Science.gov

Sample records for 19-rod clusters r3

  1. An imaging photoelectron-photoion coincidence investigation of homochiral 2R,3R-butanediol clusters

    NASA Astrophysics Data System (ADS)

    Daly, Steven; Powis, Ivan; Garcia, Gustavo A.; Tia, Maurice; Nahon, Laurent

    2017-07-01

    We report an experimental investigation of homochiral cluster formation in seeded molecular beam expansions of (2R,3R)-butanediol. Synchrotron radiation vacuum ultraviolet photoionization measurements have been performed using a double imaging electron-ion spectrometer in various configurations and modes of operation. These include measurements of the cluster ion mass spectra, wavelength scanned ion yields, and threshold electron spectra. Protonated cluster ions ranging up to n = 7 have been observed and size-selected photoelectron spectra and photoelectron circular dichroism (PECD) have been recorded by velocity map imaging, recorded in coincidence with ions, at a number of fixed photon energies. Translation temperatures of the cluster ions have been further examined by ion imaging measurements. As well as the sequence of protonated clusters with integral numbers of butanediol monomer units, a second series with half-integral monomer masses is observed and deduced to result from a facile cleavage of a butanediol monomer moiety within the nascent cluster. This second sequence of half-integral masses displays quite distinct behaviours. PECD measurements are used to show that the half-integral mass cluster ions do not share a common parentage with whole integer masses. Using an analogy developed with simple theoretical calculations of butanediol dimer structures, it is inferred that the dissociative branching into integral and half-integral ion mass sequences is controlled by the presence of different butanediol monomer conformations within the hydrogen bonded clusters.

  2. Five anthocyanin polymorphisms are associated with an R2R3-MYB cluster in Mimulus guttatus (Phrymaceae).

    PubMed

    Lowry, David B; Sheng, Calvin C; Lasky, Jesse R; Willis, John H

    2012-01-01

    Botanists have long been interested in the reasons for genetic variation among individuals, populations, and species of plants. The anthocyanin pathway is ideal for studying the evolution of such phenotypic variation. We used a combination of quantitative trait loci mapping and association studies to understand the genetic basis of variation in five anthocyanin phenotypes including calyx, corolla, and leaf coloration patterns that vary within and among populations of Mimulus guttatus. We then examined what genes might be responsible for this phenotypic variation and whether one of the traits, calyx spotting, is randomly distributed across the geographic range of the species. All five phenotypes in M. guttatus were primarily controlled by the same major locus (PLA1), which contains a tandem array of three R2R3-MYB genes known to be involved in the evolution of flower color in a related species of Mimulus. Calyx spotting was nonrandomly distributed across the range of M. guttatus and correlated with multiple climate variables. The results of this study suggest that variation in R2R3-MYB genes is the primary cause of potentially important anthocyanin phenotypic variation within and among populations of M. guttatus, a finding consistent with recent theoretical and empirical research on flower color evolution.

  3. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    PubMed

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  4. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    PubMed Central

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  5. Isolation and Molecular Characterization of Thirteen R2R3-MYB Transcription Factors from Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Sun, Wei; Lv, Haiyan; Xiao, Gong; Zeng, Shaohua; Wang, Ying

    2013-01-01

    Epimedium sagittatum (Sieb. et Zucc.) Maxim, a popular traditional Chinese medicinal plant, has been widely used for treating sexual dysfunction and osteoporosis in China. The main bioactive components in herba epimedii are prenylated flavonol glycosides, which are end products of a branch of the flavonoid biosynthetic pathway. The MYB transcription factors (TF) act as activators or repressors to regulate the flavonoid pathway. In this study, 13 full-length cDNA clones of R2R3-MYB TFs from E. sagittatum (designated as EsMYB1 to EsMYB13) were isolated and characterized. Sequence similarity and phylogenetic analysis placed nine R2R3-MYB members of E. sagittatum into five subgroups of the Arabidopsis R2R3-MYB family, while four members were not clustered into a defined subgroup. The number and length of introns from Epimedium R2R3-MYB genes varied significantly, but intron positions and phases were well conserved. Expression patterns of Epimedium R2R3-MYB genes in various tissues showed diverse. Finally, it is suggested that five Epimedium R2R3-MYB genes may be involved in regulating the flavonoid pathway and could be used as valuable candidate genes for metabolic engineering studies in future. Sequence information of 13 R2R3-MYB genes discovered here will also provide an entry point into the overview of whole R2R3-MYB family in Epimedium. PMID:23271373

  6. Isolation and molecular characterization of thirteen R2R3-MYB transcription factors from Epimedium sagittatum.

    PubMed

    Huang, Wenjun; Sun, Wei; Lv, Haiyan; Xiao, Gong; Zeng, Shaohua; Wang, Ying

    2012-12-27

    Epimedium sagittatum (Sieb. et Zucc.) Maxim, a popular traditional Chinese medicinal plant, has been widely used for treating sexual dysfunction and osteoporosis in China. The main bioactive components in herba epimedii are prenylated flavonol glycosides, which are end products of a branch of the flavonoid biosynthetic pathway. The MYB transcription factors (TF) act as activators or repressors to regulate the flavonoid pathway. In this study, 13 full-length cDNA clones of R2R3-MYB TFs from E. sagittatum (designated as EsMYB1 to EsMYB13) were isolated and characterized. Sequence similarity and phylogenetic analysis placed nine R2R3-MYB members of epimedii into five subgroups of the Arabidopsis R2R3-MYB family, while four members were not clustered into a defined subgroup. The number and length of introns from epimedii R2R3-MYB genes varied significantly, but intron positions and phases were well conserved. Expression patterns of epimedii R2R3-MYB genes in various tissues showed diverse. Finally, it is suggested that five epimedii R2R3-MYB genes may be involved in regulating the flavonoid pathway and could be used as valuable candidate genes for metabolic engineering studies in future. Sequence information of 13 R2R3-MYB genes discovered here will also provide an entry point into the overview of whole R2R3-MYB family in epimedii.

  7. Genome-wide identification, functional prediction, and evolutionary analysis of the R2R3-MYB superfamily in Brassica napus.

    PubMed

    Hajiebrahimi, Ali; Owji, Hajar; Hemmati, Shiva

    2017-10-01

    R2R3-MYB transcription factors (TFs) have been shown to play important roles in plants, including in development and in various stress conditions. Phylogenetic analysis showed the presence of 249 R2R3-MYB TFs in Brassica napus, called BnaR2R3-MYB TFs, clustered into 38 clades. BnaR2R3-MYB TFs were distributed on 19 chromosomes of B. napus. Sixteen gene clusters were identified. BnaR2R3-MYB TFs were characterized by motif prediction, gene structure analysis, and gene ontology. Evolutionary analysis revealed that BnaR2R3-MYB TFs are mainly formed as a result of whole-genome duplication. Orthologs and paralogs of BnaR2R3-MYB TFs were identified in B. napus, B. rapa, B. oleracea, and Arabidopsis thaliana using synteny-based methods. Purifying selection was pervasive within R2R3-MYB TFs. Kn/Ks values lower than 0.3 indicated that BnaR2R3-MYB TFs are being functionally converged. The role of gene conversion in the formation of BnaR2R3-MYB TFs was significant. Cis-regulatory elements in the upstream regions of BnaR2R3-MYB genes, miRNA targeting BnaR2R3MYB TFs, and post translational modifications were identified. Digital expression data revealed that BnaR2R3-MYB genes were highly expressed in the roots and under high salinity treatment after 24 h. BnaMYB21, BnaMYB141, and BnaMYB148 have been suggested for improving salt-tolerant B. napus. BnaR2R3-MYB genes were mostly up regulated on the 14th day post inoculation with Leptosphaeria biglobosa and L. maculan. BnaMYB150 is a candidate for increased tolerance to Leptospheria in B. napus.

  8. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects.

    PubMed

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; Todd King, M; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; Vanitallie, Theodore B; Veech, Richard L

    2012-08-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1-2h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8-3.1h for β-hydroxybutyrate and 8-14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet.

  9. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; King, M. Todd; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; VanItallie, Theodore B.; Veech, Richard L.

    2013-01-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1–2 h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8–3.1 h for β-hydroxybutyrate and 8–14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet. PMID:22561291

  10. DISINTEGRATING ASTEROID P/2013 R3

    SciTech Connect

    Jewitt, David; Li, Jing; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Larson, Stephen

    2014-03-20

    Splitting of the nuclei of comets into multiple components has been frequently observed but, to date, no main-belt asteroid has been observed to break up. Using the Hubble Space Telescope, we find that main-belt asteroid P/2013 R3 consists of 10 or more distinct components, the largest up to 200 m in radius (assumed geometric albedo of 0.05) each of which produces a coma and comet-like dust tail. A diffuse debris cloud with total mass ∼2 × 10{sup 8} kg further envelopes the entire system. The velocity dispersion among the components, ΔV ∼ 0.2-0.5 m s{sup –1}, is comparable to the gravitational escape speeds of the largest members, while their extrapolated plane-of-sky motions suggest a break up between 2013 February and September. The broadband optical colors are those of a C-type asteroid. We find no spectral evidence for gaseous emission, placing model-dependent upper limits to the water production rate ≤1 kg s{sup –1}. Breakup may be due to a rotationally induced structural failure of the precursor body.

  11. Oral 28-day and developmental toxicity studies of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; Knight, Nicholas S.; Murray, Andrew J.; Cochlin, Lowri E.; King, M. Todd; Wong, Andrea W.; Roberts, Ashley; Robertson, Jeremy; Veech, Richard L.

    2013-01-01

    (R)-3-Hydroxybutyl (R)-3-hydroxybutyrate (ketone monoester) has been developed as an oral source of ketones, which may be utilized for energy. In a 28-day toxicity study, Crl:WI (Wistar) rats received diets containing, as 30% of the calories, ketone monoester (12 and 15 g/kg body weight/day for male and female rats, respectively). Control groups received either carbohydrate- or fat-based diets. Rats in the test group consumed less feed and gained less weight than control animals; similar findings have been documented in studies of ketogenic diets. Between-group differences were noted in selected hematology, coagulation, and serum chemistry parameters; however, values were within normal physiological ranges and/or were not accompanied by other changes indicative of toxicity. Upon gross and microscopic evaluation, there were no findings associated with the ketone monoester. In a developmental toxicity study, pregnant Crl:WI (Han) rats were administered 2 g/kg body weight/day ketone monoester or water (control) via gavage on days 6 through 20 of gestation. No Caesarean-sectioning or litter parameters were affected by the test article. The overall incidence of fetal alterations was higher in the test group; however, there were no specific alterations attributable to the test substance. The results of these studies support the safety of ketone monoester. PMID:22504461

  12. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  13. Project R-3 (San Jose, California): Analysis and Selection Kit.

    ERIC Educational Resources Information Center

    RMC Research Corp., Mountain View, CA.

    Project R-3 is a motivational program designed to upgrade essential reading and math skills of junior high school students. It emphasizes student readiness, subject relevance, and learning reinforcement (R-3) in a laboratory environment. All incoming seventh graders are involved in the project and remain with it for three years. A teaching team of…

  14. Production of (R)-3-hydroxybutyric acid by Arxula adeninivorans.

    PubMed

    Biernacki, Mateusz; Riechen, Jan; Hähnel, Urs; Roick, Thomas; Baronian, Kim; Bode, Rüdiger; Kunze, Gotthard

    2017-12-01

    (R)-3-hydroxybutyric acid can be used in industrial and health applications. The synthesis pathway comprises two enzymes, β-ketothiolase and acetoacetyl-CoA reductase which convert cytoplasmic acetyl-CoA to (R)-3-hydroxybutyric acid [(R)-3-HB] which is released into the culture medium. In the present study we used the non-conventional yeast, Arxula adeninivorans, for the synthesis enantiopure (R)-3-HB. To establish optimal production, we investigated three different endogenous yeast thiolases (Akat1p, Akat2p, Akat4p) and three bacterial thiolases (atoBp, thlp, phaAp) in combination with an enantiospecific reductase (phaBp) from Cupriavidus necator H16 and endogenous yeast reductases (Atpk2p, Afox2p). We found that Arxula is able to release (R)-3-HB used an existing secretion system negating the need to engineer membrane transport. Overexpression of thl and phaB genes in organisms cultured in a shaking flask resulted in 4.84 g L(-1) (R)-3-HB, at a rate of 0.023 g L(-1) h(-1) over 214 h. Fed-batch culturing with glucose as a carbon source did not improve the yield, but a similar level was reached with a shorter incubation period [3.78 g L(-1) of (R)-3-HB at 89 h] and the rate of production was doubled to 0.043 g L(-1) h(-1) which is higher than any levels in yeast reported to date. The secreted (R)-3-HB was 99.9% pure. This is the first evidence of enantiopure (R)-3-HB synthesis using yeast as a production host and glucose as a carbon source.

  15. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification.

    PubMed

    Chicote, Javier U; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins.

  16. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification

    PubMed Central

    Chicote, Javier U.; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins. PMID:28257417

  17. Complete biconservative surfaces in R3 and S3

    NASA Astrophysics Data System (ADS)

    Nistor, Simona

    2016-12-01

    In this paper we consider the complete biconservative surfaces in Euclidean space R3 and in the unit Euclidean sphere S3. Biconservative surfaces in 3-dimensional space forms are characterized by the fact that the gradient of their mean curvature function is an eigenvector of the shape operator, and we are interested in studying local and global properties of such surfaces with non-constant mean curvature function. We determine the simply connected, complete Riemannian surfaces that admit biconservative immersions in R3 and S3. Moreover, such immersions are explicitly described.

  18. Detector production for the R3B Si-tracker

    NASA Astrophysics Data System (ADS)

    Borri, M.; Lemmon, R.; Thornhill, J.; Bate, R.; Chartier, M.; Clague, N.; Herzberg, R.-D.; Labiche, M.; Lindsay, S.; Nolan, P.; Pearce, F.; Powell, W.; Wells, D.

    2016-11-01

    R3B is a fixed target experiment which will study reactions with relativistic radioactive beams at FAIR. Its Si-tracker will surround the target volume and it will detect light charged-particles like protons. The detector technology in use consists of double-sided silicon strip sensors wire bonded to the custom made R3B-ASIC. The tracker allows for a maximum of two outer layers and one inner layer. This paper reports on the production of detectors necessary to build the minimum tracking configuration: one inner layer and one outer layer.

  19. Biotechnological production of (R)-3-hydroxybutyric acid monomer.

    PubMed

    Tokiwa, Yutaka; Ugwu, Charles U

    2007-11-01

    The escalating problems regarding the treatment of plastic waste materials have led to development of biodegradable plastics. At present, a number of aliphatic polyesters; such as poly[(R)-3-hydroxybutyrate] (PHB), poly(l-lactide), polycaplolactone, poly(ethylene succinate) and poly(butylene succinate) have been developed. Among these aliphatic polyesters, PHB is one of the most attractive since it can undergo biodegradation at various environmental conditions and has properties similar to polypropylene. Although much effort has been made to produce PHB and its copolyesters from renewable resources or through microbial processes, their commercialization and widespread application are still not economically attractive compared to conventional non-biodegradable plastic. Moreover, wide application of PHB and its copolyesters as biodegradable plastic have not only been limited by the cost of production but also by their stinky smell during industrial processing. However, (R)-3-hydroxybutyric acid, a monomer of PHB has wide industrial and medical applications. (R)-3-hydroxybutyric acid can also serve as chiral precursor for synthesis of pure biodegradable PHB and its copolyesters. A number of options are available for production of (R)-3-hydroxybutyric acid. This review discusses each of these options to assess the alternatives that exist for production of pure biodegradable PHB and its copolyesters with good properties.

  20. R3 - Management in Demil Operations: Today and Tomorrow

    DTIC Science & Technology

    2000-04-01

    from human activities. How the dumping should to be perfomed was regulated in detail by the Armed Forces, though the instructions were a little...demilitarization of ammunition and alternatives to OB/OD as well as recource recovery and reuse (R3) management. The project also includes monitoring...society in which human activity does not damage health, climate or ecosystems. 5 It is a society geared to renewable resources and conserving the resources

  1. High Performance Analytics with the R3-Cache

    NASA Astrophysics Data System (ADS)

    Eavis, Todd; Sayeed, Ruhan

    Contemporary data warehouses now represent some of the world’s largest databases. As these systems grow in size and complexity, however, it becomes increasingly difficult for brute force query processing approaches to meet the performance demands of end users. Certainly, improved indexing and more selective view materialization are helpful in this regard. Nevertheless, with warehouses moving into the multi-terabyte range, it is clear that the minimization of external memory accesses must be a primary performance objective. In this paper, we describe the R 3-cache, a natively multi-dimensional caching framework designed specifically to support sophisticated warehouse/OLAP environments. R 3-cache is based upon an in-memory version of the R-tree that has been extended to support buffer pages rather than disk blocks. A key strength of the R 3-cache is that it is able to utilize multi-dimensional fragments of previous query results so as to significantly minimize the frequency and scale of disk accesses. Moreover, the new caching model directly accommodates the standard relational storage model and provides mechanisms for pro-active updates that exploit the existence of query “hot spots”. The current prototype has been evaluated as a component of the Sidera DBMS, a “shared nothing” parallel OLAP server designed for multi-terabyte analytics. Experimental results demonstrate significant performance improvements relative to simpler alternatives.

  2. Two-Dimensional Raman Correlation Spectroscopy Study of Poly[(R)-3-hydroxybutyrate- co-(R)-3-hydroxyhexanoate] Copolymers.

    PubMed

    Noda, Isao; Roy, Anjan; Carriere, James; Sobieski, Brian J; Chase, D Bruce; Rabolt, John F

    2017-07-01

    Two-dimensional correlation analysis was applied to the time-dependent evolution of Raman spectra during the isothermal crystallization of bioplastic, poly[(R)-3-hydroxybutyrate- co-(R)-3-hydroxyhexanoate] or PHBHx copolymer. Simultaneous Raman measurement of both carbonyl stretching and low-frequency crystalline lattice mode regions made it possible to carry out the highly informative hetero-mode correlation analysis. The crystallization process of PHBHx involves: (1) the early nucleation stage; (2) the primary growth of well-ordered crystals of PHBHx; and (3) the secondary crystal growth phase. The latter stage probably occurs in the inter-lamellar region, with an accompanying reduction of the amorphous component, which occurs most dominantly during the primary crystal growth. The development of a fully formed lamellar structure comprising the 21 helices occurs after the primary growth of crystals. In the later stage, secondary inter lamellar space crystallization occurs after the full formation of packed helices comprising the lamellae.

  3. Perturbative Chern-Simons theory on noncommutative Bbb R3

    NASA Astrophysics Data System (ADS)

    Bichl, Andreas A.; Grimstrup, Jesper M.; Putz, Volkmar; Schweda, Manfred

    2000-07-01

    A U(N) Chern-Simons theory on non-commutative Bbb R3 is constructed as a θ-deformed field theory. The model is characterized by two symmetries: the BRST-symmetry and the topological linear vector supersymmetry. It is shown that the theory is finite and θ-independent at the one-loop level and that the calculations respect the restriction of the topological supersymmetry. Thus the topological θ-deformed Chern-Simons theory is an example of a model which is non singular in the limit θ→0.

  4. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission

    PubMed Central

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  5. Additive manufacturing of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] scaffolds for engineered bone development.

    PubMed

    Mota, Carlos; Wang, Shen-Yu; Puppi, Dario; Gazzarri, Matteo; Migone, Chiara; Chiellini, Federica; Chen, Guo-Qiang; Chiellini, Emo

    2017-01-01

    A wide range of poly(hydroxyalkanoate)s (PHAs), a class of biodegradable polyesters produced by various bacteria grown under unbalanced conditions, have been proposed for the fabrication of tissue-engineering scaffolds. In this study, the manufacture of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] (or PHBHHx) scaffolds, by means of an additive manufacturing technique based on a computer-controlled wet-spinning system, was investigated. By optimizing the processing parameters, three-dimensional scaffolds with different internal architectures were fabricated, based on a layer-by-layer approach. The resulting scaffolds were characterized by scanning electron microscopy, which showed good control over the fibre alignment and a fully interconnected porous network, with porosity in the range 79-88%, fibre diameter 47-76 µm and pore size 123-789 µm. Moreover, the resulting fibres presented an internal porosity connected to the external fibre surface as a consequence of the phase-inversion process governing the solidification of the polymer solution. Scaffold compressive modulus and yield stress and strain could be varied in a certain range by changing the architectural parameters. Cell-culture experiments employing the MC3T3-E1 murine pre-osteoblast cell line showed good cell proliferation after 21 days of culture. The PHBHHx scaffolds demonstrated promising results in terms of cell differentiation towards an osteoblast phenotype. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  6. The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

    DOE PAGES

    Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

    2017-06-24

    In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

  7. Evaluation of electron population terms for <r-3Se>4p, <r-3S>3p, and <r-3O>(2p): how do HOMO and LUMO shrink or expand depending on nuclear charges?

    PubMed

    Nakanishi, Waro; Hayashi, Satoko; Narahara, Kenji; Yamaki, Daisuke; Hada, Masahiko

    2008-01-01

    Electron population terms <r(-3)N> are evaluated for N=Se, S, and O. Calculations are performed on HOMO and LUMO constructed by pure atomic 4p(Se), 3p(S), and 2p(O) orbitals, employing the 6-311+G(3d) and/or 6-311(++)G(3df,3pd) basis sets at the HF, MP2, and DFT (B3 LYP) levels. Se(4+), Se(2+), Se(0), and Se(2-) with the O(h) symmetry are called G(A: Se) and HSe(+), H(2)Se, and HSe(-) with the C(infinityh) or C(2v) symmetry are named G(B: Se), here [G(A+B: Se) in all]. HOMO and LUMO in G(A+B: N) (N=Se, S, and O) satisfy the conditions of the calculations for <r(-3)N>. The <r(-3)Se>(4p), <r(-3)S>(3p), and <r(-3)O>(2p) values correlate well with the corresponding MO energies (epsilon(N)) for all calculation levels employed. Plots of <r(-3)N>(HOMO) and <r(-3)N>(LUMO) versus Q(N) (N=Se, S, and O) at the HF and MP2 levels are analyzed as two correlations. However, the plots at the DFT level can be analyzed as single correlation. A regression curve is assumed for the analysis. Behaviors of <r(-3)N> clarify how valence orbitals shrink or expand depending on Q(N). The applicability of <r(-3)N> is examined to establish a new method that enables us to analyze chemical shifts with the charge effect separately from others. A utility program derived from the Gaussian 03 (NMRANAL-NH03G) is applied to evaluate <r(-3)N> and examine the applicability to the NMR analysis.

  8. Distributed temperature sensing inside a 19-rod bundle

    DOE PAGES

    Lomperski, S.; Bremer, N.; Gerardi, C.

    2017-05-23

    The temperature field within a model of a sodium-cooled fast reactor fuel rod bundle was measured using Ø155 μm fiber optic distributed temperature sensors (DTS). The bundle consists of 19 electrically-heated rods Ø6.3 mm and 865 mm long. Working fluids were argon and air at atmospheric pressure and Reynolds numbers up to 300. A 20 m-long DTS was threaded through Ø1 mm capillaries wound around rods as wire-wraps. The sensor generated 173 measurements along each rod at 5 mm resolution for a total of 3300 data locations. A second DTS, 58 m long, was suspended between rods to provide 9300more » fluid temperature measurements at 20 mm resolution. Such data density makes it possible to construct 3D maps of the temperature field that are beyond the reach of traditional sensors such as thermocouples. This is illustrated through a series of steady-state and transient tests. As a result, the work demonstrates the feasibility of mapping temperature within the close confines of a rod bundle at resolutions suitable for validation of computational fluid dynamics codes.« less

  9. Gold in the layered structures of R3Au7Sn3: From relativity to versatility

    DOE PAGES

    Provino, Alessia; Steinberg, Simon Alexander; Smetana, Volodymyr; ...

    2016-07-11

    A new isotypic series of ternary rare earth element-gold-tetrel intermetallic compounds has been synthesized and their structures and properties have been characterized. R3Au7Sn3 (R = Y, La-Nd, Sm, Gd-Tm, Lu) crystallize with the hexagonal Gd3Au7Sn3 prototype (Pearson symbol hP26; P63/m, a = 8.110-8.372 Å, c = 9.351-9.609 Å, Vcell = 532.7-583.3 Å3, Z = 2), an ordered variant of the Cu10Sn3-type. Their structure is built up by GdPt2Sn-type layers, which feature edge-sharing Sn@Au6 trigonal antiprisms connected by trigonal R3 groups. Additional insertion of gold atoms leads to the formation of new homoatomic Au clusters, Au@Au6; alternatively, the structure can bemore » considered as a superstructural polyhedral packing of the ZrBeSi-type. The magnetization, heat ca-pacity and electrical resistivity have been measured for R3Au7Sn3 (R = Ce, Pr, Nd and Tb). All four compounds order antiferromagnetically with the highest TN of 13 K for Tb3Au7Sn3. In Ce3Au7Sn3, which has a TN of 2.9 K, the heat capacity and electrical resistivity data in zero and applied fields indicate the presence of Kondo interactions. The coefficient of the linear term in the electronic heat capacity, γ, derived from the heat capacity data below 0.5 K is 211 mJ/Ce mol K2 suggesting strong electronic correlations due to the Kondo interaction. The electronic structure calculations based on the projector augmented wave method for particular representatives of the series suggest different tendencies of the localized R-4f AOs to hybridize with the valence states. LMTO-based bonding analysis on the non-magnetic La3Au7Sn3 indicates that the integrated crystal orbital Hamilton popu-lations (COHPs) are dominated by the heteroatomic Au–Sn contacts; however, contributions from La–Au and La–Sn separations are significant, both together exceeding 40 % in the overall bonding. Furthermore, homoatomic Au–Au interactions are evident for the Au@Au6 units but, despite of the high atomic concentration of

  10. UV mutagenesis of Cupriavidus necator for extracellular production of (R)-3-hydroxybutyric acid.

    PubMed

    Ugwu, C U; Tokiwa, Y; Aoyagi, H; Uchiyama, H; Tanaka, H

    2008-07-01

    Ultraviolet (UV) mutagenesis was carried out to obtain mutant strains of Cupriavidus necator that could produce (R)-3-hydroxybutyric acid [(R)-3-HB] in the culture supernatant. C. necator (formerly known as Ralstonia eutropha) was subjected to UV radiation to generate mutants that are capable of producing (R)-3-HB in the culture supernatant. Results indicated that UV mutagen disrupted the phbB (phbB knock-out) and thus, promoted production of (R)-3-HB in mutant strains. Inclusion of acetoacetate esters (carbonyl compounds) in the culture broth led to increased production of (R)-3-HB. Thus, acetoacetyl-CoA (an intermediate of the PHB synthetic pathway) might have been converted to acetoacetate, which in the presence of (R)-3-HB dehydrogenase and NADPH/NADP(+), resulted in extracellular production of (R)-3-HB. UV mutagenesis proved to be a satisfactory method in generating interesting mutants for extracellular production of (R)-3-HB. Extracellular production of (R)-3-HB upon addition of acetoacetate esters would suggest a likely (R)-3-HB biosynthetic pathway in C. necator. Mutants obtained in this study are very useful for production of (R)-3-HB. For the first time, the production of (R)-3-HB by C. necator via acetoacetate is reported.

  11. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice

    PubMed Central

    Inoue, Masashi; Glendinning, John I.; Theodorides, Maria L.; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K.; Bachmanov, Alexander A.

    2008-01-01

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (d-tryptophan, d-phenylalanine, l-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (l-glutamine, l-threonine, l-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5′-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

  12. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice.

    PubMed

    Inoue, Masashi; Glendinning, John I; Theodorides, Maria L; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K; Bachmanov, Alexander A

    2007-12-19

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (D-tryptophan, D-phenylalanine, L-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (L-glutamine, L-threonine, L-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5'-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system.

  13. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene.

    PubMed

    Murovets, Vladimir O; Bachmanov, Alexander A; Zolotarev, Vasiliy A

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain.

  14. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene

    PubMed Central

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain. PMID:26107521

  15. Gold-rich R3Au7Sn3: Establishing the interdependence between electronic features and physical properties

    DOE PAGES

    Provino, Alessia; Steinberg, Simon; Smetana, Volodymyr; ...

    2015-05-18

    Two new polar intermetallic compounds Y3Au7Sn3 (I) and Gd3Au7Sn3 (II) have been synthesized and their structures have been determined by single crystal X-ray diffraction (P63/m; Z = 2, a = 8.148(1)/8.185(3), and c = 9.394(2)/9.415(3) for I/II, respectively). They can formally be assigned to the Cu10Sn3 type and consist of parallel slabs of Sn centered, edge-sharing trigonal Au6 antiprisms connected through R3 (R = Y, Gd) triangles. Additional Au atoms reside in the centres of trigonal Au6 prisms forming Au@Au6 clusters with Au–Au distances of 2.906–2.960 Å, while the R–R contacts in the R3 groups are considerably larger than themore » sums of their metallic radii. These exclusive structural arrangements provide alluring systems to study the synergism between strongly correlated systems, particularly, those in the structure of (II), and extensive polar intermetallic contacts, which has been inspected by measurements of the magnetic properties, heat capacities and electrical conductivities of both compounds. Gd3Au7Sn3 shows an antiferromagnetic ordering at 13 K, while Y3Au7Sn3 is a Pauli paramagnet and a downward curvature in its electrical resistivity at about 1.9 K points to a superconducting transition. DFT-based band structure calculations on R3Au7Sn3 (R = Y, Gd) account for the results of the conductivity measurements and different spin ordering models of (II) provide conclusive hints about its magnetic structure. As a result, chemical bonding analyses of both compounds indicate that the vast majority of bonding originates from the heteroatomic Au–Gd and Au–Sn interactions, while homoatomic Au–Au bonding is evident within the Au@Au6 clusters.« less

  16. Phenoxy herbicides and fibrates potently inhibit the human chemosensory receptor subunit T1R3

    PubMed Central

    Maillet, Emeline L.; Margolskee, Robert F.; Mosinger, Bedrich

    2009-01-01

    We show that phenoxy-auxin herbicides and lipid-lowering fibrates inhibit human but not rodent T1R3. T1R3 as a co-receptor in taste cells responds to sweet compounds and amino-acids; in endocrine cells of gut and pancreas T1R3 contributes to glucose sensing. Thus, certain effects of fibrates in treating hyperlipidemia and type II diabetes may be via actions on T1R3. Likewise, phenoxy-herbicides may have adverse metabolic effects in humans that would have gone undetected in studies on rodents. PMID:19817384

  17. Crystal structure of 2-amino-4-methyl-pyridin-1-ium (2R,3R)-3-carb-oxy-2,3-di-hydroxy-propano-ate monohydrate.

    PubMed

    Jovita, J V; Sathya, S; Usha, G; Vasanthi, R; Ramanand, A

    2014-09-01

    The title mol-ecular salt, C6H9N2 (+)·C4H5O6 (-)·H2O, crystallized with two 2-amino-4-methyl-pyridin-1-ium cations, two l-(+)-tartaric acid monoanions [systematic name: (2R,3R)-3-carb-oxy-2,3-di-hydroxy-propano-ate] and two water mol-ecules in the asymmetric unit. In the crystal, the cations, anions and water mol-ecules are linked via a number of O-H⋯O and N-H⋯O hydrogen bonds, and a C-H⋯O hydrogen bond, forming a three-dimensional structure.

  18. (2R,3S,4R)-3,4-Isopropyl­idenedi­oxy-2-(phenyl­sulfonyl­meth­yl)pyrrolidin-1-ol

    PubMed Central

    Flores, Mari Fe; Garcia, Pilar; M. Garrido, Narciso; Sanz, Francisca; Diez, David

    2012-01-01

    The title compound, C14H19NO5S, was prepared by nucleophilic addition of the lithium derivative of methyl­phenyl­sulfone to (3S,4R)-3,4-isopropyl­idene­dioxy­pyrroline 1-oxide. There are four mol­ecules in the asymmetric unit. The crystal structure determination confirms the configuration of the chiral centres as 2R,3S,4R. In the crystal, pairs of O—H⋯N hydrogen bonds link the mol­ecules into dimers. PMID:22904989

  19. Closure report for underground storage tank 141-R3U1 and its associated underground piping

    SciTech Connect

    Mallon, B.J.; Blake, R.G.

    1994-03-01

    Underground storage tank UST 141-R3U1 at Lawrence Livermore National Laboratory (LLNL), was registered with the State Water Resources Control Board on June 27, 1984. This tank system consisted of a concrete tank, lined with polyvinyl chloride, and approximately 100 feet of PVC underground piping. UST 141-R3U1 had a capacity of 450 gallons. The underground piping connected three floor drains and one sink inside Building 141 to UST 141-R3U1. The wastewater collected in UST 141-R3U1 contained organic solvents, metals, and inorganic acids. On November 30, 1987, the 141-R3U1 tank system failed a precision tank test. The 141-R3U1 tank system was subsequently emptied and removed from service pending further precision tests to determine the location of the leak within the tank system. A precision tank test on February 5, 1988, was performed to confirm the November 30, 1987 test. Four additional precision tests were performed on this tank system between February 25, 1988, and March 6, 1988. The leak was located where the inlet piping from Building 141 penetrates the concrete side of UST 141-R3U1. The volume of wastewater that entered the backfill and soil around and/or beneath UST 141-R3U1 is unknown. On December 13, 1989, the LLNL Environmental Restoration Division submitted a plan to close UST 141-R3U1 and its associated piping to the Alameda County Department of Environmental Health. UST 141-R3U1 was closed as an UST, and shall be used instead as additional secondary containment for two aboveground storage tanks.

  20. Diversification of R2R3-MYB Transcription Factors in the Tomato Family Solanaceae.

    PubMed

    Gates, Daniel J; Strickler, Susan R; Mueller, Lukas A; Olson, Bradley J S C; Smith, Stacey D

    2016-08-01

    MYB transcription factors play an important role in regulating key plant developmental processes involving defense, cell shape, pigmentation, and root formation. Within this gene family, sequences containing an R2R3 MYB domain are the most abundant type and exhibit a wide diversity of functions. In this study, we identify 559 R2R3 MYB genes using whole genome data from four species of Solanaceae and reconstruct their evolutionary relationships. We compare the Solanaceae R2R3 MYBs to the well-characterized Arabidopsis thaliana sequences to estimate functional diversity and to identify gains and losses of MYB clades in the Solanaceae. We identify numerous R2R3 MYBs that do not appear closely related to Arabidopsis MYBs, and thus may represent clades of genes that have been lost along the Arabidopsis lineage or gained after the divergence of Rosid and Asterid lineages. Despite differences in the distribution of R2R3 MYBs across functional subgroups and species, the overall size of the R2R3 subfamily has changed relatively little over the roughly 50 million-year history of Solanaceae. We added our information regarding R2R3 MYBs in Solanaceae to other data and performed a meta-analysis to trace the evolution of subfamily size across land plants. The results reveal many shifts in the number of R2R3 genes, including a 54 % increase along the angiosperm stem lineage. The variation in R2R3 subfamily size across land plants is weakly positively correlated with genome size and strongly positively correlated with total number of genes. The retention of such a large number of R2R3 copies over long evolutionary time periods suggests that they have acquired new functions and been maintained by selection. Discovering the nature of this functional diversity will require integrating forward and reverse genetic approaches on an -omics scale.

  1. Downregulation of DcR3 sensitizes hepatocellular carcinoma cells to TRAIL-induced apoptosis

    PubMed Central

    Liang, Chaojie; Xu, Yingchen; Li, Guangming; Zhao, Tuanjie; Xia, Feng; Li, Guanqun; Zhang, Dongxin; Wu, Jixiang

    2017-01-01

    Decoy receptor 3 (DcR3) has been recently described as an antiapoptosis and prometastasis factor since it can competitively bind to FasL, TL1A, and LIGHT, and it is highly expressed in many malignant tumors. Downregulation of DcR3 can promote tumor cell apoptosis and inhibit metastasis. A previous study demonstrated that reduction of DcR3 could induce tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis in pancreatic cancer cells. However, whether such an effect is seen in hepatocellular carcinoma (HCC) remains to be explored. This study was designed to investigate the sensitivity of HCC cells to TRAIL after silencing DcR3, and this was done by evaluating the expression of DcR3 in HCC cells and the effect on TRAIL-mediated apoptosis after downregulation of DcR3. Our data showed that DcR3 was highly expressed in HepG2, BEL-7402, Hep3B, Huh-7, MHCC97H, and SMCC7721 cell lines compared with normal liver cell line LO-2. Both HepG2 and BEL-7402 were tolerant to TRAIL-mediated apoptosis, and the tolerance was negatively correlated to the expression of DcR3. Silencing of DcR3 with shRNA and treatment with TRAIL induced obvious apoptosis in HepG2 and BEL-7402, with more cancer cells found in the G1 phase. SiDcR3 combined with TRAIL could induce activation of caspases-3, -8, and -9, raise the expression of the apoptotic protein Bax, and reduce the expression of antiapoptotic proteins (Bcl-2, Mcl-1, Bcl-XL, IAP-2, and survivin). Caspase-8 inhibitor Ac-IETD-CHO significantly decreased the activation of caspase cascade, indicating that the extrinsic pathway may have a vital role in the apoptotic events induced by SiDcR3/TRAIL. Furthermore, our results showed that the TRAIL death receptor 5 (DR5) was upregulated and that DR5 neutralizing antibody abrogated the effect of SiDcR3. Our results demonstrated that downregulation of DcR3 could enhance TRAIL-mediated apoptosis in HCC through the death receptor pathway. In the future, this might be useful as

  2. Maize R2R3 Myb genes: Sequence analysis reveals amplification in the higher plants.

    PubMed

    Rabinowicz, P D; Braun, E L; Wolfe, A D; Bowen, B; Grotewold, E

    1999-09-01

    Transcription factors containing the Myb-homologous DNA-binding domain are widely found in eukaryotes. In plants, R2R3 Myb-domain proteins are involved in the control of form and metabolism. The Arabidopsis genome harbors >100 R2R3 Myb genes, but few have been found in monocots, animals, and fungi. Using RT-PCR from different maize organs, we cloned 480 fragments corresponding to a 42-44 residue-long sequence spanning the region between the conserved DNA-recognition helices (Myb(BRH)) of R2R3 Myb domains. We determined that maize expresses >80 different R2R3 Myb genes, and evolutionary distances among maize Myb(BRH) sequences indicate that most of the amplification of the R2R3 Myb gene family occurred after the origin of land plants but prior to the separation of monocots and dicots. In addition, evidence is provided for the very recent duplication of particular classes of R2R3 Myb genes in the grasses. Together, these findings render a novel line of evidence for the amplification of the R2R3 Myb gene family in the early history of land plants and suggest that maize provides a possible model system to examine the hypothesis that the expansion of Myb genes is associated with the regulation of novel plant cellular functions.

  3. A regulatory gene network related to the porcine umami taste receptor (TAS1R1/TAS1R3).

    PubMed

    Kim, J M; Ren, D; Reverter, A; Roura, E

    2016-02-01

    Taste perception plays an important role in the mediation of food choices in mammals. The first porcine taste receptor genes identified, sequenced and characterized, TAS1R1 and TAS1R3, were related to the dimeric receptor for umami taste. However, little is known about their regulatory network. The objective of this study was to unfold the genetic network involved in porcine umami taste perception. We performed a meta-analysis of 20 gene expression studies spanning 480 porcine microarray chips and screened 328 taste-related genes by selective mining steps among the available 12,320 genes. A porcine umami taste-specific regulatory network was constructed based on the normalized coexpression data of the 328 genes across 27 tissues. From the network, we revealed the 'taste module' and identified a coexpression cluster for the umami taste according to the first connector with the TAS1R1/TAS1R3 genes. Our findings identify several taste-related regulatory genes and extend previous genetic background of porcine umami taste.

  4. An efficient conversion of (3R,3'R,6'R)-lutein to (3R,3'S,6'R)-lutein (3'-epilutein) and (3R,3'R)-zeaxanthin.

    PubMed

    Khachik, Frederick

    2003-01-01

    Two dietary carotenoids, (3R,3'R,6'R)-lutein (1) and (3R,3'R)-zeaxanthin (2), and their metabolite (3R,3'S,6'R)-lutein (3'-epilutein) (3) accumulate in human serum, milk, and ocular tissues. There is increasing evidence that compounds 1 and 2 play an important role in the prevention of age-related macular degeneration. Therefore, the availability of these carotenoids for metabolic studies and clinical trials is essential. Compound 1 is isolated from extracts of marigold flowers (Tagete erecta) and is commercially available, whereas 2 is only accessible by a lengthy total synthesis, and a viable method for synthesis of 3 has not yet been developed. This report describes an efficient conversion of technical grade 1 to 2 via 3. Acid-catalyzed epimerization of 1 yields an equimolar mixture of diastereomers 1 and 3. The mixture was separated by enzyme-mediated acylation with lipase AK from Pseudomonas fluorescens that preferentially esterified 3 and after alkaline hydrolysis yielded this carotenoid in 90% diastereomeric excess (de). Compound 3 was also separated from 1 in 56-88% de by solvent extraction and low-temperature crystallization, Soxhlet extraction, or supercritical fluid extraction. Base-catalyzed isomerization of 3 gave 2 in excellent yield, providing a convenient alternative to the total synthesis of this important dietary carotenoid.

  5. Novel Aspects of the Z and R3 Antigens of Streptococcus agalactiae Revealed by Immunological Testing

    PubMed Central

    Maeland, Johan A.; Lyng, Randi V.; Mavenyengwa, Rooyen T.

    2013-01-01

    Group B streptococci (GBS) are important human and bovine pathogens which can be classified by a variety of phenotype- and gene-based techniques. The capsular polysaccharide and strain-variable, surface-anchored proteins are particularly important phenotypic markers. In an earlier study, a previously unrecognized protein antigen called Z was described. It was expressed by 27.2% of GBS strains from Zimbabwe, usually in combination with R3 protein expression. In this study, a putative Z-specific antiserum actually contained antibodies against two different antigens named Z1 and Z2; Z1 was >250 kDa in molecular mass. Z1, Z2, and R3 generated multiple stained bands on Western blots and showed similar chromatographic characteristics with respect to molecular mass, aggregate formation, and charge. Of 28 reference and prototype GBS strains examined, 8/28 (28.5%) isolates expressed one, two, or all three of the Z1, Z2, and R3 antigens; 4/28 expressed all three antigens; 2/28 expressed Z2 and R3; 1/28 expressed Z1 only; and 1/28 expressed R3 only. Twenty (71.5%) of the 28 isolates expressed none of the three antigens. Expression of one or more of these antigens was shown by isolates of the capsular polysaccharide types Ia, Ib, V, and IX and NT strains and occurred in combination with expression of various other strain-variable and surface-localized protein antigens. When used as serosubtype markers, Z1, Z2, and R3 affected existing GBS serotype designations for some of the isolates. For instance, the R3 reference strain Prague 10/84 (ATCC 49447) changed serotype markers from V/R3 to V/R3, Z1, and Z2. Other isolates may change correspondingly, implying consequences for GBS serotyping and research. PMID:23408530

  6. Novel aspects of the Z and R3 antigens of Streptococcus agalactiae revealed by immunological testing.

    PubMed

    Maeland, Johan A; Radtke, Andreas; Lyng, Randi V; Mavenyengwa, Rooyen T

    2013-04-01

    Group B streptococci (GBS) are important human and bovine pathogens which can be classified by a variety of phenotype- and gene-based techniques. The capsular polysaccharide and strain-variable, surface-anchored proteins are particularly important phenotypic markers. In an earlier study, a previously unrecognized protein antigen called Z was described. It was expressed by 27.2% of GBS strains from Zimbabwe, usually in combination with R3 protein expression. In this study, a putative Z-specific antiserum actually contained antibodies against two different antigens named Z1 and Z2; Z1 was >250 kDa in molecular mass. Z1, Z2, and R3 generated multiple stained bands on Western blots and showed similar chromatographic characteristics with respect to molecular mass, aggregate formation, and charge. Of 28 reference and prototype GBS strains examined, 8/28 (28.5%) isolates expressed one, two, or all three of the Z1, Z2, and R3 antigens; 4/28 expressed all three antigens; 2/28 expressed Z2 and R3; 1/28 expressed Z1 only; and 1/28 expressed R3 only. Twenty (71.5%) of the 28 isolates expressed none of the three antigens. Expression of one or more of these antigens was shown by isolates of the capsular polysaccharide types Ia, Ib, V, and IX and NT strains and occurred in combination with expression of various other strain-variable and surface-localized protein antigens. When used as serosubtype markers, Z1, Z2, and R3 affected existing GBS serotype designations for some of the isolates. For instance, the R3 reference strain Prague 10/84 (ATCC 49447) changed serotype markers from V/R3 to V/R3, Z1, and Z2. Other isolates may change correspondingly, implying consequences for GBS serotyping and research.

  7. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers.

    PubMed

    DeVoe, Dale; Gotshall, Robert; McArthur, Trisha

    2003-10-01

    This study compared the RT3 Research Tracker accelerometer to the Tritrac R3D accelerometer in both laboratory and field settings and tested the hypothesis that the RT3 records higher physical activity counts and smaller standard deviations than the R3D. The RT3 is relatively new and untested and its concurrent validity with existing instruments and physical activity needs to be assessed before being used in research. In this study the RT3 had higher average recordings of physical activity counts in all of the nine testing situations than the R3D. However, in terms of agreement between the instruments, the RT3 might be 582 below or 1,236 above (activity counts) the R3D in assessing physical activity. These results do not establish that the RT3 is more consistently measuring higher physical activity counts than the R3D. Comparing vector magnitude with oxygen consumption and heart rate across the 0% grade testing conditions indicated that the RT3 and R3D are sensitive to changes in various intensities of level ambulation. When the 5%, 10%, and 15% grade on the treadmill protocols were analyzed, low correlations between oxygen consumption and heart rate with vector magnitude responses were found for both the RT3 and R3D. Differences in agreement between the RT3 and R3D did not vary in any systematic way over the range in testing conditions which substantiates that the RT3 and R3D accelerometers are sensitive on flat surfaces but are insensitive to changes in grade.

  8. Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

    PubMed Central

    Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

    2007-01-01

    Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

  9. Long-time behavior of solution for the compressible nematic liquid crystal flows in R3

    NASA Astrophysics Data System (ADS)

    Gao, Jincheng; Tao, Qiang; Yao, Zheng-an

    2016-08-01

    In this paper, we investigate the global existence and long-time behavior of classical solution for the compressible nematic liquid crystal flows in three-dimensional whole space. First of all, the global existence of classical solution is established under the condition that the initial data are close to the constant equilibrium state in HN (R3) (N ≥ 3)-framework. Then, one establishes algebraic time decay for the classical solution by weighted energy method. Finally, the algebraic decay rate of classical solution in Lp (R3)-norm with 2 ≤ p ≤ ∞ and optimal decay rate of their spatial derivative in L2 (R3)-norm are obtained if the initial perturbation belong to L1 (R3) additionally.

  10. R3 receptor tyrosine phosphatases: conserved regulators of receptor tyrosine kinase signaling and tubular organ development.

    PubMed

    Jeon, Mili; Zinn, Kai

    2015-01-01

    R3 receptor tyrosine phosphatases (RPTPs) are characterized by extracellular domains composed solely of long chains of fibronectin type III repeats, and by the presence of a single phosphatase domain. There are five proteins in mammals with this structure, two in Drosophila and one in Caenorhabditis elegans. R3 RPTPs are selective regulators of receptor tyrosine kinase (RTK) signaling, and a number of different RTKs have been shown to be direct targets for their phosphatase activities. Genetic studies in both invertebrate model systems and in mammals have shown that R3 RPTPs are essential for tubular organ development. They also have important functions during nervous system development. R3 RPTPs are likely to be tumor suppressors in a number of types of cancer.

  11. R3 receptor tyrosine phosphatases: conserved regulators of receptor tyrosine kinase signaling and tubular organ development

    PubMed Central

    Jeon, Mili; Zinn, Kai

    2014-01-01

    Summary R3 receptor tyrosine phosphatases (RPTPs) are characterized by extracellular domains composed solely of long chains of fibronectin type III repeats, and by the presence of a single phosphatase domain. There are five proteins in mammals with this structure, two in Drosophila, and one in Caenorhabditis elegans. R3 RPTPs are selective regulators of receptor tyrosine kinase (RTK) signaling, and a number of different RTKs have been shown to be direct targets for their phosphatase activities. Genetic studies in both invertebrate model systems and in mammals have shown that R3 RPTPs are essential for tubular organ development. They also have important functions during nervous system development. R3 RPTPs are likely to be tumor suppressors in a number of types of cancer. PMID:25242281

  12. Regulation of Cell Fate Determination by Single-Repeat R3 MYB Transcription Factors in Arabidopsis

    SciTech Connect

    Wang, Shucai; Chen, Jay

    2014-01-01

    MYB transcription factors regulate multiple aspects of plant growth and development. Among the large family of MYB transcription factors, single-repeat R3 MYB are characterized by their short sequence (<120 amino acids) consisting largely of the single MYB DNA-binding repeat. In the model plant Arabidopsis, R3 MYBs mediate lateral inhibition during epidermal patterning and are best characterized for their regulatory roles in trichome and root hair development. R3 MYBs act as negative regulators for trichome formation but as positive regulators for root hair development. In this article, we provide a comprehensive review on the role of R3 MYBs in the regulation of cell type specification in the model plant Arabidopsis.

  13. Genome-Wide Identification and Characterization of R2R3MYB Family in Cucumis sativus

    PubMed Central

    Li, Qiang; Zhang, Cunjia; Li, Jing; Wang, Lina; Ren, Zhonghai

    2012-01-01

    Background The R2R3MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some species, little is known about R2R3MYB genes in cucumber (Cucumis sativus L.). Principal Findings This study has identified 55 R2R3MYB genes in the latest cucumber genome and the CsR2R3MYB family contained the smallest number of identified genes compared to other species that have been studied due to the absence of recent gene duplication events. These results were also supported by genome distribution and gene duplication analysis. Phylogenetic analysis showed that they could be classified into 11 subgroups. The evolutionary relationships and the intron - exon organizations that showed similarities with Arabidopsis, Vitis and Glycine R2R3MYB proteins were also analyzed and suggested strong gene conservation but also the expansions of particular functional genes during the evolution of the plant species. In addition, we found that 8 out of 55 (∼14.54%) cucumber R2R3MYB genes underwent alternative splicing events, producing a variety of transcripts from a single gene, which illustrated the extremely high complexity of transcriptome regulation. Tissue-specific expression profiles showed that 50 cucumber R2R3MYB genes were expressed in at least one of the tissues and the other 5 genes showed very low expression in all tissues tested, which suggested that cucumber R2R3MYB genes took part in many cellular processes. The transcript abundance level analysis during abiotic conditions (NaCl, ABA and low temperature treatments) identified a group of R2R3MYB genes that responded to one or more treatments. Conclusions This study has produced a comparative genomics analysis of the cucumber R2R3MYB gene family and has provided the first steps towards the selection of CsR2R3MYB genes for cloning and functional dissection that can be used in further studies to uncover their roles in cucumber growth and

  14. Genome-wide identification and characterization of R2R3MYB family in Cucumis sativus.

    PubMed

    Li, Qiang; Zhang, Cunjia; Li, Jing; Wang, Lina; Ren, Zhonghai

    2012-01-01

    The R2R3MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some species, little is known about R2R3MYB genes in cucumber (Cucumis sativus L.). This study has identified 55 R2R3MYB genes in the latest cucumber genome and the CsR2R3MYB family contained the smallest number of identified genes compared to other species that have been studied due to the absence of recent gene duplication events. These results were also supported by genome distribution and gene duplication analysis. Phylogenetic analysis showed that they could be classified into 11 subgroups. The evolutionary relationships and the intron-exon organizations that showed similarities with Arabidopsis, Vitis and Glycine R2R3MYB proteins were also analyzed and suggested strong gene conservation but also the expansions of particular functional genes during the evolution of the plant species. In addition, we found that 8 out of 55 (∼14.54%) cucumber R2R3MYB genes underwent alternative splicing events, producing a variety of transcripts from a single gene, which illustrated the extremely high complexity of transcriptome regulation. Tissue-specific expression profiles showed that 50 cucumber R2R3MYB genes were expressed in at least one of the tissues and the other 5 genes showed very low expression in all tissues tested, which suggested that cucumber R2R3MYB genes took part in many cellular processes. The transcript abundance level analysis during abiotic conditions (NaCl, ABA and low temperature treatments) identified a group of R2R3MYB genes that responded to one or more treatments. This study has produced a comparative genomics analysis of the cucumber R2R3MYB gene family and has provided the first steps towards the selection of CsR2R3MYB genes for cloning and functional dissection that can be used in further studies to uncover their roles in cucumber growth and development.

  15. Investigating ( R)-3-Methylcyclopentanone Conformers Using Temperature-Dependent Raman Spectroscopy

    NASA Astrophysics Data System (ADS)

    Al-Basheer, W.

    2014-05-01

    Recorded temperature-dependent Raman spectra of neat (R)-3-methylcyclopentanone (R3MCP) over the Raman active C-H stretch region (2850-3000 cm-1) are being employed to determine conformer energy difference (ΔH° = 4.83 ± 0.45 kJ/mol) between R3MCP equatorial-methyl and axial-methyl isomers. Upon comparison with spectra obtained at room temperature, crystalline R3MCP Raman spectra recorded at liquid nitrogen temperature (~77 K) are being utilized to assist identifying Raman vibrational modes a rising due to R3MCP equatorial and axial conformers. Correspondingly, density functional theory calculations (correlation function type B3LYP using a moderate 6-31G* and large aug-cc-pVDZ basis sets) are also manipulated to obtain highly resolved Raman spectra for the optimized geometries of equatorial and axial conformers, which are also used to help identify vibrational modes a rising due to each conformer. Reported calculated spectra of the individual R3MCP conformers are shown to have good agreement with corresponding experimental Raman spectra.

  16. A potent antibrowning agent from pine needles of Cedrus deodara: 2R,3R-dihydromyricetin.

    PubMed

    Liang, Xue; Wu, Yan-Ping; Qiu, Jing-Hong; Zhong, Kai; Gao, Hong

    2014-09-01

    This article focuses on finding the novel antibrowning agents from the pine needles of Cedrus deodara and studying its antibrowning effect. By bioassay guide of tyrosinase inhibitory activity, the main active compound was isolated and purified from 50% methanol extract of pine needles of C. deodara through macroporous resin Diaion HP-20 column chromatography and high-performance liquid chromatography. Based on mass and nuclear magnetic resonance data, the active compound was identified as 2R,3R-dihydromyricetin, which showed the potent monophenolase and diphenolase inhibitory activities. Moreover, 2R,3R-dihydromyricetin exhibited a strong ABTS radical scavenging activity with a dose-dependent manner. The antibrowning efficacy of 2R,3R-dihydromyricetin was evaluated by monitoring the changes of L*, a*, and b* values and total color difference (△E) on fresh-cut apple slices. It was found that 2R,3R-dihydromyricetin was effective in inhibiting the browning of apple slices treated with a concentration as low as 0.05% at 25 °C for 24 h. Its antibrowning effect was significantly better than ascorbic acid (0.5%) alone. Furthermore, 2R,3R-dihydromyricetin showed a good synergistic antibrowning effect with ascorbic acid. This is the first report that 2R,3R-dihydromyricetin from pine needles of C. deodara may be used as a potential antibrowning agent in protecting against food browning.

