Science.gov

Sample records for 19-rod clusters r3

  1. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    PubMed Central

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  2. Isolation and Molecular Characterization of Thirteen R2R3-MYB Transcription Factors from Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Sun, Wei; Lv, Haiyan; Xiao, Gong; Zeng, Shaohua; Wang, Ying

    2013-01-01

    Epimedium sagittatum (Sieb. et Zucc.) Maxim, a popular traditional Chinese medicinal plant, has been widely used for treating sexual dysfunction and osteoporosis in China. The main bioactive components in herba epimedii are prenylated flavonol glycosides, which are end products of a branch of the flavonoid biosynthetic pathway. The MYB transcription factors (TF) act as activators or repressors to regulate the flavonoid pathway. In this study, 13 full-length cDNA clones of R2R3-MYB TFs from E. sagittatum (designated as EsMYB1 to EsMYB13) were isolated and characterized. Sequence similarity and phylogenetic analysis placed nine R2R3-MYB members of E. sagittatum into five subgroups of the Arabidopsis R2R3-MYB family, while four members were not clustered into a defined subgroup. The number and length of introns from Epimedium R2R3-MYB genes varied significantly, but intron positions and phases were well conserved. Expression patterns of Epimedium R2R3-MYB genes in various tissues showed diverse. Finally, it is suggested that five Epimedium R2R3-MYB genes may be involved in regulating the flavonoid pathway and could be used as valuable candidate genes for metabolic engineering studies in future. Sequence information of 13 R2R3-MYB genes discovered here will also provide an entry point into the overview of whole R2R3-MYB family in Epimedium. PMID:23271373

  3. Isolation and molecular characterization of thirteen R2R3-MYB transcription factors from Epimedium sagittatum.

    PubMed

    Huang, Wenjun; Sun, Wei; Lv, Haiyan; Xiao, Gong; Zeng, Shaohua; Wang, Ying

    2012-12-27

    Epimedium sagittatum (Sieb. et Zucc.) Maxim, a popular traditional Chinese medicinal plant, has been widely used for treating sexual dysfunction and osteoporosis in China. The main bioactive components in herba epimedii are prenylated flavonol glycosides, which are end products of a branch of the flavonoid biosynthetic pathway. The MYB transcription factors (TF) act as activators or repressors to regulate the flavonoid pathway. In this study, 13 full-length cDNA clones of R2R3-MYB TFs from E. sagittatum (designated as EsMYB1 to EsMYB13) were isolated and characterized. Sequence similarity and phylogenetic analysis placed nine R2R3-MYB members of epimedii into five subgroups of the Arabidopsis R2R3-MYB family, while four members were not clustered into a defined subgroup. The number and length of introns from epimedii R2R3-MYB genes varied significantly, but intron positions and phases were well conserved. Expression patterns of epimedii R2R3-MYB genes in various tissues showed diverse. Finally, it is suggested that five epimedii R2R3-MYB genes may be involved in regulating the flavonoid pathway and could be used as valuable candidate genes for metabolic engineering studies in future. Sequence information of 13 R2R3-MYB genes discovered here will also provide an entry point into the overview of whole R2R3-MYB family in epimedii.

  4. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects.

    PubMed

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; Todd King, M; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; Vanitallie, Theodore B; Veech, Richard L

    2012-08-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1-2h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8-3.1h for β-hydroxybutyrate and 8-14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet.

  5. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; King, M. Todd; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; VanItallie, Theodore B.; Veech, Richard L.

    2013-01-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1–2 h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8–3.1 h for β-hydroxybutyrate and 8–14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet. PMID:22561291

  6. DISINTEGRATING ASTEROID P/2013 R3

    SciTech Connect

    Jewitt, David; Li, Jing; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Larson, Stephen

    2014-03-20

    Splitting of the nuclei of comets into multiple components has been frequently observed but, to date, no main-belt asteroid has been observed to break up. Using the Hubble Space Telescope, we find that main-belt asteroid P/2013 R3 consists of 10 or more distinct components, the largest up to 200 m in radius (assumed geometric albedo of 0.05) each of which produces a coma and comet-like dust tail. A diffuse debris cloud with total mass ∼2 × 10{sup 8} kg further envelopes the entire system. The velocity dispersion among the components, ΔV ∼ 0.2-0.5 m s{sup –1}, is comparable to the gravitational escape speeds of the largest members, while their extrapolated plane-of-sky motions suggest a break up between 2013 February and September. The broadband optical colors are those of a C-type asteroid. We find no spectral evidence for gaseous emission, placing model-dependent upper limits to the water production rate ≤1 kg s{sup –1}. Breakup may be due to a rotationally induced structural failure of the precursor body.

  7. Oral 28-day and developmental toxicity studies of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; Knight, Nicholas S.; Murray, Andrew J.; Cochlin, Lowri E.; King, M. Todd; Wong, Andrea W.; Roberts, Ashley; Robertson, Jeremy; Veech, Richard L.

    2013-01-01

    (R)-3-Hydroxybutyl (R)-3-hydroxybutyrate (ketone monoester) has been developed as an oral source of ketones, which may be utilized for energy. In a 28-day toxicity study, Crl:WI (Wistar) rats received diets containing, as 30% of the calories, ketone monoester (12 and 15 g/kg body weight/day for male and female rats, respectively). Control groups received either carbohydrate- or fat-based diets. Rats in the test group consumed less feed and gained less weight than control animals; similar findings have been documented in studies of ketogenic diets. Between-group differences were noted in selected hematology, coagulation, and serum chemistry parameters; however, values were within normal physiological ranges and/or were not accompanied by other changes indicative of toxicity. Upon gross and microscopic evaluation, there were no findings associated with the ketone monoester. In a developmental toxicity study, pregnant Crl:WI (Han) rats were administered 2 g/kg body weight/day ketone monoester or water (control) via gavage on days 6 through 20 of gestation. No Caesarean-sectioning or litter parameters were affected by the test article. The overall incidence of fetal alterations was higher in the test group; however, there were no specific alterations attributable to the test substance. The results of these studies support the safety of ketone monoester. PMID:22504461

  8. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  9. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification.

    PubMed

    Chicote, Javier U; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins.

  10. Production of (R)-3-hydroxybutyric acid by Arxula adeninivorans.

    PubMed

    Biernacki, Mateusz; Riechen, Jan; Hähnel, Urs; Roick, Thomas; Baronian, Kim; Bode, Rüdiger; Kunze, Gotthard

    2017-12-01

    (R)-3-hydroxybutyric acid can be used in industrial and health applications. The synthesis pathway comprises two enzymes, β-ketothiolase and acetoacetyl-CoA reductase which convert cytoplasmic acetyl-CoA to (R)-3-hydroxybutyric acid [(R)-3-HB] which is released into the culture medium. In the present study we used the non-conventional yeast, Arxula adeninivorans, for the synthesis enantiopure (R)-3-HB. To establish optimal production, we investigated three different endogenous yeast thiolases (Akat1p, Akat2p, Akat4p) and three bacterial thiolases (atoBp, thlp, phaAp) in combination with an enantiospecific reductase (phaBp) from Cupriavidus necator H16 and endogenous yeast reductases (Atpk2p, Afox2p). We found that Arxula is able to release (R)-3-HB used an existing secretion system negating the need to engineer membrane transport. Overexpression of thl and phaB genes in organisms cultured in a shaking flask resulted in 4.84 g L(-1) (R)-3-HB, at a rate of 0.023 g L(-1) h(-1) over 214 h. Fed-batch culturing with glucose as a carbon source did not improve the yield, but a similar level was reached with a shorter incubation period [3.78 g L(-1) of (R)-3-HB at 89 h] and the rate of production was doubled to 0.043 g L(-1) h(-1) which is higher than any levels in yeast reported to date. The secreted (R)-3-HB was 99.9% pure. This is the first evidence of enantiopure (R)-3-HB synthesis using yeast as a production host and glucose as a carbon source.

  11. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification

    PubMed Central

    Chicote, Javier U.; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins. PMID:28257417

  12. Detector production for the R3B Si-tracker

    NASA Astrophysics Data System (ADS)

    Borri, M.; Lemmon, R.; Thornhill, J.; Bate, R.; Chartier, M.; Clague, N.; Herzberg, R.-D.; Labiche, M.; Lindsay, S.; Nolan, P.; Pearce, F.; Powell, W.; Wells, D.

    2016-11-01

    R3B is a fixed target experiment which will study reactions with relativistic radioactive beams at FAIR. Its Si-tracker will surround the target volume and it will detect light charged-particles like protons. The detector technology in use consists of double-sided silicon strip sensors wire bonded to the custom made R3B-ASIC. The tracker allows for a maximum of two outer layers and one inner layer. This paper reports on the production of detectors necessary to build the minimum tracking configuration: one inner layer and one outer layer.

  13. Complete biconservative surfaces in R3 and S3

    NASA Astrophysics Data System (ADS)

    Nistor, Simona

    2016-12-01

    In this paper we consider the complete biconservative surfaces in Euclidean space R3 and in the unit Euclidean sphere S3. Biconservative surfaces in 3-dimensional space forms are characterized by the fact that the gradient of their mean curvature function is an eigenvector of the shape operator, and we are interested in studying local and global properties of such surfaces with non-constant mean curvature function. We determine the simply connected, complete Riemannian surfaces that admit biconservative immersions in R3 and S3. Moreover, such immersions are explicitly described.

  14. High Performance Analytics with the R3-Cache

    NASA Astrophysics Data System (ADS)

    Eavis, Todd; Sayeed, Ruhan

    Contemporary data warehouses now represent some of the world’s largest databases. As these systems grow in size and complexity, however, it becomes increasingly difficult for brute force query processing approaches to meet the performance demands of end users. Certainly, improved indexing and more selective view materialization are helpful in this regard. Nevertheless, with warehouses moving into the multi-terabyte range, it is clear that the minimization of external memory accesses must be a primary performance objective. In this paper, we describe the R 3-cache, a natively multi-dimensional caching framework designed specifically to support sophisticated warehouse/OLAP environments. R 3-cache is based upon an in-memory version of the R-tree that has been extended to support buffer pages rather than disk blocks. A key strength of the R 3-cache is that it is able to utilize multi-dimensional fragments of previous query results so as to significantly minimize the frequency and scale of disk accesses. Moreover, the new caching model directly accommodates the standard relational storage model and provides mechanisms for pro-active updates that exploit the existence of query “hot spots”. The current prototype has been evaluated as a component of the Sidera DBMS, a “shared nothing” parallel OLAP server designed for multi-terabyte analytics. Experimental results demonstrate significant performance improvements relative to simpler alternatives.

  15. Perturbative Chern-Simons theory on noncommutative Bbb R3

    NASA Astrophysics Data System (ADS)

    Bichl, Andreas A.; Grimstrup, Jesper M.; Putz, Volkmar; Schweda, Manfred

    2000-07-01

    A U(N) Chern-Simons theory on non-commutative Bbb R3 is constructed as a θ-deformed field theory. The model is characterized by two symmetries: the BRST-symmetry and the topological linear vector supersymmetry. It is shown that the theory is finite and θ-independent at the one-loop level and that the calculations respect the restriction of the topological supersymmetry. Thus the topological θ-deformed Chern-Simons theory is an example of a model which is non singular in the limit θ→0.

  16. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission

    PubMed Central

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  17. Additive manufacturing of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] scaffolds for engineered bone development.

    PubMed

    Mota, Carlos; Wang, Shen-Yu; Puppi, Dario; Gazzarri, Matteo; Migone, Chiara; Chiellini, Federica; Chen, Guo-Qiang; Chiellini, Emo

    2017-01-01

    A wide range of poly(hydroxyalkanoate)s (PHAs), a class of biodegradable polyesters produced by various bacteria grown under unbalanced conditions, have been proposed for the fabrication of tissue-engineering scaffolds. In this study, the manufacture of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] (or PHBHHx) scaffolds, by means of an additive manufacturing technique based on a computer-controlled wet-spinning system, was investigated. By optimizing the processing parameters, three-dimensional scaffolds with different internal architectures were fabricated, based on a layer-by-layer approach. The resulting scaffolds were characterized by scanning electron microscopy, which showed good control over the fibre alignment and a fully interconnected porous network, with porosity in the range 79-88%, fibre diameter 47-76 µm and pore size 123-789 µm. Moreover, the resulting fibres presented an internal porosity connected to the external fibre surface as a consequence of the phase-inversion process governing the solidification of the polymer solution. Scaffold compressive modulus and yield stress and strain could be varied in a certain range by changing the architectural parameters. Cell-culture experiments employing the MC3T3-E1 murine pre-osteoblast cell line showed good cell proliferation after 21 days of culture. The PHBHHx scaffolds demonstrated promising results in terms of cell differentiation towards an osteoblast phenotype. Copyright © 2014 John Wiley & Sons, Ltd.

  18. Evaluation of electron population terms for <r-3Se>4p, <r-3S>3p, and <r-3O>(2p): how do HOMO and LUMO shrink or expand depending on nuclear charges?

    PubMed

    Nakanishi, Waro; Hayashi, Satoko; Narahara, Kenji; Yamaki, Daisuke; Hada, Masahiko

    2008-01-01

    Electron population terms <r(-3)N> are evaluated for N=Se, S, and O. Calculations are performed on HOMO and LUMO constructed by pure atomic 4p(Se), 3p(S), and 2p(O) orbitals, employing the 6-311+G(3d) and/or 6-311(++)G(3df,3pd) basis sets at the HF, MP2, and DFT (B3 LYP) levels. Se(4+), Se(2+), Se(0), and Se(2-) with the O(h) symmetry are called G(A: Se) and HSe(+), H(2)Se, and HSe(-) with the C(infinityh) or C(2v) symmetry are named G(B: Se), here [G(A+B: Se) in all]. HOMO and LUMO in G(A+B: N) (N=Se, S, and O) satisfy the conditions of the calculations for <r(-3)N>. The <r(-3)Se>(4p), <r(-3)S>(3p), and <r(-3)O>(2p) values correlate well with the corresponding MO energies (epsilon(N)) for all calculation levels employed. Plots of <r(-3)N>(HOMO) and <r(-3)N>(LUMO) versus Q(N) (N=Se, S, and O) at the HF and MP2 levels are analyzed as two correlations. However, the plots at the DFT level can be analyzed as single correlation. A regression curve is assumed for the analysis. Behaviors of <r(-3)N> clarify how valence orbitals shrink or expand depending on Q(N). The applicability of <r(-3)N> is examined to establish a new method that enables us to analyze chemical shifts with the charge effect separately from others. A utility program derived from the Gaussian 03 (NMRANAL-NH03G) is applied to evaluate <r(-3)N> and examine the applicability to the NMR analysis.

  19. Gold in the layered structures of R3Au7Sn3: From relativity to versatility

    DOE PAGES

    Provino, Alessia; Steinberg, Simon Alexander; Smetana, Volodymyr; ...

    2016-07-11

    A new isotypic series of ternary rare earth element-gold-tetrel intermetallic compounds has been synthesized and their structures and properties have been characterized. R3Au7Sn3 (R = Y, La-Nd, Sm, Gd-Tm, Lu) crystallize with the hexagonal Gd3Au7Sn3 prototype (Pearson symbol hP26; P63/m, a = 8.110-8.372 Å, c = 9.351-9.609 Å, Vcell = 532.7-583.3 Å3, Z = 2), an ordered variant of the Cu10Sn3-type. Their structure is built up by GdPt2Sn-type layers, which feature edge-sharing Sn@Au6 trigonal antiprisms connected by trigonal R3 groups. Additional insertion of gold atoms leads to the formation of new homoatomic Au clusters, Au@Au6; alternatively, the structure can bemore » considered as a superstructural polyhedral packing of the ZrBeSi-type. The magnetization, heat ca-pacity and electrical resistivity have been measured for R3Au7Sn3 (R = Ce, Pr, Nd and Tb). All four compounds order antiferromagnetically with the highest TN of 13 K for Tb3Au7Sn3. In Ce3Au7Sn3, which has a TN of 2.9 K, the heat capacity and electrical resistivity data in zero and applied fields indicate the presence of Kondo interactions. The coefficient of the linear term in the electronic heat capacity, γ, derived from the heat capacity data below 0.5 K is 211 mJ/Ce mol K2 suggesting strong electronic correlations due to the Kondo interaction. The electronic structure calculations based on the projector augmented wave method for particular representatives of the series suggest different tendencies of the localized R-4f AOs to hybridize with the valence states. LMTO-based bonding analysis on the non-magnetic La3Au7Sn3 indicates that the integrated crystal orbital Hamilton popu-lations (COHPs) are dominated by the heteroatomic Au–Sn contacts; however, contributions from La–Au and La–Sn separations are significant, both together exceeding 40 % in the overall bonding. Furthermore, homoatomic Au–Au interactions are evident for the Au@Au6 units but, despite of the high atomic concentration of

  20. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice.

    PubMed

    Inoue, Masashi; Glendinning, John I; Theodorides, Maria L; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K; Bachmanov, Alexander A

    2007-12-19

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (D-tryptophan, D-phenylalanine, L-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (L-glutamine, L-threonine, L-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5'-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system.

  1. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice

    PubMed Central

    Inoue, Masashi; Glendinning, John I.; Theodorides, Maria L.; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K.; Bachmanov, Alexander A.

    2008-01-01

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (d-tryptophan, d-phenylalanine, l-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (l-glutamine, l-threonine, l-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5′-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

  2. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene

    PubMed Central

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain. PMID:26107521

  3. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene.

    PubMed

    Murovets, Vladimir O; Bachmanov, Alexander A; Zolotarev, Vasiliy A

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain.

  4. Gold-rich R3Au7Sn3: Establishing the interdependence between electronic features and physical properties

    DOE PAGES

    Provino, Alessia; Steinberg, Simon; Smetana, Volodymyr; ...

    2015-05-18

    Two new polar intermetallic compounds Y3Au7Sn3 (I) and Gd3Au7Sn3 (II) have been synthesized and their structures have been determined by single crystal X-ray diffraction (P63/m; Z = 2, a = 8.148(1)/8.185(3), and c = 9.394(2)/9.415(3) for I/II, respectively). They can formally be assigned to the Cu10Sn3 type and consist of parallel slabs of Sn centered, edge-sharing trigonal Au6 antiprisms connected through R3 (R = Y, Gd) triangles. Additional Au atoms reside in the centres of trigonal Au6 prisms forming Au@Au6 clusters with Au–Au distances of 2.906–2.960 Å, while the R–R contacts in the R3 groups are considerably larger than themore » sums of their metallic radii. These exclusive structural arrangements provide alluring systems to study the synergism between strongly correlated systems, particularly, those in the structure of (II), and extensive polar intermetallic contacts, which has been inspected by measurements of the magnetic properties, heat capacities and electrical conductivities of both compounds. Gd3Au7Sn3 shows an antiferromagnetic ordering at 13 K, while Y3Au7Sn3 is a Pauli paramagnet and a downward curvature in its electrical resistivity at about 1.9 K points to a superconducting transition. DFT-based band structure calculations on R3Au7Sn3 (R = Y, Gd) account for the results of the conductivity measurements and different spin ordering models of (II) provide conclusive hints about its magnetic structure. As a result, chemical bonding analyses of both compounds indicate that the vast majority of bonding originates from the heteroatomic Au–Gd and Au–Sn interactions, while homoatomic Au–Au bonding is evident within the Au@Au6 clusters.« less

  5. Phenoxy herbicides and fibrates potently inhibit the human chemosensory receptor subunit T1R3

    PubMed Central

    Maillet, Emeline L.; Margolskee, Robert F.; Mosinger, Bedrich

    2009-01-01

    We show that phenoxy-auxin herbicides and lipid-lowering fibrates inhibit human but not rodent T1R3. T1R3 as a co-receptor in taste cells responds to sweet compounds and amino-acids; in endocrine cells of gut and pancreas T1R3 contributes to glucose sensing. Thus, certain effects of fibrates in treating hyperlipidemia and type II diabetes may be via actions on T1R3. Likewise, phenoxy-herbicides may have adverse metabolic effects in humans that would have gone undetected in studies on rodents. PMID:19817384

  6. (2R,3S,4R)-3,4-Isopropyl­idenedi­oxy-2-(phenyl­sulfonyl­meth­yl)pyrrolidin-1-ol

    PubMed Central

    Flores, Mari Fe; Garcia, Pilar; M. Garrido, Narciso; Sanz, Francisca; Diez, David

    2012-01-01

    The title compound, C14H19NO5S, was prepared by nucleophilic addition of the lithium derivative of methyl­phenyl­sulfone to (3S,4R)-3,4-isopropyl­idene­dioxy­pyrroline 1-oxide. There are four mol­ecules in the asymmetric unit. The crystal structure determination confirms the configuration of the chiral centres as 2R,3S,4R. In the crystal, pairs of O—H⋯N hydrogen bonds link the mol­ecules into dimers. PMID:22904989

  7. Diversification of R2R3-MYB Transcription Factors in the Tomato Family Solanaceae.

    PubMed

    Gates, Daniel J; Strickler, Susan R; Mueller, Lukas A; Olson, Bradley J S C; Smith, Stacey D

    2016-08-01

    MYB transcription factors play an important role in regulating key plant developmental processes involving defense, cell shape, pigmentation, and root formation. Within this gene family, sequences containing an R2R3 MYB domain are the most abundant type and exhibit a wide diversity of functions. In this study, we identify 559 R2R3 MYB genes using whole genome data from four species of Solanaceae and reconstruct their evolutionary relationships. We compare the Solanaceae R2R3 MYBs to the well-characterized Arabidopsis thaliana sequences to estimate functional diversity and to identify gains and losses of MYB clades in the Solanaceae. We identify numerous R2R3 MYBs that do not appear closely related to Arabidopsis MYBs, and thus may represent clades of genes that have been lost along the Arabidopsis lineage or gained after the divergence of Rosid and Asterid lineages. Despite differences in the distribution of R2R3 MYBs across functional subgroups and species, the overall size of the R2R3 subfamily has changed relatively little over the roughly 50 million-year history of Solanaceae. We added our information regarding R2R3 MYBs in Solanaceae to other data and performed a meta-analysis to trace the evolution of subfamily size across land plants. The results reveal many shifts in the number of R2R3 genes, including a 54 % increase along the angiosperm stem lineage. The variation in R2R3 subfamily size across land plants is weakly positively correlated with genome size and strongly positively correlated with total number of genes. The retention of such a large number of R2R3 copies over long evolutionary time periods suggests that they have acquired new functions and been maintained by selection. Discovering the nature of this functional diversity will require integrating forward and reverse genetic approaches on an -omics scale.

  8. Closure report for underground storage tank 141-R3U1 and its associated underground piping

    SciTech Connect

    Mallon, B.J.; Blake, R.G.

    1994-03-01

    Underground storage tank UST 141-R3U1 at Lawrence Livermore National Laboratory (LLNL), was registered with the State Water Resources Control Board on June 27, 1984. This tank system consisted of a concrete tank, lined with polyvinyl chloride, and approximately 100 feet of PVC underground piping. UST 141-R3U1 had a capacity of 450 gallons. The underground piping connected three floor drains and one sink inside Building 141 to UST 141-R3U1. The wastewater collected in UST 141-R3U1 contained organic solvents, metals, and inorganic acids. On November 30, 1987, the 141-R3U1 tank system failed a precision tank test. The 141-R3U1 tank system was subsequently emptied and removed from service pending further precision tests to determine the location of the leak within the tank system. A precision tank test on February 5, 1988, was performed to confirm the November 30, 1987 test. Four additional precision tests were performed on this tank system between February 25, 1988, and March 6, 1988. The leak was located where the inlet piping from Building 141 penetrates the concrete side of UST 141-R3U1. The volume of wastewater that entered the backfill and soil around and/or beneath UST 141-R3U1 is unknown. On December 13, 1989, the LLNL Environmental Restoration Division submitted a plan to close UST 141-R3U1 and its associated piping to the Alameda County Department of Environmental Health. UST 141-R3U1 was closed as an UST, and shall be used instead as additional secondary containment for two aboveground storage tanks.

  9. Downregulation of DcR3 sensitizes hepatocellular carcinoma cells to TRAIL-induced apoptosis

    PubMed Central

    Liang, Chaojie; Xu, Yingchen; Li, Guangming; Zhao, Tuanjie; Xia, Feng; Li, Guanqun; Zhang, Dongxin; Wu, Jixiang

    2017-01-01

    Decoy receptor 3 (DcR3) has been recently described as an antiapoptosis and prometastasis factor since it can competitively bind to FasL, TL1A, and LIGHT, and it is highly expressed in many malignant tumors. Downregulation of DcR3 can promote tumor cell apoptosis and inhibit metastasis. A previous study demonstrated that reduction of DcR3 could induce tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis in pancreatic cancer cells. However, whether such an effect is seen in hepatocellular carcinoma (HCC) remains to be explored. This study was designed to investigate the sensitivity of HCC cells to TRAIL after silencing DcR3, and this was done by evaluating the expression of DcR3 in HCC cells and the effect on TRAIL-mediated apoptosis after downregulation of DcR3. Our data showed that DcR3 was highly expressed in HepG2, BEL-7402, Hep3B, Huh-7, MHCC97H, and SMCC7721 cell lines compared with normal liver cell line LO-2. Both HepG2 and BEL-7402 were tolerant to TRAIL-mediated apoptosis, and the tolerance was negatively correlated to the expression of DcR3. Silencing of DcR3 with shRNA and treatment with TRAIL induced obvious apoptosis in HepG2 and BEL-7402, with more cancer cells found in the G1 phase. SiDcR3 combined with TRAIL could induce activation of caspases-3, -8, and -9, raise the expression of the apoptotic protein Bax, and reduce the expression of antiapoptotic proteins (Bcl-2, Mcl-1, Bcl-XL, IAP-2, and survivin). Caspase-8 inhibitor Ac-IETD-CHO significantly decreased the activation of caspase cascade, indicating that the extrinsic pathway may have a vital role in the apoptotic events induced by SiDcR3/TRAIL. Furthermore, our results showed that the TRAIL death receptor 5 (DR5) was upregulated and that DR5 neutralizing antibody abrogated the effect of SiDcR3. Our results demonstrated that downregulation of DcR3 could enhance TRAIL-mediated apoptosis in HCC through the death receptor pathway. In the future, this might be useful as

  10. A regulatory gene network related to the porcine umami taste receptor (TAS1R1/TAS1R3).

    PubMed

    Kim, J M; Ren, D; Reverter, A; Roura, E

    2016-02-01

    Taste perception plays an important role in the mediation of food choices in mammals. The first porcine taste receptor genes identified, sequenced and characterized, TAS1R1 and TAS1R3, were related to the dimeric receptor for umami taste. However, little is known about their regulatory network. The objective of this study was to unfold the genetic network involved in porcine umami taste perception. We performed a meta-analysis of 20 gene expression studies spanning 480 porcine microarray chips and screened 328 taste-related genes by selective mining steps among the available 12,320 genes. A porcine umami taste-specific regulatory network was constructed based on the normalized coexpression data of the 328 genes across 27 tissues. From the network, we revealed the 'taste module' and identified a coexpression cluster for the umami taste according to the first connector with the TAS1R1/TAS1R3 genes. Our findings identify several taste-related regulatory genes and extend previous genetic background of porcine umami taste.

  11. Maize R2R3 Myb genes: Sequence analysis reveals amplification in the higher plants.

    PubMed

    Rabinowicz, P D; Braun, E L; Wolfe, A D; Bowen, B; Grotewold, E

    1999-09-01

    Transcription factors containing the Myb-homologous DNA-binding domain are widely found in eukaryotes. In plants, R2R3 Myb-domain proteins are involved in the control of form and metabolism. The Arabidopsis genome harbors >100 R2R3 Myb genes, but few have been found in monocots, animals, and fungi. Using RT-PCR from different maize organs, we cloned 480 fragments corresponding to a 42-44 residue-long sequence spanning the region between the conserved DNA-recognition helices (Myb(BRH)) of R2R3 Myb domains. We determined that maize expresses >80 different R2R3 Myb genes, and evolutionary distances among maize Myb(BRH) sequences indicate that most of the amplification of the R2R3 Myb gene family occurred after the origin of land plants but prior to the separation of monocots and dicots. In addition, evidence is provided for the very recent duplication of particular classes of R2R3 Myb genes in the grasses. Together, these findings render a novel line of evidence for the amplification of the R2R3 Myb gene family in the early history of land plants and suggest that maize provides a possible model system to examine the hypothesis that the expansion of Myb genes is associated with the regulation of novel plant cellular functions.

  12. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers.

    PubMed

    DeVoe, Dale; Gotshall, Robert; McArthur, Trisha

    2003-10-01

    This study compared the RT3 Research Tracker accelerometer to the Tritrac R3D accelerometer in both laboratory and field settings and tested the hypothesis that the RT3 records higher physical activity counts and smaller standard deviations than the R3D. The RT3 is relatively new and untested and its concurrent validity with existing instruments and physical activity needs to be assessed before being used in research. In this study the RT3 had higher average recordings of physical activity counts in all of the nine testing situations than the R3D. However, in terms of agreement between the instruments, the RT3 might be 582 below or 1,236 above (activity counts) the R3D in assessing physical activity. These results do not establish that the RT3 is more consistently measuring higher physical activity counts than the R3D. Comparing vector magnitude with oxygen consumption and heart rate across the 0% grade testing conditions indicated that the RT3 and R3D are sensitive to changes in various intensities of level ambulation. When the 5%, 10%, and 15% grade on the treadmill protocols were analyzed, low correlations between oxygen consumption and heart rate with vector magnitude responses were found for both the RT3 and R3D. Differences in agreement between the RT3 and R3D did not vary in any systematic way over the range in testing conditions which substantiates that the RT3 and R3D accelerometers are sensitive on flat surfaces but are insensitive to changes in grade.

  13. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

    PubMed Central

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-01-01

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

  14. Regulation of Cell Fate Determination by Single-Repeat R3 MYB Transcription Factors in Arabidopsis

    SciTech Connect

    Wang, Shucai; Chen, Jay

    2014-01-01

    MYB transcription factors regulate multiple aspects of plant growth and development. Among the large family of MYB transcription factors, single-repeat R3 MYB are characterized by their short sequence (<120 amino acids) consisting largely of the single MYB DNA-binding repeat. In the model plant Arabidopsis, R3 MYBs mediate lateral inhibition during epidermal patterning and are best characterized for their regulatory roles in trichome and root hair development. R3 MYBs act as negative regulators for trichome formation but as positive regulators for root hair development. In this article, we provide a comprehensive review on the role of R3 MYBs in the regulation of cell type specification in the model plant Arabidopsis.

  15. R3 receptor tyrosine phosphatases: conserved regulators of receptor tyrosine kinase signaling and tubular organ development.

    PubMed

    Jeon, Mili; Zinn, Kai

    2015-01-01

    R3 receptor tyrosine phosphatases (RPTPs) are characterized by extracellular domains composed solely of long chains of fibronectin type III repeats, and by the presence of a single phosphatase domain. There are five proteins in mammals with this structure, two in Drosophila and one in Caenorhabditis elegans. R3 RPTPs are selective regulators of receptor tyrosine kinase (RTK) signaling, and a number of different RTKs have been shown to be direct targets for their phosphatase activities. Genetic studies in both invertebrate model systems and in mammals have shown that R3 RPTPs are essential for tubular organ development. They also have important functions during nervous system development. R3 RPTPs are likely to be tumor suppressors in a number of types of cancer.

  16. R3 receptor tyrosine phosphatases: conserved regulators of receptor tyrosine kinase signaling and tubular organ development

    PubMed Central

    Jeon, Mili; Zinn, Kai

    2014-01-01

    Summary R3 receptor tyrosine phosphatases (RPTPs) are characterized by extracellular domains composed solely of long chains of fibronectin type III repeats, and by the presence of a single phosphatase domain. There are five proteins in mammals with this structure, two in Drosophila, and one in Caenorhabditis elegans. R3 RPTPs are selective regulators of receptor tyrosine kinase (RTK) signaling, and a number of different RTKs have been shown to be direct targets for their phosphatase activities. Genetic studies in both invertebrate model systems and in mammals have shown that R3 RPTPs are essential for tubular organ development. They also have important functions during nervous system development. R3 RPTPs are likely to be tumor suppressors in a number of types of cancer. PMID:25242281

  17. Investigating ( R)-3-Methylcyclopentanone Conformers Using Temperature-Dependent Raman Spectroscopy

    NASA Astrophysics Data System (ADS)

    Al-Basheer, W.

    2014-05-01

    Recorded temperature-dependent Raman spectra of neat (R)-3-methylcyclopentanone (R3MCP) over the Raman active C-H stretch region (2850-3000 cm-1) are being employed to determine conformer energy difference (ΔH° = 4.83 ± 0.45 kJ/mol) between R3MCP equatorial-methyl and axial-methyl isomers. Upon comparison with spectra obtained at room temperature, crystalline R3MCP Raman spectra recorded at liquid nitrogen temperature (~77 K) are being utilized to assist identifying Raman vibrational modes a rising due to R3MCP equatorial and axial conformers. Correspondingly, density functional theory calculations (correlation function type B3LYP using a moderate 6-31G* and large aug-cc-pVDZ basis sets) are also manipulated to obtain highly resolved Raman spectra for the optimized geometries of equatorial and axial conformers, which are also used to help identify vibrational modes a rising due to each conformer. Reported calculated spectra of the individual R3MCP conformers are shown to have good agreement with corresponding experimental Raman spectra.

  18. A potent antibrowning agent from pine needles of Cedrus deodara: 2R,3R-dihydromyricetin.

    PubMed

    Liang, Xue; Wu, Yan-Ping; Qiu, Jing-Hong; Zhong, Kai; Gao, Hong

    2014-09-01

    This article focuses on finding the novel antibrowning agents from the pine needles of Cedrus deodara and studying its antibrowning effect. By bioassay guide of tyrosinase inhibitory activity, the main active compound was isolated and purified from 50% methanol extract of pine needles of C. deodara through macroporous resin Diaion HP-20 column chromatography and high-performance liquid chromatography. Based on mass and nuclear magnetic resonance data, the active compound was identified as 2R,3R-dihydromyricetin, which showed the potent monophenolase and diphenolase inhibitory activities. Moreover, 2R,3R-dihydromyricetin exhibited a strong ABTS radical scavenging activity with a dose-dependent manner. The antibrowning efficacy of 2R,3R-dihydromyricetin was evaluated by monitoring the changes of L*, a*, and b* values and total color difference (△E) on fresh-cut apple slices. It was found that 2R,3R-dihydromyricetin was effective in inhibiting the browning of apple slices treated with a concentration as low as 0.05% at 25 °C for 24 h. Its antibrowning effect was significantly better than ascorbic acid (0.5%) alone. Furthermore, 2R,3R-dihydromyricetin showed a good synergistic antibrowning effect with ascorbic acid. This is the first report that 2R,3R-dihydromyricetin from pine needles of C. deodara may be used as a potential antibrowning agent in protecting against food browning.

  19. Microvillous cells expressing IP3R3 in the olfactory epithelium of mice

    PubMed Central

    Hegg, Colleen C.; Jia, Cuihong; Chick, Wallace S.; Restrepo, Diego; Hansen, Anne

    2015-01-01

    Microvillous cells of the main olfactory epithelium have been described variously as primary olfactory neurons, secondary chemosensory cells, or non-sensory cells. Here we generated an IP3R3tm1(tauGFP) mouse in which the coding region for a fusion protein of tau and green fluorescent protein (tauGFP) replaces the first exon of the Itpr3 gene. We provide immunohistochemical and functional characterization of the cells expressing IP3 receptor type 3 in the olfactory epithelium. Since we determined that these cells bear microvilli at their apex, we call these cells IP3R3 MV cells. The cell body of these IP3R3 MV cells lies in the upper third of the main olfactory epithelium; a long thick basal process projects towards the base of the epithelium without penetrating the basal lamina. Retrograde labeling and unilateral bulbectomy corroborated that these IP3R3 MV cells do not extend axons to the olfactory bulb and therefore are not olfactory sensory neurons. The immunohistochemical features of the IP3R3 MV cell varied suggesting either developmental stages or the existence of subsets of these cells. Thus, for example, subsets of the IP3R3 MV cells make contact with substance P fibers or express the purinergic receptor P2X3. In addition, in recordings of intracellular calcium, these cells respond to ATP and substance P as well as to a variety of odors. The characterization of IP3R3 MV cells as non-neuronal chemoresponsive cells helps explain the differing descriptions of microvillous cells in the literature. PMID:20958798

  20. Tau Assembly: The Dominant Role of PHF6 (VQIVYK) in Microtubule Binding Region Repeat R3

    PubMed Central

    Ganguly, Pritam; Do, Thanh D.; Larini, Luca; LaPointe, Nichole E.; Sercel, Alexander J.; Shade, Madeleine F.; Feinstein, Stuart C.; Bowers, Michael T.; Shea, Joan-Emma

    2015-01-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; 273GKVQIINKKLDL284) and PHF6 (R3/wt; 306VQIVYKPVDLSK317), and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*/PHF6 interactions in initiating the aggregation of full length Tau. Lastly, R2/ΔK280 binds stronger to R3/wt than R2/wt suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  1. Determining the Nature and Origin of Mass Loss from Active Asteroid P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David

    2014-10-01

    We propose a program of WFC3 images of the active asteroid P/2013 R3 in order to determine the nature and origin of mass loss from this object. R3 has a unique, multiple nucleus structure in which the components are measured to separate at sub-meter per second velocities. It is best explained as a rotational breakup (presumably resulting from the YORP torque). We will obtain images over a wide time base in Cycle 22 in order to determine the orbits of the fragments and we will obtain time-series, high resolution photometry in order to measure their rotations. Rotational breakup and rotational mass-shedding are suspected to be the main mechanisms of destruction for sub-kilometer asteroids. Neither has been observed before but, between P/2013 R3 and P/2013 P5 (subject of another proposal) we have the first, potentially ground-breaking opportunities to observe both.

  2. Multiple positive solutions for Kirchhoff-type problems in R^3 involving critical Sobolev exponents

    NASA Astrophysics Data System (ADS)

    Fan, Haining

    2016-10-01

    In this paper, we study the following nonlinear problem of Kirchhoff type with critical Sobolev exponent -(a+bintlimits_{R^3}|nabla u|^2dx)Δ u+u=λ f(x)u^{q-1}+g(x)u^5,quad xin R^3, uin H^1(R^3), where a, b > 0, 4 < q < 6, and {λ} is a positive parameter. Under certain assumptions on f( x) and g( x) and {λ} is small enough, we obtain a relationship between the number of positive solutions and the topology of the global maximum set of g. The Nehari manifold and Ljusternik-Schnirelmann category are the main tools in our study. Moreover, using the Mountain Pass Theorem, we give an existence result about {λ} large.

  3. Stress-induced adaptation of neutrophilic granulocyte activity in K and R3 carp lines.

    PubMed

    Pijanowski, L; Verburg-van Kemenade, B M L; Irnazarow, I; Chadzinska, M

    2015-12-01

    Both in mammals and fish, stress induces remarkable changes in the immune response. We focused on stress-induced changes in the activity of neutrophilic granulocytes in the R3 and K lines of common carp, which showed differential stress responses. Our study clearly demonstrates that a prolonged restraint stress differentially affects the activity of K and R3 carp neutrophils. In the K line, stress decreased the respiratory burst, while in the R3 line it reduced the release of extracellular DNA. Surprisingly, the stress-induced changes in ROS production and NET formation did not correlate with changes in gene expression of the inflammatory mediators and GR receptors. In neutrophilic granulocytes from K carp, gene expression of the stress-sensitive cortisol GR1 receptor was significantly higher than in neutrophils from R3 fish, which will make these cells more sensitive to high levels of cortisol. Moreover, upon stress, neutrophilic granulocytes of K carp up-regulated gene expression of the anti-inflammatory cytokine IL-10 while this was not observed in neutrophilic granulocytes of R3 carp. Therefore, we can hypothesize that, in contrast to R3 neutrophils, the more cortisol sensitive neutrophils from K carp respond to stress with up-regulation of IL-10 and consequently reduction of ROS production. Most probably the ROS-independent NET formation in K carp is not regulated by this anti-inflammatory cytokine. These data may indicate a predominantly ROS-independent formation of NETs by carp neutrophilic granulocytes. Moreover, they underline the important role of IL-10 in stress-induced immunoregulation.

  4. Cluster Headache

    MedlinePlus

    Cluster headache Overview By Mayo Clinic Staff Cluster headaches, which occur in cyclical patterns or clusters, are one of the most painful types of headache. A cluster headache commonly awakens you ...

  5. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

    PubMed

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  6. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  7. Genome-wide identification and characterization of R2R3MYB family in Rosaceae.

    PubMed

    González, Máximo; Carrasco, Basilio; Salazar, Erika

    2016-09-01

    Transcription factors R2R3MYB family have been associated with the control of secondary metabolites, development of structures, cold tolerance and response to biotic and abiotic stress, among others. In recent years, genomes of Rosaceae botanical family are available. Although this information has been used to study the karyotype evolution of these species from an ancestral genome, there are no studies that treat the evolution and diversity of gene families present in these species or in the botanical family. Here we present the first comparative study of the R2R3MYB subfamily of transcription factors in three species of Rosaceae family (Malus domestica, Prunus persica and Fragaria vesca). We described 186, 98 and 86 non-redundant gene models for apple, peach and strawberry, respectively. In this research, we analyzed the intron-exon structure and genomic distribution of R2R3MYB families mentioned above. The phylogenetic comparisons revealed putative functions of some R2R3MYB transcription factors. This analysis found 44 functional subgroups, seven of which were unique for Rosaceae. In addition, our results showed a highly collinearity among some genes revealing the existence of conserved gene models between the three species studied. Although some gene models in these species have been validated under several approaches, more research in the Rosaceae family is necessary to determine gene expression patterns in specific tissues and development stages to facilitate understanding of the regulatory and biochemical mechanism in this botanical family.

  8. Subspecialization of R2R3-MYB Repressors for Anthocyanin and Proanthocyanidin Regulation in Forage Legumes

    PubMed Central

    Albert, Nick W.

    2015-01-01

    The synthesis of anthocyanin pigments and proanthocyanidins (condensed tannins) is regulated by MYB-bHLH-WDR (MBW) transcription factor complexes in all angiosperms studied to date. Tr-MYB133 and Tr-MYB134 were isolated from Trifolium repens and encode R2R3-MYBs that antagonize the activity of MBW activation complexes. These two genes are conserved in other legume species, and form two sub-clades within the larger anthocyanin/proanthocyanidin clade of MYB repressors. However, unlike petunia and Arabidopsis, these R2R3-MYB repressors do not prevent ectopic accumulation of anthocyanins or proanthocyanidins. Instead, they are expressed when anthocyanins or proanthocyanidins are being synthesized, and provide feedback regulation to MBW complexes. This feedback occurs because Tr-MYB133 and Tr-MYB134 are themselves regulated by MBW complexes. Tr-MYB133 is regulated by MBW complexes containing anthocyanin-related R2R3-MYB proteins (Tr-RED LEAF), while Tr-MYB134 is regulated by complexes containing the proanthocyanidin R2R3-MYBs (Tr-MYB14). Other features of the MBW gene regulation networks are also conserved within legumes, including the ability for the anthocyanin MBW complexes to activate the expression of the AN1/TT8 clade bHLH factor. The regulation of Tr-MYB133 and Tr-MYB134 by distinct, pathway-specific MBW complexes has resulted in subspecialization for controlling anthocyanin or proanthocyanidin synthesis. PMID:26779194

  9. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

    PubMed Central

    Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

    2015-01-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  10. Production of (R)-3-hydroxybutyric acid by Burkholderia cepacia from wood extract hydrolysates

    PubMed Central

    2014-01-01

    (R)-hydroxyalkanoic acids (R-HAs) are valuable building blocks for the synthesis of fine chemicals and biopolymers because of the chiral center and the two active functional groups. Hydroxyalkanoic acids fermentation can revolutionize the polyhydroxyalkanoic acids (PHA) production by increasing efficiency and enhancing product utility. Modifying the fermentation conditions that promotes the in vivo depolymerization and secretion to fermentation broth in wild type bacteria is a novel and promising approach to produce R-HAs. Wood extract hydrolysate (WEH) was found to be a suitable substrate for R-3-hydroxybutyric acid (R-3-HB) production by Burkholderia cepacia. Using Paulownia elongate WEH as a feedstock, the R-3-HB concentration in fermentation broth reached as high as 14.2 g/L after 3 days of batch fermentation and the highest concentration of 16.8 g/L was obtained at day 9. Further investigation indicated that the composition of culture medium contributed to the enhanced R-3-HB production. PMID:24949263

  11. Subspecialization of R2R3-MYB Repressors for Anthocyanin and Proanthocyanidin Regulation in Forage Legumes.

    PubMed

    Albert, Nick W

    2015-01-01

    The synthesis of anthocyanin pigments and proanthocyanidins (condensed tannins) is regulated by MYB-bHLH-WDR (MBW) transcription factor complexes in all angiosperms studied to date. Tr-MYB133 and Tr-MYB134 were isolated from Trifolium repens and encode R2R3-MYBs that antagonize the activity of MBW activation complexes. These two genes are conserved in other legume species, and form two sub-clades within the larger anthocyanin/proanthocyanidin clade of MYB repressors. However, unlike petunia and Arabidopsis, these R2R3-MYB repressors do not prevent ectopic accumulation of anthocyanins or proanthocyanidins. Instead, they are expressed when anthocyanins or proanthocyanidins are being synthesized, and provide feedback regulation to MBW complexes. This feedback occurs because Tr-MYB133 and Tr-MYB134 are themselves regulated by MBW complexes. Tr-MYB133 is regulated by MBW complexes containing anthocyanin-related R2R3-MYB proteins (Tr-RED LEAF), while Tr-MYB134 is regulated by complexes containing the proanthocyanidin R2R3-MYBs (Tr-MYB14). Other features of the MBW gene regulation networks are also conserved within legumes, including the ability for the anthocyanin MBW complexes to activate the expression of the AN1/TT8 clade bHLH factor. The regulation of Tr-MYB133 and Tr-MYB134 by distinct, pathway-specific MBW complexes has resulted in subspecialization for controlling anthocyanin or proanthocyanidin synthesis.

  12. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    PubMed

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa.

  13. The Rapid Response Radiation Survey (R3S) Mission Using the HISat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in LEO, will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HiSat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaDX), will validate exposure prediction capabilities of NAIRAS. This paper discusses the development of the R3S experiment as made possible by use of the HiSat architecture. The system design and operational modes of the experiment are described, as well as the experiment interfaces to the HiSat satellite via the user defined adapter (UDA) provided by NovaWurks. This paper outlines the steps taken by the project to execute the R3S mission in the 4 months of design, build, and test. Finally, description of the engineering process is provided, including the use of facilitated rapid/concurrent engineering sessions, the associated documentation, and the review process employed.

  14. COMPARATIVE EVALUATION OF R3f GARNET BEAD FILTRATION AND MULTIMEDIA FILTRATION SYSTEMS; FINAL REPORT

    EPA Science Inventory

    This report summarizes the results of tests conducted to date at the EPA T&E Facility on the R3f filtration system utilizing fine beads (such as garnet beads or glass beads) and a conventional multimedia filtration system. Both systems have been designed and built by Enprotec, a...

  15. Overexpression of MusaMYB31, a R2R3 type MYB transcription factor gene indicate its role as a negative regulator of lignin biosynthesis in banana

    PubMed Central

    Ganapathi, T. R.

    2017-01-01

    Lignin and polyphenols are important cellular components biosynthesized through phenylpropanoid pathway. Phenylpropanoid pathway in plants is regulated by some important transcription factors including R2R3 MYB transcription factors. In this study, we report the cloning and functional characterization of a banana R2R3-MYB transcription factor (MusaMYB31) by overexpression in transgenic banana plants and evaluated its potential role in regulating biosynthesis of lignin and polyphenols. Sequence analysis of MusaMYB31 indicated its clustering with members of subgroup 4 (Sg4) of R2R3MYB family which are well known for their role as repressors of lignin biosynthesis. Expression analysis indicated higher expression of MusaMYB31 in corm and root tissue, known for presence of highly lignified tissue than other organs of banana. Overexpression of MusaMYB31 in banana cultivar Rasthali was carried out and four transgenic lines were confirmed by GUS histochemical staining, PCR analysis and Southern blot. Histological and biochemical analysis suggested reduction of cell wall lignin in vascular elements of banana. Transgenic lines showed alteration in transcript levels of general phenylpropanoid pathway genes including lignin biosynthesis pathway genes. Reduction of total polyphenols content in transgenic lines was in line with the observation related to repression of general phenylpropanoid pathway genes. This study suggested the potential role of MusaMYB31 as repressor of lignin and polyphenols biosynthesis in banana. PMID:28234982

  16. Overexpression of MusaMYB31, a R2R3 type MYB transcription factor gene indicate its role as a negative regulator of lignin biosynthesis in banana.

    PubMed

    Tak, Himanshu; Negi, Sanjana; Ganapathi, T R

    2017-01-01

    Lignin and polyphenols are important cellular components biosynthesized through phenylpropanoid pathway. Phenylpropanoid pathway in plants is regulated by some important transcription factors including R2R3 MYB transcription factors. In this study, we report the cloning and functional characterization of a banana R2R3-MYB transcription factor (MusaMYB31) by overexpression in transgenic banana plants and evaluated its potential role in regulating biosynthesis of lignin and polyphenols. Sequence analysis of MusaMYB31 indicated its clustering with members of subgroup 4 (Sg4) of R2R3MYB family which are well known for their role as repressors of lignin biosynthesis. Expression analysis indicated higher expression of MusaMYB31 in corm and root tissue, known for presence of highly lignified tissue than other organs of banana. Overexpression of MusaMYB31 in banana cultivar Rasthali was carried out and four transgenic lines were confirmed by GUS histochemical staining, PCR analysis and Southern blot. Histological and biochemical analysis suggested reduction of cell wall lignin in vascular elements of banana. Transgenic lines showed alteration in transcript levels of general phenylpropanoid pathway genes including lignin biosynthesis pathway genes. Reduction of total polyphenols content in transgenic lines was in line with the observation related to repression of general phenylpropanoid pathway genes. This study suggested the potential role of MusaMYB31 as repressor of lignin and polyphenols biosynthesis in banana.

  17. Solvent, temperature and concentration effects on the optical rotatory dispersion of (R)-3-methylcyclohexanone

    NASA Astrophysics Data System (ADS)

    Alenaizan, Asem; Al-Basheer, Watheq; Musa, Musa M.

    2017-02-01

    Optical rotatory dispersion (ORD) spectra are reported for isolated and solvated (R)-3-methylcyclohexanone (R-3MCH) in 10 solvents, of wide polarity range, and over the spectral range 350-650 nm. Sample concentration effects on ORD spectra of R-3MCH were also recorded and investigated over widely varying concentrations from 2.5 × 10-3 to 2.5 × 10-1 g/mL where an observed sensitivity of optical rotation (OR) to incident light wavelength at low concentrations is correlated to solvent effects. Temperature effects were also studied by recording ORD spectra over the temperature range 0-65 °C in toluene. Recorded specific OR was plotted against various solvent parameters, namely, dipole moment, polarity, refractive index and polarizability to probe solvent effects. Furthermore, solvent effects were studied by incorporating Kamlet's and Taft's solvent parameters in the multi-parametric linear fitting. Theoretically, ORD spectra and populations of optimized geometries of equatorial and axial conformers of R-3MCH were calculated in the gas and solvated phases. All theoretical calculations were performed employing the polarizable continuum model using density functional theoretical and composite scheme (G4) methods with aug-cc-pVTZ and aug-cc-pVDZ basis sets. Net ORD spectra of R-3MCH were generated by the Boltzmann-weighted sum of the contributions of the dominant conformers. Upon comparing theoretical and experimental ORD spectra, a very good agreement is observed for the ORD spectra in the gas phase and high polarity solvents compared to relatively lesser agreement in low polarity solvents.

  18. Expression of ryanodine receptor RyR3 produces Ca2+ sparks in dyspedic myotubes

    PubMed Central

    Ward, Christopher W; Schneider, Martin F; Castillo, Daniel; Protasi, Feliciano; Wang, Yaming; Wayne Chen, S R; Allen, Paul D

    2000-01-01

    Discrete, localized elevations of myoplasmic [Ca2+], Ca2+‘sparks’, were readily detected using the fluorescent Ca2+ indicator fluo-3 and laser scanning confocal microscopy in ‘dyspedic’ 1B5 myotubes, i.e. myotubes which do not express ryanodine receptors (RyRs), transduced with virions containing cDNA for RyR type 3 that were saponin permeabilized to allow dye entry. Ca2+ sparks were never observed in non-transduced RyR null myotubes.The spatial locations of sparks observed in permeabilized myotubes roughly corresponded to regions of RyR protein expression in the same myotube as detected after subsequent fixation and antibody staining.Permeabilized RyR3-transduced myotubes exhibited similar punctate peripheral RyR3 protein immunohistochemical patterns as myotubes fixed before permeabilization indicating that permeabilization did not affect the structural organization of the triad.Ca2+ sparks, recorded in line scan mode, in permeabilized myotubes expressing RyR3 exhibited mean amplitudes (change in fluorescence/mean fluorescence, ΔF/F: 1.20 ± 0.04) and temporal rise times (10-90 %; 6.31 ± 0.12 ms) similar to those of sparks recorded in permeabilized frog skeletal muscle fibres (0.98 ± 0.01; 6.11 ± 0.07, respectively) using the same confocal system. Spatial extent and temporal duration of the Ca2+ sparks were ≈40 % larger in the RyR3-expressing myotube cultures than in frog fibres.Ca2+ sparks recorded in line scan mode often occurred repetitively at the same spatial location in RyR3-expressing myotubes. Such repetitive events were highly reproducible in amplitude and spatio-temporal properties, as previously observed for repetitive mode sparks in frog skeletal muscle.Ca2+ sparks recorded in xy mode were frequently compressed in the y (slower scan) direction compared to the x direction. This asymmetry was reproduced assuming spatially symmetric events having the time course of Ca2+ sparks recorded in line scan (xt) mode.These expression studies

  19. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

    PubMed Central

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Li, Jilun

    2015-01-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus. PMID:25819953

  20. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

    PubMed

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Wen, Ying; Li, Jilun

    2015-06-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

  1. A Supervisor-Targeted Implementation Approach to Promote System Change: The R(3) Model.

    PubMed

    Saldana, Lisa; Chamberlain, Patricia; Chapman, Jason

    2016-11-01

    Opportunities to evaluate strategies to create system-wide change in the child welfare system (CWS) and the resulting public health impact are rare. Leveraging a real-world, system-initiated effort to infuse the use of evidence-based principles throughout a CWS workforce, a pilot of the R(3) model and supervisor-targeted implementation approach is described. The development of R(3) and its associated fidelity monitoring was a collaboration between the CWS and model developers. Outcomes demonstrate implementation feasibility, strong fidelity scale measurement properties, improved supervisor fidelity over time, and the acceptability and perception of positive change by agency leadership. The value of system-initiated collaborations is discussed.

  2. Effects of Nitrogen Resources on Fermentative Biohydrogen Production of Biohydrogenbacterium R3 sp.nov.

    NASA Astrophysics Data System (ADS)

    Chen, Hong; Han, Wei; Yue, Li-ran; Li, Yong-feng; Liu, Kun; Yang, Chuan-ping

    2010-11-01

    This study discussed the effects of nitrogen resources (include organic nitrogen resources and inorganic nitrogen resources) on hydrogen production bacterium (HPB) Biohydrogenbacterium R3 sp.nov. The performance of organic nitrogen resource to Biohydrogenbacterium R3 sp.nov. was better than that of inorganic nitrogen resource on cell growth and hydrogen production. Yeast powder was most beneficial to promote cell growth and hydrogen production among all those nitrogen resources with the maximum of hydrogen production yield, hydrogen production ration and specific hydrogen produce ration were 1529.69 ml H2/L, 16.94 mmol H2/g CDW•h and 1.33 mol H2/mol glucose, respectively.

  3. (2R,3S,2'' R,3''R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract.

    PubMed

    Balemba, Onesmo B; Stark, Timo D; Lösch, Sofie; Patterson, Savannah; McMillan, John S; Mawe, Gary M; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca(2+)) imaging was used to analyze the effect of GBB on Ca(2+) flashes and Ca(2+) waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1-5 and M7, and (2R,3S,2'' R,3''R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2'' R,3''R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2''R,3'' R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca(2+) flashes and Ca(2+) waves. GBB, M3 and (2R,3 S,2''R,3''R)-manniflavanone inhibited action potentials. L-type Ca(2+) channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2''R,3'' R)-manniflavanone. GBB and (2R,3S,2'' R,3''R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3 S,2''R,3''R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2'' R,3''R)-manniflavanone relax smooth muscle by inhibiting L-type Ca(2+) channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias.

  4. (2R,3S,2”R,3”R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract

    PubMed Central

    Balemba, Onesmo B.; Stark, Timo D.; Lösch, Sofie; Patterson, Savannah; McMillan, John S.; Mawe, Gary M.; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca2+) imaging was used to analyze the effect of GBB on Ca2+ flashes and Ca2+ waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1–5 and M7, and (2R,3S,2”R,3”R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2”R,3”R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2”R,3”R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca2+ flashes and Ca2+ waves. GBB, M3 and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials. L-type Ca2+ channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2”R,3”R)-manniflavanone. GBB and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3S,2”R,3”R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2”R,3”R)-manniflavanone relax smooth muscle by inhibiting L-type Ca2+ channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  5. Antiausterity activity of arctigenin enantiomers: importance of (2R,3R)-absolute configuration.

    PubMed

    Awale, Suresh; Kato, Mamoru; Dibwe, Dya Fita; Li, Feng; Miyoshi, Chika; Esumi, Hiroyasu; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2014-01-01

    From a MeOH extract of powdered roots of Wikstroemia indica, six dibenzyl-gamma-butyrolactone-type lignans with (2S,3S)-absolute configuration [(+)-arctigenin (1), (+)-matairesinol (2), (+)-trachelogenin (3), (+)-nortrachelogenin (4), (+)-hinokinin (5), and (+)-kusunokinin (6)] were isolated, whereas three dibenzyl-gamma-butyrolactone-type lignans with (2R,3R)-absolute configuration [(-)-arctigenin (1*), (-)-matairesinol (2*), (-)-trachelogenin (3*)] were isolated from Trachelospermum asiaticum. The in vitro preferential cytotoxic activity of the nine compounds was evaluated against human pancreatic PANC-1 cancer cells in nutrient-deprived medium (NDM), but none of the six lignans (1-6) with (2S,3S)-absolute configuration showed preferential cytotoxicity. On the other hand, three lignans (1*-3*) with (2R,3R)-absolute configuration exhibited preferential cytotoxicity in a concentration-dependent manner with PC50 values of 0.54, 6.82, and 5.85 microM, respectively. Furthermore, the effect of (-)- and (+)-arctigenin was evaluated against the activation of Akt, which is a key process in the tolerance to nutrition starvation. Interestingly, only (-)-arctigenin (1*) strongly suppressed the activation of Akt. These results indicate that the (2R,3R)-absolute configuration of (-)-enantiomers should be required for the preferential cytotoxicity through the inhibition of Akt activation.

