetic reconstruction reflecting clades discriminated in small-subunit rRNA gene phylogeny, which was not possible with any other algorithm using local alignment for the same data set. It is concluded that DNAWD provides rapid insight into broader relationships between groups using genes that otherwise would be hardly usable for this purpose. PMID:15956403

  2. 16S rRNA sequences of Bartonella bacilliformis and cat scratch disease bacillus reveal phylogenetic relationships with the alpha-2 subgroup of the class Proteobacteria.

    PubMed Central

    O'Connor, S P; Dorsch, M; Steigerwalt, A G; Brenner, D J; Stackebrandt, E


    The primary structures of 16S rRNAs of Bartonella bacilliformis, an isolate of the cat scratch disease (CSD) bacillus, and a strain phenotypically similar to the CSD bacillus were determined by reverse transcriptase sequencing. These microorganisms were found to be members of the alpha-2 subgroup of the class Proteobacteria. The sequence from B. bacilliformis was most closely related to the rRNA of Rochalimaea quintana (91.7% homology), the etiologic agent of trench fever. The sequence from the isolate of the CSD bacillus showed the greatest homology with Brucella abortus (89.7%) and, when compared with oligonucleotide catalog data, formed a cluster with Rhodopseudomonas palustris, Pseudomonas carboxidovorans, Nitrobacter species, and Bradyrhizobium species. The 16S rRNA sequence was also determined for the Cleveland Clinic isolate, which was previously shown to be phenotypically similar to and approximately 30% related, by DNA hybridization, to the CSD bacillus. The Cleveland Clinic isolate was isolated from a patient not diagnosed with CSD. The rRNAs from these bacteria exhibited 98.2% homology, confirming that this isolate is a second species in the same genus as the CSD bacillus. Our data suggest that neither B. bacilliformis nor the CSD bacillus is the etiologic agent of bacillary epithelioid angiomatosis. PMID:1719021

  3. The genetic diversity of genus Bacillus and the related genera revealed by 16s rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    PubMed Central

    Cihan, Arzu Coleri; Tekin, Nilgun; Ozcan, Birgul; Cokmus, Cumhur


    Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%), the facultative thermophiles (14%) and the mesophiles (12%). These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16), Brevibacillus (13), Paenibacillus (1) and Thermoactinomycetes (2) were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4–100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6), B. lichenformis (3), B. subtilis (3), B. agri (3), B. smithii (2), T. vulgaris (2) and finally P. barengoltzii (1). In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies. PMID:24031834

  4. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.


    Chernoff, Y O; Vincent, A; Liebman, S W


    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  5. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M


    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  6. Characterization of Hafnia alvei by biochemical tests, random amplified polymorphic DNA PCR, and partial sequencing of 16S rRNA gene.

    PubMed Central

    Ridell, J; Siitonen, A; Paulin, L; Lindroos, O; Korkeala, H; Albert, M J


    Hafnia alvei strains which possess the attachment-effacement gene (eaeA) may have clinical importance as new diarrhea-causing pathogens and should therefore be differentiated from other H. alvei strains. We characterized diarrheal H. alvei strains, which were positive in the PCR test for the eaeA gene, using biochemical tests not routinely used for identification of members of the family Enterobacteriaceae, and compared them with eaeA-negative strains isolated from different clinical and nonclinical sources to find characteristics useful for identification. Random amplified polymorphic DNA (RAPD)-PCR and partial sequencing of the 16S rRNA gene were utilized to study the genetic diversity of the isolates. The eaeA-positive strains were found to have many characteristic biochemical properties. Negative reactions in the 2-ketogluconate and histidine assimilation tests and a positive reaction in the 3-hydroxybenzoate assimilation test may be useful in routine diagnostics. Nearly identical RAPD-PCR profiles and identical 353-bp fragments of the 16S rRNA genes indicated little genetic diversity among the eaeA-positive strains. The low level of homology (92%) in the partial 16S rRNA genes of eaeA-positive and -negative H. alvei strains raises questions about the taxonomic positioning of eaeA-positive H. alvei. PMID:7494030

  7. Comparative analyses of phenotypic methods and 16S rRNA, khe, rpoB genes sequencing for identification of clinical isolates of Klebsiella pneumoniae.