  17. Microvillous cells expressing IP3R3 in the olfactory epithelium of mice

    PubMed Central

    Hegg, Colleen C.; Jia, Cuihong; Chick, Wallace S.; Restrepo, Diego; Hansen, Anne

    2015-01-01

    Microvillous cells of the main olfactory epithelium have been described variously as primary olfactory neurons, secondary chemosensory cells, or non-sensory cells. Here we generated an IP3R3tm1(tauGFP) mouse in which the coding region for a fusion protein of tau and green fluorescent protein (tauGFP) replaces the first exon of the Itpr3 gene. We provide immunohistochemical and functional characterization of the cells expressing IP3 receptor type 3 in the olfactory epithelium. Since we determined that these cells bear microvilli at their apex, we call these cells IP3R3 MV cells. The cell body of these IP3R3 MV cells lies in the upper third of the main olfactory epithelium; a long thick basal process projects towards the base of the epithelium without penetrating the basal lamina. Retrograde labeling and unilateral bulbectomy corroborated that these IP3R3 MV cells do not extend axons to the olfactory bulb and therefore are not olfactory sensory neurons. The immunohistochemical features of the IP3R3 MV cell varied suggesting either developmental stages or the existence of subsets of these cells. Thus, for example, subsets of the IP3R3 MV cells make contact with substance P fibers or express the purinergic receptor P2X3. In addition, in recordings of intracellular calcium, these cells respond to ATP and substance P as well as to a variety of odors. The characterization of IP3R3 MV cells as non-neuronal chemoresponsive cells helps explain the differing descriptions of microvillous cells in the literature. PMID:20958798

  18. Production of (R)-3-hydroxybutyric acid by fermentation and bioconversion processes with Azohydromonas lata.

    PubMed

    Ugwu, Charles U; Tokiwa, Yutaka; Ichiba, Toshio

    2011-06-01

    Feasibility of producing (R)-3-hydroxybutyric acid ((R)-3-HB) using wild type Azohydromonas lata and its mutants (derived by UV mutation) was investigated. A. lata mutant (M5) produced 780 m g/l in the culture broth when sucrose was used as the carbon source. M5 was further studied in terms of its specificity with various bioconversion substrates for production of (R)-3-HB. (R)-3-HB concentration produced in the culture broth by M5 mutant was 2.7-fold higher than that of the wild type strain when sucrose (3% w/v) and (R,S)-1,3-butanediol (3% v/v) were used as carbon source and bioconversion substrate, respectively. Bioconversion of resting cells (M5) with glucose (1% v/w), ethylacetoacetate (2% v/v), and (R,S)-1,3-butanediol (3% v/v), resulted in (R)-3-HB concentrations of 6.5 g/l, 7.3g/l and 8.7 g/l, respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Tau Assembly: The Dominant Role of PHF6 (VQIVYK) in Microtubule Binding Region Repeat R3

    PubMed Central

    Ganguly, Pritam; Do, Thanh D.; Larini, Luca; LaPointe, Nichole E.; Sercel, Alexander J.; Shade, Madeleine F.; Feinstein, Stuart C.; Bowers, Michael T.; Shea, Joan-Emma

    2015-01-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; 273GKVQIINKKLDL284) and PHF6 (R3/wt; 306VQIVYKPVDLSK317), and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*/PHF6 interactions in initiating the aggregation of full length Tau. Lastly, R2/ΔK280 binds stronger to R3/wt than R2/wt suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  20. Glucose transporter/T1R3-expressing cells in rat tracheal epithelium

    PubMed Central

    Merigo, Flavia; Benati, Donatella; Cristofoletti, Mirko; Amarù, Fabio; Osculati, Francesco; Sbarbati, Andrea

    2012-01-01

    Glucose transport plays an important role in maintaining low sugar concentration in airway surface liquid (ASL), which is critical for mucociliary clearance and bacterial colonization. Experimental evidence indicates that glucose/hexose uptake in lung/airway cells occurs by means of two structurally distinct glucose transporter pathways: the Na+-dependent glucose transporters (SGLT family) and the facilitative glucose transporters (GLUT family). In this study, we examined the expression of the major glucose transporters of the intestine, GLUT2, GLUT5, SGLT1 and T1R3 taste receptor subunit, in the trachea of rats using immunohistochemistry and immunoelectron microscopy, and compared them using double-labeled confocal microscopy. We found that GLUT2, GLUT5, SGLT1 and T1R3 are selectively expressed in different cell types. T1R3 and GLUT2 are predominantly expressed in subsets of solitary chemoreceptor cells (SCCs) and ciliated cells, GLUT5 is present in subsets of SCCs and in secretory cells, and SGLT1 is exclusively expressed in a unique cell type, SCCs. Furthermore, we demonstrated that T1R3 is colocalized with SGLT1 in SCCs and with GLUT2 transporter in ciliated cells. In conclusion, these findings reveal that different cell types are associated with the uptake of glucose in ASL and that, due to their T1R3 expression, SCCs and ciliated cells are most likely to participate in the chemosensory process in ASL. PMID:22640462

  1. Conifer R2R3-MYB transcription factors: sequence analyses and gene expression in wood-forming tissues of white spruce (Picea glauca)

    PubMed Central

    Bedon, Frank; Grima-Pettenati, Jacqueline; Mackay, John

    2007-01-01

    Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences), and loblolly pine, Pinus taeda L. (five sequences). Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco. PMID:17397551

  2. Determining the Nature and Origin of Mass Loss from Active Asteroid P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David

    2014-10-01

    We propose a program of WFC3 images of the active asteroid P/2013 R3 in order to determine the nature and origin of mass loss from this object. R3 has a unique, multiple nucleus structure in which the components are measured to separate at sub-meter per second velocities. It is best explained as a rotational breakup (presumably resulting from the YORP torque). We will obtain images over a wide time base in Cycle 22 in order to determine the orbits of the fragments and we will obtain time-series, high resolution photometry in order to measure their rotations. Rotational breakup and rotational mass-shedding are suspected to be the main mechanisms of destruction for sub-kilometer asteroids. Neither has been observed before but, between P/2013 R3 and P/2013 P5 (subject of another proposal) we have the first, potentially ground-breaking opportunities to observe both.

  3. Multiple positive solutions for Kirchhoff-type problems in R^3 involving critical Sobolev exponents

    NASA Astrophysics Data System (ADS)

    Fan, Haining

    2016-10-01

    In this paper, we study the following nonlinear problem of Kirchhoff type with critical Sobolev exponent -(a+bintlimits_{R^3}|nabla u|^2dx)Δ u+u=λ f(x)u^{q-1}+g(x)u^5,quad xin R^3, uin H^1(R^3), where a, b > 0, 4 < q < 6, and {λ} is a positive parameter. Under certain assumptions on f( x) and g( x) and {λ} is small enough, we obtain a relationship between the number of positive solutions and the topology of the global maximum set of g. The Nehari manifold and Ljusternik-Schnirelmann category are the main tools in our study. Moreover, using the Mountain Pass Theorem, we give an existence result about {λ} large.

  4. Complete genome of Arthrobacter alpinus strain R3.8, bioremediation potential unraveled with genomic analysis.

    PubMed

    See-Too, Wah-Seng; Ee, Robson; Lim, Yan-Lue; Convey, Peter; Pearce, David A; Mohidin, Taznim Begam Mohd; Yin, Wai-Fong; Chan, Kok Gan

    2017-01-01

    Arthrobacter alpinus R3.8 is a psychrotolerant bacterial strain isolated from a soil sample obtained at Rothera Point, Adelaide Island, close to the Antarctic Peninsula. Strain R3.8 was sequenced in order to help discover potential cold active enzymes with biotechnological applications. Genome analysis identified various cold adaptation genes including some coding for anti-freeze proteins and cold-shock proteins, genes involved in bioremediation of xenobiotic compounds including naphthalene, and genes with chitinolytic and N-acetylglucosamine utilization properties and also plant-growth-influencing properties. In this genome report, we present a complete genome sequence of A. alpinus strain R3.8 and its annotation data, which will facilitate exploitation of potential novel cold-active enzymes.

  5. Phosphorus Taste Involves T1R2 and T1R3.

    PubMed

    Tordoff, Michael G

    2017-06-01

    Rodents consume solutions of phosphates and pyrophosphates in preference to water. Recently, we found that the preference for trisodium pyrophosphate (Na3HP2O7) was greater in T1R3 knockout (KO) mice than wild-type (WT) controls, suggesting that T1R3 is a pyrophosphate detector. We now show that this heightened Na3HP2O7 preference of T1R3 KO mice extends to disodium phosphate (Na2HPO4), disodium and tetrasodium pyrophosphate (Na2H2PO4 and Na4H2PO4), a tripolyphosphate (Na5P3O10), a non-sodium phosphate [(NH4)2HPO4], and a non-sodium pyrophosphate (K4P2O7) but not to non-P salts with large anions (sodium gluconate, acetate, or propionate). Licking rates for Na3HP2O7 are higher in T1R2 KO mice than WT controls; Na3HP2O7 preference scores are increased even more in T1R2 KO mice and T1R2+T1R3 double KO mice than in T1R3 KO mice; preference scores for Na3HP2O7 are normal in T1R1 KO mice. These results implicate each subunit of the T1R2+T1R3 dimer in the behavioral response to P-containing taste compounds. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Stress-induced adaptation of neutrophilic granulocyte activity in K and R3 carp lines.

    PubMed

    Pijanowski, L; Verburg-van Kemenade, B M L; Irnazarow, I; Chadzinska, M

    2015-12-01

    Both in mammals and fish, stress induces remarkable changes in the immune response. We focused on stress-induced changes in the activity of neutrophilic granulocytes in the R3 and K lines of common carp, which showed differential stress responses. Our study clearly demonstrates that a prolonged restraint stress differentially affects the activity of K and R3 carp neutrophils. In the K line, stress decreased the respiratory burst, while in the R3 line it reduced the release of extracellular DNA. Surprisingly, the stress-induced changes in ROS production and NET formation did not correlate with changes in gene expression of the inflammatory mediators and GR receptors. In neutrophilic granulocytes from K carp, gene expression of the stress-sensitive cortisol GR1 receptor was significantly higher than in neutrophils from R3 fish, which will make these cells more sensitive to high levels of cortisol. Moreover, upon stress, neutrophilic granulocytes of K carp up-regulated gene expression of the anti-inflammatory cytokine IL-10 while this was not observed in neutrophilic granulocytes of R3 carp. Therefore, we can hypothesize that, in contrast to R3 neutrophils, the more cortisol sensitive neutrophils from K carp respond to stress with up-regulation of IL-10 and consequently reduction of ROS production. Most probably the ROS-independent NET formation in K carp is not regulated by this anti-inflammatory cytokine. These data may indicate a predominantly ROS-independent formation of NETs by carp neutrophilic granulocytes. Moreover, they underline the important role of IL-10 in stress-induced immunoregulation.

  7. Metabolic engineering of Enterobacter cloacae for high-yield production of enantiopure (2R,3R)-2,3-butanediol from lignocellulose-derived sugars.

    PubMed

    Li, Lixiang; Li, Kun; Wang, Yu; Chen, Chao; Xu, Youqiang; Zhang, Lijie; Han, Binbin; Gao, Chao; Tao, Fei; Ma, Cuiqing; Xu, Ping

    2015-03-01

    Biotechnological production of biofuels is restricted by toxicity of the products such as ethanol and butanol. As its low toxicity to microbes, 2,3-butanediol (2,3-BD), a fuel and platform bio-chemical, could be a promising alternative for biofuel production from renewable bioresources. In addition, no bacterial strains have been reported to produce enantiopure 2,3-BD using lignocellulosic hydrolysates. In this study, Enterobacter cloacae strain SDM was systematically and metabolically engineered to construct an efficient biocatalyst for production of the fuel and enantiopure bio-chemical-(2R,3R)-2,3-BD. First, the various (2R,3R)-2,3-BD dehydrogenase encoding genes were expressed in a meso-2,3-BD dehydrogenase encoding gene disrupted E. cloacae strain under native promoter Pb of the 2,3-BD biosynthetic gene cluster of E. cloacae. Then, carbon catabolite repression was eliminated via inactivation of the glucose transporter encoding gene ptsG and overexpression of a galactose permease encoding gene galP. The resultant strain could utilize glucose and xylose simultaneously. To improve the efficiency of (2R,3R)-2,3-BD production, the byproduct-producing genes (ldh and frdA) were knocked out, thereby enhancing the yield of (2R,3R)-2,3-BD by 16.5% in 500-mL Erlenmeyer flasks. By using fed-batch fermentation in a 5-L bioreactor, 152.0 g/L (2R,3R)-2,3-BD (purity>97.5%) was produced within 44 h with a specific productivity of 3.5 g/[Lh] and a yield of 97.7% from a mixture of glucose and xylose, two major carbohydrate components in lignocellulosic hydrolysates. In addition, when a lignocellulosic hydrolysate was used as the substrate, 119.4 g/L (2R,3R)-2,3-BD (purity>96.0%) was produced within 51 h with a productivity of 2.3g/[Lh] and a yield of 95.0%. These results show that the highest records have been acquired for enantiopure (2R,3R)-2,3-BD production by a native or engineered strain from biomass-derived sugars. In addition to producing the 2,3-BD, our systematic

  8. (2R,3S,2″R,3″R)-Manniflavanone Protects Proliferating Skeletal Muscle Cells against Oxidative Stress and Stimulates Myotube Formation.

    PubMed

    Acharya, Suresh; Stark, Timo D; Oh, Seung Tack; Jeon, Songhee; Pak, Sok Cheon; Kim, Mina; Hur, Jinyoung; Matsutomo, Toshiaki; Hofmann, Thomas; Hill, Rodney A; Balemba, Onesmo B

    2017-05-10

    We investigated the antioxidative properties of (2R,3S,2″R,3″R)-manniflavanone (MF) using in vitro assays and examined its effects on myogenesis and lactate-induced oxidative stress in C2C12 cells. MF was purified from Garcinia buchananii stem bark. H2O2 and oxygen radical absorbance capacity assays demonstrated that MF is a powerful antioxidant. This finding was supported by diphenylpicrylhydrazine radical scavenging activity of MF. MF was less cytotoxic to C2C12 cells compared to ascorbic acid and myricetin. Moreover, MF accelerated myotube formation in the differentiated C2C12 cells by up-regulating myogenic proteins such as MyoG and myosin heavy chain. Furthermore, MF rescued late differentiation of myoblast suppressed by lactate treatment and up-regulated the expression levels of Nrf2 in lactate-induced oxidative stress, indicating that MF stimulates antioxidative activity inside C2C12 cells. Collectively, MF is a potent antioxidant with a higher safety profile than ascorbic acid and myricetin. It reduces oxidative stress-induced delaying of skeletal muscle differentiation by scavenging reactive oxygen species and regulating myogenic proteins factors.

  9. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  10. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

    PubMed

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  11. Cancer Clusters

    MedlinePlus

    ... Genetics Services Directory Cancer Prevention Overview Research Cancer Clusters On This Page What is a cancer cluster? ... the number of cancer cases in the suspected cluster Many reported clusters include too few cancer cases ...

  12. COMPARATIVE EVALUATION OF R3f GARNET BEAD FILTRATION AND MULTIMEDIA FILTRATION SYSTEMS; FINAL REPORT

    EPA Science Inventory

    This report summarizes the results of tests conducted to date at the EPA T&E Facility on the R3f filtration system utilizing fine beads (such as garnet beads or glass beads) and a conventional multimedia filtration system. Both systems have been designed and built by Enprotec, a...

  13. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    PubMed

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa.

  14. Subspecialization of R2R3-MYB Repressors for Anthocyanin and Proanthocyanidin Regulation in Forage Legumes

    PubMed Central

    Albert, Nick W.

    2015-01-01

    The synthesis of anthocyanin pigments and proanthocyanidins (condensed tannins) is regulated by MYB-bHLH-WDR (MBW) transcription factor complexes in all angiosperms studied to date. Tr-MYB133 and Tr-MYB134 were isolated from Trifolium repens and encode R2R3-MYBs that antagonize the activity of MBW activation complexes. These two genes are conserved in other legume species, and form two sub-clades within the larger anthocyanin/proanthocyanidin clade of MYB repressors. However, unlike petunia and Arabidopsis, these R2R3-MYB repressors do not prevent ectopic accumulation of anthocyanins or proanthocyanidins. Instead, they are expressed when anthocyanins or proanthocyanidins are being synthesized, and provide feedback regulation to MBW complexes. This feedback occurs because Tr-MYB133 and Tr-MYB134 are themselves regulated by MBW complexes. Tr-MYB133 is regulated by MBW complexes containing anthocyanin-related R2R3-MYB proteins (Tr-RED LEAF), while Tr-MYB134 is regulated by complexes containing the proanthocyanidin R2R3-MYBs (Tr-MYB14). Other features of the MBW gene regulation networks are also conserved within legumes, including the ability for the anthocyanin MBW complexes to activate the expression of the AN1/TT8 clade bHLH factor. The regulation of Tr-MYB133 and Tr-MYB134 by distinct, pathway-specific MBW complexes has resulted in subspecialization for controlling anthocyanin or proanthocyanidin synthesis. PMID:26779194

  15. Production of (R)-3-hydroxybutyric acid by Burkholderia cepacia from wood extract hydrolysates

    PubMed Central

    2014-01-01

    (R)-hydroxyalkanoic acids (R-HAs) are valuable building blocks for the synthesis of fine chemicals and biopolymers because of the chiral center and the two active functional groups. Hydroxyalkanoic acids fermentation can revolutionize the polyhydroxyalkanoic acids (PHA) production by increasing efficiency and enhancing product utility. Modifying the fermentation conditions that promotes the in vivo depolymerization and secretion to fermentation broth in wild type bacteria is a novel and promising approach to produce R-HAs. Wood extract hydrolysate (WEH) was found to be a suitable substrate for R-3-hydroxybutyric acid (R-3-HB) production by Burkholderia cepacia. Using Paulownia elongate WEH as a feedstock, the R-3-HB concentration in fermentation broth reached as high as 14.2 g/L after 3 days of batch fermentation and the highest concentration of 16.8 g/L was obtained at day 9. Further investigation indicated that the composition of culture medium contributed to the enhanced R-3-HB production. PMID:24949263

  16. The TL1A/DR3/DcR3 pathway in autoimmune rheumatic diseases.

    PubMed

    Siakavellas, Spyros I; Sfikakis, Petros P; Bamias, Giorgos

    2015-08-01

    TNF-like cytokine 1A (TL1A) and its receptors, death receptor 3 (DR3) and decoy receptor 3 (DcR3) are members of the TNF and TNF receptor superfamilies of proteins, respectively. They constitute a cytokine system that actively interferes with the regulation of immune responses and may participate in the pathogenesis of autoimmune diseases. This review aims to present the current knowledge on the role of the TL1A/DR3/DcR3 system in the pathophysiology of autoimmune rheumatic diseases, with a focus on rheumatoid arthritis (RA). An extensive literature search was performed in the PubMed database using the following keywords: TL1A, death receptor 3, DR3, decoy receptor 3, DcR3, TNFSF15, TNFRSF25, and TNFSF6B. Studies were assessed and selected in view of their relevance to autoimmune rheumatic diseases. The TL1A/DR3/DcR3 axis is a novel immune pathway that participates in the pathogenesis of a variety of autoimmune rheumatic diseases. These molecules may be promising therapeutic targets for inflammatory arthritis. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Evaluation of Project R-3, San Jose, Calif., 1971-72.

    ERIC Educational Resources Information Center

    Rapp, M. L.; Haggart, S. A.

    Project R-3 has as its primary objective improving both reading and mathematics skills. The other objectives are to change the self-image of students from one of failure to one of success, and to change their behavior patterns as students by providing them with immediate success experiences. The project started in the spring of 1970 when students…

  18. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

    PubMed Central

    Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

    2015-01-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  19. The Rapid Response Radiation Survey (R3S) Mission Using the HISat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in LEO, will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HiSat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaDX), will validate exposure prediction capabilities of NAIRAS. This paper discusses the development of the R3S experiment as made possible by use of the HiSat architecture. The system design and operational modes of the experiment are described, as well as the experiment interfaces to the HiSat satellite via the user defined adapter (UDA) provided by NovaWurks. This paper outlines the steps taken by the project to execute the R3S mission in the 4 months of design, build, and test. Finally, description of the engineering process is provided, including the use of facilitated rapid/concurrent engineering sessions, the associated documentation, and the review process employed.

  20. Condensed tannins: A proposed route to 2R,3R-(2,3-cis)-proanthocyanidins

    Treesearch

    Richard W. Hemingway; Peter E. Laks

    1985-01-01

    Roux,1 Haslam,2-4 and Stafford5-8 have proposed differing biogenetic schemes for the formation of proanthocyanidins (condensed tannins) in plants. All three schemes suffer from difficulties in explaining the formation of the 2R,3R-(2,3-cis)-proanthocyanidins that predominate in...

  1. Genome-wide identification and characterization of R2R3MYB family in Rosaceae.

    PubMed

    González, Máximo; Carrasco, Basilio; Salazar, Erika

    2016-09-01

    Transcription factors R2R3MYB family have been associated with the control of secondary metabolites, development of structures, cold tolerance and response to biotic and abiotic stress, among others. In recent years, genomes of Rosaceae botanical family are available. Although this information has been used to study the karyotype evolution of these species from an ancestral genome, there are no studies that treat the evolution and diversity of gene families present in these species or in the botanical family. Here we present the first comparative study of the R2R3MYB subfamily of transcription factors in three species of Rosaceae family (Malus domestica, Prunus persica and Fragaria vesca). We described 186, 98 and 86 non-redundant gene models for apple, peach and strawberry, respectively. In this research, we analyzed the intron-exon structure and genomic distribution of R2R3MYB families mentioned above. The phylogenetic comparisons revealed putative functions of some R2R3MYB transcription factors. This analysis found 44 functional subgroups, seven of which were unique for Rosaceae. In addition, our results showed a highly collinearity among some genes revealing the existence of conserved gene models between the three species studied. Although some gene models in these species have been validated under several approaches, more research in the Rosaceae family is necessary to determine gene expression patterns in specific tissues and development stages to facilitate understanding of the regulatory and biochemical mechanism in this botanical family.

  2. COMPARATIVE EVALUATION OF R3f GARNET BEAD FILTRATION AND MULTIMEDIA FILTRATION SYSTEMS; FINAL REPORT

    EPA Science Inventory

    This report summarizes the results of tests conducted to date at the EPA T&E Facility on the R3f filtration system utilizing fine beads (such as garnet beads or glass beads) and a conventional multimedia filtration system. Both systems have been designed and built by Enprotec, a...

  3. The R2R3-MYB Transcription Factor Gene Family in Maize

    PubMed Central

    Du, Hai; Feng, Bo-Run; Yang, Si-Si; Huang, Yu-Bi; Tang, Yi-Xiong

    2012-01-01

    MYB proteins comprise a large family of plant transcription factors, members of which perform a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). In the present study, we performed a comprehensive computational analysis, to yield a complete overview of the R2R3-MYB gene family in maize, including the phylogeny, expression patterns, and also its structural and functional characteristics. The MYB gene structure in maize and Arabidopsis were highly conserved, indicating that they were originally compact in size. Subgroup-specific conserved motifs outside the MYB domain may reflect functional conservation. The genome distribution strongly supports the hypothesis that segmental and tandem duplication contribute to the expansion of maize MYB genes. We also performed an updated and comprehensive classification of the R2R3-MYB gene families in maize and other plant species. The result revealed that the functions were conserved between maize MYB genes and their putative orthologs, demonstrating the origin and evolutionary diversification of plant MYB genes. Species-specific groups/subgroups may evolve or be lost during evolution, resulting in functional divergence. Expression profile study indicated that maize R2R3-MYB genes exhibit a variety of expression patterns, suggesting diverse functions. Furthermore, computational prediction potential targets of maize microRNAs (miRNAs) revealed that miR159, miR319, and miR160 may be implicated in regulating maize R2R3-MYB genes, suggesting roles of these miRNAs in post-transcriptional regulation and transcription networks. Our comparative analysis of R2R3-MYB genes in maize confirm and extend the sequence and functional characteristics of this gene family, and will facilitate future functional analysis of the MYB gene family in maize. PMID:22719841

  4. Solvent, temperature and concentration effects on the optical rotatory dispersion of (R)-3-methylcyclohexanone

    NASA Astrophysics Data System (ADS)

    Alenaizan, Asem; Al-Basheer, Watheq; Musa, Musa M.

    2017-02-01

    Optical rotatory dispersion (ORD) spectra are reported for isolated and solvated (R)-3-methylcyclohexanone (R-3MCH) in 10 solvents, of wide polarity range, and over the spectral range 350-650 nm. Sample concentration effects on ORD spectra of R-3MCH were also recorded and investigated over widely varying concentrations from 2.5 × 10-3 to 2.5 × 10-1 g/mL where an observed sensitivity of optical rotation (OR) to incident light wavelength at low concentrations is correlated to solvent effects. Temperature effects were also studied by recording ORD spectra over the temperature range 0-65 °C in toluene. Recorded specific OR was plotted against various solvent parameters, namely, dipole moment, polarity, refractive index and polarizability to probe solvent effects. Furthermore, solvent effects were studied by incorporating Kamlet's and Taft's solvent parameters in the multi-parametric linear fitting. Theoretically, ORD spectra and populations of optimized geometries of equatorial and axial conformers of R-3MCH were calculated in the gas and solvated phases. All theoretical calculations were performed employing the polarizable continuum model using density functional theoretical and composite scheme (G4) methods with aug-cc-pVTZ and aug-cc-pVDZ basis sets. Net ORD spectra of R-3MCH were generated by the Boltzmann-weighted sum of the contributions of the dominant conformers. Upon comparing theoretical and experimental ORD spectra, a very good agreement is observed for the ORD spectra in the gas phase and high polarity solvents compared to relatively lesser agreement in low polarity solvents.

  5. Formation of Polyesters by Pseudomonas oleovorans: Effect of Substrates on Formation and Composition of Poly-(R)-3-Hydroxyalkanoates and Poly-(R)-3-Hydroxyalkenoates

    PubMed Central

    Lageveen, Roland G.; Huisman, Gjalt W.; Preusting, Hans; Ketelaar, Peter; Eggink, Gerrit; Witholt, Bernard

    1988-01-01

    Pseudomonas oleovorans grows on C6 to C12n-alkanes and 1-alkenes. These substrates are oxidized to the corresponding fatty acids, which are oxidized further via the β-oxidation pathway, yielding shorter fatty acids which have lost one or more C2 units. P. oleovorans normally utilizes β-oxidation pathway intermediates for growth, but in this paper we show that the intermediate 3-hydroxy fatty acids can also be polymerized to intracellular poly-(R)-3-hydroxyalkanoates (PHAs) when the medium contains limiting amounts of essential elements, such as nitrogen. The monomer composition of these polyesters is a reflection of the substrates used for growth of P. oleovorans. The largest monomer found in PHAs always contained as many C atoms as did the n-alkane used as a substrate. Monomers which were shorter by one or more C2 units were also observed. Thus, for C-even substrates, only C-even monomers were found, the smallest being (R)-3-hydroxyhexanoate. For C-odd substrates, only C-odd monomers were found, with (R)-3-hydroxyheptanoate as the smallest monomer. 1-Alkenes were also incorporated into PHAs, albeit less efficiently and with lower yields than n-alkanes. These PHAs contained both saturated and unsaturated monomers, apparently because the 1-alkene substrates could be oxidized to carboxylic acids at either the saturated or the unsaturated ends. Up to 55% of the PHA monomers contained terminal double bonds when P. oleovorans was grown on 1-alkenes. The degree of unsaturation of PHAs could be modulated by varying the ratio of alkenes to alkanes in the growth medium. Since 1-alkenes were also shortened before being polymerized, as was the case for n-alkanes, copolymers which varied with respect to both monomer chain length and the percentage of terminal double bonds were formed during nitrogen-limited growth of P. oleovorans on 1-alkenes. Such polymers are expected to be useful for future chemical modifications. Images PMID:16347790

  6. Overexpression of MusaMYB31, a R2R3 type MYB transcription factor gene indicate its role as a negative regulator of lignin biosynthesis in banana.

    PubMed

    Tak, Himanshu; Negi, Sanjana; Ganapathi, T R

    2017-01-01

    Lignin and polyphenols are important cellular components biosynthesized through phenylpropanoid pathway. Phenylpropanoid pathway in plants is regulated by some important transcription factors including R2R3 MYB transcription factors. In this study, we report the cloning and functional characterization of a banana R2R3-MYB transcription factor (MusaMYB31) by overexpression in transgenic banana plants and evaluated its potential role in regulating biosynthesis of lignin and polyphenols. Sequence analysis of MusaMYB31 indicated its clustering with members of subgroup 4 (Sg4) of R2R3MYB family which are well known for their role as repressors of lignin biosynthesis. Expression analysis indicated higher expression of MusaMYB31 in corm and root tissue, known for presence of highly lignified tissue than other organs of banana. Overexpression of MusaMYB31 in banana cultivar Rasthali was carried out and four transgenic lines were confirmed by GUS histochemical staining, PCR analysis and Southern blot. Histological and biochemical analysis suggested reduction of cell wall lignin in vascular elements of banana. Transgenic lines showed alteration in transcript levels of general phenylpropanoid pathway genes including lignin biosynthesis pathway genes. Reduction of total polyphenols content in transgenic lines was in line with the observation related to repression of general phenylpropanoid pathway genes. This study suggested the potential role of MusaMYB31 as repressor of lignin and polyphenols biosynthesis in banana.

  7. Genome Sequencing and Transposon Mutagenesis of Burkholderia seminalis TC3.4.2R3 Identify Genes Contributing to Suppression of Orchid Necrosis Caused by B. gladioli.

    PubMed

    Araújo, Welington L; Creason, Allison L; Mano, Emy T; Camargo-Neves, Aline A; Minami, Sonia N; Chang, Jeff H; Loper, Joyce E

    2016-06-01

    From a screen of 36 plant-associated strains of Burkholderia spp., we identified 24 strains that suppressed leaf and pseudobulb necrosis of orchid caused by B. gladioli. To gain insights into the mechanisms of disease suppression, we generated a draft genome sequence from one suppressive strain, TC3.4.2R3. The genome is an estimated 7.67 megabases in size, with three replicons, two chromosomes, and the plasmid pC3. Using a combination of multilocus sequence analysis and phylogenomics, we identified TC3.4.2R3 as B. seminalis, a species within the Burkholderia cepacia complex that includes opportunistic human pathogens and environmental strains. We generated and screened a library of 3,840 transposon mutants of strain TC3.4.2R3 on orchid leaves to identify genes contributing to plant disease suppression. Twelve mutants deficient in suppression of leaf necrosis were selected and the transposon insertions were mapped to eight loci. One gene is in a wcb cluster that is related to synthesis of extracellular polysaccharide, a key determinant in bacterial-host interactions in other systems, and the other seven are highly conserved among Burkholderia spp. The fundamental information developed in this study will serve as a resource for future research aiming to identify mechanisms contributing to biological control.

  8. Overexpression of MusaMYB31, a R2R3 type MYB transcription factor gene indicate its role as a negative regulator of lignin biosynthesis in banana

    PubMed Central

    Ganapathi, T. R.

    2017-01-01

    Lignin and polyphenols are important cellular components biosynthesized through phenylpropanoid pathway. Phenylpropanoid pathway in plants is regulated by some important transcription factors including R2R3 MYB transcription factors. In this study, we report the cloning and functional characterization of a banana R2R3-MYB transcription factor (MusaMYB31) by overexpression in transgenic banana plants and evaluated its potential role in regulating biosynthesis of lignin and polyphenols. Sequence analysis of MusaMYB31 indicated its clustering with members of subgroup 4 (Sg4) of R2R3MYB family which are well known for their role as repressors of lignin biosynthesis. Expression analysis indicated higher expression of MusaMYB31 in corm and root tissue, known for presence of highly lignified tissue than other organs of banana. Overexpression of MusaMYB31 in banana cultivar Rasthali was carried out and four transgenic lines were confirmed by GUS histochemical staining, PCR analysis and Southern blot. Histological and biochemical analysis suggested reduction of cell wall lignin in vascular elements of banana. Transgenic lines showed alteration in transcript levels of general phenylpropanoid pathway genes including lignin biosynthesis pathway genes. Reduction of total polyphenols content in transgenic lines was in line with the observation related to repression of general phenylpropanoid pathway genes. This study suggested the potential role of MusaMYB31 as repressor of lignin and polyphenols biosynthesis in banana. PMID:28234982

  9. Expression of ryanodine receptor RyR3 produces Ca2+ sparks in dyspedic myotubes

    PubMed Central

    Ward, Christopher W; Schneider, Martin F; Castillo, Daniel; Protasi, Feliciano; Wang, Yaming; Wayne Chen, S R; Allen, Paul D

    2000-01-01

    Discrete, localized elevations of myoplasmic [Ca2+], Ca2+‘sparks’, were readily detected using the fluorescent Ca2+ indicator fluo-3 and laser scanning confocal microscopy in ‘dyspedic’ 1B5 myotubes, i.e. myotubes which do not express ryanodine receptors (RyRs), transduced with virions containing cDNA for RyR type 3 that were saponin permeabilized to allow dye entry. Ca2+ sparks were never observed in non-transduced RyR null myotubes.The spatial locations of sparks observed in permeabilized myotubes roughly corresponded to regions of RyR protein expression in the same myotube as detected after subsequent fixation and antibody staining.Permeabilized RyR3-transduced myotubes exhibited similar punctate peripheral RyR3 protein immunohistochemical patterns as myotubes fixed before permeabilization indicating that permeabilization did not affect the structural organization of the triad.Ca2+ sparks, recorded in line scan mode, in permeabilized myotubes expressing RyR3 exhibited mean amplitudes (change in fluorescence/mean fluorescence, ΔF/F: 1.20 ± 0.04) and temporal rise times (10-90 %; 6.31 ± 0.12 ms) similar to those of sparks recorded in permeabilized frog skeletal muscle fibres (0.98 ± 0.01; 6.11 ± 0.07, respectively) using the same confocal system. Spatial extent and temporal duration of the Ca2+ sparks were ≈40 % larger in the RyR3-expressing myotube cultures than in frog fibres.Ca2+ sparks recorded in line scan mode often occurred repetitively at the same spatial location in RyR3-expressing myotubes. Such repetitive events were highly reproducible in amplitude and spatio-temporal properties, as previously observed for repetitive mode sparks in frog skeletal muscle.Ca2+ sparks recorded in xy mode were frequently compressed in the y (slower scan) direction compared to the x direction. This asymmetry was reproduced assuming spatially symmetric events having the time course of Ca2+ sparks recorded in line scan (xt) mode.These expression studies

  10. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

    PubMed Central

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Li, Jilun

    2015-01-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus. PMID:25819953

  11. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

    PubMed

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Wen, Ying; Li, Jilun

    2015-06-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

  12. A Supervisor-Targeted Implementation Approach to Promote System Change: The R(3) Model.

    PubMed

    Saldana, Lisa; Chamberlain, Patricia; Chapman, Jason

    2016-11-01

    Opportunities to evaluate strategies to create system-wide change in the child welfare system (CWS) and the resulting public health impact are rare. Leveraging a real-world, system-initiated effort to infuse the use of evidence-based principles throughout a CWS workforce, a pilot of the R(3) model and supervisor-targeted implementation approach is described. The development of R(3) and its associated fidelity monitoring was a collaboration between the CWS and model developers. Outcomes demonstrate implementation feasibility, strong fidelity scale measurement properties, improved supervisor fidelity over time, and the acceptability and perception of positive change by agency leadership. The value of system-initiated collaborations is discussed.

  13. Effects of Nitrogen Resources on Fermentative Biohydrogen Production of Biohydrogenbacterium R3 sp.nov.

    NASA Astrophysics Data System (ADS)

    Chen, Hong; Han, Wei; Yue, Li-ran; Li, Yong-feng; Liu, Kun; Yang, Chuan-ping

    2010-11-01

    This study discussed the effects of nitrogen resources (include organic nitrogen resources and inorganic nitrogen resources) on hydrogen production bacterium (HPB) Biohydrogenbacterium R3 sp.nov. The performance of organic nitrogen resource to Biohydrogenbacterium R3 sp.nov. was better than that of inorganic nitrogen resource on cell growth and hydrogen production. Yeast powder was most beneficial to promote cell growth and hydrogen production among all those nitrogen resources with the maximum of hydrogen production yield, hydrogen production ration and specific hydrogen produce ration were 1529.69 ml H2/L, 16.94 mmol H2/g CDW•h and 1.33 mol H2/mol glucose, respectively.

  14. (2R,3S,2”R,3”R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract

    PubMed Central

    Balemba, Onesmo B.; Stark, Timo D.; Lösch, Sofie; Patterson, Savannah; McMillan, John S.; Mawe, Gary M.; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca2+) imaging was used to analyze the effect of GBB on Ca2+ flashes and Ca2+ waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1–5 and M7, and (2R,3S,2”R,3”R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2”R,3”R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2”R,3”R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca2+ flashes and Ca2+ waves. GBB, M3 and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials. L-type Ca2+ channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2”R,3”R)-manniflavanone. GBB and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3S,2”R,3”R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2”R,3”R)-manniflavanone relax smooth muscle by inhibiting L-type Ca2+ channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  15. (2R,3S,2'' R,3''R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract.

    PubMed

    Balemba, Onesmo B; Stark, Timo D; Lösch, Sofie; Patterson, Savannah; McMillan, John S; Mawe, Gary M; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca(2+)) imaging was used to analyze the effect of GBB on Ca(2+) flashes and Ca(2+) waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1-5 and M7, and (2R,3S,2'' R,3''R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2'' R,3''R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2''R,3'' R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca(2+) flashes and Ca(2+) waves. GBB, M3 and (2R,3 S,2''R,3''R)-manniflavanone inhibited action potentials. L-type Ca(2+) channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2''R,3'' R)-manniflavanone. GBB and (2R,3S,2'' R,3''R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3 S,2''R,3''R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2'' R,3''R)-manniflavanone relax smooth muscle by inhibiting L-type Ca(2+) channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias.

  16. Poly-(R)-3-hydroxybutyrates (PHB) are Atherogenic Components of Lipoprotein Lp(a).

    PubMed

    Reusch, Rosetta N

    2015-12-01

    The hypothesis is that poly-(R)-3-hydroxybutyrates (PHB), linear polymers of the ketone body, R-3-hydroxybutyrate (R-3HB), are atherogenic components of lipoprotein Lp(a). PHB are universal constituents of biological cells and are thus components of all foods. Medium chain-length PHB (<200 residues) (mPHB) are located in membranes and organelles, and short-chain PHB (<15 residues) are covalently attached to certain proteins (cPHB). PHB are highly insoluble in water, but soluble in lipids in which they exhibit a high intrinsic viscosity. They have a higher density than other cellular lipids and they are very adhesive, i.e. they engage in multiple noncovalent interactions with other molecules and salts via hydrogen, hydrophobic and coordinate bonds, thus producing insoluble deposits. Following digestive processes, PHB enter the circulation in chylomicrons and very low density lipoproteins (VLDL). The majority of the PHB (>70%) are absorbed by albumin, which transports them to the liver for disposal. When the amount of PHB in the diet exceed the capacity of albumin to safely remove them from the circulation, the excess PHB remain in the lipid core of LDL particles that become constituents of lipoprotein Lp(a), and contribute to the formation of arterial deposits. In summary, the presence of PHB – water-insoluble, dense, viscous, adhesive polymers – in the lipid cores of the LDL moieties of Lp(a) particles supports the hypothesis that PHB are atherogenic components of Lp(a).

  17. The cysteine-rich region of T1R3 determines responses to intensely sweet proteins.

    PubMed

    Jiang, Peihua; Ji, Qingzhou; Liu, Zhan; Snyder, Lenore A; Benard, Lumie M J; Margolskee, Robert F; Max, Marianna

    2004-10-22

    A wide variety of chemically diverse compounds taste sweet, including natural sugars such as glucose, fructose, sucrose, and sugar alcohols, small molecule artificial sweeteners such as saccharin and acesulfame K, and proteins such as monellin and thaumatin. Brazzein, like monellin and thaumatin, is a naturally occurring plant protein that humans, apes, and Old World monkeys perceive as tasting sweet but that is not perceived as sweet by other species including New World monkeys, mouse, and rat. It has been shown that heterologous expression of T1R2 plus T1R3 together yields a receptor responsive to many of the above-mentioned sweet tasting ligands. We have determined that the molecular basis for species-specific sensitivity to brazzein sweetness depends on a site within the cysteine-rich region of human T1R3. Other mutations in this region of T1R3 affected receptor activity toward monellin, and in some cases, overall efficacy to multiple sweet compounds, implicating this region as a previously unrecognized important determinant of sweet receptor function.

  18. Enzyme-catalyzed synthesis of poly[(R)-(-)-3-hydroxybutyrate]: Formation of macroscopic granules in vitro

    SciTech Connect

    Gerngross, T.U.; Martin, D.P.

    1995-07-03

    A combined chemical and enzymatic procedure has been developed to synthesize macroscopic poly[(R)-(-)-3-hydroxybutyrate] (PHB) granules in vitro. The granules form in a matter of minutes when purified polyhydroxyalkanoate (PHA) synthase from Alcaligenes eutrophus is exposed to synthetically prepared (R)-3-hydroxybutyryl coenzyme A, thereby establishing the minimal requirements for PHB granule formation. The artificial granules are spherical with diameters of up to 3 {mu}m and significantly larger than their native counterparts (0.5 {mu}m). The isolated PHB was characterized by {sup 1}H and {sup 13}C NMR, gel-permeation chromatography, and chemical analysis. The in vitro polymerization system yields PHB with a molecular mass > 10 x 10{sup 6} Da, exceeding by an order of magnitude the mass of PHAs typically extracted from microorganisms. We also demonstrate that the molecular mass of the polymer can be controlled by the initial PHA synthase concentration. Preliminary kinetic analysis of de novo granule formation confirms earlier findings of a lag time for the enzyme but suggests the involvement of an additional granule assembly step. Minimal requirements for substrate recognition were investigated. Since substrate analogs lacking the adenosine 3{prime}, 5{prime}-bisphosphate moiety of (R)-3-hydroxybutyryl coenzyme A were not accepted by the PHA synthase, we provide evidence that this structural element of the substrate is essential for catalysis. PHAs provide a range of natural, renewable, biodegradable thermoplastics with a broad range of useful material properties. 33 refs., 6 figs., 1 tab.

  19. Antiausterity activity of arctigenin enantiomers: importance of (2R,3R)-absolute configuration.

    PubMed

    Awale, Suresh; Kato, Mamoru; Dibwe, Dya Fita; Li, Feng; Miyoshi, Chika; Esumi, Hiroyasu; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2014-01-01

    From a MeOH extract of powdered roots of Wikstroemia indica, six dibenzyl-gamma-butyrolactone-type lignans with (2S,3S)-absolute configuration [(+)-arctigenin (1), (+)-matairesinol (2), (+)-trachelogenin (3), (+)-nortrachelogenin (4), (+)-hinokinin (5), and (+)-kusunokinin (6)] were isolated, whereas three dibenzyl-gamma-butyrolactone-type lignans with (2R,3R)-absolute configuration [(-)-arctigenin (1*), (-)-matairesinol (2*), (-)-trachelogenin (3*)] were isolated from Trachelospermum asiaticum. The in vitro preferential cytotoxic activity of the nine compounds was evaluated against human pancreatic PANC-1 cancer cells in nutrient-deprived medium (NDM), but none of the six lignans (1-6) with (2S,3S)-absolute configuration showed preferential cytotoxicity. On the other hand, three lignans (1*-3*) with (2R,3R)-absolute configuration exhibited preferential cytotoxicity in a concentration-dependent manner with PC50 values of 0.54, 6.82, and 5.85 microM, respectively. Furthermore, the effect of (-)- and (+)-arctigenin was evaluated against the activation of Akt, which is a key process in the tolerance to nutrition starvation. Interestingly, only (-)-arctigenin (1*) strongly suppressed the activation of Akt. These results indicate that the (2R,3R)-absolute configuration of (-)-enantiomers should be required for the preferential cytotoxicity through the inhibition of Akt activation.

  20. Containerless Solidification of Hexagonal Metastable Phases from an Undercooled R3Fe5O12 Melt

    NASA Astrophysics Data System (ADS)

    Kumar, Vijaya; Kentei Yu, Yu; Kameko, Masashi; Ishikawa, Takehiko; Kuribayashi, Kazuhiko; Yoda, Shinichi

    Containerless processing is a promising technique to explore the technologically important materials using rapid solidification of an undercooled melt because it provides large undercooling prior to nucleation. In the R-Fe-O system (R=Rare-earth element), rare-earth iron garnet (R3 Fe5 O12 ) can be formed through a peritectic reaction between RFeO3 , which is a primary phase, and a melt, which contains more Fe2 O3 than the R3 Fe5 O12 composition. The iron garnet is know to become unstable with increasing ionic radius of the rare-earth ion from Lu to Sm and does not exist in a stable form in La, Pr, and Nd [1,2]. Recently, we investigated the effect of oxygen partial pressure Po2 on metastable phase formation from an undercooled RFeO3 melt through containerless solidification. On the other hand, Po2 was considered to be one of the most important thermodynamic parameters which control phase constituents during containerless processing. In the R-Fe-O system, multiferroic hexagonal RFeO3 (P63 cm) and Fe2+ -containing ferroelectric phases such as RFe2 O4 (r-R3m) and new hexagonal R3 Fe2 O7 (P63 /mmc) phases were obtained metastably with decreasing Po2 from 105 to 10-1 Pa [3,4]. However, in the R3 Fe5 O12 system, the effect of Po2 during rapid solidification has not been studied yet. The purpose of this study is to elucidate the effect of Po2 on the formation of metastable phases from an undercooled R3 Fe5 O12 melt under controlled Po2 using gas-jet levitation technique. In order to undercool the melt deeply below the melting temperature under a precisely con-trolled oxygen partial pressure, an aerodynamic levitator (ADL) combined with ZrO2 oxygen sensor was designed. A spherical R3 Fe5 O12 sample was levitated by an ADL and completely melted by a CO2 laser in an atmosphere with predetermined Po2 . The surface temperature of the levitated droplet was monitored by a two-color pyrometer. Then, the droplet was cooled by turning off the CO2 laser. Meanwhile, the recalescence

  1. Crystal Structure of the Complex of Human FasL and Its Decoy Receptor DcR3.

    PubMed

    Liu, Weifeng; Ramagopal, Udupi; Cheng, Huiyong; Bonanno, Jeffrey B; Toro, Rafael; Bhosle, Rahul; Zhan, Chenyang; Almo, Steven C

    2016-11-01

    The apoptotic effect of FasL:Fas signaling is disrupted by DcR3, a unique secreted member of the tumor necrosis factor receptor superfamily, which also binds and neutralizes TL1A and LIGHT. DcR3 is highly elevated in patients with various tumors and contributes to mechanisms by which tumor cells to evade host immune surveillance. Here we report the crystal structure of FasL in complex with DcR3. Comparison of FasL:DcR3 structure with our earlier TL1A:DcR3 and LIGHT:DcR3 structures supports a paradigm involving the recognition of invariant main-chain and conserved side-chain functionalities, which is responsible for the recognition of multiple TNF ligands exhibited by DcR3. The FasL:DcR3 structure also provides insight into the FasL:Fas recognition surface. We demonstrate that the ability of recombinant FasL to induce Jurkat cell apoptosis is significantly enhanced by native glycosylation or by structure-inspired mutations, both of which result in reduced tendency to aggregate. All of these activities are efficiently inhibited by recombinant DcR3.

  2. The R3 component of the electrically elicited blink reflex is present in patients with congenital insensitivity to pain.

    PubMed

    Téllez, Maria J; Axelrod, Felicia; Kaufmann, Horacio

    2009-01-01

    To clarify whether the R3 component of the electrically elicited blink reflex is a nociceptive response we studied two patients with congenital insensitivity to pain due to the impaired development of Adelta and C nerve fibers (hereditary sensory and autonomic neuropathy types III and IV). We postulated that if the R3 component is a nociceptive reflex, it should be absent in these patients. The R3 responses were elicited in both sides in both the patients at all intensities, strongly suggesting that the R3 component of the blink reflex is not a nociceptive response.

  3. Cluster headache

    MedlinePlus

    Histamine headache; Headache - histamine; Migrainous neuralgia; Headache - cluster; Horton's headache; Vascular headache - cluster ... Doctors do not know exactly what causes cluster headaches. They ... (chemical in the body released during an allergic response) or ...

  4. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  5. A sugarcane R2R3-MYB transcription factor gene is alternatively spliced during drought stress

    PubMed Central

    Guo, Jinlong; Ling, Hui; Ma, Jingjing; Chen, Yun; Su, Yachun; Lin, Qingliang; Gao, Shiwu; Wang, Hengbo; Que, Youxiong; Xu, Liping

    2017-01-01

    MYB transcription factors of the R2R3-MYB family have been shown to play important roles in many plant processes. A sugarcane R2R3-MYB gene (ScMYB2) and its two alternative forms of transcript (ScMYB2S1 and ScMYB2S2) were identified in this study. The deduced protein of ScMYB2S1 is a typical plant R2R3-MYB protein, while ScMYB2S2 encodes a truncated protein. Real-time qPCR analysis revealed that ScMYB2S1 is suppressed under PEG-simulated drought stress in sugarcane, while ScMYB2S2 is induced at later treatment stage. A senescence symptom was observed when ScMYB2S1 was injected into tobacco leaves mediated by Agrobacterium, but no symptom for ScMYB2S2. Further investigation showed that the expression levels of 4 senescence-associated genes, NtPR-1a, NtNYC1, NtCAT3 and NtABRE, were markedly induced in tobacco leaves after ScMYB2S1-injection, while they were not sensitive to ScMYB2S2-injection. Moreover, MDA and proline were also investigated after injection. Similarly, MDA and proline levels were induced by ABA and ScMYB2S1, while inhibited by ScMYB2S2. We propose that ScMYB2, by alternatively splicing two transcripts (ScMYB2S1 and ScMYB2S2), is involved in an ABA-mediated leaf senescence signaling pathway and play positive role in respond to drought-induced senescence in sugarcane. The results of this study provide information for further research in sugarcane stress processes. PMID:28167824

  6. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis.

    PubMed

    Schwinn, Kathy E; Ngo, Hanh; Kenel, Fernand; Brummell, David A; Albert, Nick W; McCallum, John A; Pither-Joyce, Meeghan; Crowhurst, Ross N; Eady, Colin; Davies, Kevin M

    2016-01-01

    Bulb color is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species.

  7. The Onion (Allium cepa L.) R2R3-MYB Gene MYB1 Regulates Anthocyanin Biosynthesis

    PubMed Central

    Schwinn, Kathy E.; Ngo, Hanh; Kenel, Fernand; Brummell, David A.; Albert, Nick W.; McCallum, John A.; Pither-Joyce, Meeghan; Crowhurst, Ross N.; Eady, Colin; Davies, Kevin M.

    2016-01-01

    Bulb color is an important consumer trait for onion (Allium cepa L., Allioideae, Asparagales). The bulbs accumulate a range of flavonoid compounds, including anthocyanins (red), flavonols (pale yellow), and chalcones (bright yellow). Flavonoid regulation is poorly characterized in onion and in other plants belonging to the Asparagales, despite being a major plant order containing many important crop and ornamental species. R2R3-MYB transcription factors associated with the regulation of distinct branches of the flavonoid pathway were isolated from onion. These belonged to sub-groups (SGs) that commonly activate anthocyanin (SG6, MYB1) or flavonol (SG7, MYB29) production, or repress phenylpropanoid/flavonoid synthesis (SG4, MYB4, MYB5). MYB1 was demonstrated to be a positive regulator of anthocyanin biosynthesis by the induction of anthocyanin production in onion tissue when transiently overexpressed and by reduction of pigmentation when transiently repressed via RNAi. Furthermore, ectopic red pigmentation was observed in garlic (Allium sativum L.) plants stably transformed with a construct for co-overexpression of MYB1 and a bHLH partner. MYB1 also was able to complement the acyanic petal phenotype of a defined R2R3-MYB anthocyanin mutant in Antirrhinum majus of the asterid clade of eudicots. The availability of sequence information for flavonoid-related MYBs from onion enabled phylogenetic groupings to be determined across monocotyledonous and dicotyledonous species, including the identification of characteristic amino acid motifs. This analysis suggests that divergent evolution of the R2R3-MYB family has occurred between Poaceae/Orchidaceae and Allioideae species. The DNA sequences identified will be valuable for future analysis of classical flavonoid genetic loci in Allium crops and will assist the breeding of these important crop species. PMID:28018399

  8. Solitary solutions for a class of Schrödinger equations in R^3

    NASA Astrophysics Data System (ADS)

    Wang, Youjun

    2016-08-01

    In this paper, we consider a model problem arising from a classical planar Heisenberg ferromagnetic spin chain -Δ u + (λ + ɛ') u ∓ Δ √{1-u2}u/√{1- u2} - ɛ'u/√{1 - u2} = 0, x in R3, where {λ} and {ɛ'}are real constants. By variational methods and perturbation arguments, we study the existence of positive classical solutions. Our results generalize the previous results in one-dimensional space given by Brüll et al. [4].

  9. Detection of plant quarantine pathogen Ralstonia solanacearum r3b2 with portable POCKIT™ and BLItz® systems

    USDA-ARS?s Scientific Manuscript database

    Ralstonia solanacearum (Rs) race 3 biovar 2 (r3b2) is designated as a quarantine pathogen in many countries and additionally as a Select Agent in the United States. Rapid, sensitive and accurate detection methods are urgently needed. We report here the development of two portable platforms for r3b...

  10. Regulation of root hair cell differentiation by R3 MYB transcription factors in tomato and Arabidopsis.

    PubMed

    Tominaga-Wada, Rumi; Wada, Takuji

    2014-01-01

    CAPRICE (CPC) encodes a small protein with an R3 MYB motif and regulates root hair and trichome cell differentiation in Arabidopsis thaliana. Six additional CPC-like MYB proteins including TRIPTYCHON (TRY), ENHANCER OF TRY AND CPC1 (ETC1), ENHANCER OF TRY AND CPC2 (ETC2), ENHANCER OF TRY AND CPC3/CPC-LIKE MYB3 (ETC3/CPL3), TRICHOMELESS1 (TCL1), and TRICHOMELESS2/CPC-LIKE MYB4 (TCL2/CPL4) also have the ability to regulate root hair and/or trichome cell differentiation in Arabidopsis. In this review, we describe our latest findings on how CPC-like MYB transcription factors regulate root hair cell differentiation. Recently, we identified the tomato SlTRY gene as an ortholog of the Arabidopsis TRY gene. Transgenic Arabidopsis plants harboring SlTRY produced more root hairs, a phenotype similar to that of 35S::CPC transgenic plants. CPC is also known to be involved in anthocyanin biosynthesis. Anthocyanin accumulation was repressed in the SlTRY transgenic plants, suggesting that SlTRY can also influence anthocyanin biosynthesis. We concluded that tomato and Arabidopsis partially use similar transcription factors for root hair cell differentiation, and that a CPC-like R3 MYB may be a key common regulator of plant root-hair development.

  11. Reliability and validity of the tritrac-R3D accelerometer during backpacking: a case study.

    PubMed

    DeVoe, D; Dalleck, L

    2001-08-01

    This study investigated the utility of the Tritrac-R3D accelerometer as a reliable and valid instrument in the quantification of physical activity while backpacking in the field and to evaluate heart-rate responses and oxygen consumption to assess the feasibility of using the Tritrac-R3D to estimate caloric expenditure. Two 7-day backpacking expeditions were conducted in two consecutive years by a single subject at Grand Canyon National Park, Arizona. The average hiking heart rate ranged front 60% to 77% HRmax during the expeditions. The average rate of estimated caloric cost ranged from 6.8 to 11.7 kcals x min.(-1) (equivalent to 408 to 702 kcals x hr.(-1)), indicating a relatively moderate to high level of exertion. The Tritrac had adequate consistency and reliability in the field between the two expeditions in recorded activity counts. The Tritrac underestimated caloric expenditure during backpacking with changes in terrain, and hiking speed contributed to even greater disparity in accuracy.

  12. Active Asteroids P/2013 P5 and P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Li, Jing; Larson, Stephen

    2014-11-01

    Active asteroids (a.k.a. main-belt comets) possess the dynamical character of asteroids but exhibit evidence for mass loss, giving them a comet-like appearance. About 16 members of this newly-recognized group are currently known. Scientific interest lies in understanding the mechanisms responsible for the mass loss. Examples of impact, sublimation and thermal disintegration have been identified, and it seems clear that still other mechanisms exist. We are investigating these objects using high resolution observations from the Hubble Space Telescope, supplemented by observations from the Keck and other ground-based telescopes.Two exciting new objects show properties consistent with mass loss caused by rotational instability. P/2013 P5 shows a unique multiple dust tail system (dust mass of order 10^5 kg), produced by irregular ejection over 8 months. This is inconsistent with an impact origin and unlike activity seen in any ice-driven comet. The inner belt orbit (a = 2.189 AU) and S-type optical colors additionally suggest a metamorphosed composition incompatible with the survival of water ice. We suggest that P5 is shedding mass through local avalanche instabilities caused by a presumed rapid spin. The small size (radius < 240 m) renders P5 potentially susceptible to spin-up by radiation torques. P/2013 R3 is a dust-shrouded, multiple object in the outer asteroid belt (a = 3.033 AU) that is disintegrating in real-time. Ten distinct components have been detected, the largest four having radii up to 200 m. The velocity dispersion amongst fragments is 0.2 to 0.5 m/s, comparable to the gravitational escape speeds of the largest components. The dust mass is of order 10^8 kg, about 1000 times larger than in P5. Keck spectra set a limit to gas production near 1 kg/s. We suggest that R3 has experienced a rotational breakup, more severe than that of P5, in which the nucleus has disintegrated into component pieces. We are tracking the components to determine their dynamics

  13. Ablation of PPP1R3G reduces glycogen deposition and mitigates high-fat diet induced obesity.

    PubMed

    Zhang, Yongxian; Gu, Jin; Wang, Lin; Zhao, Zilong; Pan, Yi; Chen, Yan

    2017-01-05

    Glycogen and triglyceride are two major forms of energy storage in the body and provide the fuel during different phases of food deprivation. However, how glycogen metabolism is linked to fat deposition in adipose tissue has not been clearly characterized. We generated a mouse model with whole-body deletion of PPP1R3G, a glycogen-targeting subunit of protein phosphatase-1 required for glycogen synthesis. Upon feeding with high-fat diet, the body weight and fat composition are significantly reduced in the PPP1R3G(-/-) mice compared to the wild type controls. The metabolic rate of the mice as measured by O2 consumption and CO2 production is accelerated by PPP1R3G deletion. The high-fat diet-induced liver steatosis is also slightly relieved by PPP1R3G deletion. The glycogen level in adipose tissue is reduced by PPP1R3G deletion. In 3T3L1 cells, overexpression of PPP1R3G leads to increases of both glycogen and triglyceride levels. In conclusion, our study indicates that glycogen is actively involved in fat accumulation in adipose tissue and obesity development upon high-fat diet. Our study also suggests that PPP1R3G is an important player that links glycogen metabolism to lipid metabolism in vivo. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Engineered Serratia marcescens for efficient (3R)-acetoin and (2R,3R)-2,3-butanediol production.

    PubMed

    Bai, Fangmin; Dai, Lu; Fan, Jiying; Truong, Ngoctu; Rao, Ben; Zhang, Liaoyuan; Shen, Yaling

    2015-05-01

    (3R)-Acetoin and (2R,3R)-2,3-butanediol are important pharmaceutical intermediates. However, until now, the quantity of natural microorganisms with the ability to produce single configuration of optically pure (3R)-acetoin and (2R,3R)-2,3-butanediol is rare. In this study, a meso-2,3-butanediol dehydrogenase encoded by the slaC gene from Serratia marcescens MG1 was identified for meso-2,3-butanediol and (2S,3S)-2,3-butanediol biosynthesis. Inactivation of the slaC gene could significantly decrease meso-2,3-butanediol and (2S,3S)-2,3-butanediol and result in a large quantity of (3R)-acetoin accumulation. Furthermore, a (2R,3R)-2,3-butanediol dehydrogenase encoded by the bdhA gene from Bacillus subtilis 168 was introduced into the slaC mutant strain of Serratia marcescens MG1. Excess (2R,3R)-2,3-butanediol dehydrogenase could accelerate the reaction from (3R)-acetoin to (2R,3R)-2,3-butanediol and lead to (2R,3R)-2,3-butanediol accumulation. In fed-batch fermentation, the excess (2R,3R)-2,3-butanediol dehydrogenase expression strain could produce 89.81 g/l (2R,3R)-2,3-butanediol with a productivity of 1.91 g/l/h at 48 h. These results provided potential applications for (3R)-acetoin and (2R,3R)-2,3-butanediol production.