  6. Poly-(R)-3-hydroxybutyrates (PHB) are Atherogenic Components of Lipoprotein Lp(a).

    PubMed

    Reusch, Rosetta N

    2015-12-01

    The hypothesis is that poly-(R)-3-hydroxybutyrates (PHB), linear polymers of the ketone body, R-3-hydroxybutyrate (R-3HB), are atherogenic components of lipoprotein Lp(a). PHB are universal constituents of biological cells and are thus components of all foods. Medium chain-length PHB (<200 residues) (mPHB) are located in membranes and organelles, and short-chain PHB (<15 residues) are covalently attached to certain proteins (cPHB). PHB are highly insoluble in water, but soluble in lipids in which they exhibit a high intrinsic viscosity. They have a higher density than other cellular lipids and they are very adhesive, i.e. they engage in multiple noncovalent interactions with other molecules and salts via hydrogen, hydrophobic and coordinate bonds, thus producing insoluble deposits. Following digestive processes, PHB enter the circulation in chylomicrons and very low density lipoproteins (VLDL). The majority of the PHB (>70%) are absorbed by albumin, which transports them to the liver for disposal. When the amount of PHB in the diet exceed the capacity of albumin to safely remove them from the circulation, the excess PHB remain in the lipid core of LDL particles that become constituents of lipoprotein Lp(a), and contribute to the formation of arterial deposits. In summary, the presence of PHB – water-insoluble, dense, viscous, adhesive polymers – in the lipid cores of the LDL moieties of Lp(a) particles supports the hypothesis that PHB are atherogenic components of Lp(a).

  7. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  8. The R3 component of the electrically elicited blink reflex is present in patients with congenital insensitivity to pain.

    PubMed

    Téllez, Maria J; Axelrod, Felicia; Kaufmann, Horacio

    2009-01-01

    To clarify whether the R3 component of the electrically elicited blink reflex is a nociceptive response we studied two patients with congenital insensitivity to pain due to the impaired development of Adelta and C nerve fibers (hereditary sensory and autonomic neuropathy types III and IV). We postulated that if the R3 component is a nociceptive reflex, it should be absent in these patients. The R3 responses were elicited in both sides in both the patients at all intensities, strongly suggesting that the R3 component of the blink reflex is not a nociceptive response.

  9. Crystal Structure of the Complex of Human FasL and Its Decoy Receptor DcR3.

    PubMed

    Liu, Weifeng; Ramagopal, Udupi; Cheng, Huiyong; Bonanno, Jeffrey B; Toro, Rafael; Bhosle, Rahul; Zhan, Chenyang; Almo, Steven C

    2016-11-01

    The apoptotic effect of FasL:Fas signaling is disrupted by DcR3, a unique secreted member of the tumor necrosis factor receptor superfamily, which also binds and neutralizes TL1A and LIGHT. DcR3 is highly elevated in patients with various tumors and contributes to mechanisms by which tumor cells to evade host immune surveillance. Here we report the crystal structure of FasL in complex with DcR3. Comparison of FasL:DcR3 structure with our earlier TL1A:DcR3 and LIGHT:DcR3 structures supports a paradigm involving the recognition of invariant main-chain and conserved side-chain functionalities, which is responsible for the recognition of multiple TNF ligands exhibited by DcR3. The FasL:DcR3 structure also provides insight into the FasL:Fas recognition surface. We demonstrate that the ability of recombinant FasL to induce Jurkat cell apoptosis is significantly enhanced by native glycosylation or by structure-inspired mutations, both of which result in reduced tendency to aggregate. All of these activities are efficiently inhibited by recombinant DcR3.

  10. Containerless Solidification of Hexagonal Metastable Phases from an Undercooled R3Fe5O12 Melt

    NASA Astrophysics Data System (ADS)

    Kumar, Vijaya; Kentei Yu, Yu; Kameko, Masashi; Ishikawa, Takehiko; Kuribayashi, Kazuhiko; Yoda, Shinichi

    Containerless processing is a promising technique to explore the technologically important materials using rapid solidification of an undercooled melt because it provides large undercooling prior to nucleation. In the R-Fe-O system (R=Rare-earth element), rare-earth iron garnet (R3 Fe5 O12 ) can be formed through a peritectic reaction between RFeO3 , which is a primary phase, and a melt, which contains more Fe2 O3 than the R3 Fe5 O12 composition. The iron garnet is know to become unstable with increasing ionic radius of the rare-earth ion from Lu to Sm and does not exist in a stable form in La, Pr, and Nd [1,2]. Recently, we investigated the effect of oxygen partial pressure Po2 on metastable phase formation from an undercooled RFeO3 melt through containerless solidification. On the other hand, Po2 was considered to be one of the most important thermodynamic parameters which control phase constituents during containerless processing. In the R-Fe-O system, multiferroic hexagonal RFeO3 (P63 cm) and Fe2+ -containing ferroelectric phases such as RFe2 O4 (r-R3m) and new hexagonal R3 Fe2 O7 (P63 /mmc) phases were obtained metastably with decreasing Po2 from 105 to 10-1 Pa [3,4]. However, in the R3 Fe5 O12 system, the effect of Po2 during rapid solidification has not been studied yet. The purpose of this study is to elucidate the effect of Po2 on the formation of metastable phases from an undercooled R3 Fe5 O12 melt under controlled Po2 using gas-jet levitation technique. In order to undercool the melt deeply below the melting temperature under a precisely con-trolled oxygen partial pressure, an aerodynamic levitator (ADL) combined with ZrO2 oxygen sensor was designed. A spherical R3 Fe5 O12 sample was levitated by an ADL and completely melted by a CO2 laser in an atmosphere with predetermined Po2 . The surface temperature of the levitated droplet was monitored by a two-color pyrometer. Then, the droplet was cooled by turning off the CO2 laser. Meanwhile, the recalescence

  11. A sugarcane R2R3-MYB transcription factor gene is alternatively spliced during drought stress

    PubMed Central

    Guo, Jinlong; Ling, Hui; Ma, Jingjing; Chen, Yun; Su, Yachun; Lin, Qingliang; Gao, Shiwu; Wang, Hengbo; Que, Youxiong; Xu, Liping

    2017-01-01

    MYB transcription factors of the R2R3-MYB family have been shown to play important roles in many plant processes. A sugarcane R2R3-MYB gene (ScMYB2) and its two alternative forms of transcript (ScMYB2S1 and ScMYB2S2) were identified in this study. The deduced protein of ScMYB2S1 is a typical plant R2R3-MYB protein, while ScMYB2S2 encodes a truncated protein. Real-time qPCR analysis revealed that ScMYB2S1 is suppressed under PEG-simulated drought stress in sugarcane, while ScMYB2S2 is induced at later treatment stage. A senescence symptom was observed when ScMYB2S1 was injected into tobacco leaves mediated by Agrobacterium, but no symptom for ScMYB2S2. Further investigation showed that the expression levels of 4 senescence-associated genes, NtPR-1a, NtNYC1, NtCAT3 and NtABRE, were markedly induced in tobacco leaves after ScMYB2S1-injection, while they were not sensitive to ScMYB2S2-injection. Moreover, MDA and proline were also investigated after injection. Similarly, MDA and proline levels were induced by ABA and ScMYB2S1, while inhibited by ScMYB2S2. We propose that ScMYB2, by alternatively splicing two transcripts (ScMYB2S1 and ScMYB2S2), is involved in an ABA-mediated leaf senescence signaling pathway and play positive role in respond to drought-induced senescence in sugarcane. The results of this study provide information for further research in sugarcane stress processes. PMID:28167824

  12. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis.

    PubMed

    Schwinn, Kathy E; Ngo, Hanh; Kenel, Fernand; Brummell, David A; Albert, Nick W; McCallum, John A; Pither-Joyce, Meeghan; Crowhurst, Ross N; Eady, Colin; Davies, Kevin M

    2016-01-01

    Bulb color is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species.

  13. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis

    PubMed Central

    Schwinn, Kathy E.; Ngo, Hanh; Kenel, Fernand; Brummell, David A.; Albert, Nick W.; McCallum, John A.; Pither-Joyce, Meeghan; Crowhurst, Ross N.; Eady, Colin; Davies, Kevin M.

    2016-01-01

    Bulb color is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species. PMID:28018399

  14. Solitary solutions for a class of Schrödinger equations in R^3

    NASA Astrophysics Data System (ADS)

    Wang, Youjun

    2016-08-01

    In this paper, we consider a model problem arising from a classical planar Heisenberg ferromagnetic spin chain -Δ u + (λ + ɛ') u ∓ Δ √{1-u2}u/√{1- u2} - ɛ'u/√{1 - u2} = 0, x in R3, where {λ} and {ɛ'}are real constants. By variational methods and perturbation arguments, we study the existence of positive classical solutions. Our results generalize the previous results in one-dimensional space given by Brüll et al. [4].

  15. Reliability and validity of the tritrac-R3D accelerometer during backpacking: a case study.

    PubMed

    DeVoe, D; Dalleck, L

    2001-08-01

    This study investigated the utility of the Tritrac-R3D accelerometer as a reliable and valid instrument in the quantification of physical activity while backpacking in the field and to evaluate heart-rate responses and oxygen consumption to assess the feasibility of using the Tritrac-R3D to estimate caloric expenditure. Two 7-day backpacking expeditions were conducted in two consecutive years by a single subject at Grand Canyon National Park, Arizona. The average hiking heart rate ranged front 60% to 77% HRmax during the expeditions. The average rate of estimated caloric cost ranged from 6.8 to 11.7 kcals x min.(-1) (equivalent to 408 to 702 kcals x hr.(-1)), indicating a relatively moderate to high level of exertion. The Tritrac had adequate consistency and reliability in the field between the two expeditions in recorded activity counts. The Tritrac underestimated caloric expenditure during backpacking with changes in terrain, and hiking speed contributed to even greater disparity in accuracy.

  16. Active Asteroids P/2013 P5 and P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Li, Jing; Larson, Stephen

    2014-11-01

    Active asteroids (a.k.a. main-belt comets) possess the dynamical character of asteroids but exhibit evidence for mass loss, giving them a comet-like appearance. About 16 members of this newly-recognized group are currently known. Scientific interest lies in understanding the mechanisms responsible for the mass loss. Examples of impact, sublimation and thermal disintegration have been identified, and it seems clear that still other mechanisms exist. We are investigating these objects using high resolution observations from the Hubble Space Telescope, supplemented by observations from the Keck and other ground-based telescopes.Two exciting new objects show properties consistent with mass loss caused by rotational instability. P/2013 P5 shows a unique multiple dust tail system (dust mass of order 10^5 kg), produced by irregular ejection over 8 months. This is inconsistent with an impact origin and unlike activity seen in any ice-driven comet. The inner belt orbit (a = 2.189 AU) and S-type optical colors additionally suggest a metamorphosed composition incompatible with the survival of water ice. We suggest that P5 is shedding mass through local avalanche instabilities caused by a presumed rapid spin. The small size (radius < 240 m) renders P5 potentially susceptible to spin-up by radiation torques. P/2013 R3 is a dust-shrouded, multiple object in the outer asteroid belt (a = 3.033 AU) that is disintegrating in real-time. Ten distinct components have been detected, the largest four having radii up to 200 m. The velocity dispersion amongst fragments is 0.2 to 0.5 m/s, comparable to the gravitational escape speeds of the largest components. The dust mass is of order 10^8 kg, about 1000 times larger than in P5. Keck spectra set a limit to gas production near 1 kg/s. We suggest that R3 has experienced a rotational breakup, more severe than that of P5, in which the nucleus has disintegrated into component pieces. We are tracking the components to determine their dynamics

  17. Glucose-Sensing Receptor T1R3: A New Signaling Receptor Activated by Glucose in Pancreatic β-Cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Hamano, Kunihisa; Medina, Johan; Li, Longfei; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptors T1R2 and T1R3 are expressed in pancreatic β-cells. Compared with T1R3, mRNA expression of T1R2 is considerably lower. At the protein level, expression of T1R2 is undetectable in β-cells. Accordingly, a major component of the sweet taste-sensing receptor in β-cells may be a homodimer of T1R3 rather than a heterodimer of T1R2/T1R3. Inhibition of this receptor by gurmarin or deletion of the T1R3 gene attenuates glucose-induced insulin secretion from β-cells. Hence the T1R3 homodimer functions as a glucose-sensing receptor (GSR) in pancreatic β-cells. When GSR is activated by the T1R3 agonist sucralose, elevation of intracellular ATP concentration ([ATP]i) is observed. Sucralose increases [ATP]i even in the absence of ambient glucose, indicating that sucralose increases [ATP]i not simply by activating glucokinase, a rate-limiting enzyme in the glycolytic pathway. In addition, sucralose augments elevation of [ATP]i induced by methylsuccinate, suggesting that sucralose activates mitochondrial metabolism. Nonmetabolizable 3-O-methylglucose also increases [ATP]i and knockdown of T1R3 attenuates elevation of [ATP]i induced by high concentration of glucose. Collectively, these results indicate that the T1R3 homodimer functions as a GSR; this receptor is involved in glucose-induced insulin secretion by activating glucose metabolism probably in mitochondria.

  18. Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice.

    PubMed

    Sclafani, Anthony; Glass, Damien S; Margolskee, Robert F; Glendinning, John I

    2010-12-01

    Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice.

  19. Cluster headache

    MedlinePlus

    Histamine headache; Headache - histamine; Migrainous neuralgia; Headache - cluster; Horton's headache; Vascular headache - cluster ... be related to the body's sudden release of histamine (chemical in the body released during an allergic ...

  20. Magnetic properties of R 3Co 8Sn 4 (R=Y, Gd)

    NASA Astrophysics Data System (ADS)

    Canepa, F.; Napoletano, M.; Manfrinetti, P.; Palenzona, A.; Cirafici, S.; Merlo, F.

    2000-10-01

    The magnetic properties of the intermetallic phases R 3Co 8Sn 4 (R=Y, Gd) are presented. The two compounds order ferro- (Y) and ferri-magnetically (Gd) with transition temperatures of 61.5 and 102.5 K, respectively. In the paramagnetic region, the Y-compound follows the Curie-Weiss law with μ=0.98 μ B/Co and θP=62.0 K while a more complex behaviour, typical of a ferrimagnetic substance, is observed for Gd 3Co 8Sn 4. The experimental data, analysed in the framework of the molecular field theory, allow to obtain the exchange parameter for the Co-Co ( JCo-Co=83 kB) and of the Gd-Co ( JGd-Co=11 kB) interactions.

  1. Full stereochemical understanding in a new (2R,3R,4R)-4-hydroxyisoleucine synthesis.

    PubMed

    Rolland, M; Kassem, T; Rolland, V; Martinez, J

    2001-12-01

    We present the crystal and molecular structures of 2,3,6,7,8,8a-hexahydro-6,8-methano-7,7,8a-trimethyl-3-(1-methyl-2-oxopropylidene)-5H-1,4-benzoxazin-2-one, C16H21NO3, (III), and 2,3,6,7,8,8a-hexahydro-3-(2-hydroxy-1-methylpropyl)-6,8-methano-7,7,8a-trimethyl-5H-1,4-benzoxazin-2-one, C16H25NO3, (V). These compounds are two of the four key intermediates in our synthetic route to (2R,3R,4R)-4-hydroxyisoleucine. The two structures provide a full understanding of the stereochemistry in successive steps. This synthesis was based on a new optically pure chiral oxazinone auxiliary derived from (1R,2R,5R)-2-hydroxypinan-3-one.

  2. Long-time asymptotics of the Navier-Stokes and vorticity equations on R(3).

    PubMed

    Gallay, Thierry; Wayne, C Eugene

    2002-10-15

    We use the vorticity formulation to study the long-time behaviour of solutions to the Navier-Stokes equation on R(3). We assume that the initial vorticity is small and decays algebraically at infinity. After introducing self-similar variables, we compute the long-time asymptotics of the rescaled vorticity equation up to second order. Each term in the asymptotics is a self-similar divergence-free vector field with Gaussian decay at infinity, and the coefficients in the expansion can be determined by solving a finite system of ordinary differential equations. As a consequence of our results, we are able to characterize the set of solutions for which the velocity field satisfies ||u(.,t)||(L(2)) = o(t(-5/4)) as t-->+ infinity. In particular, we show that these solutions lie on a smooth invariant submanifold of codimension 11 in our function space.

  3. Heteroclinic bifurcations near Hopf-zero bifurcation in reversible vector fields in R3

    NASA Astrophysics Data System (ADS)

    Lamb, Jeroen S. W.; Teixeira, Marco-Antonio; Webster, Kevin N.

    We study the dynamics near a symmetric Hopf-zero (also known as saddle-node Hopf or fold-Hopf) bifurcation in a reversible vector field in R3, with involutory an reversing symmetry whose fixed point subspace is one-dimensional. We focus on the case in which the normal form for this bifurcation displays a degenerate family of heteroclinics between two asymmetric saddle-foci. We study local perturbations of this degenerate family of heteroclinics within the class of reversible vector fields and establish the generic existence of hyperbolic basic sets (horseshoes), independent of the eigenvalues of the saddle-foci, as well as cascades of bifurcations of periodic, heteroclinic and homoclinic orbits. Finally, we discuss the application of our results to the Michelson system, describing stationary states and travelling waves of the Kuramoto-Sivashinsky PDE.

  4. The R3-MYB gene GhCPC negatively regulates cotton fiber elongation.

    PubMed

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen

    2015-01-01

    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in -1-5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model.

  5. H+, CH3+ and R3Si+ Carborane Reagents: When Triflates Fail

    PubMed Central

    Reed, Christopher A.

    2009-01-01

    CONSPECTUS For decades, triflic acid, methyl triflate and trialkylsilyl triflate reagents have served synthetic chemistry well as clean, strong electrophilic sources of H+, CH3+ and R3Si+ respectively. However, a number of weakly basic substrates are unreactive towards these reagents. In addition, triflate anion can express undesired nucleophilicity towards electrophilically activated substrates. In this Account, we describe methods that replace triflate-based electrophilic reagents with carborane reagents. Using carborane anions of type CHB11R5X6− (R = H, Me, X; X = Br, Cl) – members of a class of notably inert, weakly nucleophilic anions – instead of triflate significantly increases the electrophilicity of these reagents and shuts down subsequent nucleophilic chemistry of the anion. Thus, H(carborane) acids cleanly protonate benzene, phosphabenzene, C60 etc. while triflic acid does not. Similarly, CH3(carborane) reagents can methylate substrates that are inert to boiling neat methyl triflate, including benzene, phosphabenzenes, phosphazenes, and the pentamethylhydrazinium ion which forms the dipositive ethane analogue, Me6N22+. Methyl carboranes are also surprisingly effective in abstracting hydride from simple alkanes to give isolable carbocation salts e.g. t-butyl cation. Trialkylsilyl carborane reagents, R3Si(carborane), abstract halides from substrates to produce cations of unprecedented reactivity. For example, fluoride is extracted from freons to form carbocations, chloride is extracted from IrCl(CO)(PPh3)2 to form a coordinatively-unsaturated iridium cation that undergoes oxidative addition with chlorobenzene at room temperature, and silylation of cyclo-N3P3Cl6 produces a catalyst for the polymerization of phosphazenes that functions at room temperature. Although currently too expensive for widespread use, carborane reagents are nevertheless of considerable interest as specialty reagents for making reactive cations and catalysts. PMID:19736934

  6. Electrical and Magnetic Properties of R3Al11 (R = La, Ce, Pr, and Nd)

    NASA Astrophysics Data System (ADS)

    Garde, Chandrashekhar S.; Takeuchi, Tetsuya; Nakano, Yasunori; Takeda, Yuji; Ota, Yuki; Miyauchi, Yuichiro; Sugiyama, Kiyohiro; Hagiwara, Masayuki; Kindo, Koichi; Honda, Fuminori; Settai, Rikio; Ōnuki, Yoshichika

    2008-12-01

    High-quality single crystals of R3Al11 (R = La, Ce, Pr, and Nd) with the La3Al11-type orthorhombic crystal structure (space group Immm) have been grown by the Al-flux method. For Ce3Al11, signatures for ferromagnetic and antiferromagnetic orderings at TC = 6.3 K and TN = 3.2 K, respectively, have been observed in the magnetic susceptibility, magnetization, specific heat, and electrical resistivity. An antiferromagnet Pr3Al11, on the other hand, exhibits two magnetic transitions at TN1 = 12.6 K and TN2 = 3.1 K. An antiferromagnet Nd3Al11 also exhibits multiple magnetic transitions at TN1 = 13.2 K, TN2 = 9.4 K, TN3 = 2.9 K, and TN4 = 1.77 K in zero magnetic field. The transition at TN4 has a first-order character. The crystalline electric field (CEF) analysis of magnetic susceptibility, magnetization and specific heat data shows that the CEF splitting is larger for Ce3Al11 than for Pr3Al11 and Nd3Al11. The CEF ground state of Pr3Al11 is a singlet. Magnetic order occurs in this compound owing to the exchange mixing of the CEF ground state and low-lying excited states. The ferromagnetic like component of the magnetization for H \\parallel [010] is characteristic of R3Al11 (R = Ce, Pr, and Nd), which is most likely due to the Dzialoshinsky-Moriya interaction for two nonequivalent R atoms.

  7. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles.

    PubMed

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-06-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (emission of benzenoid II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of cinnamyl alcohol dehydrogenase1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles.

  8. Index theorem for topological excitations on R3 × S1 and Chern-Simons theory

    NASA Astrophysics Data System (ADS)

    Poppitz, Erich; Ünsal, Mithat

    2009-03-01

    We derive an index theorem for the Dirac operator in the background of various topological excitations on an R3 × S1 geometry. The index theorem provides more refined data than the APS index for an instanton on R4 and reproduces it in decompactification limit. In the R3 limit, it reduces to the Callias index theorem. The index is expressed in terms of topological charge and the η-invariant associated with the boundary Dirac operator. Neither topological charge nor η-invariant is typically an integer, however, the non-integer parts cancel to give an integer-valued index. Our derivation is based on axial current non-conservation — an exact operator identity valid on any four-manifold — and on the existence of a center symmetric, or approximately center symmetric, boundary holonomy (Wilson line). We expect the index theorem to usefully apply to many physical systems of interest, such as low temperature (large S1, confined) phases of gauge theories, center stabilized Yang-Mills theories with vector-like or chiral matter (at S1 of any size), and supersymmetric gauge theories with supersymmetry-preserving boundary conditions (also at any S1). In QCD-like and chiral gauge theories, the index theorem should shed light into the nature of topological excitations responsible for chiral symmetry breaking and the generation of mass gap in the gauge sector. We also show that imposing chirally-twisted boundary condition in gauge theories with fermions induces a Chern-Simons term in the infrared. This suggests that some QCD-like gauge theories should possess components with a topological Chern-Simons phase in the small S1 regime.

  9. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  10. Expression and clinicopathological implication of DcR3 in lung cancer tissues: a tissue microarray study with 365 cases

    PubMed Central

    Zhang, Yu; Luo, Jie; He, Rongquan; Huang, Wenting; Li, Zuyun; Li, Ping; Dang, Yiwu; Chen, Gang; Li, Shikang

    2016-01-01

    Background Decoy receptor 3 (DcR3) has been reported to be involved in different cancers. However, few related researches have been accomplished on the role of DcR3 in lung cancer. Objective To explore the expression level and clinicopathological implication of DcR3 protein in lung cancer tissues. Materials and methods Immunohistochemistry was used to examine DcR3 protein expression in lung cancer (n=365) and normal lung tissues (n=26). The relationships between DcR3 expression and clinical parameters were further investigated. Furthermore, the diagnostic and clinicopathological value of DcR3 mRNA was analyzed based on The Cancer Genome Atlas database in lung cancer patients. Results Compared to normal lung tissues, DcR3 expression was significantly higher in lung cancer (P=0.007) tissues, including small-cell lung cancer (P=0.001) and non-small-cell lung cancer (P=0.008). In addition, DcR3 expression was related to tumor-node-metastasis (TNM) stage (P<0.001), tumor diameter (P=0.007), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) in lung cancers. When concerning non-small-cell lung cancer, consistent correlations between DcR3 expression and TNM stage (P<0.001), tumor diameter (P=0.019), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) were found. Simultaneously, in small-cell lung cancer, TNM stage (P=0.004) and lymph node metastasis (P=0.005) were also associated with DcR3 expression. Additionally, receiver operator characteristic curve revealed that the area under curve (AUC) of DcR3 was 0.637 (95% confidence interval [CI] 0.531–0.742) for lung cancer. Furthermore, DcR3 was overexpressed in both adenocarcinoma and squamous cell carcinoma tissues than in noncancerous lung tissues (all P<0.0001) based on the data from The Cancer Genome Atlas. AUC of DcR3 was 0.726 (95% CI 0.644–0.788) for lung adenocarcinoma patients and 0.647 (95% CI 0.566–0.728) for squamous cell carcinoma patients. DcR3 expression was also related to

  11. About the Clusters Program

    EPA Pesticide Factsheets

    The Environmental Technology Innovation Clusters Program advises cluster organizations, encourages collaboration between clusters, tracks U.S. environmental technology clusters, and connects EPA programs to cluster needs.

  12. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures

    PubMed Central

    Rahrig, Ryan R.; Petrov, Anton I.; Leontis, Neocles B.; Zirbel, Craig L.

    2013-01-01

    The R3D Align web server provides online access to ‘RNA 3D Align’ (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  13. The equilibrium points in the perturbed R3BP with triaxial and luminous primaries

    NASA Astrophysics Data System (ADS)

    Singh, Jagadish

    2013-07-01

    This study explores the effects of small perturbations in the Coriolis and centrifugal forces, radiation pressures and triaxiality of the two stars (primaries) on the position and stability of an infinitesimal mass (third body) in the framework of the planar circular restricted three-body problem (R3BP). it is observed that the positions of the usual five (three collinear and two triangular) equilibrium points are affected by the radiation, triaxiality and a small perturbation in the centrifugal force, but are unaffected by that of the Coriolis force. The collinear points are found to remain unstable, while the triangular points are seen to be stable for 0< μ< μ c and unstable for μc ≤μ≤1/2, where μ c is the critical mass ratio influenced by the small perturbations in the Coriolis and centrifugal forces, radiation and triaxiality. It is also noticed that the former one and all the latter three posses stabilizing and destabilizing behavior respectively. Therefore, the overall effect is that the size of the region of stability decreases with increase in the values of the parameters involved.

  14. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation

    PubMed Central

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L−1 h−1, was seen for phosphate-limitation. PMID:26347729

  15. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB.

    PubMed

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D; Smith, Steven W; Ordway, Jared M; Martienssen, Robert A; Sambanthamurthi, Ravigadevi

    2014-06-30

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the virescens (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis production of anthocyanin pigment1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock's C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material.

  16. Expression and Purification of Functional Ligand-binding Domains of T1R3 Taste Receptors

    SciTech Connect

    Nie,Y.; Hobbs, J.; Vigues, S.; Olson, W.; Conn, G.; Munger, S.

    2006-01-01

    Chemosensory receptors, including odor, taste, and vomeronasal receptors, comprise the largest group of G protein-coupled receptors (GPCRs) in the mammalian genome. However, little is known about the molecular determinants that are critical for the detection and discrimination of ligands by most of these receptors. This dearth of understanding is due in part to difficulties in preparing functional receptors suitable for biochemical and biophysical analyses. Here we describe in detail two strategies for the expression and purification of the ligand-binding domain of T1R taste receptors, which are constituents of the sweet and umami taste receptors. These class C GPCRs contain a large extracellular N-terminal domain (NTD) that is the site of interaction with most ligands and that is amenable to expression as a separate polypeptide in heterologous cells. The NTD of mouse T1R3 was expressed as two distinct fusion proteins in Escherichia coli and purified by column chromatography. Spectroscopic analysis of the purified NTD proteins shows them to be properly folded and capable of binding ligands. This methodology should not only facilitate the characterization of T1R ligand interactions but may also be useful for dissecting the function of other class C GPCRs such as the large family of orphan V2R vomeronasal receptors.

  17. An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers.

    PubMed

    Sagawa, Janelle M; Stanley, Lauren E; LaFountain, Amy M; Frank, Harry A; Liu, Chang; Yuan, Yao-Wu

    2016-02-01

    Carotenoids are yellow, orange, and red pigments that contribute to the beautiful colors and nutritive value of many flowers and fruits. The structural genes in the highly conserved carotenoid biosynthetic pathway have been well characterized in multiple plant systems, but little is known about the transcription factors that control the expression of these structural genes. By analyzing a chemically induced mutant of Mimulus lewisii through bulk segregant analysis and transgenic experiments, we have identified an R2R3-MYB, Reduced Carotenoid Pigmentation 1 (RCP1), as the first transcription factor that positively regulates carotenoid biosynthesis during flower development. Loss-of-function mutations in RCP1 lead to down-regulation of all carotenoid biosynthetic genes and reduced carotenoid content in M. lewisii flowers, a phenotype recapitulated by RNA interference in the wild-type background. Overexpression of this gene in the rcp1 mutant background restores carotenoid production and, unexpectedly, results in simultaneous decrease of anthocyanin production in some transgenic lines by down-regulating the expression of an activator of anthocyanin biosynthesis. Identification of transcriptional regulators of carotenoid biosynthesis provides the 'toolbox' genes for understanding the molecular basis of flower color diversification in nature and for potential enhancement of carotenoid production in crop plants via genetic engineering.

  18. R3 Index for Four-Dimensional N =2 Field Theories

    NASA Astrophysics Data System (ADS)

    Alexandrov, Sergei; Moore, Gregory W.; Neitzke, Andrew; Pioline, Boris

    2015-03-01

    In theories with N =2 supersymmetry on R3 ,1, supersymmetric bound states can decay across walls of marginal stability in the space of Coulomb branch parameters, leading to discontinuities in the BPS indices Ω (γ ,u ) . We consider a supersymmetric index I which receives contributions from 1 /2 -BPS states, generalizing the familiar Witten index Tr (-1 )Fe-β H . We expect I to be smooth away from loci where massless particles appear, thanks to contributions from the continuum of multiparticle states. Taking inspiration from a similar phenomenon in the hypermultiplet moduli space of N =2 string vacua, we conjecture a formula expressing I in terms of the BPS indices Ω (γ ,u ), which is continuous across the walls and exhibits the expected contributions from single particle states at large β . This gives a universal prediction for the contributions of multiparticle states to the index I . This index is naturally a function on the moduli space after reduction on a circle, closely related to the canonical hyperkähler metric and hyperholomorphic connection on this space.

  19. Global smooth solutions in R3 to short wave-long wave interactions in magnetohydrodynamics

    NASA Astrophysics Data System (ADS)

    Frid, Hermano; Jia, Junxiong; Pan, Ronghua

    2017-04-01

    We consider a Benney-type system modeling short wave-long wave interactions in compressible viscous fluids under the influence of a magnetic field. Accordingly, this large system now consists of the compressible MHD equations coupled with a nonlinear Schrödinger equation along particle paths. We study the global existence of smooth solutions to the Cauchy problem in R3 when the initial data are small smooth perturbations of an equilibrium state. An important point here is that, instead of the simpler case having zero as the equilibrium state for the magnetic field, we consider an arbitrary non-zero equilibrium state B bar for the magnetic field. This is motivated by applications, e.g., Earth's magnetic field, and the lack of invariance of the MHD system with respect to either translations or rotations of the magnetic field. The usual time decay investigation through spectral analysis in this non-zero equilibrium case meets serious difficulties, for the eigenvalues in the frequency space are no longer spherically symmetric. Instead, we employ a recently developed technique of energy estimates involving evolution in negative Besov spaces, and combine it with the particular interplay here between Eulerian and Lagrangian coordinates.

  20. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  1. Searching for AdS3 waves and asymptotically Lifshitz black holes in R3 new massive gravity

    NASA Astrophysics Data System (ADS)

    Anastasiou, Giorgos G.; Setare, M. R.; Vagenas, Elias C.

    2013-09-01

    In this paper, we consider the structure of the AdS3 vacua in R3 expansion of new massive gravity (R3-NMG). We obtain the degeneracies of the AdS3 vacua at several points of the parametric space. Additionally, following a specific analysis we show that AdS3 wave solutions are present. Using these wave solutions, we single out two special points of the parametric space for which logarithmic terms appear in the solutions. The first one is a point at which the effective mass of the wave profile, which is interpreted as a scalar mode, completely saturates the Breitenlohner-Freedman bound of the AdS3 space in which the wave is propagating. The second special point is a point at which the central charge of the theory vanishes. Furthermore, we investigate the possibility of asymptotically Lifshitz black hole solutions to be present in the three-dimensional R3-NMG. We derive analytically the Lifshitz vacua considering specific relations between the mass parameters of R3-NMG. A certain polynomial equation arises at the first special point where solutions with logarithmic falloff in the AdS3 space appear. Solving this polynomial equation, we obtain the values of the dynamical exponent z which correspond to possible asymptotically Lifshitz black hole solutions. However, it is shown that asymptotically Lifshitz black hole solutions do not exist in the three-dimensional R3-NMG for a specific ansatz of the black hole metric.

  2. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    PubMed Central

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  3. Sucrose-conditioned flavor preferences in sweet ageusic T1r3 and Calhm1 knockout mice.

    PubMed

    Sclafani, Anthony; Marambaud, Philippe; Ackroff, Karen

    2014-03-14

    The present study compared the ability of sweet ageusic T1r3 knockout (KO) and Calhm1 KO mice to acquire preferences for a sucrose-paired flavor as well as for unflavored sucrose. The KO and wildtype (WT) mice were given 24-h one-bottle access to 8% sucrose containing one flavor CS+, e.g., grape) and to water containing a different flavor (CS-, e.g., cherry) over 4 training days. In subsequent two-bottle tests with the flavors in water only, the T1r3 KO and Calhm1 KO mice, like WT mice, preferred the CS+ to the CS-. After training with flavored solutions, both KO groups also preferred unflavored 8% sucrose to water although Calhm1 KO mice required more sugar experience to match the preference of the T1r3 KO mice. These findings demonstrate that Calhm1 KO mice, like T1r3 KO mice and WT mice, are sensitive to the post-oral preference conditioning actions of sucrose and can discriminate sugar from water. Yet, despite their acquired sucrose preferences, the Calhm1 KO and T1r3 KO mice consumed only half as much sugar per day as did WT mice. Thus, sweet taste signaling elements are not needed in the gut for sugar conditioning, but sweet taste signaling in the mouth is essential for the full expression of sugar appetite.

  4. Forbidden Zones for Circular Regular Orbits of the Moons in Solar System, R3BP

    NASA Astrophysics Data System (ADS)

    Ershkov, Sergey V.

    2017-03-01

    Previously, we have considered the equations of motion of the three-body problem in a Lagrange form (which means a consideration of relative motions of 3-bodies in regard to each other). Analysing such a system of equations, we considered the case of small-body motion of negligible mass m 3 around the second of two giant-bodies m 1, m 2 ( which are rotating around their common centre of masses on Kepler's trajectories), the mass of which is assumed to be less than the mass of central body. In the current development, we have derived a key parameter η that determines the character of quasi-circular motion of the small third body m 3 relative to the second body m 2 (planet). Namely, by making several approximations in the equations of motion of the three-body problem, such the system could be reduced to the key governing Riccati-type ordinary differential equations. Under assumptions of R3BP (restricted three-body problem), we additionally note that Riccati-type ODEs above should have the invariant form if the key governing (dimensionless) parameter η remains in the range 10-2[InlineMediaObject not available: see fulltext.] 10-3. Such an amazing fact let us evaluate the forbidden zones for Moon's orbits in the inner solar system or the zones of distances ( between Moon and Planet) for which the motion of small body could be predicted to be unstable according to basic features of the solutions of Riccati-type.

  5. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis spp.

    PubMed

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-05-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp.

  6. (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) induces hyperketonemiain Alzheimer’s disease

    PubMed Central

    Chu, Chang-Biao; Jiao, Li-Dong

    2015-01-01

    The present study demonstrates the effect of (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) on hyperketonemia in 2 patients with Alzheimer’s disease dementia who were performed a mini-mental state examination score of above 11 and 10. The patients were treated with OBHB for 24 months and received usual diet. The patients were administered 15 g of OBHB three times per day for two days. The dosage of OBHB was increased to 30 g three times daily from the day 4. OBHB was always taken after adding with soda-flavoured syrups in order to mask the bitter taste. The measurement of plasma β-hydroxybutyrate (βHB) levels after every week was performed to determine OBHB plasma βHB dose-response relationships. Precision Xtra Glucose and Ketone Monitoring System (Abbott Diabetes Care, Inc., Alameda, CA, USA) was used to measure βHB levels in the blood samples. We did not observe any adverse effects of OBHB in any of the patients and it was well tolerated throughout the 24 months treatment period. Both of the patients showed marked improvement in mood, behaviour, self-care, cognitive and daily activity performance. The results revealed a marked improvement in conversation and interaction after administration of OBHB doses. The biochemical investigation of the blood samples before, during OBHB treatment and after 24 months of the treatment revealed only minor changes in the plasma lipids. There was a decrease in cholesterol level from 251 to 158 and 247 to 152 mg/dL in the two patients respectively after 24 months of the treatment. Similarly the level of high-density lipoprotein cholesterol was found to decrease from 157 to 79 and 149 to 76 mg/dL, respectively in two patients. Thus OBHB can be a promising agent in the treatment of hyperketonemia and can be taken as an oral supplement without changing the habitual diet. PMID:26221318

  7. The Role of Short-Chain Conjugated Poly-(R)-3-Hydroxybutyrate (cPHB) in Protein Folding

    PubMed Central

    Reusch, Rosetta N.

    2013-01-01

    Poly-(R)-3-hydroxybutyrate (PHB), a linear polymer of R-3-hydroxybutyrate (R-3HB), is a fundamental constituent of biological cells. Certain prokaryotes accumulate PHB of very high molecular weight (10,000 to >1,000,000 residues), which is segregated within granular deposits in the cytoplasm; however, all prokaryotes and all eukaryotes synthesize PHB of medium-chain length (~100–200 residues) which resides within lipid bilayers or lipid vesicles, and PHB of short-chain length (<12 residues) which is conjugated to proteins (cPHB), primarily proteins in membranes and organelles. The physical properties of cPHB indicate it plays important roles in the targeting and folding of cPHB-proteins. Here we review the occurrence, physical properties and molecular characteristics of cPHB, and discuss its influence on the folding and structure of outer membrane protein A (OmpA) of Escherichia coli. PMID:23702844

  8. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.

    PubMed

    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi

    2014-06-01

    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3.

  9. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

    PubMed Central

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

    2008-01-01

    Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

  10. Detection of the virulent form of AVR3a from Phytophthora infestans following artificial evolution of potato resistance gene R3a.

    PubMed

    Chapman, Sean; Stevens, Laura J; Boevink, Petra C; Engelhardt, Stefan; Alexander, Colin J; Harrower, Brian; Champouret, Nicolas; McGeachy, Kara; Van Weymers, Pauline S M; Chen, Xinwei; Birch, Paul R J; Hein, Ingo

    2014-01-01

    Engineering resistance genes to gain effector recognition is emerging as an important step in attaining broad, durable resistance. We engineered potato resistance gene R3a to gain recognition of the virulent AVR3aEM effector form of Phytophthora infestans. Random mutagenesis, gene shuffling and site-directed mutagenesis of R3a were conducted to produce R3a* variants with gain of recognition towards AVR3aEM. Programmed cell death following gain of recognition was enhanced in iterative rounds of artificial evolution and neared levels observed for recognition of AVR3aKI by R3a. We demonstrated that R3a*-mediated recognition responses, like for R3a, are dependent on SGT1 and HSP90. In addition, this gain of response is associated with re-localisation of R3a* variants from the cytoplasm to late endosomes when co-expressed with either AVR3aKI or AVR3aEM a mechanism that was previously only seen for R3a upon co-infiltration with AVR3aKI. Similarly, AVR3aEM specifically re-localised to the same vesicles upon recognition by R3a* variants, but not with R3a. R3a and R3a* provide resistance to P. infestans isolates expressing AVR3aKI but not those homozygous for AVR3aEM.

  11. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  12. Spitzer Clusters

    NASA Astrophysics Data System (ADS)

    Krick, Kessica

    This proposal is a specific response to the strategic goal of NASA's research program to "discover how the universe works and explore how the universe evolved into its present form." Towards this goal, we propose to mine the Spitzer archive for all observations of galaxy groups and clusters for the purpose of studying galaxy evolution in clusters, contamination rates for Sunyaev Zeldovich cluster surveys, and to provide a database of Spitzer observed clusters to the broader community. Funding from this proposal will go towards two years of support for a Postdoc to do this work. After searching the Spitzer Heritage Archive, we have found 194 unique galaxy groups and clusters that have data from both the Infrared array camera (IRAC; Fazio et al. 2004) at 3.6 - 8 microns and the multiband imaging photometer for Spitzer (MIPS; Rieke et al. 2004) at 24microns. This large sample will add value beyond the individual datasets because it will be a larger sample of IR clusters than ever before and will have sufficient diversity in mass, redshift, and dynamical state to allow us to differentiate amongst the effects of these cluster properties. An infrared sample is important because it is unaffected by dust extinction while at the same time is an excellent measure of both stellar mass (IRAC wavelengths) and star formation rate (MIPS wavelengths). Additionally, IRAC can be used to differentiate star forming galaxies (SFG) from active galactic nuclei (AGN), due to their different spectral shapes in this wavelength regime. Specifically, we intend to identify SFG and AGN in galaxy groups and clusters. Groups and clusters differ from the field because the galaxy densities are higher, there is a large potential well due mainly to the mass of the dark matter, and there is hot X-ray gas (the intracluster medium; ICM). We will examine the impact of these differences in environment on galaxy formation by comparing cluster properties of AGN and SFG to those in the field. Also, we will

  13. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  14. Structural analysis of a glycosides hydrolase family 42 cold-adapted ß-galactosidase from Rahnella sp. R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ß-galactosidase isolated from a psychrotrophic bacterium, Rahnella sp. R3 (R-ß-Gal), exhibits high activity at low temperature. R-ß-Gal is a member of the glycoside hydrolases family 42 (GH42), and forms a 225 kDa trimeric structure in solution. The X-ray crystal structure of R-ß-Gal was determi...

  15. 76 FR 65199 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-20

    ... HUMAN SERVICES Food and Drug Administration International Conference on Harmonisation; E2B(R3... and Message Specification; Appendix on Backwards and Forwards Compatibility; Availability AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA)...

  16. Electronic structure and stability of the C H3N H3PbB r3 (001) surface

    NASA Astrophysics Data System (ADS)

    Huang, Xin; Paudel, Tula R.; Dowben, Peter A.; Dong, Shuai; Tsymbal, Evgeny Y.

    2016-11-01

    The energetics and the electronic structure of methylammonium lead bromine (C H3N H3PbB r3 ) perovskite (001) surfaces are studied based on density functional theory. By examining the surface grand potential, we predict that the C H3N H3Br -terminated (001) surface is energetically more favorable than the PbB r2 -terminated (001) surface, under thermodynamic equilibrium conditions of bulk C H3N H3PbB r3 . The electronic structure of each of these two different surface terminations retains some of the characteristics of the bulk, while new surface states are found near band edges which may affect the photovoltaic performance in the solar cells based on C H3N H3PbB r3 . The calculated electron affinity of C H3N H3PbB r3 reveals a sizable difference for the two surface terminations, indicating a possibility of tuning the band offset between the halide perovskite and adjacent electrode with proper interface engineering.

  17. Evaluation of Radial Flow Fluidized Filter (R3F) Followed by Microfiltration and Ultrafiltration Systems in Calimesa, California

    EPA Science Inventory

    U.S. EPA coordinated a field study with South Mesa Water Utility to look for treatment alternatives for California State Project Water in the small community of Calimesa, California. EPA evaluated the performance of a system comprised of Radial Flow Fluidized Filtration (R3f) fo...

  18. The Eucalyptus grandis R2R3-MYB transcription factor family: evidence for woody growth-related evolution and function.

    PubMed

    Soler, Marçal; Camargo, Eduardo Leal Oliveira; Carocha, Victor; Cassan-Wang, Hua; San Clemente, Hélène; Savelli, Bruno; Hefer, Charles A; Paiva, Jorge A Pinto; Myburg, Alexander A; Grima-Pettenati, Jacqueline

    2015-06-01

    The R2R3-MYB family, one of the largest transcription factor families in higher plants, controls a wide variety of plant-specific processes including, notably, phenylpropanoid metabolism and secondary cell wall formation. We performed a genome-wide analysis of this superfamily in Eucalyptus, one of the most planted hardwood trees world-wide. A total of 141 predicted R2R3-MYB sequences identified in the Eucalyptus grandis genome sequence were subjected to comparative phylogenetic analyses with Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. We analysed features such as gene structure, conserved motifs and genome location. Transcript abundance patterns were assessed by RNAseq and validated by high-throughput quantitative PCR. We found some R2R3-MYB subgroups with expanded membership in E. grandis, V. vinifera and P. trichocarpa, and others preferentially found in woody species, suggesting diversification of specific functions in woody plants. By contrast, subgroups containing key genes regulating lignin biosynthesis and secondary cell wall formation are more conserved across all of the species analysed. In Eucalyptus, R2R3-MYB tandem gene duplications seem to disproportionately affect woody-preferential and woody-expanded subgroups. Interestingly, some of the genes belonging to woody-preferential subgroups show higher expression in the cambial region, suggesting a putative role in the regulation of secondary growth.

  19. Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

  20. 75 FR 3160 - Commerce in Explosives-Storage of Shock Tube With Detonators (2005R-3P)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-20

    ...--Storage of Shock Tube With Detonators (2005R-3P) AGENCY: Bureau of Alcohol, Tobacco, Firearms, and... tube to be stored with detonators because these materials when stored together do not pose a mass detonation hazard. Shock tube is a small diameter plastic laminate tube coated with a very thin layer...

  1. N-methyl-(R)-3-(tert-butyl)-sulfinyl-1,4-dihydropyridine: a novel NADH model compound.

    PubMed

    Xie, Kun; Liu, You-Cheng; Cui, Yi; Wang, Jian-Ge; Fu, Yao; Mak, Thomas C W

    2007-03-12

    We have synthesized a novel chiral NADH model compound, N-methyl-(R)-3-(tert-butyl)-sulphinyl-1,4-dihydropyridine with high enantioselectivity and used it in the reduction of methyl benzoylformate, producing (S)-methyl mandelate in 95% ee. The absolute structure of its precursor, 3-(tert-butyl)sulfinyl pyridine, was determined by X-ray analysis.

  2. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    SciTech Connect

    Cervenakova, L.; Brown, P.; Nagle, J.

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  3. Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an ...

  4. Star clusters

    NASA Astrophysics Data System (ADS)

    Labhardt, Lukas; Binggeli, Bruno

    Star clusters are at the heart of astronomy, being key objects for our understanding of stellar evolution and galactic structure. Observations with the Hubble Space Telescope and other modern equipment have revealed fascinating new facts about these galactic building blocks. This book provides two comprehensive and up-to-date, pedagogically designed reviews on star clusters by two well-known experts in the field. Bruce Carney presents our current knowledge of the relative and absolute ages of globular clusters and the chemical history of our Galaxy. Bill Harris addresses globular clusters in external galaxies and their use as tracers of galaxy formation and cosmic distance indicators. The book is written for graduate students as well as professionals in astronomy and astrophysics.

  5. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  6. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  7. The Rapid Response Radiation Survey (R3S) Mission Using the HiSat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael A.; Norman, Ryan B.; Soto, Hector L.; Stewart, Victor A.; Jones, Mark L.; Kowalski, Matthew C.; Ben Shabat, Adam; Gough, Kerry M.; Stavely, Rebecca L.; Shim, Alex C.; Jaeger, Gene T. K.

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in Low Earth Orbit (LEO), will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HISat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. Currently, airline professionals are the second largest demographic of radiation workers and to date their radiation exposure is undocumented in the USA. The NAIRAS model seeks to fill this information gap. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaD-X), will validate exposure prediction capabilities of NAIRAS. The R3S mission collects total dose and radiation spectrum measurements using a Teledyne µDosimeter and a Liulin-6SA2 LED spectrometer. These two radiation sensors provide a cross correlated radiometric measurement in combination with the Honeywell HMR2300 Smart Digital Magnetometer. The magnetometer assesses the Earth's magnetic field in the LEO environment and allows radiation dose to be mapped as a function of the Earth's magnetic shielding. R3S is also unique in that the radiation sensors will be exposed on the outer surface of the spacecraft, possibly making this the first measurements of the LEO radiation environment with bare sensors. Viability of R3S as an extremely fast turnaround mission is due, in part, to the nature of the robust, well-defined interfaces of the conformal satellite HiSat Architecture. The HiSat architecture, which was developed with the support of the Defense Advanced Research Projects Agency's (DARPA's) Phoenix Program, enabled the R3S system to advance from the first concept to delivery of preliminary design review (PDR) level documents in

  8. Potential of Burkholderia seminalis TC3.4.2R3 as Biocontrol Agent Against Fusarium oxysporum Evaluated by Mass Spectrometry Imaging

    NASA Astrophysics Data System (ADS)

    Araújo, Francisca Diana da Silva; Araújo, Welington Luiz; Eberlin, Marcos Nogueira

    2017-02-01

    Species of genus Burkholderia display different interaction profiles in the environment, causing either several diseases in plants and animals or being beneficial to some plants, promoting their growth, and suppressing phytopathogens. Burkholderia spp. also produce many types of biomolecules with antimicrobial activity, which may be commercially used to protect crops of economic interest, mainly against fungal diseases. Herein we have applied matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) to investigate secondary metabolites produced by B. seminalis TC3.4.2R3 in monoculture and coculture with plant pathogen Fusarium oxysporum. The siderophore pyochelin and the rhamnolipid Rha-Rha-C15-C14 were detected in wild-type B. seminalis strain, and their productions were found to vary in mutant strains carrying disruptions in gene clusters associated with antimicrobial compounds. Two mycotoxins were detected in F. oxysporum. During coculture with B. seminalis, metabolites probably related to defense mechanisms of these microorganisms were observed in the interspecies interaction zone. Our findings demonstrate the effective application of MALDI-MSI in the detection of bioactive molecules involved in the defense mechanism of B. seminalis, and these findings suggest the potential use of this bacterium in the biocontrol of plant diseases caused by F. oxysporum.

  9. DcR3 induces epithelial-mesenchymal transition through activation of the TGF-β3/SMAD signaling pathway in CRC

    PubMed Central

    Hu, Zhi-Yan; Li, Sheng-Nan; Kan, He-Ping; Wang, Xiao-Yan; Li, Zu-Guo

    2016-01-01

    Decoy receptor 3 (DcR3), a novel member of the tumor necrosis factor receptor (TNFR) family, was recently reported to be associated with tumorigenesis and metastasis. However, the role of DcR3 in human colorectal cancer (CRC) has not been fully elucidated. In this study, we found that DcR3 expression was significantly higher in human colorectal cancer tissues than in paired normal tissues, and that DcR3 expression was strongly correlated with tumor invasion, lymph node metastases and poor prognoses. Moreover, DcR3 overexpression significantly enhanced CRC cell proliferation and migration in vitro and tumorigenesis in vivo. Conversely, DcR3 knockdown significantly repressed CRC cell proliferation and migration in vitro, and DcR3 deficiency also attenuated CRC tumorigenesis and metastasis in vivo. Functionally, DcR3 was essential for TGF-β3/SMAD-mediated epithelial-mesenchymal transition (EMT) of CRC cells. Importantly, cooperation between DcR3 and TGF-β3/SMAD-EMT signaling-related protein expression was correlated with survival and survival time in CRC patients. In conclusion, our results demonstrate that DcR3 may be a prognostic biomarker for CRC and that this receptor facilitates CRC development and metastasis by participating in TGF-β3/SMAD-mediated EMT of CRC cells. PMID:27764793

  10. Polarized Raman scattering of multiferroic BiFeO3 epitaxial films with rhombohedral R3c symmetry

    NASA Astrophysics Data System (ADS)

    Singh, Manoj K.; Jang, Hyun M.; Ryu, Sangwoo; Jo, Moon-Ho

    2006-01-01

    Highly (111)-oriented rhombohedral BiFeO3 (BFO) thin films were grown on (111) SrTiO3 substrates by pulsed laser deposition. Polarized Raman-scattering study of the (111)-oriented epitaxial BFO thin film with rhombohedral R3c symmetry was carried out by employing two distinct backscattering geometries. The A1-symmetry transverse-optical [A1(TO )] phonons were selectively isolated from the E-symmetry transverse-optical [E(TO)] phonons by employing Y'(ZZ)Y' polarization configuration in a novel side-view backscattering. By comparing the Y'(ZZ)Y' spectrum with the Z(X 'X')Z polarization spectrum in a normal backscattering, we were able to assign most of A1 and E-symmetry normal modes of R3c BFO. In addition, we found that there was a negligible LO-TO splitting in the A1-symmetry normal modes.

  11. Large time behavior for the system of a viscous liquid-gas two-phase flow model in R3

    NASA Astrophysics Data System (ADS)

    Wang, Wenjun; Wang, Weike

    2016-11-01

    The Cauchy problem of a three-dimensional compressible viscous liquid-gas two-phase flow model is considered in the present paper. The global existence and uniqueness of solutions are established when the initial data is close to its equilibrium in the framework of Sobolev space H3 (R3). Moreover, the optimal L2-L2 convergence rates are also obtained for the solution.

  12. The Nonlinear Stability of L 4 in the R3BP when the Smaller Primary is a Heterogeneous Spheroid

    NASA Astrophysics Data System (ADS)

    Shalini, Kumari; Suraj, Md Sanam; Aggarwal, Rajiv

    2017-03-01

    We have investigated the nonlinear stability of the triangular libration point L 4 in the R3BP when the smaller primary is a heterogeneous spheroid with three layers having different densities. We observe that in the nonlinear sense, the triangular libration is stable in the range of linear stability 0< μ< μ c , a critical value of mass parameter μ, except for three mass ratios μ 1^' },μ 2^' }, μ 3^' } at which Moser's theorem is not applicable.

  13. T1R3 is expressed in brush cells and ghrelin-producing cells of murine stomach.

    PubMed

    Hass, Nicole; Schwarzenbacher, Karin; Breer, Heinz

    2010-03-01

    Various digestive and enteroendocrine signaling processes are constantly being adapted to the chemical composition and quantity of the chyme contained in the diverse compartments of the gastrointestinal tract. The chemosensory monitoring that underlies the adaptive capacity of the gut is thought to be performed by so called brush cells that share morphological and molecular features with gustatory sensory cells. A substantial population of brush cells is localized in the gastric mucosa. However, no chemosensory receptors have been found to be expressed in these cells so far, challenging the concept that they serve a chemosensory function. The canonical chemoreceptors for the detection of macronutrients are taste receptors belonging to the T1R family; these have been identified in several tissues in addition to the gustatory system including the small intestine. We demonstrate the expression of the T1R subtype T1R3, which is essential for the detection of both sugars and amino acids in the gustatory system, in two distinct cell populations of the gastric mucosa. One population corresponds to open-type brush cells, emphasizing the notion that they are a chemosensory cell type; T1R3 immunoreactivity in these cells is restricted to the apical cell pole, which might provide the basis for the detection of luminal macronutrient compounds. The second gastric T1R3-positive population consists of closed-type endocrine cells that produce ghrelin. This finding suggests that ghrelin-releasing cells, which lack access to the stomach lumen, might receive chemosensory input from macronutrients in the circulation via T1R3.

  14. The optical counterpart of the supersoft X-ray source r3-8 in M31

    NASA Astrophysics Data System (ADS)

    Orio, M.; Luna, G. J. M.; Kotulla, R.; Gallagher, J. S. G.

    2015-10-01

    On behalf of a larger collaboration we announce that we have obtained spectra of the M31 supersoft X-ray source defined as r3-8 in the Chandra catalogs (see Chiosi et al. 2014, MNRAS 443, 1821, and references therein) using GMOS and the B600 grating at Gemini North, in the 4150-7100 Angstrom range, on 2015/9/9.

  15. Anthocyanin leaf markings are regulated by a family of R2R3-MYB genes in the genus Trifolium.

    PubMed

    Albert, Nick W; Griffiths, Andrew G; Cousins, Greig R; Verry, Isabelle M; Williams, Warren M

    2015-01-01

    Anthocyanin pigments accumulate to form spatially restricted patterns in plants, particularly in flowers, but also occur in vegetative tissues. Spatially restricted anthocyanin leaf markings are poorly characterised in plants, but are common in forage legumes. We hypothesised that the molecular basis for anthocyanin leaf markings in Trifolium spp. is due to the activity of a family of R2R3-MYB genes. R2R3-MYB genes were identified that are associated with the two classic pigmentation loci in T. repens. The R locus patterns 'red leaf', 'red midrib' and 'red fleck' are conditioned by a single MYB gene, RED LEAF. The 'diffuse red leaf' trait is regulated by the RED LEAF DIFFUSE MYB gene. The V locus was identified through mapping two V-linked traits, 'V-broken yellow' (Vby) and 'red leaflet' (Vrl). Two highly similar R2R3-MYB genes, RED V-a and RED V-b, mapped to the V locus and co-segregated with the RED V pigmentation pattern. Functional characterisation of RED LEAF and RED V was performed, confirming their function as anthocyanin regulators and identifying a C-terminal region necessary for transactivation. The mechanisms responsible for generating anthocyanin leaf markings in T. repens provide a valuable system to compare with mechanisms that regulate complex floral pigmentation.

  16. Mediation of Autophagic Cell Death by Type 3 Ryanodine Receptor (RyR3) in Adult Hippocampal Neural Stem Cells

    PubMed Central

    Chung, Kyung Min; Jeong, Eun-Ji; Park, Hyunhee; An, Hyun-Kyu; Yu, Seong-Woon

    2016-01-01

    Cytoplasmic Ca2+ actively engages in diverse intracellular processes from protein synthesis, folding and trafficking to cell survival and death. Dysregulation of intracellular Ca2+ levels is observed in various neuropathological states including Alzheimer’s and Parkinson’s diseases. Ryanodine receptors (RyRs) and inositol 1,4,5-triphosphate receptors (IP3Rs), the main Ca2+ release channels located in endoplasmic reticulum (ER) membranes, are known to direct various cellular events such as autophagy and apoptosis. Here we investigated the intracellular Ca2+-mediated regulation of survival and death of adult hippocampal neural stem (HCN) cells utilizing an insulin withdrawal model of autophagic cell death (ACD). Despite comparable expression levels of RyR and IP3R transcripts in HCN cells at normal state, the expression levels of RyRs—especially RyR3—were markedly upregulated upon insulin withdrawal. While treatment with the RyR agonist caffeine significantly promoted the autophagic death of insulin-deficient HCN cells, treatment with its inhibitor dantrolene prevented the induction of autophagy following insulin withdrawal. Furthermore, CRISPR/Cas9-mediated knockout of the RyR3 gene abolished ACD of HCN cells. This study delineates a distinct, RyR3-mediated ER Ca2+ regulation of autophagy and programmed cell death in neural stem cells. Our findings provide novel insights into the critical, yet understudied mechanisms underlying the regulatory function of ER Ca2+ in neural stem cell biology. PMID:27199668

  17. Ground state sign-changing solutions for a class of Schrödinger-Poisson type problems in R3

    NASA Astrophysics Data System (ADS)

    Chen, Sitong; Tang, Xianhua

    2016-08-01

    This paper is dedicated to studying the following Schrödinger-Poisson system -triangle u+V(x)u+λφ u=K(x)f(u),& quad xin R3,-triangleφ= u^2,quad xin R3, where V, K are positive continuous potentials, f is a continuous function and {λ} is a positive parameter. We develop a direct approach to establish the existence of one ground state sign-changing solution {u_λ} with precisely two nodal domains, by introducing a weaker condition that there exists {θ_0in (0,1)} such that K(x)[f(τ)/τ^3-f(tτ)/(tτ)^3 ]sign(1-t)+θ_0V(x)|1-t^2|/(tτ)^2 ≥ 0, quad forall x in R^3, t > 0, τ≠ 0 than the usual increasing condition on {f(t)/|t|^3}. Under the above condition, we also prove that the energy of any sign-changing solution is strictly larger than two times the least energy, and give a convergence property of {u_λ} as {λsearrow 0}.