    He, Yanxia; Guo, Xianguang; Xiang, Shifei; Li, Jiao; Li, Xiaoqin; Xiang, Hui; He, Jinlei; Chen, Dali; Chen, Jianping


    The present work aimed to evaluate 16S rRNA, khe and rpoB gene sequencing for the identification of Klebsiella pneumoniae in comparison with phenotypic methods. Fifteen clinical isolates were examined, which were initially identified as K. pneumoniae subsp. pneumoniae using the automated VITEK 32 system in two hospitals in Enshi City, China. Their identity was further supported by conventional phenotypic methods on the basis of morphological and biochemical characteristics. Using Bayesian phylogenetic analyses and haplotypes network reconstruction, 13 isolates were identified as K. pneumoniae, whereas the other two isolates (K19, K24) were classified as Shigella sp. and Enterobacter sp., respectively. Of the three genes, 16S rRNA and khe gene could discriminate the clinical isolates at the genus level, whereas rpoB could discriminate Klebsiella at the species and even subspecies level. Overall, the gene tree based on rpoB is more compatible with the currently accepted classification of Klebsiella than those based on 16S rRNA and khe genes, showing that rpoB can be a powerful tool for identification of K. pneumoniae isolates. Above all, our study challenges the utility of khe as a species-specific marker for identification of K. pneumoniae.

  8. Phylogenetic analysis of Histoplasma capsulatum based on partial sequence of the D1/D2 region of the 28S rRNA gene.


    Komori, Takashi; Sano, Ayako; Yarita, Kyoko; Kitagawa, Teruyuki; Kamei, Katsuhiko; Nishimura, Kazuko


    In order to confirm the phylogenetic relationships of Histoplasma capsulatum, the partial sequences of large subunit (28S) ribosomal gene (D1/D2 region) of 49 isolates were studied. The similarity values of the 49 isolates were more than 99.0% across 617 base pairs, however, the 49 isolates were divided into 9 groups. These 9 groups were independent of 3 varieties, var. capsulatum, var. farciminosum and var. duboisii. These results showed that analysis of the nucleotide sequence of the 28S rRNA gene was very effective for identification of H. capsulatum and that three varieties of H. capsulatum should be reclassified according to the phylogenetic relationship established from analysis of the D1/D2 region sequences. PMID:16282973

  9. Application of SmartGene IDNS software to partial 16S rRNA gene sequences for a diverse group of bacteria in a clinical laboratory.


    Simmon, Keith E; Croft, Ann C; Petti, Cathy A


    Laboratories often receive clinical isolates for bacterial identification that have ambiguous biochemical profiles by conventional testing. With the emergence of 16S rRNA gene sequencing as an identification tool, we evaluated the usefulness of SmartGene IDNS, a 16S rRNA sequence database and software program for microbial identification. Identification by conventional methods of a diverse group of bacterial clinical isolates was compared with gene sequences interrogated by the SmartGene and MicroSeq databases. Of 300 isolates, SmartGene identified 295 (98%) to the genus level and 262 (87%) to the species level, with 5 (2%) being inconclusive. MicroSeq identified 271 (90%) to the genus level and 223 (74%) to the species level, with 29 (10%) being inconclusive. SmartGene and MicroSeq agreed on the genus for 233 (78%) isolates and the species for 212 (71%) isolates. Conventional methods identified 291 (97%) isolates to the genus level and 208 (69%) to the species level, with 9 (3%) being inconclusive. SmartGene, MicroSeq, and conventional identifications agreed for 193 (64%) of the results. Twenty-seven microorganisms were not represented in MicroSeq, compared to only 2 not represented in SmartGene. Overall, SmartGene IDNS provides comprehensive and accurate identification of a diverse group of bacteria and has the added benefit of being a user-friendly program that can be modified to meet the unique needs of clinical laboratories.

  10. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.


    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H


    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  11. Phylogenetic relationships of Blepharisma americanum and Colpoda inflata within the phylum ciliophora inferred from complete small subunit rRNA gene sequences.


    Greenwood, S J; Schlegel, M; Sogin, M L; Lynn, D H


    The complete small subunit rRNA gene sequences of the heterotrich Blepharisma americanum and the colpodid Colpoda inflata were determined to be 1719 and 1786 nucleotides respectively. The phylogeny produced by comparisons with other ciliates indicated that C. inflata is allied more closely with the nassophoreans and oligohymenophoreans than the spirotrichs. This is consistent with the placement of the colpodids in the Class Copodea. Blepharisma americanum was not grouped with the hypotrichs but instead was placed as the earliest branching ciliate. The distinct separation of B. americanum supports the elevation to class status given the heterotrichs based on morphological characters.

  12. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.


    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments. PMID:26454634

  13. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing.


    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas.