  15. Glucose-Sensing Receptor T1R3: A New Signaling Receptor Activated by Glucose in Pancreatic β-Cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Hamano, Kunihisa; Medina, Johan; Li, Longfei; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptors T1R2 and T1R3 are expressed in pancreatic β-cells. Compared with T1R3, mRNA expression of T1R2 is considerably lower. At the protein level, expression of T1R2 is undetectable in β-cells. Accordingly, a major component of the sweet taste-sensing receptor in β-cells may be a homodimer of T1R3 rather than a heterodimer of T1R2/T1R3. Inhibition of this receptor by gurmarin or deletion of the T1R3 gene attenuates glucose-induced insulin secretion from β-cells. Hence the T1R3 homodimer functions as a glucose-sensing receptor (GSR) in pancreatic β-cells. When GSR is activated by the T1R3 agonist sucralose, elevation of intracellular ATP concentration ([ATP]i) is observed. Sucralose increases [ATP]i even in the absence of ambient glucose, indicating that sucralose increases [ATP]i not simply by activating glucokinase, a rate-limiting enzyme in the glycolytic pathway. In addition, sucralose augments elevation of [ATP]i induced by methylsuccinate, suggesting that sucralose activates mitochondrial metabolism. Nonmetabolizable 3-O-methylglucose also increases [ATP]i and knockdown of T1R3 attenuates elevation of [ATP]i induced by high concentration of glucose. Collectively, these results indicate that the T1R3 homodimer functions as a GSR; this receptor is involved in glucose-induced insulin secretion by activating glucose metabolism probably in mitochondria.

  16. Full stereochemical understanding in a new (2R,3R,4R)-4-hydroxyisoleucine synthesis.

    PubMed

    Rolland, M; Kassem, T; Rolland, V; Martinez, J

    2001-12-01

    We present the crystal and molecular structures of 2,3,6,7,8,8a-hexahydro-6,8-methano-7,7,8a-trimethyl-3-(1-methyl-2-oxopropylidene)-5H-1,4-benzoxazin-2-one, C16H21NO3, (III), and 2,3,6,7,8,8a-hexahydro-3-(2-hydroxy-1-methylpropyl)-6,8-methano-7,7,8a-trimethyl-5H-1,4-benzoxazin-2-one, C16H25NO3, (V). These compounds are two of the four key intermediates in our synthetic route to (2R,3R,4R)-4-hydroxyisoleucine. The two structures provide a full understanding of the stereochemistry in successive steps. This synthesis was based on a new optically pure chiral oxazinone auxiliary derived from (1R,2R,5R)-2-hydroxypinan-3-one.

  17. CYB5R3: a key player in aerobic metabolism and aging?

    PubMed Central

    de Cabo, Rafael; Siendones, Emilio; Minor, Robin; Navas, Plácido

    2010-01-01

    Aging results from a complex and not completely understood chain of processes that are associated with various negative metabolic consequences and ultimately leads to senescence and death. The intracellular ratio of pyridine nucleotides (NAD+/NADH), has been proposed to be at the center stage of age-related biochemical changes in organisms, and may help to explain the observed influence of calorie restriction and energy-sensitive proteins on lifespan in model organisms. Indeed, the NAD+/NADH ratios affect the activity of a number of proteins, including sirtuins, which have gained prominence in the aging field as potential mediators of the beneficial effects of calorie restriction and mediating lifespan. Here we review the activities of a redox enzyme (NQR1 in yeast and CYB5R3 in mammals) that also influences the NAD+/NADH ratio and may play a regulatory role that connects aerobic metabolism with aging. PMID:20228936

  18. Long-time asymptotics of the Navier-Stokes and vorticity equations on R(3).

    PubMed

    Gallay, Thierry; Wayne, C Eugene

    2002-10-15

    We use the vorticity formulation to study the long-time behaviour of solutions to the Navier-Stokes equation on R(3). We assume that the initial vorticity is small and decays algebraically at infinity. After introducing self-similar variables, we compute the long-time asymptotics of the rescaled vorticity equation up to second order. Each term in the asymptotics is a self-similar divergence-free vector field with Gaussian decay at infinity, and the coefficients in the expansion can be determined by solving a finite system of ordinary differential equations. As a consequence of our results, we are able to characterize the set of solutions for which the velocity field satisfies ||u(.,t)||(L(2)) = o(t(-5/4)) as t-->+ infinity. In particular, we show that these solutions lie on a smooth invariant submanifold of codimension 11 in our function space.

  19. Synthesis, magnetic and electrical properties of R3AlCx (R = Ce, Pr and Nd)

    NASA Astrophysics Data System (ADS)

    Ghule, S. S.; Garde, C. S.; Ramakrishnan, S.; Singh, S.; Rajarajan, A. K.; Laad, Meena; Karmakar, Koushik

    2017-09-01

    R3AlCx (R = Ce, Pr and Nd; x = 0-1) series has been synthesized by arc melting. Rietveld analysis of x-ray powder diffraction reveals cubic (Pm-3m) structure. A Kondo temperature TK 1 K is estimated for Ce3AlC0.65 from the susceptibility and resistivity data. Magnetic susceptibility measurements indicate antiferromagnetic (AFM) order for R = Pr (x = 0.8 and 1) and Nd (x = 0.6, 0.8 and 1) and ferromagnetic (FM) for Nd3Al. Metamagnetic behaviour in the magnetization curve indicates complex magnetic structure. Band structure calculations indicate growth of a pseudo-gap in the density of states (DOS) from Ce3AlC to Pr3AlC to Nd3AlC. The DOS calculations predict a metallic behaviour which is consistent with the resistivity measurements.

  20. Magnetic properties of R 3Co 8Sn 4 (R=Y, Gd)

    NASA Astrophysics Data System (ADS)

    Canepa, F.; Napoletano, M.; Manfrinetti, P.; Palenzona, A.; Cirafici, S.; Merlo, F.

    2000-10-01

    The magnetic properties of the intermetallic phases R 3Co 8Sn 4 (R=Y, Gd) are presented. The two compounds order ferro- (Y) and ferri-magnetically (Gd) with transition temperatures of 61.5 and 102.5 K, respectively. In the paramagnetic region, the Y-compound follows the Curie-Weiss law with μ=0.98 μ B/Co and θP=62.0 K while a more complex behaviour, typical of a ferrimagnetic substance, is observed for Gd 3Co 8Sn 4. The experimental data, analysed in the framework of the molecular field theory, allow to obtain the exchange parameter for the Co-Co ( JCo-Co=83 kB) and of the Gd-Co ( JGd-Co=11 kB) interactions.

  1. The relativistic spherical δ -shell interaction in R3: Spectrum and approximation

    NASA Astrophysics Data System (ADS)

    Mas, Albert; Pizzichillo, Fabio

    2017-08-01

    This note revolves on the free Dirac operator in R3 and its δ -shell interaction with electrostatic potentials supported on a sphere. On one hand, we characterize the eigenstates of those couplings by finding sharp constants and minimizers of some precise inequalities related to an uncertainty principle. On the other hand, we prove that the domains given by Dittrich et al. [J. Math. Phys. 30(12), 2875-2882 (1989)] and by Arrizabalaga et al. [J. Math. Pures Appl. 102(4), 617-639 (2014)] for the realization of an electrostatic spherical shell interaction coincide. Finally, we explore the spectral relation between the shell interaction and its approximation by short range potentials with shrinking support, improving previous results in the spherical case.

  2. Heteroclinic bifurcations near Hopf-zero bifurcation in reversible vector fields in R3

    NASA Astrophysics Data System (ADS)

    Lamb, Jeroen S. W.; Teixeira, Marco-Antonio; Webster, Kevin N.

    We study the dynamics near a symmetric Hopf-zero (also known as saddle-node Hopf or fold-Hopf) bifurcation in a reversible vector field in R3, with involutory an reversing symmetry whose fixed point subspace is one-dimensional. We focus on the case in which the normal form for this bifurcation displays a degenerate family of heteroclinics between two asymmetric saddle-foci. We study local perturbations of this degenerate family of heteroclinics within the class of reversible vector fields and establish the generic existence of hyperbolic basic sets (horseshoes), independent of the eigenvalues of the saddle-foci, as well as cascades of bifurcations of periodic, heteroclinic and homoclinic orbits. Finally, we discuss the application of our results to the Michelson system, describing stationary states and travelling waves of the Kuramoto-Sivashinsky PDE.

  3. Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice.

    PubMed

    Sclafani, Anthony; Glass, Damien S; Margolskee, Robert F; Glendinning, John I

    2010-12-01

    Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice.

  4. Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice

    PubMed Central

    Glass, Damien S.; Margolskee, Robert F.; Glendinning, John I.

    2010-01-01

    Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice. PMID:20926763

  5. Overexpression of DcR3 and Its Significance on Tumor Cell Differentiation and Proliferation in Glioma

    PubMed Central

    Huang, Suning; Dang, Yiwu; Chen, Long-Hua

    2014-01-01

    Background. Overexpression of decoy receptor 3 (DcR3) have been reported in various classes of malignancies. However, its expression and clinicopathological contribution in gliomas has not been fully elucidated. Objective. To explore the expression and clinical significance of DcR3 protein in relation to tumor cell differentiation and proliferation in glioma cell lines and tissues. Methods. One hundred and twenty-five samples of glioma patients and 18 cases of normal brain tissues were recruited. The expression of DcR3 protein was detected using immunohistochemistry. Tumor differentiation was assessed by histologic characters and the status of glial fibrillary acidic protein (GFAP). Tumor cell labeling indexes (LIs) of Ki-67 and PCNA were also obtained. The relationship between the DcR3 level and clinicopathological features was investigated, including tumor differentiation, LIs, and survival. Meanwhile, the expression of DcR3 protein was also measured in the supernatants of 8 glioma cell lines and glioma cells freshly prepared from 8 human glioblastoma specimens by using western blot. Results. The level of DcR3 protein in gliomas was significantly higher than that in normal brain tissues (P < 0.01). DcR3 expression showed positive correlations with tumor pathological grade (r = 0.621, P < 0.01) and negative with GFAP expression (r = −0.489, P < 0.01). Furthermore, there were positive correlations between DcR3 expression and Ki-67, PCNA LIs (r = 0.529, P < 0.01; r = 0.556, P < 0.01). The survival in the DcR3 negative group was 50 ± 1.79 months, longer than that of the DcR3 positive group (48.36 ± 2.90), however, without significance (P = 0.149). Different levels of DcR3 could also be detected in the culturing supernatants of all the 8 glioma cell lines and glioma cells freshly obtained from 8 human glioblastoma specimens. Conclusions. The overexpression of DcR3 might play a crucial role in the tumorigenesis, differentiation, and proliferation of glioma. PMID

  6. Electrical and Magnetic Properties of R3Al11 (R = La, Ce, Pr, and Nd)

    NASA Astrophysics Data System (ADS)

    Garde, Chandrashekhar S.; Takeuchi, Tetsuya; Nakano, Yasunori; Takeda, Yuji; Ota, Yuki; Miyauchi, Yuichiro; Sugiyama, Kiyohiro; Hagiwara, Masayuki; Kindo, Koichi; Honda, Fuminori; Settai, Rikio; Ōnuki, Yoshichika

    2008-12-01

    High-quality single crystals of R3Al11 (R = La, Ce, Pr, and Nd) with the La3Al11-type orthorhombic crystal structure (space group Immm) have been grown by the Al-flux method. For Ce3Al11, signatures for ferromagnetic and antiferromagnetic orderings at TC = 6.3 K and TN = 3.2 K, respectively, have been observed in the magnetic susceptibility, magnetization, specific heat, and electrical resistivity. An antiferromagnet Pr3Al11, on the other hand, exhibits two magnetic transitions at TN1 = 12.6 K and TN2 = 3.1 K. An antiferromagnet Nd3Al11 also exhibits multiple magnetic transitions at TN1 = 13.2 K, TN2 = 9.4 K, TN3 = 2.9 K, and TN4 = 1.77 K in zero magnetic field. The transition at TN4 has a first-order character. The crystalline electric field (CEF) analysis of magnetic susceptibility, magnetization and specific heat data shows that the CEF splitting is larger for Ce3Al11 than for Pr3Al11 and Nd3Al11. The CEF ground state of Pr3Al11 is a singlet. Magnetic order occurs in this compound owing to the exchange mixing of the CEF ground state and low-lying excited states. The ferromagnetic like component of the magnetization for H \\parallel [010] is characteristic of R3Al11 (R = Ce, Pr, and Nd), which is most likely due to the Dzialoshinsky-Moriya interaction for two nonequivalent R atoms.

  7. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles.

    PubMed

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-06-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (emission of benzenoid II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of cinnamyl alcohol dehydrogenase1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles.

  8. Anatomy of an Asteroid Breakup: The Case of P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David; Agarwal, Jessica; Li, Jing; Weaver, Harold; Mutchler, Max; Larson, Stephen

    2017-05-01

    We present an analysis of new and published data on P/2013 R3, the first asteroid detected while disintegrating. Thirteen discrete components are measured in the interval between UT 2013 October 01 and 2014 February 13. We determine a mean, pair-wise velocity dispersion among these components of Δv = 0.33 ± 0.03 m s-1 and find that their separation times are staggered over an interval of ˜5 months. Dust enveloping the system has, in the first observations, a cross-section of ˜30 km2 but fades monotonically at a rate consistent with the action of radiation pressure sweeping. The individual components exhibit comet-like morphologies and also fade except where secondary fragmentation is accompanied by the release of additional dust. We find only upper limits to the radii of any embedded solid nuclei, typically ˜100-200 m (geometric albedo 0.05 assumed). Combined, the components of P/2013 R3 would form a single spherical body with a radius of ≲ 400 m, which is our best estimate of the size of the precursor object. The observations are consistent with rotational disruption of a weak (cohesive strength of ˜50 to 100 N m-2) parent body, ˜400 m in radius. Estimated radiation (YORP) spin-up times of this parent are ≲ 1 {Myr}, shorter than the collisional lifetime. If present, water ice sublimating at as little as 10-3 kg s-1 could generate a torque on the parent body rivaling the YORP torque. Under conservative assumptions about the frequency of similar disruptions, the inferred asteroid debris production rate is ≳103 kg s-1, which is at least 4% of the rate needed to maintain the Zodiacal Cloud.

  9. The R3-MYB gene GhCPC negatively regulates cotton fiber elongation.

    PubMed

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen

    2015-01-01

    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in -1-5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model.

  10. H(+), CH(3)(+), and R(3)Si(+) carborane reagents: when triflates fail.

    PubMed

    Reed, Christopher A

    2010-01-19

    For decades, triflic acid, methyl triflate, and trialkylsilyl triflate reagents have served synthetic chemistry well as clean, strong electrophilic sources of H(+), CH(3)(+), and R(3)Si(+), respectively. However, a number of weakly basic substrates are unreactive toward these reagents. In addition, triflate anion can express undesired nucleophilicity toward electrophilically activated substrates. In this Account, we describe methods that replace triflate-based electrophilic reagents with carborane reagents. Using carborane anions of type CHB(11)R(5)X(6)(-) (R = H, Me, X; X = Br, Cl), members of a class of notably inert, weakly nucleophilic anions, significantly increases the electrophilicity of these reagents and shuts down subsequent nucleophilic chemistry of the anion. Thus, H(carborane) acids cleanly protonate benzene, phosphabenzene, C(60), etc., while triflic acid does not. Similarly, CH(3)(carborane) reagents can methylate substrates that are inert to boiling neat methyl triflate, including benzene, phosphabenzenes, phosphazenes, and the pentamethylhydrazinium ion, which forms the dipositive ethane analogue, Me(6)N(2)(2+). Methyl carboranes are also surprisingly effective in abstracting hydride from simple alkanes to give isolable carbocation salts, e.g., t-butyl cation. Trialkylsilyl carborane reagents, R(3)Si(carborane), abstract halides from substrates to produce cations of unprecedented reactivity. For example, fluoride is extracted from freons to form carbocations; chloride is extracted from IrCl(CO)(PPh(3))(2) to form a coordinatively unsaturated iridium cation that undergoes oxidative addition with chlorobenzene at room temperature; and silylation of cyclo-N(3)P(3)Cl(6) produces a catalyst for the polymerization of phosphazenes that functions at room temperature. Although currently too expensive for widespread use, carborane reagents are nevertheless of considerable interest as specialty reagents for making reactive cations and catalysts.

  11. An R2R3-MYB Transcription Factor Regulates Capsaicinoid Biosynthesis1[OPEN

    PubMed Central

    Arce-Rodríguez, Magda L.

    2017-01-01

    Capsaicinoids are responsible for the hot taste of chili peppers. They are restricted to the genus Capsicum and are synthesized by the acylation of the aromatic compound vanillylamine (derived from the phenylpropanoid pathway) with a branched-chain fatty acid by the catalysis of the putative enzyme capsaicinoid synthase. R2R3-MYB transcription factors have been reported in different species of plants as regulators of structural genes of the phenylpropanoid pathway; therefore, we hypothesized that MYB genes might be involved in the regulation of the biosynthesis of pungent compounds. In this study, an R2R3-MYB transcription factor gene, designated CaMYB31, was isolated and characterized in Capsicum annuum ‘Tampiqueño 74’. Bioinformatic analysis suggested that CaMYB31 could be involved in secondary metabolism, stress and plant hormone responses, and development. CaMYB31 expression analysis from placental tissue of pungent and nonpungent chili pepper fruits showed a positive correlation with the structural genes Ca4H, Comt, Kas, pAmt, and AT3 expression and also with the content of capsaicin and dihydrocapsacin during fruit development. However, CaMYB31 also was expressed in vegetative tissues (leaves, roots, and stems). Moreover, CaMYB31 silencing significantly reduced the expression of capsaicinoid biosynthetic genes and the capsaicinoid content. Additionally, CaMYB31 expression was affected by the plant hormones indoleacetic acid, jasmonic acid, salicylic acid, and gibberellic acid or by wounding, temperature, and light, factors known to affect the production of capsaicinoids. These findings indicate that CaMYB31 is indeed involved in the regulation of structural genes of the capsaicinoid biosynthetic pathway. PMID:28483879

  12. An R2R3-MYB Transcription Factor Regulates Capsaicinoid Biosynthesis.

    PubMed

    Arce-Rodríguez, Magda L; Ochoa-Alejo, Neftalí

    2017-07-01

    Capsaicinoids are responsible for the hot taste of chili peppers. They are restricted to the genus Capsicum and are synthesized by the acylation of the aromatic compound vanillylamine (derived from the phenylpropanoid pathway) with a branched-chain fatty acid by the catalysis of the putative enzyme capsaicinoid synthase. R2R3-MYB transcription factors have been reported in different species of plants as regulators of structural genes of the phenylpropanoid pathway; therefore, we hypothesized that MYB genes might be involved in the regulation of the biosynthesis of pungent compounds. In this study, an R2R3-MYB transcription factor gene, designated CaMYB31, was isolated and characterized in Capsicum annuum 'Tampiqueño 74'. Bioinformatic analysis suggested that CaMYB31 could be involved in secondary metabolism, stress and plant hormone responses, and development. CaMYB31 expression analysis from placental tissue of pungent and nonpungent chili pepper fruits showed a positive correlation with the structural genes Ca4H, Comt, Kas, pAmt, and AT3 expression and also with the content of capsaicin and dihydrocapsacin during fruit development. However, CaMYB31 also was expressed in vegetative tissues (leaves, roots, and stems). Moreover, CaMYB31 silencing significantly reduced the expression of capsaicinoid biosynthetic genes and the capsaicinoid content. Additionally, CaMYB31 expression was affected by the plant hormones indoleacetic acid, jasmonic acid, salicylic acid, and gibberellic acid or by wounding, temperature, and light, factors known to affect the production of capsaicinoids. These findings indicate that CaMYB31 is indeed involved in the regulation of structural genes of the capsaicinoid biosynthetic pathway. © 2017 American Society of Plant Biologists. All Rights Reserved.

  13. Index theorem for topological excitations on R3 × S1 and Chern-Simons theory

    NASA Astrophysics Data System (ADS)

    Poppitz, Erich; Ünsal, Mithat

    2009-03-01

    We derive an index theorem for the Dirac operator in the background of various topological excitations on an R3 × S1 geometry. The index theorem provides more refined data than the APS index for an instanton on R4 and reproduces it in decompactification limit. In the R3 limit, it reduces to the Callias index theorem. The index is expressed in terms of topological charge and the η-invariant associated with the boundary Dirac operator. Neither topological charge nor η-invariant is typically an integer, however, the non-integer parts cancel to give an integer-valued index. Our derivation is based on axial current non-conservation — an exact operator identity valid on any four-manifold — and on the existence of a center symmetric, or approximately center symmetric, boundary holonomy (Wilson line). We expect the index theorem to usefully apply to many physical systems of interest, such as low temperature (large S1, confined) phases of gauge theories, center stabilized Yang-Mills theories with vector-like or chiral matter (at S1 of any size), and supersymmetric gauge theories with supersymmetry-preserving boundary conditions (also at any S1). In QCD-like and chiral gauge theories, the index theorem should shed light into the nature of topological excitations responsible for chiral symmetry breaking and the generation of mass gap in the gauge sector. We also show that imposing chirally-twisted boundary condition in gauge theories with fermions induces a Chern-Simons term in the infrared. This suggests that some QCD-like gauge theories should possess components with a topological Chern-Simons phase in the small S1 regime.

  14. H+, CH3+ and R3Si+ Carborane Reagents: When Triflates Fail

    PubMed Central

    Reed, Christopher A.

    2009-01-01

    CONSPECTUS For decades, triflic acid, methyl triflate and trialkylsilyl triflate reagents have served synthetic chemistry well as clean, strong electrophilic sources of H+, CH3+ and R3Si+ respectively. However, a number of weakly basic substrates are unreactive towards these reagents. In addition, triflate anion can express undesired nucleophilicity towards electrophilically activated substrates. In this Account, we describe methods that replace triflate-based electrophilic reagents with carborane reagents. Using carborane anions of type CHB11R5X6− (R = H, Me, X; X = Br, Cl) – members of a class of notably inert, weakly nucleophilic anions – instead of triflate significantly increases the electrophilicity of these reagents and shuts down subsequent nucleophilic chemistry of the anion. Thus, H(carborane) acids cleanly protonate benzene, phosphabenzene, C60 etc. while triflic acid does not. Similarly, CH3(carborane) reagents can methylate substrates that are inert to boiling neat methyl triflate, including benzene, phosphabenzenes, phosphazenes, and the pentamethylhydrazinium ion which forms the dipositive ethane analogue, Me6N22+. Methyl carboranes are also surprisingly effective in abstracting hydride from simple alkanes to give isolable carbocation salts e.g. t-butyl cation. Trialkylsilyl carborane reagents, R3Si(carborane), abstract halides from substrates to produce cations of unprecedented reactivity. For example, fluoride is extracted from freons to form carbocations, chloride is extracted from IrCl(CO)(PPh3)2 to form a coordinatively-unsaturated iridium cation that undergoes oxidative addition with chlorobenzene at room temperature, and silylation of cyclo-N3P3Cl6 produces a catalyst for the polymerization of phosphazenes that functions at room temperature. Although currently too expensive for widespread use, carborane reagents are nevertheless of considerable interest as specialty reagents for making reactive cations and catalysts. PMID:19736934

  15. The cysteine-rich domain of human T1R3 is necessary for the interaction between human T1R2-T1R3 sweet receptors and a sweet-tasting protein, thaumatin.

    PubMed

    Ohta, Keisuke; Masuda, Tetsuya; Tani, Fumito; Kitabatake, Naofumi

    2011-03-18

    Thaumatin is an intensely sweet-tasting protein perceived by humans but not rodents. Its threshold value of sweetness in humans is 50nM, the lowest of any sweet-tasting protein. In the present study, the sites where sweet receptors interact with thaumatin were investigated using human embryonic kidney 293 (HEK293) cells expressing the sweet receptors T1R2-T1R3. Chimeric human- mouse sweet receptors were constructed and their responses to sweeteners were investigated. The human (h) T1R2- mouse (m) T1R3 combination responded to sucralose but not to thaumatin, clearly indicating that a T1R3 subunit from humans is necessary for the interaction with thaumatin. Furthermore, results obtained from using chimeric T1R3s showed that the cysteine-rich domain (CRD) of human T1R3 is important for the interaction with thaumatin. The CRD of T1R3 would be a prominent target for designing new sweeteners. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Expression and clinicopathological implication of DcR3 in lung cancer tissues: a tissue microarray study with 365 cases.

    PubMed

    Zhang, Yu; Luo, Jie; He, Rongquan; Huang, Wenting; Li, Zuyun; Li, Ping; Dang, Yiwu; Chen, Gang; Li, Shikang

    2016-01-01

    Decoy receptor 3 (DcR3) has been reported to be involved in different cancers. However, few related researches have been accomplished on the role of DcR3 in lung cancer. To explore the expression level and clinicopathological implication of DcR3 protein in lung cancer tissues. Immunohistochemistry was used to examine DcR3 protein expression in lung cancer (n=365) and normal lung tissues (n=26). The relationships between DcR3 expression and clinical parameters were further investigated. Furthermore, the diagnostic and clinicopathological value of DcR3 mRNA was analyzed based on The Cancer Genome Atlas database in lung cancer patients. Compared to normal lung tissues, DcR3 expression was significantly higher in lung cancer (P=0.007) tissues, including small-cell lung cancer (P=0.001) and non-small-cell lung cancer (P=0.008). In addition, DcR3 expression was related to tumor-node-metastasis (TNM) stage (P<0.001), tumor diameter (P=0.007), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) in lung cancers. When concerning non-small-cell lung cancer, consistent correlations between DcR3 expression and TNM stage (P<0.001), tumor diameter (P=0.019), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) were found. Simultaneously, in small-cell lung cancer, TNM stage (P=0.004) and lymph node metastasis (P=0.005) were also associated with DcR3 expression. Additionally, receiver operator characteristic curve revealed that the area under curve (AUC) of DcR3 was 0.637 (95% confidence interval [CI] 0.531-0.742) for lung cancer. Furthermore, DcR3 was overexpressed in both adenocarcinoma and squamous cell carcinoma tissues than in noncancerous lung tissues (all P<0.0001) based on the data from The Cancer Genome Atlas. AUC of DcR3 was 0.726 (95% CI 0.644-0.788) for lung adenocarcinoma patients and 0.647 (95% CI 0.566-0.728) for squamous cell carcinoma patients. DcR3 expression was also related to the overall survival (P<0.001) and disease-free survival

  17. Expression and clinicopathological implication of DcR3 in lung cancer tissues: a tissue microarray study with 365 cases

    PubMed Central

    Zhang, Yu; Luo, Jie; He, Rongquan; Huang, Wenting; Li, Zuyun; Li, Ping; Dang, Yiwu; Chen, Gang; Li, Shikang

    2016-01-01

    Background Decoy receptor 3 (DcR3) has been reported to be involved in different cancers. However, few related researches have been accomplished on the role of DcR3 in lung cancer. Objective To explore the expression level and clinicopathological implication of DcR3 protein in lung cancer tissues. Materials and methods Immunohistochemistry was used to examine DcR3 protein expression in lung cancer (n=365) and normal lung tissues (n=26). The relationships between DcR3 expression and clinical parameters were further investigated. Furthermore, the diagnostic and clinicopathological value of DcR3 mRNA was analyzed based on The Cancer Genome Atlas database in lung cancer patients. Results Compared to normal lung tissues, DcR3 expression was significantly higher in lung cancer (P=0.007) tissues, including small-cell lung cancer (P=0.001) and non-small-cell lung cancer (P=0.008). In addition, DcR3 expression was related to tumor-node-metastasis (TNM) stage (P<0.001), tumor diameter (P=0.007), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) in lung cancers. When concerning non-small-cell lung cancer, consistent correlations between DcR3 expression and TNM stage (P<0.001), tumor diameter (P=0.019), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) were found. Simultaneously, in small-cell lung cancer, TNM stage (P=0.004) and lymph node metastasis (P=0.005) were also associated with DcR3 expression. Additionally, receiver operator characteristic curve revealed that the area under curve (AUC) of DcR3 was 0.637 (95% confidence interval [CI] 0.531–0.742) for lung cancer. Furthermore, DcR3 was overexpressed in both adenocarcinoma and squamous cell carcinoma tissues than in noncancerous lung tissues (all P<0.0001) based on the data from The Cancer Genome Atlas. AUC of DcR3 was 0.726 (95% CI 0.644–0.788) for lung adenocarcinoma patients and 0.647 (95% CI 0.566–0.728) for squamous cell carcinoma patients. DcR3 expression was also related to

  18. The role of T1r3 and Trpm5 in carbohydrate-induced obesity in mice.

    PubMed

    Glendinning, John I; Gillman, Jennifer; Zamer, Haley; Margolskee, Robert F; Sclafani, Anthony

    2012-08-20

    We examined the role of T1r3 and Trpm5 taste signaling proteins in carbohydrate-induced overeating and obesity. T1r3, encoded by Tas1r3, is part of the T1r2+T1r3 sugar taste receptor, while Trpm5 mediates signaling for G protein-coupled receptors in taste cells. It is known that C57BL/6 wild-type (WT) mice are attracted to the tastes of both Polycose (a glucose polymer) and sucrose, whereas Tas1r3 KO mice are attracted to the taste of Polycose but not sucrose. In contrast, Trpm5 KO mice are not attracted to the taste of sucrose or Polycose. In Experiment 1, we maintained the WT, Tas1r3 KO and Trpm5 KO mice on one of three diets for 38days: lab chow plus water (Control diet); chow, water and 34% Polycose solution (Polycose diet); or chow, water and 34% sucrose solution (Sucrose diet). The WT and Tas1r3 KO mice overconsumed the Polycose diet and became obese. The WT and Tas1r3 KO mice also overconsumed the Sucrose diet, but only the WT mice became obese. The Trpm5 KO mice, in contrast, showed little or no overeating on the Sucrose and Polycose diets, and gained less weight than WT mice on these diets. In Experiment 2, we asked whether the Tas1r3 KO mice exhibited impaired weight gain on the Sucrose diet because it was insipid. To test this hypothesis, we maintained the WT and Tas1r3 KO mice on one of two diets for 38 days: chow, water and a dilute (1%) but highly palatable Intralipid emulsion (Control diet); or chow, water and a 34% sucrose+1% Intralipid solution (Suc+IL diet). The WT and Tas1r3 KO mice both exhibited little or no overeating but became obese on the Suc+IL diet. Our results suggest that nutritive solutions must be highly palatable to cause carbohydrate-induced obesity in mice, and that palatability produces this effect in part by enhancing nutrient utilization. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. The role of T1r3 and Trpm5 in carbohydrate-induced obesity in mice

    PubMed Central

    Glendinning, John I.; Gillman, Jennifer; Zamer, Haley; Margolskee, Robert F.; Sclafani, Anthony

    2012-01-01

    We examined the role of T1r3 and Trpm5 taste signaling proteins in carbohydrate-induced overeating and obesity. T1r3, encoded by Tas1r3, is part of the T1r2+T1r3 sugar taste receptor, while Trpm5 mediates signaling for G protein-coupled receptors in taste cells. It is known that C57BL/6 wild-type (WT) and Tas1r3 knock-out (KO) mice are attracted to the taste of Polycose (a glucose polymer), but not sucrose. In contrast, Trpm5 KO mice are not attracted to the taste of sucrose or Polycose. In Experiment 1, we maintained the WT, Tas1r3 KO and Trpm5 KO mice on one of three diets for 38 days: lab chow plus water (Control diet); chow, water and 34% Polycose solution (Polycose diet); or chow, water and 34% sucrose solution (Sucrose diet). The WT and Tas1r3 KO mice overconsumed the Polycose diet and became obese. The WT and Tas1r3 KO mice also overconsumed the Sucrose diet, but only the WT mice became obese. The Trpm5 KO mice, in contrast, showed little or no overeating on the Sucrose and Polycose diets, and gained slightly or significantly less weight than WT mice on these diets. In Experiment 2, we asked whether the Tas1r3 KO mice exhibited impaired weight gain on the Sucrose diet because it was insipid. To test this hypothesis, we maintained the WT and Tas1r3 KO mice on one of two diets for 38 days: chow, water and a dilute (1%) but highly palatable Intralipid emulsion (Control diet); or chow, water and a 34% sucrose + 1% Intralipid solution (Suc+IL diet). The WT and Tas1r3 KO mice both gained weight and became obese on the Suc+IL diet. Our results suggest that nutritive solutions must be highly palatable to cause carbohydrate-induced obesity in mice, and that palatability produces this effect in part by enhancing nutrient utilization. PMID:22683548

  20. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  1. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures

    PubMed Central

    Rahrig, Ryan R.; Petrov, Anton I.; Leontis, Neocles B.; Zirbel, Craig L.

    2013-01-01

    The R3D Align web server provides online access to ‘RNA 3D Align’ (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  2. About the Clusters Program

    EPA Pesticide Factsheets

    The Environmental Technology Innovation Clusters Program advises cluster organizations, encourages collaboration between clusters, tracks U.S. environmental technology clusters, and connects EPA programs to cluster needs.

  3. Global smooth solutions in R3 to short wave-long wave interactions in magnetohydrodynamics

    NASA Astrophysics Data System (ADS)

    Frid, Hermano; Jia, Junxiong; Pan, Ronghua

    2017-04-01

    We consider a Benney-type system modeling short wave-long wave interactions in compressible viscous fluids under the influence of a magnetic field. Accordingly, this large system now consists of the compressible MHD equations coupled with a nonlinear Schrödinger equation along particle paths. We study the global existence of smooth solutions to the Cauchy problem in R3 when the initial data are small smooth perturbations of an equilibrium state. An important point here is that, instead of the simpler case having zero as the equilibrium state for the magnetic field, we consider an arbitrary non-zero equilibrium state B bar for the magnetic field. This is motivated by applications, e.g., Earth's magnetic field, and the lack of invariance of the MHD system with respect to either translations or rotations of the magnetic field. The usual time decay investigation through spectral analysis in this non-zero equilibrium case meets serious difficulties, for the eigenvalues in the frequency space are no longer spherically symmetric. Instead, we employ a recently developed technique of energy estimates involving evolution in negative Besov spaces, and combine it with the particular interplay here between Eulerian and Lagrangian coordinates.

  4. Microtubule-Binding R3 Fragment from Tau Self-Assembles into Giant Multistranded Amyloid Ribbons.

    PubMed

    Adamcik, Jozef; Sánchez-Ferrer, Antoni; Ait-Bouziad, Nadine; Reynolds, Nicholas P; Lashuel, Hilal A; Mezzenga, Raffaele

    2016-01-11

    Tau protein and its fragments self-assemble into amyloid fibrils in the presence of polyanions, such as heparin. By combining microscopy, scattering, and spectroscopy techniques, we studied the aggregation of the 26-mer Tau-derived peptide alone, Tau(306-327), the third repeat fragment (R3) of the microtubule-binding domain. We show that: i) the sole Tau(306-327) can self-assemble into amyloid fibrils without the need of aggregation-promoting polyanions; ii) the resulting structures consist of surprisingly large, well-ordered 2D laminated flat ribbons, with a log-normal distribution of the lateral width, reaching the unprecedented lateral size of 350 nm and/or 45 individual protofilaments, that is, the largest amyloid laminated structures ever observed for Tau or any other amyloidogenic sequence. Our results provide insight into the molecular determinants of Tau aggregation and open new perspectives in the understanding of the assembly of amyloid fibrils and β-sheet-based biomaterials. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers.

    PubMed

    Sagawa, Janelle M; Stanley, Lauren E; LaFountain, Amy M; Frank, Harry A; Liu, Chang; Yuan, Yao-Wu

    2016-02-01

    Carotenoids are yellow, orange, and red pigments that contribute to the beautiful colors and nutritive value of many flowers and fruits. The structural genes in the highly conserved carotenoid biosynthetic pathway have been well characterized in multiple plant systems, but little is known about the transcription factors that control the expression of these structural genes. By analyzing a chemically induced mutant of Mimulus lewisii through bulk segregant analysis and transgenic experiments, we have identified an R2R3-MYB, Reduced Carotenoid Pigmentation 1 (RCP1), as the first transcription factor that positively regulates carotenoid biosynthesis during flower development. Loss-of-function mutations in RCP1 lead to down-regulation of all carotenoid biosynthetic genes and reduced carotenoid content in M. lewisii flowers, a phenotype recapitulated by RNA interference in the wild-type background. Overexpression of this gene in the rcp1 mutant background restores carotenoid production and, unexpectedly, results in simultaneous decrease of anthocyanin production in some transgenic lines by down-regulating the expression of an activator of anthocyanin biosynthesis. Identification of transcriptional regulators of carotenoid biosynthesis provides the 'toolbox' genes for understanding the molecular basis of flower color diversification in nature and for potential enhancement of carotenoid production in crop plants via genetic engineering.

  6. Expression and Purification of Functional Ligand-binding Domains of T1R3 Taste Receptors

    SciTech Connect

    Nie,Y.; Hobbs, J.; Vigues, S.; Olson, W.; Conn, G.; Munger, S.

    2006-01-01

    Chemosensory receptors, including odor, taste, and vomeronasal receptors, comprise the largest group of G protein-coupled receptors (GPCRs) in the mammalian genome. However, little is known about the molecular determinants that are critical for the detection and discrimination of ligands by most of these receptors. This dearth of understanding is due in part to difficulties in preparing functional receptors suitable for biochemical and biophysical analyses. Here we describe in detail two strategies for the expression and purification of the ligand-binding domain of T1R taste receptors, which are constituents of the sweet and umami taste receptors. These class C GPCRs contain a large extracellular N-terminal domain (NTD) that is the site of interaction with most ligands and that is amenable to expression as a separate polypeptide in heterologous cells. The NTD of mouse T1R3 was expressed as two distinct fusion proteins in Escherichia coli and purified by column chromatography. Spectroscopic analysis of the purified NTD proteins shows them to be properly folded and capable of binding ligands. This methodology should not only facilitate the characterization of T1R ligand interactions but may also be useful for dissecting the function of other class C GPCRs such as the large family of orphan V2R vomeronasal receptors.

  7. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB.

    PubMed

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D; Smith, Steven W; Ordway, Jared M; Martienssen, Robert A; Sambanthamurthi, Ravigadevi

    2014-06-30

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the virescens (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis production of anthocyanin pigment1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock's C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material.

  8. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation

    PubMed Central

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L−1 h−1, was seen for phosphate-limitation. PMID:26347729

  9. The equilibrium points in the perturbed R3BP with triaxial and luminous primaries

    NASA Astrophysics Data System (ADS)

    Singh, Jagadish

    2013-07-01

    This study explores the effects of small perturbations in the Coriolis and centrifugal forces, radiation pressures and triaxiality of the two stars (primaries) on the position and stability of an infinitesimal mass (third body) in the framework of the planar circular restricted three-body problem (R3BP). it is observed that the positions of the usual five (three collinear and two triangular) equilibrium points are affected by the radiation, triaxiality and a small perturbation in the centrifugal force, but are unaffected by that of the Coriolis force. The collinear points are found to remain unstable, while the triangular points are seen to be stable for 0< μ< μ c and unstable for μc ≤μ≤1/2, where μ c is the critical mass ratio influenced by the small perturbations in the Coriolis and centrifugal forces, radiation and triaxiality. It is also noticed that the former one and all the latter three posses stabilizing and destabilizing behavior respectively. Therefore, the overall effect is that the size of the region of stability decreases with increase in the values of the parameters involved.

  10. R3 Index for Four-Dimensional N =2 Field Theories

    NASA Astrophysics Data System (ADS)

    Alexandrov, Sergei; Moore, Gregory W.; Neitzke, Andrew; Pioline, Boris

    2015-03-01

    In theories with N =2 supersymmetry on R3 ,1, supersymmetric bound states can decay across walls of marginal stability in the space of Coulomb branch parameters, leading to discontinuities in the BPS indices Ω (γ ,u ) . We consider a supersymmetric index I which receives contributions from 1 /2 -BPS states, generalizing the familiar Witten index Tr (-1 )Fe-β H . We expect I to be smooth away from loci where massless particles appear, thanks to contributions from the continuum of multiparticle states. Taking inspiration from a similar phenomenon in the hypermultiplet moduli space of N =2 string vacua, we conjecture a formula expressing I in terms of the BPS indices Ω (γ ,u ), which is continuous across the walls and exhibits the expected contributions from single particle states at large β . This gives a universal prediction for the contributions of multiparticle states to the index I . This index is naturally a function on the moduli space after reduction on a circle, closely related to the canonical hyperkähler metric and hyperholomorphic connection on this space.

  11. Poly[(R)-3-hydroxybutyrate] production under different salinity conditions by a novel Bacillus megaterium strain.

    PubMed

    Rodríguez-Contreras, Alejandra; Koller, Martin; Braunegg, Gerhart; Marqués-Calvo, María Soledad

    2016-01-25

    Bacillus megaterium uyuni S29, isolated from the Bolivian salt lake Uyuni, displays a high capability to produce poly[(R)-3-hydroxybutyrate] (PHB) in industrial culture media. In order to analyze the influence of salt on biomass formation and PHB production, cultivations at different NaCl concentrations were carried out according to the salinity conditions of the habitats of the strain's original isolation. In this preliminary report, the strain showed considerable adaptability to media of different salinity, obtaining the best results for both cellular growth and PHB production in media containing 45 g/L NaCl. The strain grew at 100 g/L NaCl and PHB production was observed even at high salt levels of 250 g/L without unwanted concurrent spore formation. Its tolerance to high salt concentrations together with auspicious PHB productivity makes this strain appealing not only for PHB production, but also for other biotechnological applications such as the treatment of salty wastewater; additional studies will be needed to further increase PHB productivity. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. T1r3 taste receptor involvement in gustatory neural responses to ethanol and oral ethanol preference

    PubMed Central

    Norman, Meghan B.; Lemon, Christian H.

    2010-01-01

    Elevated alcohol consumption is associated with enhanced preference for sweet substances across species and may be mediated by oral alcohol-induced activation of neurobiological substrates for sweet taste. Here, we directly examined the contribution of the T1r3 receptor protein, important for sweet taste detection in mammals, to ethanol intake and preference and the neural processing of ethanol taste by measuring behavioral and central neurophysiological responses to oral alcohol in T1r3 receptor-deficient mice and their C57BL/6J background strain. T1r3 knockout and wild-type mice were tested in behavioral preference assays for long-term voluntary intake of a broad concentration range of ethanol, sucrose, and quinine. For neurophysiological experiments, separate groups of mice of each genotype were anesthetized, and taste responses to ethanol and stimuli of different taste qualities were electrophysiologically recorded from gustatory neurons in the nucleus of the solitary tract. Mice lacking the T1r3 receptor were behaviorally indifferent to alcohol (i.e., ∼50% preference values) at concentrations typically preferred by wild-type mice (5–15%). Central neural taste responses to ethanol in T1r3-deficient mice were significantly lower compared with C57BL/6J controls, a strain for which oral ethanol stimulation produced a concentration-dependent activation of sweet-responsive NTS gustatory neurons. An attenuated difference in ethanol preference between knockouts and controls at concentrations >15% indicated that other sensory and/or postingestive effects of ethanol compete with sweet taste input at high concentrations. As expected, T1r3 knockouts exhibited strongly suppressed behavioral and neural taste responses to sweeteners but did not differ from wild-type mice in responses to prototypic salt, acid, or bitter stimuli. These data implicate the T1r3 receptor in the sensory detection and transduction of ethanol taste. PMID:20145204

  13. The cytoplasmic domain of TGFβR3 through its interaction with the scaffolding protein, GIPC, directs epicardial cell behavior.

    PubMed

    Sánchez, Nora S; Hill, Cynthia R; Love, Joseph D; Soslow, Jonathan H; Craig, Evisabel; Austin, Anita F; Brown, Christopher B; Czirok, Andras; Camenisch, Todd D; Barnett, Joey V

    2011-10-15

    The epicardium is a major contributor of the cells that are required for the formation of coronary vessels. Mice lacking both copies of the gene encoding the Type III Transforming Growth Factor β Receptor (TGFβR3) fail to form the coronary vasculature, but the molecular mechanism by which TGFβR3 signals coronary vessel formation is unknown. We used intact embryos and epicardial cells from E11.5 mouse embryos to reveal the mechanisms by which TGFβR3 signals and regulates epicardial cell behavior. Analysis of E13.5 embryos reveals a lower rate of epicardial cell proliferation and decreased epicardially derived cell invasion in Tgfbr3(-/-) hearts. Tgfbr3(-/-) epicardial cells in vitro show decreased proliferation and decreased invasion in response to TGFβ1 and TGFβ2. Unexpectedly, loss of TGFβR3 also decreases responsiveness to two other important regulators of epicardial cell behavior, FGF2 and HMW-HA. Restoring full length TGFβR3 in Tgfbr3(-/-) cells rescued deficits in invasion in vitro in response TGFβ1 and TGFβ2 as well as FGF2 and HMW-HA. Expression of TGFβR3 missing the 3 C-terminal amino acids that are required to interact with the scaffolding protein GIPC1 did not rescue any of the deficits. Overexpression of GIPC1 alone in Tgfbr3(-/-) cells did not rescue invasion whereas knockdown of GIPC1 in Tgfbr3(+/+) cells decreased invasion in response to TGFβ2, FGF2, and HMW-HA. We conclude that TGFβR3 interaction with GIPC1 is critical for regulating invasion and growth factor responsiveness in epicardial cells and that dysregulation of epicardial cell proliferation and invasion contributes to failed coronary vessel development in Tgfbr3(-/-) mice. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. The cytoplasmic domain of TGFβR3 through its interaction with the scaffolding protein, GIPC, directs epicardial cell behavior

    PubMed Central

    Sánchez, Nora S.; Hill, Cynthia R.; Love, Joseph D.; Soslow, Jonathan H.; Craig, Evisabel; Austin, Anita F.; Brown, Christopher B.; Czirok, Andras; Camenisch, Todd D.; Barnett, Joey V.

    2011-01-01

    The epicardium is a major contributor of the cells that are required for the formation of coronary vessels. Mice lacking both copies of the gene encoding the Type III Transforming Growth Factor β Receptor (TGFβR3) fail to form the coronary vasculature, but the molecular mechanism by which TGFβR3 signals coronary vessel formation is unknown. We used intact embryos and epicardial cells from E11.5 mouse embryos to reveal the mechanisms by which TGFβR3 signals and regulates epicardial cell behavior. Analysis of E13.5 embryos reveals a lower rate of epicardial cell proliferation and decreased epicardially-derived cell invasion in Tgfbr3−/− hearts. Tgfbr3−/− epicardial cells in vitro show decreased proliferation and decreased invasion in response to TGFβ1 and TGFβ2. Unexpectedly, loss of TGFβR3 also decreases responsiveness to two other important regulators of epicardial cell behavior, FGF2 and HMW-HA. Restoring full length TGFβR3 in Tgfbr3−/− cells rescued deficits in invasion in vitro in response TGFβ1 and TGFβ2 as well as FGF2 and HMW-HA. Expression of TGFβR3 missing the 3 C-terminal amino acids that are required to interact with the scaffolding protein GIPC1 did not rescue any of the deficits. Overexpression of GIPC1 alone in Tgfbr3−/− cells did not rescue invasion whereas knockdown of GIPC1 in Tgfbr3+/+ cells decreased invasion in response to TGFβ2, FGF2, and HMW-HA. We conclude that TGFβR3 interaction with GIPC1 is critical for regulating invasion and growth factor responsiveness in epicardial cells and that dysregulation of epicardial cell proliferation and invasion contributes to failed coronary vessel development in Tgfbr3−/− mice. PMID:21871877

  15. Activation of the sweet taste receptor, T1R3, by the artificial sweetener sucralose regulates the pulmonary endothelium.

    PubMed

    Harrington, Elizabeth O; Vang, Alexander; Braza, Julie; Shil, Aparna; Chichger, Havovi

    2017-09-28

    A hallmark of acute respiratory distress syndrome (ARDS) is pulmonary vascular permeability. In these settings, loss of barrier integrity is mediated by cell-contact disassembly and actin-remodelling. Studies into molecular mechanisms responsible for improving microvascular barrier function are therefore vital in the development of therapeutic targets for reducing vascular permeability in ARDS. The sweet taste receptor, T1R3 is a GPCR, activated following exposure to sweet molecules, to trigger a gustducin-dependent signal cascade. In recent years, extraoral locations for T1R3 have been identified however, no studies have focused on T1R3 within the vasculature. We hypothesise that activation of T1R3, in the pulmonary vasculature, plays a role in regulating endothelial barrier function in settings of ARDS. Our study demonstrated expression of T1R3 within the pulmonary vasculature, with a drop in expression levels following exposure to barrier disruptive agents. Exposure of lung microvascular endothelial cells to the intensely sweet molecule, sucralose, attenuated LPS- and thrombin-induced endothelial barrier dysfunction. Likewise, sucralose exposure attenuated bacteria-induced lung edema formation in vivo. Inhibition of sweet taste signalling, through zinc sulfate, T1R3 or G-protein siRNA, blunted the protective effects of sucralose on the endothelium. Sucralose significantly reduced LPS-induced increased expression or phosphorylation of key signalling molecules, Src, PAK, MLC2, HSP27 and p110αPI3K. Activation of T1R3, by sucralose, protects the pulmonary endothelium from edemagenic-agent-induced barrier disruption, potentially through abrogation of Src/PAK/p110αPI3K-mediated cell-contact disassembly and Src/MLC2/HSP27-mediated actin-remodelling. Identification of sweet taste sensing in the pulmonary vasculature may represent a novel therapeutic target to protect the endothelium in settings of ARDS. Copyright © 2016, American Journal of Physiology-Lung Cellular

  16. Genome-wide identification and characterisation of R2R3-MYB genes in sugar beet (Beta vulgaris).

    PubMed

    Stracke, Ralf; Holtgräwe, Daniela; Schneider, Jessica; Pucker, Boas; Sörensen, Thomas Rosleff; Weisshaar, Bernd

    2014-09-25

    The R2R3-MYB genes comprise one of the largest transcription factor gene families in plants, playing regulatory roles in plant-specific developmental processes, metabolite accumulation and defense responses. Although genome-wide analysis of this gene family has been carried out in some species, the R2R3-MYB genes in Beta vulgaris ssp. vulgaris (sugar beet) as the first sequenced member of the order Caryophyllales, have not been analysed heretofore. We present a comprehensive, genome-wide analysis of the MYB genes from Beta vulgaris ssp. vulgaris (sugar beet) which is the first species of the order Caryophyllales with a sequenced genome. A total of 70 R2R3-MYB genes as well as genes encoding three other classes of MYB proteins containing multiple MYB repeats were identified and characterised with respect to structure and chromosomal organisation. Also, organ specific expression patterns were determined from RNA-seq data. The R2R3-MYB genes were functionally categorised which led to the identification of a sugar beet-specific clade with an atypical amino acid composition in the R3 domain, putatively encoding betalain regulators. The functional classification was verified by experimental confirmation of the prediction that the R2R3-MYB gene Bv_iogq encodes a flavonol regulator. This study provides the first step towards cloning and functional dissection of the role of MYB transcription factor genes in the nutritionally and evolutionarily interesting species B. vulgaris. In addition, it describes the flavonol regulator BvMYB12, being the first sugar beet R2R3-MYB with an experimentally proven function.

  17. Contribution of the T1r3 taste receptor to the response properties of central gustatory neurons.

    PubMed

    Lemon, Christian H; Margolskee, Robert F

    2009-05-01

    T1r3 is a critical subunit of T1r sweet taste receptors. Here we studied how the absence of T1r3 impacts responses to sweet stimuli by taste neurons in the nucleus tractus solitarius (NTS) of the mouse. The consequences bear on the multiplicity of sweet taste receptors and how T1r3 influences the distribution of central gustatory neurons. Taste responses to glycine, sucrose, NaCl, HCl, and quinine were electrophysiologically recorded from single NTS neurons in anesthetized T1r3 knockout (KO) and wild-type (WT) C57BL/6 mice. Other stimuli included l-proline, d-fructose, d-glucose, d-sorbitol, Na-saccharin, acesulfame-K, monosodium glutamate, NaNO(3), Na-acetate, citric acid, KCl, denatonium, and papaverine. Forty-one WT and 41 KO neurons were recorded. Relative to WT, KO responses to all sweet stimuli were significantly lower, although the degree of attenuation differed among stimuli, with near zero responses to sugars but salient residual activity to artificial sweeteners and glycine. Residual KO across-neuron responses to sweet stimuli were variably similar to nonsweet responses, as indexed by multivariate and correlation analyses. In some cases, this suggested that residual KO activity to "sweet" stimuli could be mediated by nonsweet taste receptors, implicating T1r3 receptors as primary contributors to NTS sweet processing. The influence of T1r3 on the distribution of NTS neurons was evaluated by comparing neuron types that emerged between WT and KO cells. Neurons tuned toward sweet stimuli composed 34% of the WT sample but did not appear among KO cells. Input from T1r3-containing receptors critically guides the normal development of NTS neurons oriented toward sweet tastants.

  18. T1r3 taste receptor involvement in gustatory neural responses to ethanol and oral ethanol preference.

    PubMed

    Brasser, Susan M; Norman, Meghan B; Lemon, Christian H

    2010-05-01

    Elevated alcohol consumption is associated with enhanced preference for sweet substances across species and may be mediated by oral alcohol-induced activation of neurobiological substrates for sweet taste. Here, we directly examined the contribution of the T1r3 receptor protein, important for sweet taste detection in mammals, to ethanol intake and preference and the neural processing of ethanol taste by measuring behavioral and central neurophysiological responses to oral alcohol in T1r3 receptor-deficient mice and their C57BL/6J background strain. T1r3 knockout and wild-type mice were tested in behavioral preference assays for long-term voluntary intake of a broad concentration range of ethanol, sucrose, and quinine. For neurophysiological experiments, separate groups of mice of each genotype were anesthetized, and taste responses to ethanol and stimuli of different taste qualities were electrophysiologically recorded from gustatory neurons in the nucleus of the solitary tract. Mice lacking the T1r3 receptor were behaviorally indifferent to alcohol (i.e., ∼50% preference values) at concentrations typically preferred by wild-type mice (5-15%). Central neural taste responses to ethanol in T1r3-deficient mice were significantly lower compared with C57BL/6J controls, a strain for which oral ethanol stimulation produced a concentration-dependent activation of sweet-responsive NTS gustatory neurons. An attenuated difference in ethanol preference between knockouts and controls at concentrations >15% indicated that other sensory and/or postingestive effects of ethanol compete with sweet taste input at high concentrations. As expected, T1r3 knockouts exhibited strongly suppressed behavioral and neural taste responses to sweeteners but did not differ from wild-type mice in responses to prototypic salt, acid, or bitter stimuli. These data implicate the T1r3 receptor in the sensory detection and transduction of ethanol taste.

  19. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  20. Sucrose-conditioned flavor preferences in sweet ageusic T1r3 and Calhm1 knockout mice.

    PubMed

    Sclafani, Anthony; Marambaud, Philippe; Ackroff, Karen

    2014-03-14

    The present study compared the ability of sweet ageusic T1r3 knockout (KO) and Calhm1 KO mice to acquire preferences for a sucrose-paired flavor as well as for unflavored sucrose. The KO and wildtype (WT) mice were given 24-h one-bottle access to 8% sucrose containing one flavor CS+, e.g., grape) and to water containing a different flavor (CS-, e.g., cherry) over 4 training days. In subsequent two-bottle tests with the flavors in water only, the T1r3 KO and Calhm1 KO mice, like WT mice, preferred the CS+ to the CS-. After training with flavored solutions, both KO groups also preferred unflavored 8% sucrose to water although Calhm1 KO mice required more sugar experience to match the preference of the T1r3 KO mice. These findings demonstrate that Calhm1 KO mice, like T1r3 KO mice and WT mice, are sensitive to the post-oral preference conditioning actions of sucrose and can discriminate sugar from water. Yet, despite their acquired sucrose preferences, the Calhm1 KO and T1r3 KO mice consumed only half as much sugar per day as did WT mice. Thus, sweet taste signaling elements are not needed in the gut for sugar conditioning, but sweet taste signaling in the mouth is essential for the full expression of sugar appetite.

  1. Human genetic polymorphisms in T1R1 and T1R3 taste receptor subunits affect their function.

    PubMed

    Raliou, Mariam; Grauso, Marta; Hoffmann, Brice; Schlegel-Le-Poupon, Claire; Nespoulous, Claude; Débat, Hélène; Belloir, Christine; Wiencis, Anna; Sigoillot, Maud; Bano, Singh Preet; Trotier, Didier; Pernollet, Jean-Claude; Montmayeur, Jean-Pierre; Faurion, Annick; Briand, Loïc

    2011-07-01

    Umami is the typical taste induced by monosodium glutamate (MSG), which is thought to be detected by the heterodimeric G protein-coupled receptor, T1R1 and T1R3. Previously, we showed that MSG detection thresholds differ substantially between individuals and we further showed that nontaster and hypotaster subjects are associated with nonsynonymous single polymorphisms occurring in the T1R1 and T1R3 genes. Here, we show using functional expression that both amino acid substitutions (A110V and R507Q) in the N-terminal ligand-binding domain of T1R1 and the 2 other ones (F749S and R757C), located in the transmembrane domain of T1R3, severely impair in vitro T1R1/T1R3 response to MSG. A molecular model of the ligand-binding region of T1R1/T1R3 provides a mechanistic explanation supporting functional expression data. The data presented here support causal relations between the genotype and previous in vivo psychophysical studies in human evaluating sensitivity to MSG. © The Author 2011. Published by Oxford University Press. All rights reserved.