  18. Washout of tritium from 3R-3(/sup 3/H)-L-aspartate in the aspartase reaction

    SciTech Connect

    Katz, B.M.; Cook, P.F.

    1987-05-01

    Bacterial aspartase catalyzes the reversible conversion of L-aspartate to fumarate and ammonia. Recent studies that made use of deuterium and /sup 15/N isotope effects suggested a carbanion intermediate mechanism in which C-N bond cleavage is rate determining. This could result in removal of a proton from the 3R position of aspartate at a rate of faster than the elimination of ammonia. 3R-3(/sup 3/H)-Aspartate was prepared enzymatically using aspartase from fumarate, ammonia and /sup 3/H/sub 2/O and aspartate isolated via chromatography on Dowex 50W x 8 at pH 1, eluting with 2N pyridine. The rate of /sup 3/H washout from this aspartate was then measured as a function of aspartate concentration and compared to the rate of production of fumarate. Tritium does washout of aspartate at a rate faster than fumarate is formed but the proton is apparently not rapidly equilibrated with solvent. The tritium washout experiments were supplemented using 3R-3(/sup 2/H)-aspartate prepared as above with /sup 2/H/sub 2/O replacing /sup 3/H/sub 2/O and monitoring the appearance of 3R-3(/sup 1/H)-aspartate via /sup 1/H-NMR. Results confirm the tritium washout results. Data are discussed in terms of the carbanion mechanism.

  19. Glutamate receptor subunit 3 (GluR3) immunoreactivity delineates a subpopulation of parvalbumin-containing interneurons in the rat hippocampus.

    PubMed

    Moga, Diana E; Janssen, William G M; Vissavajjhala, Prabhakar; Czelusniak, Sharon M; Moran, Thomas M; Hof, Patrick R; Morrison, John H

    2003-07-14

    Rasmussen's encephalitis is a childhood disease resulting in intractable seizures associated with hippocampal and neocortical inflammation. An autoantibody against the GluR3 subunit of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors is implicated in the pathophysiology of Rasmussen's encephalitis. AMPA receptors mediate excitatory neurotransmission in the brain and contain combinations of four subunits (GluR1-4). Although the distributions of GluR1, GluR2, and GluR4 are known in some detail, the cellular distribution of GluR3 in the mammalian brain remains to be described. We developed and characterized a GluR3-specific monoclonal antibody and quantified the cellular distribution of GluR3 in CA1 of the rat hippocampus. GluR3 immunoreactivity was detected in all pyramidal neurons and astrocytes and in most interneurons. We quantified the intensity of GluR3 immunoreactivity in interneuron subtypes defined by their calcium-binding protein content. GluR3 immunofluorescence, but not GluR1 or GluR2 immunofluorescence, was significantly elevated in somata of parvalbumin-containing interneurons compared to pyramidal somata. Strikingly, increased GluR3 immunofluorescence was not observed in calbindin- and calretinin-containing interneurons. Furthermore, 24% of parvalbumin-containing interneurons could be distinguished from surrounding neurons based on their intense GluR3 immunoreactivity. This subpopulation had significantly elevated GluR3 immunoreactivity compared to the rest of parvalbumin-containing interneurons. Electron microscopy revealed enriched GluR3 immunoreactivity in parvalbumin-containing perikarya at cytoplasmic and postsynaptic sites. Parvalbumin-containing interneurons, potent inhibitors of cortical pyramidal neurons, are vulnerable in the brains of epileptic patients. Our findings suggest that the somata of these interneurons are enriched in GluR3, which may render them vulnerable to pathological states such as epilepsy and

  20. The Brassica napus blackleg resistance gene LepR3 encodes a receptor-like protein triggered by the Leptosphaeria maculans effector AVRLM1.

    PubMed

    Larkan, N J; Lydiate, D J; Parkin, I A P; Nelson, M N; Epp, D J; Cowling, W A; Rimmer, S R; Borhan, M H

    2013-01-01

    LepR3, found in the Brassica napus cv 'Surpass 400', provides race-specific resistance to the fungal pathogen Leptosphaeria maculans, which was overcome after great devastation in Australia in 2004. We investigated the LepR3 locus to identify the genetic basis of this resistance interaction. We employed a map-based cloning strategy, exploiting collinearity with the Arabidopsis thaliana and Brassica rapa genomes to enrich the map and locate a candidate gene. We also investigated the interaction of LepR3 with the L. maculans avirulence gene AvrLm1 using transgenics. LepR3 was found to encode a receptor-like protein (RLP). We also demonstrated that avirulence towards LepR3 is conferred by AvrLm1, which is responsible for both the Rlm1 and LepR3-dependent resistance responses in B. napus. LepR3 is the first functional B. napus disease resistance gene to be cloned. AvrLm1's interaction with two independent resistance loci, Rlm1 and LepR3, highlights the need to consider redundant phenotypes in 'gene-for-gene' interactions and offers an explanation as to why LepR3 was overcome so rapidly in parts of Australia.

  1. Enhanced transfection efficiency and targeted delivery of self-assembling h-R3-dendriplexes in EGFR-overexpressing tumor cells.

    PubMed

    Li, Jun; Li, Shengnan; Xia, Songyun; Feng, Jinfeng; Zhang, Xuedi; Hao, Yanli; Chen, Lei; Zhang, Xiaoning

    2015-09-22

    The efficient gene transfection, cellular uptake and targeted delivery in vivo are key issues for non-viral gene delivery vectors in cancer therapy. To solve these issues, we designed a new targeted gene delivery system based on epidermal growth factor receptor (EGFR) targeting strategy. An anti-EGFR monoclonal antibody h-R3 was introduced to dendriplexes of PAMAM and DNA via electrostatic interactions to form self-assembled h-R3-PAMAM-DNA complexes (h-R3-dendriplexes). Dendriplexes h-R3-dendriplexes represented excellent DNA encapsulation ability and formed unique nanostructures. Compared to dendriplexes, h-R3-dendriplexes presented lower cytotoxicity, higher gene transfection efficiency, excellent endosome escape ability and high nuclear accumulation in the EGFR-overexpressing HepG2 cells. Both ex vivo fluorescence imaging and confocal results of frozen section revealed that h-R3-dendriplexes showed higher targeted delivery and much better gene expression in the tumors than dendriplexes at the same N/P ratio, and h-R3-dendriplexes had accumulation primarily in the tumor and kidney. Moreover, h-R3-dendriplexes for p53 delivery indicated efficient cell growth inhibition and potentiated paclitaxel-induced cell death. These results indicate that the h-R3-dendriplexes represent a great potential to be used as efficient targeted gene delivery carriers in EGFR-overexpressing tumor cells.

  2. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

    PubMed Central

    Ma, Lisong; Borhan, M. Hossein

    2015-01-01

    The fungus Leptosphaeria maculans (L. maculans) is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus) worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localized cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR). However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1). Silencing of NbSOBIR1 or NbSERK3 (BAK1) compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signaling complex and were able to define the AvrLm1 effector domain. PMID:26579176

  3. Cluster bulleticity

    NASA Astrophysics Data System (ADS)

    Massey, Richard; Kitching, Thomas; Nagai, Daisuke

    2011-05-01

    The unique properties of dark matter are revealed during collisions between clusters of galaxies, such as the bullet cluster (1E 0657-56) and baby bullet (MACS J0025-12). These systems provide evidence for an additional, invisible mass in the separation between the distributions of their total mass, measured via gravitational lensing, and their ordinary 'baryonic' matter, measured via its X-ray emission. Unfortunately, the information available from these systems is limited by their rarity. Constraints on the properties of dark matter, such as its interaction cross-section, are therefore restricted by uncertainties in the individual systems' impact velocity, impact parameter and orientation with respect to the line of sight. Here we develop a complementary, statistical measurement in which every piece of substructure falling into every massive cluster is treated as a bullet. We define 'bulleticity' as the mean separation between dark matter and ordinary matter, and we measure the signal in hydrodynamical simulations. The phase space of substructure orbits also exhibits symmetries that provide an equivalent control test. Any detection of bulleticity in real data would indicate a difference in the interaction cross-sections of baryonic and dark matter that may rule out hypotheses of non-particulate dark matter that are otherwise able to model individual systems. A subsequent measurement of bulleticity could constrain the dark matter cross-section. Even with conservative estimates, the existing Hubble Space Telescope archive should yield an independent constraint tighter than that from the bullet cluster. This technique is then trivially extendable to and benefits enormously from larger, future surveys.

  4. Biosurfactins production by Bacillus amyloliquefaciens R3 and their antibacterial activity against multi-drug resistant pathogenic E. coli.

    PubMed

    Chi, Zhe; Rong, Yan-Jun; Li, Yang; Tang, Mei-Juan; Chi, Zhen-Ming

    2015-05-01

    In this work, the anti-Escherichia coli activity of the bioactive substances produced by Bacillus amyloliquefaciens R3 was examined. A new and cheap medium for production of the anti-E. coli substances which contained 20.0 g L(-1) soybean powder, 20.0 g L(-1) wheat flour, pH 6.0 was developed. A crude surfactant concentration of 0.48 mg mL(-1) was obtained after 27 h of 10-L fermentation, and the diameter of the clear zone on the plate seeded with the pathogenic E. coli 2# was 23.3 mm. A preliminary characterization suggested that the anti-E. coli substances produced by B. amyloliquefaciens R3 were the biosurfactins (F1, F2, F3, F4, and F5) with amino acids (GLLVDLL) and hydroxy fatty acids (of 12-15 carbons in length). It was found that all the strains of the pathogenic E. coli showed resistance to several different antibiotics, suggesting that they were the multi-drug resistance and all the strains of the pathogenic E. coli were sensitive to the biosurfactins, indicating that the biosurfactins produced by B. amyloliquefaciens R3 had a broad spectrum of antibacterial activity against the pathogenic E. coli with multi-drug resistant profiles. After the treatment with the purified biosurfactin (F1), the cell membrane of both the whole cells and protoplasts of the E. coli 2# was damaged and the whole cells of the bacterium were broken.

  5. Multiple R2R3-MYB Transcription Factors Involved in the Regulation of Anthocyanin Accumulation in Peach Flower

    PubMed Central

    Zhou, Hui; Peng, Qian; Zhao, Jianbo; Owiti, Albert; Ren, Fei; Liao, Liao; Wang, Lu; Deng, Xianbao; Jiang, Quan; Han, Yuepeng

    2016-01-01

    Anthocyanin accumulation is responsible for flower coloration in peach. Here, we report the identification and functional characterization of eight flavonoid-related R2R3-MYB transcription factors, designated PpMYB10.2, PpMYB9, PpMYBPA1, Peace, PpMYB17, PpMYB18, PpMYB19, and PpMYB20, respectively, in peach flower transcriptome. PpMYB10.2 and PpMYB9 are able to activate transcription of anthocyanin biosynthetic genes, whilst PpMYBPA1 and Peace have a strong activation on the promoters of proanthocyanin (PA) biosynthetic genes. PpMYB17-20 show a strong repressive effect on transcription of flavonoid pathway genes such as dihydroflavonol 4-reductase. These results indicate that anthocyanin accumulation in peach flower is coordinately regulated by a set of R2R3-MYB genes. In addition, PpMYB9 and PpMYB10.2 are closely related but separated into two groups, designated MYB9 and MYB10, respectively. PpMYB9 shows a strong activation on the PpUGT78A2 promoter, but with no effect on the promoter of PpUGT78B (commonly called PpUFGT in previous studies). In contrast, PpMYB10.2 is able to activate the PpUFGT promoter, but not for the PpUGT78A2 promoter. Unlike the MYB10 gene that is universally present in plants, the MYB9 gene is lost in most dicot species. Therefore, the PpMYB9 gene represents a novel group of anthocyanin-related MYB activators, which may have diverged in function from the MYB10 genes. Our study will aid in understanding the complex mechanism regulating floral pigmentation in peach and functional divergence of the R2R3-MYB gene family in plants. PMID:27818667

  6. Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis

    PubMed Central

    Butt, Hamama Islam; Yang, Zhaoen; Chen, Eryong; Zhao, Ge; Gong, Qian; Yang, Zuoren; Zhang, Xueyan

    2017-01-01

    Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop. PMID:28125637

  7. The impact of Ghana's R3M programme on the provision of safe abortions and postabortion care.

    PubMed

    Sundaram, Aparna; Juarez, Fatima; Ahiadeke, Clement; Bankole, Akinrinola; Blades, Nakeisha

    2015-10-01

    In 2006, in response to the high maternal mortality, driven largely by unsafe abortions, the government of Ghana, in partnership with other organizations, launched the reducing maternal mortality and morbidity (R3M) programme in seven districts in Greater Accra, Ashanti and Eastern, to improve comprehensive abortion care services. This article examines whether this intervention made a difference to the provision of safe abortion services and postabortion care (PAC). We also examine the role played by provider attitudes and knowledge of the abortion law, on providers with clinical training in service provision. Primary data on health care providers in Ghana, collected using a quasi-experimental design, were analysed using propensity score weighting. Apart from the treatment group, the sample included two controls: (1) Districts in Accra, Ashanti and Eastern, not exposed to the treatment; and (2) Districts from distant Brong Ahafo, also not exposed to the treatment. The findings show that providers in the treatment group are nearly 16 times as likely to provide safe abortions compared with their peers in Brong Ahafo, and ∼2.5 times as likely compared with providers in the other control group. R3M providers were also different from their peers in providing PAC. Associations between provider attitudes and knowledge of the law on both outcomes were either non-significant or inconsistent including for providers with clinical knowledge of abortion provision. Provider confidence however is strongly associated with service provision. We conclude that the R3M programme is helping safe abortion provision, with the differences being greater with control groups that are geographically distant, perhaps owing to lower contamination from movement of providers between facilities. Increasing provider confidence is key to improving both safe abortion provision and PAC.

  8. Lactisole inhibits the glucose-sensing receptor T1R3 expressed in mouse pancreatic β-cells.

    PubMed

    Hamano, Kunihisa; Nakagawa, Yuko; Ohtsu, Yoshiaki; Li, Longfei; Medina, Johan; Tanaka, Yuji; Masuda, Katsuyoshi; Komatsu, Mitsuhisa; Kojima, Itaru

    2015-07-01

    Glucose activates the glucose-sensing receptor T1R3 and facilitates its own metabolism in pancreatic β-cells. An inhibitor of this receptor would be helpful in elucidating the physiological function of the glucose-sensing receptor. The present study was conducted to examine whether or not lactisole can be used as an inhibitor of the glucose-sensing receptor. In MIN6 cells, in a dose-dependent manner, lactisole inhibited insulin secretion induced by sweeteners, acesulfame-K, sucralose and glycyrrhizin. The IC50 was ∼4 mmol/l. Lactisole attenuated the elevation of cytoplasmic Ca2+ concentration ([Ca2+]c) evoked by sucralose and acesulfame-K but did not affect the elevation of intracellular cAMP concentration ([cAMP]c) induced by these sweeteners. Lactisole also inhibited the action of glucose in MIN6 cells. Thus, lactisole significantly reduced elevations of intracellular [NADH] and intracellular [ATP] induced by glucose, and also inhibited glucose-induced insulin secretion. To further examine the effect of lactisole on T1R3, we prepared HEK293 cells stably expressing mouse T1R3. In these cells, sucralose elevated both [Ca2+]c and [cAMP]c. Lactisole attenuated the sucralose-induced increase in [Ca2+]c but did not affect the elevation of [cAMP]c. Finally, lactisole inhibited insulin secretion induced by a high concentration of glucose in mouse islets. These results indicate that the mouse glucose-sensing receptor was inhibited by lactisole. Lactisole may be useful in assessing the role of the glucose-sensing receptor in mouse pancreatic β-cells.

  9. Structure-activity relationship of daptomycin analogues with substitution at (2S, 3R) 3-methyl glutamic acid position.

    PubMed

    Lin, Du'an; Lam, Hiu Yung; Han, Wenbo; Cotroneo, Nicole; Pandya, Bhaumik A; Li, Xuechen

    2017-02-01

    Daptomycin is a highly effective lipopeptide antibiotic against Gram-positive pathogens. The presence of (2S, 3R) 3-methyl glutamic acid (mGlu) in daptomycin has been found to be important to the antibacterial activity. However the role of (2S, 3R) mGlu is yet to be revealed. Herein, we reported the syntheses of three daptomycin analogues with (2S, 3R) mGlu substituted by (2S, 3R) methyl glutamine (mGln), dimethyl glutamic acid and (2S, 3R) ethyl glutamic acid (eGlu), respectively, and their antibacterial activities. The detailed synthesis of dimethyl glutamic acid was also reported.

  10. Mechanistic basis for functional promiscuity in the TNF and TNF receptor superfamilies: structure of the LIGHT:DcR3 assembly.

    PubMed

    Liu, Weifeng; Zhan, Chenyang; Cheng, Huiyong; Kumar, P Rajesh; Bonanno, Jeffrey B; Nathenson, Stanley G; Almo, Steven C

    2014-09-02

    LIGHT initiates intracellular signaling via engagement of the two TNF receptors, HVEM and LTβR. In humans, LIGHT is neutralized by DcR3, a unique soluble member of the TNFR superfamily, which tightly binds LIGHT and inhibits its interactions with HVEM and LTβR. DcR3 also neutralizes two other TNF ligands, FasL and TL1A. Due to its ability to neutralize three distinct different ligands, DcR3 contributes to a wide range of biological and pathological processes, including cancer and autoimmune diseases. However, the mechanisms that support the broad specificity of DcR3 remain to be fully defined. We report the structures of LIGHT and the LIGHT:DcR3 complex, which reveal the structural basis for the DcR3-mediated neutralization of LIGHT and afford insights into DcR3 function and binding promiscuity. Based on these structures, we designed LIGHT mutants with altered affinities for DcR3 and HVEM, which may represent mechanistically informative probe reagents.

  11. Specific elevation of DcR3 in sera of sepsis patients and its potential role as a clinically important biomarker of sepsis

    PubMed Central

    Kim, Sunghee; Mi, Lijun; Zhang, Lurong

    2012-01-01

    Because of its potentially important role in the pathogenesis of sepsis, the expression of soluble decoy receptor 3 (DcR3) was investigated in sera of sepsis patients. The serum levels of DcR3 and its TNF-like ligand TL1A and homologous decoy receptor OPG were quantified by ELISA. The values of DcR3 to diagnose sepsis were analyzed by receiver-operating characteristic (ROC) curves. The results showed that DcR3 was significantly elevated in sepsis compared to SIRS (systemic inflammatory response syndrome), a condition similar to sepsis but resulting from noninfectious insults. DcR3 showed superior area under the ROC curve (AUC, 0.958) compared to poor AUCs of TL1A and OPG. At a cut-off of 3.24 ng/ml, DcR3 predicted sepsis from SIRS with 96% sensitivity and 82.6% specificity. DcR3 also predicted sepsis from cancer and inflammatory bowel disease with equally excellent values. Therefore, DcR3 serum level has the potential to serve as a reliable biomarker of sepsis. PMID:22647538

  12. Membrane-Bound CYB5R3 Is a Common Effector of Nutritional and Oxidative Stress Response Through FOXO3a and Nrf2

    PubMed Central

    Siendones, Emilio; SantaCruz-Calvo, Sara; Martín-Montalvo, Alejandro; Cascajo, María V.; Ariza, Julia; López-Lluch, Guillermo; Villalba, José M.; Acquaviva-Bourdain, Cécile; Roze, Emmanuel; Bernier, Michel; de Cabo, Rafael

    2014-01-01

    Abstract Aims: Membrane-bound CYB5R3 deficiency in humans causes recessive hereditary methaemoglobinaemia (RHM), an incurable disease that is characterized by severe neurological disorders. CYB5R3 encodes for NADH-dependent redox enzyme that contributes to metabolic homeostasis and stress protection; however, how it is involved in the neurological pathology of RHM remains unknown. Here, the role and transcriptional regulation of CYB5R3 was studied under nutritional and oxidative stress. Results: CYB5R3-deficient cells exhibited a decrease of the NAD+/NADH ratio, mitochondrial respiration rate, ATP production, and mitochondrial electron transport chain activities, which were associated with higher sensitivity to oxidative stress, and an increase in senescence-associated β-galactosidase activity. Overexpression of either forkhead box class O 3a (FOXO3a) or nuclear factor (erythroid-derived 2)-like2 (Nrf2) was associated with increased CYB5R3 levels, and genetic ablation of Nrf2 resulted in lower CYB5R3 expression. The presence of two antioxidant response element sequences in the CYB5R3 promoter led to chromatin immunoprecipitation studies, which showed that cellular stressors enhanced the binding of Nrf2 and FOXO3a to the CYB5R3 promoter. Innovation: Our findings demonstrate that CYB5R3 contributes to regulate redox homeostasis, aerobic metabolism, and cellular senescence, suggesting that CYB5R3 might be a key effector of oxidative and nutritional stress pathways. The expression of CYB5R3 is regulated by the cooperation of Nrf2 and FOXO3a. Conclusion: CYB5R3 is an essential gene that appears as a final effector for both nutritional and oxidative stress responses through FOXO3a and Nrf2, respectively, and their interaction promotes CYB5R3 expression. These results unveil a potential mechanism of action by which CYB5R3 deficiency contributes to the pathophysiological underpinnings of neurological disorders in RHM patients. Antioxid. Redox Signal. 21, 1708–1725. PMID

  13. Protein phosphatase complex PP5/PPP2R3C dephosphorylates P-glycoprotein/ABCB1 and down-regulates the expression and function.

    PubMed

    Katayama, Kazuhiro; Yamaguchi, Miho; Noguchi, Kohji; Sugimoto, Yoshikazu

    2014-04-01

    P-glycoprotein (P-gp)/ABCB1 is a key molecule of multidrug resistance in cancer. Protein phosphatase (PP) 2A, regulatory subunit B, gamma (PPP2R3C), which is a regulatory subunit of PP2A and PP5, was identified as a binding candidate to P-gp. Immunoprecipitation-western blotting revealed that PP5 and PPP2R3C were coprecipitated with P-gp, while PP2A was not. PP5/PPP2R3C dephosphorylated protein kinase A/protein kinase C-phosphorylation of P-gp. Knockdown of PP5 and/or PPP2R3C increased P-gp expression and lowered the sensitivity to vincristine and doxorubicin. Consequently, our results indicate that PP5/PPP2R3C negatively regulates P-gp expression and function.

  14. Expression of the sweetpotato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis.

    PubMed

    Chu, Hyosub; Jeong, Jae Cheol; Kim, Wook-Jin; Chung, Dong Min; Jeon, Hyo Kon; Ahn, Young Ock; Kim, Sun Ha; Lee, Haeng-Soon; Kwak, Sang-Soo; Kim, Cha Young

    2013-06-01

    R2R3-type MYB transcription factors (TFs) play important roles in transcriptional regulation of anthocyanins. The R2R3-type IbMYB1 is known to be a key regulator of anthocyanin biosynthesis in the storage roots of sweetpotato. We previously showed that transient expression of IbMYB1a led to anthocyanin pigmentation in tobacco leaves. In this article, we generated transgenic Arabidopsis plants expressing the IbMYB1a gene under the control of CaMV 35S promoter, and the sweetpotato SPO and SWPA2 promoters. Overexpression of IbMYBa in transgenic Arabidopsis produced strong anthocyanin pigmentation in seedlings and generated a deep purple color in leaves, stems and seeds. Reverse transcription-polymerase chain reaction analysis showed that IbMYB1a expression induced upregulation of several structural genes in the anthocyanin biosynthetic pathway, including 4CL, CHI, F3'H, DFR, AGT, AAT and GST. Furthermore, overexpression of IbMYB1a led to enhanced expression of the AtTT8 (bHLH) and PAP1/AtMYB75 genes. high-performance liquid chromatography analysis revealed that IbMYB1a expression led to the production of cyanidin as a major core molecule of anthocyanidins in Arabidopsis, as occurs in the purple leaves of sweetpotato (cv. Sinzami). This result shows that the IbMYB1a TF is sufficient to induce anthocyanin accumulation in seedlings, leaves, stems and seeds of Arabidopsis plants.

  15. CONSTRAINTS ON THE PHYSICAL PROPERTIES OF MAIN BELT COMET P/2013 R3 FROM ITS BREAKUP EVENT

    SciTech Connect

    Hirabayashi, Masatoshi; Sánchez, Diego Paul; Gabriel, Travis; Scheeres, Daniel J.

    2014-07-01

    Jewitt et al. recently reported that main belt comet P/2013 R3 experienced a breakup, probably due to rotational disruption, with its components separating on mutually hyperbolic orbits. We propose a technique for constraining physical properties of the proto-body, especially the initial spin period and cohesive strength, as a function of the body's estimated size and density. The breakup conditions are developed by combining mutual orbit dynamics of the smaller components and the failure condition of the proto-body. Given a proto-body with a bulk density ranging from 1000 kg m{sup –3} to 1500 kg m{sup –3} (a typical range of the bulk density of C-type asteroids), we obtain possible values of the cohesive strength (40-210 Pa) and the initial spin state (0.48-1.9 hr). From this result, we conclude that although the proto-body could have been a rubble pile, it was likely spinning beyond its gravitational binding limit and would have needed cohesive strength to hold itself together. Additional observations of P/2013 R3 will enable stronger constraints on this event, and the present technique will be able to give more precise estimates of its internal structure.

  16. Electrically tunable transport and high-frequency dynamics in antiferromagnetic S r3I r2O7

    NASA Astrophysics Data System (ADS)

    Seinige, Heidi; Williamson, Morgan; Shen, Shida; Wang, Cheng; Cao, Gang; Zhou, Jianshi; Goodenough, John B.; Tsoi, Maxim

    2016-12-01

    We report dc and high-frequency transport properties of antiferromagnetic S r3I r2O7 . Temperature-dependent resistivity measurements show that the activation energy of this material can be tuned by an applied dc electrical bias. The latter allows for continuous variations in the sample resistivity of as much as 50% followed by a reversible resistive switching at higher biases. Such a switching is of high interest for antiferromagnetic applications in high-speed memory devices. Interestingly, we found the switching behavior to be strongly affected by a high-frequency (microwave) current applied to the sample. The microwaves at 3-7 GHz suppress the dc switching and produce resonancelike features that we tentatively associated with the dissipationless magnonics recently predicted to occur in antiferromagnetic insulators subject to ac electric fields. We have characterized the effects of microwave irradiation on electronic transport in S r3I r2O7 as a function of microwave frequency and power, strength and direction of external magnetic field, strength and polarity of applied dc bias, and temperature. Our observations support the potential of antiferromagnetic materials for high-speed/high-frequency spintronic applications.

  17. Genome-wide analysis of the R2R3-MYB transcription factor gene family in sweet orange (Citrus sinensis).

    PubMed

    Liu, Chaoyang; Wang, Xia; Xu, Yuantao; Deng, Xiuxin; Xu, Qiang

    2014-10-01

    MYB transcription factor represents one of the largest gene families in plant genomes. Sweet orange (Citrus sinensis) is one of the most important fruit crops worldwide, and recently the genome has been sequenced. This provides an opportunity to investigate the organization and evolutionary characteristics of sweet orange MYB genes from whole genome view. In the present study, we identified 100 R2R3-MYB genes in the sweet orange genome. A comprehensive analysis of this gene family was performed, including the phylogeny, gene structure, chromosomal localization and expression pattern analyses. The 100 genes were divided into 29 subfamilies based on the sequence similarity and phylogeny, and the classification was also well supported by the highly conserved exon/intron structures and motif composition. The phylogenomic comparison of MYB gene family among sweet orange and related plant species, Arabidopsis, cacao and papaya suggested the existence of functional divergence during evolution. Expression profiling indicated that sweet orange R2R3-MYB genes exhibited distinct temporal and spatial expression patterns. Our analysis suggested that the sweet orange MYB genes may play important roles in different plant biological processes, some of which may be potentially involved in citrus fruit quality. These results will be useful for future functional analysis of the MYB gene family in sweet orange.

  18. Ultrafast transient lens spectroscopy of various C40 carotenoids: lycopene, beta-carotene, (3R,3'R)-zeaxanthin, (3R,3'R,6'R)-lutein, echinenone, canthaxanthin, and astaxanthin.

    PubMed

    Kopczynski, Matthäus; Lenzer, Thomas; Oum, Kawon; Seehusen, Jaane; Seidel, Marco T; Ushakov, Vladimir G

    2005-07-21

    The ultrafast internal conversion (IC) dynamics of seven C(40) carotenoids have been investigated at room temperature in a variety of solvents using two-color transient lens (TL) pump-probe spectroscopy. We provide comprehensive data sets for the carbonyl carotenoids canthaxanthin, astaxanthin, and-for the first time-echinenone, as well as new data for lycopene, beta-carotene, (3R,3'R)-zeaxanthin and (3R,3'R,6'R)-lutein in solvents which have not yet been investigated in the literature. Measurements were carried out to determine, how the IC processes are influenced by the conjugation length of the carotenoids, additional substituents and the polarity of the solvent. TL signals were recorded at 800 nm following excitation into the high energy edge of the carotenoid S2 band at 400 nm. For the S2 lifetime solvent-independent upper limits on the order of 100-200 fs are estimated for all carotenoids studied. The S1 lifetimes are in the picosecond range and increase systematically with decreasing conjugation length. For instance, in the sequence canthaxanthin/echinenone/beta-carotene (13/12/11 double bonds) one finds tau1 approximately 5, 7.7 and 9 ps for the S1-->S0 IC process, respectively. Hydroxyl groups not attached to the conjugated system have no apparent influence on tau1, as observed for canthaxanthin/astaxanthin (tau1 approximately 5 ps in both cases). For all carotenoids studied, tau1 is found to be insensitive to the solvent polarity. This is particularly interesting in the case of echinenone, canthaxanthin and astaxanthin, because earlier measurements for other carbonyl carotenoids like, e.g., peridinin partly showed dramatic differences. The likely presence of an intramolecular charge transfer state in the excited state manifold of C40 carbonyl carotenoids, which is stabilized in polar solvents, has obviously no influence on the measured tau1.

  19. Structural, electronic and thermodynamic properties of R3ZnH5 (R=K, Rb, Cs): A first-principle calculation

    NASA Astrophysics Data System (ADS)

    Li, Jia; Zhang, Shengli; Huang, Shiping; Wang, Peng; Tian, Huiping

    2013-02-01

    R3ZnH5 (R=K, Rb, Cs) series have been investigated with respect to the crystal structure, electronic and thermodynamic properties using first-principle methods based on density functional theory with generalized gradient approximation. The optimized structures and atomic coordinates are in good agreement with the experimental data. The strong covalent interactions are obtained between Zn and H atoms in the 18-electron [ZnH4]2- complex, while an ionic interaction is found between [ZnH4]2- and R atom. The formation enthalpies show that the formations of R3ZnH5 hydrides are all exothermic at 298 K. The vibration free energies of R3ZnH5 show that the thermodynamic stabilities of R3ZnH5 hydrides decrease with the increasing diameter of R atom. Two possible decomposition reactions of R3ZnH5 series have been suggested in our work. One (reaction one) is that R3ZnH5 hydrides decomposes to elements directly, and the other (reaction two) is that R3ZnH5 hydrides decomposes to RH hydride. The results show that the first decomposition reaction is more favorable one. The spontaneous decomposition reaction of K3ZnH5 hydrides occur upon 465 K via reaction one, and 564 K via reaction two, respectively.

  20. On the stability of triangular points in the relativistic R3BP with oblate primaries and bigger radiating

    NASA Astrophysics Data System (ADS)

    Bello, Nakone; Singh, Jagadish

    2016-01-01

    We consider a version of the relativistic R3BP which includes the effects of oblateness of the primaries and radiation of the bigger primary as well on the stability of triangular points. We observe that the positions of the triangular points and their stability are affected by the relativistic effect apart from the radiation and oblateness of the primaries. It is further seen for these points that the range of stability region increases or decreases according as the part of the critical mass value, depending upon relativistic terms, radiation and oblateness coefficients, is positive or negative. A numerical exploration shows that in the Sun-Saturn, Sun-Uranus, Sun-Neptune systems, the oblateness has no influence on their positions and range of stability region; whereas it has a little influence on the Sun-Mars, Sun-Jupiter systems. On the other hand, we found that radiation pressure has an observable effect on the solar system.

  1. Magnetic nanosized rare earth iron garnets R3Fe5O12: Sol-gel fabrication, characterization and reinspection

    NASA Astrophysics Data System (ADS)

    Opuchovic, Olga; Kareiva, Aivaras; Mazeika, Kestutis; Baltrunas, Dalis

    2017-01-01

    The magnetic nanosized rare earth iron garnets (R3Fe5O12, where R=Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu) were prepared by an aqueous sol-gel method. Herein we present, that all these garnets can be obtained by this effective synthesis method simply by changing the temperature of the final annealing. It was also demonstrated, that a different annealing temperature leads to a different particle size distribution of the final product. The SEM analysis results revealed that the smallest particles were formed in the range of 75-130 nm. The phase purity and structure of the rare earth iron garnets were estimated using XRD analysis and Mössbauer spectroscopy. Magnetic properties were determined by magnetization measurements. The relation between the particle size, composition and magnetic properties of the sol-gel derived garnets were also discussed in this study.

  2. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles1

    PubMed Central

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C.; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-01-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (EMISSION OF BENZENOID II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of CINNAMYL ALCOHOL DEHYDROGENASE1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  3. A single-repeat R3-MYB transcription factor MYBC1 negatively regulates freezing tolerance in Arabidopsis

    SciTech Connect

    Zhai, Hong; Bai, Xi; Zhu, Yanming; Li, Yong; Cai, Hua; Ji, Wei; Ji, Zuojun; Liu, Xiaofei; Liu, Xin; Li, Jing

    2010-04-16

    We had previously identified the MYBC1 gene, which encodes a single-repeat R3-MYB protein, as a putative osmotic responding gene; however, no R3-MYB transcription factor has been reported to regulate osmotic stress tolerance. Thus, we sought to elucidate the function of MYBC1 in response to osmotic stresses. Real-time RT-PCR analysis indicated that MYBC1 expression responded to cold, dehydration, salinity and exogenous ABA at the transcript level. mybc1 mutants exhibited an increased tolerance to freezing stress, whereas 35S::MYBC1 transgenic plants exhibited decreased cold tolerance. Transcript levels of some cold-responsive genes, including CBF/DREB genes, KIN1, ADC1, ADC2 and ZAT12, though, were not altered in the mybc1 mutants or the 35S::MYBC1 transgenic plants in response to cold stress, as compared to the wild type. Microarray analysis results that are publically available were investigated and found transcript level of MYBC1 was not altered by overexpression of CBF1, CBF2, and CBF3, suggesting that MYBC1 is not down regulated by these CBF family members. Together, these results suggested that MYBC1is capable of negatively regulating the freezing tolerance of Arabidopsis in the CBF-independent pathway. In transgenic Arabidopsis carrying an MYBC1 promoter driven {beta}-glucuronidase (GUS) construct, GUS activity was observed in all tissues and was relatively stronger in the vascular tissues. Fused MYBC1 and GFP protein revealed that MYBC1 was localized exclusively in the nuclear compartment.

  4. Dendritic cells engineered to secrete anti-DcR3 antibody augment cytotoxic T lymphocyte response against pancreatic cancer in vitro

    PubMed Central

    Chen, Jiang; Guo, Xiao-Zhong; Li, Hong-Yu; Zhao, Jia-Jun; Xu, Wen-Da

    2017-01-01

    AIM To investigate the enhanced cytotoxic T lymphocyte responses against pancreatic cancer (PC) in vitro induced by dendritic cells (DCs) engineered to secrete anti-DcR3 monoclonal antibody (mAb). METHODS DCs, T lymphocytes and primary PC cells were obtained from PC patients. DCs were transfected with a designed humanized anti-DcR3 monoclonal antibody heavy and light chain mRNA and/or total tumor RNA (DC-tumor-anti-DcR3 RNA or DC-total tumor RNA) by using electroporation technology. The identification, concentration and function of anti-DcR3 mAb secreted by DC-tumor-anti-DcR3 RNA were determined by western blotting and enzyme-linked immunosorbent assay. After co-culturing of autologous isolated PC cells with target DCs, the effects of secreting anti-DcR3 mAb on RNA-DCs’ viability and apoptosis were assessed by MTT assay and flow cytometry. Analysis of enhanced antigen-specific immune response against PC induced by anti-DcR3 mAb secreting DCs was performed using a 51Cr releasing test. T cell responses induced by RNA-loaded DCs were analyzed by measuring cytokine levels, including IFN-γ, IL-10, IL4, TNF-α and IL-12. RESULTS The anti-DcR3 mAb secreted by DCs reacted with recombinant human DcR3 protein and generated a band with 35 kDa molecular weight. The secreting mAb was transient, peaking at 24 h and becoming undetectable after 72 h. After co-incubation with DC-tumor-anti-DcR3 RNA for designated times, the DcR3 level in the supernatant of autologous PC cells was significantly down-regulated (P < 0.05). DCs secreting anti-DcR3 mAb could improve cell viability and slow down the apoptosis of RNA-loaded DCs, compared with DC-total tumor RNA (P < 0.01). The anti-DcR3 mAb secreted by DC-tumor-anti-DcR3 RNA could enhance the induction of cytotoxic T lymphocytes (CTLs) activity toward RNA-transfected DCs, primary tumor cells, and PC cell lines, compared with CTLs stimulated by DC-total tumor RNA or control group (P < 0.05). Meanwhile, the antigen-specific CTL responses

  5. Development of a Functionally Minimized Mutant of the R3C Ligase Ribozyme Offers Insight into the Plausibility of the RNA World Hypothesis

    PubMed Central

    Kurihara, Eri; Uchida, Sayuri; Umehara, Takuya; Tamura, Koji

    2014-01-01

    The R3C ligase ribozyme is an artificial ligase ribozyme produced by modification of the ribozyme that lacks cytidine. Here, we attempted to modify the original R3C ribozyme (73 nucleotides) by reducing the number of nucleotides while maintaining the maximum possible catalytic efficiency. By partially deleting both the “grip” (P4 + P5) and “hammer” (P3) stem-loops, we found the critical border to retain activity comparable to that of full-length R3C. The three-way junction structure was necessary to maintain enzymatic function and the stability of the “grip” (P4 + P5) stem had a large influence on the catalytic activity of R3C. The final minimized ribozyme we obtained comprised ~50 nucleotides, comparable to the estimated length of prebiotically synthesized RNA. Our findings suggest that the autocatalytic function in ribozymes is indeed possible to obtain using sequence lengths achievable with prebiotic synthesis. PMID:25256424

  6. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers during a backpacking expedition by a single subject.

    PubMed

    DeVoe, Dale

    2004-10-01

    This study compared the RT3 Research Tracker accelerometer and the Tritrac R3D accelerometer in a field setting. A six-day backpacking expedition (122.4 km in length) was completed by a single subject in the Grand Canyon National Park, Arizona. The overall correlation between the counts of vector magnitude activity for the RT3 and R3D was moderate (r =.75, p<.001), with the overall calculated bias [mean difference (RT3 minus R3D) and standard deviation of the differences] across all six days estimated at 235+/-436 vector magnitude activity counts. However, agreement between the instruments is problematic; the RT3 might be 201 activity counts below or 671 activity counts above the R3D in assessing physical activity during backpacking.

  7. Cluster headache

    PubMed Central

    Leroux, Elizabeth; Ducros, Anne

    2008-01-01

    Cluster headache (CH) is a primary headache disease characterized by recurrent short-lasting attacks (15 to 180 minutes) of excruciating unilateral periorbital pain accompanied by ipsilateral autonomic signs (lacrimation, nasal congestion, ptosis, miosis, lid edema, redness of the eye). It affects young adults, predominantly males. Prevalence is estimated at 0.5–1.0/1,000. CH has a circannual and circadian periodicity, attacks being clustered (hence the name) in bouts that can occur during specific months of the year. Alcohol is the only dietary trigger of CH, strong odors (mainly solvents and cigarette smoke) and napping may also trigger CH attacks. During bouts, attacks may happen at precise hours, especially during the night. During the attacks, patients tend to be restless. CH may be episodic or chronic, depending on the presence of remission periods. CH is associated with trigeminovascular activation and neuroendocrine and vegetative disturbances, however, the precise cautive mechanisms remain unknown. Involvement of the hypothalamus (a structure regulating endocrine function and sleep-wake rhythms) has been confirmed, explaining, at least in part, the cyclic aspects of CH. The disease is familial in about 10% of cases. Genetic factors play a role in CH susceptibility, and a causative role has been suggested for the hypocretin receptor gene. Diagnosis is clinical. Differential diagnoses include other primary headache diseases such as migraine, paroxysmal hemicrania and SUNCT syndrome. At present, there is no curative treatment. There are efficient treatments to shorten the painful attacks (acute treatments) and to reduce the number of daily attacks (prophylactic treatments). Acute treatment is based on subcutaneous administration of sumatriptan and high-flow oxygen. Verapamil, lithium, methysergide, prednisone, greater occipital nerve blocks and topiramate may be used for prophylaxis. In refractory cases, deep-brain stimulation of the hypothalamus and

  8. Formation of Cluster Complexes by Cluster-Cluster-Collisions

    NASA Astrophysics Data System (ADS)

    Ichihashi, Masahiko; Odaka, Hideho

    2015-03-01

    Multi-element clusters are interested in their chemical and physical properties, and it is expected that they are utilized as catalysts, for example. Their properties critically depend on the size, composition and atomic ordering, and it should be important to adjust the above parameters for their functionality. One of the ways to form a multi-element cluster is to employ a low-energy collision between clusters. Here, we show characteristic results obtained in the collision between a neutral Ar cluster and a size-selected Co cluster ion. Low-energy collision experiment was accomplished by using a newly developed merging-beam apparatus. Cobalt cluster ions were produced by laser ablation, and mass-selected. On the other hand, argon clusters were prepared by the supersonic expansion of Ar gas. Both cluster beams were merged together in an ion guide, and ionic cluster complexes were mass-analyzed. In the collision of Co2+ and ArN, Co2Arn+ (n = 1 - 30) were observed, and the total intensity of Co2Arn+ (n >= 1) is inversely proportional to the relative velocity between Co2+ and ArN. This suggests that the charge-induced dipole interaction between Co2+ and a neutral Ar cluster is dominant in the formation of the cluster complex, Co2+Arn.

  9. Comprehensive behavioral phenotyping of ryanodine receptor type 3 (RyR3) knockout mice: decreased social contact duration in two social interaction tests.

    PubMed

    Matsuo, Naoki; Tanda, Koichi; Nakanishi, Kazuo; Yamasaki, Nobuyuki; Toyama, Keiko; Takao, Keizo; Takeshima, Hiroshi; Miyakawa, Tsuyoshi

    2009-01-01

    Dynamic regulation of the intracellular Ca2+ concentration is crucial for various neuronal functions such as synaptic transmission and plasticity, and gene expression. Ryanodine receptors (RyRs) are a family of intracellular calcium release channels that mediate calcium-induced calcium release from the endoplasmic reticulum. Among the three RyR isoforms, RyR3 is preferentially expressed in the brain especially in the hippocampus and striatum. To investigate the behavioral effects of RyR3 deficiency, we subjected RyR3 knockout (RyR3-/-) mice to a battery of behavioral tests. RyR3-/- mice exhibited significantly decreased social contact duration in two different social interaction tests, where two mice can freely move and make contacts with each other. They also exhibited hyperactivity and mildly impaired prepulse inhibition and latent inhibition while they did not show significant abnormalities in motor function and working and reference memory tests. These results indicate that RyR3 has an important role in locomotor activity and social behavior.

  10. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis

    PubMed Central

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  11. The soybean R2R3 MYB transcription factor GmMYB100 negatively regulates plant flavonoid biosynthesis.

    PubMed

    Yan, Junhui; Wang, Biao; Zhong, Yunpeng; Yao, Luming; Cheng, Linjing; Wu, Tianlong

    2015-09-01

    Soybean flavonoids, a group of important signaling molecules in plant-environment interaction, ubiquitously exist in soybean and are tightly regulated by many genes. Here we reported that GmMYB100, a gene encoding a R2R3 MYB transcription factor, is involved in soybean flavonoid biosynthesis. GmMYB100 is mainly expressed in flowers, leaves and immature embryo, and its level is decreased after pod ripening. Subcellular localization assay indicates that GmMYB100 is a nuclear protein. GmMYB100 has transactivation ability revealed by a yeast functional assay; whereas bioinformatic analysis suggests that GmMYB100 has a negative function in flavonoid biosynthesis. GmMYB100-overexpression represses the transcript levels of flavonoid-related genes in transgenic soybean hairy roots and Arabidopsis, and inhibits isoflavonoid (soybean) and flavonol (Arabidopsis) production in transgenic plants. Furthermore, the transcript levels of six flavonoid-related genes and flavonoid (isoflavonoid and flavone aglycones) accumulation are elevated in the GmMYB100-RNAi transgenic hairy roots. We also demonstrate that GmMYB100 protein depresses the promoter activities of soybean chalcone synthase and chalcone isomerase. These findings indicate that GmMYB100 is a negative regulator in soybean flavonoid biosynthesis pathway.

  12. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion

    PubMed Central

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Phan Tran, Lam-Son; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  13. Ab initio study of the one- and two-photon circular dichroism of R-(+)-3-methyl-cyclopentanone

    NASA Astrophysics Data System (ADS)

    Rizzo, Antonio; Lin, Na; Ruud, Kenneth

    2008-04-01

    One- and two-photon circular dichroism spectra of R-(+)-3-methyl-cyclopentanone, a system that has been the subject of recent experimental studies of (2+1) resonance-enhanced multiphoton ionization circular dichroism, have been calculated with an origin-invariant density functional theory approximation in the region of the lowest electronic excited states, both for the gas phase and for a selection of solvents. A polarizable continuum model is used in the calculations performed on the solvated system. Two low-lying conformers are analyzed, and a comparison of the intensities and characteristic features is made with the corresponding two-photon absorption for each species, also for the Boltzmann-averaged spectra. The effect of the choice of geometry, basis set, and exchange-correlation functional is carefully analyzed. It is found that a density functional theory approach using the Coulomb attenuating method variant of Becke's three-parameter exchange and the Lee-Yang-Parr correlation functionals with correlation-consistent basis sets of double-zeta quality can reproduce the experimental electronic circular dichroism spectra very well. The features appearing in experiment are characterized in terms of molecular excitations, and the differences in the response of each state in the one- and two-photon processes are highlighted.

  14. Time Profile of Cosmic Radiation Exposure During the EXPOSE-E Mission: The R3DE Instrument

    PubMed Central

    Horneck, Gerda; Häder, Donat-Peter; Schuster, Martin; Richter, Peter; Lebert, Michael; Demets, Rene

    2012-01-01

    Abstract The aim of this paper is to present the time profile of cosmic radiation exposure obtained by the Radiation Risk Radiometer-Dosimeter during the EXPOSE-E mission in the European Technology Exposure Facility on the International Space Station's Columbus module. Another aim is to make the obtained results available to other EXPOSE-E teams for use in their data analysis. Radiation Risk Radiometer-Dosimeter is a low-mass and small-dimension automatic device that measures solar radiation in four channels and cosmic ionizing radiation as well. The main results of the present study include the following: (1) three different radiation sources were detected and quantified—galactic cosmic rays (GCR), energetic protons from the South Atlantic Anomaly (SAA) region of the inner radiation belt, and energetic electrons from the outer radiation belt (ORB); (2) the highest daily averaged absorbed dose rate of 426 μGy d−1 came from SAA protons; (3) GCR delivered a much smaller daily absorbed dose rate of 91.1 μGy d−1, and the ORB source delivered only 8.6 μGy d−1. The analysis of the UV and temperature data is a subject of another article (Schuster et al., 2012). Key Words: Ionizing radiation—R3D—ISS. Astrobiology 12, 403–411. PMID:22680687

  15. Genome-wide analysis of citrus R2R3MYB genes and their spatiotemporal expression under stresses and hormone treatments.

    PubMed

    Xie, Rangjin; Li, Yongjie; He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development.

  16. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2.

    PubMed

    Hu, Ruyi; Liu, Wenming; Qiu, Xingfeng; Lin, Zhenghe; Xie, Yan; Hong, Xingya; Paerhati, Reyila; Qi, Zhongquan; Zhuang, Guohong; Liu, Zhongchen

    2016-03-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC.

  17. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2

    PubMed Central

    HU, RUYI; LIU, WENMING; QIU, XINGFENG; LIN, ZHENGHE; XIE, YAN; HONG, XINGYA; PAERHATI, REYILA; QI, ZHONGQUAN; ZHUANG, GUOHONG; LIU, ZHONGCHEN

    2016-01-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC. PMID:26998086

  18. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis.

    PubMed

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-06-01

    BACKGROUND DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. MATERIAL AND METHODS Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. RESULTS Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33-18.05), TNM stage (OR=5.51, 95% CI: 2.83-10.71), differentiation (OR=4.16, 95% CI: 2.28-7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16-10.9), age (OR=0.85, 95% CI: 0.51-1.44), and overall survival time (OR=1.84, 95% CI: 0.58-5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. CONCLUSIONS Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation.

  19. Endocrine and metabolic changes in neonatal calves in response to growth hormone and long-R3-insulin-like growth factor-I administration.

    PubMed

    Hammon, H; Blum, J W

    1998-01-01

    Postnatal growth is primarily controlled by growth hormone (GH) and insulin-like growth factor-I (IGF-I). We have studied effects of recombinant bovine GH (rbGH) and Long-R3-insulin-like growth factor-I (Long-R3-IGF-I) on metabolic and endocrine characteristics of neonatal calves. Group GrC (control) was fed colostrum as first meal and then milk replacer up to day 7. Groups GrIGFf, GrIGFi and GrGH were fed as GrC. In group GrIGFf, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was fed together with colostrum or milk replacer and in group GrIGFi, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was injected subcutaneously at times of feeding. Calves of group GrGH were injected rbGH (1 mg/[kg x day, s.c.], twice daily for 7 days) at times of feeding. While orally administered Long-R3-IGF-I had no effects, subcutaneously administered Long-R3-IGF-I lowered plasma glucose and insulin concentrations (p < 0.05). In group GrGH, day-2 postprandial plasma insulin concentrations were increased more than in Long-R3-IGF-I-treated groups (p < 0.05) and day-2 postprandial prolactin responses were greater in group GrGH than in controls (p < 0.05). Other traits (lactic acid, nonesterified fatty acids, glucagon, cortisol, thyroxine and 3.5.3'-triiodothyronine) exhibited age-dependent changes, but were not significantly affected by rbGH or Long-R3-IGF-I. The study shows, that parenteral, but not oral, Long-R3-IGF-I affects plasma glucose and insulin concentrations, and that rbGH transiently influences plasma prolactin concentrations in neonatal calves.

  20. H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TβR3 in placentae with fetal growth restriction

    PubMed Central

    Lu, Lingeng; Men, Yi; Geng, Tingting; Buhimschi, Catalin S.; Buhimschi, Irina A.; Bukowski, Radek; Guller, Seth; Paidas, Michael; Huang, Yingqun

    2016-01-01

    Fetal growth restriction (FGR) is a well-recognized risk factor for perinatal mortality and morbidity, as well as neurodevelopmental impairment and adulthood onset disorders. Here we report that the H19 long noncoding RNA (lncRNA) is significantly decreased in placentae from pregnancies with FGR. Downregulation of H19 leads to reduced migration and invasion of extravillous trophoblast (EVT) cells in vitro. This is consistent with reduced trophoblast invasion that has been observed in FGR. Genome-scale transcriptome profiling of EVT cells reveals significantly decreased expression of the type III TGF-β receptor (TβR3) following H19 knockdown. Decreased TβR3 expression is also seen in FGR placentae. TβR3 repression decreases EVT cell migration and invasion, owing to impaired TGF-β signaling through a non-canonical TGF-β signaling pathway. Further, we identify TβR3 as a novel regulatory target of microRNA let-7. We propose that dysregulation of this newly identified H19/TβR3-mediated regulatory pathway may contribute to the molecular mechanism of FGR. Our findings are the first to show a lncRNA-based mechanism of FGR, holding promise for the development of novel predictive, diagnostic, and therapeutic modalities for FGR. PMID:27223264

  1. H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TβR3 in placentae with fetal growth restriction.

    PubMed

    Zuckerwise, Lisa; Li, Jing; Lu, Lingeng; Men, Yi; Geng, Tingting; Buhimschi, Catalin S; Buhimschi, Irina A; Bukowski, Radek; Guller, Seth; Paidas, Michael; Huang, Yingqun

    2016-06-21

    Fetal growth restriction (FGR) is a well-recognized risk factor for perinatal mortality and morbidity, as well as neurodevelopmental impairment and adulthood onset disorders. Here we report that the H19 long noncoding RNA (lncRNA) is significantly decreased in placentae from pregnancies with FGR. Downregulation of H19 leads to reduced migration and invasion of extravillous trophoblast (EVT) cells in vitro. This is consistent with reduced trophoblast invasion that has been observed in FGR. Genome-scale transcriptome profiling of EVT cells reveals significantly decreased expression of the type III TGF-β receptor (TβR3) following H19 knockdown. Decreased TβR3 expression is also seen in FGR placentae. TβR3 repression decreases EVT cell migration and invasion, owing to impaired TGF-β signaling through a non-canonical TGF-β signaling pathway. Further, we identify TβR3 as a novel regulatory target of microRNA let-7. We propose that dysregulation of this newly identified H19/TβR3-mediated regulatory pathway may contribute to the molecular mechanism of FGR. Our findings are the first to show a lncRNA-based mechanism of FGR, holding promise for the development of novel predictive, diagnostic, and therapeutic modalities for FGR.

  2. Oligo-(R)-3-hydroxybutyrate modification of sorting signal enables pore formation by Escherichia coli OmpA.

    PubMed

    Negoda, A; Negoda, E; Reusch, R N

    2010-08-01

    The outer membrane protein A (OmpA) of Escherichia coli is a well-known model for protein targeting and protein folding. Wild-type OmpA, isolated either from cytoplasmic inclusion bodies or from outer membranes, forms narrow pores of approximately 80 pS in planar lipid bilayers at room temperature. The pores are well structured with narrow conductance range when OmpA is isolated using lithium dodecyl sulfate (LDS) or RapiGest surfactant but display irregular conductance when OmpA is isolated with urea or guanidine hydrochloride. Previous studies have shown that serine residues S163 and S167 of the sorting signal of OmpA (residues 163-169), i.e., the essential sequence for outer membrane incorporation, are covalently modified by oligomers of (R)-3-hydroxybutyrate (cOHB). Here we find that single-mutants S163 and S167 of OmpA, which still contain cOHB on one serine of the sorting signal, form narrow pores in planar lipid bilayers at room temperature with lower and more irregular conductance than wild-type OmpA, whereas double mutants S163:S167 and S163:V166 of OmpA, with no cOHB on the sorting signal, are unable to form stable pores in planar lipid bilayers. Our results indicate that modification of serines in the sorting signal of OmpA by cOHB in the cytoplasm enables OmpA to incorporate into lipid bilayers at room temperature as a narrow pore. They further suggest that cOHB modification may be an important factor in protein targeting and protein folding.

  3. Monoclonal antibodies for structure-function studies of (R)-3-hydroxybutyrate dehydrogenase, a lipid-dependent membrane-bound enzyme.

    PubMed Central

    Adami, P; Duncan, T M; McIntyre, J O; Carter, C E; Fu, C; Melin, M; Latruffe, N; Fleischer, S

    1993-01-01

    Monoclonal antibodies (mAbs) have been used to study structure-function relationships of (R)-3-hydroxybutyrate dehydrogenase (BDH) (EC 1.1.1.30), a lipid-requiring mitochondrial membrane enzyme with an absolute and specific requirement for phosphatidylcholine (PC) for enzymic activity. The purified enzyme (apoBDH, devoid of phospholipid and thereby inactive) can be re-activated with preformed phospholipid vesicles containing PC or by short-chain soluble PC. Five of six mAbs cross-react with BDH from bovine heart and rat liver, including two mAbs to conformational epitopes. One mAb was found to be specific for the C-terminal sequence of BDH and served to: (1) map endopeptidase cleavage and epitope sites on BDH; and (2) demonstrate that the C-terminus is essential for the activity of BDH. Carboxypeptidase cleavage of only a few (< or = 14) C-terminal amino acids from apoBDH (as detected by the loss of C-terminal epitope for mAb 3-10A) prevents activation by either bilayer or soluble PC. Further, for BDH in bilayers containing PC, the C-terminus is protected from carboxy-peptidase cleavage, whereas in bilayers devoid of PC the C-terminus is cleaved, and subsequent activation by PC is precluded. We conclude that: (1) the C-terminus of BDH is essential for enzymic activity, consistent with the prediction, from primary sequence analysis, that the PC-binding site is in the C-terminal domain of BDH; and (2) the allosteric activation of BDH by PC in bilayers protects the C-terminus from carboxypeptidase cleavage, indicative of a PC-induced conformational change in the enzyme. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7686368

  4. Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp.1[OPEN

    PubMed Central

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-01-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  5. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    PubMed

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides.

  6. The somatotropic axis in neonatal calves can be modulated by nutrition, growth hormone, and Long-R3-IGF-I.

    PubMed

    Hammon, H; Blum, J W

    1997-07-01

    Effects on the somatotropic axis [plasma levels of insulin-like growth factors (IGFs) I and II, IGF-binding proteins (IGFBPs), and growth hormone (GH)] of feeding different amounts of colostrum or milk replacer, of Long-R3-IGF-I (administered subcutaneously or orally; 50 micrograms.kg body wt-1.day-1 for 7 days), and of subcutaneously injected recombinant bovine GH (rbGH; 1 mg.kg body wt-1.day-1 for 7 days) were evaluated in calves during the 1st wk of life. Plasma Long-R3-IGF-I increased after subcutaneous application but not with the oral dose. Endogenous IGF-I was higher in calves fed colostrum six times compared with those fed only milk replacer. Native IGF-I was highest in rbGH-injected calves but was lowered by the subcutaneous injection of Long-R3-IGF-I. IGF-II concentrations were not modified by any of the treatments. IGFBP-2 increased in calves fed only milk replacer and those receiving subcutaneous Long-R3-IGF-I. GH was not modulated by differences in nutrition but increased after rbGH administration and similarly in all groups after intravenous injection of GH-releasing factor analog GRF-(1-29). Parenteral administration of Long-R3-IGF-I decreased GH concentration but did not affect the secretory pattern. The data demonstrate that the somatotrophic axis is basically functioning in neonatal calves and is influenced by nutrition, GH, and Long-R3-IGF-I.