  14. Molecular characterisation of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing

    PubMed Central

    Yamaguti, Maurício; Oliveira, Rosângela C; Marques, Lucas M; Buzinhani, Melissa; Buim, Marcos R; Neto, Renata L; Guimarães, Ana Márcia S; Timenetsky, Jorge


    Economic loss in pig breeding is common due to respiratory disorders, and Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, namely, are the most common infectious agents. The aim of this study is to recover these mollicutes and detect their genotypic variations by pulsed-field gel electrophoresis (PFGE) and sequencing the 16 s rRNA gene. One hundred and twenty-six swabs from tonsil and nasal mucus of pigs with respiratory disorders were analysed. A total of 78 lungs were sampled, as well as two trachea and two tonsils obtained from animals with respiratory disorder. A total of 59 isolates were obtained: 1 (1.70 per cent) of M hyopneumoniae, 2 (3.40 per cent) of Mycoplasma flocculare and 56 (94.90 per cent) of M hyorhinis. The PFGE for M hyorhinis showed 10 profiles with enzyme AvaI and 9 profiles with XhoI. A low polymorphism of the 16sRNS gene was detected in M hyorhinis isolates compared with the type strain in the GenBank. M hyorhinis isolates of different herds showed a large heterogenicity with enzymes AvaI and XhoI. The sequencing of the 16S rRNA gene allowed for analysing the interspecific and intraspecific variations of isolated mycoplasmas. PMID:26688737

  15. Design and evaluation of universal 16S rRNA gene primers for high-throughput sequencing to simultaneously detect DAMO microbes and anammox bacteria.


    Lu, Yong-Ze; Ding, Zhao-Wei; Ding, Jing; Fu, Liang; Zeng, Raymond J


    To develop universal 16S rRNA gene primers for high-throughput sequencing for the simultaneous detection of denitrifying anaerobic methane oxidation (DAMO) archaea, DAMO bacteria, and anaerobic ammonium oxidation (anammox) bacteria, four published primer sets (PS2-PS5) were modified. The overall coverage of the four primer pairs was evaluated in silico with the Silva SSU r119 dataset. Based on the virtual evaluation, the two best primer pairs (PS4 and PS5) were selected for further verification. Illumina MiSeq sequencing of a freshwater sediment and a culture from a DAMO-anammox reactor using these two primer pairs revealed that PS5 (341b4F-806R) was the most promising universal primer pair. This pair of primers detected both archaea and bacteria with less bias than PS4. Furthermore, an anaerobic fermentation culture and a wastewater treatment plant culture were used to verify the accuracy of PS5. More importantly, it detected DAMO archaea, DAMO bacteria, and anammox bacteria simultaneously with no false positives appeared. This universal 16S rRNA gene primer pair extends the existing molecular tools for studying the community structures and distributions of DAMO microbes and their potential interactions with anammox bacteria in different environments.

  16. Soil Acidobacterial 16S rRNA Gene Sequences Reveal Subgroup Level Differences between Savanna-Like Cerrado and Atlantic Forest Brazilian Biomes

    PubMed Central

    Catão, Elisa C. P.; Lopes, Fabyano A. C.; Araújo, Janaína F.; de Castro, Alinne P.; Barreto, Cristine C.; Bustamante, Mercedes M. C.; Quirino, Betania F.; Krüger, Ricardo H.


    16S rRNA sequences from the phylum Acidobacteria have been commonly reported from soil microbial communities, including those from the Brazilian Savanna (Cerrado) and the Atlantic Forest biomes, two biomes that present contrasting characteristics of soil and vegetation. Using 16S rRNA sequences, the present work aimed to study acidobacterial diversity and distribution in soils of Cerrado savanna and two Atlantic forest sites. PCA and phylogenetic reconstruction showed that the acidobacterial communities found in “Mata de galeria” forest soil samples from the Cerrado biome have a tendency to separate from the other Cerrado vegetation microbial communities in the direction of those found in the Atlantic Forest, which is correlated with a high abundance of Acidobacteria subgroup 2 (GP2). Environmental conditions seem to promote a negative correlation between GP2 and subgroup 1 (GP1) abundance. Also GP2 is negatively correlated to pH, but positively correlated to high Al3+ concentrations. The Cerrado soil showed the lowest Acidobacteria richness and diversity indexes of OTUs at the species and subgroups levels when compared to Atlantic Forest soils. These results suggest specificity of acidobacterial subgroups to soils of different biomes and are a starting point to understand their ecological roles, a topic that needs to be further explored. PMID:25309599

  17. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting.