  2. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    PubMed Central

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  3. Searching for AdS3 waves and asymptotically Lifshitz black holes in R3 new massive gravity

    NASA Astrophysics Data System (ADS)

    Anastasiou, Giorgos G.; Setare, M. R.; Vagenas, Elias C.

    2013-09-01

    In this paper, we consider the structure of the AdS3 vacua in R3 expansion of new massive gravity (R3-NMG). We obtain the degeneracies of the AdS3 vacua at several points of the parametric space. Additionally, following a specific analysis we show that AdS3 wave solutions are present. Using these wave solutions, we single out two special points of the parametric space for which logarithmic terms appear in the solutions. The first one is a point at which the effective mass of the wave profile, which is interpreted as a scalar mode, completely saturates the Breitenlohner-Freedman bound of the AdS3 space in which the wave is propagating. The second special point is a point at which the central charge of the theory vanishes. Furthermore, we investigate the possibility of asymptotically Lifshitz black hole solutions to be present in the three-dimensional R3-NMG. We derive analytically the Lifshitz vacua considering specific relations between the mass parameters of R3-NMG. A certain polynomial equation arises at the first special point where solutions with logarithmic falloff in the AdS3 space appear. Solving this polynomial equation, we obtain the values of the dynamical exponent z which correspond to possible asymptotically Lifshitz black hole solutions. However, it is shown that asymptotically Lifshitz black hole solutions do not exist in the three-dimensional R3-NMG for a specific ansatz of the black hole metric.

  4. Forbidden Zones for Circular Regular Orbits of the Moons in Solar System, R3BP

    NASA Astrophysics Data System (ADS)

    Ershkov, Sergey V.

    2017-03-01

    Previously, we have considered the equations of motion of the three-body problem in a Lagrange form (which means a consideration of relative motions of 3-bodies in regard to each other). Analysing such a system of equations, we considered the case of small-body motion of negligible mass m 3 around the second of two giant-bodies m 1, m 2 ( which are rotating around their common centre of masses on Kepler's trajectories), the mass of which is assumed to be less than the mass of central body. In the current development, we have derived a key parameter η that determines the character of quasi-circular motion of the small third body m 3 relative to the second body m 2 (planet). Namely, by making several approximations in the equations of motion of the three-body problem, such the system could be reduced to the key governing Riccati-type ordinary differential equations. Under assumptions of R3BP (restricted three-body problem), we additionally note that Riccati-type ODEs above should have the invariant form if the key governing (dimensionless) parameter η remains in the range 10-2[InlineMediaObject not available: see fulltext.] 10-3. Such an amazing fact let us evaluate the forbidden zones for Moon's orbits in the inner solar system or the zones of distances ( between Moon and Planet) for which the motion of small body could be predicted to be unstable according to basic features of the solutions of Riccati-type.

  5. Optimal Decay Rate of the Compressible Navier-Stokes-Poisson System in {mathbb {R}^3}

    NASA Astrophysics Data System (ADS)

    Li, Hai-Liang; Matsumura, Akitaka; Zhang, Guojing

    2010-05-01

    The compressible Navier-Stokes-Poisson (NSP) system is considered in {mathbb {R}^3} in the present paper, and the influences of the electric field of the internal electrostatic potential force governed by the self-consistent Poisson equation on the qualitative behaviors of solutions is analyzed. It is observed that the rotating effect of electric field affects the dispersion of fluids and reduces the time decay rate of solutions. Indeed, we show that the density of the NSP system converges to its equilibrium state at the same L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 respectively as the compressible Navier-Stokes system, but the momentum of the NSP system decays at the L 2-rate {(1+t)^{-frac {1}{4}}} or L ∞-rate (1 + t)-1 respectively, which is slower than the L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 for compressible Navier-Stokes system [Duan et al., in Math Models Methods Appl Sci 17:737-758, 2007; Liu and Wang, in Comm Math Phys 196:145-173, 1998; Matsumura and Nishida, in J Math Kyoto Univ 20:67-104, 1980] and the L ∞-rate (1 + t)- p with {p in (1, 3/2)} for irrotational Euler-Poisson system [Guo, in Comm Math Phys 195:249-265, 1998]. These convergence rates are shown to be optimal for the compressible NSP system.

  6. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis spp.

    PubMed

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-05-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp.

  7. (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) induces hyperketonemiain Alzheimer’s disease

    PubMed Central

    Chu, Chang-Biao; Jiao, Li-Dong

    2015-01-01

    The present study demonstrates the effect of (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) on hyperketonemia in 2 patients with Alzheimer’s disease dementia who were performed a mini-mental state examination score of above 11 and 10. The patients were treated with OBHB for 24 months and received usual diet. The patients were administered 15 g of OBHB three times per day for two days. The dosage of OBHB was increased to 30 g three times daily from the day 4. OBHB was always taken after adding with soda-flavoured syrups in order to mask the bitter taste. The measurement of plasma β-hydroxybutyrate (βHB) levels after every week was performed to determine OBHB plasma βHB dose-response relationships. Precision Xtra Glucose and Ketone Monitoring System (Abbott Diabetes Care, Inc., Alameda, CA, USA) was used to measure βHB levels in the blood samples. We did not observe any adverse effects of OBHB in any of the patients and it was well tolerated throughout the 24 months treatment period. Both of the patients showed marked improvement in mood, behaviour, self-care, cognitive and daily activity performance. The results revealed a marked improvement in conversation and interaction after administration of OBHB doses. The biochemical investigation of the blood samples before, during OBHB treatment and after 24 months of the treatment revealed only minor changes in the plasma lipids. There was a decrease in cholesterol level from 251 to 158 and 247 to 152 mg/dL in the two patients respectively after 24 months of the treatment. Similarly the level of high-density lipoprotein cholesterol was found to decrease from 157 to 79 and 149 to 76 mg/dL, respectively in two patients. Thus OBHB can be a promising agent in the treatment of hyperketonemia and can be taken as an oral supplement without changing the habitual diet. PMID:26221318

  8. The Role of Short-Chain Conjugated Poly-(R)-3-Hydroxybutyrate (cPHB) in Protein Folding

    PubMed Central

    Reusch, Rosetta N.

    2013-01-01

    Poly-(R)-3-hydroxybutyrate (PHB), a linear polymer of R-3-hydroxybutyrate (R-3HB), is a fundamental constituent of biological cells. Certain prokaryotes accumulate PHB of very high molecular weight (10,000 to >1,000,000 residues), which is segregated within granular deposits in the cytoplasm; however, all prokaryotes and all eukaryotes synthesize PHB of medium-chain length (~100–200 residues) which resides within lipid bilayers or lipid vesicles, and PHB of short-chain length (<12 residues) which is conjugated to proteins (cPHB), primarily proteins in membranes and organelles. The physical properties of cPHB indicate it plays important roles in the targeting and folding of cPHB-proteins. Here we review the occurrence, physical properties and molecular characteristics of cPHB, and discuss its influence on the folding and structure of outer membrane protein A (OmpA) of Escherichia coli. PMID:23702844

  9. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.

    PubMed

    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi

    2014-06-01

    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3.

  10. Electronic, elastic and optical properties of divalent (R+2X) and trivalent (R+3X) rare earth monochalcogenides

    NASA Astrophysics Data System (ADS)

    Kumar, V.; Chandra, S.; Singh, J. K.

    2017-08-01

    Based on plasma oscillations theory of solids, simple relations have been proposed for the calculation of bond length, specific gravity, homopolar energy gap, heteropolar energy gap, average energy gap, crystal ionicity, bulk modulus, electronic polarizability and dielectric constant of rare earth divalent R+2X and trivalent R+3X monochalcogenides. The specific gravity of nine R+2X, twenty R+3X, and bulk modulus of twenty R+3X monochalcogenides have been calculated for the first time. The calculated values of all parameters are compared with the available experimental and the reported values. A fairly good agreement has been obtained between them. The average percentage deviation of two parameters: bulk modulus and electronic polarizability for which experimental data are known, have also been calculated and found to be better than the earlier correlations.

  11. Electronic, elastic and optical properties of divalent (R+2X) and trivalent (R+3X) rare earth monochalcogenides

    NASA Astrophysics Data System (ADS)

    Kumar, V.; Chandra, S.; Singh, J. K.

    2017-03-01

    Based on plasma oscillations theory of solids, simple relations have been proposed for the calculation of bond length, specific gravity, homopolar energy gap, heteropolar energy gap, average energy gap, crystal ionicity, bulk modulus, electronic polarizability and dielectric constant of rare earth divalent R+2X and trivalent R+3X monochalcogenides. The specific gravity of nine R+2X, twenty R+3X, and bulk modulus of twenty R+3X monochalcogenides have been calculated for the first time. The calculated values of all parameters are compared with the available experimental and the reported values. A fairly good agreement has been obtained between them. The average percentage deviation of two parameters: bulk modulus and electronic polarizability for which experimental data are known, have also been calculated and found to be better than the earlier correlations.

  12. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes.

    PubMed

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

    2008-07-22

    The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions.

  13. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

    PubMed Central

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

    2008-01-01

    Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

  14. Polymorphisms in the Taste Receptor Gene (Tas1r3) Region Are Associated with Saccharin Preference in 30 Mouse Strains

    PubMed Central

    Reed, D. R.; Li, S.; Li, X.; Huang, L.; Tordoff, M. G.; Starling-Roney, R.; Taniguchi, K.; West, D. B.; Ohmen, J. D.; Beauchamp, G. K.; Bachmanov, A. A.

    2006-01-01

    The results of recent studies suggest that the mouse Sac (saccharin preference) locus is identical to the Tas1r3 (taste receptor) gene. The goal of this study was to identify Tas1r3 sequence variants associated with saccharin preference in a large number of inbred mouse strains. Initially, we sequenced ~6.7 kb of the Tas1r3 gene and its flanking regions from six inbred mouse strains with high and low saccharin preference, including the strains in which the Sac alleles were described originally (C57BL/6J, Sacb; DBA/2J, Sacd). Of the 89 sequence variants detected among these six strains, eight polymorphic sites were significantly associated with preferences for 1.6 mm saccharin. Next, each of these eight variant sites were genotyped in 24 additional mouse strains. Analysis of the genotype–phenotype associations in all 30 strains showed the strongest association with saccharin preference at three sites: nucleotide (nt) −791 (3 bp insertion/deletion), nt +135 (Ser45Ser), and nt +179 (Ile60Thr). We measured Tas1r3 gene expression, transcript size, and T1R3 immunoreactivity in the taste tissue of two inbred mouse strains with different Tas1r3 haplotypes and saccharin preferences. The results of these experiments suggest that the polymorphisms associated with saccharin preference do not act by blocking gene expression, changing alternative splicing, or interfering with protein translation in taste tissue. The amino acid substitution (Ile60Thr) may influence the ability of the protein to form dimers or bind sweeteners. Here, we present data for future studies directed to experimentally confirm the function of these polymorphisms and highlight some of the difficulties of identifying specific DNA sequence variants that underlie quantitative trait loci. PMID:14749438

  15. Interleukin-1R3 mediates interleukin-1-induced potassium current increase through fast activation of Akt kinase.

    PubMed

    Qian, Jiang; Zhu, Ling; Li, Qiming; Belevych, Natalya; Chen, Qun; Zhao, Fangli; Herness, Scott; Quan, Ning

    2012-07-24

    Inflammatory cytokine interleukin-1 (IL-1) performs multiple functions in the central nervous system. The type 1 IL-1 receptor (IL-1R1) and the IL-1 receptor accessory protein (IL-1RAcP) form a functional IL-1 receptor complex that is thought to mediate most, if not all, IL-1-induced effects. Several recent studies, however, suggest the existence of a heretofore-unidentified receptor for IL-1. In this study, we report that the IL-1R1 gene contains an internal promoter that drives the transcription of a shortened IL-1R1 mRNA. This mRNA is the template for a unique IL-1R protein that is identical to IL-1R1 at the C terminus, but with a shorter extracellular domain at the N terminus. We have termed this molecule IL-1R3. The mRNA and protein for IL-1R3 are expressed in normal and two strains of commercially available IL-1R1 knockout mice. Western blot analysis shows IL-1R3 is preferentially expressed in neural tissues. Furthermore, IL-1β binds specifically to IL-1R3 when it is complexed with the newly discovered alternative IL-1 receptor accessory protein, IL-1RAcPb. Stimulation of neurons expressing both IL-1R3 and IL-1RAcPb with IL-1β causes fast activation of the Akt kinase, which leads to an increase in voltage-gated potassium current. These results demonstrate that IL-1R3/IL-1RAcPb complex mediates a unique subset of IL-1 activity that accounts for many previously unexplained IL-1 effects in the central nervous system.

  16. Characterization of a (2R,3R)-2,3-Butanediol Dehydrogenase from Rhodococcus erythropolis WZ010.

    PubMed

    Yu, Meilan; Huang, Meijuan; Song, Qingqing; Shao, Jianzhong; Ying, Xiangxian

    2015-04-20

    The gene encoding a (2R,3R)-2,3-butanediol dehydrogenase from Rhodococcus erythropolis WZ010 (ReBDH) was over-expressed in Escherichia coli and the resulting recombinant ReBDH was successfully purified by Ni-affinity chromatography. The purified ReBDH in the native form was found to exist as a monomer with a calculated subunit size of 37180, belonging to the family of the zinc-containing alcohol dehydrogenases. The enzyme was NAD(H)-specific and its optimal activity for acetoin reduction was observed at pH 6.5 and 55 °C. The optimal pH and temperature for 2,3-butanediol oxidation were pH 10 and 45 °C, respectively. The enzyme activity was inhibited by ethylenediaminetetraacetic acid (EDTA) or metal ions Al3+, Zn2+, Fe2+, Cu2+ and Ag+, while the addition of 10% (v/v) dimethyl sulfoxide (DMSO) in the reaction mixture increased the activity by 161.2%. Kinetic parameters of the enzyme showed lower Km values and higher catalytic efficiency for diacetyl and NADH in comparison to those for (2R,3R)-2,3-butanediol and NAD+. The activity of acetoin reduction was 7.7 times higher than that of (2R,3R)-2,3-butanediol oxidation when ReBDH was assayed at pH 7.0, suggesting that ReBDH-catalyzed reaction in vivo might favor (2R,3R)-2,3-butanediol formation rather than (2R,3R)-2,3-butanediol oxidation. The enzyme displayed absolute stereospecificity in the reduction of diacetyl to (2R,3R)-2,3-butanediol via (R)-acetoin, demonstrating its potential application on the synthesis of (R)-chiral alcohols.

  17. Interleukin-1R3 mediates interleukin-1–induced potassium current increase through fast activation of Akt kinase

    PubMed Central

    Qian, Jiang; Zhu, Ling; Li, Qiming; Belevych, Natalya; Chen, Qun; Zhao, Fangli; Herness, Scott; Quan, Ning

    2012-01-01

    Inflammatory cytokine interleukin-1 (IL-1) performs multiple functions in the central nervous system. The type 1 IL-1 receptor (IL-1R1) and the IL-1 receptor accessory protein (IL-1RAcP) form a functional IL-1 receptor complex that is thought to mediate most, if not all, IL-1–induced effects. Several recent studies, however, suggest the existence of a heretofore-unidentified receptor for IL-1. In this study, we report that the IL-1R1 gene contains an internal promoter that drives the transcription of a shortened IL-1R1 mRNA. This mRNA is the template for a unique IL-1R protein that is identical to IL-1R1 at the C terminus, but with a shorter extracellular domain at the N terminus. We have termed this molecule IL-1R3. The mRNA and protein for IL-1R3 are expressed in normal and two strains of commercially available IL-1R1 knockout mice. Western blot analysis shows IL-1R3 is preferentially expressed in neural tissues. Furthermore, IL-1β binds specifically to IL-1R3 when it is complexed with the newly discovered alternative IL-1 receptor accessory protein, IL-1RAcPb. Stimulation of neurons expressing both IL-1R3 and IL-1RAcPb with IL-1β causes fast activation of the Akt kinase, which leads to an increase in voltage-gated potassium current. These results demonstrate that IL-1R3/IL-1RAcPb complex mediates a unique subset of IL-1 activity that accounts for many previously unexplained IL-1 effects in the central nervous system. PMID:22778412

  18. Detection of the virulent form of AVR3a from Phytophthora infestans following artificial evolution of potato resistance gene R3a.

    PubMed

    Chapman, Sean; Stevens, Laura J; Boevink, Petra C; Engelhardt, Stefan; Alexander, Colin J; Harrower, Brian; Champouret, Nicolas; McGeachy, Kara; Van Weymers, Pauline S M; Chen, Xinwei; Birch, Paul R J; Hein, Ingo

    2014-01-01

    Engineering resistance genes to gain effector recognition is emerging as an important step in attaining broad, durable resistance. We engineered potato resistance gene R3a to gain recognition of the virulent AVR3aEM effector form of Phytophthora infestans. Random mutagenesis, gene shuffling and site-directed mutagenesis of R3a were conducted to produce R3a* variants with gain of recognition towards AVR3aEM. Programmed cell death following gain of recognition was enhanced in iterative rounds of artificial evolution and neared levels observed for recognition of AVR3aKI by R3a. We demonstrated that R3a*-mediated recognition responses, like for R3a, are dependent on SGT1 and HSP90. In addition, this gain of response is associated with re-localisation of R3a* variants from the cytoplasm to late endosomes when co-expressed with either AVR3aKI or AVR3aEM a mechanism that was previously only seen for R3a upon co-infiltration with AVR3aKI. Similarly, AVR3aEM specifically re-localised to the same vesicles upon recognition by R3a* variants, but not with R3a. R3a and R3a* provide resistance to P. infestans isolates expressing AVR3aKI but not those homozygous for AVR3aEM.

  19. Acid clusters

    SciTech Connect

    Keesee, R.G.; Castleman, A.W. Jr.

    1986-04-01

    Molecular clusters can be considered to be the smallest size range of an aerosol particle size distribution. Nucleation from the gas phase to particles or droplets involves the formation of clusters in the initial stages. Consequently, knowledge of the properties and formation of clusters containing acids contribute to an understanding of acid rain. This paper presents an overview of results obtained in the laboratory on the formation and stability of both neutral and ionized acid clusters. With free jet expansion techniques, the authors have produced clusters of aqueous nitric acid, aqueous hydrochloric acid, aqueous sulfuric acid, acetic acid and aqueous sulfur dioxide. For analogy to buffering, the formation of clusters containing ammonia have also been examined. These have included ammonia with aqueous nitric acid, hydrogen sulfide and sulfur dioxide. The basic experiment involves expansion of vapor through a nozzle, collimation of the jet with a skimmer to form a well-directed molecular beam, and detection of clusters via electron impact ionization and mass spectrometry. Some variations include the introduction of a reactive gas into vacuum near the expansion as described elsewhere and the implementation of an electrostatic quadrupolar field to examine the polarity of the neutral clusters.

  20. The Eucalyptus grandis R2R3-MYB transcription factor family: evidence for woody growth-related evolution and function.

    PubMed

    Soler, Marçal; Camargo, Eduardo Leal Oliveira; Carocha, Victor; Cassan-Wang, Hua; San Clemente, Hélène; Savelli, Bruno; Hefer, Charles A; Paiva, Jorge A Pinto; Myburg, Alexander A; Grima-Pettenati, Jacqueline

    2015-06-01

    The R2R3-MYB family, one of the largest transcription factor families in higher plants, controls a wide variety of plant-specific processes including, notably, phenylpropanoid metabolism and secondary cell wall formation. We performed a genome-wide analysis of this superfamily in Eucalyptus, one of the most planted hardwood trees world-wide. A total of 141 predicted R2R3-MYB sequences identified in the Eucalyptus grandis genome sequence were subjected to comparative phylogenetic analyses with Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. We analysed features such as gene structure, conserved motifs and genome location. Transcript abundance patterns were assessed by RNAseq and validated by high-throughput quantitative PCR. We found some R2R3-MYB subgroups with expanded membership in E. grandis, V. vinifera and P. trichocarpa, and others preferentially found in woody species, suggesting diversification of specific functions in woody plants. By contrast, subgroups containing key genes regulating lignin biosynthesis and secondary cell wall formation are more conserved across all of the species analysed. In Eucalyptus, R2R3-MYB tandem gene duplications seem to disproportionately affect woody-preferential and woody-expanded subgroups. Interestingly, some of the genes belonging to woody-preferential subgroups show higher expression in the cambial region, suggesting a putative role in the regulation of secondary growth.

  1. 75 FR 3160 - Commerce in Explosives-Storage of Shock Tube With Detonators (2005R-3P)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-20

    ...--Storage of Shock Tube With Detonators (2005R-3P) AGENCY: Bureau of Alcohol, Tobacco, Firearms, and... tube to be stored with detonators because these materials when stored together do not pose a mass detonation hazard. Shock tube is a small diameter plastic laminate tube coated with a very thin layer...

  2. Evaluation of Radial Flow Fluidized Filter (R3F) Followed by Microfiltration and Ultrafiltration Systems in Calimesa, California

    EPA Science Inventory

    U.S. EPA coordinated a field study with South Mesa Water Utility to look for treatment alternatives for California State Project Water in the small community of Calimesa, California. EPA evaluated the performance of a system comprised of Radial Flow Fluidized Filtration (R3f) fo...

  3. 76 FR 65199 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-20

    ... and Message Specification; Appendix on Backwards and Forwards Compatibility; Availability AGENCY: Food... Guide--Backwards and Forwards Compatibility'' (the draft BFC appendix). The draft E2B(R3) implementation... Forwards Compatibility'' should be made available for public comment. The documents are the product of the...

  4. Evaluation of Radial Flow Fluidized Filter (R3F) Followed by Microfiltration and Ultrafiltration Systems in Calimesa, California

    EPA Science Inventory

    U.S. EPA coordinated a field study with South Mesa Water Utility to look for treatment alternatives for California State Project Water in the small community of Calimesa, California. EPA evaluated the performance of a system comprised of Radial Flow Fluidized Filtration (R3f) fo...

  5. Electronic structure and stability of the C H3N H3PbB r3 (001) surface

    NASA Astrophysics Data System (ADS)

    Huang, Xin; Paudel, Tula R.; Dowben, Peter A.; Dong, Shuai; Tsymbal, Evgeny Y.

    2016-11-01

    The energetics and the electronic structure of methylammonium lead bromine (C H3N H3PbB r3 ) perovskite (001) surfaces are studied based on density functional theory. By examining the surface grand potential, we predict that the C H3N H3Br -terminated (001) surface is energetically more favorable than the PbB r2 -terminated (001) surface, under thermodynamic equilibrium conditions of bulk C H3N H3PbB r3 . The electronic structure of each of these two different surface terminations retains some of the characteristics of the bulk, while new surface states are found near band edges which may affect the photovoltaic performance in the solar cells based on C H3N H3PbB r3 . The calculated electron affinity of C H3N H3PbB r3 reveals a sizable difference for the two surface terminations, indicating a possibility of tuning the band offset between the halide perovskite and adjacent electrode with proper interface engineering.

  6. Structural analysis of a glycosides hydrolase family 42 cold-adapted ß-galactosidase from Rahnella sp. R3

    USDA-ARS?s Scientific Manuscript database

    The ß-galactosidase isolated from a psychrotrophic bacterium, Rahnella sp. R3 (R-ß-Gal), exhibits high activity at low temperature. R-ß-Gal is a member of the glycoside hydrolases family 42 (GH42), and forms a 225 kDa trimeric structure in solution. The X-ray crystal structure of R-ß-Gal was determi...

  7. Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

    USDA-ARS?s Scientific Manuscript database

    A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

  8. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    SciTech Connect

    Cervenakova, L.; Brown, P.; Nagle, J.

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  9. Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis

    USDA-ARS?s Scientific Manuscript database

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an ...

  10. N-methyl-(R)-3-(tert-butyl)-sulfinyl-1,4-dihydropyridine: a novel NADH model compound.

    PubMed

    Xie, Kun; Liu, You-Cheng; Cui, Yi; Wang, Jian-Ge; Fu, Yao; Mak, Thomas C W

    2007-03-12

    We have synthesized a novel chiral NADH model compound, N-methyl-(R)-3-(tert-butyl)-sulphinyl-1,4-dihydropyridine with high enantioselectivity and used it in the reduction of methyl benzoylformate, producing (S)-methyl mandelate in 95% ee. The absolute structure of its precursor, 3-(tert-butyl)sulfinyl pyridine, was determined by X-ray analysis.

  11. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  12. Two distinct determinants of ligand specificity in T1R1/T1R3 (the umami taste receptor).

    PubMed

    Toda, Yasuka; Nakagita, Tomoya; Hayakawa, Takashi; Okada, Shinji; Narukawa, Masataka; Imai, Hiroo; Ishimaru, Yoshiro; Misaka, Takumi

    2013-12-27

    Umami taste perception in mammals is mediated by a heteromeric complex of two G-protein-coupled receptors, T1R1 and T1R3. T1R1/T1R3 exhibits species-dependent differences in ligand specificity; human T1R1/T1R3 specifically responds to L-Glu, whereas mouse T1R1/T1R3 responds more strongly to other L-amino acids than to L-Glu. The mechanism underlying this species difference remains unknown. In this study we analyzed chimeric human-mouse receptors and point mutants of T1R1/T1R3 and identified 12 key residues that modulate amino acid recognition in the human- and mouse-type responses in the extracellular Venus flytrap domain of T1R1. Molecular modeling revealed that the residues critical for human-type acidic amino acid recognition were located at the orthosteric ligand binding site. In contrast, all of the key residues for the mouse-type broad response were located at regions outside of both the orthosteric ligand binding site and the allosteric binding site for inosine-5'-monophosphate (IMP), a known natural umami taste enhancer. Site-directed mutagenesis demonstrated that the newly identified key residues for the mouse-type responses modulated receptor activity in a manner distinct from that of the allosteric modulation via IMP. Analyses of multiple point mutants suggested that the combination of two distinct determinants, amino acid selectivity at the orthosteric site and receptor activity modulation at the non-orthosteric sites, may mediate the ligand specificity of T1R1/T1R3. This hypothesis was supported by the results of studies using nonhuman primate T1R1 receptors. A complex molecular mechanism involving changes in the properties of both the orthosteric and non-orthosteric sites of T1R1 underlies the determination of ligand specificity in mammalian T1R1/T1R3.

  13. Spitzer Clusters

    NASA Astrophysics Data System (ADS)

    Krick, Kessica

    This proposal is a specific response to the strategic goal of NASA's research program to "discover how the universe works and explore how the universe evolved into its present form." Towards this goal, we propose to mine the Spitzer archive for all observations of galaxy groups and clusters for the purpose of studying galaxy evolution in clusters, contamination rates for Sunyaev Zeldovich cluster surveys, and to provide a database of Spitzer observed clusters to the broader community. Funding from this proposal will go towards two years of support for a Postdoc to do this work. After searching the Spitzer Heritage Archive, we have found 194 unique galaxy groups and clusters that have data from both the Infrared array camera (IRAC; Fazio et al. 2004) at 3.6 - 8 microns and the multiband imaging photometer for Spitzer (MIPS; Rieke et al. 2004) at 24microns. This large sample will add value beyond the individual datasets because it will be a larger sample of IR clusters than ever before and will have sufficient diversity in mass, redshift, and dynamical state to allow us to differentiate amongst the effects of these cluster properties. An infrared sample is important because it is unaffected by dust extinction while at the same time is an excellent measure of both stellar mass (IRAC wavelengths) and star formation rate (MIPS wavelengths). Additionally, IRAC can be used to differentiate star forming galaxies (SFG) from active galactic nuclei (AGN), due to their different spectral shapes in this wavelength regime. Specifically, we intend to identify SFG and AGN in galaxy groups and clusters. Groups and clusters differ from the field because the galaxy densities are higher, there is a large potential well due mainly to the mass of the dark matter, and there is hot X-ray gas (the intracluster medium; ICM). We will examine the impact of these differences in environment on galaxy formation by comparing cluster properties of AGN and SFG to those in the field. Also, we will

  14. Determination of LongR(3)-IGF-I, R(3)-IGF-I, Des1-3 IGF-I and their metabolites in human plasma samples by means of LC-MS.

    PubMed

    Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Fichant, Eric; Schänzer, Wilhelm; Thevis, Mario

    2017-08-01

    According to the regulations of the World Anti-Doping Agency (WADA), growth promoting peptides such as the insulin-like growth factor-I (IGF-I) and its synthetic analogues belong to the class of prohibited compounds. While several assays to quantify endogenous IGF-I have been established, the potential misuse of synthetic analogues such as LongR(3)-IGF-I, R(3)-IGF-I and Des1-3-IGF-I remains a challenge and superior pharmacokinetic properties have been described for these analogues. Within the present study, it was demonstrated that the target peptides can be successfully detected in plasma samples by means of magnetic beads-based immunoaffinity purification and subsequent nanoscale liquid chromatographic separation with high resolution mass spectrometric detection. Noteworthy, the usage of a specific antibody for LongR(3)-IGF-I enables the determination in low ng/mL levels despite the presence of an enormous excess of endogenous human IGF-I. In addition, different metabolism studies (in-vitro and in-vivo) were performed using sophisticated strategies such as incubation with skin tissue microsomes, degradation in biological fluids (for all analogues), and administration to rats (for LongR(3)-IGF-I). Herewith, several C-and N-terminally truncated metabolites were identified and their relevancy was additionally confirmed by in-vivo experiments with rodents. Especially for LongR(3)-IGF-I, a metabolite ((Des1-11)-LongR(3)-IGF-I) was identified that prolonged the detectability in-vivo by a factor of approximately 2. The method was validated for qualitative interpretation considering the parameters specificity, identification capability, recovery (26-60%), limit of detection (0.5ng/mL), imprecision (<25%), linearity, stability, and matrix effects. A stable isotope labelled ((15)N)-IGF-I was used as internal standard to control all sample preparation steps. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  16. Expression of the glucose-sensing receptor T1R3 in pancreatic islet: changes in the expression levels in various nutritional and metabolic states.

    PubMed

    Medina, Anya; Nakagawa, Yuko; Ma, Jinhui; Li, Longfei; Hamano, Kunihisa; Akimoto, Toshio; Ninomiya, Yuzo; Kojima, Itaru

    2014-01-01

    We reported recently that the taste type 1 receptor 3 (T1R3), a subunit of the sweet taste receptor, functions as a cell-surface glucose-sensing receptor in pancreatic β-cells. In the present study, we investigated the expression of T1R3 in pancreatic islets. mRNA for T1R2 and T1R3 was detected in mouse pancreatic islets. Quantitatively, the mRNA expression level of T1R2 was less than 1% of that of T1R3. Immunohistochemically, T1R3 was abundantly expressed in mouse islets whereas T1R2 was barely detected. Most immunoreactive T1R3 was colocalized with insulin and almost all β-cells were positive for T1R3. In addition, T1R3 was expressed in some portion of α-cells. Immunoreactivity of T1R3 in β-cells was markedly reduced in fed mice compared to those in fasting mice. In contrast, mRNA for T1R3 was not different in islets of fasting and fed mice. Glucose-induced insulin-secretion was higher in islets obtained from fasting mice compared to those from fed mice. The expression of T1R3 was markedly reduced in islets of ob/ob mice compared to those of control mice. Similarly, the expression of T1R3 was reduced in islet of db/db mice. In addition, the expression of T1R3 was markedly reduced in β-cells of fatty diabetic rats and GK rats, models of obese and non-obese type 2 diabetes, respectively. These results indicate that T1R3 is expressed mainly in β-cells and the expression levels are different depending upon the nutritional and metabolic conditions.

  17. Star clusters

    NASA Astrophysics Data System (ADS)

    Labhardt, Lukas; Binggeli, Bruno

    Star clusters are at the heart of astronomy, being key objects for our understanding of stellar evolution and galactic structure. Observations with the Hubble Space Telescope and other modern equipment have revealed fascinating new facts about these galactic building blocks. This book provides two comprehensive and up-to-date, pedagogically designed reviews on star clusters by two well-known experts in the field. Bruce Carney presents our current knowledge of the relative and absolute ages of globular clusters and the chemical history of our Galaxy. Bill Harris addresses globular clusters in external galaxies and their use as tracers of galaxy formation and cosmic distance indicators. The book is written for graduate students as well as professionals in astronomy and astrophysics.

  18. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  19. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  20. Hausdorff clustering

    NASA Astrophysics Data System (ADS)

    Basalto, Nicolas; Bellotti, Roberto; de Carlo, Francesco; Facchi, Paolo; Pantaleo, Ester; Pascazio, Saverio

    2008-10-01

    A clustering algorithm based on the Hausdorff distance is analyzed and compared to the single, complete, and average linkage algorithms. The four clustering procedures are applied to a toy example and to the time series of financial data. The dendrograms are scrutinized and their features compared. The Hausdorff linkage relies on firm mathematical grounds and turns out to be very effective when one has to discriminate among complex structures.

  1. The Rapid Response Radiation Survey (R3S) Mission Using the HiSat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael A.; Norman, Ryan B.; Soto, Hector L.; Stewart, Victor A.; Jones, Mark L.; Kowalski, Matthew C.; Ben Shabat, Adam; Gough, Kerry M.; Stavely, Rebecca L.; Shim, Alex C.; Jaeger, Gene T. K.

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in Low Earth Orbit (LEO), will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HISat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. Currently, airline professionals are the second largest demographic of radiation workers and to date their radiation exposure is undocumented in the USA. The NAIRAS model seeks to fill this information gap. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaD-X), will validate exposure prediction capabilities of NAIRAS. The R3S mission collects total dose and radiation spectrum measurements using a Teledyne µDosimeter and a Liulin-6SA2 LED spectrometer. These two radiation sensors provide a cross correlated radiometric measurement in combination with the Honeywell HMR2300 Smart Digital Magnetometer. The magnetometer assesses the Earth's magnetic field in the LEO environment and allows radiation dose to be mapped as a function of the Earth's magnetic shielding. R3S is also unique in that the radiation sensors will be exposed on the outer surface of the spacecraft, possibly making this the first measurements of the LEO radiation environment with bare sensors. Viability of R3S as an extremely fast turnaround mission is due, in part, to the nature of the robust, well-defined interfaces of the conformal satellite HiSat Architecture. The HiSat architecture, which was developed with the support of the Defense Advanced Research Projects Agency's (DARPA's) Phoenix Program, enabled the R3S system to advance from the first concept to delivery of preliminary design review (PDR) level documents in

  2. Crystal structure of 2-amino-4-methyl­pyridin-1-ium (2R,3R)-3-carb­oxy-2,3-di­hydroxy­propano­ate monohydrate

    PubMed Central

    Jovita, J. V.; Sathya, S.; Usha, G.; Vasanthi, R.; Ramanand, A.

    2014-01-01

    The title mol­ecular salt, C6H9N2 +·C4H5O6 −·H2O, crystallized with two 2-amino-4-methyl­pyridin-1-ium cations, two l-(+)-tartaric acid monoanions [systematic name: (2R,3R)-3-carb­oxy-2,3-di­hydroxy­propano­ate] and two water mol­ecules in the asymmetric unit. In the crystal, the cations, anions and water mol­ecules are linked via a number of O—H⋯O and N—H⋯O hydrogen bonds, and a C—H⋯O hydrogen bond, forming a three-dimensional structure PMID:25309212

  3. Potential of Burkholderia seminalis TC3.4.2R3 as Biocontrol Agent Against Fusarium oxysporum Evaluated by Mass Spectrometry Imaging

    NASA Astrophysics Data System (ADS)

    Araújo, Francisca Diana da Silva; Araújo, Welington Luiz; Eberlin, Marcos Nogueira

    2017-02-01

    Species of genus Burkholderia display different interaction profiles in the environment, causing either several diseases in plants and animals or being beneficial to some plants, promoting their growth, and suppressing phytopathogens. Burkholderia spp. also produce many types of biomolecules with antimicrobial activity, which may be commercially used to protect crops of economic interest, mainly against fungal diseases. Herein we have applied matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) to investigate secondary metabolites produced by B. seminalis TC3.4.2R3 in monoculture and coculture with plant pathogen Fusarium oxysporum. The siderophore pyochelin and the rhamnolipid Rha-Rha-C15-C14 were detected in wild-type B. seminalis strain, and their productions were found to vary in mutant strains carrying disruptions in gene clusters associated with antimicrobial compounds. Two mycotoxins were detected in F. oxysporum. During coculture with B. seminalis, metabolites probably related to defense mechanisms of these microorganisms were observed in the interspecies interaction zone. Our findings demonstrate the effective application of MALDI-MSI in the detection of bioactive molecules involved in the defense mechanism of B. seminalis, and these findings suggest the potential use of this bacterium in the biocontrol of plant diseases caused by F. oxysporum.

  4. Potential of Burkholderia seminalis TC3.4.2R3 as Biocontrol Agent Against Fusarium oxysporum Evaluated by Mass Spectrometry Imaging

    NASA Astrophysics Data System (ADS)

    Araújo, Francisca Diana da Silva; Araújo, Welington Luiz; Eberlin, Marcos Nogueira

    2017-05-01

    Species of genus Burkholderia display different interaction profiles in the environment, causing either several diseases in plants and animals or being beneficial to some plants, promoting their growth, and suppressing phytopathogens. Burkholderia spp. also produce many types of biomolecules with antimicrobial activity, which may be commercially used to protect crops of economic interest, mainly against fungal diseases. Herein we have applied matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) to investigate secondary metabolites produced by B. seminalis TC3.4.2R3 in monoculture and coculture with plant pathogen Fusarium oxysporum. The siderophore pyochelin and the rhamnolipid Rha-Rha-C15-C14 were detected in wild-type B. seminalis strain, and their productions were found to vary in mutant strains carrying disruptions in gene clusters associated with antimicrobial compounds. Two mycotoxins were detected in F. oxysporum. During coculture with B. seminalis, metabolites probably related to defense mechanisms of these microorganisms were observed in the interspecies interaction zone. Our findings demonstrate the effective application of MALDI-MSI in the detection of bioactive molecules involved in the defense mechanism of B. seminalis, and these findings suggest the potential use of this bacterium in the biocontrol of plant diseases caused by F. oxysporum.

  5. DcR3 induces epithelial-mesenchymal transition through activation of the TGF-β3/SMAD signaling pathway in CRC

    PubMed Central

    Hu, Zhi-Yan; Li, Sheng-Nan; Kan, He-Ping; Wang, Xiao-Yan; Li, Zu-Guo

    2016-01-01

    Decoy receptor 3 (DcR3), a novel member of the tumor necrosis factor receptor (TNFR) family, was recently reported to be associated with tumorigenesis and metastasis. However, the role of DcR3 in human colorectal cancer (CRC) has not been fully elucidated. In this study, we found that DcR3 expression was significantly higher in human colorectal cancer tissues than in paired normal tissues, and that DcR3 expression was strongly correlated with tumor invasion, lymph node metastases and poor prognoses. Moreover, DcR3 overexpression significantly enhanced CRC cell proliferation and migration in vitro and tumorigenesis in vivo. Conversely, DcR3 knockdown significantly repressed CRC cell proliferation and migration in vitro, and DcR3 deficiency also attenuated CRC tumorigenesis and metastasis in vivo. Functionally, DcR3 was essential for TGF-β3/SMAD-mediated epithelial-mesenchymal transition (EMT) of CRC cells. Importantly, cooperation between DcR3 and TGF-β3/SMAD-EMT signaling-related protein expression was correlated with survival and survival time in CRC patients. In conclusion, our results demonstrate that DcR3 may be a prognostic biomarker for CRC and that this receptor facilitates CRC development and metastasis by participating in TGF-β3/SMAD-mediated EMT of CRC cells. PMID:27764793

  6. The Involvement of the T1R3 Receptor Protein in the Control of Glucose Metabolism in Mice at Different Levels of Glycemia.

    PubMed

    Murovets, V O; Bachmanov, A A; Travnikov, S V; Churikova, A A; Zolotarev, V A

    2014-07-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL/6J-Tas1r3(tm1Rfm) (Tas1r3-/-), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal or intragastric glucose administration. We have shown that in the Tas1r3-/- strain, in addition to the disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3-/- strain than in the control strain, which suggests that T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the KATP-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier.

  7. CCAAT/Enhancer-binding protein beta regulates expression of human T1R3 taste receptor gene in the bile duct carcinoma cell line, HuCCT1.

    PubMed

    Toyono, Takashi; Seta, Yuji; Kataoka, Shinji; Toyoshima, Kuniaki

    2007-01-01

    The T1R family (T1R1, T1R2 and T1R3 receptors) has a role in the detection of umami and sweet tastes in taste buds. Although T1R3 is also expressed in the intrahepatic bile duct, the expression patterns of T1R1 and T1R2 in this region have not been determined. In addition, the mechanisms of transcriptional regulation of the human T1R3 gene (Tas1r3) have not been elucidated. In this study, we determined the expression patterns of T1R2 and T1R3 in human liver and the function of C/EBPbeta in Tas1r3 promoter activity. Immunohistochemistry showed that T1R2 and T1R3 were expressed in the intrahepatic bile duct. 5'-RACE analysis revealed that the transcriptional start sites of Tas1r3 were located 67 bp and 176 bp upstream of the ATG. Promoter analysis of Tas1r3 was performed using the luciferase reporter assay and EMSA in the Tas1r3-expressing cell line, HuCCT1. The 226-bp region upstream of the ATG had promoter activity, and C/EBPbeta activated the Tas1r3 promoter activity in HuCCT1 cells. These results show that T1R2 and T1R3 receptors, in addition to their role in taste perception, may also have a role in intrahepatic cholangiocytes. C/EBPbeta was identified as the transcription factor regulating Tas1r3 promoter activity in HuCCT1 cells.

  8. [Involvement of Tas1r3 receptor protein in control of the metabolism of glucose at different levels of glycemia in mice].

    PubMed

    Murovets, V O; Bachmanov, A A; Travnikov, S V; Tchurikova, A A; Zolotarev, V A

    2014-01-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose, tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL6J-Tas1r3(tm1Rfm) (Tas1r3-/-), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal to disappearance glucose administration. We have shown that in the Tas1r3-/- strain, in addition to disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3-/- strain than in the control strain, which suggested that the T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the K(ATP)-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier.

  9. First description of food-borne Salmonella enterica resistance regions R1 and R3 associated with IS26 elements.

    PubMed

    Gomes-Neves, Eduarda; Manageiro, Vera; Ferreira, Eugénia; Correia da Costa, José M; Caniça, Manuela

    2015-09-01

    In this study, we assessed the presence of IS26 in food-borne ASSuT-type Salmonella enterica isolates. A new genetic region (R3) was described, that included a C14 caspase gene between IS26 elements. R3 was present in two Salmonella Rissen isolates from a swine carcass and a meat handler, collected at the same abattoir. Furthermore, a new rearrangement of resistance region R1, harboring the blaTEM-1 gene flanked by IS26 elements, was identified in Salmonella Typhimurium and Salmonella 4,[5],12:i:-, from different samples. This study highlights the zoonotic potential of Salmonella spp. isolates and the possible role of IS26 in the mobilization of resistance genes. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. A novel enantioselective epoxide hydrolase for (R)-phenyl glycidyl ether to generate (R)-3-phenoxy-1,2-propanediol.

    PubMed

    Wu, Shijin; Shen, Jiajia; Zhou, Xiaoyun; Chen, Jianmeng

    2007-10-01

    Bacillus sp. Z018, a novel strain producing epoxide hydrolase, was isolated from soil. The epoxide hydrolase catalyzed the stereospecific hydrolysis of (R)-phenyl glycidyl ether to generate (R)-3-phenoxy-1,2-propanediol. Epoxide hydrolase from Bacillus sp. Z018 was inducible, and (R)-phenyl glycidyl ether was able to act as an inducer. The fermentation conditions for epoxide hydrolase were 35 degrees C, pH 7.5 with glucose and NH(4)Cl as the best carbon and nitrogen source, respectively. Under optimized conditions, the biotransformation yield of 45.8% and the enantiomeric excess of 96.3% were obtained for the product (R)-3-phenoxy-1,2-propanediol.

  11. Polarized Raman scattering of multiferroic BiFeO3 epitaxial films with rhombohedral R3c symmetry

    NASA Astrophysics Data System (ADS)

    Singh, Manoj K.; Jang, Hyun M.; Ryu, Sangwoo; Jo, Moon-Ho

    2006-01-01

    Highly (111)-oriented rhombohedral BiFeO3 (BFO) thin films were grown on (111) SrTiO3 substrates by pulsed laser deposition. Polarized Raman-scattering study of the (111)-oriented epitaxial BFO thin film with rhombohedral R3c symmetry was carried out by employing two distinct backscattering geometries. The A1-symmetry transverse-optical [A1(TO )] phonons were selectively isolated from the E-symmetry transverse-optical [E(TO)] phonons by employing Y'(ZZ)Y' polarization configuration in a novel side-view backscattering. By comparing the Y'(ZZ)Y' spectrum with the Z(X 'X')Z polarization spectrum in a normal backscattering, we were able to assign most of A1 and E-symmetry normal modes of R3c BFO. In addition, we found that there was a negligible LO-TO splitting in the A1-symmetry normal modes.

  12. T1R3 is expressed in brush cells and ghrelin-producing cells of murine stomach.

    PubMed

    Hass, Nicole; Schwarzenbacher, Karin; Breer, Heinz

    2010-03-01

    Various digestive and enteroendocrine signaling processes are constantly being adapted to the chemical composition and quantity of the chyme contained in the diverse compartments of the gastrointestinal tract. The chemosensory monitoring that underlies the adaptive capacity of the gut is thought to be performed by so called brush cells that share morphological and molecular features with gustatory sensory cells. A substantial population of brush cells is localized in the gastric mucosa. However, no chemosensory receptors have been found to be expressed in these cells so far, challenging the concept that they serve a chemosensory function. The canonical chemoreceptors for the detection of macronutrients are taste receptors belonging to the T1R family; these have been identified in several tissues in addition to the gustatory system including the small intestine. We demonstrate the expression of the T1R subtype T1R3, which is essential for the detection of both sugars and amino acids in the gustatory system, in two distinct cell populations of the gastric mucosa. One population corresponds to open-type brush cells, emphasizing the notion that they are a chemosensory cell type; T1R3 immunoreactivity in these cells is restricted to the apical cell pole, which might provide the basis for the detection of luminal macronutrient compounds. The second gastric T1R3-positive population consists of closed-type endocrine cells that produce ghrelin. This finding suggests that ghrelin-releasing cells, which lack access to the stomach lumen, might receive chemosensory input from macronutrients in the circulation via T1R3.

  13. The optical counterpart of the supersoft X-ray source r3-8 in M31

    NASA Astrophysics Data System (ADS)

    Orio, M.; Luna, G. J. M.; Kotulla, R.; Gallagher, J. S. G.

    2015-10-01

    On behalf of a larger collaboration we announce that we have obtained spectra of the M31 supersoft X-ray source defined as r3-8 in the Chandra catalogs (see Chiosi et al. 2014, MNRAS 443, 1821, and references therein) using GMOS and the B600 grating at Gemini North, in the 4150-7100 Angstrom range, on 2015/9/9.

  14. The Nonlinear Stability of L 4 in the R3BP when the Smaller Primary is a Heterogeneous Spheroid

    NASA Astrophysics Data System (ADS)

    Shalini, Kumari; Suraj, Md Sanam; Aggarwal, Rajiv

    2017-03-01

    We have investigated the nonlinear stability of the triangular libration point L 4 in the R3BP when the smaller primary is a heterogeneous spheroid with three layers having different densities. We observe that in the nonlinear sense, the triangular libration is stable in the range of linear stability 0< μ< μ c , a critical value of mass parameter μ, except for three mass ratios μ 1^' },μ 2^' }, μ 3^' } at which Moser's theorem is not applicable.

  15. Absolute quantification of DcR3 and GDF15 from human serum by LC-ESI MS

    PubMed Central

    Lancrajan, Ioana; Schneider-Stock, Regine; Naschberger, Elisabeth; Schellerer, Vera S; Stürzl, Michael; Enz, Ralf

    2015-01-01

    Biomarkers are widely used in clinical diagnosis, prognosis and therapy monitoring. Here, we developed a protocol for the efficient and selective enrichment of small and low concentrated biomarkers from human serum, involving a 95% effective depletion of high-abundant serum proteins by partial denaturation and enrichment of low-abundant biomarkers by size exclusion chromatography. The recovery of low-abundance biomarkers was above 97%. Using this protocol, we quantified the tumour markers DcR3 and growth/differentiation factor (GDF)15 from 100 μl human serum by isotope dilution mass spectrometry, using 15N metabolically labelled and concatamerized fingerprint peptides for the both proteins. Analysis of three different fingerprint peptides for each protein by liquid chromatography electrospray ionization mass spectrometry resulted in comparable concentrations in three healthy human serum samples (DcR3: 27.23 ± 2.49 fmol/ml; GDF15: 98.11 ± 0.49 fmol/ml). In contrast, serum levels were significantly elevated in tumour patients for DcR3 (116.94 ± 57.37 fmol/ml) and GDF15 (164.44 ± 79.31 fmol/ml). Obtained data were in good agreement with ELISA and qPCR measurements, as well as with literature data. In summary, our protocol allows the reliable quantification of biomarkers, shows a higher resolution at low biomarker concentrations than antibody-based strategies, and offers the possibility of multiplexing. Our proof-of-principle studies in patient sera encourage the future analysis of the prognostic value of DcR3 and GDF15 for colon cancer patients in larger patient cohorts. PMID:25823874

  16. Absolute quantification of DcR3 and GDF15 from human serum by LC-ESI MS.

    PubMed

    Lancrajan, Ioana; Schneider-Stock, Regine; Naschberger, Elisabeth; Schellerer, Vera S; Stürzl, Michael; Enz, Ralf

    2015-07-01

    Biomarkers are widely used in clinical diagnosis, prognosis and therapy monitoring. Here, we developed a protocol for the efficient and selective enrichment of small and low concentrated biomarkers from human serum, involving a 95% effective depletion of high-abundant serum proteins by partial denaturation and enrichment of low-abundant biomarkers by size exclusion chromatography. The recovery of low-abundance biomarkers was above 97%. Using this protocol, we quantified the tumour markers DcR3 and growth/differentiation factor (GDF)15 from 100 μl human serum by isotope dilution mass spectrometry, using (15) N metabolically labelled and concatamerized fingerprint peptides for the both proteins. Analysis of three different fingerprint peptides for each protein by liquid chromatography electrospray ionization mass spectrometry resulted in comparable concentrations in three healthy human serum samples (DcR3: 27.23 ± 2.49 fmol/ml; GDF15: 98.11 ± 0.49 fmol/ml). In contrast, serum levels were significantly elevated in tumour patients for DcR3 (116.94 ± 57.37 fmol/ml) and GDF15 (164.44 ± 79.31 fmol/ml). Obtained data were in good agreement with ELISA and qPCR measurements, as well as with literature data. In summary, our protocol allows the reliable quantification of biomarkers, shows a higher resolution at low biomarker concentrations than antibody-based strategies, and offers the possibility of multiplexing. Our proof-of-principle studies in patient sera encourage the future analysis of the prognostic value of DcR3 and GDF15 for colon cancer patients in larger patient cohorts. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  17. DcR3 binds to ovarian cancer via heparan sulfate proteoglycans and modulates tumor cells response to platinum with corresponding alteration in the expression of BRCA1

    PubMed Central

    2012-01-01

    Background Overcoming platinum resistance is a major obstacle in the treatment of Epithelial Ovarian Cancer (EOC). In our previous work Decoy Receptor 3 (DcR3) was found to be related to platinum resistance. The major objective of this work was to define the cellular interaction of DcR3 with EOC and to explore its effects on platinum responsiveness. Methods We studied cell lines and primary cultures for the expression of and the cells ability to bind DcR3. Cells were cultured with DcR3 and then exposed to platinum. Cell viability was determined by MTT assay. Finally, the cells molecular response to DcR3 was studied using real time RT-PCR based differential expression arrays, standard RT-PCR, and Western blot. Results High DcR3 in the peritoneal cavity of women with EOC is associated with significantly shorter time to first recurrence after platinum based therapy (p = 0.02). None-malignant cells contribute DcR3 in the peritoneal cavity. The cell lines studied do not secrete DcR3; however they all bind exogenous DcR3 to their surface implying that they can be effected by DcR3 from other sources. DcR3s protein binding partners are minimally expressed or negative, however, all cells expressed the DcR3 binding Heparan Sulfate Proteoglycans (HSPGs) Syndecans-2, and CD44v3. DcR3 binding was inhibited by heparin and heparinase. After DcR3 exposure both SKOV-3 and OVCAR-3 became more resistant to platinum with 15% more cells surviving at high doses. On the contrary CaOV3 became more sensitive to platinum with 20–25% more cell death. PCR array analysis showed increase expression of BRCA1 mRNA in SKOV-3 and OVCAR-3 and decreased BRCA1 expression in CaOV-3 after exposure to DcR3. This was confirmed by gene specific real time PCR and Western blot analysis. Conclusions Non-malignant cells contribute to the high levels of DcR3 in ovarian cancer. DcR3 binds readily to EOC cells via HSPGs and alter their responsiveness to platinum chemotherapy. The paradoxical responses seen

  18. The reduced model multiscale method (R3M) for the non-linear homogenization of hyperelastic media at finite strains

    NASA Astrophysics Data System (ADS)

    Yvonnet, J.; He, Q.-C.

    2007-04-01

    This paper presents a new multi-scale method for the homogenization analysis of hyperelastic solids undergoing finite strains. The key contribution is to use an incremental nonlinear homogenization technique in tandem with a model reduction method, in order to alleviate the complexity of multiscale procedures, which usually involve a large number of nonlinear nested problems to be solved. The problem associated with the representative volume element (RVE) is solved via a model reduction method (proper orthogonal decomposition). The reduced basis is obtained through pre-computations on the RVE. The technique, coined as reduced model multiscale method (R3M), allows reducing significantly the computation times, as no large matrix needs to be inverted, and as the convergence of both macro and micro problems is enhanced. Furthermore, the R3M drastically reduces the size of the data base describing the history of the micro problems. In order to validate the technique in the context of porous elastomers at finite strains, a comparison between a full and a reduced multiscale analysis is performed through numerical examples, involving different micro and macro structures, as well as different nonlinear models (Neo-Hookean, Mooney-Rivlin). It is shown that the R3M gives good agreement with the full simulations, at lower computational and data storage requirements.

  19. Mediation of Autophagic Cell Death by Type 3 Ryanodine Receptor (RyR3) in Adult Hippocampal Neural Stem Cells.

    PubMed

    Chung, Kyung Min; Jeong, Eun-Ji; Park, Hyunhee; An, Hyun-Kyu; Yu, Seong-Woon

    2016-01-01

    Cytoplasmic Ca(2+) actively engages in diverse intracellular processes from protein synthesis, folding and trafficking to cell survival and death. Dysregulation of intracellular Ca(2+) levels is observed in various neuropathological states including Alzheimer's and Parkinson's diseases. Ryanodine receptors (RyRs) and inositol 1,4,5-triphosphate receptors (IP3Rs), the main Ca(2+) release channels located in endoplasmic reticulum (ER) membranes, are known to direct various cellular events such as autophagy and apoptosis. Here we investigated the intracellular Ca(2+)-mediated regulation of survival and death of adult hippocampal neural stem (HCN) cells utilizing an insulin withdrawal model of autophagic cell death (ACD). Despite comparable expression levels of RyR and IP3R transcripts in HCN cells at normal state, the expression levels of RyRs-especially RyR3-were markedly upregulated upon insulin withdrawal. While treatment with the RyR agonist caffeine significantly promoted the autophagic death of insulin-deficient HCN cells, treatment with its inhibitor dantrolene prevented the induction of autophagy following insulin withdrawal. Furthermore, CRISPR/Cas9-mediated knockout of the RyR3 gene abolished ACD of HCN cells. This study delineates a distinct, RyR3-mediated ER Ca(2+) regulation of autophagy and programmed cell death in neural stem cells. Our findings provide novel insights into the critical, yet understudied mechanisms underlying the regulatory function of ER Ca(2+) in neural stem cell biology.

  20. Ground state sign-changing solutions for a class of Schrödinger-Poisson type problems in R3

    NASA Astrophysics Data System (ADS)

    Chen, Sitong; Tang, Xianhua

    2016-08-01

    This paper is dedicated to studying the following Schrödinger-Poisson system -triangle u+V(x)u+λφ u=K(x)f(u),& quad xin R3,-triangleφ= u^2,quad xin R3, where V, K are positive continuous potentials, f is a continuous function and {λ} is a positive parameter. We develop a direct approach to establish the existence of one ground state sign-changing solution {u_λ} with precisely two nodal domains, by introducing a weaker condition that there exists {θ_0in (0,1)} such that K(x)[f(τ)/τ^3-f(tτ)/(tτ)^3 ]sign(1-t)+θ_0V(x)|1-t^2|/(tτ)^2 ≥ 0, quad forall x in R^3, t > 0, τ≠ 0 than the usual increasing condition on {f(t)/|t|^3}. Under the above condition, we also prove that the energy of any sign-changing solution is strictly larger than two times the least energy, and give a convergence property of {u_λ} as {λsearrow 0}.