  7. Relativistic electron fluxes and dose rate variations during April-May 2010 geomagnetic disturbances in the R3DR data on ISS

    NASA Astrophysics Data System (ADS)

    Dachev, Ts. P.; Tomov, B. T.; Matviichuk, Yu. N.; Dimitrov, Pl. G.; Bankov, N. G.; Reitz, G.; Horneck, G.; Häder, D.-P.; Lebert, M.; Schuster, M.

    2012-07-01

    Space radiation has been monitored successfully using the Radiation Risks Radiometer-Dosimeter (R3D) installed at the ESA EXPOSE-R (R3DR) facility outside of the Russian Zvezda module of the International Space Station (ISS) between March 2009 and January 2011. R3DR is a Liulin type spectrometer-dosimeter with a single Si PIN detector 2 cm2 of area and 0.3 mm thick. The R3DR instrument accumulated about 2 million measurements of the absorbed dose rate and flux of 10 s resolution. The total external and internal shielding before the detector of R3DR device is 0.41 g cm-2. The calculated stopping energy of normally incident particles to the detector is 0.78 MeV for electrons and 15.8 MeV for protons. After the Coronal Mass Ejection (CME) at 09:54 UTC on 3 April 2010, a shock was observed at the ACE spacecraft at 0756 UTC on 5 April, which led to a sudden impulse on Earth at 08:26 UTC. Nevertheless, while the magnetic substorms on 5 and 6 of April were moderate; the second largest in history of GOES fluence of electrons with energy >2 MeV was measured. The R3DR data show a relatively small amount of relativistic electrons on 5 April. The maximum dose rate of 2323 μGy day-1 was reached on 7 April; by 9 April, a dose of 6600 μGy was accumulated. By the end of the period on 7 May 2010 a total dose of 11,587 μGy was absorbed. Our data were compared with AE-8 MIN, CRESS and ESA-SEE1 models using SPENVIS and with similar observations on American, Japanese and Russian satellites.

  8. PREFACE: Nuclear Cluster Conference; Cluster'07

    NASA Astrophysics Data System (ADS)

    Freer, Martin

    2008-05-01

    The Cluster Conference is a long-running conference series dating back to the 1960's, the first being initiated by Wildermuth in Bochum, Germany, in 1969. The most recent meeting was held in Nara, Japan, in 2003, and in 2007 the 9th Cluster Conference was held in Stratford-upon-Avon, UK. As the name suggests the town of Stratford lies upon the River Avon, and shortly before the conference, due to unprecedented rainfall in the area (approximately 10 cm within half a day), lay in the River Avon! Stratford is the birthplace of the `Bard of Avon' William Shakespeare, and this formed an intriguing conference backdrop. The meeting was attended by some 90 delegates and the programme contained 65 70 oral presentations, and was opened by a historical perspective presented by Professor Brink (Oxford) and closed by Professor Horiuchi (RCNP) with an overview of the conference and future perspectives. In between, the conference covered aspects of clustering in exotic nuclei (both neutron and proton-rich), molecular structures in which valence neutrons are exchanged between cluster cores, condensates in nuclei, neutron-clusters, superheavy nuclei, clusters in nuclear astrophysical processes and exotic cluster decays such as 2p and ternary cluster decay. The field of nuclear clustering has become strongly influenced by the physics of radioactive beam facilities (reflected in the programme), and by the excitement that clustering may have an important impact on the structure of nuclei at the neutron drip-line. It was clear that since Nara the field had progressed substantially and that new themes had emerged and others had crystallized. Two particular topics resonated strongly condensates and nuclear molecules. These topics are thus likely to be central in the next cluster conference which will be held in 2011 in the Hungarian city of Debrechen. Martin Freer Participants and Cluster'07

  9. Integral potential method for a transmission problem with Lipschitz interface in R3 for the Stokes and Darcy-Forchheimer-Brinkman PDE systems

    NASA Astrophysics Data System (ADS)

    Kohr, Mirela; Lanza de Cristoforis, Massimo; Mikhailov, Sergey E.; Wendland, Wolfgang L.

    2016-10-01

    The purpose of this paper is to obtain existence and uniqueness results in weighted Sobolev spaces for transmission problems for the nonlinear Darcy-Forchheimer-Brinkman system and the linear Stokes system in two complementary Lipschitz domains in R3, one of them is a bounded Lipschitz domain {Ω} with connected boundary, and the other one is the exterior Lipschitz domain R3 setminus overline{Ω}. We exploit a layer potential method for the Stokes and Brinkman systems combined with a fixed point theorem in order to show the desired existence and uniqueness results, whenever the given data are suitably small in some weighted Sobolev spaces and boundary Sobolev spaces.

  10. Cluster Physics with Merging Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Molnar, Sandor

    Collisions between galaxy clusters provide a unique opportunity to study matter in a parameter space which cannot be explored in our laboratories on Earth. In the standard ΛCDM model, where the total density is dominated by the cosmological constant (Λ) and the matter density by cold dark matter (CDM), structure formation is hierarchical, and clusters grow mostly by merging. Mergers of two massive clusters are the most energetic events in the universe after the Big Bang, hence they provide a unique laboratory to study cluster physics. The two main mass components in clusters behave differently during collisions: the dark matter is nearly collisionless, responding only to gravity, while the gas is subject to pressure forces and dissipation, and shocks and turbulence are developed during collisions. In the present contribution we review the different methods used to derive the physical properties of merging clusters. Different physical processes leave their signatures on different wavelengths, thus our review is based on a multifrequency analysis. In principle, the best way to analyze multifrequency observations of merging clusters is to model them using N-body/HYDRO numerical simulations. We discuss the results of such detailed analyses. New high spatial and spectral resolution ground and space based telescopes will come online in the near future. Motivated by these new opportunities, we briefly discuss methods which will be feasible in the near future in studying merging clusters.

  11. Positive selection and functional divergence of R2R3-MYB paralogous genes expressed in inflorescence buds of Scutellaria species (Labiatae).

    PubMed

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-03-13

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification.

  12. Novel R2R3-MYB transcription factors from Prunus Americana regulates differential patterns of anthocyanin accumulation in tobacco and citrus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The levels of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  13. Gold-bismuth clusters.

    PubMed

    Martínez, Ana

    2014-08-07

    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  14. Polymorphisms in the carcinogen detoxification genes CYB5A and CYB5R3 and breast cancer risk in African American women

    PubMed Central

    Blanke, Kristina L.; Sacco, James C.; Millikan, Robert C.; Olshan, Andrew F.; Luo, Jingchun; Trepanier, Lauren A.

    2014-01-01

    Purpose Cytochrome b5 (encoded by CYB5A) and NADH cytochrome b5 reductase (encoded by CYB5R3) detoxify aromatic and heterocyclic amine mammary carcinogens found in cigarette smoke. We hypothesized that CYB5A and CYB5R3 polymorphisms would be associated with breast cancer risk in women. Methods We characterized the prevalence of 18 CYB5A and CYB5R3 variants in genomic DNA from African American (AfrAm) and Caucasian (Cauc) women from the Carolina Breast Cancer Study population (1946 cases and 1747 controls), and determined their associations with breast cancer risk, with effect modification by smoking. Results A CYB5R3 variant, I1M+6T (rs8190370) was significantly more common in breast cancer cases (MAF 0.0238) compared to controls (0.0169, P =0.039); this was attributable to a higher MAF in AfrAm cases (0.0611) compared to AfrAm controls (0.0441, P=0.046; adjusted OR 1.41, CI 0.98-2.04; P=0.062). When smoking was considered, I1M+6T was more strongly associated with breast cancer risk in AfrAm smokers (adjusted OR 2.10, 1.08-4.07; P=0.028) compared to never-smokers (OR=1.21; 0.77-1.88; P for interaction=0.176). I1M+6T and three additional CYB5R3 variants, -251T, I8-1676C, and *392C, as well as two CYB5A variants, 13G and I2-992T, were significantly more common in AfrAms compared to Caucs. Conclusions CYB5R3 I1M+6 C>T should be considered in future molecular epidemiologic studies of breast cancer risk in AfrAms. Further, variants in CYB5A and CYB5R3 should be considered in the evaluation of other tumors in AfrAms that are associated with aromatic and heterocyclic amine exposures, to include prostate, bladder, and colon cancers. PMID:25225034

  15. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis

    PubMed Central

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    Background DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. Material/Methods Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. Results Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33–18.05), TNM stage (OR=5.51, 95% CI: 2.83–10.71), differentiation (OR=4.16, 95% CI: 2.28–7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16–10.9), age (OR=0.85, 95% CI: 0.51–1.44), and overall survival time (OR=1.84, 95% CI: 0.58–5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. Conclusions Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  16. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  17. Application of machine learning methods to histone methylation ChIP-Seq data reveals H4R3me2 globally represses gene expression

    PubMed Central

    2010-01-01

    Background In the last decade, biochemical studies have revealed that epigenetic modifications including histone modifications, histone variants and DNA methylation form a complex network that regulate the state of chromatin and processes that depend on it including transcription and DNA replication. Currently, a large number of these epigenetic modifications are being mapped in a variety of cell lines at different stages of development using high throughput sequencing by members of the ENCODE consortium, the NIH Roadmap Epigenomics Program and the Human Epigenome Project. An extremely promising and underexplored area of research is the application of machine learning methods, which are designed to construct predictive network models, to these large-scale epigenomic data sets. Results Using a ChIP-Seq data set of 20 histone lysine and arginine methylations and histone variant H2A.Z in human CD4+ T-cells, we built predictive models of gene expression as a function of histone modification/variant levels using Multilinear (ML) Regression and Multivariate Adaptive Regression Splines (MARS). Along with extensive crosstalk among the 20 histone methylations, we found H4R3me2 was the most and second most globally repressive histone methylation among the 20 studied in the ML and MARS models, respectively. In support of our finding, a number of experimental studies show that PRMT5-catalyzed symmetric dimethylation of H4R3 is associated with repression of gene expression. This includes a recent study, which demonstrated that H4R3me2 is required for DNMT3A-mediated DNA methylation--a known global repressor of gene expression. Conclusion In stark contrast to univariate analysis of the relationship between H4R3me2 and gene expression levels, our study showed that the regulatory role of some modifications like H4R3me2 is masked by confounding variables, but can be elucidated by multivariate/systems-level approaches. PMID:20653935

  18. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  19. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar.

  20. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion.

  1. Nuclear Clusters in Astrophysics

    NASA Astrophysics Data System (ADS)

    Kubono, S.; Binh, Dam N.; Hayakawa, S.; Hashimoto, H.; Kahl, D.; Wakabayashi, Y.; Yamaguchi, H.; Teranishi, T.; Iwasa, N.; Komatsubara, T.; Kato, S.; Khiem, Le H.

    2010-03-01

    The role of nuclear clustering is discussed for nucleosynthesis in stellar evolution with Cluster Nucleosynthesis Diagram (CND) proposed before. Special emphasis is placed on α-induced stellar reactions together with molecular states for O and C burning.

  2. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  3. [Pathophysiology of cluster headache].

    PubMed

    Donnet, Anne

    2015-11-01

    The aetiology of cluster headache is partially unknown. Three areas are involved in the pathogenesis of cluster headache: the trigeminal nociceptive pathways, the autonomic system and the hypothalamus. The cluster headache attack involves activation of the trigeminal autonomic reflex. A dysfunction located in posterior hypothalamic gray matter is probably pivotal in the process. There is a probable association between smoke exposure, a possible genetic predisposition and the development of cluster headache.

  4. Clustering algorithm studies

    NASA Astrophysics Data System (ADS)

    Graf, Norman A.

    2001-07-01

    An object-oriented framework for undertaking clustering algorithm studies has been developed. We present here the definitions for the abstract Cells and Clusters as well as the interface for the algorithm. We intend to use this framework to investigate the interplay between various clustering algorithms and the resulting jet reconstruction efficiency and energy resolutions to assist in the design of the calorimeter detector.

  5. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  6. Star cluster dynamics.

    PubMed

    Vesperini, Enrico

    2010-02-28

    Dynamical evolution plays a key role in shaping the current properties of star clusters and star cluster systems. A detailed understanding of the effects of evolutionary processes is essential to be able to disentangle the properties that result from dynamical evolution from those imprinted at the time of cluster formation. In this review, I focus my attention on globular clusters, and review the main physical ingredients driving their early and long-term evolution, describe the possible evolutionary routes and show how cluster structure and stellar content are affected by dynamical evolution.

  7. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  8. Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli

    SciTech Connect

    Nie,Y.; Vigues, S.; Hobbs, J.; Conn, G.; Munger, S.

    2005-01-01

    The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice. Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.

  9. Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco.

    PubMed

    Omer, Sumita; Kumar, Santosh; Khan, Bashir M

    2013-01-01

    KEY MESSAGE : LlMYB1 , a subgroup 4 R2R3-type MYB transcription factor gene from Leucaena leucocephala appears to be a repressor of lignin biosynthesis pathway by regulating the transcription of general phenylpropanoid pathway genes. R2R3MYB transcription factors are known to play a wide role in regulating the phenylpropanoid pathway in plants. In this study, we report isolation, cloning and characterization of an R2R3MYB transcription factor gene (LlMYB1) from an economically important tree species, Leucaena leucocephala. LlMYB1 consists of 705 bp coding sequence corresponding to 235 amino acids. Sequence alignment revealed that the N-terminal (MYB) domain of the gene shares up to 95 % similarity with subgroup 4 (Sg4) members of R2R3Myb gene family functionally known to be lignin repressors. Highly divergent C-terminal region of the gene carried an ERF-associated amphiphilic repression (EAR) motif, another characteristic of the Sg4. The gene was phylogenetically grouped closest with AmMYB308, a known repressor of monolignol biosynthetic pathway genes. Spatio-temporal expression studies at different ages of seedlings using quantitative real-time PCR (QRT-PCR) showed highest transcript level of the gene in 10 day old stem tissues. Over-expression of the gene in transgenic tobacco showed statistically significant decline in the transcript levels of the general phenylpropanoid pathway genes and reduction in lignin content. Our study suggests that LlMYB1 might be playing the role of a repressor of lignin biosynthesis in L. leucocephala.

  10. The Brassica napus receptor-like protein RLM2 is encoded by a second allele of the LepR3/Rlm2 blackleg resistance locus.

    PubMed

    Larkan, Nicholas J; Ma, Lisong; Borhan, Mohammad Hossein

    2015-09-01

    Leucine-rich repeat receptor-like proteins (LRR-RLPs) are highly adaptable parts of the signalling apparatus for extracellular detection of plant pathogens. Resistance to blackleg disease of Brassica spp. caused by Leptosphaeria maculans is largely governed by host race-specific R-genes, including the LRR-RLP gene LepR3. The blackleg resistance gene Rlm2 was previously mapped to the same genetic interval as LepR3. In this study, the LepR3 locus of the Rlm2 Brassica napus line 'Glacier DH24287' was cloned, and B. napus transformants were analysed for recovery of the Rlm2 phenotype. Multiple B. napus, B. rapa and B. juncea lines were assessed for sequence variation at the locus. Rlm2 was found to be an allelic variant of the LepR3 LRR-RLP locus, conveying race-specific resistance to L. maculans isolates harbouring AvrLm2. Several defence-related LRR-RLPs have previously been shown to associate with the RLK SOBIR1 to facilitate defence signalling. Bimolecular fluorescence complementation (BiFC) and co-immunoprecipitation of RLM2-SOBIR1 studies revealed that RLM2 interacts with SOBIR1 of Arabidopsis thaliana when co-expressed in Nicotiana benthamiana. The interaction of RLM2 with AtSOBIR1 is suggestive of a conserved defence signalling pathway between B. napus and its close relative A. thaliana.

  11. The structures of T6, T3R3 and R6 bovine insulin: combining X-ray diffraction and absorption spectroscopy.

    PubMed

    Frankær, Christian Grundahl; Knudsen, Marianne Vad; Norén, Katarina; Nazarenko, Elena; Ståhl, Kenny; Harris, Pernille

    2012-10-01

    The crystal structures of three conformations, T(6), T(3)R(3) and R(6), of bovine insulin were solved at 1.40, 1.30 and 1.80 Å resolution, respectively. All conformations crystallized in space group R3. In contrast to the T(6) and T(3)R(3) structures, different conformations of the N-terminal B-chain residue PheB1 were observed in the R(6) insulin structure, resulting in an eightfold doubling of the unit-cell volume upon cooling. The zinc coordination in each conformation was studied by X-ray absorption spectroscopy (XAS), including both EXAFS and XANES. Zinc adopts a tetrahedral coordination in all R(3) sites and an octahedral coordination in T(3) sites. The coordination distances were refined from XAS with a standard deviation of <0.01 Å. In contrast to the distances determined from the medium-resolution crystal structures, the XAS results were in good agreement with similar coordination geometries found in small molecules, as well as in other high-resolution insulin structures. As the radiation dose for XRD experiments is two orders of magnitude higher compared with that of XAS experiments, the single crystals were exposed to a higher degree of radiation damage that affected the zinc coordination in the T(3) sites in particular. Furthermore, XANES spectra for the zinc sites in T(6) and R(6) insulin were successfully calculated using finite difference methods and the bond distances and angles were optimized from a quantitative XANES analysis.

  12. Metabolism of myo-[2-3H]Inositol and scyllo-[R-3H]Inositol in Ripening Wheat Kernels 1

    PubMed Central

    Sasaki, Ken; Loewus, Frank A.

    1980-01-01

    Injection of myo-[2-3H]inositol or scyllo-[R-3H]inositol into the peduncular cavity of wheat stalks about 2 to 4 weeks postanthesis led to rapid translocation into the spike and accumulation of label in developing kernels, especially the bran fraction. With myo-[2-3H]inositol, about 50 to 60% of the label was incorporated into high molecular weight cell wall substance in the region of the injection. That portion translocated to the kernels was utilized primarily for cell wall polysaccharide formation and phytate biosynthesis. A small amount was recovered as free myo-inositol and galactinol. When scyllo-[R-3H]inositol was supplied, most of the label was translocated into the developing kernels where it accumulated as free scyllo-inositol and O-α-d-galactopyranosyl-scyllo-inositol in approximately equal amount. None of the label from scyllo-[R-3H]inositol was utilized for either phytate biosynthesis or cell wall polysaccharide formation. PMID:16661513

  13. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    PubMed Central

    Görner, Christian; Hirte, Max; Huber, Stephanie; Schrepfer, Patrick; Brück, Thomas

    2015-01-01

    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus. Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an Escherichia coli based terpene production system, allowed efficient production of this olefinic macrocycle. To diversify the 3,7,18-dolabellatriene bioactivity we evaluated chemical and enzymatic methods for selective oxidation. Epoxidation by acetic peracid, which was formed in situ by a lipase catalyzed reaction of acetic acid with H2O2, provided efficient access to two monooxidized dolabellanes and to a novel di-epoxidated dolabellane species. These compounds could act as synthons en-route to new dolabellanes with diversified bioactivities. Furthermore, we demonstrate the almost quantitative 3,7,18-dolabellatriene conversion into the new, non-natural compound (1R,3E,7E,11S,12S,18R)-dolabella-3,7-diene-20-ol by hydroboration–oxidation with an enantiomeric excess of 94%, for the first time. PMID:26528263

  14. Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes.

    PubMed Central

    Meissner, R C; Jin, H; Cominelli, E; Denekamp, M; Fuertes, A; Greco, R; Kranz, H D; Penfield, S; Petroni, K; Urzainqui, A; Martin, C; Paz-Ares, J; Smeekens, S; Tonelli, C; Weisshaar, B; Baumann, E; Klimyuk, V; Marillonnet, S; Patel, K; Speulman, E; Tissier, A F; Bouchez, D; Jones, J J; Pereira, A; Wisman, E

    1999-01-01

    More than 92 genes encoding MYB transcription factors of the R2R3 class have been described in Arabidopsis. The functions of a few members of this large gene family have been described, indicating important roles for R2R3 MYB transcription factors in the regulation of secondary metabolism, cell shape, and disease resistance, and in responses to growth regulators and stresses. For the majority of the genes in this family, however, little functional information is available. As the first step to characterizing these genes functionally, the sequences of >90 family members, and the map positions and expression profiles of >60 members, have been determined previously. An important second step in the functional analysis of the MYB family, through a process of reverse genetics that entails the isolation of insertion mutants, is described here. For this purpose, a variety of gene disruption resources has been used, including T-DNA-insertion populations and three distinct populations that harbor transposon insertions. We report the isolation of 47 insertions into 36 distinct MYB genes by screening a total of 73 genes. These defined insertion lines will provide the foundation for subsequent detailed functional analyses for the assignment of specific functions to individual members of the R2R3 MYB gene family. PMID:10521515

  15. Cloning and Characterisation of (R)-3-hydroxyacyl-acyl Carrier Protein-coenzyme A Transferase Gene (phaG) from Pseudomonas sp. USM 4-55.

    PubMed

    Arsad, Hasni; Sudesh, Kumar; Nazalan, Najimudin; Muhammad, Tengku Sifzizul Tengku; Wahab, Habibah; Razip Samian, Mohd

    2009-12-01

    The (R)-3-hydroxyacyl-ACP-CoA transferase catalyses the conversion of (R)-3-hydroxyacyl-ACP to (R)-3-hydroxyacyl-CoA derivatives, which serves as the ultimate precursor for polyhydroxyalkanoate (PHA) polymerisation from unrelated substrates in pseudomonads. PhaG was found to be responsible for channelling precursors for polyhydroxyalkanoate (PHA) synthase from a de novo fatty acid biosynthesis pathway when cultured on carbohydrates, such as glucose or gluconate. The phaG gene was cloned from Pseudomonas sp. USM 4-55 using a homologous probe. The gene was located in a 3660 bp Sal I fragment (GenBank accession number EU305558). The open reading frame (ORF) was 885 bp long and encoded a 295 amino acid protein. The predicted molecular weight was 33251 Da, and it showed a 62% identity to the PhaG of Pseudomonas aeruginosa. The function of the cloned phaG of Pseudomonas sp. USM 4-55 was confirmed by complementation studies. Plasmid pBCS39, which harboured the 3660 bp Sal I fragment, was found to complement the PhaG-mutant heterologous host cell, Pseudomonas putida PhaGN-21. P. putida PhaGN-21, which harboured pBCS39, accumulated PHA that accounted for up to 18% of its cellular dry weight (CDW). P. putida PhaGN-21, which harboured the vector alone (PBBR1MCS-2), accumulated only 0.6% CDW of PHA.

  16. Fuzzy Subspace Clustering

    NASA Astrophysics Data System (ADS)

    Borgelt, Christian

    In clustering we often face the situation that only a subset of the available attributes is relevant for forming clusters, even though this may not be known beforehand. In such cases it is desirable to have a clustering algorithm that automatically weights attributes or even selects a proper subset. In this paper I study such an approach for fuzzy clustering, which is based on the idea to transfer an alternative to the fuzzifier (Klawonn and Höppner, What is fuzzy about fuzzy clustering? Understanding and improving the concept of the fuzzifier, In: Proc. 5th Int. Symp. on Intelligent Data Analysis, 254-264, Springer, Berlin, 2003) to attribute weighting fuzzy clustering (Keller and Klawonn, Int J Uncertain Fuzziness Knowl Based Syst 8:735-746, 2000). In addition, by reformulating Gustafson-Kessel fuzzy clustering, a scheme for weighting and selecting principal axes can be obtained. While in Borgelt (Feature weighting and feature selection in fuzzy clustering, In: Proc. 17th IEEE Int. Conf. on Fuzzy Systems, IEEE Press, Piscataway, NJ, 2008) I already presented such an approach for a global selection of attributes and principal axes, this paper extends it to a cluster-specific selection, thus arriving at a fuzzy subspace clustering algorithm (Parsons, Haque, and Liu, 2004).

  17. Alkali Metal Cluster Theory.

    NASA Astrophysics Data System (ADS)

    Chen, Jian

    Available from UMI in association with The British Library. Requires signed TDF. In this thesis, we apply the tight-binding Hubbard model to alkali metal clusters with Hartree-Fock self-consistent methods and perturbation methods for the numerical calculations. We have studied the relation between the equilibrium structures and the range of the hopping matrix elements in the Hubbard Hamiltonian. The results show that the structures are not sensitive to the interaction range but are determined by the number of valence electrons each atom has. Inertia tensors are used to analyse the symmetries of the clusters. The principal axes of the clusters are determined and they are the axes of rotational symmetries of clusters if the clusters have any. The eigenvalues of inertia tensors which are the indication of the deformation of clusters are compared between our model and the ellipsoidal jellium model. The agreement is good for large clusters. At a finite temperature, the thermal motion fluctuates the structures. We defined a fluctuation function with the distance matrix of a cluster. The fluctuation has been studied with the Monte-Carlo simulation method. Our studies show that the clusters remain in the solid state when temperature is low. The small values of fluctuation functions indicates the thermal vibration of atoms around their equilibrium positions. If the temperature is high, the atoms are delocalized. The cluster melts and enters the liquid region. The cluster melting is simulated by the Monte-Carlo simulation with the fluctuation function we defined. Energy levels of clusters are calculated from the Hubbard model. Ionization potentials and magic numbers are also obtained from these energy levels. The results confirm that the Hubbard model is a good approximation for a small cluster. The excitation energy is presented by the difference between the original level and excited level, and the electron-hole interactions. We also have studied cooling of clusters

  18. Radiolabeling and biological evaluation of DOTA-Ph-Al derivative conjugated to anti-EGFR antibody ior egf/r3 for targeted tumor imaging and therapy.

    PubMed

    Pnwar, Puja; Iznaga-Escobar, Normando; Mishra, Pushpa; Srivastava, Vibha; Sharma, Rakesh Kumar; Chandra, Ramesh; Mishra, Anil K

    2005-08-01

    An appropriate bifunctional chelating agent namely DOTA-Ph-Al was developed for the conjugation with biological vectors (anti EGFr antibody). We hereby report the synthesis of p-bromoacetamidobenzyl derivative of DOTA and its conjugation to monoclonal antibody anti-EGFR ior egf/r3. Immunoconjugate was prepared by conjugation of p-bromoacetamidobenzyl derivative of DOTA with ior egf/r3. Modified antibody was purified by size exclusion chromatography. DOTA-Ph-Al-ior egf/r3 exhibited quantitative 99mTc-labeling (>96%) with specific activity 10-20 mCi/mg of protein and 90Y-labeling with specific activity 2-5 mCi/mg. Immunoreactivity was determined by flow cytometry. Receptor ligand assay on murine cell line EAT and human tumor cell line U-87MG showed Kd = 2.87 nM and 4.86 nM respectively. The stability in serum indicated that 99mTc remained bound to antibodies up to 24h and 98% 90Y was associated with the mAb for five days. Biodistribution characteristics of Ab-conjugate radiolabeled to 99mTc and 90Y radionuclide was examined in BALB/c mice grafted with EAT and athymic mice with U-87MG cell line demonstrated high tumor uptake with 5.5 +/- 1.3 and 7.85 +/- 1.2%ID/g at four and 24 h for 99mTc- DOTA-Ph-AI-ior egf/r3 in EAT tumors after post injection respectively. Maximal radiotracer uptake peaked 17.6 +/- 2.5%ID/g in EAT tumor and 12.89 +/- 0.66% ID/g in U-87MG tumor at 48h for 90Y. The drug excreted through renal routes as the activity in the kidneys was 13.42 +/- 0.33%ID/g at 1 h and 4.51 +/- 1.2%ID/g at 4 h for 99mTc- DOTA-Ph-Al-ior egf/r3.

  19. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  20. Clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Vikhlinin, A. A.; Kravtsov, A. V.; Markevich, M. L.; Sunyaev, R. A.; Churazov, E. M.

    2014-04-01

    Galaxy clusters are formed via nonlinear growth of primordial density fluctuations and are the most massive gravitationally bound objects in the present Universe. Their number density at different epochs and their properties depend strongly on the properties of dark matter and dark energy, making clusters a powerful tool for observational cosmology. Observations of the hot gas filling the gravitational potential well of a cluster allows studying gasdynamic and plasma effects and the effect of supermassive black holes on the heating and cooling of gas on cluster scales. The work of Yakov Borisovich Zeldovich has had a profound impact on virtually all cosmological and astrophysical studies of galaxy clusters, introducing concepts such as the Harrison-Zeldovich spectrum, the Zeldovich approximation, baryon acoustic peaks, and the Sunyaev-Zeldovich effect. Here, we review the most basic properties of clusters and their role in modern astrophysics and cosmology.

  1. Chemistry Within Molecular Clusters

    DTIC Science & Technology

    1990-01-01

    DME )nCH3OCH 2 +). We speculate that this is due to the fragments being consumed by an ion-molecule reaction within the cluster. One likely candidate is...the ion-molecule reaction of the fragment cations with a neutral DME , within the bulk cluster to form a trimethyloxonlum cation intermediate. This...the observed products. We therefore speculate that the DME cluster reactions leading to the same products, should involve the same mechanism found to

  2. Chemistry Within Molecular Clusters

    DTIC Science & Technology

    1992-06-01

    and ( DME ).CH 3OCH2+). We speculate that this is due to the fragments being consumed by an ion-molecule reaction within the cluster. A likely candidate...is the ion-molecule reaction of the fragment cations with a neutral DME within the bulk cluster, to form a trimethyloxonium cation intermediate...a trimethyloxonium intermediate as the common intermediate for the observed products. We therefore speculate that the DME cluster reactions leading to

  3. Cluster State Quantum Computation

    DTIC Science & Technology

    2014-02-01

    nearest neighbor cluster state has been shown to be a universal resource for MBQC thus we can say our quantum computer is universal. We note that...CLUSTER STATE QUANTUM COMPUTATION FEBRUARY 2014 FINAL TECHNICAL REPORT APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED STINFO COPY AIR FORCE...TITLE AND SUBTITLE CLUSTER STATE QUANTUM COMPUTATION 5a. CONTRACT NUMBER IN-HOUSE 5b. GRANT NUMBER N/A 5c. PROGRAM ELEMENT NUMBER 62788F 6

  4. Chemical Reactions in Clusters

    DTIC Science & Technology

    1992-11-04

    NH 3)n, n _> 4, clusters has been attributed to the (solvated) naphtholate anion.3a A single picosecond decay measurement has been reported which...vibrational energy in the cluster Sl state. The data are summarized in Table I. A model to explain these decay results can be constructed based on a proton...11 TITLE (Include Security Classification) Chemical Reactions in Clusters 12 PERSONAL AUTHOR(S) Elliot R. Bernstein 13a TYPE OF REPORT 13b TIME COVERED

  5. Star Clusters within FIRE

    NASA Astrophysics Data System (ADS)

    Perez, Adrianna; Moreno, Jorge; Naiman, Jill; Ramirez-Ruiz, Enrico; Hopkins, Philip F.

    2017-01-01

    In this work, we analyze the environments surrounding star clusters of simulated merging galaxies. Our framework employs Feedback In Realistic Environments (FIRE) model (Hopkins et al., 2014). The FIRE project is a high resolution cosmological simulation that resolves star forming regions and incorporates stellar feedback in a physically realistic way. The project focuses on analyzing the properties of the star clusters formed in merging galaxies. The locations of these star clusters are identified with astrodendro.py, a publicly available dendrogram algorithm. Once star cluster properties are extracted, they will be used to create a sub-grid (smaller than the resolution scale of FIRE) of gas confinement in these clusters. Then, we can examine how the star clusters interact with these available gas reservoirs (either by accreting this mass or blowing it out via feedback), which will determine many properties of the cluster (star formation history, compact object accretion, etc). These simulations will further our understanding of star formation within stellar clusters during galaxy evolution. In the future, we aim to enhance sub-grid prescriptions for feedback specific to processes within star clusters; such as, interaction with stellar winds and gas accretion onto black holes and neutron stars.

  6. Melting of nickel clusters

    SciTech Connect

    Garzon, I.L.; Jellinek, J.

    1991-12-31

    The meltinglike phenomenon in Ni{sub n}, n = 19,20,55, clusters is studied using microcanonical molecular dynamics simulations. The interaction between the atoms in the clusters is modelled by a size-dependent Gupta-like potential that incorporates many-body effects. The clusters display the ``usual`` stages in their meltinglike transition, which characterize also Lennard-Jones (e.g., noble gas) and ionic clusters. In addition, Ni{sub 20} passes through a so-called premelting stage found earlier also for Ni{sub 14}. 11 ref., 3 figs.

  7. Melting of nickel clusters

    SciTech Connect

    Garzon, I.L. . Inst. de Fisica); Jellinek, J. )

    1991-01-01

    The meltinglike phenomenon in Ni{sub n}, n = 19,20,55, clusters is studied using microcanonical molecular dynamics simulations. The interaction between the atoms in the clusters is modelled by a size-dependent Gupta-like potential that incorporates many-body effects. The clusters display the usual'' stages in their meltinglike transition, which characterize also Lennard-Jones (e.g., noble gas) and ionic clusters. In addition, Ni{sub 20} passes through a so-called premelting stage found earlier also for Ni{sub 14}. 11 ref., 3 figs.

  8. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  9. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  10. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  11. Photoionization of molecular clusters

    NASA Astrophysics Data System (ADS)

    Andres, R. P.; Calo, J. M.

    1981-12-01

    An experimental apparatus consisting of a novel multiple expansion cluster source coupled with a molecular beam system and photoionization mass spectrometer has been designed and constructed. This apparatus has been thoroughly tested and preliminary measurements of the growth kinetics of water clusters and the photoionization cross section of the water dimer have been carried out.

  12. Probability and Cancer Clusters

    ERIC Educational Resources Information Center

    Hamilton-Keene, Rachael; Lenard, Christoper T.; Mills, Terry M.

    2009-01-01

    Recently there have been several news items about possible cancer clusters in the Australian media. The term "cancer cluster" is used when an unusually large number of people in one geographic area, often a workplace, are diagnosed with cancer in a short space of time. In this paper the authors explore this important health issue using…

  13. Coma cluster of galaxies

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Atlas Image mosaic, covering 34' x 34' on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies (over 1000 members), most prominently the two giant ellipticals, NGC 4874 (right) and NGC 4889 (left). The remaining members are mostly smaller ellipticals, but spiral galaxies are also evident in the 2MASS image. The cluster is seen toward the constellation Coma Berenices, but is actually at a distance of about 100 Mpc (330 million light years, or a redshift of 0.023) from us. At this distance, the cluster is in what is known as the 'Hubble flow,' or the overall expansion of the Universe. As such, astronomers can measure the Hubble Constant, or the universal expansion rate, based on the distance to this cluster. Large, rich clusters, such as Coma, allow astronomers to measure the 'missing mass,' i.e., the matter in the cluster that we cannot see, since it gravitationally influences the motions of the member galaxies within the cluster. The near-infrared maps the overall luminous mass content of the member galaxies, since the light at these wavelengths is dominated by the more numerous older stellar populations. Galaxies, as seen by 2MASS, look fairly smooth and homogeneous, as can be seen from the Hubble 'tuning fork' diagram of near-infrared galaxy morphology. Image mosaic by S. Van Dyk (IPAC).

  14. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  15. Cluster Guide. Accounting Occupations.

    ERIC Educational Resources Information Center

    Beaverton School District 48, OR.

    Based on a recent task inventory of key occupations in the accounting cluster taken in the Portland, Oregon, area, this curriculum guide is intended to assist administrators and teachers in the design and implementation of high school accounting cluster programs. The guide is divided into four major sections: program organization and…

  16. Marketing Occupations. Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    This cluster guide, which is designed to show teachers what specific knowledge and skills qualify high school students for entry-level employment (or postsecondary training) in marketing occupations, is organized into three sections: (1) cluster organization and implementation, (2) instructional emphasis areas, and (3) assessment. The first…

  17. Ultrametric Hierarchical Clustering Algorithms.

    ERIC Educational Resources Information Center

    Milligan, Glenn W.

    1979-01-01

    Johnson has shown that the single linkage and complete linkage hierarchical clustering algorithms induce a metric on the data known as the ultrametric. Johnson's proof is extended to four other common clustering algorithms. Two additional methods also produce hierarchical structures which can violate the ultrametric inequality. (Author/CTM)

  18. [Cluster headache differential diagnosis].

    PubMed

    Guégan-Massardier, Evelyne; Laubier, Cécile

    2015-11-01

    Cluster headache is characterized by disabling stereotyped headache. Early diagnosis allows appropriate treatment, unfortunately diagnostic errors are frequent. The main differential diagnoses are other primary or essential headaches. Migraine, more frequent and whose diagnosis is carried by excess, trigeminal neuralgia or other trigemino-autonomic cephalgia. Vascular or tumoral underlying condition can mimic cluster headache, neck and brain imaging is recommended, ideally MRI.

  19. Targeting Clusters, Achieving Excellence.

    ERIC Educational Resources Information Center

    Rosenfeld, Stuart; Jacobs, Jim; Liston, Cynthia

    2003-01-01

    Suggests that groups, or clusters, of industries form partnerships with community colleges in order to positively impact economic development. Asserts that a cluster-oriented community college system requires innovation, specialized resources and expertise, knowledge of trends, and links to industry. Offers suggestions for developing such a…

  20. Multiple frame cluster tracking

    NASA Astrophysics Data System (ADS)

    Gadaleta, Sabino; Klusman, Mike; Poore, Aubrey; Slocumb, Benjamin J.

    2002-08-01

    Tracking large number of closely spaced objects is a challenging problem for any tracking system. In missile defense systems, countermeasures in the form of debris, chaff, spent fuel, and balloons can overwhelm tracking systems that track only individual objects. Thus, tracking these groups or clusters of objects followed by transitions to individual object tracking (if and when individual objects separate from the groups) is a necessary capability for a robust and real-time tracking system. The objectives of this paper are to describe the group tracking problem in the context of multiple frame target tracking and to formulate a general assignment problem for the multiple frame cluster/group tracking problem. The proposed approach forms multiple clustering hypotheses on each frame of data and base individual frame clustering decisions on the information from multiple frames of data in much the same way that MFA or MHT work for individual object tracking. The formulation of the assignment problem for resolved object tracking and candidate clustering methods for use in multiple frame cluster tracking are briefly reviewed. Then, three different formulations are presented for the combination of multiple clustering hypotheses on each frame of data and the multiple frame assignments of clusters between frames.

  1. Brightest Cluster Galaxy Identification

    NASA Astrophysics Data System (ADS)

    Leisman, Luke; Haarsma, D. B.; Sebald, D. A.; ACCEPT Team

    2011-01-01

    Brightest cluster galaxies (BCGs) play an important role in several fields of astronomical research. The literature includes many different methods and criteria for identifying the BCG in the cluster, such as choosing the brightest galaxy, the galaxy nearest the X-ray peak, or the galaxy with the most extended profile. Here we examine a sample of 75 clusters from the Archive of Chandra Cluster Entropy Profile Tables (ACCEPT) and the Sloan Digital Sky Survey (SDSS), measuring masked magnitudes and profiles for BCG candidates in each cluster. We first identified galaxies by hand; in 15% of clusters at least one team member selected a different galaxy than the others.We also applied 6 other identification methods to the ACCEPT sample; in 30% of clusters at least one of these methods selected a different galaxy than the other methods. We then developed an algorithm that weighs brightness, profile, and proximity to the X-ray peak and centroid. This algorithm incorporates the advantages of by-hand identification (weighing multiple properties) and automated selection (repeatable and consistent). The BCG population chosen by the algorithm is more uniform in its properties than populations selected by other methods, particularly in the relation between absolute magnitude (a proxy for galaxy mass) and average gas temperature (a proxy for cluster mass). This work supported by a Barry M. Goldwater Scholarship and a Sid Jansma Summer Research Fellowship.

  2. Hybridization schemes for clusters

    NASA Astrophysics Data System (ADS)

    Wales, David J.

    The concept of an optimum hybridization scheme for cluster compounds is developed with particular reference to electron counting. The prediction of electron counts for clusters and the interpretation of the bonding is shown to depend critically upon the presumed hybridization pattern of the cluster vertex atoms. This fact has not been properly appreciated in previous work, particularly in applications of Stone's tensor surface harmonic (TSH) theory, but is found to be a useful tool when dealt with directly. A quantitative definition is suggested for the optimum cluster hybridization pattern based directly upon the ease of interpretation of the molecular orbitals, and results are given for a range of species. The relationship of this scheme to the detailed cluster geometry is described using Löwdin's partitioned perturbation theory, and the success and range of application of TSH theory are discussed.

  3. Cool Cluster Correctly Correlated

    SciTech Connect

    Varganov, Sergey Aleksandrovich

    2005-01-01

    Atomic clusters are unique objects, which occupy an intermediate position between atoms and condensed matter systems. For a long time it was thought that physical and chemical properties of atomic dusters monotonically change with increasing size of the cluster from a single atom to a condensed matter system. However, recently it has become clear that many properties of atomic clusters can change drastically with the size of the clusters. Because physical and chemical properties of clusters can be adjusted simply by changing the cluster's size, different applications of atomic clusters were proposed. One example is the catalytic activity of clusters of specific sizes in different chemical reactions. Another example is a potential application of atomic clusters in microelectronics, where their band gaps can be adjusted by simply changing cluster sizes. In recent years significant advances in experimental techniques allow one to synthesize and study atomic clusters of specified sizes. However, the interpretation of the results is often difficult. The theoretical methods are frequently used to help in interpretation of complex experimental data. Most of the theoretical approaches have been based on empirical or semiempirical methods. These methods allow one to study large and small dusters using the same approximations. However, since empirical and semiempirical methods rely on simple models with many parameters, it is often difficult to estimate the quantitative and even qualitative accuracy of the results. On the other hand, because of significant advances in quantum chemical methods and computer capabilities, it is now possible to do high quality ab-initio calculations not only on systems of few atoms but on clusters of practical interest as well. In addition to accurate results for specific clusters, such methods can be used for benchmarking of different empirical and semiempirical approaches. The atomic clusters studied in this work contain from a few atoms to

  4. Galaxy cluster's rotation

    NASA Astrophysics Data System (ADS)

    Manolopoulou, M.; Plionis, M.

    2017-03-01

    We study the possible rotation of cluster galaxies, developing, testing, and applying a novel algorithm which identifies rotation, if such does exist, as well as its rotational centre, its axis orientation, rotational velocity amplitude, and, finally, the clockwise or counterclockwise direction of rotation on the plane of the sky. To validate our algorithms we construct realistic Monte Carlo mock rotating clusters and confirm that our method provides robust indications of rotation. We then apply our methodology on a sample of Abell clusters with z ≲ 0.1 with member galaxies selected from the Sloan Digital Sky Survey DR10 spectroscopic data base. After excluding a number of substructured clusters, which could provide erroneous indications of rotation, and taking into account the expected fraction of misidentified coherent substructure velocities for rotation, provided by our Monte Carlo simulation analysis, we find that ∼23 per cent of our clusters are rotating under a set of strict criteria. Loosening the strictness of the criteria, on the expense of introducing spurious rotation indications, we find this fraction increasing to ∼28 per cent. We correlate our rotation indicators with the cluster dynamical state, provided either by their Bautz-Morgan type or by their X-ray isophotal shape and find for those clusters showing rotation within 1.5 h^{-1}_{70} Mpc that the significance of their rotation is related to the dynamically younger phases of cluster formation but after the initial anisotropic accretion and merging has been completed. Finally, finding rotational modes in galaxy clusters could lead to the necessity of correcting the dynamical cluster mass calculations.

  5. A practical deca-gram scale ring expansion of (R)-(-)-carvone to (R)-(+)-3-methyl-6-isopropenyl-cyclohept-3-enone-1.

    PubMed

    Alves, Leandro de C; Desiderá, André L; de Oliveira, Kleber T; Newton, Sean; Ley, Steven V; Brocksom, Timothy J

    2015-07-28

    A route to enantiopure (R)-(+)-3-methyl-6-isopropenyl-cyclohept-3-enone-1, an intermediate for terpenoids, has been developed and includes a highly chemo- and regioselective Tiffeneau-Demjanov reaction. Starting from readily available (R)-(-)-carvone, this robust sequence is available on a deca-gram scale and uses flow chemistry for the initial epoxidation reaction. The stereochemistry of the addition of two nucleophiles to the carbonyl group of (R)-(-)-carvone has been determined by X-ray diffraction studies and chemical correlation.

  6. A R2R3-MYB Transcription Factor Regulates the Flavonol Biosynthetic Pathway in a Traditional Chinese Medicinal Plant, Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Khaldun, A. B. M.; Chen, Jianjun; Zhang, Chanjuan; Lv, Haiyan; Yuan, Ling; Wang, Ying

    2016-01-01

    Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components (BCs) in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from Epimedium sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase) and EsFLS (flavonol synthase), but not the promoters of EsDFRs (dihydroflavonol 4-reductase) and EsANS (anthocyanidin synthase) in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase), NtCHI (chalcone isomerase), NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS) were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived BCs in E. sagittatum. Thus

  7. (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-Mono(di,tri)fluoromethylcyclopropyl]alanines and their incorporation into hormaomycin analogues

    PubMed Central

    Kozhushkov, Sergei I; Yufit, Dmitrii S; Grosse, Christian; Kaiser, Marcel

    2014-01-01

    Summary Efficient and scalable syntheses of enantiomerically pure (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-mono(di,tri)fluoromethylcyclopropyl]alanines 9a–c, as well as allo-D-threonine (4) and (2S,3R)-β-methylphenylalanine (3), using the Belokon' approach with (S)- and (R)-2-[(N-benzylprolyl)amino]benzophenone [(S)- and (R)-10] as reusable chiral auxiliaries have been developed. Three new fluoromethyl analogues of the naturally occurring octadepsipeptide hormaomycin (1) with (fluoromethylcyclopropyl)alanine moieties have been synthesized and subjected to preliminary tests of their antibiotic activity. PMID:25550751

  8. Anticonvulsant activity of artificial sweeteners: a structural link between sweet-taste receptor T1R3 and brain glutamate receptors.

    PubMed

    Talevi, Alan; Enrique, Andrea V; Bruno-Blanch, Luis E

    2012-06-15

    A virtual screening campaign based on application of a topological discriminant function capable of identifying novel anticonvulsant agents indicated several widely-used artificial sweeteners as potential anticonvulsant candidates. Acesulfame potassium, cyclamate and saccharin were tested in the Maximal Electroshock Seizure model (mice, ip), showing moderate anticonvulsant activity. We hypothesized a probable structural link between the receptor responsible of sweet taste and anticonvulsant molecular targets. Bioinformatic tools confirmed a highly significant sequence-similarity between taste-related protein T1R3 and several metabotropic glutamate receptors from different species, including glutamate receptors upregulated in epileptogenesis and certain types of epilepsy.

  9. Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture

    DOEpatents

    Sanfilippo, Antonio; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2009-12-22

    Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture are described. In one aspect, a document clustering method includes providing a document set comprising a plurality of documents, providing a cluster comprising a subset of the documents of the document set, using a plurality of terms of the documents, providing a cluster label indicative of subject matter content of the documents of the cluster, wherein the cluster label comprises a plurality of word senses, and selecting one of the word senses of the cluster label.

  10. Evolution Properties of Clusters and AXAF Contributions to understanding Clusters

    NASA Technical Reports Server (NTRS)

    Jones, Christine

    1998-01-01

    Our ROSAT survey for distant clusters of galaxies contains the largest solid angle of all ROSAT pointed surveying and thus has sufficient area to test the previously reported cluster evolution. We find significant negative cluster evolution, i.e,, at high redshifts there are fewer luminous clusters than at present. We compare optical cluster properties for the most distant clusters in the ROSAT survey with those measured for nearby clusters. We also present AXAF capabilities and show how AXAF will significantly extend our understanding of cluster properties and their cosmological evolution.

  11. Formation and Reactivity of Organo-Functionalized Tin Selenide Clusters.

    PubMed

    Rinn, Niklas; Eußner, Jens P; Kaschuba, Willy; Xie, Xiulan; Dehnen, Stefanie

    2016-02-24

    Reactions of R(1) SnCl3 (R(1) =CMe2 CH2 C(O)Me) with (SiMe3 )2 Se yield a series of organo-functionalized tin selenide clusters, [(SnR(1) )2 SeCl4 ] (1), [(SnR(1) )2 Se2 Cl2 ] (2), [(SnR(1) )3 Se4 Cl] (3), and [(SnR(1) )4 Se6 ] (4), depending on the solvent and ratio of the reactants used. NMR experiments clearly suggest a stepwise formation of 1 through 4 by subsequent condensation steps with the concomitant release of Me3 SiCl. Furthermore, addition of hydrazines to the keto-functionalized clusters leads to the formation of hydrazone derivatives, [(Sn2 (μ-R(3) )(μ-Se)Cl4 ] (5, R(3) =[CMe2 CH2 CMe(NH)]2 ), [(SnR(2) )3 Se4 Cl] (6, R(2) =CMe2 CH2 C(NNH2 )Me), [(SnR(4) )3 Se4 ][SnCl3 ] (7, R(4) =CMe2 CH2 C(NNHPh)Me), [(SnR(2) )4 Se6 ] (8), and [(SnR(4) )4 Se6 ] (9). Upon treatment of 4 with [Cu(PPh3 )3 Cl] and excess (SiMe3 )2 Se, the cluster fragments to form [(R(1) Sn)2 Se2 (CuPPh3 )2 Se2 ] (10), the first discrete Sn/Se/Cu cluster compound reported in the literature. The derivatization reactions indicate fundamental differences between organotin sulfide and organotin selenide chemistry.

  12. The metabolism of (R)-3-hydroxybutyrate is regulated by the enhancer-binding protein PA2005 and the alternative sigma factor RpoN in Pseudomonas aeruginosa PAO1.

    PubMed

    Lundgren, Benjamin R; Harris, Joshua R; Sarwar, Zaara; Scheel, Ryan A; Nomura, Christopher T

    2015-11-01

    A variety of soil-dwelling bacteria produce polyhydroxybutyrate (PHB), which serves as a source of energy and carbon under nutrient deprivation. Bacteria belonging to the genus Pseudomonas do not generally produce PHB but are capable of using the PHB degradation product (R)-3-hydroxybutyrate [(R)-3-HB] as a growth substrate. Essential to this utilization is the NAD+-dependent dehydrogenase BdhA that converts (R)-3-HB into acetoacetate, a molecule that readily enters central metabolism. Apart from the numerous studies that had focused on the biochemical characterization of BdhA, there was nothing known about the assimilation of (R)-3-HB in Pseudomonas, including the genetic regulation of bdhA expression. This study aimed to define the regulatory factors that govern or dictate the expression of the bdhA gene and (R)-3-HB assimilation in Pseudomonas aeruginosa PAO1. Importantly, expression of the bdhA gene was found to be specifically induced by (R)-3-HB in a manner dependent on the alternative sigma factor RpoN and the enhancer-binding protein PA2005.This mode of regulation was essential for the utilization of (R)-3-HB as a sole source of energy and carbon. However, non-induced levels of bdhA expression were sufficient for P. aeruginosa PAO1 to grow on ( ± )-1,3-butanediol, which is catabolized through an (R)-3-HB intermediate. Because this is, we believe, the first report of an enhancer-binding protein that responds to (R)-3-HB, PA2005 was named HbcR for (R)-3-hydroxybutyrate catabolism regulator.

  13. The metabolism of (R)-3-hydroxybutyrate is regulated by the enhancer-binding protein PA2005 and the alternative sigma factor RpoN in Pseudomonas aeruginosa PAO1

    PubMed Central

    Lundgren, Benjamin R.; Harris, Joshua R.; Sarwar, Zaara; Scheel, Ryan A.

    2015-01-01

    A variety of soil-dwelling bacteria produce polyhydroxybutyrate (PHB), which serves as a source of energy and carbon under nutrient deprivation. Bacteria belonging to the genus Pseudomonas do not generally produce PHB but are capable of using the PHB degradation product (R)-3-hydroxybutyrate [(R)-3-HB] as a growth substrate. Essential to this utilization is the NAD+-dependent dehydrogenase BdhA that converts (R)-3-HB into acetoacetate, a molecule that readily enters central metabolism. Apart from the numerous studies that had focused on the biochemical characterization of BdhA, there was nothing known about the assimilation of (R)-3-HB in Pseudomonas, including the genetic regulation of bdhA expression. This study aimed to define the regulatory factors that govern or dictate the expression of the bdhA gene and (R)-3-HB assimilation in Pseudomonas aeruginosa PAO1. Importantly, expression of the bdhA gene was found to be specifically induced by (R)-3-HB in a manner dependent on the alternative sigma factor RpoN and the enhancer-binding protein PA2005.This mode of regulation was essential for the utilization of (R)-3-HB as a sole source of energy and carbon. However, non-induced levels of bdhA expression were sufficient for P. aeruginosa PAO1 to grow on ( ± )-1,3-butanediol, which is catabolized through an (R)-3-HB intermediate. Because this is, we believe, the first report of an enhancer-binding protein that responds to (R)-3-HB, PA2005 was named HbcR for (R)-3-hydroxybutyrate catabolism regulator. PMID:26311173

  14. Studies in clustering theory

    NASA Astrophysics Data System (ADS)

    Stell, George

    In recent years the properties of percolation models have been studied intensively. The purpose of our project was to develop a general theory of percolation and clustering between particles of arbitrary size and shape, with arbitrary correlations between them. The goal of such a theory includes the treatment of continuum percolation as well as a novel treatment of lattice percolation. We made substantial progress toward this goal. The quantities basic to a description of clustering, the mean cluster size, mean number of clusters, etc., were developed. Concise formulas were given for the terms in such series, and proved, at least for sufficiently low densities, that the series are absolutely convergent. These series can now be used to construct Pade approximants that will allow one to probe the percolation transition. A scaled-particle theory of percolation was developed which gives analytic approximants for the mean number of clusters in a large class of two and three dimensional percolation models. Although this quantity is essential in many applications, e.g., explaining colligative properties, and interpreting low-angle light-scattering data, no systematic studies of it have been done before this work. Recently carried out detailed computer simulations show that the mean number of clusters is given to high accuracy by several of there approximations. Extensions of this work will allow calculation of the complete cluster size distribution.

  15. Nuclear Star Clusters

    NASA Astrophysics Data System (ADS)

    Neumayer, Nadine

    2017-03-01

    The centers of galaxies host two distinct, compact components: massive black holes and nuclear star clusters. Nuclear star clusters are the densest stellar systems in the universe, with masses of ~ 107M⊙ and sizes of ~ 5pc. They are almost ubiquitous at the centres of nearby galaxies with masses similar to, or lower than the Milky Way. Their occurrence both in spirals and dwarf elliptical galaxies appears to be a strong function of total galaxy light or mass. Nucleation fractions are up to 100% for total galaxy magnitudes of M B = -19mag or total galaxy luminosities of about L B = 1010 L ⊙ and falling nucleation fractions for both smaller and higher galaxy masses. Although nuclear star clusters are so common, their formation mechanisms are still under debate. The two main formation scenarios proposed are the infall and subsequent merging of star clusters and the in-situ formation of stars at the center of a galaxy. Here, I review the state-of-the-art of nuclear star cluster observations concerning their structure, stellar populations and kinematics. These observations are used to constrain the proposed formation scenarios for nuclear star clusters. Constraints from observations show, that likely both cluster infall and in-situ star formation are at work. The relative importance of these two mechanisms is still subject of investigation.

  16. Allodynia in Cluster Headache.

    PubMed

    Wilbrink, Leopoldine A; Louter, Mark A; Teernstra, Onno Pm; van Zwet, Erik W; Huygen, Frank Jpm; Haan, Joost; Ferrari, Michel D; Terwindt, Gisela M

    2017-03-04

    Cutaneous allodynia is an established marker for central sensitization in migraine. There is debate whether cutaneous allodynia may also occur in cluster headache, another episodic headache disorder. Here we examined the presence and severity of allodynia in a large well-defined nation-wide population of people with cluster headache.Using validated questionnaires we assessed, cross-sectionally, ictal allodynia and comorbid depression and migraine in the nation-wide "Leiden University Cluster headache neuro-Analysis" (LUCA) study. Participants with cluster headache were diagnosed according to the International Classification of Headache Disorders criteria. Multivariate regression models were used, with correction for demographic factors and cluster headache subtype (chronic vs. episodic; recent attacks < 1 month vs. no recent attacks).In total 606/798 (75.9%) participants with cluster headache responded of whom 218/606 (36%) had allodynia during attacks. Female gender (OR 2.05, 95% CI 1.28-3.29), low age at onset (OR 0.98, 95% CI 0.96- 0.99), lifetime depression (OR 1.63; 95% CI 1.06-2.50), comorbid migraine (OR 1.96; 95% CI 1.02-3.79), and having recent attacks (OR 1.80; 95% CI 1.13-2.86), but not duration of attacks and chronic cluster headache, were independent risk factors for allodynia.The high prevalence of cutaneous allodynia with similar risk factors for allodynia as found for migraine suggests that central sensitization, like in migraine, also occurs in cluster headache. In clinical practice, awareness that people with cluster headache may suffer from allodynia can in the future be an important feature in treatment options.

  17. Green polymer chemistry: investigating the mechanism of radical ring-opening redox polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT).

    PubMed

    Rosenthal-Kim, Emily Q; Puskas, Judit E

    2015-04-13

    The mechanism of the new Radical Ring-opening Redox Polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT) by triethylamine (TEA) and dilute H2O2 was investigated. Scouting studies showed that the formation of high molecular weight polymers required a 1:2 molar ratio of DODT to TEA and of DODT to H2O2. Further investigation into the chemical composition of the organic and aqueous phases by 1H-NMR spectroscopy and mass spectrometry demonstrated that DODT is ionized by two TEA molecules (one for each thiol group) and thus transferred into the aqueous phase. The organic phase was found to have cyclic disulfide dimers, trimers and tetramers. Dissolving DODT and TEA in water before the addition of H2O2 yielded a polymer with Mn = 55,000 g/mol, in comparison with Mn = 92,000 g/mol when aqueous H2O2 was added to a DODT/TEA mixture. After polymer removal, MALDI-ToF MS analysis of the residual reaction mixtures showed only cyclic oligomers remaining. Below the LCST for TEA in water, 18.7 °C, the system yielded a stable emulsion, and only cyclic oligomers were found. Below DODT/TEA and H2O2 1:2 molar ratio mostly linear oligomers were formed, with <20% cyclic oligomers. The findings support the proposed mechanism of R3P.

  18. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis

    SciTech Connect

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D.; Douglas, Carl

    2014-05-23

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.

  19. On moduli space of symmetric orthogonal matrices and exclusive Racah matrix S bar for representation R = [3,1] with multiplicities

    NASA Astrophysics Data System (ADS)

    Morozov, A.