    Böhme, Karola; Fernández-No, Inmaculada C; Pazos, Manuel; Gallardo, José M; Barros-Velázquez, Jorge; Cañas, Benito; Calo-Mata, Pilar


    The present study aims to compare two molecular technologies, 16S rRNA sequencing and MALDI-TOF MS, for bacterial species identification in seafood. With this aim, 70 reference strains from culture collections, including important seafood-borne pathogenic and spoilage bacterial species, and 50 strains isolated from commercial seafood products, were analysed by both techniques. Genomic analysis only identified the species of 50% of the isolated strains, proving to be particularly poor at identifying members of the Pseudomonas and Bacillus genera. In contrast, MALDI-TOF MS fingerprinting identified 76% of the strains at the species level. The mass spectral data were submitted to the SpectraBank database (, making this information available to other researchers. Furthermore, cluster analysis of the peak mass lists was carried out with the web application SPECLUST and the calculated groupings were consistent with results determined by a phylogenetic approach that is based on the 16S rRNA sequences. However, the MALDI-TOF MS analysis demonstrated more discriminating potential that allowed for better classification, especially for the Pseudomonas and Bacillus genera. This is of importance with respect to the varying pathogenic and spoilage character at the intragenus and intraspecies level. In this sense, MALDI-TOF MS demonstrated to be a competent bacterial typing tool that extends phenotypic and genotypic approaches, allowing a more ample classification of bacterial strains.

  18. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole


    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  19. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    PubMed Central

    Meli, Marina L.; Novacco, Marilisa; Borel, Nicole


    The 18S ribosomal RNA (rRNA) gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal) DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR) analysis. We compared (i) samples from various animal species, tissues, and sample types, including swabs; (ii) multiple DNA extraction methods; and (iii) both fresh and formalin-fixed paraffin-embedded (FFPE) samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects. PMID:27672657

  20. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    PubMed Central

    Wang, Yu; Jiang, Xiawei; Xu, Zemin; Ying, Chaoqun; Yu, Wei; Xiao, Yonghong


    A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC) with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification. PMID:27379169

  1. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing.


    Wang, Yu; Jiang, Xiawei; Xu, Zemin; Ying, Chaoqun; Yu, Wei; Xiao, Yonghong


    A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC) with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  2. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris) Harbor a Core Subset of Bacteria Normally Associated with the Wild Host

    PubMed Central

    Meeus, Ivan; Parmentier, Laurian; Billiet, Annelies; Maebe, Kevin; Van Nieuwerburgh, Filip; Deforce, Dieter; Wäckers, Felix; Vandamme, Peter; Smagghe, Guy


    A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees) confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella), Orbaceae (Gilliamella), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed. PMID:25923917

  3. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris) Harbor a Core Subset of Bacteria Normally Associated with the Wild Host.


    Meeus, Ivan; Parmentier, Laurian; Billiet, Annelies; Maebe, Kevin; Van Nieuwerburgh, Filip; Deforce, Dieter; Wäckers, Felix; Vandamme, Peter; Smagghe, Guy


    A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees) confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella), Orbaceae (Gilliamella), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed.

  4. High-throughput 16S rRNA gene sequencing reveals alterations of intestinal microbiota in myalgic encephalomyelitis/chronic fatigue syndrome patients.


    Frémont, Marc; Coomans, Danny; Massart, Sebastien; De Meirleir, Kenny


    Human intestinal microbiota plays an important role in the maintenance of host health by providing energy, nutrients, and immunological protection. Intestinal dysfunction is a frequent complaint in myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) patients, and previous reports suggest that dysbiosis, i.e. the overgrowth of abnormal populations of bacteria in the gut, is linked to the pathogenesis of the disease. We used high-throughput 16S rRNA gene sequencing to investigate the presence of specific alterations in the gut microbiota of ME/CFS patients from Belgium and Norway. 43 ME/CFS patients and 36 healthy controls were included in the study. Bacterial DNA was extracted from stool samples, PCR amplification was performed on 16S rRNA gene regions, and PCR amplicons were sequenced using Roche FLX 454 sequencer. The composition of the gut microbiota was found to differ between Belgian controls and Norwegian controls: Norwegians showed higher percentages of specific Firmicutes populations (Roseburia, Holdemania) and lower proportions of most Bacteroidetes genera. A highly significant separation could be achieved between Norwegian controls and Norwegian patients: patients presented increased proportions of Lactonifactor and Alistipes, as well as a decrease in several Firmicutes populations. In Belgian subjects the patient/control separation was less pronounced, however some abnormalities observed in Norwegian patients were also found in Belgian patients. These results show that intestinal microbiota is altered in ME/CFS. High-throughput sequencing is a useful tool to diagnose dysbiosis in patients and could help designing treatments based on gut microbiota modulation (antibiotics, pre and probiotics supplementation).