  1. Anthocyanin leaf markings are regulated by a family of R2R3-MYB genes in the genus Trifolium.

    PubMed

    Albert, Nick W; Griffiths, Andrew G; Cousins, Greig R; Verry, Isabelle M; Williams, Warren M

    2015-01-01

    Anthocyanin pigments accumulate to form spatially restricted patterns in plants, particularly in flowers, but also occur in vegetative tissues. Spatially restricted anthocyanin leaf markings are poorly characterised in plants, but are common in forage legumes. We hypothesised that the molecular basis for anthocyanin leaf markings in Trifolium spp. is due to the activity of a family of R2R3-MYB genes. R2R3-MYB genes were identified that are associated with the two classic pigmentation loci in T. repens. The R locus patterns 'red leaf', 'red midrib' and 'red fleck' are conditioned by a single MYB gene, RED LEAF. The 'diffuse red leaf' trait is regulated by the RED LEAF DIFFUSE MYB gene. The V locus was identified through mapping two V-linked traits, 'V-broken yellow' (Vby) and 'red leaflet' (Vrl). Two highly similar R2R3-MYB genes, RED V-a and RED V-b, mapped to the V locus and co-segregated with the RED V pigmentation pattern. Functional characterisation of RED LEAF and RED V was performed, confirming their function as anthocyanin regulators and identifying a C-terminal region necessary for transactivation. The mechanisms responsible for generating anthocyanin leaf markings in T. repens provide a valuable system to compare with mechanisms that regulate complex floral pigmentation.

  2. Washout of tritium from 3R-3(/sup 3/H)-L-aspartate in the aspartase reaction

    SciTech Connect

    Katz, B.M.; Cook, P.F.

    1987-05-01

    Bacterial aspartase catalyzes the reversible conversion of L-aspartate to fumarate and ammonia. Recent studies that made use of deuterium and /sup 15/N isotope effects suggested a carbanion intermediate mechanism in which C-N bond cleavage is rate determining. This could result in removal of a proton from the 3R position of aspartate at a rate of faster than the elimination of ammonia. 3R-3(/sup 3/H)-Aspartate was prepared enzymatically using aspartase from fumarate, ammonia and /sup 3/H/sub 2/O and aspartate isolated via chromatography on Dowex 50W x 8 at pH 1, eluting with 2N pyridine. The rate of /sup 3/H washout from this aspartate was then measured as a function of aspartate concentration and compared to the rate of production of fumarate. Tritium does washout of aspartate at a rate faster than fumarate is formed but the proton is apparently not rapidly equilibrated with solvent. The tritium washout experiments were supplemented using 3R-3(/sup 2/H)-aspartate prepared as above with /sup 2/H/sub 2/O replacing /sup 3/H/sub 2/O and monitoring the appearance of 3R-3(/sup 1/H)-aspartate via /sup 1/H-NMR. Results confirm the tritium washout results. Data are discussed in terms of the carbanion mechanism.

  3. Mediation of Autophagic Cell Death by Type 3 Ryanodine Receptor (RyR3) in Adult Hippocampal Neural Stem Cells

    PubMed Central

    Chung, Kyung Min; Jeong, Eun-Ji; Park, Hyunhee; An, Hyun-Kyu; Yu, Seong-Woon

    2016-01-01

    Cytoplasmic Ca2+ actively engages in diverse intracellular processes from protein synthesis, folding and trafficking to cell survival and death. Dysregulation of intracellular Ca2+ levels is observed in various neuropathological states including Alzheimer’s and Parkinson’s diseases. Ryanodine receptors (RyRs) and inositol 1,4,5-triphosphate receptors (IP3Rs), the main Ca2+ release channels located in endoplasmic reticulum (ER) membranes, are known to direct various cellular events such as autophagy and apoptosis. Here we investigated the intracellular Ca2+-mediated regulation of survival and death of adult hippocampal neural stem (HCN) cells utilizing an insulin withdrawal model of autophagic cell death (ACD). Despite comparable expression levels of RyR and IP3R transcripts in HCN cells at normal state, the expression levels of RyRs—especially RyR3—were markedly upregulated upon insulin withdrawal. While treatment with the RyR agonist caffeine significantly promoted the autophagic death of insulin-deficient HCN cells, treatment with its inhibitor dantrolene prevented the induction of autophagy following insulin withdrawal. Furthermore, CRISPR/Cas9-mediated knockout of the RyR3 gene abolished ACD of HCN cells. This study delineates a distinct, RyR3-mediated ER Ca2+ regulation of autophagy and programmed cell death in neural stem cells. Our findings provide novel insights into the critical, yet understudied mechanisms underlying the regulatory function of ER Ca2+ in neural stem cell biology. PMID:27199668

  4. Glutamate receptor subunit 3 (GluR3) immunoreactivity delineates a subpopulation of parvalbumin-containing interneurons in the rat hippocampus.

    PubMed

    Moga, Diana E; Janssen, William G M; Vissavajjhala, Prabhakar; Czelusniak, Sharon M; Moran, Thomas M; Hof, Patrick R; Morrison, John H

    2003-07-14

    Rasmussen's encephalitis is a childhood disease resulting in intractable seizures associated with hippocampal and neocortical inflammation. An autoantibody against the GluR3 subunit of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors is implicated in the pathophysiology of Rasmussen's encephalitis. AMPA receptors mediate excitatory neurotransmission in the brain and contain combinations of four subunits (GluR1-4). Although the distributions of GluR1, GluR2, and GluR4 are known in some detail, the cellular distribution of GluR3 in the mammalian brain remains to be described. We developed and characterized a GluR3-specific monoclonal antibody and quantified the cellular distribution of GluR3 in CA1 of the rat hippocampus. GluR3 immunoreactivity was detected in all pyramidal neurons and astrocytes and in most interneurons. We quantified the intensity of GluR3 immunoreactivity in interneuron subtypes defined by their calcium-binding protein content. GluR3 immunofluorescence, but not GluR1 or GluR2 immunofluorescence, was significantly elevated in somata of parvalbumin-containing interneurons compared to pyramidal somata. Strikingly, increased GluR3 immunofluorescence was not observed in calbindin- and calretinin-containing interneurons. Furthermore, 24% of parvalbumin-containing interneurons could be distinguished from surrounding neurons based on their intense GluR3 immunoreactivity. This subpopulation had significantly elevated GluR3 immunoreactivity compared to the rest of parvalbumin-containing interneurons. Electron microscopy revealed enriched GluR3 immunoreactivity in parvalbumin-containing perikarya at cytoplasmic and postsynaptic sites. Parvalbumin-containing interneurons, potent inhibitors of cortical pyramidal neurons, are vulnerable in the brains of epileptic patients. Our findings suggest that the somata of these interneurons are enriched in GluR3, which may render them vulnerable to pathological states such as epilepsy and

  5. Improvement of (R)-3-hydroxybutyric acid secretion during Halomonas sp. KM-1 cultivation with saccharified Japanese cedar by the addition of urea.

    PubMed

    Kawata, Y; Nojiri, M; Matsushita, I; Tsubota, J

    2015-10-01

    Japanese cedar (Cryptomeria japonica) is a major species in artificial Japanese forests. The Halomonas sp. KM-1 was recently isolated and found to grow effectively on saccharified Japanese cedar wood, resulting in the intracellular storage of poly-(R)-3-hydroxybutyric acid (PHB) under aerobic conditions. Under microaerobic conditions, the extracellular secretion of (R)-3-hydroxybutyric acid ((R)-3-HB) led to the degradation of intracellular PHB. In this study, the production of PHB and the secretion of (R)-3-HB using saccharified Japanese cedar were much improved in cultures that were grown in the presence of urea. The level of intracellular PHB production after 36 h under aerobic cultivation was 23·6 g l(-1) ; after shifting to microaerobic conditions for 24 h, the (R)-3-HB concentration in the medium reached 21·1 g l(-1) . Thus, KM-1 efficiently utilizes saccharified Japanese cedar to produce PHB and secretes (R)-3-HB, making it a practical candidate for use in the industrial production of (R)-3-HB. Japanese cedar is a major species grown in artificial Japanese forests, and its thinning is crucial for the health of artificial forests and the Japanese economy. Halomonas sp. KM-1 grew effectively on saccharified Japanese cedar wood, resulting in intracellular storage of poly-(R)-3-hydroxybutyric acid (PHB) under aerobic conditions. Under microaerobic conditions, extracellular secretion of (R)-3-hydroxybutyric acid ((R)-3-HB) caused intracellular PHB degradation. (R)-3-HB is a chiral compound that is useful in the chemical, health food and pharmaceutical industries. The production of PHB and secretion of (R)-3-HB using saccharified wood was dramatically improved, which may positively affect its future industrial production. © 2015 The Society for Applied Microbiology.

  6. Impact of T1r3 and Trpm5 on Carbohydrate Preference and Acceptance in C57BL/6 Mice

    PubMed Central

    2013-01-01

    Knockout (KO) mice missing the sweet taste receptor subunit T1r3 or the signaling protein Trpm5 have greatly attenuated sweetener preferences but learn to prefer sucrose in 24-h tests. Here, we examined 24-h preferences of T1r3 KO, Trpm5 KO, and C57BL/6J wild-type (WT) mice for glucose, fructose, galactose, and corn starch. Unlike glucose, fructose has little postoral reward effect in WT mice, whereas conflicting data have been obtained with galactose. Naïve KO mice were initially indifferent to dilute glucose solutions (0.5–4%) but exhibited strong preferences for 8–32% concentrations. In a second test, they strongly preferred (~90%) all glucose concentrations although they drank less sugar than WT mice. Naïve KO mice were indifferent to 0.5–8% fructose and avoided 16–32% fructose. However, the glucose-experienced KO mice displayed significant preferences for all fructose solutions. Naïve KO mice preferred only 8% galactose, whereas WT mice preferred 4–16% galactose, and all mice avoided 32% galactose. Galactose experience enhanced the preference for this sugar in KO and WT mice. Naïve T1r3 KO and WT mice displayed similar preferences for 0.5–32% corn starch, which were enhanced by starch experience. Naïve Trpm5 KO mice did not prefer starch but did so after 1-bottle starch experience. The results confirm the sweet taste deficits of T1r3 KO and Trpm5 KO mice but demonstrate their ability to develop strong glucose and milder galactose preferences attributed to the postoral actions of these sugars. The acquired preference for the non-sweet flavor properties of glucose generalized to those of fructose. The findings further demonstrate that although Trpm5 (but not T1r3) signaling is essential for starch preference, Trpm5 KO mice can learn to prefer starch based on its postoral effects. PMID:23547138

  7. Identification of the cyclamate interaction site within the transmembrane domain of the human sweet taste receptor subunit T1R3.

    PubMed

    Jiang, Peihua; Cui, Meng; Zhao, Baohua; Snyder, Lenore A; Benard, Lumie M J; Osman, Roman; Max, Marianna; Margolskee, Robert F

    2005-10-07

    The artificial sweetener cyclamate tastes sweet to humans, but not to mice. When expressed in vitro, the human sweet receptor (a heterodimer of two taste receptor subunits: hT1R2 + hT1R3) responds to cyclamate, but the mouse receptor (mT1R2 + mT1R3) does not. Using mixed-species pairings of human and mouse sweet receptor subunits, we determined that responsiveness to cyclamate requires the human form of T1R3. Using chimeras, we determined that it is the transmembrane domain of hT1R3 that is required for the sweet receptor to respond to cyclamate. Using directed mutagenesis, we identified several amino acid residues within the transmembrane domain of T1R3 that determine differential responsiveness to cyclamate of the human versus mouse sweet receptors. Alanine-scanning mutagenesis of residues predicted to line a transmembrane domain binding pocket in hT1R3 identified six residues specifically involved in responsiveness to cyclamate. Using molecular modeling, we docked cyclamate within the transmembrane domain of T1R3. Our model predicts substantial overlap in the hT1R3 binding pockets for the agonist cyclamate and the inverse agonist lactisole. The transmembrane domain of T1R3 is likely to play a critical role in the interconversion of the sweet receptor from the ground state to the active state.

  8. The Brassica napus blackleg resistance gene LepR3 encodes a receptor-like protein triggered by the Leptosphaeria maculans effector AVRLM1.

    PubMed

    Larkan, N J; Lydiate, D J; Parkin, I A P; Nelson, M N; Epp, D J; Cowling, W A; Rimmer, S R; Borhan, M H

    2013-01-01

    LepR3, found in the Brassica napus cv 'Surpass 400', provides race-specific resistance to the fungal pathogen Leptosphaeria maculans, which was overcome after great devastation in Australia in 2004. We investigated the LepR3 locus to identify the genetic basis of this resistance interaction. We employed a map-based cloning strategy, exploiting collinearity with the Arabidopsis thaliana and Brassica rapa genomes to enrich the map and locate a candidate gene. We also investigated the interaction of LepR3 with the L. maculans avirulence gene AvrLm1 using transgenics. LepR3 was found to encode a receptor-like protein (RLP). We also demonstrated that avirulence towards LepR3 is conferred by AvrLm1, which is responsible for both the Rlm1 and LepR3-dependent resistance responses in B. napus. LepR3 is the first functional B. napus disease resistance gene to be cloned. AvrLm1's interaction with two independent resistance loci, Rlm1 and LepR3, highlights the need to consider redundant phenotypes in 'gene-for-gene' interactions and offers an explanation as to why LepR3 was overcome so rapidly in parts of Australia.

  9. Enhanced transfection efficiency and targeted delivery of self-assembling h-R3-dendriplexes in EGFR-overexpressing tumor cells.

    PubMed

    Li, Jun; Li, Shengnan; Xia, Songyun; Feng, Jinfeng; Zhang, Xuedi; Hao, Yanli; Chen, Lei; Zhang, Xiaoning

    2015-09-22

    The efficient gene transfection, cellular uptake and targeted delivery in vivo are key issues for non-viral gene delivery vectors in cancer therapy. To solve these issues, we designed a new targeted gene delivery system based on epidermal growth factor receptor (EGFR) targeting strategy. An anti-EGFR monoclonal antibody h-R3 was introduced to dendriplexes of PAMAM and DNA via electrostatic interactions to form self-assembled h-R3-PAMAM-DNA complexes (h-R3-dendriplexes). Dendriplexes h-R3-dendriplexes represented excellent DNA encapsulation ability and formed unique nanostructures. Compared to dendriplexes, h-R3-dendriplexes presented lower cytotoxicity, higher gene transfection efficiency, excellent endosome escape ability and high nuclear accumulation in the EGFR-overexpressing HepG2 cells. Both ex vivo fluorescence imaging and confocal results of frozen section revealed that h-R3-dendriplexes showed higher targeted delivery and much better gene expression in the tumors than dendriplexes at the same N/P ratio, and h-R3-dendriplexes had accumulation primarily in the tumor and kidney. Moreover, h-R3-dendriplexes for p53 delivery indicated efficient cell growth inhibition and potentiated paclitaxel-induced cell death. These results indicate that the h-R3-dendriplexes represent a great potential to be used as efficient targeted gene delivery carriers in EGFR-overexpressing tumor cells.

  10. dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

    PubMed

    Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

    2015-08-11

    The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of

  11. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

    PubMed Central

    Ma, Lisong; Borhan, M. Hossein

    2015-01-01

    The fungus Leptosphaeria maculans (L. maculans) is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus) worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localized cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR). However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1). Silencing of NbSOBIR1 or NbSERK3 (BAK1) compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signaling complex and were able to define the AvrLm1 effector domain. PMID:26579176

  12. Observation of magnetic domain and bubble structures in magnetoelectric S r3C o2F e24O41

    NASA Astrophysics Data System (ADS)

    Nakajima, H.; Kawase, H.; Kurushima, K.; Kotani, A.; Kimura, T.; Mori, S.

    2017-07-01

    The magnetic domain and bubble structures in the Z-type hexaferrite S r3C o2F e24O41 were investigated using Lorentz microscopy. This hexaferrite exhibits a room-temperature magnetoelectric effect that is attributed to its transverse conical spin structure (TC phase). Upon heating, the TC phase transforms into a ferrimagnetic phase with magnetic moments in the hexagonal a b plane between 410 and 480 K (FM2 phase) and into another ferrimagnetic phase with moments parallel to the c axis between 490 and 680 K (FM1 phase). Accordingly, in this study, the magnetic domain structures in S r3C o2F e24O41 were observed to change dramatically with temperature. In the TC phase, irregular fine magnetic domains were observed after cooling the specimen from the FM2 to TC phase. In the FM1 phase, striped magnetic domain walls with pairs of bright and dark contrast were formed parallel to the c axis. Upon applying an external magnetic field, the striped magnetic domain walls transformed into magnetic bubbles. The topology of the magnetic bubbles was dependent on the angle between the external magnetic field (H ) direction and the easy c axis. Namely, magnetic bubbles with the topological number N =1 (type I) were created for H ∥c , whereas magnetic bubbles with N =0 (type II) were created when the magnetic field was tilted from the c axis by 5∘. We attribute the high magnetocrystalline anisotropy of S r3C o2F e24O41 to the emergence of magnetic bubbles in the FM1 phase.

  13. The impact of Ghana's R3M programme on the provision of safe abortions and postabortion care.

    PubMed

    Sundaram, Aparna; Juarez, Fatima; Ahiadeke, Clement; Bankole, Akinrinola; Blades, Nakeisha

    2015-10-01

    In 2006, in response to the high maternal mortality, driven largely by unsafe abortions, the government of Ghana, in partnership with other organizations, launched the reducing maternal mortality and morbidity (R3M) programme in seven districts in Greater Accra, Ashanti and Eastern, to improve comprehensive abortion care services. This article examines whether this intervention made a difference to the provision of safe abortion services and postabortion care (PAC). We also examine the role played by provider attitudes and knowledge of the abortion law, on providers with clinical training in service provision. Primary data on health care providers in Ghana, collected using a quasi-experimental design, were analysed using propensity score weighting. Apart from the treatment group, the sample included two controls: (1) Districts in Accra, Ashanti and Eastern, not exposed to the treatment; and (2) Districts from distant Brong Ahafo, also not exposed to the treatment. The findings show that providers in the treatment group are nearly 16 times as likely to provide safe abortions compared with their peers in Brong Ahafo, and ∼2.5 times as likely compared with providers in the other control group. R3M providers were also different from their peers in providing PAC. Associations between provider attitudes and knowledge of the law on both outcomes were either non-significant or inconsistent including for providers with clinical knowledge of abortion provision. Provider confidence however is strongly associated with service provision. We conclude that the R3M programme is helping safe abortion provision, with the differences being greater with control groups that are geographically distant, perhaps owing to lower contamination from movement of providers between facilities. Increasing provider confidence is key to improving both safe abortion provision and PAC.

  14. The impact of Ghana’s R3M programme on the provision of safe abortions and postabortion care

    PubMed Central

    Sundaram, Aparna; Juarez, Fatima; Ahiadeke, Clement; Bankole, Akinrinola; Blades, Nakeisha

    2015-01-01

    In 2006, in response to the high maternal mortality, driven largely by unsafe abortions, the government of Ghana, in partnership with other organizations, launched the reducing maternal mortality and morbidity (R3M) programme in seven districts in Greater Accra, Ashanti and Eastern, to improve comprehensive abortion care services. This article examines whether this intervention made a difference to the provision of safe abortion services and postabortion care (PAC). We also examine the role played by provider attitudes and knowledge of the abortion law, on providers with clinical training in service provision. Primary data on health care providers in Ghana, collected using a quasi-experimental design, were analysed using propensity score weighting. Apart from the treatment group, the sample included two controls: (1) Districts in Accra, Ashanti and Eastern, not exposed to the treatment; and (2) Districts from distant Brong Ahafo, also not exposed to the treatment. The findings show that providers in the treatment group are nearly 16 times as likely to provide safe abortions compared with their peers in Brong Ahafo, and ∼2.5 times as likely compared with providers in the other control group. R3M providers were also different from their peers in providing PAC. Associations between provider attitudes and knowledge of the law on both outcomes were either non-significant or inconsistent including for providers with clinical knowledge of abortion provision. Provider confidence however is strongly associated with service provision. We conclude that the R3M programme is helping safe abortion provision, with the differences being greater with control groups that are geographically distant, perhaps owing to lower contamination from movement of providers between facilities. Increasing provider confidence is key to improving both safe abortion provision and PAC. PMID:25261230

  15. Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis

    PubMed Central

    Butt, Hamama Islam; Yang, Zhaoen; Chen, Eryong; Zhao, Ge; Gong, Qian; Yang, Zuoren; Zhang, Xueyan

    2017-01-01

    Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop. PMID:28125637

  16. Multiple R2R3-MYB Transcription Factors Involved in the Regulation of Anthocyanin Accumulation in Peach Flower

    PubMed Central

    Zhou, Hui; Peng, Qian; Zhao, Jianbo; Owiti, Albert; Ren, Fei; Liao, Liao; Wang, Lu; Deng, Xianbao; Jiang, Quan; Han, Yuepeng

    2016-01-01

    Anthocyanin accumulation is responsible for flower coloration in peach. Here, we report the identification and functional characterization of eight flavonoid-related R2R3-MYB transcription factors, designated PpMYB10.2, PpMYB9, PpMYBPA1, Peace, PpMYB17, PpMYB18, PpMYB19, and PpMYB20, respectively, in peach flower transcriptome. PpMYB10.2 and PpMYB9 are able to activate transcription of anthocyanin biosynthetic genes, whilst PpMYBPA1 and Peace have a strong activation on the promoters of proanthocyanin (PA) biosynthetic genes. PpMYB17-20 show a strong repressive effect on transcription of flavonoid pathway genes such as dihydroflavonol 4-reductase. These results indicate that anthocyanin accumulation in peach flower is coordinately regulated by a set of R2R3-MYB genes. In addition, PpMYB9 and PpMYB10.2 are closely related but separated into two groups, designated MYB9 and MYB10, respectively. PpMYB9 shows a strong activation on the PpUGT78A2 promoter, but with no effect on the promoter of PpUGT78B (commonly called PpUFGT in previous studies). In contrast, PpMYB10.2 is able to activate the PpUFGT promoter, but not for the PpUGT78A2 promoter. Unlike the MYB10 gene that is universally present in plants, the MYB9 gene is lost in most dicot species. Therefore, the PpMYB9 gene represents a novel group of anthocyanin-related MYB activators, which may have diverged in function from the MYB10 genes. Our study will aid in understanding the complex mechanism regulating floral pigmentation in peach and functional divergence of the R2R3-MYB gene family in plants. PMID:27818667

  17. Biosurfactins production by Bacillus amyloliquefaciens R3 and their antibacterial activity against multi-drug resistant pathogenic E. coli.

    PubMed

    Chi, Zhe; Rong, Yan-Jun; Li, Yang; Tang, Mei-Juan; Chi, Zhen-Ming

    2015-05-01

    In this work, the anti-Escherichia coli activity of the bioactive substances produced by Bacillus amyloliquefaciens R3 was examined. A new and cheap medium for production of the anti-E. coli substances which contained 20.0 g L(-1) soybean powder, 20.0 g L(-1) wheat flour, pH 6.0 was developed. A crude surfactant concentration of 0.48 mg mL(-1) was obtained after 27 h of 10-L fermentation, and the diameter of the clear zone on the plate seeded with the pathogenic E. coli 2# was 23.3 mm. A preliminary characterization suggested that the anti-E. coli substances produced by B. amyloliquefaciens R3 were the biosurfactins (F1, F2, F3, F4, and F5) with amino acids (GLLVDLL) and hydroxy fatty acids (of 12-15 carbons in length). It was found that all the strains of the pathogenic E. coli showed resistance to several different antibiotics, suggesting that they were the multi-drug resistance and all the strains of the pathogenic E. coli were sensitive to the biosurfactins, indicating that the biosurfactins produced by B. amyloliquefaciens R3 had a broad spectrum of antibacterial activity against the pathogenic E. coli with multi-drug resistant profiles. After the treatment with the purified biosurfactin (F1), the cell membrane of both the whole cells and protoplasts of the E. coli 2# was damaged and the whole cells of the bacterium were broken.

  18. Lactisole inhibits the glucose-sensing receptor T1R3 expressed in mouse pancreatic β-cells.

    PubMed

    Hamano, Kunihisa; Nakagawa, Yuko; Ohtsu, Yoshiaki; Li, Longfei; Medina, Johan; Tanaka, Yuji; Masuda, Katsuyoshi; Komatsu, Mitsuhisa; Kojima, Itaru

    2015-07-01

    Glucose activates the glucose-sensing receptor T1R3 and facilitates its own metabolism in pancreatic β-cells. An inhibitor of this receptor would be helpful in elucidating the physiological function of the glucose-sensing receptor. The present study was conducted to examine whether or not lactisole can be used as an inhibitor of the glucose-sensing receptor. In MIN6 cells, in a dose-dependent manner, lactisole inhibited insulin secretion induced by sweeteners, acesulfame-K, sucralose and glycyrrhizin. The IC50 was ∼4 mmol/l. Lactisole attenuated the elevation of cytoplasmic Ca2+ concentration ([Ca2+]c) evoked by sucralose and acesulfame-K but did not affect the elevation of intracellular cAMP concentration ([cAMP]c) induced by these sweeteners. Lactisole also inhibited the action of glucose in MIN6 cells. Thus, lactisole significantly reduced elevations of intracellular [NADH] and intracellular [ATP] induced by glucose, and also inhibited glucose-induced insulin secretion. To further examine the effect of lactisole on T1R3, we prepared HEK293 cells stably expressing mouse T1R3. In these cells, sucralose elevated both [Ca2+]c and [cAMP]c. Lactisole attenuated the sucralose-induced increase in [Ca2+]c but did not affect the elevation of [cAMP]c. Finally, lactisole inhibited insulin secretion induced by a high concentration of glucose in mouse islets. These results indicate that the mouse glucose-sensing receptor was inhibited by lactisole. Lactisole may be useful in assessing the role of the glucose-sensing receptor in mouse pancreatic β-cells.

  19. Return of the glucoreceptor: Glucose activates the glucose-sensing receptor T1R3 and facilitates metabolism in pancreatic β-cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Ohtsu, Yoshiaki; Hamano, Kunihisa; Medina, Johan; Nagasawa, Masahiro

    2015-05-01

    Subunits of the sweet taste receptor, namely T1R2 and T1R3, are expressed in mouse pancreatic islets. Quantitatively, the expression of messenger ribonucleic acid for T1R2 is much lower than that of T1R3, and immunoreactive T1R2 is in fact undetectable. Presumably, a homodimer of T1R3 could function as a signaling receptor. Activation of this receptor by adding an artificial sweetener, sucralose, leads to an increase in intracellular adenosine triphosphate ([ATP]c). This increase in [ATP]c is observed in the absence of ambient glucose. Sucralose also augments elevation of [ATP]c induced by methylsuccinate, a substrate for mitochondria. Consequently, activation of T1R3 promotes metabolism in mitochondria and increases [ATP]c. 3-O-Methylglucose, a non-metabolizable analog of glucose, also increases [ATP]c. Conversely, knockdown of T1R3 attenuates elevation of [ATP]c induced by glucose. Hence, glucose promotes its own metabolism by activating T1R3 and augmenting ATP production. Collectively, a homodimer of T1R3 functions as a cell surface glucose-sensing receptor and participates in the action of glucose on insulin secretion. The glucose-sensing receptor T1R3 might be the putative glucoreceptor proposed decades ago by Niki et al. The glucose-sensing receptor is involved in the action of glucose and modulates glucose metabolism in pancreatic β-cells.

  20. Synthesis of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, and evaluation of its proteasome inhibitory activities

    PubMed Central

    Osanai, Kumi; Huo, Congde; Landis-Piwowar, Kristin R.; Dou, Q. Ping; Chan, Tak Hang

    2010-01-01

    The total and semi syntheses of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, was accomplished. The proteasome inhibition and cytotoxic activities of the synthetic compound and its acetyl derivative were studied and compared with (2R, 3R)-epigallocatechin-3-gallate (EGCG), the active component from green tea. PMID:21152270

  1. Synthesis of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, and evaluation of its proteasome inhibitory activities.

    PubMed

    Osanai, Kumi; Huo, Congde; Landis-Piwowar, Kristin R; Dou, Q Ping; Chan, Tak Hang

    2007-08-06

    The total and semi syntheses of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, was accomplished. The proteasome inhibition and cytotoxic activities of the synthetic compound and its acetyl derivative were studied and compared with (2R, 3R)-epigallocatechin-3-gallate (EGCG), the active component from green tea.

  2. Mechanistic basis for functional promiscuity in the TNF and TNF receptor superfamilies: structure of the LIGHT:DcR3 assembly.

    PubMed

    Liu, Weifeng; Zhan, Chenyang; Cheng, Huiyong; Kumar, P Rajesh; Bonanno, Jeffrey B; Nathenson, Stanley G; Almo, Steven C

    2014-09-02

    LIGHT initiates intracellular signaling via engagement of the two TNF receptors, HVEM and LTβR. In humans, LIGHT is neutralized by DcR3, a unique soluble member of the TNFR superfamily, which tightly binds LIGHT and inhibits its interactions with HVEM and LTβR. DcR3 also neutralizes two other TNF ligands, FasL and TL1A. Due to its ability to neutralize three distinct different ligands, DcR3 contributes to a wide range of biological and pathological processes, including cancer and autoimmune diseases. However, the mechanisms that support the broad specificity of DcR3 remain to be fully defined. We report the structures of LIGHT and the LIGHT:DcR3 complex, which reveal the structural basis for the DcR3-mediated neutralization of LIGHT and afford insights into DcR3 function and binding promiscuity. Based on these structures, we designed LIGHT mutants with altered affinities for DcR3 and HVEM, which may represent mechanistically informative probe reagents.

  3. Specific elevation of DcR3 in sera of sepsis patients and its potential role as a clinically important biomarker of sepsis

    PubMed Central

    Kim, Sunghee; Mi, Lijun; Zhang, Lurong

    2012-01-01

    Because of its potentially important role in the pathogenesis of sepsis, the expression of soluble decoy receptor 3 (DcR3) was investigated in sera of sepsis patients. The serum levels of DcR3 and its TNF-like ligand TL1A and homologous decoy receptor OPG were quantified by ELISA. The values of DcR3 to diagnose sepsis were analyzed by receiver-operating characteristic (ROC) curves. The results showed that DcR3 was significantly elevated in sepsis compared to SIRS (systemic inflammatory response syndrome), a condition similar to sepsis but resulting from noninfectious insults. DcR3 showed superior area under the ROC curve (AUC, 0.958) compared to poor AUCs of TL1A and OPG. At a cut-off of 3.24 ng/ml, DcR3 predicted sepsis from SIRS with 96% sensitivity and 82.6% specificity. DcR3 also predicted sepsis from cancer and inflammatory bowel disease with equally excellent values. Therefore, DcR3 serum level has the potential to serve as a reliable biomarker of sepsis. PMID:22647538

  4. Cluster bulleticity

    NASA Astrophysics Data System (ADS)

    Massey, Richard; Kitching, Thomas; Nagai, Daisuke

    2011-05-01

    The unique properties of dark matter are revealed during collisions between clusters of galaxies, such as the bullet cluster (1E 0657-56) and baby bullet (MACS J0025-12). These systems provide evidence for an additional, invisible mass in the separation between the distributions of their total mass, measured via gravitational lensing, and their ordinary 'baryonic' matter, measured via its X-ray emission. Unfortunately, the information available from these systems is limited by their rarity. Constraints on the properties of dark matter, such as its interaction cross-section, are therefore restricted by uncertainties in the individual systems' impact velocity, impact parameter and orientation with respect to the line of sight. Here we develop a complementary, statistical measurement in which every piece of substructure falling into every massive cluster is treated as a bullet. We define 'bulleticity' as the mean separation between dark matter and ordinary matter, and we measure the signal in hydrodynamical simulations. The phase space of substructure orbits also exhibits symmetries that provide an equivalent control test. Any detection of bulleticity in real data would indicate a difference in the interaction cross-sections of baryonic and dark matter that may rule out hypotheses of non-particulate dark matter that are otherwise able to model individual systems. A subsequent measurement of bulleticity could constrain the dark matter cross-section. Even with conservative estimates, the existing Hubble Space Telescope archive should yield an independent constraint tighter than that from the bullet cluster. This technique is then trivially extendable to and benefits enormously from larger, future surveys.

  5. Membrane-Bound CYB5R3 Is a Common Effector of Nutritional and Oxidative Stress Response Through FOXO3a and Nrf2

    PubMed Central

    Siendones, Emilio; SantaCruz-Calvo, Sara; Martín-Montalvo, Alejandro; Cascajo, María V.; Ariza, Julia; López-Lluch, Guillermo; Villalba, José M.; Acquaviva-Bourdain, Cécile; Roze, Emmanuel; Bernier, Michel; de Cabo, Rafael

    2014-01-01

    Abstract Aims: Membrane-bound CYB5R3 deficiency in humans causes recessive hereditary methaemoglobinaemia (RHM), an incurable disease that is characterized by severe neurological disorders. CYB5R3 encodes for NADH-dependent redox enzyme that contributes to metabolic homeostasis and stress protection; however, how it is involved in the neurological pathology of RHM remains unknown. Here, the role and transcriptional regulation of CYB5R3 was studied under nutritional and oxidative stress. Results: CYB5R3-deficient cells exhibited a decrease of the NAD+/NADH ratio, mitochondrial respiration rate, ATP production, and mitochondrial electron transport chain activities, which were associated with higher sensitivity to oxidative stress, and an increase in senescence-associated β-galactosidase activity. Overexpression of either forkhead box class O 3a (FOXO3a) or nuclear factor (erythroid-derived 2)-like2 (Nrf2) was associated with increased CYB5R3 levels, and genetic ablation of Nrf2 resulted in lower CYB5R3 expression. The presence of two antioxidant response element sequences in the CYB5R3 promoter led to chromatin immunoprecipitation studies, which showed that cellular stressors enhanced the binding of Nrf2 and FOXO3a to the CYB5R3 promoter. Innovation: Our findings demonstrate that CYB5R3 contributes to regulate redox homeostasis, aerobic metabolism, and cellular senescence, suggesting that CYB5R3 might be a key effector of oxidative and nutritional stress pathways. The expression of CYB5R3 is regulated by the cooperation of Nrf2 and FOXO3a. Conclusion: CYB5R3 is an essential gene that appears as a final effector for both nutritional and oxidative stress responses through FOXO3a and Nrf2, respectively, and their interaction promotes CYB5R3 expression. These results unveil a potential mechanism of action by which CYB5R3 deficiency contributes to the pathophysiological underpinnings of neurological disorders in RHM patients. Antioxid. Redox Signal. 21, 1708–1725. PMID

  6. Protein phosphatase complex PP5/PPP2R3C dephosphorylates P-glycoprotein/ABCB1 and down-regulates the expression and function.

    PubMed

    Katayama, Kazuhiro; Yamaguchi, Miho; Noguchi, Kohji; Sugimoto, Yoshikazu

    2014-04-01

    P-glycoprotein (P-gp)/ABCB1 is a key molecule of multidrug resistance in cancer. Protein phosphatase (PP) 2A, regulatory subunit B, gamma (PPP2R3C), which is a regulatory subunit of PP2A and PP5, was identified as a binding candidate to P-gp. Immunoprecipitation-western blotting revealed that PP5 and PPP2R3C were coprecipitated with P-gp, while PP2A was not. PP5/PPP2R3C dephosphorylated protein kinase A/protein kinase C-phosphorylation of P-gp. Knockdown of PP5 and/or PPP2R3C increased P-gp expression and lowered the sensitivity to vincristine and doxorubicin. Consequently, our results indicate that PP5/PPP2R3C negatively regulates P-gp expression and function.

  7. Electrically tunable transport and high-frequency dynamics in antiferromagnetic S r3I r2O7

    NASA Astrophysics Data System (ADS)

    Seinige, Heidi; Williamson, Morgan; Shen, Shida; Wang, Cheng; Cao, Gang; Zhou, Jianshi; Goodenough, John B.; Tsoi, Maxim

    2016-12-01

    We report dc and high-frequency transport properties of antiferromagnetic S r3I r2O7 . Temperature-dependent resistivity measurements show that the activation energy of this material can be tuned by an applied dc electrical bias. The latter allows for continuous variations in the sample resistivity of as much as 50% followed by a reversible resistive switching at higher biases. Such a switching is of high interest for antiferromagnetic applications in high-speed memory devices. Interestingly, we found the switching behavior to be strongly affected by a high-frequency (microwave) current applied to the sample. The microwaves at 3-7 GHz suppress the dc switching and produce resonancelike features that we tentatively associated with the dissipationless magnonics recently predicted to occur in antiferromagnetic insulators subject to ac electric fields. We have characterized the effects of microwave irradiation on electronic transport in S r3I r2O7 as a function of microwave frequency and power, strength and direction of external magnetic field, strength and polarity of applied dc bias, and temperature. Our observations support the potential of antiferromagnetic materials for high-speed/high-frequency spintronic applications.

  8. Microbial synthesis of poly((R)-3-hydroxybutyrate-co-3-hydroxypropionate) from unrelated carbon sources by engineered Cupriavidus necator.

    PubMed

    Fukui, Toshiaki; Suzuki, Mamie; Tsuge, Takeharu; Nakamura, Satoshi

    2009-04-13

    Cupriavidus necator was engineered aiming to synthesize poly[(R)-3-hydroxybutyrate-co-3-hydroxypropionate] copolyester, P(3HB-co-3HP), from structurally unrelated carbon sources without addition of any precursor compounds. We modified a metabolic pathway in C. necator for generation of 3-hydroxypropionyl-CoA (3HP-CoA) by introducing malonyl-CoA reductase and the 3HP-CoA synthetase domain of trifunctional propionyl-CoA synthase; both members of the 3-hydroxypropionate cycle, a novel CO(2)-fixation pathway in the green nonsulfur bacterium Chloroflexus aurantiacus . In this recombinant strain, 3HP-CoA was expected to be provided from acetyl-CoA via malonyl-CoA, and then copolymerized by the function of polyhydroxyalkanoate synthase along with (R)-3-hydroxybutyryl-CoA synthesized from two acetyl-CoA molecules. C. necator wild-type strains H16 and JMP134 harboring the two heterologous genes actually synthesized P(3HB-co-3HP) copolyester with 0.2-2.1 mol % of 3HP fraction from fructose or alkanoic acids of even carbon numbers. Enzyme assay suggested that lower activity of 3HP-CoA synthetase than that of malonyl-CoA reductase caused the limited incorporation of 3HP unit into the copolyesters synthesized by the recombinant strains. The present study demonstrates the potential of engineering metabolic pathways for production of copolyesters having favorable characteristics from inexpensive carbon resources.

  9. CONSTRAINTS ON THE PHYSICAL PROPERTIES OF MAIN BELT COMET P/2013 R3 FROM ITS BREAKUP EVENT

    SciTech Connect

    Hirabayashi, Masatoshi; Sánchez, Diego Paul; Gabriel, Travis; Scheeres, Daniel J.

    2014-07-01

    Jewitt et al. recently reported that main belt comet P/2013 R3 experienced a breakup, probably due to rotational disruption, with its components separating on mutually hyperbolic orbits. We propose a technique for constraining physical properties of the proto-body, especially the initial spin period and cohesive strength, as a function of the body's estimated size and density. The breakup conditions are developed by combining mutual orbit dynamics of the smaller components and the failure condition of the proto-body. Given a proto-body with a bulk density ranging from 1000 kg m{sup –3} to 1500 kg m{sup –3} (a typical range of the bulk density of C-type asteroids), we obtain possible values of the cohesive strength (40-210 Pa) and the initial spin state (0.48-1.9 hr). From this result, we conclude that although the proto-body could have been a rubble pile, it was likely spinning beyond its gravitational binding limit and would have needed cohesive strength to hold itself together. Additional observations of P/2013 R3 will enable stronger constraints on this event, and the present technique will be able to give more precise estimates of its internal structure.

  10. Expression of the sweetpotato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis.

    PubMed

    Chu, Hyosub; Jeong, Jae Cheol; Kim, Wook-Jin; Chung, Dong Min; Jeon, Hyo Kon; Ahn, Young Ock; Kim, Sun Ha; Lee, Haeng-Soon; Kwak, Sang-Soo; Kim, Cha Young

    2013-06-01

    R2R3-type MYB transcription factors (TFs) play important roles in transcriptional regulation of anthocyanins. The R2R3-type IbMYB1 is known to be a key regulator of anthocyanin biosynthesis in the storage roots of sweetpotato. We previously showed that transient expression of IbMYB1a led to anthocyanin pigmentation in tobacco leaves. In this article, we generated transgenic Arabidopsis plants expressing the IbMYB1a gene under the control of CaMV 35S promoter, and the sweetpotato SPO and SWPA2 promoters. Overexpression of IbMYBa in transgenic Arabidopsis produced strong anthocyanin pigmentation in seedlings and generated a deep purple color in leaves, stems and seeds. Reverse transcription-polymerase chain reaction analysis showed that IbMYB1a expression induced upregulation of several structural genes in the anthocyanin biosynthetic pathway, including 4CL, CHI, F3'H, DFR, AGT, AAT and GST. Furthermore, overexpression of IbMYB1a led to enhanced expression of the AtTT8 (bHLH) and PAP1/AtMYB75 genes. high-performance liquid chromatography analysis revealed that IbMYB1a expression led to the production of cyanidin as a major core molecule of anthocyanidins in Arabidopsis, as occurs in the purple leaves of sweetpotato (cv. Sinzami). This result shows that the IbMYB1a TF is sufficient to induce anthocyanin accumulation in seedlings, leaves, stems and seeds of Arabidopsis plants.

  11. Genome-wide analysis of the R2R3-MYB transcription factor gene family in sweet orange (Citrus sinensis).

    PubMed

    Liu, Chaoyang; Wang, Xia; Xu, Yuantao; Deng, Xiuxin; Xu, Qiang

    2014-10-01

    MYB transcription factor represents one of the largest gene families in plant genomes. Sweet orange (Citrus sinensis) is one of the most important fruit crops worldwide, and recently the genome has been sequenced. This provides an opportunity to investigate the organization and evolutionary characteristics of sweet orange MYB genes from whole genome view. In the present study, we identified 100 R2R3-MYB genes in the sweet orange genome. A comprehensive analysis of this gene family was performed, including the phylogeny, gene structure, chromosomal localization and expression pattern analyses. The 100 genes were divided into 29 subfamilies based on the sequence similarity and phylogeny, and the classification was also well supported by the highly conserved exon/intron structures and motif composition. The phylogenomic comparison of MYB gene family among sweet orange and related plant species, Arabidopsis, cacao and papaya suggested the existence of functional divergence during evolution. Expression profiling indicated that sweet orange R2R3-MYB genes exhibited distinct temporal and spatial expression patterns. Our analysis suggested that the sweet orange MYB genes may play important roles in different plant biological processes, some of which may be potentially involved in citrus fruit quality. These results will be useful for future functional analysis of the MYB gene family in sweet orange.

  12. T1R3 and gustducin in gut sense sugars to regulate expression of Na+-glucose cotransporter 1

    PubMed Central

    Margolskee, Robert F.; Dyer, Jane; Kokrashvili, Zaza; Salmon, Kieron S. H.; Ilegems, Erwin; Daly, Kristian; Maillet, Emeline L.; Ninomiya, Yuzo; Mosinger, Bedrich; Shirazi-Beechey, Soraya P.

    2007-01-01

    Dietary sugars are transported from the intestinal lumen into absorptive enterocytes by the sodium-dependent glucose transporter isoform 1 (SGLT1). Regulation of this protein is important for the provision of glucose to the body and avoidance of intestinal malabsorption. Although expression of SGLT1 is regulated by luminal monosaccharides, the luminal glucose sensor mediating this process was unknown. Here, we show that the sweet taste receptor subunit T1R3 and the taste G protein gustducin, expressed in enteroendocrine cells, underlie intestinal sugar sensing and regulation of SGLT1 mRNA and protein. Dietary sugar and artificial sweeteners increased SGLT1 mRNA and protein expression, and glucose absorptive capacity in wild-type mice, but not in knockout mice lacking T1R3 or α-gustducin. Artificial sweeteners, acting on sweet taste receptors expressed on enteroendocrine GLUTag cells, stimulated secretion of gut hormones implicated in SGLT1 up-regulation. Gut-expressed taste signaling elements involved in regulating SGLT1 expression could provide novel therapeutic targets for modulating the gut's capacity to absorb sugars, with implications for the prevention and/or treatment of malabsorption syndromes and diet-related disorders including diabetes and obesity. PMID:17724332

  13. Liquefied Wood as Inexpensive Precursor-Feedstock for Bio-Mediated Incorporation of (R)-3-Hydroxyvalerate into Polyhydroxyalkanoates

    PubMed Central

    Koller, Martin; Miranda de Sousa Dias, Miguel; Rodríguez-Contreras, Alejandra; Kunaver, Matjaž; Žagar, Ema; Kržan, Andrej; Braunegg, Gerhart

    2015-01-01

    Liquefied wood (LW) prepared in a microwave process was applied as a novel; inexpensive precursor feedstock for incorporation of (R)-3-hydroxyvalerate (3HV) into polyhydroxyalkanoate (PHA) biopolyesters in order to improve the biopolyester’s material quality; Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a shake flask scale using different mixtures of glucose and LW as carbon source. The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. As major outcome, a poly(3HB-co-0.8%-3HV) copolyester was obtained displaying a desired high molar mass of Mw = 5.39 × 105 g/mol at low molar-mass dispersity (ĐM of 1.53), a degree of crystallinity (Xc) of 62.1%, and melting temperature Tm (176.3 °C) slightly lower than values reported for poly([R]-3-hydroxybutyrate) (PHB) homopolyester produced by C. necator; thus, the produced biopolyester is expected to be more suitable for polymer processing purposes. PMID:28793581

  14. Liquefied Wood as Inexpensive Precursor-Feedstock for Bio-Mediated Incorporation of (R)-3-Hydroxyvalerate into Polyhydroxyalkanoates.

    PubMed

    Koller, Martin; Dias, Miguel Miranda de Sousa; Rodríguez-Contreras, Alejandra; Kunaver, Matjaž; Žagar, Ema; Kržan, Andrej; Braunegg, Gerhart

    2015-09-23

    Liquefied wood (LW) prepared in a microwave process was applied as a novel; inexpensive precursor feedstock for incorporation of (R)-3-hydroxyvalerate (3HV) into polyhydroxyalkanoate (PHA) biopolyesters in order to improve the biopolyester's material quality; Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a shake flask scale using different mixtures of glucose and LW as carbon source. The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. As major outcome, a poly(3HB-co-0.8%-3HV) copolyester was obtained displaying a desired high molar mass of Mw = 5.39 × 10⁵ g/mol at low molar-mass dispersity (ĐM of 1.53), a degree of crystallinity (Xc) of 62.1%, and melting temperature Tm (176.3 °C) slightly lower than values reported for poly([R]-3-hydroxybutyrate) (PHB) homopolyester produced by C. necator; thus, the produced biopolyester is expected to be more suitable for polymer processing purposes.

  15. Ultrafast transient lens spectroscopy of various C40 carotenoids: lycopene, beta-carotene, (3R,3'R)-zeaxanthin, (3R,3'R,6'R)-lutein, echinenone, canthaxanthin, and astaxanthin.

    PubMed

    Kopczynski, Matthäus; Lenzer, Thomas; Oum, Kawon; Seehusen, Jaane; Seidel, Marco T; Ushakov, Vladimir G

    2005-07-21

    The ultrafast internal conversion (IC) dynamics of seven C(40) carotenoids have been investigated at room temperature in a variety of solvents using two-color transient lens (TL) pump-probe spectroscopy. We provide comprehensive data sets for the carbonyl carotenoids canthaxanthin, astaxanthin, and-for the first time-echinenone, as well as new data for lycopene, beta-carotene, (3R,3'R)-zeaxanthin and (3R,3'R,6'R)-lutein in solvents which have not yet been investigated in the literature. Measurements were carried out to determine, how the IC processes are influenced by the conjugation length of the carotenoids, additional substituents and the polarity of the solvent. TL signals were recorded at 800 nm following excitation into the high energy edge of the carotenoid S2 band at 400 nm. For the S2 lifetime solvent-independent upper limits on the order of 100-200 fs are estimated for all carotenoids studied. The S1 lifetimes are in the picosecond range and increase systematically with decreasing conjugation length. For instance, in the sequence canthaxanthin/echinenone/beta-carotene (13/12/11 double bonds) one finds tau1 approximately 5, 7.7 and 9 ps for the S1-->S0 IC process, respectively. Hydroxyl groups not attached to the conjugated system have no apparent influence on tau1, as observed for canthaxanthin/astaxanthin (tau1 approximately 5 ps in both cases). For all carotenoids studied, tau1 is found to be insensitive to the solvent polarity. This is particularly interesting in the case of echinenone, canthaxanthin and astaxanthin, because earlier measurements for other carbonyl carotenoids like, e.g., peridinin partly showed dramatic differences. The likely presence of an intramolecular charge transfer state in the excited state manifold of C40 carbonyl carotenoids, which is stabilized in polar solvents, has obviously no influence on the measured tau1.

  16. Identification, isolation and expression analysis of eight stress-related R2R3-MYB genes in tartary buckwheat (Fagopyrum tataricum).

    PubMed

    Gao, Fei; Zhao, Hai-Xia; Yao, Hui-Peng; Li, Cheng-Lei; Chen, Hui; Wang, An-Hu; Park, Sang-Un; Wu, Qi

    2016-06-01

    Eight R2R3 - MYB genes in tartary buckwheat were identified, and their expression patterns were comprehensively analyzed, which reveals role in plant response to abiotic stresses. The proteins of the R2R3-MYB superfamily play key roles in the growth and development processes as well as defense responses in plants. However, their characteristics and functions have not been fully investigated in tartary buckwheat (Fagopyrum tataricum), a strongly abiotic resistant coarse cereal. In this article, eight tartary buckwheat R2R3-MYB genes were isolated with full-length cDNA and DNA sequences. Phylogenetic analysis of the members of the R2R3-MYB superfamily between Arabidopsis and tartary buckwheat revealed that the assumed functions of the eight tartary buckwheat R2R3-MYB proteins are divided into five Arabidopsis functional subgroups that are involved in abiotic stress. Expression analysis during abiotic stress and exogenous phytohormone treatments identified that the eight R2R3-MYB genes responded to one or more treatments. This study is the first comprehensive analysis of the R2R3-MYB gene family in tartary buckwheat under abiotic stress.

  17. Five amino acid residues in cysteine-rich domain of human T1R3 were involved in the response for sweet-tasting protein, thaumatin.

    PubMed

    Masuda, Tetsuya; Taguchi, Wakana; Sano, Ayane; Ohta, Keisuke; Kitabatake, Naofumi; Tani, Fumito

    2013-07-01

    Thaumatin, a sweet-tasting plant protein, elicits a sweet taste sensation at 50 nM in humans but not rodents. Although it was shown that the cysteine-rich domain (CRD) of human T1R3 (hT1R3) is important for the response to thaumatin, the amino acid residues within CRD critical for response are still unknown. A comparison of the amino acid sequence (69 amino acid residues) of CRD between hT1R3 and mouse T1R3 (mT1R3) revealed sixteen amino acids that differ. In the present study, we converted each of these sixteen amino acids in hT1R3 to their mouse counterpart and examined the response to thaumatin and sucralose using a cell-based assay. No significant decrease in the response to sucralose was seen among any of the sixteen mutants. However, five mutants (Q504K, A537T, R556P, S559P, and R560K) exhibited a significantly diminished response to thaumatin. The five critical residues involved in the response to thaumatin were dispersed in the CRD of hT1R3 and widely distributed when compared to brazzein. The unique intense sweet-taste of thaumatin might be attributed to the different receptor activation mechanism compared to the small molecule sweetener sucralose. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Structural, electronic and thermodynamic properties of R3ZnH5 (R=K, Rb, Cs): A first-principle calculation

    NASA Astrophysics Data System (ADS)

    Li, Jia; Zhang, Shengli; Huang, Shiping; Wang, Peng; Tian, Huiping

    2013-02-01

    R3ZnH5 (R=K, Rb, Cs) series have been investigated with respect to the crystal structure, electronic and thermodynamic properties using first-principle methods based on density functional theory with generalized gradient approximation. The optimized structures and atomic coordinates are in good agreement with the experimental data. The strong covalent interactions are obtained between Zn and H atoms in the 18-electron [ZnH4]2- complex, while an ionic interaction is found between [ZnH4]2- and R atom. The formation enthalpies show that the formations of R3ZnH5 hydrides are all exothermic at 298 K. The vibration free energies of R3ZnH5 show that the thermodynamic stabilities of R3ZnH5 hydrides decrease with the increasing diameter of R atom. Two possible decomposition reactions of R3ZnH5 series have been suggested in our work. One (reaction one) is that R3ZnH5 hydrides decomposes to elements directly, and the other (reaction two) is that R3ZnH5 hydrides decomposes to RH hydride. The results show that the first decomposition reaction is more favorable one. The spontaneous decomposition reaction of K3ZnH5 hydrides occur upon 465 K via reaction one, and 564 K via reaction two, respectively.

  19. Recombinant expression, in vitro refolding, and biophysical characterization of the N-terminal domain of T1R3 taste receptor.

    PubMed

    Maîtrepierre, Elodie; Sigoillot, Maud; Le Pessot, Laurence; Briand, Loïc

    2012-05-01

    The sweet taste receptor is a heterodimeric receptor composed of the T1R2 and T1R3 subunits, while T1R1 and T1R3 assemble to form the umami taste receptor. T1R receptors belong to the family of class C G-protein coupled receptors (GPCRs). In addition to a transmembrane heptahelical domain, class C GPCRs have a large extracellular N-terminal domain (NTD), which is the primary ligand-binding site. The T1R2 and T1R1 subunits have been shown to be responsible for ligand binding, via their NTDs. However, little is known about the contribution of T1R3-NTD to receptor functions. To enable biophysical characterization, we overexpressed the human NTD of T1R3 (hT1R3-NTD) using Escherichia coli in the form of inclusion bodies. Using a fractional factorial screen coupled to a functional assay, conditions were determined for the refolding of hT1R3-NTD. Far-UV circular dichroism spectroscopic studies revealed that hT1R3-NTD was well refolded. Using size-exclusion chromatography, we found that the refolded protein behaves as a dimer. Ligand binding quantified by tryptophan fluorescence quenching and microcalorimetry showed that hT1R3-NTD is functional and capable of binding sucralose with an affinity in the millimolar range. This study also provides a strategy to produce functional hT1R3-NTD by heterologous expression in E. coli; this is a prerequisite for structural determination and functional analysis of ligand-binding regions of other class C GPCRs. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Magnetic nanosized rare earth iron garnets R3Fe5O12: Sol-gel fabrication, characterization and reinspection

    NASA Astrophysics Data System (ADS)

    Opuchovic, Olga; Kareiva, Aivaras; Mazeika, Kestutis; Baltrunas, Dalis

    2017-01-01

    The magnetic nanosized rare earth iron garnets (R3Fe5O12, where R=Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu) were prepared by an aqueous sol-gel method. Herein we present, that all these garnets can be obtained by this effective synthesis method simply by changing the temperature of the final annealing. It was also demonstrated, that a different annealing temperature leads to a different particle size distribution of the final product. The SEM analysis results revealed that the smallest particles were formed in the range of 75-130 nm. The phase purity and structure of the rare earth iron garnets were estimated using XRD analysis and Mössbauer spectroscopy. Magnetic properties were determined by magnetization measurements. The relation between the particle size, composition and magnetic properties of the sol-gel derived garnets were also discussed in this study.

  1. On the stability of triangular points in the relativistic R3BP with oblate primaries and bigger radiating

    NASA Astrophysics Data System (ADS)

    Bello, Nakone; Singh, Jagadish

    2016-01-01

    We consider a version of the relativistic R3BP which includes the effects of oblateness of the primaries and radiation of the bigger primary as well on the stability of triangular points. We observe that the positions of the triangular points and their stability are affected by the relativistic effect apart from the radiation and oblateness of the primaries. It is further seen for these points that the range of stability region increases or decreases according as the part of the critical mass value, depending upon relativistic terms, radiation and oblateness coefficients, is positive or negative. A numerical exploration shows that in the Sun-Saturn, Sun-Uranus, Sun-Neptune systems, the oblateness has no influence on their positions and range of stability region; whereas it has a little influence on the Sun-Mars, Sun-Jupiter systems. On the other hand, we found that radiation pressure has an observable effect on the solar system.

  2. Structure-activity relationship of daptomycin analogues with substitution at (2S, 3R) 3-methyl glutamic acid position.

    PubMed

    Lin, Du'an; Lam, Hiu Yung; Han, Wenbo; Cotroneo, Nicole; Pandya, Bhaumik A; Li, Xuechen

    2017-02-01

    Daptomycin is a highly effective lipopeptide antibiotic against Gram-positive pathogens. The presence of (2S, 3R) 3-methyl glutamic acid (mGlu) in daptomycin has been found to be important to the antibacterial activity. However the role of (2S, 3R) mGlu is yet to be revealed. Herein, we reported the syntheses of three daptomycin analogues with (2S, 3R) mGlu substituted by (2S, 3R) methyl glutamine (mGln), dimethyl glutamic acid and (2S, 3R) ethyl glutamic acid (eGlu), respectively, and their antibacterial activities. The detailed synthesis of dimethyl glutamic acid was also reported. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. (2R, 3S)-Pinobanksin-3-cinnamate ameliorates photoreceptor degeneration in Pde6(rd)(10) mice.

    PubMed

    Li, Yin; Li, Tuo; Li, Jia-Zhang; Wu, Qing-Song

    2017-09-01

    As an inherited disorder caused by initial death of rod photoreceptors, retinitis pigmentosa is currently untreatable and usually leads to partial or complete blindness. (2R, 3S)-Pinobanksin-3-cinnamate (PC) is a new flavonone isolated from the seed of Alpinia galanga Willd, and has been reported to exert neuroprotective effects by upregulating endogenous antioxidant enzymes. In this study, the anti-oxidative and neuroprotective activity of PC against photoreceptor apoptosis in rd10 mouse model of retinitis pigmentosa was explored. PC showed to produce significant improvement in histology and function in rd10 mice through reducing oxidative stress. For the first time, the protective effects of PC were demonstrated against retina degeneration in rd10 mice and our study provides scientific rationale on using PC as the supplementary treatment to the outer retina diseases, including retinitis pigmentosa, in which oxidative stress is thought to contribute to disease progression.