    2017-03-01

    Racah matrices and higher j-symbols are used in description of braiding properties of conformal blocks and in construction of knot polynomials. However, in complicated cases the logic is actually inverted: they are much better deduced from these applications than from the basic representation theory. Following the recent proposal of [1] we obtain the exclusive Racah matrix S bar for the currently-front-line case of representation R = [ 3 , 1 ] with non-trivial multiplicities, where it is actually operator-valued, i.e. depends on the choice of bases in the intertwiner spaces. Effective field theory for arborescent knots in this case possesses gauge invariance, which is not yet properly described and understood. Because of this lack of knowledge a big part (about a half) of S bar needs to be reconstructed from orthogonality conditions. Therefore we discuss the abundance of symmetric orthogonal matrices, to which S bar belongs, and explain that dimension of their moduli space is also about a half of that for the ordinary orthogonal matrices. Thus the knowledge approximately matches the freedom and this explains why the method can work - with some limited addition of educated guesses. A similar calculation for R = [ r , 1 ] for r > 3 should also be doable.

  20. PacMYBA, a sweet cherry R2R3-MYB transcription factor, is a positive regulator of salt stress tolerance and pathogen resistance.

    PubMed

    Shen, Xinjie; Guo, Xinwei; Guo, Xiao; Zhao, Di; Zhao, Wei; Chen, Jingsheng; Li, Tianhong

    2017-03-01

    Plant R2R3-MYB transcription factors play crucial roles in stress responses. We previously isolated a R2R3-MYB homolog from sweet cherry cv. Hong Deng, designated PacMYBA (GenBank accession No. KF974774). To explore the role of PacMYBA in the plant stress response, we heterologously expressed PacMYBA in transgenic Arabidopsis thaliana plants. In a previous study, we demonstrated that PacMYBA is mainly localized to the nucleus and could be induced by abscisic acid (ABA). Analysis of the promoter sequence of PacMYBA revealed that it contains several stress-related cis-elements. QPCR results showed that PacMYBA is induced by salt, salicylic (SA), and jasmonic acid (JA) in sweet cherry leaves. Transgenic Arabidopsis plants heterologously expressing PacMYBA exhibited enhanced salt-tolerance and increased resistance to Pseudomonas syringe pv. tomato (Pst) DC3000 infection. Overexpression of PacMYBA decreased the osmotic potential (OP), increased the free proline content, and increased the peroxidase content in transgenic Arabidopsis plants. Furthermore, overexpression of PacMYBA also affected the expression levels of salt stress- and pathogen defense-related genes in the transgenic plants. These results indicate that PacMYBA is a positive regulator of salt stress tolerance and pathogen resistance.

  1. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis.

    PubMed

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D; Douglas, Carl J

    2014-05-23

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.

  2. A systems-oriented analysis of the grapevine R2R3-MYB transcription factor family uncovers new insights into the regulation of stilbene accumulation

    PubMed Central

    Wong, Darren Chern Jan; Schlechter, Rudolf; Vannozzi, Alessandro; Höll, Janine; Hmmam, Ibrahim; Bogs, Jochen; Tornielli, Giovanni Battista; Castellarin, Simone Diego; Matus, José Tomás

    2016-01-01

    R2R3-MYB transcription factors (TFs) belong to a large and functionally diverse protein superfamily in plants. In this study, we explore the evolution and function of this family in grapevine (Vitis vinifera L.), a high-value fruit crop. We identified and manually curated 134 genes using RNA-Seq data, and named them systematically according to the Super-Nomenclature Committee. We identified novel genes, splicing variants and grapevine/woody-specific duplicated subgroups, suggesting possible neo- and sub-functionalization events. Regulatory network analysis ascribed biological functions to uncharacterized genes and validated those of known genes (e.g. secondary cell wall biogenesis and flavonoid biosynthesis). A comprehensive analysis of different MYB binding motifs in the promoters of co-expressed genes predicted grape R2R3-MYB binding preferences and supported evidence for putative downstream targets. Enrichment of cis-regulatory motifs for diverse TFs reinforced the notion of transcriptional coordination and interaction between MYBs and other regulators. Analysis of the network of Subgroup 2 showed that the resveratrol-related VviMYB14 and VviMYB15 share common co-expressed STILBENE SYNTHASE genes with the uncharacterized VviMYB13. These regulators have distinct expression patterns within organs and in response to biotic and abiotic stresses, suggesting a pivotal role of VviMYB13 in regulating stilbene accumulation in vegetative tissues and under biotic stress conditions. PMID:27407139

  3. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

    PubMed Central

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-01-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

  4. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis

    PubMed Central

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D.; Douglas, Carl J.

    2014-01-01

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes. PMID:24852237

  5. Extending Beowulf Clusters

    USGS Publications Warehouse

    Steinwand, Daniel R.; Maddox, Brian; Beckmann, Tim; Hamer, George

    2003-01-01

    Beowulf clusters can provide a cost-effective way to compute numerical models and process large amounts of remote sensing image data. Usually a Beowulf cluster is designed to accomplish a specific set of processing goals, and processing is very efficient when the problem remains inside the constraints of the original design. There are cases, however, when one might wish to compute a problem that is beyond the capacity of the local Beowulf system. In these cases, spreading the problem to multiple clusters or to other machines on the network may provide a cost-effective solution.

  6. Dwarfs in Coma Cluster

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Click on image for larger poster version

    This false-color mosaic of the central region of the Coma cluster combines infrared and visible-light images to reveal thousands of faint objects (green). Follow-up observations showed that many of these objects, which appear here as faint green smudges, are dwarf galaxies belonging to the cluster. Two large elliptical galaxies, NGC 4889 and NGC 4874, dominate the cluster's center. The mosaic combines visible-light data from the Sloan Digital Sky Survey (color coded blue) with long- and short-wavelength infrared views (red and green, respectively) from NASA's Spitzer Space Telescope.

  7. Magnetization of ferromagnetic clusters

    SciTech Connect

    Onishi, Naoki; Bertsch, G.; Yabana, Kazuhiro

    1995-02-01

    The magnetization and deflection profiles of magnetic clusters in a Stern-Gerlach magnet are calculated for conditions under which the magnetic moment is fixed in the intrinsic frame of the cluster, and the clusters enter the magnetic field adiabatically. The predicted magnetization is monotonic in the Langevin parameter, the ratio of magnetic energy {mu}{sub 0}B to thermal energy k{sub B}T. In low field the average magnetization is 2/3 of the Langevin function. The high-field moment approaches saturation asymptotically as B{sup {minus}1/2} instead of the B{sup {minus}1} dependence in the Langevin function.

  8. H-cluster stars

    NASA Astrophysics Data System (ADS)

    Lai, X. Y.; Gao, C. Y.; Xu, R. X.

    2013-06-01

    The study of dense matter at ultrahigh density has a very long history, which is meaningful for us to understand not only cosmic events in extreme circumstances but also fundamental laws of physics. It is well known that the state of cold matter at supranuclear density depends on the non-perturbative nature of quantum chromodynamics (QCD) and is essential for modelling pulsars. A so-called H-cluster matter is proposed in this paper as the nature of dense matter in reality. In compact stars at only a few nuclear densities but low temperature, quarks could be interacting strongly with each other there. That might render quarks grouped in clusters, although the hypothetical quark clusters in cold dense matter have not been confirmed due to the lack of both theoretical and experimental evidence. Motivated by recent lattice QCD simulations of the H-dibaryons (with structure uuddss), we therefore consider here a possible kind of quark clusters, H-clusters, that could emerge inside compact stars during their initial cooling as the dominant components inside (the degree of freedom could then be H-clusters there). Taking into account the in-medium stiffening effect, we find that at baryon densities of compact stars H-cluster matter could be more stable than nuclear matter. We also find that for the H-cluster matter with lattice structure, the equation of state could be so stiff that it would seem to be `superluminal' in the most dense region. However, the real sound speed for H-cluster matter is in fact difficult to calculate, so at this stage we do not put constraints on our model from the usual requirement of causality. We study the stars composed of H-clusters, i.e. H-cluster stars, and derive the dependence of their maximum mass on the in-medium stiffening effect, showing that the maximum mass could be well above 2 M⊙ as observed and that the resultant mass-radius relation fits the measurement of the rapid burster under reasonable parameters. Besides a general

  9. Atomic cluster collisions

    NASA Astrophysics Data System (ADS)

    Korol, Andrey V.; Solov'yov, Andrey

    2013-01-01

    Atomic cluster collisions are a field of rapidly emerging research interest by both experimentalists and theorists. The international symposium on atomic cluster collisions (ISSAC) is the premier forum to present cutting-edge research in this field. It was established in 2003 and the most recent conference was held in Berlin, Germany in July of 2011. This Topical Issue presents original research results from some of the participants, who attended this conference. This issues specifically focuses on two research areas, namely Clusters and Fullerenes in External Fields and Nanoscale Insights in Radiation Biodamage.

  10. Partially supervised speaker clustering.

    PubMed

    Tang, Hao; Chu, Stephen Mingyu; Hasegawa-Johnson, Mark; Huang, Thomas S

    2012-05-01

    Content-based multimedia indexing, retrieval, and processing as well as multimedia databases demand the structuring of the media content (image, audio, video, text, etc.), one significant goal being to associate the identity of the content to the individual segments of the signals. In this paper, we specifically address the problem of speaker clustering, the task of assigning every speech utterance in an audio stream to its speaker. We offer a complete treatment to the idea of partially supervised speaker clustering, which refers to the use of our prior knowledge of speakers in general to assist the unsupervised speaker clustering process. By means of an independent training data set, we encode the prior knowledge at the various stages of the speaker clustering pipeline via 1) learning a speaker-discriminative acoustic feature transformation, 2) learning a universal speaker prior model, and 3) learning a discriminative speaker subspace, or equivalently, a speaker-discriminative distance metric. We study the directional scattering property of the Gaussian mixture model (GMM) mean supervector representation of utterances in the high-dimensional space, and advocate exploiting this property by using the cosine distance metric instead of the euclidean distance metric for speaker clustering in the GMM mean supervector space. We propose to perform discriminant analysis based on the cosine distance metric, which leads to a novel distance metric learning algorithm—linear spherical discriminant analysis (LSDA). We show that the proposed LSDA formulation can be systematically solved within the elegant graph embedding general dimensionality reduction framework. Our speaker clustering experiments on the GALE database clearly indicate that 1) our speaker clustering methods based on the GMM mean supervector representation and vector-based distance metrics outperform traditional speaker clustering methods based on the “bag of acoustic features” representation and statistical

  11. Combining cluster number counts and galaxy clustering

    NASA Astrophysics Data System (ADS)

    Lacasa, Fabien; Rosenfeld, Rogerio

    2016-08-01

    The abundance of clusters and the clustering of galaxies are two of the important cosmological probes for current and future large scale surveys of galaxies, such as the Dark Energy Survey. In order to combine them one has to account for the fact that they are not independent quantities, since they probe the same density field. It is important to develop a good understanding of their correlation in order to extract parameter constraints. We present a detailed modelling of the joint covariance matrix between cluster number counts and the galaxy angular power spectrum. We employ the framework of the halo model complemented by a Halo Occupation Distribution model (HOD). We demonstrate the importance of accounting for non-Gaussianity to produce accurate covariance predictions. Indeed, we show that the non-Gaussian covariance becomes dominant at small scales, low redshifts or high cluster masses. We discuss in particular the case of the super-sample covariance (SSC), including the effects of galaxy shot-noise, halo second order bias and non-local bias. We demonstrate that the SSC obeys mathematical inequalities and positivity. Using the joint covariance matrix and a Fisher matrix methodology, we examine the prospects of combining these two probes to constrain cosmological and HOD parameters. We find that the combination indeed results in noticeably better constraints, with improvements of order 20% on cosmological parameters compared to the best single probe, and even greater improvement on HOD parameters, with reduction of error bars by a factor 1.4-4.8. This happens in particular because the cross-covariance introduces a synergy between the probes on small scales. We conclude that accounting for non-Gaussian effects is required for the joint analysis of these observables in galaxy surveys.

  12. How Clusters Work

    EPA Pesticide Factsheets

    Technology innovation clusters are geographic concentrations of interconnected companies, universities, and other organizations with a focus on environmental technology. They play a key role in addressing the nation’s pressing environmental problems.

  13. [Treatment of cluster headache].

    PubMed

    Fabre, N

    2005-07-01

    Remarkable therapeutic improvements have come forward recently for trigemino-autonomic cephalalgias. Attack treatment in cluster headache is based on sumatriptan and oxygen. Non-vasoconstrictive treatments are opening a new post-triptan era but are not yet applicable. Prophylactic treatment of cluster headache is based on verapamil and lithium. The efficacy of anti-epileptic drugs in cluster headache remains to be demonstrated. Surgical treatment aimed at the parasympathetic pathways and at the trigeminal nerve demonstrates a high rate of recurrence and adverse events and questions about the relevance of a "peripheral" target in cluster headache. The efficacy of continuous hypothalamic stimulation in patients with intractable headache constitutes a breakthrough, but must be demonstrated at a larger scale and the benefice/risk ratio must be carefully evaluated. Indomethacin still remains the gold standard in paroxysmal hemicrania treatment. Until recently SUNCT was considered an intractable condition. However there are some reports of complete relief with lamotrigine, topiramate and gabapentin.

  14. Clustered frequency comb.

    PubMed

    Matsko, Andrey B; Savchenkov, Anatoliy A; Huang, Shu-Wei; Maleki, Lute

    2016-11-01

    We show theoretically that it is feasible to generate a spectrally broad Kerr frequency comb consisting of several spectral clusters phase matched due to interplay among second- and higher-order group velocity dispersion contributions. We validate the theoretical analysis experimentally by driving a magnesium fluoride resonator, characterized with 110 GHz free spectral range, with a continuous wave light at 1.55 μm and observing two comb clusters separated by nearly two-thirds of an octave.

  15. Cluster State Quantum Computing

    DTIC Science & Technology

    2012-12-01

    implementation of quantum computation,” Fortschr. Phys. 48, 771 (2000). [Dragoman01] D. Dragoman, “Proposal for a three-qubit teleportation experiment”, Phys...CLUSTER STATE QUANTUM COMPUTING DECEMBER 2012 INTERIM TECHNICAL REPORT APPROVED FOR PUBLIC RELEASE; DISTRIBUTION...From - To) NOV 2010 – OCT 2012 4. TITLE AND SUBTITLE CLUSTER STATE QUANTUM COMPUTING 5a. CONTRACT NUMBER IN-HOUSE 5b. GRANT NUMBER N/A 5c

  16. Globular clusters with Gaia

    NASA Astrophysics Data System (ADS)

    Pancino, E.; Bellazzini, M.; Giuffrida, G.; Marinoni, S.

    2017-01-01

    The treatment of crowded fields in Gaia data will only be a reality in a few years from now. In particular, for globular clusters, only the end-of-mission data (public in 2022-2023) will have the necessary full crowding treatment and will reach sufficient quality for the faintest stars. As a consequence, the work on the deblending and decontamination pipelines is still ongoing. We describe the present status of the pipelines for different Gaia instruments, and we model the end-of-mission crowding errors on the basis of available information. We then apply the nominal post-launch Gaia performances, appropriately worsened by the estimated crowding errors, to a set of 18 simulated globular clusters with different concentration, distance, and field contamination. We conclude that there will be 103-104 stars with astrometric performances virtually untouched by crowding (contaminated by <1 mmag) in the majoritiy of clusters. The most limiting factor will be field crowding, not cluster crowding: the most contaminated clusters will only contain 10-100 clean stars. We also conclude that: (i) the systemic proper motions and parallaxes will be determined to 1% or better up to ≃15 kpc, and the nearby clusters will have radial velocities to a few km s-1 ; (ii) internal kinematics will be of unprecendented quality, cluster masses will be determined to ≃10% up to 15 kpc and beyond, and it will be possible to identify differences of a few km s-1 or less in the kinematics (if any) of cluster sub-populations up to 10 kpc and beyond; (iii) the brightest stars (V≃17 mag) will have space-quality, wide-field photometry (mmag errors), and all Gaia photometry will have 1-3% errors on the absolute photometric calibration.

  17. Chemistry within Molecular Clusters

    DTIC Science & Technology

    1992-05-29

    molecule reaction of the fragment cations with a neutral DME within the bulk cluster, to form a trimethyloxonium cation intermediate. Similar ion...trimethyloxonium intermediate as the common intermediate for the observed products. We therefore speculate that the DME cluster reactions leading to the same...1982, 20, 51, Ibid. Kinetics of Ion-Molecule Reactions ; Ausloos, P., Ed.; Plenum, New York, 1979; p. 69. (18) Ono, Y.; Ng, C. Y. J. Am. Chem. Soc. 1982

  18. Wild Duck Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    On April 7, 2005, the Deep Impact spacecraft's Impactor Target Sensor camera recorded this image of M11, the Wild Duck cluster, a galactic open cluster located 6 thousand light years away. The camera is located on the impactor spacecraft, which will image comet Tempel 1 beginning 22 hours before impact until about 2 seconds before impact. Impact with comet Tempel 1 is planned for July 4, 2005.

  19. Parallel Wolff Cluster Algorithms

    NASA Astrophysics Data System (ADS)

    Bae, S.; Ko, S. H.; Coddington, P. D.

    The Wolff single-cluster algorithm is the most efficient method known for Monte Carlo simulation of many spin models. Due to the irregular size, shape and position of the Wolff clusters, this method does not easily lend itself to efficient parallel implementation, so that simulations using this method have thus far been confined to workstations and vector machines. Here we present two parallel implementations of this algorithm, and show that one gives fairly good performance on a MIMD parallel computer.

  20. Structural transitions in clusters.

    PubMed

    Hartke, Bernd

    2002-05-03

    If one adds more particles to a cluster, the energetically optimal structure is neither preserved nor does it change in a continuous fashion. Instead, one finds several cluster size regions where one structural principle dominates almost without exception, and rather narrow boundary regions in-between. The structure of the solid is usually reached only at relatively large sizes, after more than one structural transition. The occurrence of this general phenomenon of size-dependent structural transitions does not seem to depend on the nature of the particles, it is found for atomic, molecular, homogeneous, and heterogeneous clusters alike. Clearly, it is a collective many-body phenomenon which can in principle be calculated but not understood in a fully reductionistic manner. Actual calculations with sufficient accuracy are not feasible today, because of the enormous computational expense, even when unconventional evolutionary algorithms are employed for global geometry optimization. Therefore, simple rules for cluster structures are highly desirable. In fact, we are dealing here not just with the academic quest for linkages between cluster structure and features of the potential energy surface, but structural transitions in clusters are also of immediate relevance for many natural and industrial processes, ranging from crystal growth all the way to nanotechnology. This article provides an exemplary overview of research on this topic, from simple model systems where first qualitative explanations start to be successful, up to more realistic complex systems which are still beyond our understanding.

  1. Cluster functional renormalization group

    NASA Astrophysics Data System (ADS)

    Reuther, Johannes; Thomale, Ronny

    2014-01-01

    Functional renormalization group (FRG) has become a diverse and powerful tool to derive effective low-energy scattering vertices of interacting many-body systems. Starting from a free expansion point of the action, the flow of the RG parameter Λ allows us to trace the evolution of the effective one- and two-particle vertices towards low energies by taking into account the vertex corrections between all parquet channels in an unbiased fashion. In this work, we generalize the expansion point at which the diagrammatic resummation procedure is initiated from a free UV limit to a cluster product state. We formulate a cluster FRG scheme where the noninteracting building blocks (i.e., decoupled spin clusters) are treated exactly, and the intercluster couplings are addressed via RG. As a benchmark study, we apply our cluster FRG scheme to the spin-1/2 bilayer Heisenberg model (BHM) on a square lattice where the neighboring sites in the two layers form the individual two-site clusters. Comparing with existing numerical evidence for the BHM, we obtain reasonable findings for the spin susceptibility, the spin-triplet excitation energy, and quasiparticle weight even in coupling regimes close to antiferromagnetic order. The concept of cluster FRG promises applications to a large class of interacting electron systems.

  2. QSO clustering - II. The correlation function of IRAS seyfert galaxies.

    NASA Astrophysics Data System (ADS)

    Georgantopoulos, I.; Shanks, T.

    1994-12-01

    We investigate the clustering properties of 192 Seyfert galaxies from the IRAS all-sky survey. Using the spatial correlation function, we detect evidence of Seyfert clustering at the 2σ confidence level at < 10 h^-1^ Mpc separations, and at the 3{SIGMA} level at < 20 h^-1^ Mpc separations. Comparison of the QSO correlation function amplitude at high redshifts, z = 1.4, with that of Seyferts below 10 h^-1^ comoving Mpc leads us to reject the stable model of AGN clustering evolution at the 4σ level, whereas a comoving model where QSOs randomly sample the galaxy distribution is more consistent. The main uncertainty here now lies in the statistical error on the amplitude of the clustering in the faint QSO surveys at z = 1.4. The Seyfert-QDOT cross-correlation function is measured to be approximately a factor of 2 higher than the QDOT galaxy autocorrelation function, suggesting an enhanced environment for Seyferts with respect to IRAS galaxies, but it is not clear whether this is also the case with respect to optical galaxies. We conclude that the comoving model is probably favoured overall, at least on the r < 10 h^-1^ Mpc scales investigated here, but it is not yet possible to rule out intermediate models: for example, an enhanced-environment, stable model with ξ(r)=(r/3)^-1.8^ at z = 1.4, which is statistically consistent with the faint QSO data.

  3. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

    PubMed Central

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-01-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

  4. Tomato R2R3-MYB Proteins SlANT1 and SlAN2: Same Protein Activity, Different Roles

    PubMed Central

    Bassolino, Laura; Povero, Giovanni; Spelt, Cornelis; Buti, Sara; Giuliano, Giovanni; Quattrocchio, Francesca; Koes, Ronald; Perata, Pierdomenico; Gonzali, Silvia

    2015-01-01

    Anthocyanins are water-soluble polyphenolic compounds with a high nutraceutical value. Despite the fact that cultivated tomato varieties do not accumulate anthocyanins in the fruit, the biosynthetic pathway can be activated in the vegetative organs by several environmental stimuli. Little is known about the molecular mechanisms regulating anthocyanin synthesis in tomato. Here, we carried out a molecular and functional characterization of two genes, SlAN2 and SlANT1, encoding two R2R3-MYB transcription factors. We show that both can induce ectopic anthocyanin synthesis in transgenic tomato lines, including the fruit. However, only SlAN2 acts as a positive regulator of anthocyanin synthesis in vegetative tissues under high light or low temperature conditions. PMID:26308527

  5. Design and construction of the structure of the DEMONSTRATOR of the CALIFA detector for R3B-FAIR using carbon-fiber composites

    NASA Astrophysics Data System (ADS)

    Casarejos, E.; Alvarez-Pol, H.; Cortina-Gil, D.; Durán, I.; Iglesias, A.; Izquierdo, P.; Yañez, P.; Vilán, J. A.

    2014-03-01

    In this paper we describe the DEMONSTRATOR structures and active units (PETALs) developed for the detector CALIFA of the experiment R3B - FAIR. The design is based in the CALIFA BARREL mechanical solutions, but adapted to the characteristics of the PETALs, namely in what concerns the load distribution during setup and service. The R&D program defined the materials and procedures for both producing the pieces of carbon fiber (CF) composites as well as the mounting of the bundles to make an alveolar structure. The procedures also include a quality control program to ensure the dimensional properties of the CF assemblies. We are also developing the use of tomographic imaging analysis for this quality program, that will be of mayor interest in the construction of the future CALIFA CF-structure.

  6. Formation of a paramagnetic Al complex and extrusion of Fe during the reaction of (diiminepyridine)Fe with AlR3 (R = Me, Et).

    PubMed

    Scott, Jennifer; Gambarotta, Sandro; Korobkov, Ilia; Knijnenburg, Quinten; de Bruin, Bas; Budzelaar, Peter H M

    2005-12-14

    The reaction of the {2,6-[2,6-(iPr)2PhN=C(CH3)]2(C5H3N)}FeCl2 catalyst precursor with R3Al [R = Me, Et] afforded {2,6-[2,6-(iPr)2PhN=C(CH3)]2(C5H3N)}AlMe2 (1) and [eta4-LAl2Et3(mu-Cl)]Fe-(eta6-C7H8) (2), respectively. These paramagnetic species arises from both transmetalation, during which the strong terdentate ligand loses the Fe center, and reduction. The extent of reduction depends on the nature of the Al alkylating agent. The electrons necessary for the reduction are likely to be provided by cleavage of Fe-C bond of transient low-valent organo-Fe species.

  7. A dual antibacterial mechanism involved in membrane disruption and DNA binding of 2R,3R-dihydromyricetin from pine needles of Cedrus deodara against Staphylococcus aureus.

    PubMed

    Wu, Yanping; Bai, Jinrong; Zhong, Kai; Huang, Yina; Gao, Hong

    2017-03-01

    The antibacterial activity and mechanism of 2R,3R-dihydromyricetin (DMY) against Staphylococcus aureus were investigated. The minimum inhibitory concentration of DMY against S. aureus was 0.125mg/ml, and the growth inhibitory assay also revealed that DMY showed a potent antibacterial activity against S. aureus. Massive nucleotide leakage and flow cytometric analysis demonstrated that DMY disrupted the membrane integrity of S. aureus. Morphological changes and membrane hyperpolarization of S. aureus cells treated with DMY further suggested that DMY destroyed cell membrane. Meanwhile, DMY probably interacted with membrane lipids and proteins, causing a significant reduction in membrane fluidity and changes in conformation of membrane protein. Moreover, DMY could interact with S. aureus DNA through the groove binding mode. Overall, the results suggested that DMY could be applied as a candidate for the development of new food preservatives as it achieved bactericidal activity by damaging cell membrane and binding to intracellular DNA.

  8. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

    PubMed

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-10-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

  9. Decreased AMPA GluR2, but not GluR3, mRNA expression in rat amygdala and dorsal hippocampus following morphine-induced behavioural sensitization.

    PubMed

    Sepehrizadeh, Zargham; Bahrololoumi Shapourabadi, Mina; Ahmadi, Shamseddin; Hashemi Bozchlou, Saeed; Zarrindast, Mohammad-Reza; Sahebgharani, Mousa

    2008-11-01

    1. Repeated administration of psychostimulants and micro-opioid receptor agonists elicits a progressive enhancement of drug-induced behavioural responses, a phenomenon termed behavioural sensitization. These changes in behaviour may reflect plastic changes requiring regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole proprionic acid (AMPA) receptor function. 2. In the present study, rats were treated for 7 days with saline or morphine (10 mg/kg). After a washout period of either 24 h or 7 days, locomotion, oral stereotypy and state-dependent memory in a passive avoidance test were measured in the presence or absence of 6-cyano-7-nitroquinoxaline-2,3-dione disodium salt (CNQX; 3 mg/kg), an AMPA receptor antagonist. In order to evaluate the mechanism underlying the behavioural responses, quantitative real-time reverse transcription-polymerase chain reaction was used to evaluate mRNA expression of the AMPA receptor subunits GluR2 and GluR3 in the striatum, prefrontal cortex, hippocampus, hypothalamus and amygdala of animals treated repeatedly with morphine. 3. The results indicate that repeated morphine treatment followed by 7 days (but not 24 h) washout produces behavioural sensitization, as determined by locomotion, oral stereotypy and state-dependent memory. Blockade of AMPA receptors with CNQX on the test day did not alter these behavioural responses. In addition, repeated morphine treatment followed by 7 days (but not 24 h) washout decreased GluR2 mRNA expression in both the amygdala (by 50%) and hippocampus (by 35%). Repeated morphine treatment did not alter GluR3 mRNA expression in any brain area assessed. 4. These data imply that AMPA receptors are involved in the development (but not expression) phase of behavioural sensitization. The decreases in GluR2 mRNA expression in the amygdala and hippocampus may result in the formation of calcium-permeable AMPA receptors, which are believed to play an important role in behavioural sensitization.

  10. Characterization of the cell response of cultured macrophages and fibroblasts to particles of short-chain poly[(R)-3-hydroxybutyric acid].

    PubMed

    Saad, B; Ciardelli, G; Matter, S; Welti, M; Uhlschmid, G K; Neuenschwander, P; Suter, U W

    1996-04-01

    The known biodegradability of poly[(R)-3-hydroxybutyric acid] (PHB) in certain biological environments had led to its proposed use as a biodegradable, biocompatible polymer. Recently, a new, rapidly biodegradable block copolymer that contains crystalline domains of PHB blocks has been synthesized. During degradation of these polymers, the PHB domains are transformed in a first step into small crystalline particles of short-chain PHB. Therefore, particles of short-chain poly[(R)-3-hydroxybutyric acid] (Mn 2300) (PHB-P), as possible degradation products, are investigated here for their effects on the viability and activation of mouse macrophages (J774), primary rat peritoneal macrophages, and mouse fibroblasts (3T3), and their biodegradation or exocytosis (or both) in these cells. Results obtained in the present study indicate that incubation of macrophages with PHB-P concentrations higher than 10 micrograms/mL were found to cause a significant decrease in the number of attached and viable cells as measured in MTT assay, and significant increase in the production levels of tumor necrosis factor-alpha (TNF-alpha) or nitric oxide (NO). At low concentrations, particles of PHB failed to induce cytotoxic effects or to activate macrophages. In addition, signs of possible biodegradation were seen in macrophages. Fibroblasts showed only limited PHB-P phagocytosis and no signs of any cellular damage or cell activation (production of collagen type I and IV, and fibronectin). Taken collectively, the present data indicate that phagocytosis of PHB-P at high concentrations ( > 10 micrograms/mL) is dose dependent and associated with cell damage in macrophages but not in fibroblasts.

  11. Behavioral Clustering of School Children.

    ERIC Educational Resources Information Center

    Huberty, Carl J.; DiStefano, Christine; Kamphaus, Randy W.

    1997-01-01

    How a cluster analysis is conducted, validated, and interpreted is illustrated using a 14-scale behavioral assessment instrument and a national sample of 1,228 elementary school students. Method, cluster typology, validity, cluster structure, and prediction of cluster membership are discussed. (Author/SLD)

  12. Clustered data in sports research.

    PubMed

    Hayen, A

    2006-05-01

    Clustered, or dependent, data, arise commonly in sports medicine and sports science research, particularly in studies of sports injury and biomechanics, particularly in sports injury trials that are randomised at team or club level, in cross-sectional surveys in which groups of individuals are studied and in studies with repeated measures designs. Clustering, or positive correlation among responses, arises because responses and outcomes from the same cluster will usually be more similar than from different clusters. Study designs with clustering will usually required an increased sample size when compared to those without clustering. Ignoring clustering in statistical analyses can also lead to misleading conclusions, including incorrect confidence intervals and p-values. Appropriate statistical analyses for clustered data must be adopted. This paper gives some examples of clustered data and discusses the implications of clustering on the design and analysis of studies in sports medicine and sports science research.

  13. Dust in galaxy clusters

    NASA Astrophysics Data System (ADS)

    Polikarpova, O. L.; Shchekinov, Yu. A.

    2017-02-01

    The conditions for the destruction of dust in hot gas in galaxy clusters are investigated. It is argued that extinction measurements can be subject to selection effects, hindering their use in obtaining trustworthy estimates of dust masses in clusters. It is shown, in particular, that the ratio of the dust mass to the extinction M d / S d increases as dust grains are disrupted, due to the rapid destruction of small grains. Over long times, this ratio can asymptotically reach values a factor of three higher than the mean value in the interstellar medium in the Galaxy. This lowers dust-mass estimates based on measurements of extinction in galaxy clusters. The characteristic lifetime of dust in hot cluster gas is determined by its possible thermal isolation by the denser medium of gas fragments within which the dust is ejected from galaxies, and can reach 100-300 million years, depending on the kinematics and morphology of the fragments. As a result, the mass fraction of dust in hot cluster gas can reach 1-3% of the Galactic value. Over its lifetime, dust can also be manifest through its far-infrared emission. The emission characteristics of the dust change as it is disrupted, and the ratio of the fluxes at 350 and 850 μm can increase appreciably. This can potentially serve as an indicator of the state of the dust and ambient gas.

  14. Spatio-temporal clustering

    NASA Astrophysics Data System (ADS)

    Kisilevich, Slava; Mansmann, Florian; Nanni, Mirco; Rinzivillo, Salvatore

    Spatio-temporal clustering is a process of grouping objects based on their spatial and temporal similarity. It is relatively new subfield of data mining which gained high popularity especially in geographic information sciences due to the pervasiveness of all kinds of location-based or environmental devices that record position, time or/and environmental properties of an object or set of objects in real-time. As a consequence, different types and large amounts of spatio-temporal data became available that introduce new challenges to data analysis and require novel approaches to knowledge discovery. In this chapter we concentrate on the spatio-temporal clustering in geographic space. First, we provide a classification of different types of spatio-temporal data. Then, we focus on one type of spatio-temporal clustering - trajectory clustering, provide an overview of the state-of-the-art approaches and methods of spatio-temporal clustering and finally present several scenarios in different application domains such as movement, cellular networks and environmental studies.

  15. Clustering granulometric features

    NASA Astrophysics Data System (ADS)

    Brun, Marcel; Balagurunathan, Yoganand; Barrera, Junior; Dougherty, Edward R.

    2002-05-01

    Granulometric features have been widely used for classification, segmentation and recently in estimation of parameters in shape models. In this paper we study the inference of clustering based on granulometric features for a collection of structuring probes in the context of random models. We use random Boolean models to represent grains of different shapes and structure. It is known that granulometric features are excellent descriptors of shape and structure of grains. Inference based on clustering these features helps to analyze the consistency of these features and clustering algorithms. This greatly aids in classifier design and feature selection. Features and the order of their addition play a role in reducing the inference errors. We study four different types of feature addition methods and the effect of replication in reducing the inference errors.

  16. Trans-tail regulation of MLL4-catalyzed H3K4 methylation by H4R3 symmetric dimethylation is mediated by a tandem PHD of MLL4.

    PubMed

    Dhar, Shilpa S; Lee, Sung-Hun; Kan, Pu-Yeh; Voigt, Philipp; Ma, Li; Shi, Xiaobing; Reinberg, Danny; Lee, Min Gyu

    2012-12-15

    Mixed-lineage leukemia 4 (MLL4; also called MLL2 and ALR) enzymatically generates trimethylated histone H3 Lys 4 (H3K4me3), a hallmark of gene activation. However, how MLL4-deposited H3K4me3 interplays with other histone marks in epigenetic processes remains largely unknown. Here, we show that MLL4 plays an essential role in differentiating NT2/D1 stem cells by activating differentiation-specific genes. A tandem plant homeodomain (PHD(4-6)) of MLL4 recognizes unmethylated or asymmetrically dimethylated histone H4 Arg 3 (H4R3me0 or H4R3me2a) and is required for MLL4's nucleosomal methyltransferase activity and MLL4-mediated differentiation. Kabuki syndrome mutations in PHD(4-6) reduce PHD(4-6)'s binding ability and MLL4's catalytic activity. PHD(4-6)'s binding strength is inhibited by H4R3 symmetric dimethylation (H4R3me2s), a gene-repressive mark. The protein arginine methyltransferase 7 (PRMT7), but not PRMT5, represses MLL4 target genes by up-regulating H4R3me2s levels and antagonizes MLL4-mediated differentiation. Consistently, PRMT7 knockdown increases MLL4-catalyzed H3K4me3 levels. During differentiation, decreased H4R3me2s levels are associated with increased H3K4me3 levels at a cohort of genes, including many HOXA and HOXB genes. These findings indicate that the trans-tail inhibition of MLL4-generated H3K4me3 by PRMT7-regulated H4R3me2s may result from H4R3me2s's interference with PHD(4-6)'s binding activity and is a novel epigenetic mechanism that underlies opposing effects of MLL4 and PRMT7 on cellular differentiation.

  17. Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death.

    PubMed

    Chen, Bisi; Niu, Fangfang; Liu, Wu-Zhen; Yang, Bo; Zhang, Jingxiao; Ma, Jieyu; Cheng, Hao; Han, Feng; Jiang, Yuan-Qing

    2016-04-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some plant species, little is known about R2R3-MYB genes in canola (Brassica napus L.). In this study, we have identified 76 R2R3-MYB genes in the canola genome through mining of expressed sequence tags (ESTs). The cDNA sequences of 44 MYB genes were successfully cloned. The transcriptional activities of BnaMYB proteins encoded by these genes were assayed in yeast. The subcellular localizations of representative R2R3-MYB proteins were investigated through GFP fusion. Besides, the transcript abundance level analysis during abiotic conditions and ABA treatment identified a group of R2R3-MYB genes that responded to one or more treatments. Furthermore, we identified a previously functionally unknown MYB gene-BnaMYB78, which modulates reactive oxygen species (ROS)-dependent cell death in Nicotiana benthamiana, through regulating the transcription of a few ROS- and defence-related genes. Taken together, this study has provided a solid foundation for understanding the roles and regulatory mechanism of canola R2R3-MYB genes.

  18. Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death

    PubMed Central

    Chen, Bisi; Niu, Fangfang; Liu, Wu-Zhen; Yang, Bo; Zhang, Jingxiao; Ma, Jieyu; Cheng, Hao; Han, Feng; Jiang, Yuan-Qing

    2016-01-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some plant species, little is known about R2R3-MYB genes in canola (Brassica napus L.). In this study, we have identified 76 R2R3-MYB genes in the canola genome through mining of expressed sequence tags (ESTs). The cDNA sequences of 44 MYB genes were successfully cloned. The transcriptional activities of BnaMYB proteins encoded by these genes were assayed in yeast. The subcellular localizations of representative R2R3-MYB proteins were investigated through GFP fusion. Besides, the transcript abundance level analysis during abiotic conditions and ABA treatment identified a group of R2R3-MYB genes that responded to one or more treatments. Furthermore, we identified a previously functionally unknown MYB gene-BnaMYB78, which modulates reactive oxygen species (ROS)-dependent cell death in Nicotiana benthamiana, through regulating the transcription of a few ROS- and defence-related genes. Taken together, this study has provided a solid foundation for understanding the roles and regulatory mechanism of canola R2R3-MYB genes. PMID:26800702

  19. Selective expression of the type 3 isoform of ryanodine receptor Ca{sup 2+} release channel (RyR3) in a subset of slow fibers in diaphragm and cephalic muscles of adult rabbits

    SciTech Connect

    Conti, Antonio; Reggiani, Carlo; Sorrentino, Vincenzo . E-mail: v.sorrentino@unisi.it

    2005-11-11

    The expression pattern of the RyR3 isoform of Ca{sup 2+} release channels was analysed by Western blot in neonatal and adult rabbit skeletal muscles. The results obtained show that the expression of the RyR3 isoform is developmentally regulated. In fact, RyR3 expression was detected in all muscles analysed at 2 and 15 days after birth while, in adult animals, it was restricted to a subset of muscles that includes diaphragm, masseter, pterygoideus, digastricus, and tongue. Interestingly, all of these muscles share a common embryonic origin being derived from the somitomeres or from the cephalic region of the embryo. Immunofluorescence analysis of rabbit skeletal muscle cross-sections showed that RyR3 staining was detected in all fibers of neonatal muscles. In contrast, in those adult muscles expressing RyR3 only a fraction of fibers was labelled. Staining of these muscles with antibodies against fast and slow myosins revealed a close correlation between expression of RyR3 and fibers expressing slow myosin isoform.

  20. Antibody h-R3-dendrimer mediated siRNA has excellent endosomal escape and tumor targeted delivery ability, and represents efficient siPLK1 silencing and inhibition of cell proliferation, migration and invasion

    PubMed Central

    Li, Jun; Liu, Jing; Li, Shengnan; Hao, Yanli; Chen, Lei; Zhang, Xiaoning

    2016-01-01

    The major obstacle to developing siRNA delivery is their extracellular and intracellular barriers. Herein, a humanized anti-EGFR monoclonal antibody h-R3 was developed to modify the self-assembled binary complexes (dendriplexes) of PAMAM and siRNA via electrostatic interactions, and two common ligands HSA and EGF were used as a control. Compared to dendriplexes, h-R3/EGF/HSA-dendriplexes showed increased particle size, decreased zeta potentials and lower cytotoxicity. Moreover, h-R3-dendriplexes presented greater cellular uptake and excellent endosomal escape ability in HepG2 cells. Ex vivo fluorescence imaging revealed that h-R3-dendriplexes showed higher targeted delivery and gene expression in the tumors than dendriplexes, HSA-dendriplexes and EGF-dendriplexes, which was in agreement with confocal results of cryosections. Furthermore, h-R3-dendriplexes for siPLK1 delivery indicated efficient gene silencing, potentiated cell growth inhibition and cell apoptosis, and suppressed cellular migration/invasion. These results indicate that h-R3-dendriplexes represent a great potential to be used as efficient targeted siRNA delivery carriers. PMID:26883109

  1. Clustering cancer gene expression data by projective clustering ensemble

    PubMed Central

    Yu, Xianxue; Yu, Guoxian

    2017-01-01

    Gene expression data analysis has paramount implications for gene treatments, cancer diagnosis and other domains. Clustering is an important and promising tool to analyze gene expression data. Gene expression data is often characterized by a large amount of genes but with limited samples, thus various projective clustering techniques and ensemble techniques have been suggested to combat with these challenges. However, it is rather challenging to synergy these two kinds of techniques together to avoid the curse of dimensionality problem and to boost the performance of gene expression data clustering. In this paper, we employ a projective clustering ensemble (PCE) to integrate the advantages of projective clustering and ensemble clustering, and to avoid the dilemma of combining multiple projective clusterings. Our experimental results on publicly available cancer gene expression data show PCE can improve the quality of clustering gene expression data by at least 4.5% (on average) than other related techniques, including dimensionality reduction based single clustering and ensemble approaches. The empirical study demonstrates that, to further boost the performance of clustering cancer gene expression data, it is necessary and promising to synergy projective clustering with ensemble clustering. PCE can serve as an effective alternative technique for clustering gene expression data. PMID:28234920

  2. Health Occupations Cluster.

    ERIC Educational Resources Information Center

    Walraven, Catherine; And Others

    These instructional materials consist of a series of curriculum worksheets that cover tasks to be mastered by students in health occupations cluster programs. Covered in the curriculum worksheets are diagnostic procedures; observing/recording/reporting/planning; safety; nutrition/elimination; hygiene/personal care/comfort;…

  3. Clustering in Bubble Suspensions

    NASA Astrophysics Data System (ADS)

    Zenit, Roberto

    2000-11-01

    A monidisperse bubble suspension is studied experimentally for the limit in which the Weber number is small and the Reynolds number is large. For this regime the suspension can be modeled using potential flow theory to describe the dynamics of the interstitial fluid. Complete theoretical descriptions have been composed (Spelt and Sangani, 1998) to model the behavior of these suspensions. Bubble clustering is a natural instability that arises from the potential flow considerations, in which bubbles tend to align in horizontal rafts as they move upwards. The appearance of bubble clusters was recently corroborated experimentally by Zenit et al. (2000), who found that although clusters did appear, their strength was not as strong as the predictions. Experiments involving gravity driven shear flows are used to explain the nature of the clustering observed in these type of flows. Balances of the bubble phase pressure (in terms of a calculated diffusion coefficient) and the Maxwell pressure (from the potential flow description) are presented to predict the stability of the bubble suspension. The predictions are compared with experimental results.

  4. FUEL ROD CLUSTERS

    DOEpatents

    Schultz, A.B.

    1959-08-01

    A cluster of nuclear fuel rods and a tubular casing therefor through which a coolant flows in heat-exchange contact with the fuel rods is described. The fuel rcds are held in the casing by virtue of the compressive force exerted between longitudinal ribs of the fuel rcds and internal ribs of the casing or the internal surfaces thereof.

  5. Hydrodynamics of Merging Clusters

    NASA Technical Reports Server (NTRS)

    David,Laurence; Mushotzky, Richard F. (Technical Monitor)

    2004-01-01

    With the Chandra X-Ray Observatory, we observed two clusters of galaxies that are undergoing major mergers . All of the analysis is complete and two papers have been accepted for publication. The abstracts of the two papers are presented in the report.

  6. PVM Support for Clusters

    NASA Technical Reports Server (NTRS)

    Springer, P.

    2000-01-01

    The latest version of PVM (3.4.3) now contains support for a PC cluster running Linux, also known as a Beowulf system. A PVM user of a computer outside the Beowulf system can add the Beowulf as a single machine.

  7. Nuclear Cluster Physics

    SciTech Connect

    Kamimura, Masayasu

    2011-05-06

    Predictive power of theory needs good models and accurate calculation methods to solve the Schroedinger equations of the systems concerned. We present some examples of successful predictions based on the nuclear cluster models of light nuclei and hypernuclei and on the calculation methods that have been developed by Kyushu group.

  8. Cluster headaches simulating parasomnias.

    PubMed

    Isik, Ugur; D'Cruz, O 'Neill F

    2002-09-01

    Nocturnal episodes of agitated arousal in otherwise healthy young children are often related to nonrapid eye movement parasomnias (night terrors). However, in patients with acute onset or increased frequency of parasomnias, organic causes of discomfort must be excluded. We report four young children whose parasomnias were caused by nocturnal cluster headaches and who responded to indomethacin dramatically.

  9. Clustered for Success

    ERIC Educational Resources Information Center

    Brulles, Dina; Winebrenner, Susan

    2012-01-01

    Schools need to address the needs of their students with high ability. Not only does this raise achievement levels schoolwide, it also attracts students from surrounding districts and recaptures advanced learners who left the school because their needs weren't being met. One practical intervention--cluster grouping--provides an inclusive…

  10. Health Occupations Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    Intended to assist the vocational teacher in designing and implementing a cluster program in health occupations, this guide suggests ideas for teaching the specific knowledge and skills that qualify students for entry-level employment in the health occupations field. The knowledge and skills are applicable to 12 occupations: dental assistant;…

  11. Buckets, Clusters and Dienst

    NASA Technical Reports Server (NTRS)

    Nelson, Michael L.; Maly, Kurt; Shen, Stewart N. T.

    1997-01-01

    In this paper we describe NCSTRL+, a unified, canonical digital library for scientific and technical information (STI). NCSTRL+ is based on the Networked Computer Science Technical Report Library (NCSTRL), a World Wide Web (WWW) accessible digital library (DL) that provides access to over 80 university departments and laboratories. NCSTRL+ implements two new technologies: cluster functionality and publishing "buckets." We have extended the Dienst protocol, the protocol underlying NCSTRL, to provide the ability to "cluster" independent collections into a logically centralized digital library based upon subject category classification, type of organization, and genres of material. The concept of "buckets" provides a mechanism for publishing and managing logically linked entities with multiple data formats. The NCSTRL+ prototype DL contains the holdings of NCSTRL and the NASA Technical Report Server (NTRS). The prototype demonstrates the feasibility of publishing into a multi-cluster DL, searching across clusters, and storing and presenting buckets of information. We show that the overhead for these additional capabilities is minimal to both the author and the user when compared to the equivalent process within NCSTRL.

  12. Universality of cluster dynamics

    NASA Astrophysics Data System (ADS)

    McFadden, Carson; Bouchard, Louis-S.

    2010-12-01

    We have studied the kinetics of cluster formation for dynamical systems of dimensions up to n=8 interacting through elastic collisions or coalescence. These systems could serve as possible models for gas kinetics, polymerization, and self-assembly. In the case of elastic collisions, we found that the cluster size probability distribution undergoes a phase transition at a critical time which can be predicted from the average time between collisions. This enables forecasting of rare events based on limited statistical sampling of the collision dynamics over short time windows. The analysis was extended to Lp -normed spaces (p=1,…,∞) to allow for some amount of interpenetration or volume exclusion. The results for the elastic collisions are consistent with previously published low-dimensional results in that a power law is observed for the empirical cluster size distribution at the critical time. We found that the same power law also exists for all dimensions n=2,…,8 , two-dimensional Lp norms, and even for coalescing collisions in two dimensions. This broad universality in behavior may be indicative of a more fundamental process governing the growth of clusters.

  13. Curriculum Guide Construction Cluster.

    ERIC Educational Resources Information Center

    Kline, Ken

    As part of a model construction cluster curriculum development project, this guide was developed and implemented in the Beaverton (Oregon) School District. The curriculum guide contains 16 units covering the following topics: introduction to construction jobs; safety and first aid; blueprint readings; basic mathematics; site work; framing; roofing…

  14. Hybrid cluster identification

    NASA Astrophysics Data System (ADS)

    Martín-Herrero, J.

    2004-10-01

    I present a hybrid method for the labelling of clusters in two-dimensional lattices, which combines the recursive approach with iterative scanning to reduce the stack size required by the pure recursive technique, while keeping its benefits: single pass and straightforward cluster characterization and percolation detection parallel to the labelling. While the capacity to hold the entire lattice in memory is usually regarded as the major constraint for the applicability of the recursive technique, the required stack size is the real limiting factor. Resorting to recursion only for the transverse direction greatly reduces the recursion depth and therefore the required stack. It also enhances the overall performance of the recursive technique, as is shown by results on a set of uniform random binary lattices and on a set of samples of the Ising model. I also show how this technique may replace the recursive technique in Wolff's cluster algorithm, decreasing the risk of stack overflow and increasing its speed, and the Hoshen-Kopelman algorithm in the Swendsen-Wang cluster algorithm, allowing effortless characterization during generation of the samples and increasing its speed.

  15. PDMS embedded Ag clusters: Coalescence and cluster-matrix interaction

    NASA Astrophysics Data System (ADS)

    Roese, S.; Engemann, D.; Hoffmann, S.; Latussek, K.; Sternemann, C.; Hövel, H.

    2016-05-01

    Polydimethylsiloxane (PDMS) has proven to be a suitable embedding medium for silver clusters to prevent aggregation. In order to investigate the influence of the PDMS on the electronic and local atomic structure of the clusters the measurement of x-ray absorption near edge structure (XANES) spectra for different coverages of silver clusters in PDMS and calculations of corresponding XANES spectra have been performed. The coalescence process and the cluster-PDMS interaction were investigated with XANES.

  16. The Rotation of Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Tovmassian, H. M.

    2015-09-01

    The method for detection of the galaxy cluster rotation based on the study of distribution of member galaxies with velocities lower and higher than the cluster mean velocity over the cluster image is proposed. The search for rotation is made for flat clusters with a/b > 1.8 and BMI type clusters which are expected to be rotating. For comparison there were studied also round clusters and clusters of NBMI type, the second by brightness galaxy, which does not differ significantly from the cluster cD galaxy. Seventeen out of studied 65 clusters are found to be rotating. It was found that the detection rate is sufficiently high for flat clusters, over 60%, and clusters of BMI type with dominant cD galaxy, ≈ 35% . The obtained results show that clusters were formed from the huge primordial gas clouds and preserved the rotation of the primordial clouds, unless they did not experience mergings with other clusters and groups of galaxies, as a result of which the rotation was prevented.

  17. Femtosecond dynamics of cluster expansion

    NASA Astrophysics Data System (ADS)

    Gao, Xiaohui; Wang, Xiaoming; Shim, Bonggu; Arefiev, Alexey; Tushentsov, Mikhail; Breizman, Boris; Downer, Mike

    2010-03-01

    Noble gas clusters irradiated by intense ultrafast laser expand quickly and become typical plasma in picosecond time scale. During the expansion, the clustered plasma demonstrates unique optical properties such as strong absorption and positive contribution to the refractive index. Here we studied cluster expansion dynamics by fs-time-resolved refractive index and absorption measurements in cluster gas jets after ionization and heating by an intense pump pulse. The refractive index measured by frequency domain interferometry (FDI) shows the transient positive peak of refractive index due to clustered plasma. By separating it from the negative contribution of the monomer plasma, we are able to determine the cluster fraction. The absorption measured by a delayed probe shows the contribution from clusters of various sizes. The plasma resonances in the cluster explain the enhancement of the absorption in our isothermal expanding cluster model. The cluster size distribution can be determined. A complete understanding of the femtosecond dynamics of cluster expansion is essential in the accurate interpretation and control of laser-cluster experiments such as phase-matched harmonic generation in cluster medium.

  18. A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

    PubMed

    Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

    2015-07-01

    Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers.

  19. A novel R2R3 MYB transcription factor NtMYBJS1 is a methyl jasmonate-dependent regulator of phenylpropanoid-conjugate biosynthesis in tobacco.

    PubMed

    Gális, Ivan; Simek, Petr; Narisawa, Tomoko; Sasaki, Mami; Horiguchi, Tatsuya; Fukuda, Hiroo; Matsuoka, Ken

    2006-05-01

    Target metabolic and large-scale transcriptomic analyses of tobacco (Nicotiana tabacum L.) Bright Yellow-2 (BY-2) cells were employed to identify novel gene(s) involved in methyl jasmonate (MJ)-dependent function in plants. At the metabolic level, we describe the specific accumulation of several phenylpropanoid-polyamine conjugates in MJ-treated BY-2 cells. Furthermore, global gene expression analysis of MJ-treated cells using a 16K cDNA microarray containing expressed sequence tags (ESTs) from BY-2 cells revealed 828 genes that were upregulated by MJ treatment within 48 h. Using time-course expression data we identified a novel MJ-inducible R2R3 MYB-type transcription factor (NtMYBJS1) that was co-expressed in a close temporal pattern with the core phenylpropanoid genes phenylalanine ammonia-lyase (PAL) and 4-coumarate:CoA ligase (4CL). Overexpression of NtMYBJS1 in tobacco BY-2 cells caused accumulation of specific phenylpropanoid conjugates in the cells. Subsequent microarray analysis of NtMYBJS1 transgenic lines revealed that a limited number of genes, including PAL and 4CL, were specifically induced in the presence of the NtMYBJS1 transgene. These results, together with results of both antisense expression analysis and of gel mobility shift assays, strongly indicate that the NtMYBJS1 protein functions in tobacco MJ signal transduction, inducing phenylpropanoid biosynthetic genes and the accumulation of phenylpropanoid-polyamine conjugates during stress.

  20. Purple foliage coloration in tea (Camellia sinensis L.) arises from activation of the R2R3-MYB transcription factor CsAN1

    PubMed Central

    Sun, Binmei; Zhu, Zhangsheng; Cao, Panrong; Chen, Hao; Chen, Changming; Zhou, Xin; Mao, Yanhui; Lei, Jianjun; Jiang, Yanpin; Meng, Wei; Wang, Yingxi; Liu, Shaoqun

    2016-01-01

    Purple foliage always appears in Camellia sinensis families; however, the transcriptional regulation of anthocyanin biosynthesis is unknown. The tea bud sport cultivar ‘Zijuan’ confers an abnormal pattern of anthocyanin accumulation, resulting in a mutant phenotype that has a striking purple color in young foliage and in the stem. In this study, we aimed to unravel the underlying molecular mechanism of anthocyanin biosynthetic regulation in C. sinensis. Our results revealed that activation of the R2R3-MYB transcription factor (TF) anthocyanin1 (CsAN1) specifically upregulated the bHLH TF CsGL3 and anthocyanin late biosynthetic genes (LBGs) to confer ectopic accumulation of pigment in purple tea. We found CsAN1 interacts with bHLH TFs (CsGL3 and CsEGL3) and recruits a WD-repeat protein CsTTG1 to form the MYB-bHLH-WDR (MBW) complex that regulates anthocyanin accumulation. We determined that the hypomethylation of a CpG island in the CsAN1 promoter is associated with the purple phenotype. Furthermore, we demonstrated that low temperature and long illumination induced CsAN1 promoter demethylation, resulting in upregulated expression to promote anthocyanin accumulation in the foliage. The successful isolation of CsAN1 provides important information on the regulatory control of anthocyanin biosynthesis in C. sinensis and offers a genetic resource for the development of new varieties with enhanced anthocyanin content. PMID:27581206

  1. Purple foliage coloration in tea (Camellia sinensis L.) arises from activation of the R2R3-MYB transcription factor CsAN1.

    PubMed

    Sun, Binmei; Zhu, Zhangsheng; Cao, Panrong; Chen, Hao; Chen, Changming; Zhou, Xin; Mao, Yanhui; Lei, Jianjun; Jiang, Yanpin; Meng, Wei; Wang, Yingxi; Liu, Shaoqun

    2016-09-01

    Purple foliage always appears in Camellia sinensis families; however, the transcriptional regulation of anthocyanin biosynthesis is unknown. The tea bud sport cultivar 'Zijuan' confers an abnormal pattern of anthocyanin accumulation, resulting in a mutant phenotype that has a striking purple color in young foliage and in the stem. In this study, we aimed to unravel the underlying molecular mechanism of anthocyanin biosynthetic regulation in C. sinensis. Our results revealed that activation of the R2R3-MYB transcription factor (TF) anthocyanin1 (CsAN1) specifically upregulated the bHLH TF CsGL3 and anthocyanin late biosynthetic genes (LBGs) to confer ectopic accumulation of pigment in purple tea. We found CsAN1 interacts with bHLH TFs (CsGL3 and CsEGL3) and recruits a WD-repeat protein CsTTG1 to form the MYB-bHLH-WDR (MBW) complex that regulates anthocyanin accumulation. We determined that the hypomethylation of a CpG island in the CsAN1 promoter is associated with the purple phenotype. Furthermore, we demonstrated that low temperature and long illumination induced CsAN1 promoter demethylation, resulting in upregulated expression to promote anthocyanin accumulation in the foliage. The successful isolation of CsAN1 provides important information on the regulatory control of anthocyanin biosynthesis in C. sinensis and offers a genetic resource for the development of new varieties with enhanced anthocyanin content.

  2. Overexpression of soybean R2R3-MYB transcription factor, GmMYB12B2, and tolerance to UV radiation and salt stress in transgenic Arabidopsis.

    PubMed

    Li, X W; Wang, Y; Yan, F; Li, J W; Zhao, Y; Zhao, X; Zhai, Y; Wang, Q Y

    2016-05-25

    MYB, v-myb avian myeloblastosis viral oncogene homolog, proteins play central roles in plant stress response. Previously, we identified a novel R2R3-MYB transcription factor, GmMYB12B2, which affected the expression levels of some key enzyme genes involved in flavonoid biosynthesis in transgenic Arabidopsis. In the present study, we analyzed the expression levels of GmMYB12B2 under salt, low temperature, drought, abscisic acid (ABA), and ultraviolet (UV) radiation treatments in soybean using semi-quantitative reverse transcription polymerase chain reaction. The expression of GmMYB12B2 was drastically induced by UV irradiation and salt treatment, but no response was detected under low temperature, drought, and ABA stresses. A detailed characterization of the GmMYB12B2 overexpression lines revealed that GmMYB12B2 might be involved in response of plants to UV radiation and salt stresses. Transgenic Arabidopsis lines constitutively expressing GmMYB12B2 showed an increased tolerance to salt and UV radiation treatment compared with wild-type plants. The expression levels of certain salt stress-responsive genes, such as DREB2A and RD17, were found to be elevated in the transgenic plants. These results indicate that GmMYB12B2 acts as a regulator in the plant stress response.