  5. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0.


    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej


    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5'-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site.

  6. Estimating Protistan Diversity Using High-Throughput Sequencing.


    Hu, Sarah K; Liu, Zhenfeng; Lie, Alle A Y; Countway, Peter D; Kim, Diane Y; Jones, Adriane C; Gast, Rebecca J; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Caron, David A


    Sequencing hypervariable regions from the 18S rRNA gene is commonly employed to characterize protistan biodiversity, yet there are concerns that short reads do not provide the same taxonomic resolution as full-length sequences. A total of 7,432 full-length sequences were used to perform an in silico analysis of how sequences of various lengths and target regions impact downstream ecological interpretations. Sequences that were longer than 400 nucleotides and included the V4 hypervariable region generated results similar to those derived from full-length 18S rRNA gene sequences. Present high-throughput sequencing capabilities are approaching protistan diversity estimation comparable to whole gene sequences.

  7. Primary and secondary structure of the 18S ribosomal RNA of the bird spider Eurypelma californica and evolutionary relationships among eukaryotic phyla.


    Hendriks, L; Van Broeckhoven, C; Vandenberghe, A; Van de Peer, Y; De Wachter, R


    The primary structure of the 18S rRNA of the bird spider Eurypelma californica has been determined in the framework of a study of metazoan phylogeny on the basis of ribosomal RNA structure. A secondary-structure model was derived by comparison of the sequence with that of 43 other eukaryotic small-ribosomal-subunit RNA sequences presently available. This comparison allows a rather detailed secondary-structure pattern to be postulated for a eukaryote-specific area of highly variable sequence and length for which no consensus model has hitherto been attained. A dendrogram, reflecting evolutionary relationships among the 40 eukaryotic species of known 18S rRNA structure, was constructed by a matrix method selecting the best-fitting tree on the basis of a least-squares criterion. The tree shows an early divergence of a microsporidium, an euglenoid, kinetoplastids and a slime mold. Among the remaining species, two main clusters are distinguishable, one comprising the Ciliata, the other comprising Metazoa, green plants, fungi and several protists. Among the Metazoa, the three phyla presently investigated, viz. Chordata, Arthropoda and Nemathelminthes, are distinguishable as three separate lines of descent.

  8. Evidence of two lineages of the symbiont 'Candidatus Erwinia dacicola' in Italian populations of Bactrocera oleae (Rossi) based on 16S rRNA gene sequences.


    Savio, Claudia; Mazzon, Luca; Martinez-Sañudo, Isabel; Simonato, Mauro; Squartini, Andrea; Girolami, Vincenzo


    The close association between the olive fly Bactrocera oleae (Rossi) (Diptera: Tephritidae) and bacteria has been known for more than a century. Recently, the presence of a host-specific, hereditary, unculturable symbiotic bacterium, designated 'Candidatus Erwinia dacicola', has been described inside the cephalic organ of the fly, called the oesophageal bulb. In the present study, the 16S rRNA gene sequence variability of 'Ca. E. dacicola' was examined within and between 26 Italian olive fly populations sampled across areas where olive trees occur in the wild and areas where cultivated olive trees have been introduced through history. The bacterial contents of the oesophageal bulbs of 314 olive flies were analysed and a minimum of 781 bp of the 16S rRNA gene was sequenced. The corresponding host fly genotype was assessed by sequencing a 776 bp portion of the mitochondrial genome. Two 'Ca. E. dacicola' haplotypes were found (htA and htB), one being slightly more prevalent than the other (57%). The two haplotypes did not co-exist in the same individuals, as confirmed by cloning. Interestingly, the olive fly populations of the two main Italian islands, Sicily and Sardinia, appeared to be represented exclusively by the htB and htA haplotypes, respectively, while peninsular populations showed both bacterial haplotypes in different proportions. No significant correlation emerged between the two symbiont haplotypes and the 16 host fly haplotypes observed, suggesting evidence for a mixed model of vertical and horizontal transmission of the symbiont during the fly life cycle.

  9. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    PubMed Central

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  10. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.


    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu


    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.