  4. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles1

    PubMed Central

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C.; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-01-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (EMISSION OF BENZENOID II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of CINNAMYL ALCOHOL DEHYDROGENASE1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  5. A single-repeat R3-MYB transcription factor MYBC1 negatively regulates freezing tolerance in Arabidopsis

    SciTech Connect

    Zhai, Hong; Bai, Xi; Zhu, Yanming; Li, Yong; Cai, Hua; Ji, Wei; Ji, Zuojun; Liu, Xiaofei; Liu, Xin; Li, Jing

    2010-04-16

    We had previously identified the MYBC1 gene, which encodes a single-repeat R3-MYB protein, as a putative osmotic responding gene; however, no R3-MYB transcription factor has been reported to regulate osmotic stress tolerance. Thus, we sought to elucidate the function of MYBC1 in response to osmotic stresses. Real-time RT-PCR analysis indicated that MYBC1 expression responded to cold, dehydration, salinity and exogenous ABA at the transcript level. mybc1 mutants exhibited an increased tolerance to freezing stress, whereas 35S::MYBC1 transgenic plants exhibited decreased cold tolerance. Transcript levels of some cold-responsive genes, including CBF/DREB genes, KIN1, ADC1, ADC2 and ZAT12, though, were not altered in the mybc1 mutants or the 35S::MYBC1 transgenic plants in response to cold stress, as compared to the wild type. Microarray analysis results that are publically available were investigated and found transcript level of MYBC1 was not altered by overexpression of CBF1, CBF2, and CBF3, suggesting that MYBC1 is not down regulated by these CBF family members. Together, these results suggested that MYBC1is capable of negatively regulating the freezing tolerance of Arabidopsis in the CBF-independent pathway. In transgenic Arabidopsis carrying an MYBC1 promoter driven {beta}-glucuronidase (GUS) construct, GUS activity was observed in all tissues and was relatively stronger in the vascular tissues. Fused MYBC1 and GFP protein revealed that MYBC1 was localized exclusively in the nuclear compartment.

  6. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae

    PubMed Central

    2010-01-01

    Background The control of plant anthocyanin accumulation is via transcriptional regulation of the genes encoding the biosynthetic enzymes. A key activator appears to be an R2R3 MYB transcription factor. In apple fruit, skin anthocyanin levels are controlled by a gene called MYBA or MYB1, while the gene determining fruit flesh and foliage anthocyanin has been termed MYB10. In order to further understand tissue-specific anthocyanin regulation we have isolated orthologous MYB genes from all the commercially important rosaceous species. Results We use gene specific primers to show that the three MYB activators of apple anthocyanin (MYB10/MYB1/MYBA) are likely alleles of each other. MYB transcription factors, with high sequence identity to the apple gene were isolated from across the rosaceous family (e.g. apples, pears, plums, cherries, peaches, raspberries, rose, strawberry). Key identifying amino acid residues were found in both the DNA-binding and C-terminal domains of these MYBs. The expression of these MYB10 genes correlates with fruit and flower anthocyanin levels. Their function was tested in tobacco and strawberry. In tobacco, these MYBs were shown to induce the anthocyanin pathway when co-expressed with bHLHs, while over-expression of strawberry and apple genes in the crop of origin elevates anthocyanins. Conclusions This family-wide study of rosaceous R2R3 MYBs provides insight into the evolution of this plant trait. It has implications for the development of new coloured fruit and flowers, as well as aiding the understanding of temporal-spatial colour change. PMID:20302676

  7. Enzymatic degradation processes of poly[(R)-3-hydroxybutyric acid] and poly[(R)-3-hydroxybutyric acid-co-(R)-3-hydroxyvaleric acid] single crystals revealed by atomic force microscopy: effects of molecular weight and second-monomer composition on erosion rates.

    PubMed

    Numata, Keiji; Kikkawa, Yoshihiro; Tsuge, Takeharu; Iwata, Tadahisa; Doi, Yoshiharu; Abe, Hideki

    2005-01-01

    Enzymatic degradation processes of poly[(R)-3-hydroxybutyric acid] (P(3HB)) and poly[(R)-3-hydroxybutyric acid-co-(R)-3-hydroxyvaleric acid] (P(3HB-co-3HV)) single crystals in the presence of PHB depolymerase from Ralstonia pickettii T1 were studied by real-time and static atomic force microscopy (AFM) observations. Fibril-like crystals were generated along the long axis of single crystals during the enzymatic degradation, and then the dimensions of fibril-like crystals were analyzed quantitatively. The morphologies and sizes of fibril-like crystals were dependent on the molecular weight and copolymer composition of polymers. For all samples, the crystalline thickness gradually decreased toward a tip from the root of a fibril-like crystal after enzymatic degradation for 1 h. The thinning of fibril-like crystals may be attributed to the destruction of chain-packing structure toward crystallographic c axis by the adsorption of enzyme. From the real-time AFM images, it was found that at the initial stage of degradation the enzymatic erosion started from the disordered chain-packing region in single crystals to form the grooves along the a axis. The generated fibril-like crystals deformed at a constant rate along the a axis with a constant rate after the induction time. The erosion rate at the grooves along the a axis increased with a decrease of molecular weight and with an increase of copolymer composition. On the other hand, the erosion rate along the a axis, at the tip of the fibril-like crystal, was dependent on only the copolymer composition, and the value increased with an increase in the copolymer composition. The morphologies and sizes of fibril-like crystals were governed by both the erosion rates along the a axis at the grooves and tip of fibril-like crystals. In addition, we were able to estimated the overall enzymatic erosion rate of single crystals by PHB depolymerase from the volumetric analysis.

  8. Development of a Functionally Minimized Mutant of the R3C Ligase Ribozyme Offers Insight into the Plausibility of the RNA World Hypothesis

    PubMed Central

    Kurihara, Eri; Uchida, Sayuri; Umehara, Takuya; Tamura, Koji

    2014-01-01

    The R3C ligase ribozyme is an artificial ligase ribozyme produced by modification of the ribozyme that lacks cytidine. Here, we attempted to modify the original R3C ribozyme (73 nucleotides) by reducing the number of nucleotides while maintaining the maximum possible catalytic efficiency. By partially deleting both the “grip” (P4 + P5) and “hammer” (P3) stem-loops, we found the critical border to retain activity comparable to that of full-length R3C. The three-way junction structure was necessary to maintain enzymatic function and the stability of the “grip” (P4 + P5) stem had a large influence on the catalytic activity of R3C. The final minimized ribozyme we obtained comprised ~50 nucleotides, comparable to the estimated length of prebiotically synthesized RNA. Our findings suggest that the autocatalytic function in ribozymes is indeed possible to obtain using sequence lengths achievable with prebiotic synthesis. PMID:25256424

  9. Dendritic cells engineered to secrete anti-DcR3 antibody augment cytotoxic T lymphocyte response against pancreatic cancer in vitro

    PubMed Central

    Chen, Jiang; Guo, Xiao-Zhong; Li, Hong-Yu; Zhao, Jia-Jun; Xu, Wen-Da

    2017-01-01

    AIM To investigate the enhanced cytotoxic T lymphocyte responses against pancreatic cancer (PC) in vitro induced by dendritic cells (DCs) engineered to secrete anti-DcR3 monoclonal antibody (mAb). METHODS DCs, T lymphocytes and primary PC cells were obtained from PC patients. DCs were transfected with a designed humanized anti-DcR3 monoclonal antibody heavy and light chain mRNA and/or total tumor RNA (DC-tumor-anti-DcR3 RNA or DC-total tumor RNA) by using electroporation technology. The identification, concentration and function of anti-DcR3 mAb secreted by DC-tumor-anti-DcR3 RNA were determined by western blotting and enzyme-linked immunosorbent assay. After co-culturing of autologous isolated PC cells with target DCs, the effects of secreting anti-DcR3 mAb on RNA-DCs’ viability and apoptosis were assessed by MTT assay and flow cytometry. Analysis of enhanced antigen-specific immune response against PC induced by anti-DcR3 mAb secreting DCs was performed using a 51Cr releasing test. T cell responses induced by RNA-loaded DCs were analyzed by measuring cytokine levels, including IFN-γ, IL-10, IL4, TNF-α and IL-12. RESULTS The anti-DcR3 mAb secreted by DCs reacted with recombinant human DcR3 protein and generated a band with 35 kDa molecular weight. The secreting mAb was transient, peaking at 24 h and becoming undetectable after 72 h. After co-incubation with DC-tumor-anti-DcR3 RNA for designated times, the DcR3 level in the supernatant of autologous PC cells was significantly down-regulated (P < 0.05). DCs secreting anti-DcR3 mAb could improve cell viability and slow down the apoptosis of RNA-loaded DCs, compared with DC-total tumor RNA (P < 0.01). The anti-DcR3 mAb secreted by DC-tumor-anti-DcR3 RNA could enhance the induction of cytotoxic T lymphocytes (CTLs) activity toward RNA-transfected DCs, primary tumor cells, and PC cell lines, compared with CTLs stimulated by DC-total tumor RNA or control group (P < 0.05). Meanwhile, the antigen-specific CTL responses

  10. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers during a backpacking expedition by a single subject.

    PubMed

    DeVoe, Dale

    2004-10-01

    This study compared the RT3 Research Tracker accelerometer and the Tritrac R3D accelerometer in a field setting. A six-day backpacking expedition (122.4 km in length) was completed by a single subject in the Grand Canyon National Park, Arizona. The overall correlation between the counts of vector magnitude activity for the RT3 and R3D was moderate (r =.75, p<.001), with the overall calculated bias [mean difference (RT3 minus R3D) and standard deviation of the differences] across all six days estimated at 235+/-436 vector magnitude activity counts. However, agreement between the instruments is problematic; the RT3 might be 201 activity counts below or 671 activity counts above the R3D in assessing physical activity during backpacking.

  11. Comprehensive behavioral phenotyping of ryanodine receptor type 3 (RyR3) knockout mice: decreased social contact duration in two social interaction tests.

    PubMed

    Matsuo, Naoki; Tanda, Koichi; Nakanishi, Kazuo; Yamasaki, Nobuyuki; Toyama, Keiko; Takao, Keizo; Takeshima, Hiroshi; Miyakawa, Tsuyoshi

    2009-01-01

    Dynamic regulation of the intracellular Ca2+ concentration is crucial for various neuronal functions such as synaptic transmission and plasticity, and gene expression. Ryanodine receptors (RyRs) are a family of intracellular calcium release channels that mediate calcium-induced calcium release from the endoplasmic reticulum. Among the three RyR isoforms, RyR3 is preferentially expressed in the brain especially in the hippocampus and striatum. To investigate the behavioral effects of RyR3 deficiency, we subjected RyR3 knockout (RyR3-/-) mice to a battery of behavioral tests. RyR3-/- mice exhibited significantly decreased social contact duration in two different social interaction tests, where two mice can freely move and make contacts with each other. They also exhibited hyperactivity and mildly impaired prepulse inhibition and latent inhibition while they did not show significant abnormalities in motor function and working and reference memory tests. These results indicate that RyR3 has an important role in locomotor activity and social behavior.

  12. The R3 receptor-like protein tyrosine phosphatase subfamily inhibits insulin signalling by dephosphorylating the insulin receptor at specific sites.

    PubMed

    Shintani, Takafumi; Higashi, Satoru; Takeuchi, Yasushi; Gaudio, Eugenio; Trapasso, Francesco; Fusco, Alfredo; Noda, Masaharu

    2015-09-01

    The autophosphorylation of specific tyrosine residues occurs in the cytoplasmic region of the insulin receptor (IR) upon insulin binding, and this in turn initiates signal transduction. The R3 subfamily (Ptprb, Ptprh, Ptprj and Ptpro) of receptor-like protein tyrosine phosphatases (RPTPs) is characterized by an extracellular region with 6-17 fibronectin type III-like repeats and a cytoplasmic region with a single phosphatase domain. We herein identified the IR as a substrate for R3 RPTPs by using the substrate-trapping mutants of R3 RPTPs. The co-expression of R3 RPTPs with the IR in HEK293T cells suppressed insulin-induced tyrosine phosphorylation of the IR. In vitro assays using synthetic phosphopeptides revealed that R3 RPTPs preferentially dephosphorylated a particular phosphorylation site of the IR: Y960 in the juxtamembrane region and Y1146 in the activation loop. Among four R3 members, only Ptprj was co-expressed with the IR in major insulin target tissues, such as the skeletal muscle, liver and adipose tissue. Importantly, the activation of IR and Akt by insulin was enhanced, and glucose and insulin tolerance was improved in Ptprj-deficient mice. These results demonstrated Ptprj as a physiological enzyme that attenuates insulin signalling in vivo, and indicate that an inhibitor of Ptprj may be an insulin-sensitizing agent. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  13. An R2R3 MYB transcription factor determines red petal colour in an Actinidia (kiwifruit) hybrid population

    PubMed Central

    2013-01-01

    Background Red colour in kiwifruit results from the presence of anthocyanin pigments. Their expression, however, is complex, and varies among genotypes, species, tissues and environments. An understanding of the biosynthesis, physiology and genetics of the anthocyanins involved, and the control of their expression in different tissues, is required. A complex, the MBW complex, consisting of R2R3-MYB and bHLH transcription factors together with a WD-repeat protein, activates anthocyanin 3-O-galactosyltransferase (F3GT1) to produce anthocyanins. We examined the expression and genetic control of anthocyanins in flowers of Actinidia hybrid families segregating for red and white petal colour. Results Four inter-related backcross families between Actinidia chinensis Planch. var. chinensis and Actinidia eriantha Benth. were identified that segregated 1:1 for red or white petal colour. Flower pigments consisted of five known anthocyanins (two delphinidin-based and three cyanidin-based) and three unknowns. Intensity and hue differed in red petals from pale pink to deep magenta, and while intensity of colour increased with total concentration of anthocyanin, no association was found between any particular anthocyanin data and hue. Real time qPCR demonstrated that an R2R3 MYB, MYB110a, was expressed at significant levels in red-petalled progeny, but not in individuals with white petals. A microsatellite marker was developed that identified alleles that segregated with red petal colour, but not with ovary, stamen filament, or fruit flesh colour in these families. The marker mapped to chromosome 10 in Actinidia. The white petal phenotype was complemented by syringing Agrobacterium tumefaciens carrying Actinidia 35S::MYB110a into the petal tissue. Red pigments developed in white petals both with, and without, co-transformation with Actinidia bHLH partners. MYB110a was shown to directly activate Actinidia F3GT1 in transient assays. Conclusions The transcription factor, MYB110a

  14. An R2R3 MYB transcription factor determines red petal colour in an Actinidia (kiwifruit) hybrid population.

    PubMed

    Fraser, Lena G; Seal, Alan G; Montefiori, Mirco; McGhie, Tony K; Tsang, Gianna K; Datson, Paul M; Hilario, Elena; Marsh, Hinga E; Dunn, Juanita K; Hellens, Roger P; Davies, Kevin M; McNeilage, Mark A; De Silva, H Nihal; Allan, Andrew C

    2013-01-16

    Red colour in kiwifruit results from the presence of anthocyanin pigments. Their expression, however, is complex, and varies among genotypes, species, tissues and environments. An understanding of the biosynthesis, physiology and genetics of the anthocyanins involved, and the control of their expression in different tissues, is required. A complex, the MBW complex, consisting of R2R3-MYB and bHLH transcription factors together with a WD-repeat protein, activates anthocyanin 3-O-galactosyltransferase (F3GT1) to produce anthocyanins. We examined the expression and genetic control of anthocyanins in flowers of Actinidia hybrid families segregating for red and white petal colour. Four inter-related backcross families between Actinidia chinensis Planch. var. chinensis and Actinidia eriantha Benth. were identified that segregated 1:1 for red or white petal colour. Flower pigments consisted of five known anthocyanins (two delphinidin-based and three cyanidin-based) and three unknowns. Intensity and hue differed in red petals from pale pink to deep magenta, and while intensity of colour increased with total concentration of anthocyanin, no association was found between any particular anthocyanin data and hue. Real time qPCR demonstrated that an R2R3 MYB, MYB110a, was expressed at significant levels in red-petalled progeny, but not in individuals with white petals.A microsatellite marker was developed that identified alleles that segregated with red petal colour, but not with ovary, stamen filament, or fruit flesh colour in these families. The marker mapped to chromosome 10 in Actinidia.The white petal phenotype was complemented by syringing Agrobacterium tumefaciens carrying Actinidia 35S::MYB110a into the petal tissue. Red pigments developed in white petals both with, and without, co-transformation with Actinidia bHLH partners. MYB110a was shown to directly activate Actinidia F3GT1 in transient assays. The transcription factor, MYB110a, regulates anthocyanin production in

  15. Constraints on the Physical Properties of Main Belt Comet P/2013 R3 from its Breakup Event

    NASA Astrophysics Data System (ADS)

    Hirabayashi, Masatoshi; Scheeres, Daniel J.; Sánchez, Diego P.; Gabriel, Travis

    2014-11-01

    Main belt comet P/2013 R3 recently experienced a breakup, probably due to rotational disruption. From October through December 2013 its small components, with effective radii of 0.2-0.5 km, were observed to be escaping with a dispersion velocity of 0.2-0.5 m/s (Jewitt et al., Apj Letters 784, L8, 2014). This study develops and applies a technique for constraining the physical properties of the proto-body. The proto-body is assumed to be a uniformly rotating biaxial ellipsoid. To model this breakup event, we develop a combined analysis for the failure condition of the proto-body during its structural breakup phase and of the mutual orbit dynamics of the small components during its dynamics phase. To model the structural breakup phase we use structural analysis. Since a uniformly rotating ellipsoid with cohesion may fail across the central cross section first, we apply the Davidsson method (Davidsson, Icarus 149, 375-383, 2001) that considered the failure condition to be characterized by the yield condition of the averaged stress over the cross section. For the dynamics phase, we consider the energy conservation during this event. Calculation of the total energy requires consideration of the shape change due to the breakup phase, and we derive it without approximation (Scheeres, CMDA 89, 127-140, 2004). These phases can be combined based on the assumption that the initial spin period is equal to the spin period when the proto-body starts the structural breakup phase. Given a proto-body with a bulk density ranging from 1000 kg/m3 to 1500 kg/m3 (a typical range of bulk density for C-type asteroids), we obtain possible values of the cohesion (40 - 210 Pa) and the initial spin state (0.48 - 1.9 hr). We conclude that although the proto-body could have been a rubble pile, it was likely spinning beyond its gravitational binding limit and would have needed cohesive strength to hold itself together. If additional observations of P/2013 R3 are carried out, the present

  16. Cluster headache

    PubMed Central

    Leroux, Elizabeth; Ducros, Anne

    2008-01-01

    Cluster headache (CH) is a primary headache disease characterized by recurrent short-lasting attacks (15 to 180 minutes) of excruciating unilateral periorbital pain accompanied by ipsilateral autonomic signs (lacrimation, nasal congestion, ptosis, miosis, lid edema, redness of the eye). It affects young adults, predominantly males. Prevalence is estimated at 0.5–1.0/1,000. CH has a circannual and circadian periodicity, attacks being clustered (hence the name) in bouts that can occur during specific months of the year. Alcohol is the only dietary trigger of CH, strong odors (mainly solvents and cigarette smoke) and napping may also trigger CH attacks. During bouts, attacks may happen at precise hours, especially during the night. During the attacks, patients tend to be restless. CH may be episodic or chronic, depending on the presence of remission periods. CH is associated with trigeminovascular activation and neuroendocrine and vegetative disturbances, however, the precise cautive mechanisms remain unknown. Involvement of the hypothalamus (a structure regulating endocrine function and sleep-wake rhythms) has been confirmed, explaining, at least in part, the cyclic aspects of CH. The disease is familial in about 10% of cases. Genetic factors play a role in CH susceptibility, and a causative role has been suggested for the hypocretin receptor gene. Diagnosis is clinical. Differential diagnoses include other primary headache diseases such as migraine, paroxysmal hemicrania and SUNCT syndrome. At present, there is no curative treatment. There are efficient treatments to shorten the painful attacks (acute treatments) and to reduce the number of daily attacks (prophylactic treatments). Acute treatment is based on subcutaneous administration of sumatriptan and high-flow oxygen. Verapamil, lithium, methysergide, prednisone, greater occipital nerve blocks and topiramate may be used for prophylaxis. In refractory cases, deep-brain stimulation of the hypothalamus and

  17. Formation of Cluster Complexes by Cluster-Cluster-Collisions

    NASA Astrophysics Data System (ADS)

    Ichihashi, Masahiko; Odaka, Hideho

    2015-03-01

    Multi-element clusters are interested in their chemical and physical properties, and it is expected that they are utilized as catalysts, for example. Their properties critically depend on the size, composition and atomic ordering, and it should be important to adjust the above parameters for their functionality. One of the ways to form a multi-element cluster is to employ a low-energy collision between clusters. Here, we show characteristic results obtained in the collision between a neutral Ar cluster and a size-selected Co cluster ion. Low-energy collision experiment was accomplished by using a newly developed merging-beam apparatus. Cobalt cluster ions were produced by laser ablation, and mass-selected. On the other hand, argon clusters were prepared by the supersonic expansion of Ar gas. Both cluster beams were merged together in an ion guide, and ionic cluster complexes were mass-analyzed. In the collision of Co2+ and ArN, Co2Arn+ (n = 1 - 30) were observed, and the total intensity of Co2Arn+ (n >= 1) is inversely proportional to the relative velocity between Co2+ and ArN. This suggests that the charge-induced dipole interaction between Co2+ and a neutral Ar cluster is dominant in the formation of the cluster complex, Co2+Arn.

  18. Ab initio study of the one- and two-photon circular dichroism of R-(+)-3-methyl-cyclopentanone

    NASA Astrophysics Data System (ADS)

    Rizzo, Antonio; Lin, Na; Ruud, Kenneth

    2008-04-01

    One- and two-photon circular dichroism spectra of R-(+)-3-methyl-cyclopentanone, a system that has been the subject of recent experimental studies of (2+1) resonance-enhanced multiphoton ionization circular dichroism, have been calculated with an origin-invariant density functional theory approximation in the region of the lowest electronic excited states, both for the gas phase and for a selection of solvents. A polarizable continuum model is used in the calculations performed on the solvated system. Two low-lying conformers are analyzed, and a comparison of the intensities and characteristic features is made with the corresponding two-photon absorption for each species, also for the Boltzmann-averaged spectra. The effect of the choice of geometry, basis set, and exchange-correlation functional is carefully analyzed. It is found that a density functional theory approach using the Coulomb attenuating method variant of Becke's three-parameter exchange and the Lee-Yang-Parr correlation functionals with correlation-consistent basis sets of double-zeta quality can reproduce the experimental electronic circular dichroism spectra very well. The features appearing in experiment are characterized in terms of molecular excitations, and the differences in the response of each state in the one- and two-photon processes are highlighted.

  19. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion

    PubMed Central

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Phan Tran, Lam-Son; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  20. The soybean R2R3 MYB transcription factor GmMYB100 negatively regulates plant flavonoid biosynthesis.

    PubMed

    Yan, Junhui; Wang, Biao; Zhong, Yunpeng; Yao, Luming; Cheng, Linjing; Wu, Tianlong

    2015-09-01

    Soybean flavonoids, a group of important signaling molecules in plant-environment interaction, ubiquitously exist in soybean and are tightly regulated by many genes. Here we reported that GmMYB100, a gene encoding a R2R3 MYB transcription factor, is involved in soybean flavonoid biosynthesis. GmMYB100 is mainly expressed in flowers, leaves and immature embryo, and its level is decreased after pod ripening. Subcellular localization assay indicates that GmMYB100 is a nuclear protein. GmMYB100 has transactivation ability revealed by a yeast functional assay; whereas bioinformatic analysis suggests that GmMYB100 has a negative function in flavonoid biosynthesis. GmMYB100-overexpression represses the transcript levels of flavonoid-related genes in transgenic soybean hairy roots and Arabidopsis, and inhibits isoflavonoid (soybean) and flavonol (Arabidopsis) production in transgenic plants. Furthermore, the transcript levels of six flavonoid-related genes and flavonoid (isoflavonoid and flavone aglycones) accumulation are elevated in the GmMYB100-RNAi transgenic hairy roots. We also demonstrate that GmMYB100 protein depresses the promoter activities of soybean chalcone synthase and chalcone isomerase. These findings indicate that GmMYB100 is a negative regulator in soybean flavonoid biosynthesis pathway.

  1. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis

    PubMed Central

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  2. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia

    PubMed Central

    Ågerstam, Helena; Karlsson, Christine; Hansen, Nils; Sandén, Carl; Askmyr, Maria; von Palffy, Sofia; Högberg, Carl; Rissler, Marianne; Wunderlich, Mark; Juliusson, Gunnar; Richter, Johan; Sjöström, Kjell; Bhatia, Ravi; Mulloy, James C.; Järås, Marcus; Fioretos, Thoas

    2015-01-01

    Acute myeloid leukemia (AML) is associated with a poor survival rate, and there is an urgent need for novel and more efficient therapies, ideally targeting AML stem cells that are essential for maintaining the disease. The interleukin 1 receptor accessory protein (IL1RAP; IL1R3) is expressed on candidate leukemic stem cells in the majority of AML patients, but not on normal hematopoietic stem cells. We show here that monoclonal antibodies targeting IL1RAP have strong antileukemic effects in xenograft models of human AML. We demonstrate that effector-cell–mediated killing is essential for the observed therapeutic effects and that natural killer cells constitute a critical human effector cell type. Because IL-1 signaling is important for the growth of AML cells, we generated an IL1RAP-targeting antibody capable of blocking IL-1 signaling and show that this antibody suppresses the proliferation of primary human AML cells. Hence, IL1RAP can be efficiently targeted with an anti-IL1RAP antibody capable of both achieving antibody-dependent cellular cytotoxicity and blocking of IL-1 signaling as modes of action. Collectively, these results provide important evidence in support of IL1RAP as a target for antibody-based treatment of AML. PMID:26261316

  3. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia.

    PubMed

    Ågerstam, Helena; Karlsson, Christine; Hansen, Nils; Sandén, Carl; Askmyr, Maria; von Palffy, Sofia; Högberg, Carl; Rissler, Marianne; Wunderlich, Mark; Juliusson, Gunnar; Richter, Johan; Sjöström, Kjell; Bhatia, Ravi; Mulloy, James C; Järås, Marcus; Fioretos, Thoas

    2015-08-25

    Acute myeloid leukemia (AML) is associated with a poor survival rate, and there is an urgent need for novel and more efficient therapies, ideally targeting AML stem cells that are essential for maintaining the disease. The interleukin 1 receptor accessory protein (IL1RAP; IL1R3) is expressed on candidate leukemic stem cells in the majority of AML patients, but not on normal hematopoietic stem cells. We show here that monoclonal antibodies targeting IL1RAP have strong antileukemic effects in xenograft models of human AML. We demonstrate that effector-cell-mediated killing is essential for the observed therapeutic effects and that natural killer cells constitute a critical human effector cell type. Because IL-1 signaling is important for the growth of AML cells, we generated an IL1RAP-targeting antibody capable of blocking IL-1 signaling and show that this antibody suppresses the proliferation of primary human AML cells. Hence, IL1RAP can be efficiently targeted with an anti-IL1RAP antibody capable of both achieving antibody-dependent cellular cytotoxicity and blocking of IL-1 signaling as modes of action. Collectively, these results provide important evidence in support of IL1RAP as a target for antibody-based treatment of AML.

  4. A chimeric repressor of petunia PH4 R2R3-MYB family transcription factor generates margined flowers in torenia

    PubMed Central

    Kasajima, Ichiro; Sasaki, Katsutomo

    2016-01-01

    ABSTRACT The development of new phenotypes is key to the commercial development of the main floricultural species and cultivars. Important new phenotypes include features such as multiple-flowers, color variations, increased flower size, new petal shapes, variegation and distinctive petal margin colourations. Although their commercial use is not yet common, the transgenic technologies provide a potentially rapid means of generating interesting new phenotypes. In this report, we construct 5 vectors which we expected to change the color of the flower anthocyanins, from purple to blue, regulating vacuolar pH. When these constructs were transformed into purple torenia, we unexpectedly recovered some genotypes having slightly margined petals. These transgenic lines expressed a chimeric repressor of the petunia PhPH4 gene under the control of Cauliflower mosaic virus 35 S RNA promoter. PhPH4 is an R2R3-type MYB transcription factor. The transgenic lines lacked pigmentation in the petal margin cells both on the adaxial and abaxial surfaces. Expressions of Flavanone 3-hydroxylase (F3H), Flavonoid 3′-hydroxylase (F3′H) and Flavonoid 3′5′-hydroxylase (F3′5′H) genes were reduced in the margins of these transgenic lines, suggesting an inhibitory effect of PhPH4 repressor on anthocyanin synthesis. PMID:27089475

  5. Characterization, biodegradability and blood compatibility of poly[(R)-3-hydroxybutyrate] based poly(ester-urethane)s.

    PubMed

    Liu, Qiaoyan; Cheng, Shaoting; Li, Zibiao; Xu, Kaitian; Chen, Guo-Qiang

    2009-09-15

    Poly(ester-urethane)s (PUs) were synthesized using hexamethylene diisocyanate (HDI) or toluene diisocyanate (TDI) to join short chains (M(n) = 2000) of poly(R-3-hydroxybutyrate) (PHB) diols and poly(epsilon-caprolactone) (PCL) diols with different feed ratios under different reaction conditions. The multiblock copolymers were characterized by nuclear magnetic resonance spectrometer (NMR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), thermogravimetric analyses (TGA), X-ray diffraction (XRD), and scanning electron microscope (SEM). XRD spectra and second DSC heat thermograms of the multiblock copolymers revealed that the crystallization of both PHB and PCL segments was mutually restricted, and, especially, the PCL segment limited the cold crystallization of the PHB segment. The SEM of platelet adhesion experiments showed that the hemocompatibility was affected to some extent by the chain flexibility of the polymers. Hydrolysis studies demonstrated that the hydrolytic degradation of PUs was generated from the scission of their ester bonds or/and urethane bonds. Simultaneously, the rate of ester bond scission was determined to some extent by the crystallization degree, which was further affected by the configuration of polymer chains. These highly elastic multiblock copolymers combining hemocompatibility and biodegradability may be developed into blood contact implant materials for biomedical applications. Copyright 2008 Wiley Periodicals, Inc.

  6. Genetic tracing of the gustatory neural pathway originating from T1R3-expressing sweet/umami taste receptor cells.

    PubMed

    Matsumoto, Ichiro; Ohmoto, Makoto; Yasuoka, Akihito; Yoshihara, Yoshihiro; Abe, Keiko

    2009-07-01

    Neural pathways conveying taste information from the tongue to the brain underlie gustatory information coding and processing. To visualize the gustatory neural pathways, we established transgenic mouse lines in which a transneuronal tracer, wheat germ agglutinin (WGA), was faithfully and robustly expressed in sweet/umami taste receptor cells (TRCs) under the control of mouse T1R3 gene promoter/enhancer. WGA protein was transferred not laterally to the cells with synaptic structure, but directly to a subset of neurons in the geniculate and nodose/petrosal ganglia, and further conveyed to a subpopulation of neurons in the rostro-central region of the nucleus of the solitary tract. However, no WGA immunoreactivity was observed in more central gustatory relay nuclei even in the parabrachial nucleus. These results imply that sweet/umami information from TRCs can be directly transmitted to the gustatory neurons that innervate the sweet/umami TRCs, and this study uncovered a precise map of the sweet/umami information pathway from TRCs to the nucleus of solitary tract in the brain stem.

  7. MYB56 encoding a R2R3 MYB transcription factor regulates seed size in Arabidopsis thaliana.

    PubMed

    Zhang, Yanjie; Liang, Wanqi; Shi, Jianxin; Xu, Jie; Zhang, Dabing

    2013-11-01

    Plant seed size is tightly regulated by the development of seed coat, embryo, and endosperm; however, currently, its underlying mechanism remains unclear. In this study, we revealed a regulatory role of an R2R3 MYB transcription factor MYB56 in controlling seed size specifically in Arabidopsis thaliana L. Loss-of-function or knock-down of MYB56 yielded smaller seeds as compared with the wild type. Conversely, overexpression of MYB56 produced larger seeds. Further observation using semi-thin sections showed that myb56 developed smaller contracted endothelial cells and reduced cell number in the outer integument layer of the seed coat during the seed development; by contrast, MYB56 overexpressing lines had expanded endothelial cells and increased cell number in the outer integument layer of the seed coat, suggesting the essential role of MYB56 in regulating seed development. In addition, reciprocal cross-analysis showed that MYB56 affected the seed development maternally. MYB56 was shown to be dominantly expressed in developing seeds, consistently with its function in seed development. Moreover, quantitative reverse transcription polymerase chain reaction analysis revealed that MYB56 regulates the expression of genes involved in cell wall metabolism such as cell division and expansion. Altogether, our results demonstrated that MYB56 represents an unknown pathway for positively controlling the seed size. © 2013 Institute of Botany, Chinese Academy of Sciences.

  8. Time Profile of Cosmic Radiation Exposure During the EXPOSE-E Mission: The R3DE Instrument

    PubMed Central

    Horneck, Gerda; Häder, Donat-Peter; Schuster, Martin; Richter, Peter; Lebert, Michael; Demets, Rene

    2012-01-01

    Abstract The aim of this paper is to present the time profile of cosmic radiation exposure obtained by the Radiation Risk Radiometer-Dosimeter during the EXPOSE-E mission in the European Technology Exposure Facility on the International Space Station's Columbus module. Another aim is to make the obtained results available to other EXPOSE-E teams for use in their data analysis. Radiation Risk Radiometer-Dosimeter is a low-mass and small-dimension automatic device that measures solar radiation in four channels and cosmic ionizing radiation as well. The main results of the present study include the following: (1) three different radiation sources were detected and quantified—galactic cosmic rays (GCR), energetic protons from the South Atlantic Anomaly (SAA) region of the inner radiation belt, and energetic electrons from the outer radiation belt (ORB); (2) the highest daily averaged absorbed dose rate of 426 μGy d−1 came from SAA protons; (3) GCR delivered a much smaller daily absorbed dose rate of 91.1 μGy d−1, and the ORB source delivered only 8.6 μGy d−1. The analysis of the UV and temperature data is a subject of another article (Schuster et al., 2012). Key Words: Ionizing radiation—R3D—ISS. Astrobiology 12, 403–411. PMID:22680687

  9. An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean

    PubMed Central

    Liu, Shulin; Zhou, Xiaoqiong; Zhang, Huairen; Wang, Chun-e; Yang, Wenming; Tian, Zhixi; Cheng, Hao; Yu, Deyue

    2017-01-01

    Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is a complex quantitative trait controlled by multiple genes, and the genetic mechanisms underlying isoflavone biosynthesis remain largely unknown. Via a genome-wide association study (GWAS), we identified 28 single nucleotide polymorphisms (SNPs) that are significantly associated with isoflavone concentrations in soybean. One of these 28 SNPs was located in the 5’-untranslated region (5’-UTR) of an R2R3-type MYB transcription factor, GmMYB29, and this gene was thus selected as a candidate gene for further analyses. A subcellular localization study confirmed that GmMYB29 was located in the nucleus. Transient reporter gene assays demonstrated that GmMYB29 activated the IFS2 (isoflavone synthase 2) and CHS8 (chalcone synthase 8) gene promoters. Overexpression and RNAi-mediated silencing of GmMYB29 in soybean hairy roots resulted in increased and decreased isoflavone content, respectively. Moreover, a candidate-gene association analysis revealed that 11 natural GmMYB29 polymorphisms were significantly associated with isoflavone contents, and regulation of GmMYB29 expression could partially contribute to the observed phenotypic variation. Taken together, these results provide important genetic insights into the molecular mechanisms underlying isoflavone biosynthesis in soybean. PMID:28489859

  10. Characterization of a Grapevine R2R3-MYB Transcription Factor That Regulates the Phenylpropanoid Pathway1[W

    PubMed Central

    Deluc, Laurent; Barrieu, François; Marchive, Chloé; Lauvergeat, Virginie; Decendit, Alain; Richard, Tristan; Carde, Jean-Pierre; Mérillon, Jean-Michel; Hamdi, Saïd

    2006-01-01

    The ripening of grape (Vitis vinifera) berry is characterized by dramatic changes in gene expression, enzymatic activities, and metabolism that lead to the production of compounds essential for berry quality. The phenylpropanoid metabolic pathway is one of the components involved in these changes. In this study, we describe the cloning and functional characterization of VvMYB5a, a cDNA isolated from a grape L. cv Cabernet Sauvignon berry library. VvMYB5a encodes a protein belonging to a small subfamily of R2R3-MYB transcription factors. Expression studies in grapevine indicate that the VvMYB5a gene is mainly expressed during the early steps of berry development in skin, flesh, and seeds. Overexpression of VvMYB5a in tobacco (Nicotiana tabacum) affects the expression of structural genes controlling the synthesis of phenylpropanoid and impacts on the metabolism of anthocyanins, flavonols, tannins, and lignins. Overexpressing VvMYB5a induces a strong accumulation of several phenolic compounds, including keracyanin (cyanidin-3-rhamnoglucoside) and quercetin-3-rhamnoglucoside, which are the main anthocyanin and flavonol compounds in tobacco. In addition, VvMYB5a overexpression increases the biosynthesis of condensed tannins and alters lignin metabolism. These findings suggest that VvMYB5a may be involved in the control of different branches of the phenylpropanoid pathway in grapevine. PMID:16384897

  11. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis.

    PubMed

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-06-01

    BACKGROUND DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. MATERIAL AND METHODS Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. RESULTS Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33-18.05), TNM stage (OR=5.51, 95% CI: 2.83-10.71), differentiation (OR=4.16, 95% CI: 2.28-7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16-10.9), age (OR=0.85, 95% CI: 0.51-1.44), and overall survival time (OR=1.84, 95% CI: 0.58-5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. CONCLUSIONS Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation.

  12. Genome-Wide Analysis of Citrus R2R3MYB Genes and Their Spatiotemporal Expression under Stresses and Hormone Treatments

    PubMed Central

    He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development. PMID:25473954

  13. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2.

    PubMed

    Hu, Ruyi; Liu, Wenming; Qiu, Xingfeng; Lin, Zhenghe; Xie, Yan; Hong, Xingya; Paerhati, Reyila; Qi, Zhongquan; Zhuang, Guohong; Liu, Zhongchen

    2016-03-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC.

  14. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2

    PubMed Central

    HU, RUYI; LIU, WENMING; QIU, XINGFENG; LIN, ZHENGHE; XIE, YAN; HONG, XINGYA; PAERHATI, REYILA; QI, ZHONGQUAN; ZHUANG, GUOHONG; LIU, ZHONGCHEN

    2016-01-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC. PMID:26998086

  15. Genome-wide analysis of citrus R2R3MYB genes and their spatiotemporal expression under stresses and hormone treatments.

    PubMed

    Xie, Rangjin; Li, Yongjie; He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development.

  16. Single nucleotide polymorphisms in the FcγR3A and TAP1 genes impact ADCC in cynomolgus monkey PBMCs.

    PubMed

    Sanford, Jonathan C; Wu, Hong; Abdiche, Yasmina; Harney, Julie A; Chaparro-Riggers, Javier; Adkins, Karissa

    2017-04-01

    Phenotypic variability is often observed in cynomolgus monkeys on preclinical studies and may, in part, be driven by genetic variability. However, the role of monkey genetic variation remains largely unexplored in the context of drug response. This study evaluated genetic variation in cynomolgus monkey FcγR3A and TAP1 genes and the potential impact of identified polymorphisms on antibody-dependent cell-mediated cytotoxicity (ADCC) in vitro. Studies in humans have demonstrated that a single nucleotide polymorphism (SNP), F158V, in FcγR3A can influence response to rituximab through altered ADCC and that SNPs in TAP1/2 decrease natural killer (NK) cell activity against major histocompatibility complex (MHC) class I deficient cells, potentially through altered ADCC. Monkeys were genotyped for FcγR3A and TAP1 SNPs, and ADCC was assessed in vitro using peripheral blood mononuclear cells (PBMCs) treated with trastuzumab in the presence of NCI-N87 cells. FcγR3A g.1134A>C (exonic S42R), FcγR3A g.5027A>G (intronic), and TAP1 g.1A>G (start codon loss) SNPs were all significantly associated with decreased ADCC for at least one trastuzumab concentration ≥0.0001 μM when compared with wild type (WT). Regression analysis demonstrated significant association of the SNP-SNP pairs FcγR3A g.1134A>C/TAP1 g.1A>G and FcγR3A g.5027A>G/TAP1 g.1A>G with a combinatorial decrease on ADCC. Mechanisms underlying the decreased ADCC were investigated by measuring FcγR3A/IgG binding affinity and expression of FcγR3A and TAP1 in PBMCs; however, no functional associations were observed. These data demonstrate that genetic variation in cynomolgus monkeys is reflective of known human genetic variation and may potentially contribute to variable drug response in preclinical studies.

  17. Endocrine and metabolic changes in neonatal calves in response to growth hormone and long-R3-insulin-like growth factor-I administration.

    PubMed

    Hammon, H; Blum, J W

    1998-01-01

    Postnatal growth is primarily controlled by growth hormone (GH) and insulin-like growth factor-I (IGF-I). We have studied effects of recombinant bovine GH (rbGH) and Long-R3-insulin-like growth factor-I (Long-R3-IGF-I) on metabolic and endocrine characteristics of neonatal calves. Group GrC (control) was fed colostrum as first meal and then milk replacer up to day 7. Groups GrIGFf, GrIGFi and GrGH were fed as GrC. In group GrIGFf, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was fed together with colostrum or milk replacer and in group GrIGFi, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was injected subcutaneously at times of feeding. Calves of group GrGH were injected rbGH (1 mg/[kg x day, s.c.], twice daily for 7 days) at times of feeding. While orally administered Long-R3-IGF-I had no effects, subcutaneously administered Long-R3-IGF-I lowered plasma glucose and insulin concentrations (p < 0.05). In group GrGH, day-2 postprandial plasma insulin concentrations were increased more than in Long-R3-IGF-I-treated groups (p < 0.05) and day-2 postprandial prolactin responses were greater in group GrGH than in controls (p < 0.05). Other traits (lactic acid, nonesterified fatty acids, glucagon, cortisol, thyroxine and 3.5.3'-triiodothyronine) exhibited age-dependent changes, but were not significantly affected by rbGH or Long-R3-IGF-I. The study shows, that parenteral, but not oral, Long-R3-IGF-I affects plasma glucose and insulin concentrations, and that rbGH transiently influences plasma prolactin concentrations in neonatal calves.

  18. An efficient Escherichia coli expression system for the production of a functional N-terminal domain of the T1R3 taste receptor.

    PubMed

    Maîtrepierre, Elodie; Sigoillot, Maud; Le Pessot, Laurence; Briand, Loïc

    2013-01-01

    Sweet taste is mediated by a dimeric receptor composed of two distinct subunits, T1R2 and T1R3, whereas the T1R1/T1R3 receptor is involved in umami taste perception. The T1R1, T1R2, and T1R3 subunits are members of the small family of class C G protein-coupled receptors (GPCRs). The members of this family are characterized by a large N-terminal domain (NTD), which is structurally similar to bacterial periplasmic-binding proteins and contains the primary ligand-binding site. In a recent study, we described a strategy to produce a functional dimeric human T1R3-NTD. Although the protein was expressed as inclusion bodies (IBs) using the Escherichia coli system, the conditions for the refolding of functional hT1R3-NTD were determined using a fractional factorial screen coupled to a binding assay. Here, we report that this refolding strategy can be used to produce T1R1- and T1R2-NTDs in large quantities. We also discuss that our findings could be more generally applicable to other class C GPCR-NTDs, including the γ-aminobutyric acid type B receptor (GABABR), the extracellular calcium-sensing receptor (CaSR) and the large family of pheromone (V2R) orphan receptors.

  19. Genome-wide analysis of the R2R3-MYB transcription factor genes in Chinese cabbage (Brassica rapa ssp. pekinensis) reveals their stress and hormone responsive patterns.

    PubMed

    Wang, Zhen; Tang, Jun; Hu, Rong; Wu, Peng; Hou, Xi-Lin; Song, Xiao-Ming; Xiong, Ai-Sheng

    2015-01-23

    The MYB superfamily is one of the most abundant transcription factor (TF) families in plants. MYB proteins include highly conserved N-terminal MYB repeats (1R, R2R3, 3R, and atypical) and various C-terminal sequences that confer extensive functions. However, the functions of most MYB genes are unknown, and have been little studied in Chinese cabbage. Here, we analyzed 256 (55.2% of total MYBs) R2R3-MYB genes from Chinese cabbage (Brassica rapa ssp. pekinensis) and anchored them onto the 10 chromosomes and three subgenomes. The R2R3-, 3R- and atypical MYB proteins in Chinese cabbage formed 45 subgroups based on domain similarity and phylogenetic topology. Organization and syntenic analysis revealed the genomic distribution and collinear relationships of the R2R3-BrMYBs. Synonymous nucleotide substitution (Ka/Ks) analysis showed that the Chinese cabbage MYB DNA-binding domain is under strong purifying selection. Moreover, RNA-seq data revealed tissue-specific and distinct R2R3-BrMYB expression profiles, and quantitative real-time PCR (qPCR) analysis in leaves showed stress responsive expression and crosstalk with ABA-auxin signaling cascades. In this study, we identified the largest MYB gene family in plants to date. Our results indicate that members of this superfamily may be involved in plant development, stress responses and leaf senescence, highlighting their functional diversity.

  20. H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TβR3 in placentae with fetal growth restriction

    PubMed Central

    Lu, Lingeng; Men, Yi; Geng, Tingting; Buhimschi, Catalin S.; Buhimschi, Irina A.; Bukowski, Radek; Guller, Seth; Paidas, Michael; Huang, Yingqun

    2016-01-01

    Fetal growth restriction (FGR) is a well-recognized risk factor for perinatal mortality and morbidity, as well as neurodevelopmental impairment and adulthood onset disorders. Here we report that the H19 long noncoding RNA (lncRNA) is significantly decreased in placentae from pregnancies with FGR. Downregulation of H19 leads to reduced migration and invasion of extravillous trophoblast (EVT) cells in vitro. This is consistent with reduced trophoblast invasion that has been observed in FGR. Genome-scale transcriptome profiling of EVT cells reveals significantly decreased expression of the type III TGF-β receptor (TβR3) following H19 knockdown. Decreased TβR3 expression is also seen in FGR placentae. TβR3 repression decreases EVT cell migration and invasion, owing to impaired TGF-β signaling through a non-canonical TGF-β signaling pathway. Further, we identify TβR3 as a novel regulatory target of microRNA let-7. We propose that dysregulation of this newly identified H19/TβR3-mediated regulatory pathway may contribute to the molecular mechanism of FGR. Our findings are the first to show a lncRNA-based mechanism of FGR, holding promise for the development of novel predictive, diagnostic, and therapeutic modalities for FGR. PMID:27223264

  1. H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TβR3 in placentae with fetal growth restriction.

    PubMed

    Zuckerwise, Lisa; Li, Jing; Lu, Lingeng; Men, Yi; Geng, Tingting; Buhimschi, Catalin S; Buhimschi, Irina A; Bukowski, Radek; Guller, Seth; Paidas, Michael; Huang, Yingqun

    2016-06-21

    Fetal growth restriction (FGR) is a well-recognized risk factor for perinatal mortality and morbidity, as well as neurodevelopmental impairment and adulthood onset disorders. Here we report that the H19 long noncoding RNA (lncRNA) is significantly decreased in placentae from pregnancies with FGR. Downregulation of H19 leads to reduced migration and invasion of extravillous trophoblast (EVT) cells in vitro. This is consistent with reduced trophoblast invasion that has been observed in FGR. Genome-scale transcriptome profiling of EVT cells reveals significantly decreased expression of the type III TGF-β receptor (TβR3) following H19 knockdown. Decreased TβR3 expression is also seen in FGR placentae. TβR3 repression decreases EVT cell migration and invasion, owing to impaired TGF-β signaling through a non-canonical TGF-β signaling pathway. Further, we identify TβR3 as a novel regulatory target of microRNA let-7. We propose that dysregulation of this newly identified H19/TβR3-mediated regulatory pathway may contribute to the molecular mechanism of FGR. Our findings are the first to show a lncRNA-based mechanism of FGR, holding promise for the development of novel predictive, diagnostic, and therapeutic modalities for FGR.

  2. Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp.1[OPEN

    PubMed Central

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-01-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  3. Oligo-(R)-3-hydroxybutyrate modification of sorting signal enables pore formation by Escherichia coli OmpA.

    PubMed

    Negoda, A; Negoda, E; Reusch, R N

    2010-08-01

    The outer membrane protein A (OmpA) of Escherichia coli is a well-known model for protein targeting and protein folding. Wild-type OmpA, isolated either from cytoplasmic inclusion bodies or from outer membranes, forms narrow pores of approximately 80 pS in planar lipid bilayers at room temperature. The pores are well structured with narrow conductance range when OmpA is isolated using lithium dodecyl sulfate (LDS) or RapiGest surfactant but display irregular conductance when OmpA is isolated with urea or guanidine hydrochloride. Previous studies have shown that serine residues S163 and S167 of the sorting signal of OmpA (residues 163-169), i.e., the essential sequence for outer membrane incorporation, are covalently modified by oligomers of (R)-3-hydroxybutyrate (cOHB). Here we find that single-mutants S163 and S167 of OmpA, which still contain cOHB on one serine of the sorting signal, form narrow pores in planar lipid bilayers at room temperature with lower and more irregular conductance than wild-type OmpA, whereas double mutants S163:S167 and S163:V166 of OmpA, with no cOHB on the sorting signal, are unable to form stable pores in planar lipid bilayers. Our results indicate that modification of serines in the sorting signal of OmpA by cOHB in the cytoplasm enables OmpA to incorporate into lipid bilayers at room temperature as a narrow pore. They further suggest that cOHB modification may be an important factor in protein targeting and protein folding.

  4. Monoclonal antibodies for structure-function studies of (R)-3-hydroxybutyrate dehydrogenase, a lipid-dependent membrane-bound enzyme.

    PubMed Central

    Adami, P; Duncan, T M; McIntyre, J O; Carter, C E; Fu, C; Melin, M; Latruffe, N; Fleischer, S

    1993-01-01

    Monoclonal antibodies (mAbs) have been used to study structure-function relationships of (R)-3-hydroxybutyrate dehydrogenase (BDH) (EC 1.1.1.30), a lipid-requiring mitochondrial membrane enzyme with an absolute and specific requirement for phosphatidylcholine (PC) for enzymic activity. The purified enzyme (apoBDH, devoid of phospholipid and thereby inactive) can be re-activated with preformed phospholipid vesicles containing PC or by short-chain soluble PC. Five of six mAbs cross-react with BDH from bovine heart and rat liver, including two mAbs to conformational epitopes. One mAb was found to be specific for the C-terminal sequence of BDH and served to: (1) map endopeptidase cleavage and epitope sites on BDH; and (2) demonstrate that the C-terminus is essential for the activity of BDH. Carboxypeptidase cleavage of only a few (< or = 14) C-terminal amino acids from apoBDH (as detected by the loss of C-terminal epitope for mAb 3-10A) prevents activation by either bilayer or soluble PC. Further, for BDH in bilayers containing PC, the C-terminus is protected from carboxy-peptidase cleavage, whereas in bilayers devoid of PC the C-terminus is cleaved, and subsequent activation by PC is precluded. We conclude that: (1) the C-terminus of BDH is essential for enzymic activity, consistent with the prediction, from primary sequence analysis, that the PC-binding site is in the C-terminal domain of BDH; and (2) the allosteric activation of BDH by PC in bilayers protects the C-terminus from carboxypeptidase cleavage, indicative of a PC-induced conformational change in the enzyme. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7686368

  5. Why are sweet proteins sweet? Interaction of brazzein, monellin and thaumatin with the T1R2-T1R3 receptor.

    PubMed

    Temussi, Piero Andrea

    2002-08-28

    Sweet tasting proteins interact with the same receptor that binds small molecular weight sweeteners, the T1R2-T1R3 G-protein coupled receptor, but the key groups on the protein surface responsible for the biological activity have not yet been identified. I propose that sweet proteins, contrary to small ligands, do not bind to the 'glutamate-like' pocket but stabilize the free form II of the T1R2-T1R3 receptor by attachment to a secondary binding site. Docking of brazzein, monellin and thaumatin with a model of the T1R2-T1R3 sweet taste receptor shows that the most likely complexes can indeed stabilize the active form of the receptor.

  6. Discovery of the beta-form crystal structure in electrospun nanofibers of bio-based poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] and its implication on properties

    NASA Astrophysics Data System (ADS)

    Gong, Liang

    Bacterially produced poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] (PHBHx) is a new type of bioplastic which not only inherits the excellent biodegradability and biocompatibility of its parent homopolymer, polyhydroxybutyrate (PHB), but also overcomes PHB’s brittleness and stiffness with the incorporation of 3-hydroxyhexanoate (Hx) comonomer units with medium-chain-length (mcl) side chains. The tough and ductile PHBHx, with a much lower crystallinity and melting temperature, is well-suited for many practical applications. Efforts have been made to broaden the application range of PHBHx by introducing the beta-form crystalline structure, where the molecular chains adopt a planar zig-zag conformation. However, it is extremely difficult to produce this beta-form in PHBHx due to its much lower crystallinity and much more flexible molecular chains. In this study, we report an approach using the technique of electrospinning. The strain-induced metastable β-form crystalline structure was successfully introduced in PHBHx by collecting the macroscopically aligned electrospun PHBHx nanofibers across the air gap on a piece of aluminum foil and on the tapered edge of a high-speed rotary disk. The presence of the β-form crystal structure in electrospun fiber mats was confirmed by wide-angle X-ray diffraction (WAXD) and Fourier transform infrared spectroscopy (FTIR), with molecular orientation of the polymer chains along the fiber axis revealed by polarized FTIR. Selected area electron diffraction (SAED) and AFM-IR were utilized to investigate the morphological and structural details of individual PHBHx nanofibers. The results demonstrated a coexistence of the thermodynamically stable α-form crystalline structure, where molecular chains adopt a left-handed 21 helical conformation, and the β-form in single fibers. The molecular orientation level and the relative amounts of the two crystalline polymorphs were found to be highly dependent on fiber collection methods

  7. Cluster-impact fusion

    SciTech Connect

    Echenique, P.M.; Manson, J.R.; Ritchie, R.H. )

    1990-03-19

    We present a model for the cluster-impact-fusion experiments of Buehler, Friedlander, and Friedman, Calculated fusion rates as a function of bombarding energy for constant cluster size agree well with experiment. The dependence of the fusion rate on cluster size at fixed bombarding energy is explained qualitatively. The role of correlated, coherent collisions in enhanced energy loss by clusters is emphasized.

  8. Relativistic electron fluxes and dose rate variations during April-May 2010 geomagnetic disturbances in the R3DR data on ISS

    NASA Astrophysics Data System (ADS)

    Dachev, Ts. P.; Tomov, B. T.; Matviichuk, Yu. N.; Dimitrov, Pl. G.; Bankov, N. G.; Reitz, G.; Horneck, G.; Häder, D.-P.; Lebert, M.; Schuster, M.

    2012-07-01

    Space radiation has been monitored successfully using the Radiation Risks Radiometer-Dosimeter (R3D) installed at the ESA EXPOSE-R (R3DR) facility outside of the Russian Zvezda module of the International Space Station (ISS) between March 2009 and January 2011. R3DR is a Liulin type spectrometer-dosimeter with a single Si PIN detector 2 cm2 of area and 0.3 mm thick. The R3DR instrument accumulated about 2 million measurements of the absorbed dose rate and flux of 10 s resolution. The total external and internal shielding before the detector of R3DR device is 0.41 g cm-2. The calculated stopping energy of normally incident particles to the detector is 0.78 MeV for electrons and 15.8 MeV for protons. After the Coronal Mass Ejection (CME) at 09:54 UTC on 3 April 2010, a shock was observed at the ACE spacecraft at 0756 UTC on 5 April, which led to a sudden impulse on Earth at 08:26 UTC. Nevertheless, while the magnetic substorms on 5 and 6 of April were moderate; the second largest in history of GOES fluence of electrons with energy >2 MeV was measured. The R3DR data show a relatively small amount of relativistic electrons on 5 April. The maximum dose rate of 2323 μGy day-1 was reached on 7 April; by 9 April, a dose of 6600 μGy was accumulated. By the end of the period on 7 May 2010 a total dose of 11,587 μGy was absorbed. Our data were compared with AE-8 MIN, CRESS and ESA-SEE1 models using SPENVIS and with similar observations on American, Japanese and Russian satellites.

  9. The somatotropic axis in neonatal calves can be modulated by nutrition, growth hormone, and Long-R3-IGF-I.

    PubMed

    Hammon, H; Blum, J W

    1997-07-01

    Effects on the somatotropic axis [plasma levels of insulin-like growth factors (IGFs) I and II, IGF-binding proteins (IGFBPs), and growth hormone (GH)] of feeding different amounts of colostrum or milk replacer, of Long-R3-IGF-I (administered subcutaneously or orally; 50 micrograms.kg body wt-1.day-1 for 7 days), and of subcutaneously injected recombinant bovine GH (rbGH; 1 mg.kg body wt-1.day-1 for 7 days) were evaluated in calves during the 1st wk of life. Plasma Long-R3-IGF-I increased after subcutaneous application but not with the oral dose. Endogenous IGF-I was higher in calves fed colostrum six times compared with those fed only milk replacer. Native IGF-I was highest in rbGH-injected calves but was lowered by the subcutaneous injection of Long-R3-IGF-I. IGF-II concentrations were not modified by any of the treatments. IGFBP-2 increased in calves fed only milk replacer and those receiving subcutaneous Long-R3-IGF-I. GH was not modulated by differences in nutrition but increased after rbGH administration and similarly in all groups after intravenous injection of GH-releasing factor analog GRF-(1-29). Parenteral administration of Long-R3-IGF-I decreased GH concentration but did not affect the secretory pattern. The data demonstrate that the somatotrophic axis is basically functioning in neonatal calves and is influenced by nutrition, GH, and Long-R3-IGF-I.