  3. Occurrence of corrensite and ordered (R3) illite/smectite (I/S) in a VLGM Middle Ordovician K-bentonite from the Hamburg Klippe, central Pennsylvania

    SciTech Connect

    Krekeler, M.P.S.; Huff, W.D. . Dept. of Geology)

    1993-03-01

    Corrensite, and ordered (R3) illite/smectite was observed in the Middle Ordovician Millbrig K-bentonite and in some stratigraphically higher K-bentonites in the Hamburg Klippe. The beds occur in the Oranda formation, and according to previously published conodont color alteration index, have been subjected to a very low grade metamorphic temperatures, on the order of 300 C. Ten samples representing a vertical profile through the thickness of the Millbrig bed were examined using XRD in the less than 5.0, 2.0, 0.5, 0.2, and smaller micrometer size fractions where applicable. High resolution XRD analysis of (060) reflections of the bulk clay were used in conjunction with computer model data, to identify corrensite, and to calculate I/S ratios. A demonstrable relationship between grain size and illite percentages through the bed exists. The abundance of corrensite increases with increasing grain size within the bed. Variations in illite percentages and the volumetric abundance are thought to be related to fluid migration through the bed. Magnesium supply for the formation of corrensite probably originated from a volumetrically equivalent amount of biotite. I/S conversion to illite may be the result of Ostwald ripening in conjunction with abundant pore water.

  4. Expression of the R2R3-MYB transcription factor TaMYB14 from Trifolium arvense activates proanthocyanidin biosynthesis in the legumes Trifolium repens and Medicago sativa.

    PubMed

    Hancock, Kerry R; Collette, Vern; Fraser, Karl; Greig, Margaret; Xue, Hong; Richardson, Kim; Jones, Chris; Rasmussen, Susanne

    2012-07-01

    Proanthocyanidins (PAs) are oligomeric flavonoids and one group of end products of the phenylpropanoid pathway. PAs have been reported to be beneficial for human and animal health and are particularly important in pastoral agricultural systems for improved animal production and reduced greenhouse gas emissions. However, the main forage legumes grown in these systems, such as Trifolium repens and Medicago sativa, do not contain any substantial amounts of PAs in leaves. We have identified from the foliar PA-accumulating legume Trifolium arvense an R2R3-MYB transcription factor, TaMYB14, and provide evidence that this transcription factor is involved in the regulation of PA biosynthesis in legumes. TaMYB14 expression is necessary and sufficient to up-regulate late steps of the phenylpropanoid pathway and to induce PA biosynthesis. RNA interference silencing of TaMYB14 resulted in almost complete cessation of PA biosynthesis in T. arvense, whereas Nicotiana tabacum, M. sativa, and T. repens plants constitutively expressing TaMYB14 synthesized and accumulated PAs in leaves up to 1.8% dry matter. Targeted liquid chromatography-multistage tandem mass spectrometry analysis identified foliar PAs up to degree of polymerization 6 in leaf extracts. Hence, genetically modified M. sativa and T. repens plants expressing TaMYB14 provide a viable option for improving animal health and mitigating the negative environmental impacts of pastoral animal production systems.

  5. Magnetoelectric emission in rare-earth doped ferroelectric crystals La2Ti2O7:R3+ ( R=Er , Eu, and Nd)

    NASA Astrophysics Data System (ADS)

    Shimada, Y.; Kiyama, H.; Tokura, Y.

    2007-06-01

    The optical magnetoelectric (OME) effect, i.e., the change of optical response on the reversal of light propagation vector (k) , has been investigated for the emission of rare earth R3+ ion ( R=Nd , Eu, Er) doped in a ferroelectric La2Ti2O7 single crystal under magnetic field (H) . The symmetry condition for the appearance of the OME effect for H⊥k was confirmed by varying the relative angle between the electric polarization and magnetic field. Another tensor component of the second-order magnetolectric tensor βijk for H∥k , i.e., the magnetochiral effect, is allowed in the Faraday configuration but found to be small compared with the OME effect in the Voigt configuration. The importance of the spin-orbit coupling, the magnetic dipole transition, and the noncentrosymmetric crystal structure is discussed as the origin of the OME effect on the basis of the observed signal magnitude depending on the species of the rare-earth ion and its optical transition moment.

  6. Changing a conserved amino acid in R2R3-MYB transcription repressors results in cytoplasmic accumulation and abolishes their repressive activity in Arabidopsis.

    PubMed

    Zhou, Meiliang; Sun, Zhanmin; Wang, Chenglong; Zhang, Xinquan; Tang, Yixiong; Zhu, Xuemei; Shao, Jirong; Wu, Yanmin

    2015-10-01

    Sub-group 4 R2R3-type MYB transcription factors, including MYB3, MYB4, MYB7 and MYB32, act as repressors in phenylpropanoid metabolism. These proteins contain the conserved MYB domain and the ethylene-responsive element binding factor-associated amphiphilic repression (EAR) repression domain. Additionally, MYB4, MYB7 and MYB32 possess a putative zinc-finger domain and a conserved GY/FDFLGL motif in their C-termini. The protein 'sensitive to ABA and drought 2' (SAD2) recognizes the nuclear pore complex, which then transports the SAD2-MYB4 complex into the nucleus. Here, we show that the conserved GY/FDFLGL motif contributes to the interaction between MYB factors and SAD2. The Asp → Asn mutation in the GY/FDFLGL motif abolishes the interaction between MYB transcription factors and SAD2, and therefore they cannot be transported into the nucleus and cannot repress their target genes. We found that MYB4(D261N) loses the capacity to repress expression of the cinnamate 4-hydroxylase (C4H) gene and biosynthesis of sinapoyl malate. Our results indicate conservation among MYB transcription factors in terms of their interaction with SAD2. Therefore, the Asp → Asn mutation may be used to engineer transcription factors.

  7. Photoionization of rare gas clusters

    NASA Astrophysics Data System (ADS)

    Zhang, Huaizhen

    This thesis concentrates on the study of photoionization of van der Waals clusters with different cluster sizes. The goal of the experimental investigation is to understand the electronic structure of van der Waals clusters and the electronic dynamics. These studies are fundamental to understand the interaction between UV-X rays and clusters. The experiments were performed at the Advanced Light Source at Lawrence Berkeley National Laboratory. The experimental method employs angle-resolved time-of-flight photoelectron spectrometry, one of the most powerful methods for probing the electronic structure of atoms, molecules, clusters and solids. The van der Waals cluster photoionization studies are focused on probing the evolution of the photoelectron angular distribution parameter as a function of photon energy and cluster size. The angular distribution has been known to be a sensitive probe of the electronic structure in atoms and molecules. However, it has not been used in the case of van der Waals clusters. We carried out outer-valence levels, inner-valence levels and core-levels cluster photoionization experiments. Specifically, this work reports on the first quantitative measurements of the angular distribution parameters of rare gas clusters as a function of average cluster sizes. Our findings for xenon clusters is that the overall photon-energy-dependent behavior of the photoelectrons from the clusters is very similar to that of the corresponding free atoms. However, distinct differences in the angular distribution point at cluster-size-dependent effects were found. For krypton clusters, in the photon energy range where atomic photoelectrons have a high angular anisotropy, our measurements show considerably more isotropic angular distributions for the cluster photoelectrons, especially right above the 3d and 4p thresholds. For the valence electrons, a surprising difference between the two spin-orbit components was found. For argon clusters, we found that the

  8. Choosing the Number of Clusters in K-Means Clustering

    ERIC Educational Resources Information Center

    Steinley, Douglas; Brusco, Michael J.

    2011-01-01

    Steinley (2007) provided a lower bound for the sum-of-squares error criterion function used in K-means clustering. In this article, on the basis of the lower bound, the authors propose a method to distinguish between 1 cluster (i.e., a single distribution) versus more than 1 cluster. Additionally, conditional on indicating there are multiple…

  9. Animation of the Phoenix Cluster

    NASA Video Gallery

    This animation shows how large numbers of stars form in the Phoenix Cluster. It begins by showing several galaxies in the cluster and hot gas (in red). This hot gas contains more normal matter than...

  10. Photoelectron spectroscopy of molecular clusters

    NASA Astrophysics Data System (ADS)

    Zhang, Xu; Pitts, Jonathan; Zheng, Chaowen; Knee, Joseph L.

    1995-09-01

    High resolution photoelectron spectroscopy is applied to the study of molecular clusters. The primary species studied are fluorene-Arn complexes. Spectroscopy of the neutral S1 state has been performed on clusters as large as n equals 30. In order to study the photoelectron spectra of the clusters size selectively mass analyzed threshold ionization (MATI) is used which is a mass resolved version of the ZEKE technique. MATI spectroscopy has been applied to clusters up to n equals 5. The spectral shifts in the S1 origin and ion threshold are used as a measure of the relative stability of the different clusters. Using previous experimental and theoretical work on related clusters the structures of the clusters are inferred from the observed spectral shifts. In some cases multiple conformations of a particular cluster size are identified.

  11. Nuclear Cluster Aspects in Astrophysics

    NASA Astrophysics Data System (ADS)

    Kubono, Shigeru

    2010-03-01

    The role of nuclear clustering is discussed for nucleosynthesis in stellar evolution with Cluster Nucleosynthesis Diagram (CND) proposed before. Special emphasis is placed on α-induced stellar reactions together with molecular states for O and C burning.

  12. Observations of Distant Clusters

    NASA Technical Reports Server (NTRS)

    Donahue, Megan

    2004-01-01

    The is the proceedings and papers supported by the LTSA grant: Homer, D. J.\\& Donahue, M. 2003, in "The Emergence of Cosmic Structure": 13'h Astrophysics Conference Proceedings, Vol. 666,3 1 1-3 14, (AIP). Baumgartner, W. H., Loewenstein, M., Horner, D. J., Mushotzky, R. F. 2003, HEAD- AAS, 35.3503. Homer, D. J. , Donahue, M., Voit G. M. 2003, HEAD-AAS, 35.1309. Nowak, M. A., Smith, B., Donahue, M., Stocke, J. 2003, HEAD-AAS, 35.1316. Scott, D., Borys, C., Chapman, S. C., Donahue, M., Fahlman, G. G., Halpem, M. Newbury, P. 2002, AAS, 128.01. Jones, L. R. et al. 2002, A new era in cosmology, ASP Conference Proceedings, Vol. 283, p. 223 Donahue, M., Daly, R. A., Homer, D. J. 2003, ApJ, 584, 643, Constraints on the Cluster Environments and Hotspot magnetic field strengths for radio sources 3280 and 3254. Donahue, M., et al. 2003, ApJ, 598, 190. The mass, baryonic fraction, and x-ray temperature of the luminous, high-redshift cluster of galaxies MS045 1.6-0305 Perlman, E. S. et al. 2002, ApJS, 140, 256. Smith, B. J., Nowak, M., Donahue, M., Stocke, J. 2003, AJ, 126, 1763. Chandra Observations of the Interacting NGC44 10 Group of Galaxies. Postman, M., Lauer, T. R., Oegerle, W., Donahue, M. 2002, ApJ, 579, 93. The KPNO/deep-range cluster survey I. The catalog and space density of intermediate-redshift clusters. Molnar, S. M., Hughes, J. P., Donahue, M., Joy, M. 2002, ApJ, 573, L91, Chandra Observations of Unresolved X-Ray Sources around Two Clusters of Galaxies. Donahue, M., Mack, J., 2002 NewAR, 46, 155, HST NIcmos and WFPC2 observations of molecular hydrogen and dust around cooling flows. Koekemoer, A. M. et al. 2002 NewAR, 46, 149, Interactions between the A2597 central radio source and dense gas host galaxy. Donahue, M. et al. 2002 ApJ, 569,689, Distant cluster hunting II.

  13. The Orion nebula star cluster

    NASA Technical Reports Server (NTRS)

    Panek, R. J.

    1982-01-01

    Photography through filters which suppress nebular light reveal a clustering of faint red stars centered on the Trapezium, this evidences a distinct cluster within the larger OB1 association. Stars within about 20 ft of trapezium comprise the Orion Nebula star cluster are considered. Topics discussed re: (1) extinction by dust grains; (2) photometric peculiarities; (3) spectroscopic peculiarities; (4) young variables; (5) the distribution and motion of gas within the cluster.

  14. Massive star clusters in galaxies.

    PubMed

    Harris, William E

    2010-02-28

    The ensemble of all star clusters in a galaxy constitutes its star cluster system. In this review, the focus of the discussion is on the ability of star clusters, particularly the systems of old massive globular clusters (GCs), to mark the early evolutionary history of galaxies. I review current themes and key findings in GC research, and highlight some of the outstanding questions that are emerging from recent work.

  15. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, James F.; Furuya, Frederic R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  16. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.; Furuya, F.R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  17. Adaptive Clustering of Hypermedia Documents.

    ERIC Educational Resources Information Center

    Johnson, Andrew; Fotouhi, Farshad

    1996-01-01

    Discussion of hypermedia systems focuses on a comparison of two types of adaptive algorithm (genetic algorithm and neural network) in clustering hypermedia documents. These clusters allow the user to index into the nodes to find needed information more quickly, since clustering is "personalized" based on the user's paths rather than…

  18. Connecting Remote Clusters with ATM

    SciTech Connect

    Hu, T.C.; Wyckoff, P.S.

    1998-10-01

    Sandia's entry into utilizing clusters of networked workstations is called Computational Plant or CPlant for short. The design of CPlant uses Ethernet to boot the individual nodes, Myrinet to communicate within a node cluster, and ATM to connect between remote clusters. This SAND document covers the work done to enable the use of ATM on the CPlant nodes in the Fall of 1997.

  19. Stellar populations in star clusters

    NASA Astrophysics Data System (ADS)

    Li, Cheng-Yuan; de Grijs, Richard; Deng, Li-Cai

    2016-12-01

    Stellar populations contain the most important information about star cluster formation and evolution. Until several decades ago, star clusters were believed to be ideal laboratories for studies of simple stellar populations (SSPs). However, discoveries of multiple stellar populations in Galactic globular clusters have expanded our view on stellar populations in star clusters. They have simultaneously generated a number of controversies, particularly as to whether young star clusters may have the same origin as old globular clusters. In addition, extensive studies have revealed that the SSP scenario does not seem to hold for some intermediate-age and young star clusters either, thus making the origin of multiple stellar populations in star clusters even more complicated. Stellar population anomalies in numerous star clusters are well-documented, implying that the notion of star clusters as true SSPs faces serious challenges. In this review, we focus on stellar populations in massive clusters with different ages. We present the history and progress of research in this active field, as well as some of the most recent improvements, including observational results and scenarios that have been proposed to explain the observations. Although our current ability to determine the origin of multiple stellar populations in star clusters is unsatisfactory, we propose a number of promising projects that may contribute to a significantly improved understanding of this subject.

  20. Subspace K-means clustering.

    PubMed

    Timmerman, Marieke E; Ceulemans, Eva; De Roover, Kim; Van Leeuwen, Karla

    2013-12-01

    To achieve an insightful clustering of multivariate data, we propose subspace K-means. Its central idea is to model the centroids and cluster residuals in reduced spaces, which allows for dealing with a wide range of cluster types and yields rich interpretations of the clusters. We review the existing related clustering methods, including deterministic, stochastic, and unsupervised learning approaches. To evaluate subspace K-means, we performed a comparative simulation study, in which we manipulated the overlap of subspaces, the between-cluster variance, and the error variance. The study shows that the subspace K-means algorithm is sensitive to local minima but that the problem can be reasonably dealt with by using partitions of various cluster procedures as a starting point for the algorithm. Subspace K-means performs very well in recovering the true clustering across all conditions considered and appears to be superior to its competitor methods: K-means, reduced K-means, factorial K-means, mixtures of factor analyzers (MFA), and MCLUST. The best competitor method, MFA, showed a performance similar to that of subspace K-means in easy conditions but deteriorated in more difficult ones. Using data from a study on parental behavior, we show that subspace K-means analysis provides a rich insight into the cluster characteristics, in terms of both the relative positions of the clusters (via the centroids) and the shape of the clusters (via the within-cluster residuals).

  1. Toward Parallel Document Clustering

    SciTech Connect

    Mogill, Jace A.; Haglin, David J.

    2011-09-01

    A key challenge to automated clustering of documents in large text corpora is the high cost of comparing documents in a multimillion dimensional document space. The Anchors Hierarchy is a fast data structure and algorithm for localizing data based on a triangle inequality obeying distance metric, the algorithm strives to minimize the number of distance calculations needed to cluster the documents into “anchors” around reference documents called “pivots”. We extend the original algorithm to increase the amount of available parallelism and consider two implementations: a complex data structure which affords efficient searching, and a simple data structure which requires repeated sorting. The sorting implementation is integrated with a text corpora “Bag of Words” program and initial performance results of end-to-end a document processing workflow are reported.

  2. Fractal polyzirconosiloxane cluster coatings

    SciTech Connect

    Sugama, T.

    1992-08-01

    Fractal polyzirconosiloxane (PZS) cluster films were prepared through the hydrolysis-polycondensation-pyrolysis synthesis of two-step HCl acid-NaOH base catalyzed sol precursors consisting of N-[3-(triethoxysilyl)propyl]-4,5-dihydroimidazole, Zr(OC{sub 3}H{sub 7}){sub 4}, methanol, and water. When amorphous PZSs were applied to aluminum as protective coatings against NaCl-induced corrosion, the effective film was that derived from the sol having a pH near the isoelectric point in the positive zeta potential region. The following four factors played an important role in assembling the protective PZS coating films: (1) a proper rate of condensation, (2) a moderate ratio of Si-O-Si to Si-O-Zr linkages formed in the PZS network, (3) hydrophobic characteristics, and (4) a specific microstructural geometry, in which large fractal clusters were linked together.

  3. Fractal polyzirconosiloxane cluster coatings

    SciTech Connect

    Sugama, T.

    1992-01-01

    Fractal polyzirconosiloxane (PZS) cluster films were prepared through the hydrolysis-polycondensation-pyrolysis synthesis of two-step HCl acid-NaOH base catalyzed sol precursors consisting of N-(3-(triethoxysilyl)propyl)-4,5-dihydroimidazole, Zr(OC{sub 3}H{sub 7}){sub 4}, methanol, and water. When amorphous PZSs were applied to aluminum as protective coatings against NaCl-induced corrosion, the effective film was that derived from the sol having a pH near the isoelectric point in the positive zeta potential region. The following four factors played an important role in assembling the protective PZS coating films: (1) a proper rate of condensation, (2) a moderate ratio of Si-O-Si to Si-O-Zr linkages formed in the PZS network, (3) hydrophobic characteristics, and (4) a specific microstructural geometry, in which large fractal clusters were linked together.

  4. Hydrated hydride anion clusters

    NASA Astrophysics Data System (ADS)

    Lee, Han Myoung; Kim, Dongwook; Singh, N. Jiten; Kołaski, Maciej; Kim, Kwang S.

    2007-10-01

    On the basis of density functional theory (DFT) and high level ab initio theory, we report the structures, binding energies, thermodynamic quantities, IR spectra, and electronic properties of the hydride anion hydrated by up to six water molecules. Ground state DFT molecular dynamics simulations (based on the Born-Oppenheimer potential surface) show that as the temperature increases, the surface-bound hydride anion changes to the internally bound structure. Car-Parrinello molecular dynamics simulations are also carried out for the spectral analysis of the monohydrated hydride. Excited-state ab initio molecular dynamics simulations show that the photoinduced charge-transfer-to-solvent phenomena are accompanied by the formation of the excess electron-water clusters and the detachment of the H radical from the clusters. The dynamics of the detachment process of a hydrogen radical upon the excitation is discussed.

  5. Clusters of Galaxies

    NASA Astrophysics Data System (ADS)

    Huchtmeier, W. K.; Richter, O. G.; Materne, J.

    1981-09-01

    The large-scale structure of the universe is dominated by clustering. Most galaxies seem to be members of pairs, groups, clusters, and superclusters. To that degree we are able to recognize a hierarchical structure of the universe. Our local group of galaxies (LG) is centred on two large spiral galaxies: the Andromeda nebula and our own galaxy. Three sr:naller galaxies - like M 33 - and at least 23 dwarf galaxies (KraanKorteweg and Tammann, 1979, Astronomische Nachrichten, 300, 181) can be found in the evironment of these two large galaxies. Neighbouring groups have comparable sizes (about 1 Mpc in extent) and comparable numbers of bright members. Small dwarf galaxies cannot at present be observed at great distances.

  6. Binaries in globular clusters

    NASA Technical Reports Server (NTRS)

    Hut, Piet; Mcmillan, Steve; Goodman, Jeremy; Mateo, Mario; Phinney, E. S.; Pryor, Carlton; Richer, Harvey B.; Verbunt, Frank; Weinberg, Martin

    1992-01-01

    Recent observations have shown that globular clusters contain a substantial number of binaries most of which are believed to be primordial. We discuss different successful optical search techniques, based on radial-velocity variables, photometric variables, and the positions of stars in the color-magnitude diagram. In addition, we review searches in other wavelengths, which have turned up low-mass X-ray binaries and more recently a variety of radio pulsars. On the theoretical side, we give an overview of the different physical mechanisms through which individual binaries evolve. We discuss the various simulation techniques which recently have been employed to study the effects of a primordial binary population, and the fascinating interplay between stellar evolution and stellar dynamics which drives globular-cluster evolution.

  7. CLUTO - A Clustering Toolkit

    DTIC Science & Technology

    2002-04-23

    061W Y C R 062W spo0 spo30 spo2 spo5 spo7 spo9 spo11 cluster 0 E F B 1 Y A L004W S S A 1 M D M 10 C Y S 3 N T G 1 Y A L018C M A K 16 F U N 19 F U N 12...013C H S P 30 C R Y 1 A R E 1 P W P 2 Y C R 056W P W P 2 Y C R 061W Y C R 062W spo0 spo30 spo2 spo5 spo7 spo9 spo11 cluster 0 (b) (a) Figure 12

  8. Basic cluster compression algorithm

    NASA Technical Reports Server (NTRS)

    Hilbert, E. E.; Lee, J.

    1980-01-01

    Feature extraction and data compression of LANDSAT data is accomplished by BCCA program which reduces costs associated with transmitting, storing, distributing, and interpreting multispectral image data. Algorithm uses spatially local clustering to extract features from image data to describe spectral characteristics of data set. Approach requires only simple repetitive computations, and parallel processing can be used for very high data rates. Program is written in FORTRAN IV for batch execution and has been implemented on SEL 32/55.

  9. Improved graph clustering

    DTIC Science & Technology

    2013-01-01

    optimization problem (2)–(3) is convex and can 1We adopt the convention that yii = 1 for any node i that belongs to a cluster. 2We assume aii = 1 for all i. 3The...relaxations: The formulation (2)–(3) is not the only way to relax the non - convex ML estimator. Instead of the nuclear norm regularizer, a hard constraint ...presented a convex optimization formulation, essentially a convexification of the maximum likelihood estimator. Our theoretic analysis shows that this

  10. Dial-A-Cluster

    SciTech Connect

    Martin, Shawn; Quach, Tu-Toan

    2016-09-14

    Dial-A-Cluster is a web application that can be used to interactively analyze multi-variate time series data. It supports multiple users, DOE markings, and user authentication. It is designed to let the user adjust the influence of particular time series in the dataset, interact with the resulting dimension reduced visualization, interact with the time series themselves, and look for correlations of the data with any available meta-data.

  11. Cosmology, Clusters and Calorimeters

    NASA Technical Reports Server (NTRS)

    Figueroa-Feliciano, Enectali

    2005-01-01

    I will review the current state of Cosmology with Clusters and discuss the application of microcalorimeter arrays to this field. With the launch of Astro-E2 this summer and a slew of new missions being developed, microcalorimeters are the next big thing in x-ray astronomy. I will cover the basics and not-so-basic concepts of microcalorimeter designs and look at the future to see where this technology will go.

  12. SBA Innovation Clusters

    DTIC Science & Technology

    2012-03-02

    Health Information Technology Cluster Health Information Technology 9 FL - Space Coast Clean Energy Jobs Accelerator Clean Energy 10 WI - Milwaukee...helping businesses that develop and commercialize clean energy technology • Helping Manufacturers and Businesses adopt Green Practices with DoC, DoE...serve energy businesses • Since 2010 : 173 Loans totaling $357M • Investments in Clean Energy Businesses – Impact Investment Initiative – Startup America

  13. GacS-dependent production of 2R, 3R-butanediol by Pseudomonas chlororaphis O6 is a major determinant for eliciting systemic resistance against Erwinia carotovora but not against Pseudomonas syringae pv. tabaci in tobacco.

    PubMed

    Han, Song Hee; Lee, Seung Je; Moon, Jae Hak; Park, Keun Hyung; Yang, Kwang Yeol; Cho, Balk Ho; Kim, Kil Yong; Kim, Yong Whan; Lee, Myung Chul; Anderson, Anne J; Kim, Young Cheol

    2006-08-01

    Root colonization by a plant-beneficial rhizobacterium, Pseudomonas chlororaphis O6, induces disease resistance in tobacco against leaf pathogens Erwinia carotovora subsp. carotovora SCC1, causing soft-rot, and Pseudomonas syringae pv. tabaci, causing wildfire. In order to identify the bacterial determinants involved in induced systemic resistance against plant diseases, extracellular components produced by the bacterium were fractionated and purified. Factors in the culture filtrate inducing systemic resistance were retained in the aqueous fraction rather than being partitioned into ethyl acetate. Fractionation on high-performance liquid chromatography followed by nuclear magnetic resonance mass spectrometry analysis identified the active compound as 2R, 3R-butanediol. 2R, 3R butanediol induced systemic resistance in tobacco to E. carotovora subsp. carotovora SCC1, but not to P. syringae pv. tabaci. Treatment of tobacco with the volatile 2R, 3R-butanediol enhanced aerial growth, a phenomenon also seen in plants colonized by P. chlororaphis O6. The isomeric form of the butanediol was important because 2S, 3S-butandiol did not affect the plant. The global sensor kinase, GacS, of P. chlororaphis O6 was a key regulator for induced systemic resistance against E. carotovora through regulation of 2R, 3R-butanediol production. This is the first report of the production of these assumed fermentation products by a pseudomonad and the role of the sensor kinase GacS in production of 2R, 3R-butanediol.

  14. Astrophysics of galaxy clusters

    NASA Astrophysics Data System (ADS)

    Ettori, Stefano

    2016-07-01

    As the nodes of the cosmic web, clusters of galaxies trace the large-scale distribution of matter in the Universe. They are thus privileged sites in which to investigate the complex physics of structure formation. However, the complete story of how these structures grow, and how they dissipate the gravitational and non-thermal components of their energy budget over cosmic time, is still beyond our grasp. Most of the baryons gravitationally bound to the cluster's halo is in the form of a diffuse, hot, metal-enriched plasma that radiates primarily in the X-ray band. X-ray observations of the evolving cluster population provide a unique opportunity to address such fundamental open questions as: How do hot diffuse baryons accrete and dynamically evolve in dark matter potentials? How and when was the energy that we observe in the ICM generated and distributed? Where and when are heavy elements produced and how are they circulated? We will present the ongoing activities to define the strategy on how an X-ray observatory with large collecting area and an unprecedented combination of high spectral and angular resolution, such as Athena, can address these questions.

  15. The potato developer (D) locus encodes an R2R3 MYB transcription factor that regulates expression of multiple anthocyanin structural genes in tuber skin.

    PubMed

    Jung, Chun Suk; Griffiths, Helen M; De Jong, Darlene M; Cheng, Shuping; Bodis, Mary; Kim, Tae Sung; De Jong, Walter S

    2009-12-01

    A dominant allele at the D locus (also known as I in diploid potato) is required for the synthesis of red and purple anthocyanin pigments in tuber skin. It has previously been reported that D maps to a region of chromosome 10 that harbors one or more homologs of Petunia an2, an R2R3 MYB transcription factor that coordinately regulates the expression of multiple anthocyanin biosynthetic genes in the floral limb. To test whether D acts similarly in tuber skin, RT-PCR was used to evaluate the expression of flavanone 3-hydroxylase (f3h), dihydroflavonol 4-reductase (dfr) and flavonoid 3',5'-hydroxylase (f3'5'h). All three genes were expressed in the periderm of red- and purple-skinned clones, while dfr and f3'5'h were not expressed, and f3h was only weakly expressed, in white-skinned clones. A potato cDNA clone with similarity to an2 was isolated from an expression library prepared from red tuber skin, and an assay developed to distinguish the two alleles of this gene in a diploid potato clone known to be heterozygous Dd. One allele was observed to cosegregate with pigmented skin in an F(1) population of 136 individuals. This allele was expressed in tuber skin of red- and purple-colored progeny, but not in white tubers, while other parental alleles were not expressed in white or colored tubers. The allele was placed under the control of a doubled 35S promoter and transformed into the light red-colored cultivar Désirée, the white-skinned cultivar Bintje, and two white diploid clones known to lack the functional allele of D. Transformants accumulated pigment in tuber skin, as well as in other tissues, including young foliage, flower petals, and tuber flesh.

  16. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine1

    PubMed Central

    Cavallini, Erika; Matus, José Tomás; Finezzo, Laura; Zenoni, Sara; Loyola, Rodrigo; Guzzo, Flavia; Schlechter, Rudolf; Ageorges, Agnès; Arce-Johnson, Patricio

    2015-01-01

    Because of the vast range of functions that phenylpropanoids possess, their synthesis requires precise spatiotemporal coordination throughout plant development and in response to the environment. The accumulation of these secondary metabolites is transcriptionally controlled by positive and negative regulators from the MYB and basic helix-loop-helix protein families. We characterized four grapevine (Vitis vinifera) R2R3-MYB proteins from the C2 repressor motif clade, all of which harbor the ethylene response factor-associated amphiphilic repression domain but differ in the presence of an additional TLLLFR repression motif found in the strong flavonoid repressor Arabidopsis (Arabidopsis thaliana) AtMYBL2. Constitutive expression of VvMYB4a and VvMYB4b in petunia (Petunia hybrida) repressed general phenylpropanoid biosynthetic genes and selectively reduced the amount of small-weight phenolic compounds. Conversely, transgenic petunia lines expressing VvMYBC2-L1 and VvMYBC2-L3 showed a severe reduction in petal anthocyanins and seed proanthocyanidins together with a higher pH of crude petal extracts. The distinct function of these regulators was further confirmed by transient expression in tobacco (Nicotiana benthamiana) leaves and grapevine plantlets. Finally, VvMYBC2-L3 was ectopically expressed in grapevine hairy roots, showing a reduction in proanthocyanidin content together with the down-regulation of structural and regulatory genes of the flavonoid pathway as revealed by a transcriptomic analysis. The physiological role of these repressors was inferred by combining the results of the functional analyses and their expression patterns in grapevine during development and in response to ultraviolet B radiation. Our results indicate that VvMYB4a and VvMYB4b may play a key role in negatively regulating the synthesis of small-weight phenolic compounds, whereas VvMYBC2-L1 and VvMYBC2-L3 may additionally fine tune flavonoid levels, balancing the inductive effects of

  17. Enzymatic degradation processes of lamellar crystals in thin films for poly[(R)-3-hydroxybutyric acid] and its copolymers revealed by real-time atomic force microscopy.

    PubMed

    Numata, Keiji; Hirota, Takuya; Kikkawa, Yoshihiro; Tsuge, Takeharu; Iwata, Tadahisa; Abe, Hideki; Doi, Yoshiharu

    2004-01-01

    Enzymatic degradation processes of flat-on lamellar crystals in melt-crystallized thin films of poly[(R)-3-hydroxybutyric acid] (P(3HB)) and its copolymers were characterized by real-time atomic force microscopy (AFM) in a phosphate buffer solution containing PHB depolymerase from Ralstonia pickettii T1. Fiberlike crystals with regular intervals were generated along the crystallographic a axis at the end of lamellar crystals during the enzymatic degradation. The morphologies and sizes of the fiberlike crystals were markedly dependent on the compositions of comonomer units in the polyesters. Length, width, interval, and thickness of the fiberlike crystals after the enzymatic degradation for 2 h were measured by AFM, and the dimensions were related to the solid-state structures of P(3HB) and its copolymers. The width and thickness decreased at the tip of fiberlike crystals, indicating that the enzymatic degradation of crystals takes place not only along the a axis but also along the b and c axes. These results from AFM measurement were compared with the data on crystal size by wide-angle X-ray diffraction, and on lamellar thickness and long period by small-angle X-ray scattering. In addition, the enzymatic erosion rate of flat-on lamellar crystals along the a axis was measured from real-time AFM height images. A schematic glacier model for the enzymatic degradation of flat-on lamellar crystals of P(3HB) by PHB depolymerase has been proposed on the basis of the AFM observations.

  18. Integrated pharmacokinetic-pharmacodynamic modeling and allometric scaling for optimizing the dosage regimen of the monoclonal ior EGF/r3 antibody.

    PubMed

    Duconge, Jorge; Castillo, Rubén; Crombet, Tania; Alvarez, Daniel; Matheu, Janet; Vecino, Gloria; Alonso, Katia; Beausoleil, Irene; Valenzuela, Carmen; Becquer, Maria A; Fernández-Sánchez, Eduardo

    2004-02-01

    The multiple-dose strategy with the monoclonal ior EGF/r3 antibody, in xenograft bearing nude mice, was supported upon the basis of its integrated pharmacokinetic-pharmacodynamic relationship, according to both the temporal (K(e0)=0.0015+/-0.000035h(-1)) and the time-independent sensitivity (C(50%)(ss), 9.23+/-0.17microg/ml; C(max,eff)(ss), 12.5microg/ml) components of its tumor growth delay action. This relationship was consistent with a sigmoidal E(max) pharmacodynamic model postulating a hypothetical effect compartment that permits us to estimate an effective steady-state concentration range (7.5-12microg/ml). Using this information we calculated both the cumulative and non-cumulative dosage regimens to compare their response patterns with respect to the control group. It follows that the differences in the estimated tumor growth inhibition ratio were statistically significant between the control group and either of the treated ones (P<0.05). The median survival time in treated mice under non-cumulative regimen (72+/-10 days), predicted an increase in this parameter as compared to the control one (55+/-6 days). Finally, using the allometric paradigm, the empiric power equation for dose scaling across mammalian species allowed the calculation of the dosage schedule for further clinical trial. The estimated maintenance dose in human (70kg) was 200mg/m(2) to be given weekly, and the corresponding loading dose was 600mg/m(2).

  19. Divergent selection drives genetic differentiation in an R2R3-MYB transcription factor that contributes to incipient speciation in Mimulus aurantiacus.

    PubMed

    Streisfeld, Matthew A; Young, Wambui N; Sobel, James M

    2013-03-01

    Identifying the molecular genetic basis of traits contributing to speciation is of crucial importance for understanding the ecological and evolutionary mechanisms that generate biodiversity. Despite several examples describing putative "speciation genes," it is often uncertain to what extent these genetic changes have contributed to gene flow reductions in nature. Therefore, considerable interest lies in characterizing the molecular basis of traits that actively confer reproductive isolation during the early stages of speciation, as these loci can be attributed directly to the process of divergence. In Southern California, two ecotypes of Mimulus aurantiacus are parapatric and differ primarily in flower color, with an anthocyanic, red-flowered morph in the west and an anthocyanin-lacking, yellow-flowered morph in the east. Evidence suggests that the genetic changes responsible for this shift in flower color have been essential for divergence and have become fixed in natural populations of each ecotype due to almost complete differences in pollinator preference. In this study, we demonstrate that a cis-regulatory mutation in an R2R3-MYB transcription factor results in differential regulation of enzymes in the anthocyanin biosynthetic pathway and is the major contributor to differences in floral pigmentation. In addition, molecular population genetic data show that, despite gene flow at neutral loci, divergent selection has driven the fixation of alternate alleles at this gene between ecotypes. Therefore, by identifying the genetic basis underlying ecologically based divergent selection in flower color between these ecotypes, we have revealed the ecological and functional mechanisms involved in the evolution of pre-mating isolation at the early stages of incipient speciation.

  20. Overexpression of a R2R3 MYB gene MdSIMYB1 increases tolerance to multiple stresses in transgenic tobacco and apples.

    PubMed

    Wang, Rong-Kai; Cao, Zhong-Hui; Hao, Yu-Jin

    2014-01-01

    MYB transcription factors (TFs) involve in plant abiotic stress tolerance and response in various plant species. In this study, rapid amplification of cDNA ends (RACE) was conducted to isolate the R2R3-MYB TF gene MdSIMYB1 from apples (Malus × domestica). The gene transcripts were abundant in the leaves, flowers and fruits, compared to other organs, and were induced by abiotic stresses and plant hormones. We observed the subcellular localization of an MdSIMYB1-GFP fusion protein in the nucleus. Furthermore, the MdSIMYB1 gene was introduced into the tobacco genome and ectopically expressed in transgenic lines. The results indicate that MdSIMYB1 transgenic tobacco seed germination is insensitive to abscisic acid and NaCl treatment. Additionally, it was found that the ectopic expression of MdSIMYB1 enhanced the tolerance of plants to high salinity, drought and cold tolerance by upregulating the stress-responsive genes NtDREB1A, NtERD10B and NtERD10C. Meanwhile, the transgenic tobacco exhibited robust root growth because of the enhanced expression of the auxin-responsive genes NtIAA4.2, NtIAA4.1 and NtIAA2.5 under stress conditions, which is conducive to stress tolerance. Finally, transgenic apple lines were obtained and tested. Transgenic apple lines that were overexpressing MdSIMYB1 exhibited a higher tolerance to abiotic stress than the wild-type control, but suppression of MdSIMYB1 resulted in lower tolerance. Our results indicate that MdSIMYB1 may be utilized as a target gene for enhancing stress tolerance in important crops.

  1. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells.

    PubMed

    Wauson, Eric M; Guerra, Marcy L; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M; Cobb, Melanie H

    2015-08-01

    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that G(I) is not central to either pathway. Although glucagon-like peptide 1, an agonist for a G(s-)coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca(2+) entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective G(q) inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for G(q). Inhibition of G(12/13) by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways.

  2. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells

    PubMed Central

    Wauson, Eric M.; Guerra, Marcy L.; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M.

    2015-01-01

    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that Gi is not central to either pathway. Although glucagon-like peptide 1, an agonist for a Gs-coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca2+ entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective Gq inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for Gq. Inhibition of G12/13 by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways. PMID:26168033

  3. Tumor targeting using anti-epidermal growth factor receptor (ior egf/r3) immunoconjugate with a tetraaza macrocyclic agent (DO3A-EA).

    PubMed

    Mishra, Gauri; Panwar, Puja; Mishra, Anil K

    2012-01-01

    Epidermal growth factor receptor (EGFR) signaling inhibition represents a highly promising arena for the application of molecularly targeted cancer therapies. EGFR conjugated metal chelates have been proposed as potential imaging agents for cancers that overexpress EGFR receptors. Through improved understanding of EGFR biology in human cancers, there is anticipation that more tumor-selective therapy approaches with diminished collateral normal tissue toxicity can be advanced. We report here on the results with a thermodynamically stable chelate, 1,4,7-tris(carboxymethyl)-10-(2-aminoethyl)-1,4,7,10-tetraazacyclododecane (DO3A-EA) and anti-EGFr (ior egf/r3) conjugate to develop immunospecific imaging agent. Conjugation and labelling with anti-EGFr was performed using standard procedure and subjected to purification on size exclusion chromatography. The conjugated antibodies were labeled with a specific activity 20-30 mCi/mg of protein. Labeling efficiencies were measured by ascending paper chromatography on ITLC-SG strips. Radiolabeling of the immunoconjugate was found to be 98.5 ± 0.30%. (99m)Tc-DO3A-EA-EGFr conjugate was studied in athymic mice bearing U-87MG, MDA-MB-468 tumors following intravenous injection. Pharmacokinetic and biodistribution studies confirmed long circulation times (t(1/2)(fast)  =  45 min and t1/2(slow)  = 4 hours 40 min) and efficient accumulation in tumors. Biodistribution studies in athymic mice grafted with U-87MG human glioblastoma multiforme and Hela human cervical carcinoma tumors revealed significant localization of (99m)Tc-labeled antibodies conjugate in tumors and reduced accumulation in normal organs. This new chelating agent is promising for immunoscintigraphy since good tumour-to-normal organ contrast could be demonstrated. These properties can be exploited for immunospecifc contrast agents in nuclear medicine and SPECT imaging.

  4. Arabidopsis R2R3-MYB transcription factor AtMYB60 functions as a transcriptional repressor of anthocyanin biosynthesis in lettuce (Lactuca sativa)

    PubMed Central

    Park, Jong-Sug; Kim, Jung-Bong; Cho, Kang-Jin; Cheon, Choong-Ill; Sung, Mi-Kyung; Choung, Myoung-Gun

    2008-01-01

    The MYB transcription factors play important roles in the regulation of many secondary metabolites at the transcriptional level. We evaluated the possible roles of the Arabidopsis R2R3-MYB transcription factors in flavonoid biosynthesis because they are induced by UV-B irradiation but their associated phenotypes are largely unexplored. We isolated their genes by RACE-PCR, and performed transgenic approach and metabolite analyses in lettuce (Lactuca sativa). We found that one member of this protein family, AtMYB60, inhibits anthocyanin biosynthesis in the lettuce plant. Wild-type lettuce normally accumulates anthocyanin, predominantly cyanidin and traces of delphinidin, and develops a red pigmentation. However, the production and accumulation of anthocyanin pigments in AtMYB60-overexpressing lettuce was inhibited. Using RT-PCR analysis, we also identified the complete absence or reduction of dihydroflavonol 4-reductase (DFR) transcripts in AtMYB60- overexpressing lettuce (AtMYB60-117 and AtMYB60-112 lines). The correlation between the overexpression of AtMYB60 and the inhibition of anthocyanin accumulation suggests that the transcription factorAtMYB60 controls anthocyanin biosynthesis in the lettuce leaf. Clarification of the roles of the AtMYB60 transcription factor will facilitate further studies and provide genetic tools to better understand the regulation in plants of the genes controlled by the MYB-type transcription factors. Furthermore, the characterization of AtMYB60 has implications for the development of new varieties of lettuce and other commercially important plants with metabolic engineering approaches. PMID:18317777

  5. Quantum mechanical interpretation of intermolecular vibrational modes of crystalline poly-(R)-3-hydroxybutyrate observed in low-frequency Raman and terahertz spectra.

    PubMed

    Yamamoto, Shigeki; Morisawa, Yusuke; Sato, Harumi; Hoshina, Hiromichi; Ozaki, Yukihiro

    2013-02-21

    Low-frequency vibrational bands observed in the Raman and terahertz (THz) spectra in the region of 50-150 cm(-1) of crystalline powder poly-(R)-3-hydroxybutyrate (PHB) were assigned based on comparisons of the Raman and THz spectra, polarization directions of THz absorption spectra, and their congruities to quantum mechanically (QM) calculated spectra. This combination, Raman and THz spectroscopies and the QM simulations, has been rarely adopted in spite of its potential of reliable assignments of the vibrational bands. The QM simulation of a spectrum has already been popular in vibrational spectroscopies, but for low-frequency bands of polymers it is still a difficult task due to its large scales of systems and a fact that interactions among polymer chains should be considered in the calculation. In this study, the spectral calculations with the aid of the Cartesian-coordinate tensor transfer (CCT) method were applied successfully to the crystalline PHB, which include the explicit consideration of an intermolecular interaction among helical polymer chains. The agreements between the calculations and the experiments are good in both the Raman and THz spectra in terms of spectral shapes, frequencies, and intensities. A Raman active band at 79 cm(-1) was assigned to the intermolecular vibrational mode of the out-of-plane C═O + CH(3) vibration. A polarization state of the corresponding far-infrared absorption band at ∼82 cm(-1), perpendicular to the helix-elongation direction of PHB, was reproduced only under the explicit correction, which indicates that this polarized band originates from the interaction among the polymer chains. The calculation explored that the polarization direction of this band was along the a axis, which is consistent with the direction in which weak intermolecular hydrogen bonds are suggested between the C═O and CH(3) groups of two parallel polymer chains. The results obtained here have confirmed sensitivity of the low

  6. Effects of mutations in the substrate-binding domain of poly[(R)-3-hydroxybutyrate] (PHB) depolymerase from Ralstonia pickettii T1 on PHB degradation.

    PubMed

    Hiraishi, Tomohiro; Hirahara, Yoko; Doi, Yoshiharu; Maeda, Mizuo; Taguchi, Seiichi

    2006-11-01

    Poly[(R)-3-hydroxybutyrate] (PHB) depolymerase from Ralstonia pickettii T1 (PhaZ(RpiT1)) adsorbs to denatured PHB (dPHB) via its substrate-binding domain (SBD) to enhance dPHB degradation. To evaluate the amino acid residues participating in dPHB adsorption, PhaZ(RpiT1) was subjected to a high-throughput screening system consisting of PCR-mediated random mutagenesis targeted to the SBD gene and a plate assay to estimate the effects of mutations in the SBD on dPHB degradation by PhaZ(RpiT1). Genetic analysis of the isolated mutants with lowered activity showed that Ser, Tyr, Val, Ala, and Leu residues in the SBD were replaced by other residues at high frequency. Some of the mutant enzymes, which contained the residues replaced at high frequency, were applied to assays of dPHB degradation and adsorption, revealing that those residues are essential for full activity of both dPHB degradation and adsorption. These results suggested that PhaZ(RpiT1) adsorbs on the surface of dPHB not only via hydrogen bonds between hydroxyl groups of Ser in the enzyme and carbonyl groups in the PHB polymer but also via hydrophobic interaction between hydrophobic residues in the enzyme and methyl groups in the PHB polymer. The L441H enzyme, which displayed lower dPHB degradation and adsorption abilities, was purified and applied to a dPHB degradation assay to compare it with the wild-type enzyme. The kinetic analysis of the dPHB degradation suggested that lowering the affinity of the SBD towards dPHB causes a decrease in the dPHB degradation rate without the loss of its hydrolytic activity for the polymer chain.

  7. Designing poly[(R)-3-hydroxybutyrate]-based polyurethane block copolymers for electrospun nanofiber scaffolds with improved mechanical properties and enhanced mineralization capability.

    PubMed

    Liu, Kerh Li; Choo, Eugene Shi Guang; Wong, Siew Yee; Li, Xu; He, Chao Bin; Wang, John; Li, Jun

    2010-06-10

    Efforts to mineralize electrospun hydrophobic polyester scaffold often require prior surface modification such as plasma or alkaline treatment, which may affect the mechanical integrity of the resultant scaffold. Here through rational design we developed a series of polyurethane block copolymers containing poly[(R)-3-hydroxybutyrate] (PHB) as hard segment and poly(ethylene glycol) (PEG) as soft segment that could be easily fabricated into mineralizable electrospun scaffold without the need of additional surface treatment. To ensure that the block copolymers do not swell excessively in water, PEG content in the polymers was kept below 50 wt %. To obtain good dry and hydrated state mechanical properties with limited PEG, low-molecular-weight PHB-diol with M(n) 1230 and 1790 were used in various molar feed ratios. The macromolecular characteristics of the block copolymers were confirmed by (1)H NMR spectroscopy, gel permeation chromatography (GPC), and thermal gravimetric analyses (TGA). With the incorporation of the hydrophilic PEG segments, the surface and bulk hydrophilicity of the block copolymers were significantly improved. Differential scanning calorimetry (DSC) revealed that the block copolymers had low PHB crystallinity and no PEG crystallinity. This was further confirmed by X-ray diffraction analyses (XRD) in both dry and hydrated states. With short PHB segments and soft PEG coupled together, the block copolymers were no longer brittle. Tensile measurements showed that the block copolymers with higher PEG content or shorter PHB segments were more ductile. Furthermore, their ductility was enhanced in hydrated states with one particular example showing increment in strain at break from 1090 to 1962%. The block copolymers were fabricated into an electrospun fibrous scaffold that was easily mineralized by simple incubation in simulated body fluid. The materials have good potential for bone regeneration application and may be extended to other applications by

  8. Stormy weather in galaxy clusters

    PubMed

    Burns

    1998-04-17

    Recent x-ray, optical, and radio observations coupled with particle and gas dynamics numerical simulations reveal an unexpectedly complex environment within clusters of galaxies, driven by ongoing accretion of matter from large-scale supercluster filaments. Mergers between clusters and continuous infall of dark matter and baryons from the cluster periphery produce long-lived "stormy weather" within the gaseous cluster atmosphere-shocks, turbulence, and winds of more than 1000 kilometers per second. This weather may be responsible for shaping a rich variety of extended radio sources, which in turn act as "barometers" and "anemometers" of cluster weather.

  9. Stellar Snowflake Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1 Stellar Snowflake Cluster Combined Image [figure removed for brevity, see original site] Figure 2 Infrared Array CameraFigure 3 Multiband Imaging Photometer

    Newborn stars, hidden behind thick dust, are revealed in this image of a section of the Christmas Tree cluster from NASA's Spitzer Space Telescope, created in joint effort between Spitzer's infrared array camera and multiband imaging photometer instruments.

    The newly revealed infant stars appear as pink and red specks toward the center of the combined image (fig. 1). The stars appear to have formed in regularly spaced intervals along linear structures in a configuration that resembles the spokes of a wheel or the pattern of a snowflake. Hence, astronomers have nicknamed this the 'Snowflake' cluster.

    Star-forming clouds like this one are dynamic and evolving structures. Since the stars trace the straight line pattern of spokes of a wheel, scientists believe that these are newborn stars, or 'protostars.' At a mere 100,000 years old, these infant structures have yet to 'crawl' away from their location of birth. Over time, the natural drifting motions of each star will break this order, and the snowflake design will be no more.

    While most of the visible-light stars that give the Christmas Tree cluster its name and triangular shape do not shine brightly in Spitzer's infrared eyes, all of the stars forming from this dusty cloud are considered part of the cluster.

    Like a dusty cosmic finger pointing up to the newborn clusters, Spitzer also illuminates the optically dark and dense Cone nebula, the tip of which can be seen towards the bottom left corner of each image.

    This combined image shows the presence of organic molecules mixed with dust as wisps of green, which have been illuminated by nearby star formation. The larger yellowish dots neighboring the baby red stars in the Snowflake Cluster are massive stellar infants forming

  10. Convex Clustering: An Attractive Alternative to Hierarchical Clustering

    PubMed Central

    Chen, Gary K.; Chi, Eric C.; Ranola, John Michael O.; Lange, Kenneth

    2015-01-01

    The primary goal in cluster analysis is to discover natural groupings of objects. The field of cluster analysis is crowded with diverse methods that make special assumptions about data and address different scientific aims. Despite its shortcomings in accuracy, hierarchical clustering is the dominant clustering method in bioinformatics. Biologists find the trees constructed by hierarchical clustering visually appealing and in tune with their evolutionary perspective. Hierarchical clustering operates on multiple scales simultaneously. This is essential, for instance, in transcriptome data, where one may be interested in making qualitative inferences about how lower-order relationships like gene modules lead to higher-order relationships like pathways or biological processes. The recently developed method of convex clustering preserves the visual appeal of hierarchical clustering while ameliorating its propensity to make false inferences in the presence of outliers and noise. The solution paths generated by convex clustering reveal relationships between clusters that are hidden by static methods such as k-means clustering. The current paper derives and tests a novel proximal distance algorithm for minimizing the objective function of convex clustering. The algorithm separates parameters, accommodates missing data, and supports prior information on relationships. Our program CONVEXCLUSTER incorporating the algorithm is implemented on ATI and nVidia graphics processing units (GPUs) for maximal speed. Several biological examples illustrate the strengths of convex clustering and the ability of the proximal distance algorithm to handle high-dimensional problems. CONVEXCLUSTER can be freely downloaded from the UCLA Human Genetics web site at http://www.genetics.ucla.edu/software/ PMID:25965340

  11. Sketching Star Clusters

    NASA Astrophysics Data System (ADS)

    Perez, Jeremy

    The next time you plan a quiet evening under a salted sky, with hopes of bathing your eyes in the ancient light of a majestic star cluster, be sure that your sketching kit comes with you! A casual glance at these celestial marvels will not give you a decent appreciation for an object whose history and character are as unique as the fingerprints you should be pressing into the side of your trusty pencil. I can think of no better way to connect with these stellar ballets, to understand their intricacies, and to recall your view later than to spend time sketching the soft glow or blazing pinpricks you see through the eyepiece.

  12. Are Earthquake Magnitudes Clustered?

    SciTech Connect

    Davidsen, Joern; Green, Adam

    2011-03-11

    The question of earthquake predictability is a long-standing and important challenge. Recent results [Phys. Rev. Lett. 98, 098501 (2007); ibid.100, 038501 (2008)] have suggested that earthquake magnitudes are clustered, thus indicating that they are not independent in contrast to what is typically assumed. Here, we present evidence that the observed magnitude correlations are to a large extent, if not entirely, an artifact due to the incompleteness of earthquake catalogs and the well-known modified Omori law. The latter leads to variations in the frequency-magnitude distribution if the distribution is constrained to those earthquakes that are close in space and time to the directly following event.

  13. Clustering with shallow trees

    NASA Astrophysics Data System (ADS)

    Bailly-Bechet, M.; Bradde, S.; Braunstein, A.; Flaxman, A.; Foini, L.; Zecchina, R.

    2009-12-01

    We propose a new method for obtaining hierarchical clustering based on the optimization of a cost function over trees of limited depth, and we derive a message-passing method that allows one to use it efficiently. The method and the associated algorithm can be interpreted as a natural interpolation between two well-known approaches, namely that of single linkage and the recently presented affinity propagation. We analyse using this general scheme three biological/medical structured data sets (human population based on genetic information, proteins based on sequences and verbal autopsies) and show that the interpolation technique provides new insight.

  14. Circular rogue wave clusters.

    PubMed

    Kedziora, David J; Ankiewicz, Adrian; Akhmediev, Nail

    2011-11-01

    Using the Darboux transformation technique and numerical simulations, we study the hierarchy of rational solutions of the nonlinear Schrödinger equation that can be considered as higher order rogue waves in this model. This analysis reveals the existence of rogue wave clusters with a high level of symmetry in the (x,t) plane. These structures arise naturally when the shifts in the Darboux scheme are taken to be eigenvalue dependent. We have found single-shell structures where a central higher order rogue wave is surrounded by a ring of first order peaks on the (x,t) plane.

  15. The galactic globular cluster system

    NASA Technical Reports Server (NTRS)

    Djorgovski, S.; Meylan, G.

    1994-01-01

    We explore correlations between various properties of Galactic globular clusters, using a database on 143 objects. Our goal is identify correlations and trends which can be used to test and constrain theoretical models of cluster formation and evolution. We use a set of 13 cluster parameters, 9 of which are independently measured. Several arguments suggest that the number of clusters still missing in the obscured regions of the Galaxy is of the order of 10, and thus the selection effects are probably not severe for our sample. Known clusters follow a power-law density distribution with a slope approximately -3.5 to -4, and an apparent core with a core radius approximately 1 kpc. Clusters show a large dynamical range in many of their properties, more so for the core parameters (which are presumably more affected by dynamical evolution) than for the half-light parameters. There are no good correlations with luminosity, although more luminous clusters tend to be more concentrated. When data are binned in luminosity, several trends emerge: more luminous clusters tend to have smaller and denser cores. We interpret this as a differential survival effect, with more massive clusters surviving longer and reaching more evolved dynamical states. Cluster core parameters and concentrations also correlate with the position in the Galaxy, with clusters closer to the Galactic center or plane being more concentrated and having smaller and denser cores. These trends are more pronounced for the fainter (less massive) clusters. This is in agreement with a picture where tidal shocks form disk or bulge passages accelerate dynamical evolution of clusters. Cluster metallicities do not correlate with any other parameter, including luminosity and velocity dispersion; the only detectable trend is with the position in the Galaxy, probably reflecting Zinn's disk-halo dichotomy. This suggests that globular clusters were not self-enriched systems. Velocity dispersions show excellent correlations

  16. Searching for intermediates in the carbon skeleton rearrangement of 2-methyleneglutarate to (R)-3-methylitaconate catalyzed by coenzyme B12-dependent 2-methyleneglutarate mutase from Eubacterium barkeri.

    PubMed

    Pierik, Antonio J; Ciceri, Daniele; Lopez, Ruben Fernandez; Kroll, Fritz; Bröker, Gerd; Beatrix, Birgitta; Buckel, Wolfgang; Golding, Bernard T

    2005-08-09

    Coenzyme B(12)-dependent 2-methyleneglutarate mutase from the strict anaerobe Eubacterium barkeri catalyzes the equilibration of 2-methyleneglutarate with (R)-3-methylitaconate. Proteins with mutations in the highly conserved coenzyme binding-motif DXH(X)(2)G(X)(41)GG (D483N and H485Q) exhibited decreased substrate turnover by 2000-fold and >4000-fold, respectively. These findings are consistent with the notion of H485 hydrogen-bonded to D483 being the lower axial ligand of adenosylcobalamin in 2-methyleneglutarate mutase. (E)- and (Z)-2-methylpent-2-enedioate and all four stereoisomers of 1-methylcyclopropane-1,2-dicarboxylate were synthesized and tested, along with acrylate, with respect to their inhibitory potential. Acrylate and the 2-methylpent-2-enedioates were noninhibitory. Among the 1-methylcyclopropane-1,2-dicarboxylates only the (1R,2R)-isomer displayed weak inhibition (noncompetitive, K(i) = 13 mM). Short incubation (5 min) of 2-methyleneglutarate mutase with 2-methyleneglutarate under anaerobic conditions generated an electron paramagnetic resonance (EPR) signal (g(xy) approximately 2.1; g(z) approximately 2.0), which by analogy with the findings on glutamate mutase from Clostridium cochlearium [Biochemistry, 1998, 37, 4105-4113] was assigned to cob(II)alamin coupled to a carbon-centered radical. At longer incubation times (>1 h), inactivation of the mutase occurred concomitant with the formation of oxygen-insensitive cob(II)alamin (g(xy) approximately 2.25; g(z) approximately 2.0). In order to identify the carbon-centered radical, various (13)C- and one (2)H-labeled substrate/product molecules were synthesized. Broadening (0.5 mT) of the EPR signal around g = 2.1 was observed only when C2 and/or C4 of 2-methyleneglutarate was labeled. No effect on the EPR signals was seen when [5'-(13)C]adenosylcobalamin was used as coenzyme. The inhibition and EPR data are discussed in the context of the addition-elimination and fragmentation-recombination mechanisms

  17. PHAT Stellar Cluster Survey. II. Andromeda Project Cluster Catalog

    NASA Astrophysics Data System (ADS)

    Johnson, L. Clifton; Seth, Anil C.; Dalcanton, Julianne J.; Wallace, Matthew L.; Simpson, Robert J.; Lintott, Chris J.; Kapadia, Amit; Skillman, Evan D.; Caldwell, Nelson; Fouesneau, Morgan; Weisz, Daniel R.; Williams, Benjamin F.; Beerman, Lori C.; Gouliermis, Dimitrios A.; Sarajedini, Ata

    2015-04-01

    We construct a stellar cluster catalog for the Panchromatic Hubble Andromeda Treasury (PHAT) survey using image classifications collected from the Andromeda Project citizen science website. We identify 2753 clusters and 2270 background galaxies within ˜0.5 deg2 of PHAT imaging searched, or ˜400 kpc2 in deprojected area at the distance of the Andromeda Galaxy (M31). These identifications result from 1.82 million classifications of ˜20,000 individual images (totaling ˜7 gigapixels) by tens of thousands of volunteers. We show that our crowd-sourced approach, which collects >80 classifications per image, provides a robust, repeatable method of cluster identification. The high spatial resolution Hubble Space Telescope images resolve individual stars in each cluster and are instrumental in the factor of ˜6 increase in the number of clusters known within the survey footprint. We measure integrated photometry in six filter passbands, ranging from the near-UV to the near-IR. PHAT clusters span a range of ˜8 magnitudes in F475W (g-band) luminosity, equivalent to ˜4 decades in cluster mass. We perform catalog completeness analysis using >3000 synthetic cluster simulations to determine robust detection limits and demonstrate that the catalog is 50% complete down to ˜500 {{M}⊙ } for ages <100 Myr. We include catalogs of clusters, background galaxies, remaining unselected candidates, and synthetic cluster simulations, making all information publicly available to the community. The catalog published here serves as the definitive base data product for PHAT cluster science, providing a census of star clusters in an {{L}\\star } spiral galaxy with unmatched sensitivity and quality.

  18. Tidal Stripping of Globular Clusters in a Simulated Galaxy Cluster

    NASA Astrophysics Data System (ADS)

    Ramos, F.; Coenda, V.; Muriel, H.; Abadi, M.

    2015-06-01

    Using a cosmological N-body numerical simulation of the formation of a galaxy-cluster-sized halo, we analyze the temporal evolution of its globular cluster population. We follow the dynamical evolution of 38 galactic dark matter halos orbiting in a galaxy cluster that at redshift z = 0 has a virial mass of 1.71 × 1014 M⊙ h-1. In order to mimic both “blue” and “red” populations of globular clusters, for each galactic halo we select two different sets of particles at high redshift (z ≈ 1), constrained by the condition that, at redshift z = 0, their average radial density profiles are similar to the observed profiles. As expected, the general galaxy cluster tidal field removes a significant fraction of the globular cluster populations to feed the intracluster population. On average, halos lost approximately 16% and 29% of their initial red and blue globular cluster populations, respectively. Our results suggest that these fractions strongly depend on the orbital trajectory of the galactic halo, specifically on the number of orbits and on the minimum pericentric distance to the galaxy cluster center that the halo has had. At a given time, these fractions also depend on the current clustercentric distance, just as observations show that the specific frequency of globular clusters SN depends on their clustercentric distance.

  19. TIDAL STRIPPING OF GLOBULAR CLUSTERS IN A SIMULATED GALAXY CLUSTER

    SciTech Connect

    Ramos, F.; Coenda, V.; Muriel, H.; Abadi, M.

    2015-06-20

    Using a cosmological N-body numerical simulation of the formation of a galaxy-cluster-sized halo, we analyze the temporal evolution of its globular cluster population. We follow the dynamical evolution of 38 galactic dark matter halos orbiting in a galaxy cluster that at redshift z = 0 has a virial mass of 1.71 × 10{sup 14} M{sub ⊙} h{sup −1}. In order to mimic both “blue” and “red” populations of globular clusters, for each galactic halo we select two different sets of particles at high redshift (z ≈ 1), constrained by the condition that, at redshift z = 0, their average radial density profiles are similar to the observed profiles. As expected, the general galaxy cluster tidal field removes a significant fraction of the globular cluster populations to feed the intracluster population. On average, halos lost approximately 16% and 29% of their initial red and blue globular cluster populations, respectively. Our results suggest that these fractions strongly depend on the orbital trajectory of the galactic halo, specifically on the number of orbits and on the minimum pericentric distance to the galaxy cluster center that the halo has had. At a given time, these fractions also depend on the current clustercentric distance, just as observations show that the specific frequency of globular clusters S{sub N} depends on their clustercentric distance.

  20. Secondary Globular Cluster populations

    NASA Astrophysics Data System (ADS)

    Fritze-v. Alvensleben, U.

    2004-02-01

    This study is motivated by two facts: 1. The formation of populous star cluster systems is widely observed to accompany violent star formation episodes in gas-rich galaxies as e.g. those triggered by strong interactions or merging. 2. The Globular Cluster (GC) systems of most but not all early-type galaxies show bimodal optical color distributions with fairly universal blue peaks and somewhat variable red peak colors, yet their Luminosity Functions (LFs) look like simple Gaussians with apparently universal turn-over magnitudes that are used for distance measurements and the determination of Ho. Based on a new set of evolutionary synthesis models for Simple (= single burst) Stellar Populations (SSPs) of various metallicities using the latest Padova isochrones I study the color and luminosity evolution of GC populations over the wavelength range from U through K, providing an extensive grid of models for comparison with observations. I assume the intrinsic widths of the color distributions and LFs to be constant in time at the values observed today for the Milky Way or M 31 halo GC populations. Taking the color distributions and LFs of the Milky Way or M 31 halo GC population as a reference for old metal-poor GC populations in general, I study for which combinations of age and metallicity a secondary GC population formed in some violent star formation event in the history of its parent galaxy may or may not be detected in the observed GC color distributions. I also investigate the effect of these secondary GCs on the LFs of the total GC system. Significant differences are found among the diagnostic efficiencies in various wavelength regions. In particular, we predict the NIR to be able to reveal the presence of GC subpopulations with different age - metallicity combinations that may perfectly hide within one inconspicuous optical color peak. If the entire manifold of possible age - metallicity combinations is admitted for a secondary GC population, we find several

  1. Erratum: Evaporation, Tidal Disruption, and Orbital Decay of Star Clusters in a Galactic Halo

    NASA Astrophysics Data System (ADS)

    Capriotti, E. R.; Hawley, S. L.

    1997-07-01

    In § 2 of the recent paper ``Evaporation, Tidal Disruption, and Orbital Decay of Star Clusters in a Galactic Halo'' by E. R. Capriotti and S. L. Hawley (ApJ, 464, 765 [1996]), equation (1) contains a misprint. It should read rt=2r/3 [(Mc)/(AMH(r))]1/3/[1-r/(AMH(r)) (dMH(r))/dr]1/3 , (1)where the difference from the published version is that an A replaces the 3 in the denominator of the last term. The authors regret the error.

  2. Decaying neutrinos in galaxy clusters

    NASA Technical Reports Server (NTRS)

    Melott, Adrian L.; Splinter, Randall J.; Persic, Massimo; Salucci, Paolo

    1994-01-01

    Davidsen et al. (1991) have argued that the failure to detect UV photons from the dark matter (DM) in cluster A665 excludes the decaying neutrino hypothesis. Sciama et al. (1993) argued that because of high central concentration the DM in that cluster must be baryonic. We study the DM profile in clusters of galaxies simulated using the Harrison-Zel'dovich spectrum of density fluctuations, and an amplitude previously derived from numerical simulations (Melott 1984b; Anninos et al. 1991) and in agreement with microwave background fluctuations (Smoot et al. 1992). We find that with this amplitude normalization cluster neutrino DM densities are comparable to observed cluster DM values. We conclude that given this normalization, the cluster DM should be at least largely composed of neutrinos. The constraint of Davidsen et al. can be somewhat weakened by the presence of baryonic DM; but it cannot be eliminated given our assumptions.

  3. Clustered protocadherins and neuronal diversity.

    PubMed

    Hirayama, Teruyoshi; Yagi, Takeshi

    2013-01-01

    Neuronal diversity is a fundamental requirement for complex neuronal networks and brain function. The clustered protocadherin (Pcdh) family possesses several characteristic features that are important for the molecular basis of neuronal diversity. Clustered Pcdhs are expressed predominantly in the central nervous system, in neurites, growth cones, and synapses. They consist of about 60 isoforms, and their expression is stochastically and combinatorially regulated in individual neurons. The multiple clustered Pcdhs expressed in individual neurons form heteromultimeric protein complexes that exhibit homophilic adhesion properties. Theoretically, the clustered Pcdhs could generate more than 3×10(10) possible variations in each neuron and 12,720 types of cis-tetramers per neuron. The clustered Pcdhs are important for normal neuronal development. The clustered Pcdh genes have also attracted attention as a target for epigenetic regulation.

  4. Light cluster production at NICA

    NASA Astrophysics Data System (ADS)

    Bastian, N.-U.; Batyuk, P.; Blaschke, D.; Danielewicz, P.; Ivanov, Yu. B.; Karpenko, Iu.; Röpke, G.; Rogachevsky, O.; Wolter, H. H.

    2016-08-01

    Light cluster production at the NICA accelerator complex offers unique possibilities to use these states as "rare probes" of in-medium characteristics such as phase space occupation and early flow. In order to explain this statement, in this contribution theoretical considerations from the nuclear statistical equilibrium model and from a quantum statistical model of cluster production are supplemented with a discussion of a transport model for light cluster formation and with results from hydrodynamic simulations combined with the coalescence model.

  5. 78 FR 56921 - South Bay Salt Pond Restoration Project, Phase 2 (Ponds R3, R4, R5, S5, A1, A2W, A8, A8S, A19...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-16

    ... Fish and Wildlife Service South Bay Salt Pond Restoration Project, Phase 2 (Ponds R3, R4, R5, S5, A1... 2 of the South Bay Salt Pond Restoration Project and consists of restoring and enhancing over 2,000.... The overall south bay salt pond restoration area includes 15,100 acres which the USFWS and the...

  6. Early Childhood Education and Development Act of 1989. Report together with Dissenting, Additional, and Individual Views (To Accompany H.R. 3). House of Representatives, 101st Congress, 1st Session.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. House Committee on Education and Labor.

    This report recommends that H.R. 3, the Early Childhood Education and Development Act of 1989, be passed as amended. Titles of the Act concern: (1) the expansion of Project Head Start; (2) early childhood development and school-related child care; (3) child care services for infants, toddlers, and young children; (4) child care and early childhood…

  7. The SMART CLUSTER METHOD - adaptive earthquake cluster analysis and declustering

    NASA Astrophysics Data System (ADS)

    Schaefer, Andreas; Daniell, James; Wenzel, Friedemann

    2016-04-01

    Earthquake declustering is an essential part of almost any statistical analysis of spatial and temporal properties of seismic activity with usual applications comprising of probabilistic seismic hazard assessments (PSHAs) and earthquake prediction methods. The nature of earthquake clusters and subsequent declustering of earthquake catalogues plays a crucial role in determining the magnitude-dependent earthquake return period and its respective spatial variation. Various methods have been developed to address this issue from other researchers. These have differing ranges of complexity ranging from rather simple statistical window methods to complex epidemic models. This study introduces the smart cluster method (SCM), a new methodology to identify earthquake clusters, which uses an adaptive point process for spatio-temporal identification. Hereby, an adaptive search algorithm for data point clusters is adopted. It uses the earthquake density in the spatio-temporal neighbourhood of each event to adjust the search properties. The identified clusters are subsequently analysed to determine directional anisotropy, focussing on a strong correlation along the rupture plane and adjusts its search space with respect to directional properties. In the case of rapid subsequent ruptures like the 1992 Landers sequence or the 2010/2011 Darfield-Christchurch events, an adaptive classification procedure is applied to disassemble subsequent ruptures which may have been grouped into an individual cluster using near-field searches, support vector machines and temporal splitting. The steering parameters of the search behaviour are linked to local earthquake properties like magnitude of completeness, earthquake density and Gutenberg-Richter parameters. The method is capable of identifying and classifying earthquake clusters in space and time. It is tested and validated using earthquake data from California and New Zealand. As a result of the cluster identification process, each event in

  8. Solute clustering and interfacial tension

    NASA Astrophysics Data System (ADS)

    Larson, M. A.; Garside, John

    1986-07-01

    The effect of surface curvature on surface tension has been included in the theory of homogeneous nucleation to show that, under certain conditions, cluster formation results in a decrease in Gibb's free energy. This cluster formation is thus a spontaneous event and a quasi-equilibrium concentration of clusters of narrow size range may then exist in supersaturated solutions. Previous experimental work suggests the existence of solute clusters in a variety of aqueous solutions. The implications for crystal nucleation and growth theory are discussed.

  9. SIZES OF GALACTIC GLOBULAR CLUSTERS

    SciTech Connect

    Van den Bergh, Sidney

    2012-02-20

    A study is made of deviations from the mean power-law relationship between the Galactocentric distances and the half-light radii of Galactic globular clusters. Surprisingly, deviations from the mean R{sub h} versus R{sub gc} relationship do not appear to correlate with cluster luminosity, cluster metallicity, or horizontal-branch morphology. Differences in orbit shape are found to contribute to the scatter in the R{sub h} versus R{sub gc} relationship of Galactic globular clusters.

  10. Active matter clusters at interfaces.

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    2016-03-01

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development, cancerous cells during tumor formation and metastasis, colonies of bacteria in a biofilm, or even flocks of birds and schools of fish at the macro-scale. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit that moves in two dimensions by exerting a force/torque per unit area whose magnitude depends on the nature of the local environment. We find that low speed (overdamped) clusters encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds (underdamped), where inertia dominates, the clusters show more complex behaviors crossing the interface multiple times and deviating from the predictable refraction and reflection for the low velocity clusters. We then present an extreme limit of the model in the absence of rotational damping where clusters can become stuck spiraling along the interface or move in large circular trajectories after leaving the interface. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  11. Absolute classification with unsupervised clustering

    NASA Technical Reports Server (NTRS)

    Jeon, Byeungwoo; Landgrebe, D. A.

    1992-01-01

    An absolute classification algorithm is proposed in which the class definition through training samples or otherwise is required only for a particular class of interest. The absolute classification is considered as a problem of unsupervised clustering when one cluster is known initially. The definitions and statistics of the other classes are automatically developed through the weighted unsupervised clustering procedure, which is developed to keep the cluster corresponding to the class of interest from losing its identity as the class of interest. Once all the classes are developed, a conventional relative classifier such as the maximum-likelihood classifier is used in the classification.

  12. Adaptive cluster detection

    NASA Astrophysics Data System (ADS)

    Friedenberg, David

    2010-10-01

    the rate of falsely detected active regions. Additionally we examine the more general field of clustering and develop a framework for clustering algorithms based around diffusion maps. Diffusion maps can be used to project high-dimensional data into a lower dimensional space while preserving much of the structure in the data. We demonstrate how diffusion maps can be used to solve clustering problems and examine the influence of tuning parameters on the results. We introduce two novel methods, the self-tuning diffusion map which replaces the global scaling parameter in the typical diffusion map framework with a local scaling parameter and an algorithm for automatically selecting tuning parameters based on a cross-validation style score called prediction strength. The methods are tested on several example datasets.

  13. Single-cluster dynamics for the random-cluster model

    NASA Astrophysics Data System (ADS)

    Deng, Youjin; Qian, Xiaofeng; Blöte, Henk W. J.

    2009-09-01

    We formulate a single-cluster Monte Carlo algorithm for the simulation of the random-cluster model. This algorithm is a generalization of the Wolff single-cluster method for the q -state Potts model to noninteger values q>1 . Its results for static quantities are in a satisfactory agreement with those of the existing Swendsen-Wang-Chayes-Machta (SWCM) algorithm, which involves a full-cluster decomposition of random-cluster configurations. We explore the critical dynamics of this algorithm for several two-dimensional Potts and random-cluster models. For integer q , the single-cluster algorithm can be reduced to the Wolff algorithm, for which case we find that the autocorrelation functions decay almost purely exponentially, with dynamic exponents zexp=0.07 (1), 0.521 (7), and 1.007 (9) for q=2 , 3, and 4, respectively. For noninteger q , the dynamical behavior of the single-cluster algorithm appears to be very dissimilar to that of the SWCM algorithm. For large critical systems, the autocorrelation function displays a range of power-law behavior as a function of time. The dynamic exponents are relatively large. We provide an explanation for this peculiar dynamic behavior.

  14. Single-cluster dynamics for the random-cluster model.

    PubMed

    Deng, Youjin; Qian, Xiaofeng; Blöte, Henk W J

    2009-09-01

    We formulate a single-cluster Monte Carlo algorithm for the simulation of the random-cluster model. This algorithm is a generalization of the Wolff single-cluster method for the q-state Potts model to noninteger values q>1. Its results for static quantities are in a satisfactory agreement with those of the existing Swendsen-Wang-Chayes-Machta (SWCM) algorithm, which involves a full-cluster decomposition of random-cluster configurations. We explore the critical dynamics of this algorithm for several two-dimensional Potts and random-cluster models. For integer q, the single-cluster algorithm can be reduced to the Wolff algorithm, for which case we find that the autocorrelation functions decay almost purely exponentially, with dynamic exponents z(exp)=0.07 (1), 0.521 (7), and 1.007 (9) for q=2, 3, and 4, respectively. For noninteger q, the dynamical behavior of the single-cluster algorithm appears to be very dissimilar to that of the SWCM algorithm. For large critical systems, the autocorrelation function displays a range of power-law behavior as a function of time. The dynamic exponents are relatively large. We provide an explanation for this peculiar dynamic behavior.

  15. Clustered engine study

    NASA Technical Reports Server (NTRS)

    Shepard, Kyle; Sager, Paul; Kusunoki, Sid; Porter, John; Campion, AL; Mouritzan, Gunnar; Glunt, George; Vegter, George; Koontz, Rob

    1993-01-01

    Several topics are presented in viewgraph form which together encompass the preliminary assessment of nuclear thermal rocket engine clustering. The study objectives, schedule, flow, and groundrules are covered. This is followed by the NASA groundrules mission and our interpretation of the associated operational scenario. The NASA reference vehicle is illustrated, then the four propulsion system options are examined. Each propulsion system's preliminary design, fluid systems, operating characteristics, thrust structure, dimensions, and mass properties are detailed as well as the associated key propulsion system/vehicle interfaces. A brief series of systems analysis is also covered including: thrust vector control requirements, engine out possibilities, propulsion system failure modes, surviving system requirements, and technology requirements. An assessment of vehicle/propulsion system impacts due to the lessons learned are presented.

  16. Analyzing geographic clustered response

    SciTech Connect

    Merrill, D.W.; Selvin, S.; Mohr, M.S.

    1991-08-01

    In the study of geographic disease clusters, an alternative to traditional methods based on rates is to analyze case locations on a transformed map in which population density is everywhere equal. Although the analyst's task is thereby simplified, the specification of the density equalizing map projection (DEMP) itself is not simple and continues to be the subject of considerable research. Here a new DEMP algorithm is described, which avoids some of the difficulties of earlier approaches. The new algorithm (a) avoids illegal overlapping of transformed polygons; (b) finds the unique solution that minimizes map distortion; (c) provides constant magnification over each map polygon; (d) defines a continuous transformation over the entire map domain; (e) defines an inverse transformation; (f) can accept optional constraints such as fixed boundaries; and (g) can use commercially supported minimization software. Work is continuing to improve computing efficiency and improve the algorithm. 21 refs., 15 figs., 2 tabs.

  17. Astronomy from satellite clusters

    NASA Astrophysics Data System (ADS)

    Stachnik, R.; Labeyrie, A.

    1984-03-01

    Attention is called to the accumulating evidence that giant space telescopes, comprising a number of separate mirrors on independent satellites, are a realistic prospect for providing research tools of extraordinary power. The ESA-sponsored group and its counterpart in the US have reached remarkably similar conclusions regarding the basic configuration of extremely large synthetic-aperture devices. Both share the basic view that a cluster of spacecraft is preferable to a single monolithic structure. The emphasis of the US group has been on a mission that sweeps across as many sources as possible in the minimum time; it is referred to as SAMSI (Spacecraft Array for Michelson Spatial Interferometry). The European group has placed more emphasis on obtaining two-dimensional images. Their system is referred to as TRIO because, at least initially, it involves three independent systems. Detailed descriptions are given of the two systems.

  18. Ionized cluster beam deposition

    NASA Technical Reports Server (NTRS)

    Kirkpatrick, A. R.

    1983-01-01

    Ionized Cluster Beam (ICB) deposition, a new technique originated by Takagi of Kyoto University in Japan, offers a number of unique capabilities for thin film metallization as well as for deposition of active semiconductor materials. ICB allows average energy per deposited atom to be controlled and involves impact kinetics which result in high diffusion energies of atoms on the growth surface. To a greater degree than in other techniques, ICB involves quantitative process parameters which can be utilized to strongly control the characteristics of films being deposited. In the ICB deposition process, material to be deposited is vaporized into a vacuum chamber from a confinement crucible at high temperature. Crucible nozzle configuration and operating temperature are such that emerging vapor undergoes supercondensation following adiabatic expansion through the nozzle.

  19. Cross-Clustering: A Partial Clustering Algorithm with Automatic Estimation of the Number of Clusters

    PubMed Central

    Tellaroli, Paola; Bazzi, Marco; Donato, Michele; Brazzale, Alessandra R.; Drăghici, Sorin

    2016-01-01

    Four of the most common limitations of the many available clustering methods are: i) the lack of a proper strategy to deal with outliers; ii) the need for a good a priori estimate of the number of clusters to obtain reasonable results; iii) the lack of a method able to detect when partitioning of a specific data set is not appropriate; and iv) the dependence of the result on the initialization. Here we propose Cross-clustering (CC), a partial clustering algorithm that overcomes these four limitations by combining the principles of two well established hierarchical clustering algorithms: Ward’s minimum variance and Complete-linkage. We validated CC by comparing it with a number of existing clustering methods, including Ward’s and Complete-linkage. We show on both simulated and real datasets, that CC performs better than the other methods in terms of: the identification of the correct number of clusters, the identification of outliers, and the determination of real cluster memberships. We used CC to cluster samples in order to identify disease subtypes, and on gene profiles, in order to determine groups of genes with the same behavior. Results obtained on a non-biological dataset show that the method is general enough to be successfully used in such diverse applications. The algorithm has been implemented in the statistical language R and is freely available from the CRAN contributed packages repository. PMID:27015427

  20. Ensemble Clustering for Result Diversification

    DTIC Science & Technology

    2012-11-01

    different clustering methods for a par- ticular data source. He et al. [8] proposed a framework to combine clusters of external resources to...representations for result diversification. In Proceedings of SIGIR, 2012. [9] D. Hiemstra and C. Hauff. Mapreduce for information retrieval evaluation: ‘let’s

  1. Antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.

    1988-06-28

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  2. Medicolegal issues in cluster headache.

    PubMed

    Loder, Elizabeth; Loder, John

    2004-04-01

    This paper identifies legal issues of relevance to the diagnosis and treatment of cluster headache, including areas of actual and potential malpractice liability. Legal topics that are relevant to cluster headache can be divided into five categories: diagnostic-related issues, risks inherent in the disease process, prescribing and treatment-related problems, research-related issues, and disability determination.

  3. Two generalizations of Kohonen clustering

    NASA Technical Reports Server (NTRS)

    Bezdek, James C.; Pal, Nikhil R.; Tsao, Eric C. K.

    1993-01-01

    The relationship between the sequential hard c-means (SHCM), learning vector quantization (LVQ), and fuzzy c-means (FCM) clustering algorithms is discussed. LVQ and SHCM suffer from several major problems. For example, they depend heavily on initialization. If the initial values of the cluster centers are outside the convex hull of the input data, such algorithms, even if they terminate, may not produce meaningful results in terms of prototypes for cluster representation. This is due in part to the fact that they update only the winning prototype for every input vector. The impact and interaction of these two families with Kohonen's self-organizing feature mapping (SOFM), which is not a clustering method, but which often leads ideas to clustering algorithms is discussed. Then two generalizations of LVQ that are explicitly designed as clustering algorithms are presented; these algorithms are referred to as generalized LVQ = GLVQ; and fuzzy LVQ = FLVQ. Learning rules are derived to optimize an objective function whose goal is to produce 'good clusters'. GLVQ/FLVQ (may) update every node in the clustering net for each input vector. Neither GLVQ nor FLVQ depends upon a choice for the update neighborhood or learning rate distribution - these are taken care of automatically. Segmentation of a gray tone image is used as a typical application of these algorithms to illustrate the performance of GLVQ/FLVQ.

  4. Active matter clusters at interfaces

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development and flocks of birds. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit whose movement depends on the nature of the local environment. We find that low speed clusters which exert forces but no active torques, encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds and clusters with active torques, they show more complex behaviors crossing the interface multiple times, becoming trapped at the interface and deviating from the predictable refraction and reflection of the low velocity clusters. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  5. On the History of Cluster Beams

    NASA Astrophysics Data System (ADS)

    Becker, E. W.

    1986-06-01

    The methods to produce and investigate cluster beams have been developed primarily with the use of permanent gases. A summary is given of related work carried out at Marburg and Karlsruhe. The report deals with the effect of carrier gases on cluster beam production; ionization, electrical acceleration and magnetic deflection of cluster beams; the retarding potential mass spectrometry of cluster beams; cluster size measurement by atomic beam attenuation; reflection of cluster beams at solid surfaces; scattering properties of4He and3He clusters; the application of cluster beams in plasma physics, and the reduction of space charge problems by acceleration of cluster ions.

  6. A2111: A z= 0.23 Butcher-Oemler Cluster with a Non-Isothermal Atmosphere and Normal Metallicity

    NASA Technical Reports Server (NTRS)

    Wang, Q. Daniel; Henriksen, Mark

    1998-01-01

    We report results from an x-ray spectral study of the z=0.23 Abell 2111 galaxy cluster using the Advanced Satellite for Astrophysics and Cosmology and the ROSAT Position Sensitive Proportional Counter. By correcting for the energy-dependent point-spread function of the instruments, we have examined the temperature structure of the cluster. The cluster's core within 3 is found to have a temperature of 5.4 +/- 0.5 keV, significantly higher than 2.8 +/-0.7 keV in the surrounding region of r = 3-6. This radially decreasing temperature structure can be parameterized by a polytropic index of gamma less than 1.4. Furthermore, the intracluster medium appears clumpy on scales less than 1. Early studies have revealed that the x-ray centroid of the cluster shifts with spatial scale and the overall optical and x-ray morphology is strongly elongated. These results together suggest that A2111 in undergoing a merger, which is likely responsible for the high fraction of blue galaxies observed in the cluster. We have further measured the abundance of the medium as 0.25 +/- 0.14 solar. This value is similar to those of nearby clusters which do not show a large blue galaxy function, suggesting that star formation in disk galaxies and subsequent loss to the intracluster medium do not drastically alter the average abundance of a cluster since z=0.23.

  7. Theoretical Studies on Cluster Compounds

    NASA Astrophysics Data System (ADS)

    Lin, Zhenyang

    Available from UMI in association with The British Library. Requires signed TDF. The Thesis describes some theoretical studies on ligated and bare clusters. Chapter 1 gives a review of the two theoretical models, Tensor Surface Harmonic Theory (TSH) and Jellium Model, accounting for the electronic structures of ligated and bare clusters. The Polyhedral Skeletal Electron Pair Theory (PSEPT), which correlates the structures and electron counts (total number of valence electrons) of main group and transition metal ligated clusters, is briefly described. A structural jellium model is developed in Chapter 2 which accounts for the electronic structures of clusters using a crystal-field perturbation. The zero-order potential we derive is of central-field form, depends on the geometry of the cluster, and has a well-defined relationship to the full nuclear-electron potential. Qualitative arguments suggest that this potential produces different energy level orderings for clusters with a nucleus with large positive charge at the centre of the cluster. Analysis of the effects of the non-spherical perturbation on the spherical jellium shell structures leads to the conclusion that for a cluster with a closed shell electronic structure a high symmetry arrangement which is approximately or precisely close packed will be preferred. It also provides a basis for rationalising those structures of clusters with incomplete shell electronic configurations. In Chapter 3, the geometric conclusions derived in the structural jellium model are developed in more detail. The group theoretical consequences of the Tensor Surface Harmonic Theory are developed in Chapter 4 for (ML_2) _{rm n}, (ML_4) _{rm n} and (ML_5 ) _{rm n} clusters where either the xz and yz or x^2 -y^2 and xy components to L_sp{rm d}{pi } and L_sp{rm d} {delta} do not contribute equally to the bonding. The closed shell requirements for such clusters are defined and the orbital symmetry constraints pertaining to the

  8. Magnetic anisotropy in single clusters

    NASA Astrophysics Data System (ADS)

    Jamet, Matthieu; Wernsdorfer, Wolfgang; Thirion, Christophe; Dupuis, Véronique; Mélinon, Patrice; Pérez, Alain; Mailly, Dominique

    2004-01-01

    The magnetic measurements on single cobalt and iron nanoclusters containing almost 1000 atoms are presented. Particles are directly buried within the superconducting film of a micro-SQUID (superconducting quantum interference device) which leads to the required sensitivity. The angular dependence of the switching field in three dimensions turns out to be in good agreement with a uniform rotation of cluster magnetization. The Stoner and Wohlfarth model yields therefore an estimation of magnetic anisotropy in a single cluster. In particular, uniaxial, biaxial, and cubic contributions can be separated. Results are interpreted on the basis of a simple atomic model in which clusters are assimilated to “giant spins.” We present an extension of the Néel model to clusters in order to estimate surface anisotropy. In the case of cobalt, this last contribution dominates and numerical simulations allow us to get the morphology of the investigated clusters.

  9. The open cluster NGC 6716

    SciTech Connect

    Grice, N.A.; Dawson, D.W. Western Connecticut State Univ., Danbury, CT )

    1990-08-01

    NGC 6716 is a young open star cluster in Sagittarius. Lindoff (1971) obtained photoelectric photometry for 12 stars and photographic UBV photometry for 115 stars in the cluster field down to V = 13.8. This work has been expanded to include more photoelectric standards and IRIS photometry for 332 stars in the cluster field down to V = 16. A reddening E(B-V) = 0.17 mag, a distance modulus of 8.69 + or - 0.15 mag (d = 547 pc), and an age of around 100 million years for the cluster are derived. Of the stars studied, 75 were judged as likely cluster members, 63 as possible members, and 194 as probable nonmembers. 13 refs.

  10. SACS: Spitzer Archival Cluster Survey

    NASA Astrophysics Data System (ADS)

    Stern, Daniel

    Emerging from the cosmic web, galaxy clusters are the most massive gravitationally bound structures in the universe. Thought to have begun their assembly at z > 2, clusters provide insights into the growth of large-scale structure as well as the physics that drives galaxy evolution. Understanding how and when the most massive galaxies assemble their stellar mass, stop forming stars, and acquire their observed morphologies in these environments remain outstanding questions. The redshift range 1.3 < z < 2 is a key epoch in this respect: elliptical galaxies start to become the dominant population in cluster cores, and star formation in spiral galaxies is being quenched. Until recently, however, this redshift range was essentially unreachable with available instrumentation, with clusters at these redshifts exceedingly challenging to identify from either ground-based optical/nearinfrared imaging or from X-ray surveys. Mid-infrared (MIR) imaging with the IRAC camera on board of the Spitzer Space Telescope has changed the landscape. High-redshift clusters are easily identified in the MIR due to a combination of the unique colors of distant galaxies and a negative k-correction in the 3-5 μm range which makes such galaxies bright. Even 90-sec observations with Spitzer/IRAC, a depth which essentially all extragalactic observations in the archive achieve, is sufficient to robustly detect overdensities of L* galaxies out to z~2. Here we request funding to embark on a ambitious scientific program, the “SACS: Spitzer Archival Cluster Survey”, a comprehensive search for the most distant galaxy clusters in all Spitzer/IRAC extragalactic pointings available in the archive. With the SACS we aim to discover ~2000 of 1.3 < z < 2.5 clusters, thus provide the ultimate catalog for high-redshift MIR selected clusters: a lasting legacy for Spitzer. The study we propose will increase by more than a factor of 10 the number of high-redshift clusters discovered by all previous surveys

  11. Decaying neutrinos in galaxy clusters

    NASA Technical Reports Server (NTRS)

    Melott, Adrian L.; Splinter, Randall J.; Persic, Massimo; Salucci, Paolo

    1993-01-01

    The DM profile in clusters of galaxies was studied and simulated using the Harrison-Zel'dovich spectrum of density fluctuations, and an amplitude previously derived from numerical simulations and in agreement with microwave background fluctuations. Neutrino DM densities, with this amplitude normalization cluster, are comparable to observed cluster DM values. It was concluded that given this normalization, the cluster DM should be al least largely composed of neutrinos. The constraint of Davidson et al., who argued that the failure to detect uv photons from the dark matter (DM) in cluster A665 excludes the decaying neutrino hypothesis, could be somewhat weakened by the presence of baryonic DM; but it cannot be eliminated given our assumptions.

  12. Structure stability and spectroscopy of metal clusters

    SciTech Connect

    Not Available

    1993-01-01

    Theory based on self-consistent field-linear combinations of atomic orbitals-molecular orbital theory was applied to clusters. Four areas were covered: electronic structure, equilibrium geometries, and stability of charged clusters, interaction of metal clusters with H and halogen atoms, thermal stability of isolated clusters, and stability and optical properties of hetero-atomic clusters. (DLC)

  13. A Linear Algebra Measure of Cluster Quality.

    ERIC Educational Resources Information Center

    Mather, Laura A.

    2000-01-01

    Discussion of models for information retrieval focuses on an application of linear algebra to text clustering, namely, a metric for measuring cluster quality based on the theory that cluster quality is proportional to the number of terms that are disjoint across the clusters. Explains term-document matrices and clustering algorithms. (Author/LRW)

  14. Information Clustering Based on Fuzzy Multisets.

    ERIC Educational Resources Information Center

    Miyamoto, Sadaaki

    2003-01-01

    Proposes a fuzzy multiset model for information clustering with application to information retrieval on the World Wide Web. Highlights include search engines; term clustering; document clustering; algorithms for calculating cluster centers; theoretical properties concerning clustering algorithms; and examples to show how the algorithms work.…

  15. Chemical transformation of chiral monolayer-protected gold clusters: observation of ligand size effects on optical and chiroptical responses

    NASA Astrophysics Data System (ADS)

    Yao, Hiroshi; Kitaoka, Noriyuki; Sasaki, Akito

    2012-01-01

    influence on the chiroptical response of the gold clusters. Electronic supplementary information (ESI) available: Typical EDX and FT-IR spectra, STEM images, phase transfer results of the gel separated cluster compounds 1R-3R, CD signal and absorption differences between the spectra of 1S/3S (and 1R/3R), a table of the excited states of (R)-(N-carbamoyl)penicillamine and the related biuret compound calculated by the TD-DFT method, together with illustrations of their HOMOs and LUMOs. See DOI: 10.1039/c2nr11544a

  16. IONOSAT Ionospheric satellite cluster

    NASA Astrophysics Data System (ADS)

    Korepanov, V.; Lizunov, G.; Fedorov, O.; Yampolsky, Yu.; Ivchenko, V.

    2008-11-01

    The IONOSAT project (from IONOspheric SATellites) is proposed by National Space Agency of Ukraine for First European Space Program as a part of Space Weather (SW) Program. As it is commonly accepted, Space Weather means the changes of the conditions on the Sun, in solar wind, magnetosphere and ionosphere which may affect the operation and reliability of on-board and ground technological systems and threaten human health. In this chain ionosphere is specific and integral part of SW formation. Moreover, namely in the ionosphere main part of the energy absorption of Sun-activated sporadic corpuscular and radiation fluxes takes places. The excitation of ionosphere by falling fluxes produces its "luminescence" in wide frequency band - from ULF waves till ultraviolet - and by this ionosphere works as an efficient "screen" or SW indicator. A goal of the proposed project is long-term spatial-temporal monitoring of main field and plasma parameters of ionosphere with aim to further develop fundamental conceptions of solar-terrestrial connections physics, nowcasting and forecast of SW, and diagnostics of natural and technogenic hazards with the help of scientific payload installed on-board a cluster of 3 low-Earth orbit (LEO) microsatellites (tentative launch date - 2012 year). The state of the project proposal and realization plans are discussed.

  17. Plug cluster module demonstration

    NASA Technical Reports Server (NTRS)

    Rousar, D. C.

    1978-01-01

    The low pressure, film cooled rocket engine design concept developed during two previous ALRC programs was re-evaluated for application as a module for a plug cluster engine capable of performing space shuttle OTV missions. The nominal engine mixture ratio was 5.5 and the engine life requirements were 1200 thermal cycles and 10 hours total operating life. The program consisted of pretest analysis; engine tests, performed using residual components; and posttest analysis. The pretest analysis indicated that operation of the operation of the film cooled engine at O/F = 5.5 was feasible. During the engine tests, steady state wall temperature and performance measurement were obtained over a range of film cooling flow rates, and the durability of the engine was demonstrated by firing the test engine 1220 times at a nominal performance ranging from 430 - 432 seconds. The performance of the test engine was limited by film coolant sleeve damage which had occurred during previous testing. The post-test analyses indicated that the nominal performance level can be increased to 436 seconds.

  18. Cosmology with Clusters of Galaxies

    NASA Astrophysics Data System (ADS)

    Borgani, Stefano

    I reviewed in my talk recent results on the cosmological constraints that can be obtained by following the evolution of the population of galaxy clusters. Using extended samples of X-ray selected clusters, I have shown how they can be used to trace this evolution out to redshift z ~ 1. This evolution can be compared to model predictions and, therefore, to constrain cosmological parameters, such as the density parameter Omega_m and the shape and amplitude of the power spectrum of density perturbations. I have emphasized that the robustness of such constraints is quite sensitive to the relation between cluster collapsed mass and X-ray luminosity and temperature. This demonstrates that our ability to place significant constraints on cosmology using clusters of galaxies relies on our capability to understand the physical processes, which determine the properties of the intra-cluster medium (ICM). In this context, I have discussed how numerical simulations of cluster formation in cosmological context can play an important role in uderstanding the ICM physics. I have presented results from a very large cosmological simulation, which also includes the hydrodynamical description of the cosmic baryons, the processes of star formation and feedback from the stellar populations. The results from this simulation represent a unique baseline to describe the processes of formation and evolution of clusters of galaxies.

  19. Clusterization and quadrupole deformation in nuclei

    SciTech Connect

    Cseh, J.; Algora, A.; Antonenko, N. V.; Jolos, R. V.; Scheid, W.; Darai, J.; Hess, P. O.

    2006-04-26

    We study the interrelation of the clusterization and quadrupole deformation of atomic nuclei, by applying cluster models. Both the energetic stability and the exclusion principle is investigated. Special attention is paid to the relative orientations of deformed clusters.

  20. Properties of Solar Flare Clustering

    NASA Astrophysics Data System (ADS)

    Title, Alan; DeRosa, Marc

    The continuous full disk observations provided by the Atmospheric Imaging Assembly (AIA) on the Solar Dynamics Observatory (SDO) give an observer the impression that flare and filament eruptions are related. However, both detailed analysis of a number of events as well as a number of statistical studies have provided only rare examples of clear causal behavior. But the mechanisms of flare triggering are not well understood, so the lack of hard evidence is not surprising. Here we have examined the waiting-time statistics of GOES X-ray flares of magnitude C5 or greater during the last sunspot cycle with the aim of assessing the degree to which flares are clustered in time. Clusters are groups of flares in which all successive flares occur within a fixed separation time - the linking window. While many of the flares in a cluster may come from the same active region, the clusters that last more than a disk passage must result from flares in multiple active regions. The longest cluster of the last cycle lasted more than 42 days. None of the flares were separated by more than 36 hours. Since that cluster lasted more than three disk passages, it could not have been caused by a single region. We find that during the last maximum, eight clusters contributed 44% of all flares. All of these clusters spanned multiple disk passages, but occupied only 16.5% of the cycle duration. Two of the clusters provided 34% of the flares. We suggest that this behavior implies that a component of the observed coordinated behavior has its origin in the solar dynamo.

  1. The Extended Virgo Cluster Catalog

    NASA Astrophysics Data System (ADS)

    Rey, Soo-Chang

    2015-08-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg2 or 60.1 Mpc2. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s-1. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  2. The Extended Virgo Cluster Catalog

    NASA Astrophysics Data System (ADS)

    Kim, Suk; Rey, Soo-Chang; Jerjen, Helmut; Lisker, Thorsten; Sung, Eon-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong

    2014-12-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg2 or 60.1 Mpc2. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s-1. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  3. THE EXTENDED VIRGO CLUSTER CATALOG

    SciTech Connect

    Kim, Suk; Rey, Soo-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong; Jerjen, Helmut; Lisker, Thorsten; Sung, Eon-Chang

    2015-01-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg{sup 2} or 60.1 Mpc{sup 2}. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s{sup –1}. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  4. R3DE: Radiation Risk Radiometer-Dosimeter on the International Space Station--optical radiation data recorded during 18 months of EXPOSE-E exposure to open space.

    PubMed

    Schuster, Martin; Dachev, Tsvetan; Richter, Peter; Häder, Donat-Peter

    2012-05-01

    Radiation Risk Radiometer-Dosimeter E (R3DE) served as a device for measuring ionizing and non-ionizing radiation as well as cosmic radiation reaching biological samples located on the EXPOSE platform EXPOSE-E. The duration of the mission was almost 1.5 years (2008-2009). With four channels, R3DE detected the wavelength ranges of photosynthetically active radiation (PAR, 400-700 nm), UVA (315-400 nm), UVB (280-315 nm), and UVC (<280 nm). In addition, the temperature was recorded. Cosmic ionizing radiation was assessed with a 256-channel spectrometer dosimeter (see separate report in this issue). The light and UV sensors of the device were calibrated with spectral measurement data obtained by the Solar Radiation and Climate Experiment (SORCE) satellite as standard. The data were corrected with respect to the cosine error of the diodes. Measurement frequency was 0.1 Hz. Due to errors in data transmission or temporary termination of EXPOSE power, not all data could be acquired. Radiation was not constant during the mission. At regular intervals of about 2 months, low or almost no radiation was encountered. The radiation dose during the mission was 1823.98 MJ m(-2) for PAR, 269.03 MJ m(-2) for UVA, 45.73 MJ m(-2) for UVB, or 18.28 MJ m(-2) for UVC. Registered sunshine duration during the mission was about 152 days (about 27% of mission time).The surface of EXPOSE was most likely turned away from the Sun for considerably longer. R3DE played a crucial role on EXPOSE-EuTEF (EuTEF, European Technology Exposure Facility), because evaluation of the astrobiology experiments depended on reliability of the data collected by the device. Observed effects in the samples were weighted by radiation doses measured by R3DE.

  5. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors

    PubMed Central

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V.; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C.

    2016-01-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs, StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13 are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1, StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation. PMID:26884602

  6. Highly enantioselective addition of terminal alkynes to aldehydes catalyzed by a new chiral beta-sulfonamide alcohol/Ti(OiPr)4/Et2Zn/R3N catalyst system.

    PubMed

    Qiu, Li; Wang, Quan; Lin, Li; Liu, Xiaodong; Jiang, Xianxing; Zhao, Qingyang; Hu, Guowen; Wang, Rui

    2009-02-01

    A new catalytic system, generated from the readily available and inexpensive beta-sulfonamide alcohol L*, Ti(O(i)Pr)(4), Et(2)Zn, and tertiary amine base (R(3)N), effectively catalyzes the enantioselective addition of various terminal alkynes including some quite challenging alkynes to aldehydes in good yields and excellent enantioselectivities. Up to 96% yield and >99% enantioselectivity were achieved with the use of N,N-diisoproylethylamine (DIPEA) as an additive in this asymmetric addition.

  7. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors.

    PubMed

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C

    2016-04-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs,StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13a re key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1,StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation.

  8. Haplotyping Problem, A Clustering Approach

    SciTech Connect

    Eslahchi, Changiz; Sadeghi, Mehdi; Pezeshk, Hamid; Kargar, Mehdi; Poormohammadi, Hadi

    2007-09-06

    Construction of two haplotypes from a set of Single Nucleotide Polymorphism (SNP) fragments is called haplotype reconstruction problem. One of the most popular computational model for this problem is Minimum Error Correction (MEC). Since MEC is an NP-hard problem, here we propose a novel heuristic algorithm based on clustering analysis in data mining for haplotype reconstruction problem. Based on hamming distance and similarity between two fragments, our iterative algorithm produces two clusters of fragments; then, in each iteration, the algorithm assigns a fragment to one of the clusters. Our results suggest that the algorithm has less reconstruction error rate in comparison with other algorithms.

  9. Haplotyping Problem, A Clustering Approach

    NASA Astrophysics Data System (ADS)

    Eslahchi, Changiz; Sadeghi, Mehdi; Pezeshk, Hamid; Kargar, Mehdi; Poormohammadi, Hadi

    2007-09-01

    Construction of two haplotypes from a set of Single Nucleotide Polymorphism (SNP) fragments is called haplotype reconstruction problem. One of the most popular computational model for this problem is Minimum Error Correction (MEC). Since MEC is an NP-hard problem, here we propose a novel heuristic algorithm based on clustering analysis in data mining for haplotype reconstruction problem. Based on hamming distance and similarity between two fragments, our iterative algorithm produces two clusters of fragments; then, in each iteration, the algorithm assigns a fragment to one of the clusters. Our results suggest that the algorithm has less reconstruction error rate in comparison with other algorithms.

  10. Monitoring computational clusters with OVIS.

    SciTech Connect

    Gentile, Ann C.; Brandt, James M.; Wong, M. H.; Pebay, Philippe Pierre

    2006-12-01

    Traditional cluster monitoring approaches consider nodes in singleton, using manufacturer-specified extreme limits as thresholds for failure ''prediction''. We have developed a tool, OVIS, for monitoring and analysis of large computational platforms which, instead, uses a statistical approach to characterize single device behaviors from those of a large number of statistically similar devices. Baseline capabilities of OVIS include the visual display of deterministic information about state variables (e.g., temperature, CPU utilization, fan speed) and their aggregate statistics. Visual consideration of the cluster as a comparative ensemble, rather than as singleton nodes, is an easy and useful method for tuning cluster configuration and determining effects of real-time changes.

  11. Neurostimulation for chronic cluster headache

    PubMed Central

    Kaube, Holger

    2012-01-01

    Neurostimulation techniques for the treatment of primary headache syndromes, particularly of chronic cluster headache, have received much interest in recent years. Occipital nerve stimulation (ONS) has yielded favourable clinical results and, despite the limited numbers of published cases, is becoming a routine treatment for refractory chronic cluster headache in specialized centres. Meanwhile, other promising techniques such as spinal cord stimulation (SCS) or sphenopalate ganglion stimulation have emerged. In this article the current state of clinical research for neurostimulation techniques for chronic cluster headache is reviewed. PMID:22590481

  12. Nonthermal Emission from Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Storm, Emma

    Galaxy clusters are the most massive gravitationally-bound objects in the universe. The bulk of the mass in a cluster is dark matter, while the dominant baryonic component is a thermal, X-ray emitting plasma. Radio observations of diffuse synchrotron emission indicate that galaxy clusters host a population of cosmic rays; however, the nature of this nonthermal component is not well-understood. In this dissertation, I investigate three sources of nonthermal emission in galaxy clusters. The first is star formation in galaxies, which is correlated to gamma-ray emission. I derive lower limits on the gamma-ray emission for nearby clusters by considering the emission from star formation in cluster galaxies. These lower limits sit about an order of magnitude below current upper limits on gamma rays in clusters and will be an important contributor to gamma-ray emission as upper limits improve over time. Dark matter annihilation, which produces relativistic particles that can result in a broad spectrum of emission in cluster environments, is another source of nonthermal emission. I use nondetections and marginal detections of diffuse radio emission in clusters to constrain dark matter annihilation. I derive limits on the annihilation cross section that are competitive with limits from the nondetection of gamma rays in clusters and show that the best objects for study in the radio are different than those in gamma rays, indicating that dark matter searches in the radio can be complementary to searches in other energy bands. I also investigate the cosmic ray population in the merging cluster A2319, which hosts a previously detected radio halo. I present new observations which reveal a two-component radio halo: a 2 Mpc region that extends far past the observable X-ray emission, and an 800 kpc "core" that is bounded by the X-ray cold front. I speculate on the origins of this structure, and show that a hadronic origin for this radio halo is disfavored. Finally, I discuss current

  13. Soft Clustering Criterion Functions for Partitional Document Clustering

    DTIC Science & Technology

    2004-05-26

    of the corresponding clusters. We represent the documents using the vector- space model [35]. In this model, each document d is considered to be a...vector in the space of the distinct terms present in the collection. We employ the tf-idf term-weighting scheme that represents each document d as the...produce balanced clusters. In this paper, due to space constraints, we focus on only four out of these seven criterion functions, which are referred to as

  14. AMOEBA clustering revisited. [cluster analysis, classification, and image display program

    NASA Technical Reports Server (NTRS)

    Bryant, Jack

    1990-01-01

    A description of the clustering, classification, and image display program AMOEBA is presented. Using a difficult high resolution aircraft-acquired MSS image, the steps the program takes in forming clusters are traced. A number of new features are described here for the first time. Usage of the program is discussed. The theoretical foundation (the underlying mathematical model) is briefly presented. The program can handle images of any size and dimensionality.

  15. Brightest cluster galaxies in the extended GMRT radio halo cluster sample. Radio properties and cluster dynamics

    NASA Astrophysics Data System (ADS)

    Kale, R.; Venturi, T.; Cassano, R.; Giacintucci, S.; Bardelli, S.; Dallacasa, D.; Zucca, E.

    2015-09-01

    Aims: First-ranked galaxies in clusters, usually referred to as brightest cluster galaxies (BCGs), show exceptional properties over the whole electromagnetic spectrum. They are the most massive elliptical galaxies and show the highest probability to be radio loud. Moreover, their special location at the centres of galaxy clusters raises the question of the role of the environment in shaping their radio properties. In the attempt to separate the effect of the galaxy mass and of the environment on their statistical radio properties, we investigate the possible dependence of the occurrence of radio loudness and of the fractional radio luminosity function on the dynamical state of the hosting cluster. Methods: We studied the radio properties of the BCGs in the Extended GMRT Radio Halo Survey (EGRHS), which consists of 65 clusters in the redshift range 0.2-0.4, with X-ray luminosity LX ≥ 5 × 1044 erg s-1, and quantitative information on their dynamical state from high-quality Chandra imaging. We obtained a statistical sample of 59 BCGs, which we divided into two classes, depending on whether the dynamical state of the host cluster was merging (M) or relaxed (R). Results: Of the 59 BCGs, 28 are radio loud and 31 are radio quiet. The radio-loud sources are favourably located in relaxed clusters (71%), while the reverse is true for the radio-quiet BCGs, which are mostly located in merging systems (81%). The fractional radio luminosity function for the BCGs in merging and relaxed clusters is different, and it is considerably higher for BCGs in relaxed clusters, where the total fraction of radio loudness reaches almost 90%, to be compared to the ~30% in merging clusters. For relaxed clusters, we found a positive correlation between the radio power of the BCGs and the strength of the cool core, consistent with previous studies on local samples. Conclusions: Our study suggests that the radio loudness of the BCGs strongly depends on the cluster dynamics; their fraction is

  16. Small intestinal morphology in eight-day-old calves fed colostrum for different durations or only milk replacer and treated with long-R3-insulin-like growth factor I and growth hormone.

    PubMed

    Bühler, C; Hammon, H; Rossi, G L; Blum, J W

    1998-03-01

    The effects of feeding different amounts of colostrum or only milk replacer and the effects of Long-R3-IGF-I (administered s.c. or orally; 50 microg/[kg BW x d] for 7 d), and of s.c. injected recombinant bovine GH (rbGH; 1 mg/[kg BW x d] for 7 d) on small intestinal mucosal morphology in newborn calves were studied by histomorphometry. Neonatal calves fed colostrum six times exhibited greater (P < .01) villus circumferences, areas, and heights in total small intestine and especially in the duodenum than calves fed only milk replacer. Furthermore, villus circumferences and areas in total small intestine were greater (P < .05) in calves fed colostrum once than in calves fed no colostrum. Villus size in total small intestine was smaller (P < .05) in rbGH-treated than in control calves; jejunum villus circumferences and heights were especially reduced (P < .05). Crypt depths in ileum were greater (P < .05) in rbGH-treated calves. In conclusion, prolonged colostrum supply significantly enhanced small intestinal villus size in neonatal calves. In contrast, Long-R3-IGF-I had no significant influence on small intestinal morphology, and rbGH in supraphysiological amounts even reduced small intestinal mucosal variables after 1 wk of treatment. The study demonstrated enhanced postnatal development of the gastrointestinal tract by prolonged colostrum feeding, but not by Long-R3-IGF-I or GH.

  17. Thermal ionization and thermally activated crossover quenching processes for 5 d -4 f luminescence in Y3A l5 -xG axO12:P r3 +

    NASA Astrophysics Data System (ADS)

    Ueda, Jumpei; Meijerink, Andries; Dorenbos, Pieter; Bos, Adrie J. J.; Tanabe, Setsuhisa

    2017-01-01

    We investigated thermally activated ionization and thermally activated crossover as the two possibilities of quenching of 5 d luminescence in P r3 + -doped Y3A l5 -xG axO12 . Varying the Ga content x gives the control over the relative energy level location of the 5 d and 4 f2:P3J states of P r3 + and the host conduction band (CB). Temperature-dependent luminescence lifetime measurements show that the 5 d luminescence quenching temperature T50 % increases up to x =2 and decreases with further increasing Ga content. This peculiar behavior is explained by a unique transition between the two quenching mechanisms which have an opposite dependence of thermal quenching on Ga content. For low Ga content, thermally activated crossover from the 4 f 5 d state to the 4 f2(P3J) states is the operative quenching mechanism. With increasing Ga content, the activation energy for thermally activated crossover becomes larger, as derived from the configuration coordinate diagram, while from the vacuum referred binding energy diagram the activation energy of thermal ionization becomes smaller. Based on these results, we demonstrated that the thermal quenching of P r3 +:5 d1-4 f luminescence in Y3A l5 -xG axO12 with x =0 ,1 ,2 is a thermally activated crossover while for x =3 ,4 ,5 it results from the thermal ionization.

  18. A Clustering Graph Generator

    SciTech Connect

    Winlaw, Manda; De Sterck, Hans; Sanders, Geoffrey

    2015-10-26

    In very simple terms a network can be de ned as a collection of points joined together by lines. Thus, networks can be used to represent connections between entities in a wide variety of elds including engi- neering, science, medicine, and sociology. Many large real-world networks share a surprising number of properties, leading to a strong interest in model development research and techniques for building synthetic networks have been developed, that capture these similarities and replicate real-world graphs. Modeling these real-world networks serves two purposes. First, building models that mimic the patterns and prop- erties of real networks helps to understand the implications of these patterns and helps determine which patterns are important. If we develop a generative process to synthesize real networks we can also examine which growth processes are plausible and which are not. Secondly, high-quality, large-scale network data is often not available, because of economic, legal, technological, or other obstacles [7]. Thus, there are many instances where the systems of interest cannot be represented by a single exemplar network. As one example, consider the eld of cybersecurity, where systems require testing across diverse threat scenarios and validation across diverse network structures. In these cases, where there is no single exemplar network, the systems must instead be modeled as a collection of networks in which the variation among them may be just as important as their common features. By developing processes to build synthetic models, so-called graph generators, we can build synthetic networks that capture both the essential features of a system and realistic variability. Then we can use such synthetic graphs to perform tasks such as simulations, analysis, and decision making. We can also use synthetic graphs to performance test graph analysis algorithms, including clustering algorithms and anomaly detection algorithms.

  19. Selenium clusters in zeolites -- theory.

    NASA Astrophysics Data System (ADS)

    Demkov, Alex; Sankey, Otto

    1997-03-01

    We investigate theoretically atomic geometries, energetics and electronic properties of Se clusters in cages and channels of the zeolites Linde A and cancrinite, and compare them with the properties of the bulk Se phases. Such regular 3D arrays of nanosize clusters supported by a host crystalline matrix are known as supralattices (A.A. Demkov, and O.F. Sankey, Chem. Mater. 8), 1793 (1996). Host zeolite frameworks are transparent, and the presence of Se gives rise to electronic cluster-like states in the energy gap region of the host material. We find that the encapsulation causes structural changes in the cluster geometry which alter its electronic structure, we call this a ``pressure'' effect. In addition, the quantum confinement further changes these states upon the encapsulation. We discuss the relative importance of these two effects, and compare our calculations with the recent experimental work ( Y. Nozue, et al.), J. Phys.: Condens. Matter. 2, 5209 (1990).

  20. Virtual Cluster Management with Xen

    SciTech Connect

    Bhatia, Nikhil; Vetter, Jeffrey S

    2008-01-01

    Recently, virtualization of hardware resources to run multiple instances of independent virtual machines over physical hosts has gained popularity due to an industry-wide focus on the need to reduce the cost of operation of an enterprise computing infrastructure. Xen is an open source hypervisor that provides a virtual machine abstraction layer which is very similar to the underlying physical machine. Using multiple physical hosts, each hosting multiple virtual machines over a VMM like Xen, system administrators can setup a high-availability virtual cluster to meet the ever-increasing demands of their data centers. In such an environment, the Xen hypervisor enables live migration of individual virtual machine instances from one physical node to another without significantly affecting the performance of the applications running on a target virtual machine. This paper describes a scalable Virtual Cluster Manager that provides such application agnostic cluster management capabilities to the system administrators maintaining virtual clusters over Xen powered virtual nodes.

  1. Infrared spectroscopy of ionic clusters

    SciTech Connect

    Price, J.M. . Dept. of Chemistry Lawrence Berkeley Lab., CA )

    1990-11-01

    This thesis describes new experiments wherein the infrared vibrational predissociation spectra of a number of mass-selected ionic cluster systems have been obtained and analyzed in the 2600 to 4000 cm{sup {minus}1} region. The species studied include: the hydrated hydronium ions, H{sub 3}O{sup +} (H{sub 2}O){sub 3 {minus}10}, ammoniated ammonium ions, NH{sub 4}{sup +}(NH{sub 3}){sub 1 {minus}10} and cluster ions involving both water and ammonia around an ammonium ion core, (mixed clusters) NH{sub 4}{sup +}(NH{sub 3}){sub n}(H{sub 2}O){sub m} (n+m=4). In each case, the spectra reveal well resolved structures that can be assigned to transitions arising from the vibrational motions of both the ion core of the clusters and the surrounding neutral solvent molecules. 154 refs., 19 figs., 8 tabs.

  2. Chemical evolution of star clusters.

    PubMed

    van Loon, Jacco Th

    2010-02-28

    I discuss the chemical evolution of star clusters, with emphasis on old Galactic globular clusters (GCs), in relation to their formation histories. GCs are clearly formed in a complex fashion, under markedly different conditions from any younger clusters presently known. Those special conditions must be linked to the early formation epoch of the Galaxy and must not have occurred since. While a link to the formation of GCs in dwarf galaxies has been suggested, present-day dwarf galaxies are not representative of the gravitational potential wells within which the GCs formed. Instead, a formation deep within the proto-Galaxy or within dark-matter mini-haloes might be favoured. Not all GCs may have formed and evolved similarly. In particular, we may need to distinguish Galactic Halo from Galactic Bulge clusters.

  3. Architecture of Eph receptor clusters

    SciTech Connect

    Himanen, Juha P.; Yermekbayeva, Laila; Janes, Peter W.; Walker, John R.; Xu, Kai; Atapattu, Lakmali; Rajashankar, Kanagalaghatta R.; Mensinga, Anneloes; Lackmann, Martin; Nikolov, Dimitar B.; Dhe-Paganon, Sirano

    2010-10-04

    Eph receptor tyrosine kinases and their ephrin ligands regulate cell navigation during normal and oncogenic development. Signaling of Ephs is initiated in a multistep process leading to the assembly of higher-order signaling clusters that set off bidirectional signaling in interacting cells. However, the structural and mechanistic details of this assembly remained undefined. Here we present high-resolution structures of the complete EphA2 ectodomain and complexes with ephrin-A1 and A5 as the base unit of an Eph cluster. The structures reveal an elongated architecture with novel Eph/Eph interactions, both within and outside of the Eph ligand-binding domain, that suggest the molecular mechanism underlying Eph/ephrin clustering. Structure-function analysis, by using site-directed mutagenesis and cell-based signaling assays, confirms the importance of the identified oligomerization interfaces for Eph clustering.