  10. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    PubMed

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides.

  11. Evolutionary Dynamics of the DNA-Binding Domains in Putative R2R3-MYB Genes Identified from Rice Subspecies indica and japonica Genomes1[w

    PubMed Central

    Jia, Li; Clegg, Michael T.; Jiang, Tao

    2004-01-01

    The molecular evolution of the R2R3-MYB gene family is of great interest because it is one of the most important transcription factor gene families in the plant kingdom. Comparative analyses of a gene family may reveal important adaptive changes at the protein level and thereby provide insights that relate structure to function. We have performed a range of comparative and bioinformatics analyses on R2R3-MYB genes identified from the rice (Oryza sativa subsp. japonica and indica) and Arabidopsis genome sequences. The study provides an initial framework to investigate how different evolutionary lineages in a gene family evolve new functions. Our results reveal a remarkable excess of non-synonymous substitutions, an indication of adaptive selection on protein structure that occurred during the evolution of both helix1 and helix2 of rice R2R3-MYB DNA-binding domains. These flexible α-helix regions associated with high frequencies of excess non-synonymous substitutions may play critical roles in the characteristic packing of R2R3-MYB DNA-binding domains and thereby modify the protein-DNA interaction process resulting in the recognition of novel DNA-binding sites. Furthermore, a co-evolutionary pattern is found between the second α-helix of the R2 domain and the second α-helix of the R3 domain by examining all the possible α-helix pairings in both the R2 and R3 domains. This points to the functional importance of pairing interactions between related secondary structures. PMID:14966247

  12. Integral potential method for a transmission problem with Lipschitz interface in R3 for the Stokes and Darcy-Forchheimer-Brinkman PDE systems

    NASA Astrophysics Data System (ADS)

    Kohr, Mirela; Lanza de Cristoforis, Massimo; Mikhailov, Sergey E.; Wendland, Wolfgang L.

    2016-10-01

    The purpose of this paper is to obtain existence and uniqueness results in weighted Sobolev spaces for transmission problems for the nonlinear Darcy-Forchheimer-Brinkman system and the linear Stokes system in two complementary Lipschitz domains in R3, one of them is a bounded Lipschitz domain {Ω} with connected boundary, and the other one is the exterior Lipschitz domain R3 setminus overline{Ω}. We exploit a layer potential method for the Stokes and Brinkman systems combined with a fixed point theorem in order to show the desired existence and uniqueness results, whenever the given data are suitably small in some weighted Sobolev spaces and boundary Sobolev spaces.

  13. PREFACE: Nuclear Cluster Conference; Cluster'07

    NASA Astrophysics Data System (ADS)

    Freer, Martin

    2008-05-01

    The Cluster Conference is a long-running conference series dating back to the 1960's, the first being initiated by Wildermuth in Bochum, Germany, in 1969. The most recent meeting was held in Nara, Japan, in 2003, and in 2007 the 9th Cluster Conference was held in Stratford-upon-Avon, UK. As the name suggests the town of Stratford lies upon the River Avon, and shortly before the conference, due to unprecedented rainfall in the area (approximately 10 cm within half a day), lay in the River Avon! Stratford is the birthplace of the `Bard of Avon' William Shakespeare, and this formed an intriguing conference backdrop. The meeting was attended by some 90 delegates and the programme contained 65 70 oral presentations, and was opened by a historical perspective presented by Professor Brink (Oxford) and closed by Professor Horiuchi (RCNP) with an overview of the conference and future perspectives. In between, the conference covered aspects of clustering in exotic nuclei (both neutron and proton-rich), molecular structures in which valence neutrons are exchanged between cluster cores, condensates in nuclei, neutron-clusters, superheavy nuclei, clusters in nuclear astrophysical processes and exotic cluster decays such as 2p and ternary cluster decay. The field of nuclear clustering has become strongly influenced by the physics of radioactive beam facilities (reflected in the programme), and by the excitement that clustering may have an important impact on the structure of nuclei at the neutron drip-line. It was clear that since Nara the field had progressed substantially and that new themes had emerged and others had crystallized. Two particular topics resonated strongly condensates and nuclear molecules. These topics are thus likely to be central in the next cluster conference which will be held in 2011 in the Hungarian city of Debrechen. Martin Freer Participants and Cluster'07

  14. Cluster-cluster aggregation in binary mixtures

    NASA Astrophysics Data System (ADS)

    Alsunaidi, A.; Lach-Hab, M.; González, Agustín E.; Blaisten-Barojas, Estela

    2000-01-01

    The structure and aggregation kinetics of three-dimensional clusters composed of two different monomeric species at three concentrations are thoroughly investigated by means of extensive, large-scale computer simulations. The aggregating monomers have all the same size and occupy the cells of a cubic lattice. Two bonding schemes are considered: (a) the binary diffusion-limited cluster-cluster aggregation (BDLCA) in which only the monomers of different species stick together, and (b) the invading binary diffusion-limited cluster-cluster aggregation (IBDLCA) in which additionally monomers of one of the two species are allowed to bond. In the two schemes, the mixed aggregates display self-similarity with a fractal dimension df that depends on the relative molar fraction of the two species and on concentration. At a given concentration, when this molar fraction is small, df approaches a value close to the reaction-limited cluster-cluster aggregation of one-component systems, and when the molar fraction is 0.5, df becomes close to the value of the diffusion-limited cluster-cluster aggregation model. The crossover between these two regimes is due to a time-decreasing reaction probability between colliding particles, particularly at small molar fractions. Several dynamical quantities are studied as a function of time. The number of clusters and the weight-average cluster size display a power-law behavior only at small concentrations. The dynamical exponents are obtained for molar fractions above 0.3 but not at or below 0.2, indicating the presence of a critical transition between a gelling to a nongelling system. The cluster-size distribution function presents scaling for molar fractions larger than 0.2.

  15. Gurmarin sensitivity of sweet taste responses is associated with co-expression patterns of T1r2, T1r3, and gustducin.

    PubMed

    Shigemura, Noriatsu; Nakao, Kazuko; Yasuo, Toshiaki; Murata, Yoshihiro; Yasumatsu, Keiko; Nakashima, Akihiko; Katsukawa, Hideo; Sako, Noritaka; Ninomiya, Yuzo

    2008-03-07

    Gurmarin (Gur) is a peptide that selectively suppresses sweet taste responses in rodents. The inhibitory effect of Gur differs among tongue regions and mouse strains. Recent studies demonstrated that co-expression levels of genes controlling sweet receptors (T1r2/T1r3 heterodimer) versus Galpha-protein, gustducin, are much lower in Gur-insensitive posterior circumvallate papillae than in Gur-sensitive anterior fungiform papillae. Here, we investigated the potential link of Gur-sensitivity with the co-expression for T1r2/T1r3 receptors and gustducin by comparing those of taste tissues of Gur-sensitive (B6, dpa congenic strains) and Gur-weakly-sensitive (BALB) strains. The results indicated that co-expression ratios among T1r2, T1r3, and gustducin in the fungiform papillae were significantly lower in Gur-weakly-sensitive BALB mice than in Gur-sensitive B6 and dpa congenic mice. This linkage between Gur-sensitivity and co-expression for T1r2/T1r3 receptors versus gustducin suggests that gustducin may be a key molecule involved in the pathway for Gur-sensitive sweet responses.

  16. Positive selection and functional divergence of R2R3-MYB paralogous genes expressed in inflorescence buds of Scutellaria species (Labiatae).

    PubMed

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-03-13

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification.

  17. Valence and environment of rare earth ions in CaAl 2O 4:Eu 2+,R 3+ persistent luminescence materials

    NASA Astrophysics Data System (ADS)

    Hölsä, Jorma; Laamanen, Taneli; Lastusaari, Mika; Malkamäki, Marja; Welter, Edmund; Zajac, Dariusz A.

    2010-04-01

    The existence of the different R 2+/R 3+/R IV (R: rare earth) ions as well as the modifications in the structural environment around the dopant and co-dopants in CaAl 2O 4:Eu 2+,R 3+ persistent luminescence materials was studied by L III edge X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) measurements at Hamburger Synchrotronstrahlungslabor (HASYLAB) at Deutsches Elektronen-Synchrotron (DESY) (Hamburg, Germany). The measurements were carried out at 10 and 296 K for selected rare earth (co-)dopants (Eu 2+; Ce 3+, Nd 3+, Sm 3+, and Yb 3+). The XANES results indicated the co-existence of both divalent and trivalent europium in all co-doped CaAl 2O 4:Eu 2+,R 3+ materials, but only divalent europium in CaAl 2O 4:Eu 2+. The measurement temperature did not affect the XANES results. The interatomic distances extracted from the EXAFS data of the CaAl 2O 4:Eu 2+,R 3+ materials indicated that co-doping creates distortions around the Eu 2+ ions suggesting dopant aggregation.

  18. Fretting and Corrosion Between a Metal Shell and Metal Liner May Explain the High Rate of Failure of R3 Modular Metal-on-Metal Hips.

    PubMed

    Ilo, Kevin C; Derby, Emma J; Whittaker, Robert K; Blunn, Gordon W; Skinner, John A; Hart, Alister J

    2017-05-01

    The R3 acetabular system used with its metal liner has higher revision rates when compared to its ceramic and polyethylene liner. In June 2012, the medical and healthcare products regulatory agency issued an alert regarding the metal liner of the R3 acetabular system. Six retrieved R3 acetabular systems with metal liners underwent detailed visual analysis using macroscopic and microscopic techniques. Visual analysis discovered corrosion on the backside of the metal liners. There was a distinct border to the areas of corrosion that conformed to antirotation tab insertions on the inner surface of the acetabular shell, which are for the polyethylene liner. Scanning electron microscopy indicated evidence of crevice corrosion, and energy-dispersive X-ray analysis confirmed corrosion debris rich in titanium. The high failure rate of the metal liner option of the R3 acetabular system may be attributed to corrosion on the backside of the liner which appear to result from geometry and design characteristics of the acetabular shell. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Project R-3; A Motivational Program Emphasizing Student Readiness, Subject Relevance, and Learning Reinforcement Through Individualized Instruction, Intensive Involvement, and Gaming/Simulation.

    ERIC Educational Resources Information Center

    San Jose Unified School District, CA.

    A course intended to upgrade essential reading and mathematics skills in students who show poor performance or negative attitudes towards school has been developed at A. Lincoln High School in San Jose, California. Called Project R-3, it seeks to motivate students by emphasizing student readiness, subject relevance, and learning reinforcement…

  20. Novel R2R3-MYB transcription factors from Prunus americana regulate differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The level of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  1. Crystal structure of methyl (2R,3S)-3-[(tert-butyl­sulfin­yl)amino]-2-fluoro-3-phenyl­propano­ate

    PubMed Central

    Zhao, Zhiwei; Fan, Wenqiang; Zhang, Yixiang; Li, Ya

    2015-01-01

    The title compound, C14H20FNO3S, contains two chiral carbon centres and the absolute configuration has been confirmed as (2R,3S). In the crystal, adjacent mol­ecules are linked by weak C—H⋯O hydrogen bonds, generating zigzag chains along the a-axis direction. PMID:26870495

  2. Crystal structure of methyl (2R,3S)-3-[(tert-butyl-sulfin-yl)amino]-2-fluoro-3-phenyl-propano-ate.

    PubMed

    Zhao, Zhiwei; Fan, Wenqiang; Zhang, Yixiang; Li, Ya

    2015-12-01

    The title compound, C14H20FNO3S, contains two chiral carbon centres and the absolute configuration has been confirmed as (2R,3S). In the crystal, adjacent mol-ecules are linked by weak C-H⋯O hydrogen bonds, generating zigzag chains along the a-axis direction.

  3. Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells.

    PubMed

    Ohmoto, Makoto; Matsumoto, Ichiro; Yasuoka, Akihito; Yoshihara, Yoshihiro; Abe, Keiko

    2008-08-01

    We established transgenic mouse lines expressing a transneuronal tracer, wheat germ agglutinin (WGA), under the control of mouse T1R3 gene promoter/enhancer. In the taste buds, WGA transgene was faithfully expressed in T1R3-positive sweet/umami taste receptor cells. WGA protein was transferred not laterally to the synapse-bearing, sour-responsive type III cells in the taste buds but directly to a subset of neurons in the geniculate and nodose/petrosal ganglia, and further conveyed to a rostro-central region of the nucleus of solitary tract. In addition, WGA was expressed in solitary chemoreceptor cells in the nasal epithelium and transferred along the trigeminal sensory pathway to the brainstem neurons. The solitary chemoreceptor cells endogenously expressed T1R3 together with bitter taste receptors T2Rs. This result shows an exceptional signature of receptor expression. Thus, the t1r3-WGA transgenic mice revealed the sweet/umami gustatory pathways from taste receptor cells and the trigeminal neural pathway from solitary chemoreceptor cells.

  4. 2R,3R-butanediol, a bacterial volatile produced by Pseudomonas chlororaphis O6, is involved in induction of systemic tolerance to drought in Arabidopsis thaliana.

    PubMed

    Cho, Song Mi; Kang, Beom Ryong; Han, Song Hee; Anderson, Anne J; Park, Ju-Young; Lee, Yong-Hwan; Cho, Baik Ho; Yang, Kwang-Yeol; Ryu, Choong-Min; Kim, Young Cheol

    2008-08-01

    Root colonization of plants with certain rhizobacteria, such as Pseudomonas chlororaphis O6, induces tolerance to biotic and abiotic stresses. Tolerance to drought was correlated with reduced water loss in P. chlororaphis O6-colonized plants and with stomatal closure, indicated by size of stomatal aperture and percentage of closed stomata. Stomatal closure and drought resistance were mediated by production of 2R,3R-butanediol, a volatile metabolite of P. chlororaphis O6. Root colonization with bacteria deficient in 2R,3R-butanediol production showed no induction of drought tolerance. Studies with Arabidopsis mutant lines indicated that induced drought tolerance required the salicylic acid (SA)-, ethylene-, and jasmonic acid-signaling pathways. Both induced drought tolerance and stomatal closure were dependent on Aba-1 and OST-1 kinase. Increases in free SA after drought stress of P. chlororaphis O6-colonized plants and after 2R,3R-butanediol treatment suggested a primary role for SA signaling in induced drought tolerance. We conclude that the bacterial volatile 2R,3R-butanediol was a major determinant in inducing resistance to drought in Arabidopsis through an SA-dependent mechanism.

  5. Novel R2R3-MYB transcription factors from Prunus Americana regulates differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The levels of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  6. R3Au9Pn (R = Y, Gd–Tm; Pn = Sb, Bi): A link between Cu10Sn3 and Gd14Ag51

    DOE PAGES

    Celania, Chris; Smetana, Volodymyr; Provino, Alessia; ...

    2017-06-05

    A new series of intermetallic compounds R3Au9Pn (R = Y, Gd–Tm; Pn = Sb, Bi) has been discovered during the explorations of the Au-rich parts of rare-earth-containing ternary systems with p-block elements. The existence of the series is strongly restricted by both geometric and electronic factors. R3Au9Pn compounds crystallize in the hexagonal crystal system with space group P63/m (a = 8.08–8.24 Å, c = 8.98–9.08 Å). All compounds feature Au-Pn, formally anionic, networks built up by layers of alternating edge-sharing Au@Au6 and Sb@Au6 trigonal antiprisms of overall composition Au6/2Pn connected through additional Au atoms and separated by a triangular cationicmore » substructure formed by R atoms. From a first look, the series appears to be isostructural with recently reported R3Au7Sn3 (a ternary ordered derivative of the Cu10Sn3-structure type), but no example of R3Au9M is known when M is a triel or tetrel element. R3Au9Pn also contains Au@Au6Au2R3 fully capped trigonal prisms, which are found to be isostructural with those found in the well-researched R14Au51 series. This structural motif, not present in R3Au7Sn3, represents a previously unrecognized link between Cu10Sn3 and Gd14Ag51 parent structure types. Magnetic property measurements carried out for Ho3Au9Sb reveal a complex magnetic structure characterized by antiferromagnetic interactions at low temperature (TN = 10 K). Two metamagnetic transitions occur at high field with a change from antiferromagnetic toward ferromagnetic ordering. Density functional theory based computations were performed to understand the materials’ properties and to shed some light on the stability ranges. As a result, this allowed a better understanding of the bonding pattern, especially of the Au-containing substructure, and elucidation of the role of the third element in the stability of the structure type.« less

  7. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis

    PubMed Central

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    Background DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. Material/Methods Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. Results Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33–18.05), TNM stage (OR=5.51, 95% CI: 2.83–10.71), differentiation (OR=4.16, 95% CI: 2.28–7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16–10.9), age (OR=0.85, 95% CI: 0.51–1.44), and overall survival time (OR=1.84, 95% CI: 0.58–5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. Conclusions Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  8. R3Au9Pn (R = Y, Gd-Tm; Pn = Sb, Bi): A Link between Cu10Sn3 and Gd14Ag51.

    PubMed

    Celania, Chris; Smetana, Volodymyr; Provino, Alessia; Pecharsky, Vitalij; Manfrinetti, Pietro; Mudring, Anja-Verena

    2017-06-19

    A new series of intermetallic compounds R3Au9Pn (R = Y, Gd-Tm; Pn = Sb, Bi) has been discovered during the explorations of the Au-rich parts of rare-earth-containing ternary systems with p-block elements. The existence of the series is strongly restricted by both geometric and electronic factors. R3Au9Pn compounds crystallize in the hexagonal crystal system with space group P63/m (a = 8.08-8.24 Å, c = 8.98-9.08 Å). All compounds feature Au-Pn, formally anionic, networks built up by layers of alternating edge-sharing Au@Au6 and Sb@Au6 trigonal antiprisms of overall composition Au6/2Pn connected through additional Au atoms and separated by a triangular cationic substructure formed by R atoms. From a first look, the series appears to be isostructural with recently reported R3Au7Sn3 (a ternary ordered derivative of the Cu10Sn3-structure type), but no example of R3Au9M is known when M is a triel or tetrel element. R3Au9Pn also contains Au@Au6Au2R3 fully capped trigonal prisms, which are found to be isostructural with those found in the well-researched R14Au51 series. This structural motif, not present in R3Au7Sn3, represents a previously unrecognized link between Cu10Sn3 and Gd14Ag51 parent structure types. Magnetic property measurements carried out for Ho3Au9Sb reveal a complex magnetic structure characterized by antiferromagnetic interactions at low temperature (TN = 10 K). Two metamagnetic transitions occur at high field with a change from antiferromagnetic toward ferromagnetic ordering. Density functional theory based computations were performed to understand the materials' properties and to shed some light on the stability ranges. This allowed a better understanding of the bonding pattern, especially of the Au-containing substructure, and elucidation of the role of the third element in the stability of the structure type.

  9. No Relationship between Sequence Variation in Protein Coding Regions of the Tas1r3 Gene and Saccharin Preference in Rats

    PubMed Central

    Lu, Ke; McDaniel, Amanda H.; Tordoff, Michael G.; Li, Xia; Beauchamp, Gary K.; Bachmanov, Alexander A.; VanderWeele, Dennis A.; Chapman, Clinton D.; Dess, Nancy K.; Huang, Liquan; Wang, Hong; Reed, Danielle R.

    2006-01-01

    Nearly all mammalian species like sweet-tasting foods and drinks, but there are differences in the degree of ‘sweet tooth’ both between species and among individuals of the same species. Some individual differences can be explained by genetic variability. Polymorphisms in a sweet taste receptor (Tas1r3) account for a large fraction of the differences in consumption of sweet solutions among inbred mouse strains. We wondered whether mice and rats share the same Tas1r3 alleles, and whether this gene might explain the large difference in saccharin preference among rats. We conducted three experiments to test this. We examined DNA sequence differences in the Tas1r3 gene among rats that differed in their consumption of saccharin in two-bottle choice tests. The animals tested were from an outbred strain (Sprague–Dawley; experiment 1), selectively bred to be high- or low-saccharin consumers (HiS and LoS; experiment 2), or from inbred strains with established differences in saccharin preference (FH/Wjd and ACI; experiment 3). Although there was considerable variation in saccharin preference among the rats there was no variation in the protein-coding regions of theTas1r3 gene. DNA variants in intronic regions were detected in 1 (of 12) outbred rat with lower-than-average saccharin preference and in the ACI inbred strain, which also has a lower saccharin preference than the FH/Wjd inbred partner strain. Possible effects of these intronic nucleotide variants on Tas1r3 gene expression or the presence of T1R3 protein in taste papillae were evaluated in the ACI and FH/Wjd strains. Based upon the results of these studies, we conclude that polymorphisms in the protein-coding regions of the sweet receptor gene Tas1r3 are uncommon and do not account for individual differences in saccharin preference for these strains of rats. DNA variants in intron 4 and 5 are more common but appear to be innocuous. PMID:15741599

  10. Polymorphisms in the carcinogen detoxification genes CYB5A and CYB5R3 and breast cancer risk in African American women

    PubMed Central

    Blanke, Kristina L.; Sacco, James C.; Millikan, Robert C.; Olshan, Andrew F.; Luo, Jingchun; Trepanier, Lauren A.

    2014-01-01

    Purpose Cytochrome b5 (encoded by CYB5A) and NADH cytochrome b5 reductase (encoded by CYB5R3) detoxify aromatic and heterocyclic amine mammary carcinogens found in cigarette smoke. We hypothesized that CYB5A and CYB5R3 polymorphisms would be associated with breast cancer risk in women. Methods We characterized the prevalence of 18 CYB5A and CYB5R3 variants in genomic DNA from African American (AfrAm) and Caucasian (Cauc) women from the Carolina Breast Cancer Study population (1946 cases and 1747 controls), and determined their associations with breast cancer risk, with effect modification by smoking. Results A CYB5R3 variant, I1M+6T (rs8190370) was significantly more common in breast cancer cases (MAF 0.0238) compared to controls (0.0169, P =0.039); this was attributable to a higher MAF in AfrAm cases (0.0611) compared to AfrAm controls (0.0441, P=0.046; adjusted OR 1.41, CI 0.98-2.04; P=0.062). When smoking was considered, I1M+6T was more strongly associated with breast cancer risk in AfrAm smokers (adjusted OR 2.10, 1.08-4.07; P=0.028) compared to never-smokers (OR=1.21; 0.77-1.88; P for interaction=0.176). I1M+6T and three additional CYB5R3 variants, -251T, I8-1676C, and *392C, as well as two CYB5A variants, 13G and I2-992T, were significantly more common in AfrAms compared to Caucs. Conclusions CYB5R3 I1M+6 C>T should be considered in future molecular epidemiologic studies of breast cancer risk in AfrAms. Further, variants in CYB5A and CYB5R3 should be considered in the evaluation of other tumors in AfrAms that are associated with aromatic and heterocyclic amine exposures, to include prostate, bladder, and colon cancers. PMID:25225034

  11. Cluster Morphology Analysis

    PubMed Central

    Jacquez, Geoffrey M.

    2009-01-01

    Most disease clustering methods assume specific shapes and do not evaluate statistical power using the applicable geography, at-risk population, and covariates. Cluster Morphology Analysis (CMA) conducts power analyses of alternative techniques assuming clusters of different relative risks and shapes. Results are ranked by statistical power and false positives, under the rationale that surveillance should (1) find true clusters while (2) avoiding false clusters. CMA then synthesizes results of the most powerful methods. CMA was evaluated in simulation studies and applied to pancreatic cancer mortality in Michigan, and finds clusters of flexible shape while routinely evaluating statistical power. PMID:20234799

  12. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. Copyright © 2015 the American Physiological Society.

  13. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion.

  14. Upregulation and nuclear localization of TNF-like cytokine 1A (TL1A) and its receptors DR3 and DcR3 in psoriatic skin lesions.

    PubMed

    Bamias, Giorgos; Evangelou, Kostas; Vergou, Theognosia; Tsimaratou, Katerina; Kaltsa, Garyfallia; Antoniou, Christina; Kotsinas, Athanasios; Kim, Sungee; Gorgoulis, Vassilis; Stratigos, Alexander J; Sfikakis, Petros P

    2011-09-01

    TNF is critically involved in the pathogenesis of psoriasis. TL1A is a TNF-like cytokine, which, after binding to death domain receptor DR3, provides costimulatory signals to lymphocytes, amplifies Th1- and Th17-mediated immune responses and induces apoptotic cell death. These functions are inhibited when TL1A associates to decoy receptor DcR3. In the present study, we investigated the expression profiles for TL1A, DR3 and DcR3 in the normal skin and in psoriatic skin lesions. By use of immunohistochemistry, we were able to demonstrate constitutive cutaneous expression of DR3 and DcR3 but not of TL1A in healthy skin. On the other hand, in patients with active psoriasis, we observed abundant immunostaining for TL1A and significant upregulation of its receptors (P < 0.05 in comparison to healthy skin). TL1A, DR3 and DcR3 proteins, as well as mRNA transcripts reflecting in situ production of TL1A and DcR3, were also specifically increased in lesional as compared to non-lesional skin from patients with psoriasis (P < 0.05). These proteins were upregulated in cell populations that are critically involved in the pathogenesis of chronic skin inflammation, such as keratinocytes, macrophages in deep dermis and cells at the perivascular/endothelial area. Finally, we provide evidence for the existence of nuclear localization of TL1A in inflammatory cells from psoriatic lesions. This was also observed in inflamed synovia from patients with rheumatoid arthritis, but not in neoplastic TL1A-expressing cell lines. We conclude that interactions between TL1A and its two receptors may be involved in the pathogenesis of chronic skin inflammation that takes place in psoriasis. © 2011 John Wiley & Sons A/S.

  15. TAS1R3 and UCN2 Transcript Levels in Blood Cells Are Associated With Sugary and Fatty Food Consumption in Children.

    PubMed

    Priego, T; Sánchez, J; Picó, C; Ahrens, W; De Henauw, S; Kourides, Y; Lissner, L; Molnár, D; Moreno, L A; Russo, P; Siani, A; Veidebaum, T; Palou, A

    2015-09-01

    New types of dietary exposure biomarkers are needed to implement effective strategies for obesity prevention in children. Of special interest are biomarkers of consumption of food rich in simple sugars and fat because their intake has been associated with obesity development. Peripheral blood cells (PBCs) represent a promising new tool for identifying novel, transcript-based biomarkers. This study aimed to study potential associations between the transcripts of taste receptor type 1 member 3 (TAS1R3) and urocortin II (UCN2) genes in PBCs and the frequency of sugary and fatty food consumption in children. Four hundred sixty-three children from the IDEFICS cohort were selected to include a similar number of boys and girls, both normal-weight and overweight, belonging to eight European countries. Anthropometric parameters (measured at baseline and in a subset of 193 children after 2 years), food consumption frequency and transcript levels of TAS1R3 and UCN2 genes in PBCs were measured. Children with low-frequency consumption of sugary foods displayed higher TAS1R3 expression levels with respect to those with intermediate or high frequency. In turn, children with high-frequency consumption of fatty foods showed lower UCN2 expression levels with respect to those with low or intermediate frequency. Moreover, transcripts of TAS1R3 were related with body mass index and fat-mass changes after a 2-year follow-up period, with low expression levels of this gene being related with increased fat accumulation over time. The transcripts of TAS1R3 and UCN2 in PBCs may be considered potential biomarkers of consumption of sugary and fatty food, respectively, to complement data of food-intake questionnaires.

  16. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  17. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  18. Cluster Physics with Merging Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Molnar, Sandor

    Collisions between galaxy clusters provide a unique opportunity to study matter in a parameter space which cannot be explored in our laboratories on Earth. In the standard ΛCDM model, where the total density is dominated by the cosmological constant (Λ) and the matter density by cold dark matter (CDM), structure formation is hierarchical, and clusters grow mostly by merging. Mergers of two massive clusters are the most energetic events in the universe after the Big Bang, hence they provide a unique laboratory to study cluster physics. The two main mass components in clusters behave differently during collisions: the dark matter is nearly collisionless, responding only to gravity, while the gas is subject to pressure forces and dissipation, and shocks and turbulence are developed during collisions. In the present contribution we review the different methods used to derive the physical properties of merging clusters. Different physical processes leave their signatures on different wavelengths, thus our review is based on a multifrequency analysis. In principle, the best way to analyze multifrequency observations of merging clusters is to model them using N-body/HYDRO numerical simulations. We discuss the results of such detailed analyses. New high spatial and spectral resolution ground and space based telescopes will come online in the near future. Motivated by these new opportunities, we briefly discuss methods which will be feasible in the near future in studying merging clusters.

  19. Comprehensive cluster analysis with Transitivity Clustering.

    PubMed

    Wittkop, Tobias; Emig, Dorothea; Truss, Anke; Albrecht, Mario; Böcker, Sebastian; Baumbach, Jan

    2011-03-01

    Transitivity Clustering is a method for the partitioning of biological data into groups of similar objects, such as genes, for instance. It provides integrated access to various functions addressing each step of a typical cluster analysis. To facilitate this, Transitivity Clustering is accessible online and offers three user-friendly interfaces: a powerful stand-alone version, a web interface, and a collection of Cytoscape plug-ins. In this paper, we describe three major workflows: (i) protein (super)family detection with Cytoscape, (ii) protein homology detection with incomplete gold standards and (iii) clustering of gene expression data. This protocol guides the user through the most important features of Transitivity Clustering and takes ∼1 h to complete.

  20. Gold-bismuth clusters.

    PubMed

    Martínez, Ana

    2014-08-07

    Metal clusters have interesting characteristics, such as the relationship between properties and size of the cluster. This is not always apparent, so theoretical studies can provide relevant information. In this report, optimized structures and electron donor-acceptor properties of AunBim clusters are reported (n + m = 2-7, 20). Density functional theory calculations were performed to obtain optimized structures. The ground states of gold clusters formed with up to seven atoms are planar. The presence of Bi modifies the structure, and the clusters become 3-D. Several optimized geometries have at least one Bi atom bonded to gold or bismuth atoms and form structures similar to NH3. This fragment is also present in clusters with 20 atoms, where the formation of Au3Bi stabilizes the structures. Bismuth clusters are better electron donors and worse electron acceptors than gold clusters. Mixed clusters fall in between these two extremes. The presence of Bi atoms in gold clusters modifies the electron donor-acceptor properties of the clusters, but there is no correlation between the number of Bi atoms present in the cluster and the capacity for donating electrons. The effect of planarity in Au19Bi clusters is the same as that in Au20 clusters. The properties of pure gold clusters are certainly interesting, but clusters formed by Bi and Au are more important because the introduction of different atoms modifies the geometry, the stability, and consequently the physical and chemical properties. Apparently, the presence of Bi may increase the reactivity of gold clusters, but further studies are necessary to corroborate this hypothesis.

  1. Nuclear Clusters in Astrophysics

    NASA Astrophysics Data System (ADS)

    Kubono, S.; Binh, Dam N.; Hayakawa, S.; Hashimoto, H.; Kahl, D.; Wakabayashi, Y.; Yamaguchi, H.; Teranishi, T.; Iwasa, N.; Komatsubara, T.; Kato, S.; Khiem, Le H.

    2010-03-01

    The role of nuclear clustering is discussed for nucleosynthesis in stellar evolution with Cluster Nucleosynthesis Diagram (CND) proposed before. Special emphasis is placed on α-induced stellar reactions together with molecular states for O and C burning.

  2. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  3. [Pathophysiology of cluster headache].

    PubMed

    Donnet, Anne

    2015-11-01

    The aetiology of cluster headache is partially unknown. Three areas are involved in the pathogenesis of cluster headache: the trigeminal nociceptive pathways, the autonomic system and the hypothalamus. The cluster headache attack involves activation of the trigeminal autonomic reflex. A dysfunction located in posterior hypothalamic gray matter is probably pivotal in the process. There is a probable association between smoke exposure, a possible genetic predisposition and the development of cluster headache.

  4. Clustering algorithm studies

    NASA Astrophysics Data System (ADS)

    Graf, Norman A.

    2001-07-01

    An object-oriented framework for undertaking clustering algorithm studies has been developed. We present here the definitions for the abstract Cells and Clusters as well as the interface for the algorithm. We intend to use this framework to investigate the interplay between various clustering algorithms and the resulting jet reconstruction efficiency and energy resolutions to assist in the design of the calorimeter detector.

  5. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  6. Star cluster dynamics.

    PubMed

    Vesperini, Enrico

    2010-02-28

    Dynamical evolution plays a key role in shaping the current properties of star clusters and star cluster systems. A detailed understanding of the effects of evolutionary processes is essential to be able to disentangle the properties that result from dynamical evolution from those imprinted at the time of cluster formation. In this review, I focus my attention on globular clusters, and review the main physical ingredients driving their early and long-term evolution, describe the possible evolutionary routes and show how cluster structure and stellar content are affected by dynamical evolution.

  7. Ghostly Open Clusters (Invited)

    NASA Astrophysics Data System (ADS)

    de La Fuente Marcos, R.

    We review theory and observations of the final stages of the evolution of open clusters. The distinguishing features of these ghostly objects depend upon the original membership of the cluster, the fraction of primordial binaries, and the initial mass function. Remnants of rich open clusters are difficult to detect and might exist in large numbers. We then examine the limited observational data available in this field, and discuss how to use the results of numerical integrations to plan future surveys and evaluate the quality of the available observational information. Current observational results render it very hard to distinguish between a poor open cluster, an open cluster remnant, or part of an association.

  8. Distinct contributions of T1R2 and T1R3 taste receptor subunits to the detection of sweet stimuli.

    PubMed

    Nie, Yiling; Vigues, Stephan; Hobbs, Jeanette R; Conn, Graeme L; Munger, Steven D

    2005-11-08

    Animals utilize hundreds of distinct G protein-coupled receptor (GPCR)-type chemosensory receptors to detect a diverse array of chemical signals in their environment, including odors, pheromones, and tastants. However, the molecular mechanisms by which these receptors selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. Here, we report that each of the two subunits in the heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in behaving mice. Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.

  9. Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli

    SciTech Connect

    Nie,Y.; Vigues, S.; Hobbs, J.; Conn, G.; Munger, S.

    2005-01-01

    The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice. Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.

  10. The Brassica napus receptor-like protein RLM2 is encoded by a second allele of the LepR3/Rlm2 blackleg resistance locus.

    PubMed

    Larkan, Nicholas J; Ma, Lisong; Borhan, Mohammad Hossein

    2015-09-01

    Leucine-rich repeat receptor-like proteins (LRR-RLPs) are highly adaptable parts of the signalling apparatus for extracellular detection of plant pathogens. Resistance to blackleg disease of Brassica spp. caused by Leptosphaeria maculans is largely governed by host race-specific R-genes, including the LRR-RLP gene LepR3. The blackleg resistance gene Rlm2 was previously mapped to the same genetic interval as LepR3. In this study, the LepR3 locus of the Rlm2 Brassica napus line 'Glacier DH24287' was cloned, and B. napus transformants were analysed for recovery of the Rlm2 phenotype. Multiple B. napus, B. rapa and B. juncea lines were assessed for sequence variation at the locus. Rlm2 was found to be an allelic variant of the LepR3 LRR-RLP locus, conveying race-specific resistance to L. maculans isolates harbouring AvrLm2. Several defence-related LRR-RLPs have previously been shown to associate with the RLK SOBIR1 to facilitate defence signalling. Bimolecular fluorescence complementation (BiFC) and co-immunoprecipitation of RLM2-SOBIR1 studies revealed that RLM2 interacts with SOBIR1 of Arabidopsis thaliana when co-expressed in Nicotiana benthamiana. The interaction of RLM2 with AtSOBIR1 is suggestive of a conserved defence signalling pathway between B. napus and its close relative A. thaliana. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to Polycose: implications for saccharide taste receptors in mice.

    PubMed

    Treesukosol, Yada; Blonde, Ginger D; Spector, Alan C

    2009-04-01

    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste.

  12. Detection of Maltodextrin and Its Discrimination from Sucrose are Independent of the T1R2+T1R3 Heterodimer.

    PubMed

    Smith, Kimberly R; Spector, Alan Craig

    2017-08-02

    Maltodextrins, such as Maltrin and Polycose, are glucose polymer mixtures of varying chain lengths that are palatable to rodents. Although glucose and other sugars activate the T1R2+T1R3 "sweet" taste receptor, recent evidence from T1R2 or T1R3 knockout (KO) mice suggests that maltodextrins, despite their glucose polymer composition, activate a separate receptor mechanism to generate a taste percept qualitatively distinguishable from that of sweeteners. However, explicit discrimination of maltodextrins from prototypical sweeteners has not yet been psychophysically tested in any murine model. Therefore, mice lacking T1R2+T1R3 and wild-type controls were tested in a two-response taste discrimination task to determine if maltodextrins are 1) detectable when both receptor subunits are absent, and 2) perceptually distinct from that of sucrose irrespective of viscosity, intensity, and hedonics. Most KO mice displayed similar Polycose sensitivity as controls. However, some KO mice were only sensitive to the higher Polycose concentrations, implicating potential allelic variation in the putative polysaccharide receptor or downstream pathways unmasked by the absence of T1R2+T1R3. Varied Maltrin and sucrose concentrations of approximately matched viscosities were then presented to render the oral somatosensory features, intensity, and hedonic value of the solutions irrelevant. While both genotypes competently discriminated Maltrin from sucrose, performance was apparently driven by the different orosensory percepts of the two stimuli in control mice and the presence of a Maltrin but not sucrose orosensory cue in KO mice. These data support the proposed presence of an orosensory receptor mechanism that gives rise to a qualitatively distinguishable sensation from that of sucrose. Copyright © 2017, American Journal of Physiology-Regulatory, Integrative and Comparative Physiology.

  13. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to polycose: implications for saccharide taste receptors in mice

    PubMed Central

    Treesukosol, Yada; Blonde, Ginger D.; Spector, Alan C.

    2009-01-01

    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste. PMID:19158407

  14. The structures of T6, T3R3 and R6 bovine insulin: combining X-ray diffraction and absorption spectroscopy.

    PubMed

    Frankær, Christian Grundahl; Knudsen, Marianne Vad; Norén, Katarina; Nazarenko, Elena; Ståhl, Kenny; Harris, Pernille

    2012-10-01

    The crystal structures of three conformations, T(6), T(3)R(3) and R(6), of bovine insulin were solved at 1.40, 1.30 and 1.80 Å resolution, respectively. All conformations crystallized in space group R3. In contrast to the T(6) and T(3)R(3) structures, different conformations of the N-terminal B-chain residue PheB1 were observed in the R(6) insulin structure, resulting in an eightfold doubling of the unit-cell volume upon cooling. The zinc coordination in each conformation was studied by X-ray absorption spectroscopy (XAS), including both EXAFS and XANES. Zinc adopts a tetrahedral coordination in all R(3) sites and an octahedral coordination in T(3) sites. The coordination distances were refined from XAS with a standard deviation of <0.01 Å. In contrast to the distances determined from the medium-resolution crystal structures, the XAS results were in good agreement with similar coordination geometries found in small molecules, as well as in other high-resolution insulin structures. As the radiation dose for XRD experiments is two orders of magnitude higher compared with that of XAS experiments, the single crystals were exposed to a higher degree of radiation damage that affected the zinc coordination in the T(3) sites in particular. Furthermore, XANES spectra for the zinc sites in T(6) and R(6) insulin were successfully calculated using finite difference methods and the bond distances and angles were optimized from a quantitative XANES analysis.

  15. Prognostic significance of TRAIL-R3 and CCR-2 expression in tumor epithelial cells of patients with early breast cancer.

    PubMed

    Labovsky, Vivian; Martinez, Leandro Marcelo; Davies, Kevin Mauro; de Luján Calcagno, María; García-Rivello, Hernán; Wernicke, Alejandra; Feldman, Leonardo; Matas, Ayelén; Giorello, María Belén; Borzone, Francisco Raúl; Choi, Hosoon; Howard, Scott C; Chasseing, Norma Alejandra

    2017-04-18

    Tumor epithelial cells (TEpCs) and spindle-shaped stromal cells, not associated with the vasculature, of patients with early breast cancer express osteoprotegerin (OPG), tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), receptor activator of nuclear factor kappa B ligand, stromal cell derived factor-1, interleukin-6, macrophage colony stimulating factor, chemokine (C-C motif) ligand-2 (CCL-2) and their receptors at significantly higher levels compared with non-neoplastic breast tissues. We evaluated the clinicopathological significance of these ligands and receptors in TEpC and spindle-shaped stromal cells, not associated with the vasculature, to determine their impact on prognosis of patients with early-stage breast cancer. We conducted immunohistochemical analyses of protein expression in primary tumors of patients with early breast cancer and analyzed their association with standard prognostic parameters and clinical outcomes, including local relapse, metastatic recurrence, disease-free survival (DFS), metastasis-free survival (MFS), and overall survival (OS). Elevated levels of TRAIL-R3 and chemokine (C-C motif) receptor 2 (CCR-2) in TEpCs and OPG and CCL-2 in stromal cells were significantly associated with a higher risk of metastasis (p = 0.032, p = 0.003, p = 0.038, and p = 0.049; respectively). Moreover, high expression of TRAIL-R3 and CCR-2 in TEpCs was associated with shorter DFS, MFS, and OS. High TRAIL-R3 expression in TEpCs was an independent prognostic factor for DFS and OS, and high CCR-2 expression in these cells was an independent prognostic factor for MFS. High levels of TRAIL-R3 and CCR-2 expression in TEpCs identified patients with early breast cancer with poor outcomes.

  16. Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco.

    PubMed

    Omer, Sumita; Kumar, Santosh; Khan, Bashir M

    2013-01-01

    KEY MESSAGE : LlMYB1 , a subgroup 4 R2R3-type MYB transcription factor gene from Leucaena leucocephala appears to be a repressor of lignin biosynthesis pathway by regulating the transcription of general phenylpropanoid pathway genes. R2R3MYB transcription factors are known to play a wide role in regulating the phenylpropanoid pathway in plants. In this study, we report isolation, cloning and characterization of an R2R3MYB transcription factor gene (LlMYB1) from an economically important tree species, Leucaena leucocephala. LlMYB1 consists of 705 bp coding sequence corresponding to 235 amino acids. Sequence alignment revealed that the N-terminal (MYB) domain of the gene shares up to 95 % similarity with subgroup 4 (Sg4) members of R2R3Myb gene family functionally known to be lignin repressors. Highly divergent C-terminal region of the gene carried an ERF-associated amphiphilic repression (EAR) motif, another characteristic of the Sg4. The gene was phylogenetically grouped closest with AmMYB308, a known repressor of monolignol biosynthetic pathway genes. Spatio-temporal expression studies at different ages of seedlings using quantitative real-time PCR (QRT-PCR) showed highest transcript level of the gene in 10 day old stem tissues. Over-expression of the gene in transgenic tobacco showed statistically significant decline in the transcript levels of the general phenylpropanoid pathway genes and reduction in lignin content. Our study suggests that LlMYB1 might be playing the role of a repressor of lignin biosynthesis in L. leucocephala.

  17. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  18. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    PubMed Central

    Görner, Christian; Hirte, Max; Huber, Stephanie; Schrepfer, Patrick; Brück, Thomas

    2015-01-01

    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus. Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an Escherichia coli based terpene production system, allowed efficient production of this olefinic macrocycle. To diversify the 3,7,18-dolabellatriene bioactivity we evaluated chemical and enzymatic methods for selective oxidation. Epoxidation by acetic peracid, which was formed in situ by a lipase catalyzed reaction of acetic acid with H2O2, provided efficient access to two monooxidized dolabellanes and to a novel di-epoxidated dolabellane species. These compounds could act as synthons en-route to new dolabellanes with diversified bioactivities. Furthermore, we demonstrate the almost quantitative 3,7,18-dolabellatriene conversion into the new, non-natural compound (1R,3E,7E,11S,12S,18R)-dolabella-3,7-diene-20-ol by hydroboration–oxidation with an enantiomeric excess of 94%, for the first time. PMID:26528263

  19. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  20. In Quest of the Alanine R3 Radical: Multivariate EPR Spectral Analyses of X-Irradiated Alanine in the Solid State.

    PubMed

    Jåstad, Eirik O; Torheim, Turid; Villeneuve, Kathleen M; Kvaal, Knut; Hole, Eli O; Sagstuen, Einar; Malinen, Eirik; Futsaether, Cecilia M

    2017-09-28

    The amino acid l-α-alanine is the most commonly used material for solid-state electron paramagnetic resonance (EPR) dosimetry, due to the formation of highly stable radicals upon irradiation, with yields proportional to the radiation dose. Two major alanine radical components designated R1 and R2 have previously been uniquely characterized from EPR and electron-nuclear double resonance (ENDOR) studies as well as from quantum chemical calculations. There is also convincing experimental evidence of a third minor radical component R3, and a tentative radical structure has been suggested, even though no well-defined spectral signature has been observed experimentally. In the present study, temperature dependent EPR spectra of X-ray irradiated polycrystalline alanine were analyzed using five multivariate methods in further attempts to understand the composite nature of the alanine dosimeter EPR spectrum. Principal component analysis (PCA), maximum likelihood common factor analysis (MLCFA), independent component analysis (ICA), self-modeling mixture analysis (SMA), and multivariate curve resolution (MCR) were used to extract pure radical spectra and their fractional contributions from the experimental EPR spectra. All methods yielded spectral estimates resembling the established R1 spectrum. Furthermore, SMA and MCR consistently predicted both the established R2 spectrum and the shape of the R3 spectrum. The predicted shape of the R3 spectrum corresponded well with the proposed tentative spectrum derived from spectrum simulations. Thus, results from two independent multivariate data analysis techniques strongly support the previous evidence that three radicals are indeed present in irradiated alanine samples.

  1. Metabolism of myo-[2-3H]Inositol and scyllo-[R-3H]Inositol in Ripening Wheat Kernels 1

    PubMed Central

    Sasaki, Ken; Loewus, Frank A.

    1980-01-01

    Injection of myo-[2-3H]inositol or scyllo-[R-3H]inositol into the peduncular cavity of wheat stalks about 2 to 4 weeks postanthesis led to rapid translocation into the spike and accumulation of label in developing kernels, especially the bran fraction. With myo-[2-3H]inositol, about 50 to 60% of the label was incorporated into high molecular weight cell wall substance in the region of the injection. That portion translocated to the kernels was utilized primarily for cell wall polysaccharide formation and phytate biosynthesis. A small amount was recovered as free myo-inositol and galactinol. When scyllo-[R-3H]inositol was supplied, most of the label was translocated into the developing kernels where it accumulated as free scyllo-inositol and O-α-d-galactopyranosyl-scyllo-inositol in approximately equal amount. None of the label from scyllo-[R-3H]inositol was utilized for either phytate biosynthesis or cell wall polysaccharide formation. PMID:16661513

  2. Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes.

    PubMed Central

    Meissner, R C; Jin, H; Cominelli, E; Denekamp, M; Fuertes, A; Greco, R; Kranz, H D; Penfield, S; Petroni, K; Urzainqui, A; Martin, C; Paz-Ares, J; Smeekens, S; Tonelli, C; Weisshaar, B; Baumann, E; Klimyuk, V; Marillonnet, S; Patel, K; Speulman, E; Tissier, A F; Bouchez, D; Jones, J J; Pereira, A; Wisman, E

    1999-01-01

    More than 92 genes encoding MYB transcription factors of the R2R3 class have been described in Arabidopsis. The functions of a few members of this large gene family have been described, indicating important roles for R2R3 MYB transcription factors in the regulation of secondary metabolism, cell shape, and disease resistance, and in responses to growth regulators and stresses. For the majority of the genes in this family, however, little functional information is available. As the first step to characterizing these genes functionally, the sequences of >90 family members, and the map positions and expression profiles of >60 members, have been determined previously. An important second step in the functional analysis of the MYB family, through a process of reverse genetics that entails the isolation of insertion mutants, is described here. For this purpose, a variety of gene disruption resources has been used, including T-DNA-insertion populations and three distinct populations that harbor transposon insertions. We report the isolation of 47 insertions into 36 distinct MYB genes by screening a total of 73 genes. These defined insertion lines will provide the foundation for subsequent detailed functional analyses for the assignment of specific functions to individual members of the R2R3 MYB gene family. PMID:10521515

  3. The T1R2/T1R3 sweet receptor and TRPM5 ion channel taste targets with therapeutic potential.

    PubMed

    Sprous, Dennis; Palmer, Kyle R

    2010-01-01

    Taste signaling is a critical determinant of ingestive behaviors and thereby linked to obesity and related metabolic dysfunctions. Recent evidence of taste signaling pathways in the gut suggests the link to be more direct, raising the possibility that taste receptor systems could be regarded as therapeutic targets. T1R2/T1R3, the G protein coupled receptor that mediates sweet taste, and the TRPM5 ion channel have been the focus of discovery programs seeking novel compounds that could be useful in modifying taste. We review in this chapter the hypothesis of gastrointestinal taste signaling and discuss the potential for T1R2/T1R3 and TRPM5 as targets of therapeutic intervention in obesity and diabetes. Critical to the development of a drug discovery program is the creation of libraries that enhance the likelihood of identifying novel compounds that modulate the target of interest. We advocate a computer-based chemoinformatic approach for assembling natural and synthetic compound libraries as well as for supporting optimization of structure activity relationships. Strategies for discovering modulators of T1R2/T1R3 and TRPM5 using methods of chemoinformatics are presented herein. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Cloning and Characterisation of (R)-3-hydroxyacyl-acyl Carrier Protein-coenzyme A Transferase Gene (phaG) from Pseudomonas sp. USM 4-55.

    PubMed

    Arsad, Hasni; Sudesh, Kumar; Nazalan, Najimudin; Muhammad, Tengku Sifzizul Tengku; Wahab, Habibah; Razip Samian, Mohd

    2009-12-01

    The (R)-3-hydroxyacyl-ACP-CoA transferase catalyses the conversion of (R)-3-hydroxyacyl-ACP to (R)-3-hydroxyacyl-CoA derivatives, which serves as the ultimate precursor for polyhydroxyalkanoate (PHA) polymerisation from unrelated substrates in pseudomonads. PhaG was found to be responsible for channelling precursors for polyhydroxyalkanoate (PHA) synthase from a de novo fatty acid biosynthesis pathway when cultured on carbohydrates, such as glucose or gluconate. The phaG gene was cloned from Pseudomonas sp. USM 4-55 using a homologous probe. The gene was located in a 3660 bp Sal I fragment (GenBank accession number EU305558). The open reading frame (ORF) was 885 bp long and encoded a 295 amino acid protein. The predicted molecular weight was 33251 Da, and it showed a 62% identity to the PhaG of Pseudomonas aeruginosa. The function of the cloned phaG of Pseudomonas sp. USM 4-55 was confirmed by complementation studies. Plasmid pBCS39, which harboured the 3660 bp Sal I fragment, was found to complement the PhaG-mutant heterologous host cell, Pseudomonas putida PhaGN-21. P. putida PhaGN-21, which harboured pBCS39, accumulated PHA that accounted for up to 18% of its cellular dry weight (CDW). P. putida PhaGN-21, which harboured the vector alone (PBBR1MCS-2), accumulated only 0.6% CDW of PHA.

  5. Cluster assembly in nitrogenase.

    PubMed

    Sickerman, Nathaniel S; Rettberg, Lee A; Lee, Chi Chung; Hu, Yilin; Ribbe, Markus W

    2017-05-09

    The versatile enzyme system nitrogenase accomplishes the challenging reduction of N2and other substrates through the use of two main metalloclusters. For molybdenum nitrogenase, the catalytic component NifDK contains the [Fe8S7]-core P-cluster and a [MoFe7S9C-homocitrate] cofactor called the M-cluster. These chemically unprecedented metalloclusters play a critical role in the reduction of N2, and both originate from [Fe4S4] clusters produced by the actions of NifS and NifU. Maturation of P-cluster begins with a pair of these [Fe4S4] clusters on NifDK called the P*-cluster. An accessory protein NifZ aids in P-cluster fusion, and reductive coupling is facilitated by NifH in a stepwise manner to form P-cluster on each half of NifDK. For M-cluster biosynthesis, two [Fe4S4] clusters on NifB are coupled with a carbon atom in a radical-SAM dependent process, and concomitant addition of a 'ninth' sulfur atom generates the [Fe8S9C]-core L-cluster. On the scaffold protein NifEN, L-cluster is matured to M-cluster by the addition of Mo and homocitrate provided by NifH. Finally, matured M-cluster in NifEN is directly transferred to NifDK, where a conformational change locks the cofactor in place. Mechanistic insights into these fascinating biosynthetic processes are detailed in this chapter. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  6. Modeling Clustered Data with Very Few Clusters.

    PubMed

    McNeish, Daniel; Stapleton, Laura M

    2016-01-01

    Small-sample inference with clustered data has received increased attention recently in the methodological literature, with several simulation studies being presented on the small-sample behavior of many methods. However, nearly all previous studies focus on a single class of methods (e.g., only multilevel models, only corrections to sandwich estimators), and the differential performance of various methods that can be implemented to accommodate clustered data with very few clusters is largely unknown, potentially due to the rigid disciplinary preferences. Furthermore, a majority of these studies focus on scenarios with 15 or more clusters and feature unrealistically simple data-generation models with very few predictors. This article, motivated by an applied educational psychology cluster randomized trial, presents a simulation study that simultaneously addresses the extreme small sample and differential performance (estimation bias, Type I error rates, and relative power) of 12 methods to account for clustered data with a model that features a more realistic number of predictors. The motivating data are then modeled with each method, and results are compared. Results show that generalized estimating equations perform poorly; the choice of Bayesian prior distributions affects performance; and fixed effect models perform quite well. Limitations and implications for applications are also discussed.

  7. Radiolabeling and biological evaluation of DOTA-Ph-Al derivative conjugated to anti-EGFR antibody ior egf/r3 for targeted tumor imaging and therapy.

    PubMed

    Pnwar, Puja; Iznaga-Escobar, Normando; Mishra, Pushpa; Srivastava, Vibha; Sharma, Rakesh Kumar; Chandra, Ramesh; Mishra, Anil K

    2005-08-01

    An appropriate bifunctional chelating agent namely DOTA-Ph-Al was developed for the conjugation with biological vectors (anti EGFr antibody). We hereby report the synthesis of p-bromoacetamidobenzyl derivative of DOTA and its conjugation to monoclonal antibody anti-EGFR ior egf/r3. Immunoconjugate was prepared by conjugation of p-bromoacetamidobenzyl derivative of DOTA with ior egf/r3. Modified antibody was purified by size exclusion chromatography. DOTA-Ph-Al-ior egf/r3 exhibited quantitative 99mTc-labeling (>96%) with specific activity 10-20 mCi/mg of protein and 90Y-labeling with specific activity 2-5 mCi/mg. Immunoreactivity was determined by flow cytometry. Receptor ligand assay on murine cell line EAT and human tumor cell line U-87MG showed Kd = 2.87 nM and 4.86 nM respectively. The stability in serum indicated that 99mTc remained bound to antibodies up to 24h and 98% 90Y was associated with the mAb for five days. Biodistribution characteristics of Ab-conjugate radiolabeled to 99mTc and 90Y radionuclide was examined in BALB/c mice grafted with EAT and athymic mice with U-87MG cell line demonstrated high tumor uptake with 5.5 +/- 1.3 and 7.85 +/- 1.2%ID/g at four and 24 h for 99mTc- DOTA-Ph-AI-ior egf/r3 in EAT tumors after post injection respectively. Maximal radiotracer uptake peaked 17.6 +/- 2.5%ID/g in EAT tumor and 12.89 +/- 0.66% ID/g in U-87MG tumor at 48h for 90Y. The drug excreted through renal routes as the activity in the kidneys was 13.42 +/- 0.33%ID/g at 1 h and 4.51 +/- 1.2%ID/g at 4 h for 99mTc- DOTA-Ph-Al-ior egf/r3.

  8. Fuzzy Subspace Clustering

    NASA Astrophysics Data System (ADS)

    Borgelt, Christian

    In clustering we often face the situation that only a subset of the available attributes is relevant for forming clusters, even though this may not be known beforehand. In such cases it is desirable to have a clustering algorithm that automatically weights attributes or even selects a proper subset. In this paper I study such an approach for fuzzy clustering, which is based on the idea to transfer an alternative to the fuzzifier (Klawonn and Höppner, What is fuzzy about fuzzy clustering? Understanding and improving the concept of the fuzzifier, In: Proc. 5th Int. Symp. on Intelligent Data Analysis, 254-264, Springer, Berlin, 2003) to attribute weighting fuzzy clustering (Keller and Klawonn, Int J Uncertain Fuzziness Knowl Based Syst 8:735-746, 2000). In addition, by reformulating Gustafson-Kessel fuzzy clustering, a scheme for weighting and selecting principal axes can be obtained. While in Borgelt (Feature weighting and feature selection in fuzzy clustering, In: Proc. 17th IEEE Int. Conf. on Fuzzy Systems, IEEE Press, Piscataway, NJ, 2008) I already presented such an approach for a global selection of attributes and principal axes, this paper extends it to a cluster-specific selection, thus arriving at a fuzzy subspace clustering algorithm (Parsons, Haque, and Liu, 2004).

  9. Cluster Magnetic Fields

    NASA Astrophysics Data System (ADS)

    Carilli, C. L.; Taylor, G. B.

    Magnetic fields in the intercluster medium have been measured using a variety of techniques, including studies of synchrotron relic and halo radio sources within clusters, studies of inverse Compton X-ray emission from clusters, surveys of Faraday rotation measures of polarized radio sources both within and behind clusters, and studies of cluster cold fronts in X-ray images. These measurements imply that most cluster atmospheres are substantially magnetized, with typical field strengths of order 1 μGauss with high areal filling factors out to Mpc radii. There is likely to be considerable variation in field strengths and topologies both within and between clusters, especially when comparing dynamically relaxed clusters to those that have recently undergone a merger. In some locations, such as the cores of cooling flow clusters, the magnetic fields reach levels of 10-40 μG and may be dynamically important. In all clusters the magnetic fields have a significant effect on energy transport in the intracluster medium. We also review current theories on the origin of cluster magnetic fields.