  4. Investigating Exoplanets Within Stellar Clusters

    NASA Astrophysics Data System (ADS)

    Glaser, Joseph Paul; Reisinger, Tyler; Thornton, Jonathan; McMillan, Stephen L. W.

    2017-01-01

    Recent surveys exploring nearby open clusters have yielded noticeable differences in the planetary population from that seen in the Field. This is surprising, as it is widely accepted that a majority of stars form within clustered environments before dispersing throughout the galaxy. Though dynamical arguments have been used to explain this discrepancy in the past, previous surveys' observational statistics and detection biases can also be used to argue that the open cluster planet population is indistinguishable from the Field.Our group aims to explore the role of stellar close encounters and interplanetary interactions in producing the observed exoplanet populations for both open cluster stars and Field stars. We employ a variety of different computational techniques to investigate these effects, ranging from traditional Monte Carlo scattering experiments to multi-scale n-body simulations. We are interested in: the effects of stellar binaries; Hot Jupiter migrations; long-period ice giants; and the habitability history of terrestrial planets.

  5. Cluster headache: conventional pharmacological management.

    PubMed

    Becker, Werner J

    2013-01-01

    Cluster headache pain is very intense, usually increases in intensity very rapidly from onset, and attacks are often frequent. These clinical features result in significant therapeutic challenges. The most effective pharmacological treatment options for acute cluster attack include subcutaneous sumatriptan, 100% oxygen, and intranasal zolmitriptan. Subcutaneous or intramuscular dihydroergotamine and intranasal sumatriptan are additional options. Transitional therapy is applicable mainly for patients with high-frequency (>2 attacks per day) episodic cluster headache, and options include short courses of high-dose oral corticosteroids, dihydroergotamine, and occipital nerve blocks with local anesthetic and steroids. Prophylactic therapy is important both for episodic and chronic cluster headache, and the main options are verapamil and lithium. Verapamil is drug of first choice but may cause cardiac arrhythmias, and periodic electrocardiograms (EKGs) during dose escalation are important. Many other drugs are also in current use, but there is an insufficient evidence base to recommend them.

  6. Cluster randomization and political philosophy.

    PubMed

    Chwang, Eric

    2012-11-01

    In this paper, I will argue that, while the ethical issues raised by cluster randomization can be challenging, they are not new. My thesis divides neatly into two parts. In the first, easier part I argue that many of the ethical challenges posed by cluster randomized human subjects research are clearly present in other types of human subjects research, and so are not novel. In the second, more difficult part I discuss the thorniest ethical challenge for cluster randomized research--cases where consent is genuinely impractical to obtain. I argue that once again these cases require no new analytic insight; instead, we should look to political philosophy for guidance. In other words, the most serious ethical problem that arises in cluster randomized research also arises in political philosophy.

  7. FIR Emission From Rich Clusters

    NASA Astrophysics Data System (ADS)

    Cox, Caroline

    1994-12-01

    Previous searches for far infrared (FIR) emission from dominant cluster galaxies using small, X-ray selected samples have found 20% to 50% of clusters to have significant FIR emission. In a new study, I have analyzed the 60microns and 100microns emission properties of cD galaxies in a complete sample of 163 Abell Clusters. For comparison, a control sample of 207 blank fields was analyzed to determine the distribution of spurious detections, which is greater than expected from Gaussian statistics. The contribution of Galactic cirrus at 60 microns and 100 microns to non-Gaussian noise is clearly demonstrated by the correspondence of a 98% confidence level to a signal to noise of 4 or 4.5 rather than to a signal to noise of 2 as expected from Gaussian statistics. After correcting for contaminated fields and spurious signals, I find that about 10% of cD galaxies in rich clusters are sources of FIR emission. Typical detected cDs have FIR luminosities of about 3 times 10(44) erg sec(-1) , which is comparable to the blue luminosities from these objects and an order of magnitude greater than the X-ray luminosities produced in the cores of clusters. Dust masses derived from the 60microns and 100 microns fluxes are ~ 10(7) M _sun. Because only about 10% of the clusters have high FIR luminosities, such strong emission is probably a transient state for an individual cluster. It has been suggested that this FIR emission is due to dust heated by electron collisions from the hot gas that dominates the intra-cluster medium. Study of the optical and X-ray properties of these clusters allows us to test models for the heating process of the dust, the origin of the dust, and its importance as a mechanism for cooling the hot gas. The central electron density and the temperature distribution for the hot gas are determined from analysis of ROSAT PSPC observations of four of these clusters. My program of UBVI imaging is designed to identify dust lanes and morphology that might indicate

  8. Deep RGS Observations of Clusters

    NASA Technical Reports Server (NTRS)

    Smith, R.; Mushotzky, R.; Loewenstein, M.

    2007-01-01

    This viewgraph presentation reviews the Reflection Grating Spectrometers (RGS) observations of clusters. It includes charts detailing the resolution difference between the European Photon Imaging Camera (EPIC) and the RGS and a partial review of existing observations, in graphic format, and as a table. Other sources show up in the ROSAT observations. The presentation reviews possible results that could be achieved in the event that 300 ks of time were allocated for the observations of clusters.

  9. R3DE: Radiation Risk Radiometer-Dosimeter on the International Space Station—Optical Radiation Data Recorded During 18 Months of EXPOSE-E Exposure to Open Space

    PubMed Central

    Schuster, Martin; Dachev, Tsvetan; Häder, Donat-Peter

    2012-01-01

    Abstract Radiation Risk Radiometer-Dosimeter E (R3DE) served as a device for measuring ionizing and non-ionizing radiation as well as cosmic radiation reaching biological samples located on the EXPOSE platform EXPOSE-E. The duration of the mission was almost 1.5 years (2008–2009). With four channels, R3DE detected the wavelength ranges of photosynthetically active radiation (PAR, 400–700 nm), UVA (315–400 nm), UVB (280–315 nm), and UVC (<280 nm). In addition, the temperature was recorded. Cosmic ionizing radiation was assessed with a 256-channel spectrometer dosimeter (see separate report in this issue). The light and UV sensors of the device were calibrated with spectral measurement data obtained by the Solar Radiation and Climate Experiment (SORCE) satellite as standard. The data were corrected with respect to the cosine error of the diodes. Measurement frequency was 0.1 Hz. Due to errors in data transmission or temporary termination of EXPOSE power, not all data could be acquired. Radiation was not constant during the mission. At regular intervals of about 2 months, low or almost no radiation was encountered. The radiation dose during the mission was 1823.98 MJ m−2 for PAR, 269.03 MJ m−2 for UVA, 45.73 MJ m−2 for UVB, or 18.28 MJ m−2 for UVC. Registered sunshine duration during the mission was about 152 days (about 27% of mission time).The surface of EXPOSE was most likely turned away from the Sun for considerably longer. R3DE played a crucial role on EXPOSE-EuTEF (EuTEF, European Technology Exposure Facility), because evaluation of the astrobiology experiments depended on reliability of the data collected by the device. Observed effects in the samples were weighted by radiation doses measured by R3DE. Key Words: ISS—EXPOSE-E—R3DE—Radiation measurement—PAR—UV radiation. Astrobiology 12, 393–402. PMID:22680686

  10. Hierarchical clustering in minimum spanning trees.

    PubMed

    Yu, Meichen; Hillebrand, Arjan; Tewarie, Prejaas; Meier, Jil; van Dijk, Bob; Van Mieghem, Piet; Stam, Cornelis Jan

    2015-02-01

    The identification of clusters or communities in complex networks is a reappearing problem. The minimum spanning tree (MST), the tree connecting all nodes with minimum total weight, is regarded as an important transport backbone of the original weighted graph. We hypothesize that the clustering of the MST reveals insight in the hierarchical structure of weighted graphs. However, existing theories and algorithms have difficulties to define and identify clusters in trees. Here, we first define clustering in trees and then propose a tree agglomerative hierarchical clustering (TAHC) method for the detection of clusters in MSTs. We then demonstrate that the TAHC method can detect clusters in artificial trees, and also in MSTs of weighted social networks, for which the clusters are in agreement with the previously reported clusters of the original weighted networks. Our results therefore not only indicate that clusters can be found in MSTs, but also that the MSTs contain information about the underlying clusters of the original weighted network.

  11. Hierarchical clustering in minimum spanning trees

    NASA Astrophysics Data System (ADS)

    Yu, Meichen; Hillebrand, Arjan; Tewarie, Prejaas; Meier, Jil; van Dijk, Bob; Van Mieghem, Piet; Stam, Cornelis Jan

    2015-02-01

    The identification of clusters or communities in complex networks is a reappearing problem. The minimum spanning tree (MST), the tree connecting all nodes with minimum total weight, is regarded as an important transport backbone of the original weighted graph. We hypothesize that the clustering of the MST reveals insight in the hierarchical structure of weighted graphs. However, existing theories and algorithms have difficulties to define and identify clusters in trees. Here, we first define clustering in trees and then propose a tree agglomerative hierarchical clustering (TAHC) method for the detection of clusters in MSTs. We then demonstrate that the TAHC method can detect clusters in artificial trees, and also in MSTs of weighted social networks, for which the clusters are in agreement with the previously reported clusters of the original weighted networks. Our results therefore not only indicate that clusters can be found in MSTs, but also that the MSTs contain information about the underlying clusters of the original weighted network.

  12. Understanding Galaxy Cluster MKW10

    NASA Astrophysics Data System (ADS)

    Sanders, Tim; Henry, Swain; Coble, Kimberly A.; Rosenberg, Jessica L.; Koopmann, Rebecca A.

    2015-01-01

    As part of the Undergraduate ALFALFA Team (UAT), we are studying the galaxy cluster MKW 10 (RA = 175.454, Dec = 10.306, z ~ 0.02), a poor cluster with a compact core in which tidal interactions have occurred. This cluster has been observed in HI and Hα. We used SDSS and NED to search for optical counterparts. By comparing data at multiple wavelengths, we hope to understand the structure, environment, and star formation history of this cluster. Following the techniques of others involved in the groups project and using the program TOPCAT to manipulate the data, we explored both the spatial and velocity distributions to determine cluster membership. We have determined that this cluster consists of 11 galaxies, mostly spiral in shape. Chicago State University is new the UAT and we began our work after taking part in the winter workshop at Arecibo.This work was supported by: Undergraduate ALFALFA Team NSF Grant AST-1211005 and the Illinois Space Grant Consortium.

  13. Collective thermoregulation in bee clusters.

    PubMed

    Ocko, Samuel A; Mahadevan, L

    2014-02-06

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection-diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective 'behavioural pressure', which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation.

  14. Ocean processes underlying surface clustering

    NASA Astrophysics Data System (ADS)

    Jacobs, Gregg A.; Huntley, Helga S.; Kirwan, A. D.; Lipphardt, Bruce L.; Campbell, Timothy; Smith, Travis; Edwards, Kacey; Bartels, Brent

    2016-01-01

    Ageostrophic ocean processes such as frontogenesis, submesoscale mixed-layer instabilities, shelf break fronts, and topographic interactions on the continental shelf produce surface-divergent flows that affect buoyant material over time. This study examines the ocean processes leading to clustering, i.e., the increase of material density over time, on the ocean surface. The time series of divergence along a material trajectory, the Lagrangian divergence (LD), is the flow property driving clustering. To understand the impacts of various ocean processes on LD, numerical ocean model simulations at different resolutions are analyzed. Although the relevant processes differ, patterns in clustering evolution from the deep ocean and the continental shelf bear similarities. Smaller-scale ocean features are associated with stronger surface divergence, and the surface material clustering is initially dominated by these features. Over time, the effect of these small-scale features becomes bounded, as material traverses small-scale regions of both positive and negative divergence. Lower-frequency flow phenomena, however, continue the clustering. As a result, clustering evolves from initial small-scale to larger-scale patterns.

  15. Clusters rich in red supergiants

    NASA Astrophysics Data System (ADS)

    Negueruela, Ignacio

    In the past few years, several clusters containing large numbers of red supergiants have been discovered. These clusters are amongst the most massive young clusters known in the Milky Way, with stellar masses reaching a few 104 M ⊙. They have provided us, for the first time, with large homogeneous samples of red supergiants of a given age. These large populations make them, despite heavy extinction along their sightlines, powerful laboratories to understand the evolutionary status of red supergiants. While some of the clusters, such as the eponymous RSGC1, are so obscured that their members are only observable in the near-IR, some of them are easily accessible, allowing for an excellent characterisation of cluster and stellar properties. The information gleaned so far from these clusters gives strong support to the idea that late-M type supergiants represent a separate class, characterised by very heavy mass loss. It also shows that the spectral-type distribution of red supergiants in the Milky Way is very strongly peaked towards M1, while suggesting a correlation between spectral type and evolutionary stage.

  16. Relativistic Binaries in Globular Clusters.

    PubMed

    Benacquista, Matthew J; Downing, Jonathan M B

    2013-01-01

    Galactic globular clusters are old, dense star systems typically containing 10(4)-10(6) stars. As an old population of stars, globular clusters contain many collapsed and degenerate objects. As a dense population of stars, globular clusters are the scene of many interesting close dynamical interactions between stars. These dynamical interactions can alter the evolution of individual stars and can produce tight binary systems containing one or two compact objects. In this review, we discuss theoretical models of globular cluster evolution and binary evolution, techniques for simulating this evolution that leads to relativistic binaries, and current and possible future observational evidence for this population. Our discussion of globular cluster evolution will focus on the processes that boost the production of tight binary systems and the subsequent interaction of these binaries that can alter the properties of both bodies and can lead to exotic objects. Direct N-body integrations and Fokker-Planck simulations of the evolution of globular clusters that incorporate tidal interactions and lead to predictions of relativistic binary populations are also discussed. We discuss the current observational evidence for cataclysmic variables, millisecond pulsars, and low-mass X-ray binaries as well as possible future detection of relativistic binaries with gravitational radiation.

  17. Splitting Methods for Convex Clustering

    PubMed Central

    Chi, Eric C.; Lange, Kenneth

    2016-01-01

    Clustering is a fundamental problem in many scientific applications. Standard methods such as k-means, Gaussian mixture models, and hierarchical clustering, however, are beset by local minima, which are sometimes drastically suboptimal. Recently introduced convex relaxations of k-means and hierarchical clustering shrink cluster centroids toward one another and ensure a unique global minimizer. In this work we present two splitting methods for solving the convex clustering problem. The first is an instance of the alternating direction method of multipliers (ADMM); the second is an instance of the alternating minimization algorithm (AMA). In contrast to previously considered algorithms, our ADMM and AMA formulations provide simple and unified frameworks for solving the convex clustering problem under the previously studied norms and open the door to potentially novel norms. We demonstrate the performance of our algorithm on both simulated and real data examples. While the differences between the two algorithms appear to be minor on the surface, complexity analysis and numerical experiments show AMA to be significantly more efficient. This article has supplemental materials available online. PMID:27087770

  18. Atomic clusters with addressable complexity

    NASA Astrophysics Data System (ADS)

    Wales, David J.

    2017-02-01

    A general formulation for constructing addressable atomic clusters is introduced, based on one or more reference structures. By modifying the well depths in a given interatomic potential in favour of nearest-neighbour interactions that are defined in the reference(s), the potential energy landscape can be biased to make a particular permutational isomer the global minimum. The magnitude of the bias changes the resulting potential energy landscape systematically, providing a framework to produce clusters that should self-organise efficiently into the target structure. These features are illustrated for small systems, where all the relevant local minima and transition states can be identified, and for the low-energy regions of the landscape for larger clusters. For a 55-particle cluster, it is possible to design a target structure from a transition state of the original potential and to retain this structure in a doubly addressable landscape. Disconnectivity graphs based on local minima that have no direct connections to a lower minimum provide a helpful way to visualise the larger databases. These minima correspond to the termini of monotonic sequences, which always proceed downhill in terms of potential energy, and we identify them as a class of biminimum. Multiple copies of the target cluster are treated by adding a repulsive term between particles with the same address to maintain distinguishable targets upon aggregation. By tuning the magnitude of this term, it is possible to create assemblies of the target cluster corresponding to a variety of structures, including rings and chains.

  19. Autophagy selectivity through receptor clustering

    NASA Astrophysics Data System (ADS)

    Rutenberg, Andrew; Brown, Aidan

    Substrate selectivity in autophagy requires an all-or-none cellular response. We focus on peroxisomes, for which autophagy receptor proteins NBR1 and p62 are well characterized. Using computational models, we explore the hypothesis that physical clustering of autophagy receptor proteins on the peroxisome surface provides an appropriate all-or-none response. We find that larger peroxisomes nucleate NBR1 clusters first, and lose them due to competitive coarsening last, resulting in significant size-selectivity. We then consider a secondary hypothesis that p62 inhibits NBR1 cluster formation. We find that p62 inhibition enhances size-selectivity enough that, even if there is no change of the pexophagy rate, the volume of remaining peroxisomes can significantly decrease. We find that enhanced ubiquitin levels suppress size-selectivity, and that this effect is more pronounced for individual peroxisomes. Sufficient ubiquitin allows receptor clusters to form on even the smallest peroxisomes. We conclude that NBR1 cluster formation provides a viable physical mechanism for all-or-none substrate selectivity in pexophagy. We predict that cluster formation is associated with significant size-selectivity. Now at Simon Fraser University.

  20. A revised moving cluster distance to the Pleiades open cluster

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Moraux, E.; Bouy, H.; Bouvier, J.; Olivares, J.; Teixeira, R.

    2017-01-01

    Context. The distance to the Pleiades open cluster has been extensively debated in the literature over several decades. Although different methods point to a discrepancy in the trigonometric parallaxes produced by the Hipparcos mission, the number of individual stars with known distances is still small compared to the number of cluster members to help solve this problem. Aims: We provide a new distance estimate for the Pleiades based on the moving cluster method, which will be useful to further discuss the so-called Pleiades distance controversy and compare it with the very precise parallaxes from the Gaia space mission. Methods: We apply a refurbished implementation of the convergent point search method to an updated census of Pleiades stars to calculate the convergent point position of the cluster from stellar proper motions. Then, we derive individual parallaxes for 64 cluster members using radial velocities compiled from the literature, and approximate parallaxes for another 1146 stars based on the spatial velocity of the cluster. This represents the largest sample of Pleiades stars with individual distances to date. Results: The parallaxes derived in this work are in good agreement with previous results obtained in different studies (excluding Hipparcos) for individual stars in the cluster. We report a mean parallax of 7.44 ± 0.08 mas and distance of pc that is consistent with the weighted mean of 135.0 ± 0.6 pc obtained from the non-Hipparcos results in the literature. Conclusions: Our result for the distance to the Pleiades open cluster is not consistent with the Hipparcos catalog, but favors the recent and more precise distance determination of 136.2 ± 1.2 pc obtained from Very Long Baseline Interferometry observations. It is also in good agreement with the mean distance of 133 ± 5 pc obtained from the first trigonometric parallaxes delivered by the Gaia satellite for the brightest cluster members in common with our sample. Full Table B.2 is only

  1. Nonlocalized clustering: a new concept in nuclear cluster structure physics.

    PubMed

    Zhou, Bo; Funaki, Y; Horiuchi, H; Ren, Zhongzhou; Röpke, G; Schuck, P; Tohsaki, A; Xu, Chang; Yamada, T

    2013-06-28

    We investigate the α+^{16}O cluster structure in the inversion-doublet band (Kπ=0(1)±}) states of 20Ne with an angular-momentum-projected version of the Tohsaki-Horiuchi-Schuck-Röpke (THSR) wave function, which was successful "in its original form" for the description of, e.g., the famous Hoyle state. In contrast with the traditional view on clusters as localized objects, especially in inversion doublets, we find that these single THSR wave functions, which are based on the concept of nonlocalized clustering, can well describe the Kπ=0(1)- band and the Kπ=0(1)+ band. For instance, they have 99.98% and 99.87% squared overlaps for 1- and 3- states (99.29%, 98.79%, and 97.75% for 0+, 2+, and 4+ states), respectively, with the corresponding exact solution of the α+16O resonating group method. These astounding results shed a completely new light on the physics of low energy nuclear cluster states in nuclei: The clusters are nonlocalized and move around in the whole nuclear volume, only avoiding mutual overlap due to the Pauli blocking effect.

  2. Seminars on Occupational Clusters. A Report.

    ERIC Educational Resources Information Center

    Bureau of Occupational and Adult Education (DHEW/OE), Washington, DC. Div. of Research and Demonstration.

    The document on occupational clusters was developed from papers presented in staff seminars in the Bureau of Occupational and Adult Education and contains eight papers: Introduction to the World of Clustering, Sidney C. High; Cluster Curriculum Development, Elizabeth J. Simpson; the Cluster Concept, Development of Curricular Materials for the…

  3. Bayesian Decision Theoretical Framework for Clustering

    ERIC Educational Resources Information Center

    Chen, Mo

    2011-01-01

    In this thesis, we establish a novel probabilistic framework for the data clustering problem from the perspective of Bayesian decision theory. The Bayesian decision theory view justifies the important questions: what is a cluster and what a clustering algorithm should optimize. We prove that the spectral clustering (to be specific, the…

  4. Overview on techniques in cluster analysis.

    PubMed

    Frades, Itziar; Matthiesen, Rune

    2010-01-01

    Clustering is the unsupervised, semisupervised, and supervised classification of patterns into groups. The clustering problem has been addressed in many contexts and disciplines. Cluster analysis encompasses different methods and algorithms for grouping objects of similar kinds into respective categories. In this chapter, we describe a number of methods and algorithms for cluster analysis in a stepwise framework. The steps of a typical clustering analysis process include sequentially pattern representation, the choice of the similarity measure, the choice of the clustering algorithm, the assessment of the output, and the representation of the clusters.

  5. Quantum Monte Carlo methods and lithium cluster properties. [Atomic clusters

    SciTech Connect

    Owen, R.K.

    1990-12-01

    Properties of small lithium clusters with sizes ranging from n = 1 to 5 atoms were investigated using quantum Monte Carlo (QMC) methods. Cluster geometries were found from complete active space self consistent field (CASSCF) calculations. A detailed development of the QMC method leading to the variational QMC (V-QMC) and diffusion QMC (D-QMC) methods is shown. The many-body aspect of electron correlation is introduced into the QMC importance sampling electron-electron correlation functions by using density dependent parameters, and are shown to increase the amount of correlation energy obtained in V-QMC calculations. A detailed analysis of D-QMC time-step bias is made and is found to be at least linear with respect to the time-step. The D-QMC calculations determined the lithium cluster ionization potentials to be 0.1982(14) (0.1981), 0.1895(9) (0.1874(4)), 0.1530(34) (0.1599(73)), 0.1664(37) (0.1724(110)), 0.1613(43) (0.1675(110)) Hartrees for lithium clusters n = 1 through 5, respectively; in good agreement with experimental results shown in the brackets. Also, the binding energies per atom was computed to be 0.0177(8) (0.0203(12)), 0.0188(10) (0.0220(21)), 0.0247(8) (0.0310(12)), 0.0253(8) (0.0351(8)) Hartrees for lithium clusters n = 2 through 5, respectively. The lithium cluster one-electron density is shown to have charge concentrations corresponding to nonnuclear attractors. The overall shape of the electronic charge density also bears a remarkable similarity with the anisotropic harmonic oscillator model shape for the given number of valence electrons.

  6. Large scale cluster computing workshop

    SciTech Connect

    Dane Skow; Alan Silverman

    2002-12-23

    Recent revolutions in computer hardware and software technologies have paved the way for the large-scale deployment of clusters of commodity computers to address problems heretofore the domain of tightly coupled SMP processors. Near term projects within High Energy Physics and other computing communities will deploy clusters of scale 1000s of processors and be used by 100s to 1000s of independent users. This will expand the reach in both dimensions by an order of magnitude from the current successful production facilities. The goals of this workshop were: (1) to determine what tools exist which can scale up to the cluster sizes foreseen for the next generation of HENP experiments (several thousand nodes) and by implication to identify areas where some investment of money or effort is likely to be needed. (2) To compare and record experimences gained with such tools. (3) To produce a practical guide to all stages of planning, installing, building and operating a large computing cluster in HENP. (4) To identify and connect groups with similar interest within HENP and the larger clustering community.

  7. IRAC imaging of GOGREEN clusters

    NASA Astrophysics Data System (ADS)

    McGee, Sean; Balogh, Michael; Cooper, Michael; Gilbank, David; Lidman, Chris; Muzzin, Adam; Old, Lyndsay; Rudnick, Greg; Wilson, Gillian; Yee, Howard

    2016-08-01

    We propose deep IRAC imaging of three galaxy clusters drawn from the GOGREEN survey of 21 galaxy clusters in the redshift range 1 < z < 1.5. This imaging will enable the accurate measurement of unprecedentedly low stellar masses at this redshift, leveraging our deep spectroscopy. This will give a first look at environmental effects on galaxy evolution at a time when galaxies are growing in a fundamentally different way from today. With this data, we will perform accurate SED modeling in order to classify galaxies as passive or star-forming and measure stellar masses, as well as compute cluster membership using accurate photometric redshifts. These data will be augmented by approved VLT, Subaru, Magellan and CFHT imaging and by an ongoing Gemini Large Programme, with which we are obtaining deep spectroscopy of > 1000 member and > 600 field galaxies. With these data and our own lower-redshift descendant data, we will measure 1) the evolution of the quenched fraction and its dependence on distance from the cluster center and 2) the relation between stellar and halo mass and its evolution. This will provide unique constraints to our in-house theoretical models at an epoch where there are currently almost none available. The imaging that we propose will ensure all 21 GOGREEN clusters have deep IRAC data, ensuring the lasting legacy of this benchmark sample.

  8. Improvements in Ionized Cluster-Beam Deposition

    NASA Technical Reports Server (NTRS)

    Fitzgerald, D. J.; Compton, L. E.; Pawlik, E. V.

    1986-01-01

    Lower temperatures result in higher purity and fewer equipment problems. In cluster-beam deposition, clusters of atoms formed by adiabatic expansion nozzle and with proper nozzle design, expanding vapor cools sufficiently to become supersaturated and form clusters of material deposited. Clusters are ionized and accelerated in electric field and then impacted on substrate where films form. Improved cluster-beam technique useful for deposition of refractory metals.

  9. Internal gettering by metal alloy clusters

    DOEpatents

    Buonassisi, Anthony; Heuer, Matthias; Istratov, Andrei A.; Pickett, Matthew D.; Marcus, Mathew A.; Weber, Eicke R.

    2010-07-27

    The present invention relates to the internal gettering of impurities in semiconductors by metal alloy clusters. In particular, intermetallic clusters are formed within silicon, such clusters containing two or more transition metal species. Such clusters have melting temperatures below that of the host material and are shown to be particularly effective in gettering impurities within the silicon and collecting them into isolated, less harmful locations. Novel compositions for some of the metal alloy clusters are also described.

  10. Association between PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), GCKR (rs780094), and elevated transaminase levels in overweight/obese Mexican adults.

    PubMed

    Flores, Yvonne N; Velázquez-Cruz, Rafael; Ramírez, Paula; Bañuelos, Manuel; Zhang, Zuo-Feng; Yee, Hal F; Chang, Shen-Chih; Canizales-Quinteros, Samuel; Quiterio, Manuel; Cabrera-Alvarez, Guillermo; Patiño, Nelly; Salmerón, Jorge

    2016-12-01

    There is scarce information about the link between specific single-nucleotide polymorphisms (SNPs) and risk of liver disease among Latinos, despite the disproportionate burden of disease among this population. Our aim was to investigate nine SNPs in or near the following genes: PNPLA3, LYPLAL1, PPP1R3B, GCKR, NCAN, IRS1, PPARG, and ADIPOR2 and examine their association with persistently elevated alanine aminotransferase (ALT) or aspartate aminotransferase (AST) levels in Mexican adults. Data and samples were collected from 741 participants in the Mexican Health Worker Cohort Study, in Cuernavaca, Mexico. We identified 207 cases who had persistently elevated levels of ALT or AST (≥40 U/L) and 534 controls with at least two consecutive normal ALT or AST results in a 6 month period, during 2004-2006 and 2011-2013. TaqMan assays were used to genotype the SNPs. The risk allele of PNPLA3 rs738409 was found to be associated with persistently elevated levels of ALT or AST, adjusting for age, sex, BMI, type 2 diabetes, and ancestry: (OR 2.28, 95 % CI 1.13, 4.58). A significant association was found between the LYPLAL1, PPP1R3B, and GCKR risk alleles and elevated ALT or AST levels among overweight/obese adults. These results suggest that among Mexicans, the PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) polymorphisms may be associated with a greater risk of chronic liver disease among overweight adults. This study is the first to examine these nine SNPs in a sample of adults in Mexico.

  11. Effective, high-yielding, and stereospecific total synthesis of D-erythro-(2R,3S)-sphingosine from D-ribo-(2S,3S,4R)-phytosphingosine.

    PubMed

    van den Berg, Richard J B H N; Korevaar, Cornelius G N; Overkleeft, Herman S; van der Marel, Gijsbert A; van Boom, Jacques H

    2004-08-20

    The synthesis of naturally occurring D-erythro-(2R,3S,4E)-sphingosine from commercially available D-ribo-(2S,3S,4R)-phytosphingosine is described. The key step in the reaction sequence comprises TMSI/DBN promoted regio- and stereoselective oxirane opening of intermediate 2-phenyl-4-(S)-[(1S,2S)-1,2-epoxyhexadecyl]-1,3-oxazoline followed by the in situ trans-elimination of 2-phenyl-4-(S)-[(1S,2R)-1,2-dideoxy-2-iodo-1-trimethylsilyloxyhexadecyl]-1,3-oxazoline.

  12. Crystal structure of (1R,3S,8R,11R)-11-acetyl-3,7,7-trimethyl-10-oxatri­cyclo­[6.4.0.01,3]dodecan-9-one

    PubMed Central

    Bismoussa, Abdoullah; Ait Itto, My Youssef; Daran, Jean-Claude; Auhmani, Abdelwahed; Auhmani, Aziz

    2015-01-01

    The title compound, C16H24O3, is built up from three fused rings, a six-membered, a seven-membered and a three-membered ring. The absolute configuration of the title compound was determined as (1R,3S,8R,11R) based on the synthetic pathway. The six-membered ring has an half-chair conformation whereas the seven-membered ring displays a boat conformation. In the cyrstal, C—H⋯O hydrogen bonds build up a two-dimensional network parallel to (0 0 1). The crystal studied was an inversion twin with a minor twin component of 34%. PMID:26870471

  13. Performance of timing RPC detectors for relativistic ions and design of a time-of-flight detector (iToF) for the R3B-FAIR experiment for fission and spallation reactions

    SciTech Connect

    Casarejos, E.; Ayyad, Y.; Benlliure, J.; Duran, I.; Paradela, C.; Lopez-Lago, M.; Segade, A.; Vilan, J. A.

    2011-07-01

    Resistive-plate-chambers (RPCs) were proposed to be used to build a time-of-flight detector for relativist heavy ions of the R3B-FAIR experiment, as well as other applications. State-of-the-art reaction codes allow for evaluating the requirements of the detector. The specific needs that working with heavy ions impose about material thicknesses are solved with new design concepts. We built prototypes and investigated the behaviour of RPCs tested with relativistic heavy ions. We measured the efficiency and streamer presence for ions with atomic numbers up to 38. Electron beams were used to study the timing capabilities of the prototypes. (authors)

  14. Totally selective ring-opening of amino epoxides with ketones: a general entry to enantiopure (2R,3S)- and (2S,3S)-3-aminoalkano-1,2-diols.

    PubMed

    Concellón, José M; Suárez, José Ramón; García-Granda, Santiago; Díaz, M Rosario

    2005-01-20

    [Reaction: see text] Transformation of enantiopure diastereoisomers (2R,1'S)- and (2S,1'S)-2-(1-aminoalkyl)epoxides into the corresponding 4-(1-aminoalkyl)-1,3-dioxolanes is achieved by reaction with different ketones in the presence of BF3.Et2O. The conversion takes place in very high yields, total selectivity, and without epimerization. A mechanism to explain this transformation is proposed. The obtained 1,3-dioxolanes can be deprotected, and (2R,3S)- and (2S,3S)-3-aminoalkano-1,2-diols were isolated.

  15. The ARCHES Integrated Cluster Finder

    NASA Astrophysics Data System (ADS)

    Mints, A.; Schwope, A.

    2014-07-01

    We are developing a tool to search for galaxy clusters associated with X-ray sources from the 3XMM catalog within the ARCHES project (Astronomical Resource cross-matching for High-Energy Studies). We make use of the new cross-matching tool developed for ARCHES to select galaxies in different catalogs around X-ray positions and then try to find clusters by searching for overdensities in the multi-color space. Colors are related to redshifts using spectroscopic data for passively evolving galaxies from the BOSS and VIPERS catalogs. So far we are making use of SDSS, UKIDSS, WISE, and CFHTLS photometric catalogs, but the method can easily be expanded to other data as well (e.g. Pan-STARRS and DES). We present test results of our tool performed on reference samples from the XMM/SDSS cluster survey (Takey et al 2012) and the NORAS/REFLEX surveys.

  16. Stream Clustering of Growing Objects

    NASA Astrophysics Data System (ADS)

    Siddiqui, Zaigham Faraz; Spiliopoulou, Myra

    We study incremental clustering of objects that grow and accumulate over time. The objects come from a multi-table stream e.g. streams of Customer and Transaction. As the Transactions stream accumulates, the Customers’ profiles grow. First, we use an incremental propositionalisation to convert the multi-table stream into a single-table stream upon which we apply clustering. For this purpose, we develop an online version of K-Means algorithm that can handle these swelling objects and any new objects that arrive. The algorithm also monitors the quality of the model and performs re-clustering when it deteriorates. We evaluate our method on the PKDD Challenge 1999 dataset.

  17. The KMOS Galaxy Clusters Project

    NASA Astrophysics Data System (ADS)

    Davies, Roger L.; Beifiori, A.; Bender, R.; Cappellari, M.; Chan, J.; Houghton, R.; Mendel, T.; Saglia, R.; Sharples, R.; Stott, J.; Smith, R.; Wilman, D.

    2015-04-01

    KMOS is a cryogenic infrared spectrograph fed by twentyfour deployable integral field units that patrol a 7.2 arcminute diameter field of view at the Nasmyth focus of the ESO VLT. It is well suited to the study of galaxy clusters at 1 < z < 2 where the well understood features in the restframe V-band are shifted into the KMOS spectral bands. Coupled with HST imagining, KMOS offers a window on the critical epoch for galaxy evolution, 7-10 Gyrs ago, when the key properties of cluster galaxies were established. We aim to investigate the size, mass, morphology and star formation history of galaxies in the clusters. Here we describe the instrument, discuss the status of the observations and report some preliminary results.

  18. Cluster assembly of hierarchical nanostructures

    SciTech Connect

    Siegel, R.W.

    1992-02-01

    In the past few years, atom clusters with diameters in the range of 2--20 nm of a variety of materials, including both metals and ceramics, have been synthesized by evaporation and condensation in high-purity gases and subsequently consolidated in situ under ultrahigh vacuum conditions to create nanophase materials. These new utlrafine-grained materials have properties that are often significantly different and considerably improved relative to those of their coarser-grained counterparts owing to both their small grain-size scale and the large percentage of their atoms in grain boundary environments. Since their properties can be engineered during the synthesis and processing steps, cluster-assembled materials appear to have significant potential for the introduction of a hierarchy of both structure and properties. Some of the recent research on nanophase materials related to properties and scale are reviewed and some of the possibilities for synthesizing hierarchical nanostructures via cluster assembly are considered.

  19. Cluster membership probability: polarimetric approach

    NASA Astrophysics Data System (ADS)

    Medhi, Biman J.; Tamura, Motohide

    2013-04-01

    Interstellar polarimetric data of the six open clusters Hogg 15, NGC 6611, NGC 5606, NGC 6231, NGC 5749 and NGC 6250 have been used to estimate the membership probability for the stars within them. For proper-motion member stars, the membership probability estimated using the polarimetric data is in good agreement with the proper-motion cluster membership probability. However, for proper-motion non-member stars, the membership probability estimated by the polarimetric method is in total disagreement with the proper-motion cluster membership probability. The inconsistencies in the determined memberships may be because of the fundamental differences between the two methods of determination: one is based on stellar proper motion in space and the other is based on selective extinction of the stellar output by the asymmetric aligned dust grains present in the interstellar medium. The results and analysis suggest that the scatter of the Stokes vectors q (per cent) and u (per cent) for the proper-motion member stars depends on the interstellar and intracluster differential reddening in the open cluster. It is found that this method could be used to estimate the cluster membership probability if we have additional polarimetric and photometric information for a star to identify it as a probable member/non-member of a particular cluster, such as the maximum wavelength value (λmax), the unit weight error of the fit (σ1), the dispersion in the polarimetric position angles (overline{ɛ }), reddening (E(B - V)) or the differential intracluster reddening (ΔE(B - V)). This method could also be used to estimate the membership probability of known member stars having no membership probability as well as to resolve disagreements about membership among different proper-motion surveys.

  20. Collaborative Clustering for Sensor Networks

    NASA Technical Reports Server (NTRS)

    Wagstaff. Loro :/; Green Jillian; Lane, Terran

    2011-01-01

    Traditionally, nodes in a sensor network simply collect data and then pass it on to a centralized node that archives, distributes, and possibly analyzes the data. However, analysis at the individual nodes could enable faster detection of anomalies or other interesting events, as well as faster responses such as sending out alerts or increasing the data collection rate. There is an additional opportunity for increased performance if individual nodes can communicate directly with their neighbors. Previously, a method was developed by which machine learning classification algorithms could collaborate to achieve high performance autonomously (without requiring human intervention). This method worked for supervised learning algorithms, in which labeled data is used to train models. The learners collaborated by exchanging labels describing the data. The new advance enables clustering algorithms, which do not use labeled data, to also collaborate. This is achieved by defining a new language for collaboration that uses pair-wise constraints to encode useful information for other learners. These constraints specify that two items must, or cannot, be placed into the same cluster. Previous work has shown that clustering with these constraints (in isolation) already improves performance. In the problem formulation, each learner resides at a different node in the sensor network and makes observations (collects data) independently of the other learners. Each learner clusters its data and then selects a pair of items about which it is uncertain and uses them to query its neighbors. The resulting feedback (a must and cannot constraint from each neighbor) is combined by the learner into a consensus constraint, and it then reclusters its data while incorporating the new constraint. A strategy was also proposed for cleaning the resulting constraint sets, which may contain conflicting constraints; this improves performance significantly. This approach has been applied to collaborative

  1. Kinetic theory of cluster dynamics

    NASA Astrophysics Data System (ADS)

    Patterson, Robert I. A.; Simonella, Sergio; Wagner, Wolfgang

    2016-11-01

    In a Newtonian system with localized interactions the whole set of particles is naturally decomposed into dynamical clusters, defined as finite groups of particles having an influence on each other's trajectory during a given interval of time. For an ideal gas with short-range intermolecular force, we provide a description of the cluster size distribution in terms of the reduced Boltzmann density. In the simplified context of Maxwell molecules, we show that a macroscopic fraction of the gas forms a giant component in finite kinetic time. The critical index of this phase transition is in agreement with previous numerical results on the elastic billiard.

  2. Are random fractal clusters isotropic\\?

    NASA Astrophysics Data System (ADS)

    Family, Fereydoon; Vicsek, Tamás; Meakin, Paul

    1985-08-01

    We have studied the shape of large clusters in the lattice-animal, percolation, and growing-percolation models. By calculating the radius of gyration tensor we find that in these models the clusters have an anisotropic shape. The results suggest that the critical droplets in related isotropic equilibrium models, such as the Ising model, may also be anisotropic. We have also determined the leading nonanalytic correction-to-scaling exponent by analyzing the anisotropy data and find that for percolation in two dimensions e~=0.47. .AE

  3. Messier's nebulae and star clusters.

    NASA Astrophysics Data System (ADS)

    Jones, K. G.

    Charles Messier's Catalogue of nebulae and star clusters, published in 1784, marked the start of a new era of deep sky astronomy. Today, this tradition of observing galaxies and clusters is kept alive by serious amateur astronomers who study the objects of the deep sky. Nearly all the objects are visible in a small telescope. The author has revised his definitive version of Messier's Catalogue. His own observations and drawings, together with maps and diagrams, make this a valuable introduction to deep sky observing. Historical and astrophysical notes bring the science of these nebulae right up to date.

  4. Galaxy Cluster Smashes Distance Record

    NASA Astrophysics Data System (ADS)

    2009-10-01

    he most distant galaxy cluster yet has been discovered by combining data from NASA's Chandra X-ray Observatory and optical and infrared telescopes. The cluster is located about 10.2 billion light years away, and is observed as it was when the Universe was only about a quarter of its present age. The galaxy cluster, known as JKCS041, beats the previous record holder by about a billion light years. Galaxy clusters are the largest gravitationally bound objects in the Universe. Finding such a large structure at this very early epoch can reveal important information about how the Universe evolved at this crucial stage. JKCS041 is found at the cusp of when scientists think galaxy clusters can exist in the early Universe based on how long it should take for them to assemble. Therefore, studying its characteristics - such as composition, mass, and temperature - will reveal more about how the Universe took shape. "This object is close to the distance limit expected for a galaxy cluster," said Stefano Andreon of the National Institute for Astrophysics (INAF) in Milan, Italy. "We don't think gravity can work fast enough to make galaxy clusters much earlier." Distant galaxy clusters are often detected first with optical and infrared observations that reveal their component galaxies dominated by old, red stars. JKCS041 was originally detected in 2006 in a survey from the United Kingdom Infrared Telescope (UKIRT). The distance to the cluster was then determined from optical and infrared observations from UKIRT, the Canada-France-Hawaii telescope in Hawaii and NASA's Spitzer Space Telescope. Infrared observations are important because the optical light from the galaxies at large distances is shifted into infrared wavelengths because of the expansion of the universe. The Chandra data were the final - but crucial - piece of evidence as they showed that JKCS041 was, indeed, a genuine galaxy cluster. The extended X-ray emission seen by Chandra shows that hot gas has been detected

  5. Quantum Dynamics of Helium Clusters

    DTIC Science & Technology

    1993-03-01

    helium clusters [10-12]. (10) DMC starts with the time - dependent Schr ~ dinger equation in imaginary time and has been employed most- The approximate...bound. (For example, the binding values may be computed by the Metropolis approach . energy of He 3 is five times greater than that of 1l1lie I We first...or four times for computational effort. If this is also the case with the the larger clusters) its original size. If the maximum en- DMC approach

  6. Cluster compression algorithm: A joint clustering/data compression concept

    NASA Technical Reports Server (NTRS)

    Hilbert, E. E.

    1977-01-01

    The Cluster Compression Algorithm (CCA), which was developed to reduce costs associated with transmitting, storing, distributing, and interpreting LANDSAT multispectral image data is described. The CCA is a preprocessing algorithm that uses feature extraction and data compression to more efficiently represent the information in the image data. The format of the preprocessed data enables simply a look-up table decoding and direct use of the extracted features to reduce user computation for either image reconstruction, or computer interpretation of the image data. Basically, the CCA uses spatially local clustering to extract features from the image data to describe spectral characteristics of the data set. In addition, the features may be used to form a sequence of scalar numbers that define each picture element in terms of the cluster features. This sequence, called the feature map, is then efficiently represented by using source encoding concepts. Various forms of the CCA are defined and experimental results are presented to show trade-offs and characteristics of the various implementations. Examples are provided that demonstrate the application of the cluster compression concept to multi-spectral images from LANDSAT and other sources.

  7. Dynamic cluster scheduling for cluster-tree WSNs.

    PubMed

    Severino, Ricardo; Pereira, Nuno; Tovar, Eduardo

    2014-01-01

    While Cluster-Tree network topologies look promising for WSN applications with timeliness and energy-efficiency requirements, we are yet to witness its adoption in commercial and academic solutions. One of the arguments that hinder the use of these topologies concerns the lack of flexibility in adapting to changes in the network, such as in traffic flows. This paper presents a solution to enable these networks with the ability to self-adapt their clusters' duty-cycle and scheduling, to provide increased quality of service to multiple traffic flows. Importantly, our approach enables a network to change its cluster scheduling without requiring long inaccessibility times or the re-association of the nodes. We show how to apply our methodology to the case of IEEE 802.15.4/ZigBee cluster-tree WSNs without significant changes to the protocol. Finally, we analyze and demonstrate the validity of our methodology through a comprehensive simulation and experimental validation using commercially available technology on a Structural Health Monitoring application scenario.

  8. Low-dimensional clustering detects incipient dominant influenza strain clusters

    PubMed Central

    He, Jiankui; Deem, Michael W.

    2010-01-01

    Influenza has been circulating in the human population and has caused three pandemics in the last century (1918 H1N1, 1957 H2N2 and 1968 H3N2). The 2009 A(H1N1) was classified by World Health Organization as the fourth pandemic. Influenza has a high evolution rate, which makes vaccine design challenging. We here consider an approach for early detection of new dominant strains. By clustering the 2009 A(H1N1) sequence data, we found two main clusters. We then define a metric to detect the emergence of dominant strains. We show on historical H3N2 data that this method is able to identify a cluster around an incipient dominant strain before it becomes dominant. For example, for H3N2 as of 30 March 2009, the method detects the cluster for the new A/British Columbia/RV1222/2009 strain. This strain detection tool would appear to be useful for annual influenza vaccine selection. PMID:21036781

  9. Globular Cluster Systems in Brightest Cluster Galaxies. III: Beyond Bimodality

    NASA Astrophysics Data System (ADS)

    Harris, William E.; Ciccone, Stephanie M.; Eadie, Gwendolyn M.; Gnedin, Oleg Y.; Geisler, Douglas; Rothberg, Barry; Bailin, Jeremy

    2017-01-01

    We present new deep photometry of the rich globular cluster (GC) systems around the Brightest Cluster Galaxies UGC 9799 (Abell 2052) and UGC 10143 (Abell 2147), obtained with the Hubble Space Telescope (HST) ACS and WFC3 cameras. For comparison, we also present new reductions of similar HST/ACS data for the Coma supergiants NGC 4874 and 4889. All four of these galaxies have huge cluster populations (to the radial limits of our data, comprising from 12,000 to 23,000 clusters per galaxy). The metallicity distribution functions (MDFs) of the GCs can still be matched by a bimodal-Gaussian form where the metal-rich and metal-poor modes are separated by ≃ 0.8 dex, but the internal dispersions of each mode are so large that the total MDF becomes very broad and nearly continuous from [Fe/H] ≃ ‑2.4 to solar. There are, however, significant differences between galaxies in the relative numbers of metal-rich clusters, suggesting that they underwent significantly different histories of mergers with massive gas-rich halos. Last, the proportion of metal-poor GCs rises especially rapidly outside projected radii R≳ 4 {R}{eff}, suggesting the importance of accreted dwarf satellites in the outer halo. Comprehensive models for the formation of GCs as part of the hierarchical formation of their parent galaxies will be needed to trace the systematic change in structure of the MDF with galaxy mass, from the distinctly bimodal form in smaller galaxies up to the broad continuum that we see in the very largest systems.

  10. Chaos theory perspective for industry clusters development

    NASA Astrophysics Data System (ADS)

    Yu, Haiying; Jiang, Minghui; Li, Chengzhang

    2016-03-01

    Industry clusters have outperformed in economic development in most developing countries. The contributions of industrial clusters have been recognized as promotion of regional business and the alleviation of economic and social costs. It is no doubt globalization is rendering clusters in accelerating the competitiveness of economic activities. In accordance, many ideas and concepts involve in illustrating evolution tendency, stimulating the clusters development, meanwhile, avoiding industrial clusters recession. The term chaos theory is introduced to explain inherent relationship of features within industry clusters. A preferred life cycle approach is proposed for industrial cluster recessive theory analysis. Lyapunov exponents and Wolf model are presented for chaotic identification and examination. A case study of Tianjin, China has verified the model effectiveness. The investigations indicate that the approaches outperform in explaining chaos properties in industrial clusters, which demonstrates industrial clusters evolution, solves empirical issues and generates corresponding strategies.

  11. DICON: interactive visual analysis of multidimensional clusters.

    PubMed

    Cao, Nan; Gotz, David; Sun, Jimeng; Qu, Huamin

    2011-12-01

    Clustering as a fundamental data analysis technique has been widely used in many analytic applications. However, it is often difficult for users to understand and evaluate multidimensional clustering results, especially the quality of clusters and their semantics. For large and complex data, high-level statistical information about the clusters is often needed for users to evaluate cluster quality while a detailed display of multidimensional attributes of the data is necessary to understand the meaning of clusters. In this paper, we introduce DICON, an icon-based cluster visualization that embeds statistical information into a multi-attribute display to facilitate cluster interpretation, evaluation, and comparison. We design a treemap-like icon to represent a multidimensional cluster, and the quality of the cluster can be conveniently evaluated with the embedded statistical information. We further develop a novel layout algorithm which can generate similar icons for similar clusters, making comparisons of clusters easier. User interaction and clutter reduction are integrated into the system to help users more effectively analyze and refine clustering results for large datasets. We demonstrate the power of DICON through a user study and a case study in the healthcare domain. Our evaluation shows the benefits of the technique, especially in support of complex multidimensional cluster analysis.

  12. Star formation and substructure in galaxy clusters

    SciTech Connect

    Cohen, Seth A.; Hickox, Ryan C.; Wegner, Gary A.; Einasto, Maret; Vennik, Jaan

    2014-03-10

    We investigate the relationship between star formation (SF) and substructure in a sample of 107 nearby galaxy clusters using data from the Sloan Digital Sky Survey. Several past studies of individual galaxy clusters have suggested that cluster mergers enhance cluster SF, while others find no such relationship. The SF fraction in multi-component clusters (0.228 ± 0.007) is higher than that in single-component clusters (0.175 ± 0.016) for galaxies with M{sub r}{sup 0.1}<−20.5. In both single- and multi-component clusters, the fraction of star-forming galaxies increases with clustercentric distance and decreases with local galaxy number density, and multi-component clusters show a higher SF fraction than single-component clusters at almost all clustercentric distances and local densities. Comparing the SF fraction in individual clusters to several statistical measures of substructure, we find weak, but in most cases significant at greater than 2σ, correlations between substructure and SF fraction. These results could indicate that cluster mergers may cause weak but significant SF enhancement in clusters, or unrelaxed clusters exhibit slightly stronger SF due to their less evolved states relative to relaxed clusters.

  13. Minima de L'intégrale D'action du Problème Newtoniende 4 Corps de Masses Égales Dans R3: Orbites `Hip-Hop'

    NASA Astrophysics Data System (ADS)

    Chenciner, Alain; Venturelli, Andrea

    2000-09-01

    We consider the problem of 4 bodies of equal masses in R 3 for the Newtonian r-1 potential. We address the question of the absolute minima of the action integral among (anti)symmetric loops of class H 1 whose period is fixed. It is the simplest case for which the results of [4] (corrected in [5]) do not apply: the minima cannot be the relative equilibria whose configuration is an absolute minimum of the potential among the configurations having a given moment of inertia with respect to their center of mass. This is because the regular tetrahedron cannot have a relative equilibrium motion in R 3 (see [2]). We show that the absolute minima of the action are not homographic motions. We also show that if we force the configuration to admit a certain type of symmetry of order 4, the absolute minimum is a collisionless orbit whose configuration ‘hesitates’ between the central configuration of the square and the one of the tetrahedron. We call these orbits ‘hip-hop’. A similar result holds in case of a symmetry of order 3 where the central configuration of the equilateral triangle with a body at the center of mass replaces the square.

  14. R3Au(6+x)Al26T (R = Ca, Sr, Eu, Yb; T = early transition metal): a large family of compounds with a stuffed BaHg11 structure type grown from aluminum flux.

    PubMed

    Latturner, Susan E; Bilc, Daniel; Mahanti, S D; Kanatzidis, Mercouri G

    2009-02-16

    A collection of new quaternary intermetallic compounds with a cubic, stuffed BaHg(11) structure type has been synthesized by the combination of a divalent rare earth or alkaline earth metal R, an early transition metal T, and gold in an excess of molten aluminum. Structural characterization of these R(3)Au(6+x)Al(26)T compounds by powder and single crystal X-ray diffraction indicates that the unit cell varies with the radii of the early transition metal T and the rare earth/alkaline earth R as expected. The element T (where T = group 4, 5, 6, and 7 element) appears to be responsible for the stabilization of up to 43 different members of the R(3)Au(6+x)Al(26)T family of compounds. Varying amounts of disorder and trends in partial occupancies of the Au stuffed site--the site that is vacant in the parent compound BaHg(11)--are also indicated by the diffraction studies of this family of compounds. Magnetic susceptibility data reveals that the transition metal atoms in these materials do not possess local magnetic moments. For the magnetic rare earth containing materials, the europium compounds undergo a ferromagnetic transition at 10 K, and the ytterbium analogues show mixed valent behavior. Band structure calculations also support a mixed valent state for Yb in these compounds.

  15. The paralogous R3 MYB proteins CAPRICE, TRIPTYCHON and ENHANCER OF TRY AND CPC1 play pleiotropic and partly non-redundant roles in the phosphate starvation response of Arabidopsis roots

    PubMed Central

    Chen, Chun-Ying; Schmidt, Wolfgang

    2015-01-01

    Phosphate (Pi) deficiency alters root hair length and frequency as a means of increasing the absorptive surface area of roots. Three partly redundant single R3 MYB proteins, CAPRICE (CPC), ENHANCER OF TRY AND CPC1 (ETC1) and TRIPTYCHON (TRY), positively regulate the root hair cell fate by participating in a lateral inhibition mechanism. To identify putative targets and processes that are controlled by these three transcription factors (TFs), we conducted transcriptional profiling of roots from Arabidopsis thaliana wild-type plants, and cpc, etc1 and try mutants grown under Pi-replete and Pi-deficient conditions using RNA-seq. The data show that in an intricate interplay between the three MYBs regulate several developmental, physiological and metabolic processes that are putatively located in different tissues. When grown on media with a low Pi concentration, all three TFs acquire additional functions that are related to the Pi starvation response, including transition metal transport, membrane lipid remodelling, and the acquisition, uptake and storage of Pi. Control of gene activity is partly mediated through the regulation of potential antisense transcripts. The current dataset extends the known functions of R3 MYB proteins, provides a suite of novel candidates with critical function in root hair development under both control and Pi-deficient conditions, and challenges the definition of genetic redundancy by demonstrating that environmental perturbations may confer specific functions to orthologous proteins that could have similar roles under control conditions. PMID:26022254

  16. The paralogous R3 MYB proteins CAPRICE, TRIPTYCHON and ENHANCER OF TRY AND CPC1 play pleiotropic and partly non-redundant roles in the phosphate starvation response of Arabidopsis roots.

    PubMed

    Chen, Chun-Ying; Schmidt, Wolfgang

    2015-08-01

    Phosphate (Pi) deficiency alters root hair length and frequency as a means of increasing the absorptive surface area of roots. Three partly redundant single R3 MYB proteins, CAPRICE (CPC), ENHANCER OF TRY AND CPC1 (ETC1) and TRIPTYCHON (TRY), positively regulate the root hair cell fate by participating in a lateral inhibition mechanism. To identify putative targets and processes that are controlled by these three transcription factors (TFs), we conducted transcriptional profiling of roots from Arabidopsis thaliana wild-type plants, and cpc, etc1 and try mutants grown under Pi-replete and Pi-deficient conditions using RNA-seq. The data show that in an intricate interplay between the three MYBs regulate several developmental, physiological and metabolic processes that are putatively located in different tissues. When grown on media with a low Pi concentration, all three TFs acquire additional functions that are related to the Pi starvation response, including transition metal transport, membrane lipid remodelling, and the acquisition, uptake and storage of Pi. Control of gene activity is partly mediated through the regulation of potential antisense transcripts. The current dataset extends the known functions of R3 MYB proteins, provides a suite of novel candidates with critical function in root hair development under both control and Pi-deficient conditions, and challenges the definition of genetic redundancy by demonstrating that environmental perturbations may confer specific functions to orthologous proteins that could have similar roles under control conditions.

  17. A Novel R2R3-MYB Transcription Factor BpMYB106 of Birch (Betula platyphylla) Confers Increased Photosynthesis and Growth Rate through Up-regulating Photosynthetic Gene Expression.

    PubMed

    Zhou, Chenguang; Li, Chenghao

    2016-01-01

    We isolated a R2R3-MYB transcription factor BpMYB106, which regulates photosynthesis in birch (Betula platyphylla Suk.). BpMYB106 mainly expresses in the leaf and shoot tip of birch, and its protein is localized in the nucleus. We further fused isolated a 1588 bp promoter of BpMYB106 and analyzed it by PLACE, which showed some cis-acting elements related to photosynthesis. BpMYB106 promoter β-glucuronidase (GUS) reporter fusion studies gene, the result, showed the GUS reporter gene in transgenic birch with BpMYB106 promoter showed strong activities in shoot tip, cotyledon margins, and mature leaf trichomes. The overexpression of BpMYB106 in birch resulted in significantly increased trichome density, net photosynthetic rate, and growth rate as compared with the wild-type birch. RNA-Seq profiling revealed the upregulation of several photosynthesis-related genes in the photosynthesis and oxidative phosphorylation pathways in the leaves of transgenic plants. Yeast one-hybrid analysis, coupled with transient assay in tobacco, revealed that BpMYB106 binds a MYB binding site MYB2 in differentially expressed gene promoters. Thus, BpMYB106 may directly activate the expression of a range of photosynthesis related genes through interacting with the MYB2 element in their promoters. Our study demonstrating the overexpression of BpMYB106-a R2R3-MYB transcription factor-upregulates the genes of the photosynthesis and oxidative phosphorylation pathways to improve photosynthesis.

  18. Clustering Teachers' Motivations for Teaching

    ERIC Educational Resources Information Center

    Visser-Wijnveen, Gerda J.; Stes, Ann; Van Petegem, Peter

    2014-01-01

    The motivation to teach is a powerful, yet neglected, force in teaching at institutes of higher education. A better understanding of academics' motivations for teaching is necessary. The aim of this mixed-method study was to identify groups with distinctively different motivations for teaching. Six clusters were identified: expertise, duty,…

  19. Symptom Clusters among Young Adolescents.

    ERIC Educational Resources Information Center

    Knishkowsky, Barry; And Others

    1995-01-01

    Examines recurrent psychosomatic symptoms and symptom clusters among Israeli school children (n=259). Results of a questionnaire that asked about the frequency of 8 psychosomatic and 8 organic complaints indicated that girls had a higher prevalence than boys for 8 of the symptoms, and that abdominal pain and headache were each reported as an…

  20. Interactive Maximum Reliability Cluster Analysis.

    ERIC Educational Resources Information Center

    Mays, Robert

    1978-01-01

    A FORTRAN program for clustering variables using the alpha coefficient of reliability is described. For batch operation, a rule for stopping the agglomerative precedure is available. The conversational version of the program allows the user to intervene in the process in order to test the final solution for sensitivity to changes. (Author/JKS)