  10. Alkali Metal Cluster Theory.

    NASA Astrophysics Data System (ADS)

    Chen, Jian

    Available from UMI in association with The British Library. Requires signed TDF. In this thesis, we apply the tight-binding Hubbard model to alkali metal clusters with Hartree-Fock self-consistent methods and perturbation methods for the numerical calculations. We have studied the relation between the equilibrium structures and the range of the hopping matrix elements in the Hubbard Hamiltonian. The results show that the structures are not sensitive to the interaction range but are determined by the number of valence electrons each atom has. Inertia tensors are used to analyse the symmetries of the clusters. The principal axes of the clusters are determined and they are the axes of rotational symmetries of clusters if the clusters have any. The eigenvalues of inertia tensors which are the indication of the deformation of clusters are compared between our model and the ellipsoidal jellium model. The agreement is good for large clusters. At a finite temperature, the thermal motion fluctuates the structures. We defined a fluctuation function with the distance matrix of a cluster. The fluctuation has been studied with the Monte-Carlo simulation method. Our studies show that the clusters remain in the solid state when temperature is low. The small values of fluctuation functions indicates the thermal vibration of atoms around their equilibrium positions. If the temperature is high, the atoms are delocalized. The cluster melts and enters the liquid region. The cluster melting is simulated by the Monte-Carlo simulation with the fluctuation function we defined. Energy levels of clusters are calculated from the Hubbard model. Ionization potentials and magic numbers are also obtained from these energy levels. The results confirm that the Hubbard model is a good approximation for a small cluster. The excitation energy is presented by the difference between the original level and excited level, and the electron-hole interactions. We also have studied cooling of clusters

  11. Cluster Correspondence Analysis.

    PubMed

    van de Velden, M; D'Enza, A Iodice; Palumbo, F

    2017-03-01

    A method is proposed that combines dimension reduction and cluster analysis for categorical data by simultaneously assigning individuals to clusters and optimal scaling values to categories in such a way that a single between variance maximization objective is achieved. In a unified framework, a brief review of alternative methods is provided and we show that the proposed method is equivalent to GROUPALS applied to categorical data. Performance of the methods is appraised by means of a simulation study. The results of the joint dimension reduction and clustering methods are compared with the so-called tandem approach, a sequential analysis of dimension reduction followed by cluster analysis. The tandem approach is conjectured to perform worse when variables are added that are unrelated to the cluster structure. Our simulation study confirms this conjecture. Moreover, the results of the simulation study indicate that the proposed method also consistently outperforms alternative joint dimension reduction and clustering methods.

  12. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  13. Reactivity of Metal Clusters.

    PubMed

    Luo, Zhixun; Castleman, A W; Khanna, Shiv N

    2016-12-14

    We summarize here the research advances on the reactivity of metal clusters. After a simple introduction of apparatuses used for gas-phase cluster reactions, we focus on the reactivity of metal clusters with various polar and nonpolar molecules in the gas phase and illustrate how elementary reactions of metal clusters proceed one-step at a time under a combination of geometric and electronic reorganization. The topics discussed in this study include chemical adsorption, addition reaction, cleavage of chemical bonds, etching effect, spin effect, the harpoon mechanism, and the complementary active sites (CAS) mechanism, among others. Insights into the reactivity of metal clusters not only facilitate a better understanding of the fundamentals in condensed-phase chemistry but also provide a way to dissect the stability and reactivity of monolayer-protected clusters synthesized via wet chemistry.

  14. Clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Vikhlinin, A. A.; Kravtsov, A. V.; Markevich, M. L.; Sunyaev, R. A.; Churazov, E. M.

    2014-04-01

    Galaxy clusters are formed via nonlinear growth of primordial density fluctuations and are the most massive gravitationally bound objects in the present Universe. Their number density at different epochs and their properties depend strongly on the properties of dark matter and dark energy, making clusters a powerful tool for observational cosmology. Observations of the hot gas filling the gravitational potential well of a cluster allows studying gasdynamic and plasma effects and the effect of supermassive black holes on the heating and cooling of gas on cluster scales. The work of Yakov Borisovich Zeldovich has had a profound impact on virtually all cosmological and astrophysical studies of galaxy clusters, introducing concepts such as the Harrison-Zeldovich spectrum, the Zeldovich approximation, baryon acoustic peaks, and the Sunyaev-Zeldovich effect. Here, we review the most basic properties of clusters and their role in modern astrophysics and cosmology.

  15. Clustering by Local Gravitation.

    PubMed

    Wang, Zhiqiang; Yu, Zhiwen; Chen, C L Philip; You, Jane; Gu, Tianlong; Wong, Hau-San; Zhang, Jun

    2017-05-02

    The objective of cluster analysis is to partition a set of data points into several groups based on a suitable distance measure. We first propose a model called local gravitation among data points. In this model, each data point is viewed as an object with mass, and associated with a local resultant force (LRF) generated by its neighbors. The motivation of this paper is that there exist distinct differences between the LRFs (including magnitudes and directions) of the data points close to the cluster centers and at the boundary of the clusters. To capture these differences efficiently, two new local measures named centrality and coordination are further investigated. Based on empirical observations, two new clustering methods called local gravitation clustering and communication with local agents are designed, and several test cases are conducted to verify their effectiveness. The experiments on synthetic data sets and real-world data sets indicate that both clustering approaches achieve good performance on most of the data sets.

  16. Multiclass Total Variation Clustering

    DTIC Science & Technology

    2014-12-01

    Multiclass Total Variation Clustering Xavier Bresson University of Lausanne Lausanne, Switzerland xavier.bresson@unil.ch Thomas Laurent Loyola...recently motivated a new set of clustering algorithms that rely on the concept of total variation. While these al- gorithms perform well for bi-partitioning...tasks, their recursive extensions yield unimpressive results for multiclass clustering tasks. This paper presents a general framework for multiclass

  17. Chemistry Within Molecular Clusters

    DTIC Science & Technology

    1990-01-01

    DME )nCH3OCH 2 +). We speculate that this is due to the fragments being consumed by an ion-molecule reaction within the cluster. One likely candidate is...the ion-molecule reaction of the fragment cations with a neutral DME , within the bulk cluster to form a trimethyloxonlum cation intermediate. This...the observed products. We therefore speculate that the DME cluster reactions leading to the same products, should involve the same mechanism found to

  18. Active cluster crystals

    NASA Astrophysics Data System (ADS)

    Delfau, Jean-Baptiste; López, Cristóbal; Hernández-García, Emilio

    2017-09-01

    We study the appearance and properties of cluster crystals (solids in which the unit cell is occupied by a cluster of particles) in a two-dimensional system of self-propelled active Brownian particles with repulsive interactions. Self-propulsion deforms the clusters by depleting particle density inside, and for large speeds it melts the crystal. Continuous field descriptions at several levels of approximation allow us to identify the relevant physical mechanisms.

  19. Chemical Reactions in Clusters

    DTIC Science & Technology

    1992-11-04

    NH 3)n, n _> 4, clusters has been attributed to the (solvated) naphtholate anion.3a A single picosecond decay measurement has been reported which...vibrational energy in the cluster Sl state. The data are summarized in Table I. A model to explain these decay results can be constructed based on a proton...11 TITLE (Include Security Classification) Chemical Reactions in Clusters 12 PERSONAL AUTHOR(S) Elliot R. Bernstein 13a TYPE OF REPORT 13b TIME COVERED

  20. Cluster Physics & Evolution

    NASA Astrophysics Data System (ADS)

    Nagai, Daisuke; Arnaud, Monique; Dasadia, Sarthak; McDonald, Michael; Mitsuishi, Ikuyuki; Morandi, Andrea

    Recent advances in X-ray and microwave observations have provided unprecedented insights into the structure and evolution of the hot X-ray emitting plasma from their cores to the virialization region in outskirts of galaxy clusters. Recent Sunyaev-Zel'dovich (SZ) surveys (ACT, Planck, SPT) have provided new cluster catalogs, significantly expanding coverage of the mass-redshift plane, while Chandra and XMM-Newton X-ray follow-up programs have improved our understanding of cluster physics and evolution as well as the surveys themselves. However, the current cluster-based cosmological constraints are still limited by uncertainties in cluster astrophysics. In order to exploit the statistical power of the current and upcoming X-ray and microwave cluster surveys, it is critical to improve our understanding of the structure and evolution of the hot X-ray emitting intracluster medium (ICM). In this session, we discussed recent advances in observations and simulations of galaxy clusters, with highlights on (i) the evolution of ICM profiles and scaling relations, (ii) physical processes operating in the outskirts of galaxy clusters, and (iii) impact of mergers on the ICM structure in groups and clusters.

  1. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  2. Reactions of intermetallic clusters

    SciTech Connect

    Farley, R.W.; Castleman, A.W. Jr. )

    1990-02-01

    Reaction of bismuth--alkali clusters with closed-shell HX acids provides insight into the structures, formation, and stabilities of these intermetallic species. HC1 and HI are observed to quantitatively strip Bi{sub {ital x}}Na{sub {ital y}} and Bi{sub {ital x}}K{sub {ital y}}, respectively, of their alkali component, leaving bare bismuth clusters as the only bismuth-containing species detected. Product bismuth clusters exhibit the same distribution observed when pure bismuth is evaporated in the source. Though evaporated simultaneously from the same crucible, this suggests alkali atoms condense onto existing bismuth clusters and have negligible effect on their formation and consequent distribution. The indistinguishibility of reacted and pure bismuth cluster distributions further argues against the simple replacement of alkali atoms with hydrogen in these reactions. This is considered further evidence that the alkali atoms are external to the stable bismuth Zintl anionic structures. Reactivities of Bi{sub {ital x}}Na{sub {ital y}} clusters with HC1 are estimated to lie between 3{times}10{sup {minus}13} for Bi{sub 4}Na, to greater than 4{times}10{sup {minus}11} for clusters possessing large numbers of alkali atoms. Bare bismuth clusters are observed in separate experiments to react significantly more slowly with rates of 1--9{times}10{sup {minus}14} and exhibit little variation of reactivity with size. The bismuth clusters may thus be considered a relatively inert substrate upon which the alkali overlayer reacts.

  3. Melting of nickel clusters

    SciTech Connect

    Garzon, I.L.; Jellinek, J.

    1991-12-31

    The meltinglike phenomenon in Ni{sub n}, n = 19,20,55, clusters is studied using microcanonical molecular dynamics simulations. The interaction between the atoms in the clusters is modelled by a size-dependent Gupta-like potential that incorporates many-body effects. The clusters display the ``usual`` stages in their meltinglike transition, which characterize also Lennard-Jones (e.g., noble gas) and ionic clusters. In addition, Ni{sub 20} passes through a so-called premelting stage found earlier also for Ni{sub 14}. 11 ref., 3 figs.

  4. Melting of nickel clusters

    SciTech Connect

    Garzon, I.L. . Inst. de Fisica); Jellinek, J. )

    1991-01-01

    The meltinglike phenomenon in Ni{sub n}, n = 19,20,55, clusters is studied using microcanonical molecular dynamics simulations. The interaction between the atoms in the clusters is modelled by a size-dependent Gupta-like potential that incorporates many-body effects. The clusters display the usual'' stages in their meltinglike transition, which characterize also Lennard-Jones (e.g., noble gas) and ionic clusters. In addition, Ni{sub 20} passes through a so-called premelting stage found earlier also for Ni{sub 14}. 11 ref., 3 figs.

  5. The youngest globular clusters

    NASA Astrophysics Data System (ADS)

    Beck, Sara

    2015-11-01

    It is likely that all stars are born in clusters, but most clusters are not bound and disperse. None of the many protoclusters in our Galaxy are likely to develop into long-lived bound clusters. The super star clusters (SSCs) seen in starburst galaxies are more massive and compact and have better chances of survival. The birth and early development of SSCs takes place deep in molecular clouds, and during this crucial stage the embedded clusters are invisible to optical or UV observations but are studied via the radio-infrared supernebulae (RISN) they excite. We review observations of embedded clusters and identify RISN within 10 Mpc whose exciting clusters have ≈ 106 M⊙ or more in volumes of a few pc3 and which are likely to not only survive as bound clusters, but to evolve into objects as massive and compact as Galactic globulars. These clusters are distinguished by very high star formation efficiency η, at least a factor of 10 higher than the few percent seen in the Galaxy, probably due to the violent disturbances their host galaxies have undergone. We review recent observations of the kinematics of the ionized gas in RISN showing outflows through low-density channels in the ambient molecular cloud; this may protect the cloud from feedback by the embedded H II region.

  6. Magnetism in cobalt clusters

    NASA Astrophysics Data System (ADS)

    Emmert, Jeffrey Wayne

    The results of Stern-Gerlach type magnetic deflection experiments on clusters of cobalt consisting of 15 to 200 atoms are reported. These cobalt clusters exhibit superparamagnetic behavior over a wide range of temperatures and applied magnetic fields. The average magnetic moment per atom was determined for each cluster size. These range from 2.28 muB to 3.40 mu B, significantly exceeding the 1.72 muB per atom moment of bulk cobalt. This enhanced magnetism predictably decreases with increasing cluster size, but the evolution to the bulk is not smooth and exhibits detailed structure.

  7. Star Clusters within FIRE

    NASA Astrophysics Data System (ADS)

    Perez, Adrianna; Moreno, Jorge; Naiman, Jill; Ramirez-Ruiz, Enrico; Hopkins, Philip F.

    2017-01-01

    In this work, we analyze the environments surrounding star clusters of simulated merging galaxies. Our framework employs Feedback In Realistic Environments (FIRE) model (Hopkins et al., 2014). The FIRE project is a high resolution cosmological simulation that resolves star forming regions and incorporates stellar feedback in a physically realistic way. The project focuses on analyzing the properties of the star clusters formed in merging galaxies. The locations of these star clusters are identified with astrodendro.py, a publicly available dendrogram algorithm. Once star cluster properties are extracted, they will be used to create a sub-grid (smaller than the resolution scale of FIRE) of gas confinement in these clusters. Then, we can examine how the star clusters interact with these available gas reservoirs (either by accreting this mass or blowing it out via feedback), which will determine many properties of the cluster (star formation history, compact object accretion, etc). These simulations will further our understanding of star formation within stellar clusters during galaxy evolution. In the future, we aim to enhance sub-grid prescriptions for feedback specific to processes within star clusters; such as, interaction with stellar winds and gas accretion onto black holes and neutron stars.

  8. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  9. Ge8R6: the ligands define the bonding situation within the cluster core.

    PubMed

    Schnepf, Andreas; Drost, Christian

    2005-10-21

    The disproportionation reaction of Ge(i) halides open up a way to cluster compounds with an average oxidation state of the germanium atoms inside the cluster core in between 0 and 1. Simultaneously compounds with germanium in an oxidation state greater than i are formed. During the reaction of Ge(i) bromide with one equivalent of LiR (R = 2,6-(tBuO)(2)C(6)H(3)) the cluster compound Ge(8)R(6) and the molecular Ge(iv) compound R(3)GeBr were isolated, representing the reduction and the oxidation product of the disproportionation reaction, respectively. The molecular structure of the Ge(8) cluster compound shows a highly different arrangement of the eight germanium atoms in the cluster core with respect to the only other Ge(8)R(6) cluster compound where amido ligands are bound to the germanium atoms. Quantum-chemical calculations reveal that the distinct arrangement of the germanium atoms can be traced back to a different bonding situation inside the cluster frameworks, which is induced by the different ligands attached to the germanium atoms. These experimental and theoretical results show that the ligands are not only necessary for protecting the cluster core against the exterior but also have a strong influence on the bonding situation and therefore on the electronic situation inside the cluster core. Hence, the ligand influences the electronic properties and consequently the physical properties which is now seen, for the first time, in metalloid germanium cluster compounds.

  10. Orosensory detection of sucrose, maltose, and glucose is severely impaired in mice lacking T1R2 or T1R3, but Polycose sensitivity remains relatively normal.

    PubMed

    Treesukosol, Yada; Spector, Alan C

    2012-07-15

    Evidence in the literature supports the hypothesis that the T1R2+3 heterodimer binds to compounds that humans describe as sweet. Here, we assessed the necessity of the T1R2 and T1R3 subunits in the maintenance of normal taste sensitivity to carbohydrate stimuli. We trained and tested water-restricted T1R2 knockout (KO), T1R3 KO and their wild-type (WT) same-sex littermate controls in a two-response operant procedure to sample a fluid and differentially respond on the basis of whether the stimulus was water or a tastant. Correct responses were reinforced with water and incorrect responses were punished with a time-out. Testing was conducted with a modified descending method of limits procedure across daily 25-min sessions. Both KO groups displayed severely impaired performance and markedly decreased sensitivity when required to discriminate water from sucrose, glucose, or maltose. In contrast, when Polycose was tested, KO mice had normal EC(50) values for their psychometric functions, with some slight, but significant, impairment in performance. Sensitivity to NaCl did not differ between these mice and their WT controls. Our findings support the view that the T1R2+3 heterodimer is the principal receptor that mediates taste detection of natural sweeteners, but not of all carbohydrate stimuli. The combined presence of T1R2 and T1R3 appears unnecessary for the maintenance of relatively normal sensitivity to Polycose, at least in this task. Some detectability of sugars at high concentrations might be mediated by the putative polysaccharide taste receptor, the remaining T1R subunit forming either a homodimer or heteromer with another protein(s), or nontaste orosensory cues.

  11. GaMYB85, an R2R3 MYB gene, in transgenic Arabidopsis plays an important role in drought tolerance.

    PubMed

    Butt, Hamama Islam; Yang, Zhaoen; Gong, Qian; Chen, Eryong; Wang, Xioaqian; Zhao, Ge; Ge, Xiaoyang; Zhang, Xueyan; Li, Fuguang

    2017-08-22

    MYB transcription factors (TFs) are one of the largest families of TFs in higher plants and are involved in diverse biological, functional, and structural processes. Previously, very few functional validation studies on R2R3 MYB have been conducted in cotton in response to abiotic stresses. In the current study, GaMYB85, a cotton R2R3 MYB TF, was ectopically expressed in Arabidopsis thaliana (Col-0) and was functionally characterized by overexpression in transgenic plants. The in-silico analysis of GaMYB85 shows the presence of a SANT domain with a conserved R2R3 MYB imperfect repeat. The GaMYB85 protein has a 257-amino acid sequence, a molecular weight of 24.91 kD, and an isoelectric point of 5.58. Arabidopsis plants overexpressing GaMYB85 exhibited a higher seed germination rate in response to mannitol and salt stress, and higher drought avoidance efficiency than wild-type plants upon water deprivation. These plants had notably higher levels of free proline and chlorophyll with subsequent lower water loss rates and higher relative water content. Germination of GaMYB85 transgenics was more sensitive to abscisic acid (ABA) and extremely liable to ABA-induced inhibition of primary root elongation. Moreover, when subjected to treatment with different concentrations of ABA, transgenic plants with ectopically expressed GaMYB85 showed reduced stomatal density, with greater stomatal size and lower stomatal opening rates than those in wild-type plants. Ectopic expression of GaMYB85 led to enhanced transcript levels of stress-related marker genes such as RD22, ADH1, RD29A, P5CS, and ABI5. Our results indicate previously unknown roles of GaMYB85, showing that it confers good drought, salt, and freezing tolerance, most probably via an ABA-induced pathway. These findings can potentially be exploited to develop improved abiotic stress tolerance in cotton plants.

  12. Orosensory detection of sucrose, maltose, and glucose is severely impaired in mice lacking T1R2 or T1R3, but Polycose sensitivity remains relatively normal

    PubMed Central

    Treesukosol, Yada

    2012-01-01

    Evidence in the literature supports the hypothesis that the T1R2+3 heterodimer binds to compounds that humans describe as sweet. Here, we assessed the necessity of the T1R2 and T1R3 subunits in the maintenance of normal taste sensitivity to carbohydrate stimuli. We trained and tested water-restricted T1R2 knockout (KO), T1R3 KO and their wild-type (WT) same-sex littermate controls in a two-response operant procedure to sample a fluid and differentially respond on the basis of whether the stimulus was water or a tastant. Correct responses were reinforced with water and incorrect responses were punished with a time-out. Testing was conducted with a modified descending method of limits procedure across daily 25-min sessions. Both KO groups displayed severely impaired performance and markedly decreased sensitivity when required to discriminate water from sucrose, glucose, or maltose. In contrast, when Polycose was tested, KO mice had normal EC50 values for their psychometric functions, with some slight, but significant, impairment in performance. Sensitivity to NaCl did not differ between these mice and their WT controls. Our findings support the view that the T1R2+3 heterodimer is the principal receptor that mediates taste detection of natural sweeteners, but not of all carbohydrate stimuli. The combined presence of T1R2 and T1R3 appears unnecessary for the maintenance of relatively normal sensitivity to Polycose, at least in this task. Some detectability of sugars at high concentrations might be mediated by the putative polysaccharide taste receptor, the remaining T1R subunit forming either a homodimer or heteromer with another protein(s), or nontaste orosensory cues. PMID:22621968

  13. PagP activation in the outer membrane triggers R3 core oligosaccharide truncation in the cytoplasm of Escherichia coli O157:H7.

    PubMed

    Smith, Abigail E; Kim, Sang-Hyun; Liu, Feng; Jia, Wenyi; Vinogradov, Evgeny; Gyles, Carlton L; Bishop, Russell E

    2008-02-15

    The Escherichia coli outer membrane phospholipid:lipid A palmitoyltransferase PagP is normally a latent enzyme, but it can be directly activated in outer membranes by lipid redistribution associated with a breach in the permeability barrier. We now demonstrate that a lipid A myristate deficiency in an E. coli O157:H7 msbB mutant constitutively activates PagP in outer membranes. The lipid A myristate deficiency is associated with hydrophobic antibiotic sensitivity and, unexpectedly, with serum sensitivity, which resulted from O-antigen polysaccharide absence due to a cytoplasmically determined truncation at the first outer core glucose unit of the R3 core oligosaccharide. Mutational inactivation of pagP in the myristate-deficient lipid A background aggravated the hydrophobic antibiotic sensitivity as a result of losing a partially compensatory increase in lipid A palmitoylation while simultaneously restoring serum resistance and O-antigen attachment to intact lipopolysaccharide. Complementation with either wild-type pagP or catalytically inactive pagPSer77Ala alleles restored the R3 core truncation. However, the intact lipopolysaccharide was preserved after complementation with an internal deletion pagPDelta5-14 allele, which mostly eliminates a periplasmic amphipathic alpha-helical domain but fully supports cell surface lipid A palmitoylation. Our findings indicate that activation of PagP not only triggers lipid A palmitoylation in the outer membrane but also separately truncates the R3 core oligosaccharide in the cytoplasm. We discuss the implication that PagP might function as an apical sensory transducer, which can be activated by a breach in the outer membrane permeability barrier.

  14. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  15. Anticonvulsant activity of artificial sweeteners: a structural link between sweet-taste receptor T1R3 and brain glutamate receptors.

    PubMed

    Talevi, Alan; Enrique, Andrea V; Bruno-Blanch, Luis E

    2012-06-15

    A virtual screening campaign based on application of a topological discriminant function capable of identifying novel anticonvulsant agents indicated several widely-used artificial sweeteners as potential anticonvulsant candidates. Acesulfame potassium, cyclamate and saccharin were tested in the Maximal Electroshock Seizure model (mice, ip), showing moderate anticonvulsant activity. We hypothesized a probable structural link between the receptor responsible of sweet taste and anticonvulsant molecular targets. Bioinformatic tools confirmed a highly significant sequence-similarity between taste-related protein T1R3 and several metabotropic glutamate receptors from different species, including glutamate receptors upregulated in epileptogenesis and certain types of epilepsy. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Streptococcus salivarius mutants defective in mannose phosphotransferase systems show reduced sensitivity to mutacins I-T9 and R-3B.

    PubMed

    Nicolas, Guillaume G; Frenette, Michel; Lavoie, Marc C

    2010-08-01

    Twenty-four mutacin-producing Streptococcus mutans strains were screened for their propensity to produce class II one-peptide bacteriocin using a deferred antagonism assay. Streptococcus salivarius and 3 mutants defective in their mannose phosphotransferase systems (mannose-PTS) were used as sensitive strains to identify which mannose-PTS could act as the docking site for class II one-peptide bacteriocin activity. We observed that only 2 strains of S. mutans, T9 and 3B, potentially produce class II one-peptide bacteriocin, namely mutacins I-T9 and R-3B, but with no preference for any mannose-PTS complex as a target.

  17. A R2R3-MYB Transcription Factor Regulates the Flavonol Biosynthetic Pathway in a Traditional Chinese Medicinal Plant, Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Khaldun, A. B. M.; Chen, Jianjun; Zhang, Chanjuan; Lv, Haiyan; Yuan, Ling; Wang, Ying

    2016-01-01

    Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components (BCs) in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from Epimedium sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase) and EsFLS (flavonol synthase), but not the promoters of EsDFRs (dihydroflavonol 4-reductase) and EsANS (anthocyanidin synthase) in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase), NtCHI (chalcone isomerase), NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS) were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived BCs in E. sagittatum. Thus

  18. (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-Mono(di,tri)fluoromethylcyclopropyl]alanines and their incorporation into hormaomycin analogues

    PubMed Central

    Kozhushkov, Sergei I; Yufit, Dmitrii S; Grosse, Christian; Kaiser, Marcel

    2014-01-01

    Summary Efficient and scalable syntheses of enantiomerically pure (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-mono(di,tri)fluoromethylcyclopropyl]alanines 9a–c, as well as allo-D-threonine (4) and (2S,3R)-β-methylphenylalanine (3), using the Belokon' approach with (S)- and (R)-2-[(N-benzylprolyl)amino]benzophenone [(S)- and (R)-10] as reusable chiral auxiliaries have been developed. Three new fluoromethyl analogues of the naturally occurring octadepsipeptide hormaomycin (1) with (fluoromethylcyclopropyl)alanine moieties have been synthesized and subjected to preliminary tests of their antibiotic activity. PMID:25550751

  19. A practical deca-gram scale ring expansion of (R)-(-)-carvone to (R)-(+)-3-methyl-6-isopropenyl-cyclohept-3-enone-1.

    PubMed

    Alves, Leandro de C; Desiderá, André L; de Oliveira, Kleber T; Newton, Sean; Ley, Steven V; Brocksom, Timothy J

    2015-07-28

    A route to enantiopure (R)-(+)-3-methyl-6-isopropenyl-cyclohept-3-enone-1, an intermediate for terpenoids, has been developed and includes a highly chemo- and regioselective Tiffeneau-Demjanov reaction. Starting from readily available (R)-(-)-carvone, this robust sequence is available on a deca-gram scale and uses flow chemistry for the initial epoxidation reaction. The stereochemistry of the addition of two nucleophiles to the carbonyl group of (R)-(-)-carvone has been determined by X-ray diffraction studies and chemical correlation.

  20. Photoionization of molecular clusters

    NASA Astrophysics Data System (ADS)

    Andres, R. P.; Calo, J. M.

    1981-12-01

    An experimental apparatus consisting of a novel multiple expansion cluster source coupled with a molecular beam system and photoionization mass spectrometer has been designed and constructed. This apparatus has been thoroughly tested and preliminary measurements of the growth kinetics of water clusters and the photoionization cross section of the water dimer have been carried out.

  1. Targeting Clusters, Achieving Excellence.

    ERIC Educational Resources Information Center

    Rosenfeld, Stuart; Jacobs, Jim; Liston, Cynthia

    2003-01-01

    Suggests that groups, or clusters, of industries form partnerships with community colleges in order to positively impact economic development. Asserts that a cluster-oriented community college system requires innovation, specialized resources and expertise, knowledge of trends, and links to industry. Offers suggestions for developing such a…

  2. Cluster Guide. Accounting Occupations.

    ERIC Educational Resources Information Center

    Beaverton School District 48, OR.

    Based on a recent task inventory of key occupations in the accounting cluster taken in the Portland, Oregon, area, this curriculum guide is intended to assist administrators and teachers in the design and implementation of high school accounting cluster programs. The guide is divided into four major sections: program organization and…

  3. Evaluating cancer clusters

    SciTech Connect

    Enterline, P.E.

    1985-03-01

    Considerable success has been achieved in identifying cancer causing agents in the workplace using epidemiologic methods. This success had made the authors very sensitive to the occurrence of cancer clusters among workers in the belief that identification of some common exposure could reveal the presence of a carcinogen and lead to preventive measures. This intense surveillance is both a blessing and a curse. On the one hand, it is a proven way of discovering environmental causes of cancer. On the other, it leads to false alarms or does not always lead to identification of a causal agent. It is easy to demonstrate, using tables of random number 5, how clusters can occur by chance and to demonstrate that when the number of comparisons made in identifying clusters is known there is a basis for their evaluation. Unfortunately, in most instances, when cancer clusters are detected in the workplace the number of comparisons made is unknown and the statistical significance of the cluster cannot be evaluated. Moreover, it is not usually recognized that in this situation when a study is made as a result of discovering a cluster in a particular population, the cases that make up the cluster cannot be included in a data set which tests the hypothesis that a cluster exists. This paper illustrates the above points by actual experiences.

  4. Ultrametric Hierarchical Clustering Algorithms.

    ERIC Educational Resources Information Center

    Milligan, Glenn W.

    1979-01-01

    Johnson has shown that the single linkage and complete linkage hierarchical clustering algorithms induce a metric on the data known as the ultrametric. Johnson's proof is extended to four other common clustering algorithms. Two additional methods also produce hierarchical structures which can violate the ultrametric inequality. (Author/CTM)

  5. Coma cluster of galaxies

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Atlas Image mosaic, covering 34' x 34' on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies (over 1000 members), most prominently the two giant ellipticals, NGC 4874 (right) and NGC 4889 (left). The remaining members are mostly smaller ellipticals, but spiral galaxies are also evident in the 2MASS image. The cluster is seen toward the constellation Coma Berenices, but is actually at a distance of about 100 Mpc (330 million light years, or a redshift of 0.023) from us. At this distance, the cluster is in what is known as the 'Hubble flow,' or the overall expansion of the Universe. As such, astronomers can measure the Hubble Constant, or the universal expansion rate, based on the distance to this cluster. Large, rich clusters, such as Coma, allow astronomers to measure the 'missing mass,' i.e., the matter in the cluster that we cannot see, since it gravitationally influences the motions of the member galaxies within the cluster. The near-infrared maps the overall luminous mass content of the member galaxies, since the light at these wavelengths is dominated by the more numerous older stellar populations. Galaxies, as seen by 2MASS, look fairly smooth and homogeneous, as can be seen from the Hubble 'tuning fork' diagram of near-infrared galaxy morphology. Image mosaic by S. Van Dyk (IPAC).

  6. Structural transitions in clusters

    NASA Astrophysics Data System (ADS)

    Ghazali, A.; Lévy, J.-C. S.

    1997-02-01

    Monatomic clusters are studied by Monte Carlo relaxation using generalized Lennard-Jones potentials. A transition from an icosahedral symmetry to a crystalline symmetry with stacking faults is always observed. Bcc-based soft atom clusters are found to have a lower energy than the corresponding hcp and fcc ones below the melting point.

  7. Coma cluster of galaxies

    NASA Image and Video Library

    1999-12-02

    Atlas Image mosaic, covering 34 x 34 on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies over 1000 members, most prominently the two giant ellipticals, NGC 4874 right and NGC 4889 left.

  8. Coma cluster of galaxies

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Atlas Image mosaic, covering 34' x 34' on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies (over 1000 members), most prominently the two giant ellipticals, NGC 4874 (right) and NGC 4889 (left). The remaining members are mostly smaller ellipticals, but spiral galaxies are also evident in the 2MASS image. The cluster is seen toward the constellation Coma Berenices, but is actually at a distance of about 100 Mpc (330 million light years, or a redshift of 0.023) from us. At this distance, the cluster is in what is known as the 'Hubble flow,' or the overall expansion of the Universe. As such, astronomers can measure the Hubble Constant, or the universal expansion rate, based on the distance to this cluster. Large, rich clusters, such as Coma, allow astronomers to measure the 'missing mass,' i.e., the matter in the cluster that we cannot see, since it gravitationally influences the motions of the member galaxies within the cluster. The near-infrared maps the overall luminous mass content of the member galaxies, since the light at these wavelengths is dominated by the more numerous older stellar populations. Galaxies, as seen by 2MASS, look fairly smooth and homogeneous, as can be seen from the Hubble 'tuning fork' diagram of near-infrared galaxy morphology. Image mosaic by S. Van Dyk (IPAC).

  9. [Cluster headache differential diagnosis].

    PubMed

    Guégan-Massardier, Evelyne; Laubier, Cécile

    2015-11-01

    Cluster headache is characterized by disabling stereotyped headache. Early diagnosis allows appropriate treatment, unfortunately diagnostic errors are frequent. The main differential diagnoses are other primary or essential headaches. Migraine, more frequent and whose diagnosis is carried by excess, trigeminal neuralgia or other trigemino-autonomic cephalgia. Vascular or tumoral underlying condition can mimic cluster headache, neck and brain imaging is recommended, ideally MRI.

  10. Marketing Occupations. Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    This cluster guide, which is designed to show teachers what specific knowledge and skills qualify high school students for entry-level employment (or postsecondary training) in marketing occupations, is organized into three sections: (1) cluster organization and implementation, (2) instructional emphasis areas, and (3) assessment. The first…

  11. Cluster Interest Inventory.

    ERIC Educational Resources Information Center

    Herzog, Douglas

    The Cluster Interest Inventory is designed to familiarize students with representative occupations in 13 career clusters: (1) agribusiness and natural resources, (2) business marketing, and office occupations, (3) communications and media, (4) consumer and homemaker, (5) fine arts and humanities, (6) health, (7) manufacturing and processing, (8)…

  12. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  13. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  14. Probability and Cancer Clusters

    ERIC Educational Resources Information Center

    Hamilton-Keene, Rachael; Lenard, Christoper T.; Mills, Terry M.

    2009-01-01

    Recently there have been several news items about possible cancer clusters in the Australian media. The term "cancer cluster" is used when an unusually large number of people in one geographic area, often a workplace, are diagnosed with cancer in a short space of time. In this paper the authors explore this important health issue using…

  15. Multiple frame cluster tracking

    NASA Astrophysics Data System (ADS)

    Gadaleta, Sabino; Klusman, Mike; Poore, Aubrey; Slocumb, Benjamin J.

    2002-08-01

    Tracking large number of closely spaced objects is a challenging problem for any tracking system. In missile defense systems, countermeasures in the form of debris, chaff, spent fuel, and balloons can overwhelm tracking systems that track only individual objects. Thus, tracking these groups or clusters of objects followed by transitions to individual object tracking (if and when individual objects separate from the groups) is a necessary capability for a robust and real-time tracking system. The objectives of this paper are to describe the group tracking problem in the context of multiple frame target tracking and to formulate a general assignment problem for the multiple frame cluster/group tracking problem. The proposed approach forms multiple clustering hypotheses on each frame of data and base individual frame clustering decisions on the information from multiple frames of data in much the same way that MFA or MHT work for individual object tracking. The formulation of the assignment problem for resolved object tracking and candidate clustering methods for use in multiple frame cluster tracking are briefly reviewed. Then, three different formulations are presented for the combination of multiple clustering hypotheses on each frame of data and the multiple frame assignments of clusters between frames.

  16. Brightest Cluster Galaxy Identification

    NASA Astrophysics Data System (ADS)

    Leisman, Luke; Haarsma, D. B.; Sebald, D. A.; ACCEPT Team

    2011-01-01

    Brightest cluster galaxies (BCGs) play an important role in several fields of astronomical research. The literature includes many different methods and criteria for identifying the BCG in the cluster, such as choosing the brightest galaxy, the galaxy nearest the X-ray peak, or the galaxy with the most extended profile. Here we examine a sample of 75 clusters from the Archive of Chandra Cluster Entropy Profile Tables (ACCEPT) and the Sloan Digital Sky Survey (SDSS), measuring masked magnitudes and profiles for BCG candidates in each cluster. We first identified galaxies by hand; in 15% of clusters at least one team member selected a different galaxy than the others.We also applied 6 other identification methods to the ACCEPT sample; in 30% of clusters at least one of these methods selected a different galaxy than the other methods. We then developed an algorithm that weighs brightness, profile, and proximity to the X-ray peak and centroid. This algorithm incorporates the advantages of by-hand identification (weighing multiple properties) and automated selection (repeatable and consistent). The BCG population chosen by the algorithm is more uniform in its properties than populations selected by other methods, particularly in the relation between absolute magnitude (a proxy for galaxy mass) and average gas temperature (a proxy for cluster mass). This work supported by a Barry M. Goldwater Scholarship and a Sid Jansma Summer Research Fellowship.

  17. Cool Cluster Correctly Correlated

    SciTech Connect

    Varganov, Sergey Aleksandrovich

    2005-01-01

    Atomic clusters are unique objects, which occupy an intermediate position between atoms and condensed matter systems. For a long time it was thought that physical and chemical properties of atomic dusters monotonically change with increasing size of the cluster from a single atom to a condensed matter system. However, recently it has become clear that many properties of atomic clusters can change drastically with the size of the clusters. Because physical and chemical properties of clusters can be adjusted simply by changing the cluster's size, different applications of atomic clusters were proposed. One example is the catalytic activity of clusters of specific sizes in different chemical reactions. Another example is a potential application of atomic clusters in microelectronics, where their band gaps can be adjusted by simply changing cluster sizes. In recent years significant advances in experimental techniques allow one to synthesize and study atomic clusters of specified sizes. However, the interpretation of the results is often difficult. The theoretical methods are frequently used to help in interpretation of complex experimental data. Most of the theoretical approaches have been based on empirical or semiempirical methods. These methods allow one to study large and small dusters using the same approximations. However, since empirical and semiempirical methods rely on simple models with many parameters, it is often difficult to estimate the quantitative and even qualitative accuracy of the results. On the other hand, because of significant advances in quantum chemical methods and computer capabilities, it is now possible to do high quality ab-initio calculations not only on systems of few atoms but on clusters of practical interest as well. In addition to accurate results for specific clusters, such methods can be used for benchmarking of different empirical and semiempirical approaches. The atomic clusters studied in this work contain from a few atoms to

  18. Dynamics of cluster dissociation

    SciTech Connect

    Keesee, R.G.; Castleman, A.W. Jr.

    1986-01-01

    The dynamics of dissociation of clusters induced by multiphoton ionization (MPI) is examined by time-of-flight mass spectrometry with the aid of a reflecting electric field. The systems discussed include ammonia, methanol, xenon, and p-xylene(Ar)/sub n/ clusters. Ammonia and methanol clusters undergo rapid intracluster reactions to yield protonated clusters. Much of the excess energy which leads to dissociation in ammonia, methanol, and xenon clusters results from the energy differences in the ground states of the neutral and ionic systems. On the other hand, in the case of p-xylene(Ar)/sub n/ the energetic differences are much smaller, so that the excess absorbed photon energy may be an important contribution. 10 refs., 3 figs.

  19. Dynamics of cluster dissociation

    SciTech Connect

    Keesee, R.G.; Castleman A.W. Jr.

    1987-09-25

    The dynamics of dissociation of clusters induced by multiphoton ionization (MPI) is examined by time-of-flight mass spectrometry with the aid of a reflecting electric field. The systems discussed include ammonia, methanol, xenon, and p-xylene(Ar)/sub n/ clusters. Ammonia and methanol clusters undergo rapid intracluster reactions to yield protonated clusters. Much of the excess energy which leads to dissociation in ammonia, methanol, and xenon clusters results from the energy differences in the ground states of the neutral and ionic systems. On the other hand, in the case of p-xylene(Ar)/sub n/ the energetic differences are much smaller, so that the excess absorbed photon energy may be an important contribution.

  20. Hybridization schemes for clusters

    NASA Astrophysics Data System (ADS)

    Wales, David J.

    The concept of an optimum hybridization scheme for cluster compounds is developed with particular reference to electron counting. The prediction of electron counts for clusters and the interpretation of the bonding is shown to depend critically upon the presumed hybridization pattern of the cluster vertex atoms. This fact has not been properly appreciated in previous work, particularly in applications of Stone's tensor surface harmonic (TSH) theory, but is found to be a useful tool when dealt with directly. A quantitative definition is suggested for the optimum cluster hybridization pattern based directly upon the ease of interpretation of the molecular orbitals, and results are given for a range of species. The relationship of this scheme to the detailed cluster geometry is described using Löwdin's partitioned perturbation theory, and the success and range of application of TSH theory are discussed.

  1. Galaxy cluster's rotation

    NASA Astrophysics Data System (ADS)

    Manolopoulou, M.; Plionis, M.

    2017-03-01

    We study the possible rotation of cluster galaxies, developing, testing, and applying a novel algorithm which identifies rotation, if such does exist, as well as its rotational centre, its axis orientation, rotational velocity amplitude, and, finally, the clockwise or counterclockwise direction of rotation on the plane of the sky. To validate our algorithms we construct realistic Monte Carlo mock rotating clusters and confirm that our method provides robust indications of rotation. We then apply our methodology on a sample of Abell clusters with z ≲ 0.1 with member galaxies selected from the Sloan Digital Sky Survey DR10 spectroscopic data base. After excluding a number of substructured clusters, which could provide erroneous indications of rotation, and taking into account the expected fraction of misidentified coherent substructure velocities for rotation, provided by our Monte Carlo simulation analysis, we find that ∼23 per cent of our clusters are rotating under a set of strict criteria. Loosening the strictness of the criteria, on the expense of introducing spurious rotation indications, we find this fraction increasing to ∼28 per cent. We correlate our rotation indicators with the cluster dynamical state, provided either by their Bautz-Morgan type or by their X-ray isophotal shape and find for those clusters showing rotation within 1.5 h^{-1}_{70} Mpc that the significance of their rotation is related to the dynamically younger phases of cluster formation but after the initial anisotropic accretion and merging has been completed. Finally, finding rotational modes in galaxy clusters could lead to the necessity of correcting the dynamical cluster mass calculations.

  2. The metabolism of (R)-3-hydroxybutyrate is regulated by the enhancer-binding protein PA2005 and the alternative sigma factor RpoN in Pseudomonas aeruginosa PAO1.

    PubMed

    Lundgren, Benjamin R; Harris, Joshua R; Sarwar, Zaara; Scheel, Ryan A; Nomura, Christopher T

    2015-11-01

    A variety of soil-dwelling bacteria produce polyhydroxybutyrate (PHB), which serves as a source of energy and carbon under nutrient deprivation. Bacteria belonging to the genus Pseudomonas do not generally produce PHB but are capable of using the PHB degradation product (R)-3-hydroxybutyrate [(R)-3-HB] as a growth substrate. Essential to this utilization is the NAD+-dependent dehydrogenase BdhA that converts (R)-3-HB into acetoacetate, a molecule that readily enters central metabolism. Apart from the numerous studies that had focused on the biochemical characterization of BdhA, there was nothing known about the assimilation of (R)-3-HB in Pseudomonas, including the genetic regulation of bdhA expression. This study aimed to define the regulatory factors that govern or dictate the expression of the bdhA gene and (R)-3-HB assimilation in Pseudomonas aeruginosa PAO1. Importantly, expression of the bdhA gene was found to be specifically induced by (R)-3-HB in a manner dependent on the alternative sigma factor RpoN and the enhancer-binding protein PA2005.This mode of regulation was essential for the utilization of (R)-3-HB as a sole source of energy and carbon. However, non-induced levels of bdhA expression were sufficient for P. aeruginosa PAO1 to grow on ( ± )-1,3-butanediol, which is catabolized through an (R)-3-HB intermediate. Because this is, we believe, the first report of an enhancer-binding protein that responds to (R)-3-HB, PA2005 was named HbcR for (R)-3-hydroxybutyrate catabolism regulator.

  3. The metabolism of (R)-3-hydroxybutyrate is regulated by the enhancer-binding protein PA2005 and the alternative sigma factor RpoN in Pseudomonas aeruginosa PAO1

    PubMed Central

    Lundgren, Benjamin R.; Harris, Joshua R.; Sarwar, Zaara; Scheel, Ryan A.

    2015-01-01

    A variety of soil-dwelling bacteria produce polyhydroxybutyrate (PHB), which serves as a source of energy and carbon under nutrient deprivation. Bacteria belonging to the genus Pseudomonas do not generally produce PHB but are capable of using the PHB degradation product (R)-3-hydroxybutyrate [(R)-3-HB] as a growth substrate. Essential to this utilization is the NAD+-dependent dehydrogenase BdhA that converts (R)-3-HB into acetoacetate, a molecule that readily enters central metabolism. Apart from the numerous studies that had focused on the biochemical characterization of BdhA, there was nothing known about the assimilation of (R)-3-HB in Pseudomonas, including the genetic regulation of bdhA expression. This study aimed to define the regulatory factors that govern or dictate the expression of the bdhA gene and (R)-3-HB assimilation in Pseudomonas aeruginosa PAO1. Importantly, expression of the bdhA gene was found to be specifically induced by (R)-3-HB in a manner dependent on the alternative sigma factor RpoN and the enhancer-binding protein PA2005.This mode of regulation was essential for the utilization of (R)-3-HB as a sole source of energy and carbon. However, non-induced levels of bdhA expression were sufficient for P. aeruginosa PAO1 to grow on ( ± )-1,3-butanediol, which is catabolized through an (R)-3-HB intermediate. Because this is, we believe, the first report of an enhancer-binding protein that responds to (R)-3-HB, PA2005 was named HbcR for (R)-3-hydroxybutyrate catabolism regulator. PMID:26311173

  4. Green polymer chemistry: investigating the mechanism of radical ring-opening redox polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT).

    PubMed

    Rosenthal-Kim, Emily Q; Puskas, Judit E

    2015-04-13

    The mechanism of the new Radical Ring-opening Redox Polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT) by triethylamine (TEA) and dilute H2O2 was investigated. Scouting studies showed that the formation of high molecular weight polymers required a 1:2 molar ratio of DODT to TEA and of DODT to H2O2. Further investigation into the chemical composition of the organic and aqueous phases by 1H-NMR spectroscopy and mass spectrometry demonstrated that DODT is ionized by two TEA molecules (one for each thiol group) and thus transferred into the aqueous phase. The organic phase was found to have cyclic disulfide dimers, trimers and tetramers. Dissolving DODT and TEA in water before the addition of H2O2 yielded a polymer with Mn = 55,000 g/mol, in comparison with Mn = 92,000 g/mol when aqueous H2O2 was added to a DODT/TEA mixture. After polymer removal, MALDI-ToF MS analysis of the residual reaction mixtures showed only cyclic oligomers remaining. Below the LCST for TEA in water, 18.7 °C, the system yielded a stable emulsion, and only cyclic oligomers were found. Below DODT/TEA and H2O2 1:2 molar ratio mostly linear oligomers were formed, with <20% cyclic oligomers. The findings support the proposed mechanism of R3P.

  5. From small sweeteners to sweet proteins: anatomy of the binding sites of the human T1R2_T1R3 receptor.

    PubMed

    Morini, Gabriella; Bassoli, Angela; Temussi, Piero A

    2005-08-25

    The sweet taste receptor, a heterodimeric G protein coupled receptor (GPCR) protein, formed by the T1R2 and T1R3 subunits, recognizes several sweet compounds including carbohydrates, amino acids, peptides, proteins, and synthetic sweeteners. Its similarity with the metabotropic glutamate mGluR1 receptor allowed us to build homology models. All possible dimers formed by combinations of the human T1R2 and T1R3 subunits, modeled on the A (closed) or B (open) chains of the extracellular ligand binding domain of the mGluR1 template, yield four ligand binding sites for low-molecular-weight sweeteners. These sites were probed by docking a set of molecules representative of all classes of sweet compounds and calculating the free energy of ligand binding. These sites are not easily accessible to sweet proteins, but docking experiments in silico showed that sweet proteins can bind to a secondary site without entering the deep cleft. Our models account for many experimental observations on the tastes of sweeteners, including sweetness synergy, and can help to design new sweeteners.

  6. The Heterologous Expression of the Chrysanthemum R2R3-MYB Transcription Factor CmMYB1 Alters Lignin Composition and Represses Flavonoid Synthesis in Arabidopsis thaliana

    PubMed Central

    Chen, Sumei; Jiang, Jiafu; Gu, Chunsun; Zhou, Guoqin; Chen, Yu; Song, Aiping; Chen, Fadi

    2013-01-01

    Plant R2R3-MYB transcription factor genes are widely distributed in higher plants and play important roles in the regulation of many secondary metabolites at the transcriptional level. In this study, a chrysanthemum subgroup 4 R2R3-MYB transcription factor gene, designated CmMYB1, was isolated through screening chrysanthemum EST (expressed sequence tag) libraries and using rapid application of cDNA ends (RACE) methods and functionally characterized. CmMYB1 is expressed in the root, stem, leaf and flowers, but most strongly in the stem and most weakly in the root. Its heterologous expression in Arabidopsis thaliana reduced the lignin content and altered the lignin composition. The heterologous expression also repressed the flavonoids content in A. thaliana. Together, these results suggested that CmMYB1 is a negative regulator of genes involved in the lignin pathway and flavonoid pathway, it may be a promising gene for controlling lignin and flavonoids profiles in plants. PMID:23840353

  7. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

    PubMed Central

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-01-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

  8. On moduli space of symmetric orthogonal matrices and exclusive Racah matrix S bar for representation R = [3,1] with multiplicities

    NASA Astrophysics Data System (ADS)

    Morozov, A.

    2017-03-01

    Racah matrices and higher j-symbols are used in description of braiding properties of conformal blocks and in construction of knot polynomials. However, in complicated cases the logic is actually inverted: they are much better deduced from these applications than from the basic representation theory. Following the recent proposal of [1] we obtain the exclusive Racah matrix S bar for the currently-front-line case of representation R = [ 3 , 1 ] with non-trivial multiplicities, where it is actually operator-valued, i.e. depends on the choice of bases in the intertwiner spaces. Effective field theory for arborescent knots in this case possesses gauge invariance, which is not yet properly described and understood. Because of this lack of knowledge a big part (about a half) of S bar needs to be reconstructed from orthogonality conditions. Therefore we discuss the abundance of symmetric orthogonal matrices, to which S bar belongs, and explain that dimension of their moduli space is also about a half of that for the ordinary orthogonal matrices. Thus the knowledge approximately matches the freedom and this explains why the method can work - with some limited addition of educated guesses. A similar calculation for R = [ r , 1 ] for r > 3 should also be doable.

  9. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis

    SciTech Connect

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D.; Douglas, Carl

    2014-05-23

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.

  10. The. lambda. CRO repressor-O sub R 3 operator complex: sup 19 F NMR studies with 5-fluorodeoxyuridine DNA oligomers

    SciTech Connect

    Metzler, W.J. III.

    1988-01-01

    This study demonstrates the utility of {sup 19}F NMR in investigating protein-nucleic acid interactions. It is shown that fluorine can easily be introduced into DNA by substitution of 5-fluorodeoxyuridine for thymine during DNA synthesis. Two dimensional Overhauser enhancement spectroscopy (HOESY) is employed as an assignment strategy. The HOESY experiment enabled unambiguous assignment of the {sup 19}F NMR spectra of DNA oligonucleotides containing more than one fluorine resonance. In addition, since the theoretical basis of HOESY experiment is found in through space interactions between nuclei, it has the potential of providing distance, and thus structural information about the system being investigated. The interaction of cro repressor from bacteriophage {lambda} with its operator DNA was investigated by monitoring perturbations to the {sup 19}F NMR spectrum of fluorine-labelled O{sub R}3 operators upon cro repressor binding. A proposed model for cro repressor-O{sub R}3 operator interaction, while generally accepted and well-publicized, lacks direct physical verification. The fluorine-labelled oligonucleotides described enabled the testing of specific predictions made by that model.

  11. A systems-oriented analysis of the grapevine R2R3-MYB transcription factor family uncovers new insights into the regulation of stilbene accumulation

    PubMed Central

    Wong, Darren Chern Jan; Schlechter, Rudolf; Vannozzi, Alessandro; Höll, Janine; Hmmam, Ibrahim; Bogs, Jochen; Tornielli, Giovanni Battista; Castellarin, Simone Diego; Matus, José Tomás

    2016-01-01

    R2R3-MYB transcription factors (TFs) belong to a large and functionally diverse protein superfamily in plants. In this study, we explore the evolution and function of this family in grapevine (Vitis vinifera L.), a high-value fruit crop. We identified and manually curated 134 genes using RNA-Seq data, and named them systematically according to the Super-Nomenclature Committee. We identified novel genes, splicing variants and grapevine/woody-specific duplicated subgroups, suggesting possible neo- and sub-functionalization events. Regulatory network analysis ascribed biological functions to uncharacterized genes and validated those of known genes (e.g. secondary cell wall biogenesis and flavonoid biosynthesis). A comprehensive analysis of different MYB binding motifs in the promoters of co-expressed genes predicted grape R2R3-MYB binding preferences and supported evidence for putative downstream targets. Enrichment of cis-regulatory motifs for diverse TFs reinforced the notion of transcriptional coordination and interaction between MYBs and other regulators. Analysis of the network of Subgroup 2 showed that the resveratrol-related VviMYB14 and VviMYB15 share common co-expressed STILBENE SYNTHASE genes with the uncharacterized VviMYB13. These regulators have distinct expression patterns within organs and in response to biotic and abiotic stresses, suggesting a pivotal role of VviMYB13 in regulating stilbene accumulation in vegetative tissues and under biotic stress conditions. PMID:27407139

  12. Differences in saccharin preference and genetic alterations of the Tas1r3 gene among senescence-accelerated mouse strains and their parental AKR/J strain.

    PubMed

    Niimi, Kimie; Takahashi, Eiki

    2014-05-10

    The senescence-accelerated mouse (SAM) is used as an animal model of senescence acceleration and age-associated disorders. SAM is derived from unexpected crosses between the AKR/J and unknown mouse strains. There are nine senescence-prone (SAMP) strains and three senescence-resistant (SAMR) strains. Although SAMP strains exhibit strain-specific and age-related pathological changes, the genes responsible for the pathologic changes in SAMP strains have not been comprehensively identified. In the present study, we evaluated sweet taste perception using the two-bottle test. We compared genotypes of the taste related gene, Tas1r3, using SAM strains and the parental AKR/J strain. The two-bottle test revealed that SAMR1 (R1), SAMP6 (P6), SAMP8 (P8), and SAMP10 (P10) mice were saccharin-preferring strains, whereas AKR/J did not prefer saccharin. All genotypes of the R1, P6, P8, and P10 strains at the polymorphic sites in Tas1r3, which is known to influence saccharin preference, were identical to those of C57BL6/J, a well-known saccharin-preferring strain, and were completely different from those of the parental AKR/J strain. These genetic alterations in SAM strains appear to arise from an unknown strain that is thought to have been crossed with AKR/J initially. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. T1R3 homomeric sweet taste receptor regulates adipogenesis through Gαs-mediated microtubules disassembly and Rho activation in 3T3-L1 cells

    PubMed Central

    Masubuchi, Yosuke; Nakagawa, Yuko; Medina, Johan; Nagasawa, Masahiro; Kojima, Itaru; Rasenick, Mark M.; Inagaki, Takeshi

    2017-01-01

    We previously reported that 3T3-L1 cells express a functional sweet taste receptor possibly as a T1R3 homomer that is coupled to Gs and negatively regulates adipogenesis by a Gαs-mediated but cAMP-independent mechanism. Here, we show that stimulation of this receptor with sucralose or saccharin induced disassembly of the microtubules in 3T3-L1 preadipocytes, which was attenuated by overexpression of the dominant-negative mutant of Gαs (Gαs-G226A). In contrast, overexpression of the constitutively active mutant of Gαs (Gαs-Q227L) as well as treatment with cholera toxin or isoproterenol but not with forskolin caused disassembly of the microtubules. Sweetener-induced microtubule disassembly was accompanied by activation of RhoA and Rho-associated kinase (ROCK). This was attenuated with by knockdown of GEF-H1, a microtubule-localized guanine nucleotide exchange factor for Rho GTPase. Furthermore, overexpression of the dominant-negative mutant of RhoA (RhoA-T19N) blocked sweetener-induced dephosphorylation of Akt and repression of PPARγ and C/EBPα in the early phase of adipogenic differentiation. These results suggest that the T1R3 homomeric sweet taste receptor negatively regulates adipogenesis through Gαs-mediated microtubule disassembly and consequent activation of the Rho/ROCK pathway. PMID:28472098

  14. T1R3 homomeric sweet taste receptor regulates adipogenesis through Gαs-mediated microtubules disassembly and Rho activation in 3T3-L1 cells.

    PubMed

    Masubuchi, Yosuke; Nakagawa, Yuko; Medina, Johan; Nagasawa, Masahiro; Kojima, Itaru; Rasenick, Mark M; Inagaki, Takeshi; Shibata, Hiroshi

    2017-01-01

    We previously reported that 3T3-L1 cells express a functional sweet taste receptor possibly as a T1R3 homomer that is coupled to Gs and negatively regulates adipogenesis by a Gαs-mediated but cAMP-independent mechanism. Here, we show that stimulation of this receptor with sucralose or saccharin induced disassembly of the microtubules in 3T3-L1 preadipocytes, which was attenuated by overexpression of the dominant-negative mutant of Gαs (Gαs-G226A). In contrast, overexpression of the constitutively active mutant of Gαs (Gαs-Q227L) as well as treatment with cholera toxin or isoproterenol but not with forskolin caused disassembly of the microtubules. Sweetener-induced microtubule disassembly was accompanied by activation of RhoA and Rho-associated kinase (ROCK). This was attenuated with by knockdown of GEF-H1, a microtubule-localized guanine nucleotide exchange factor for Rho GTPase. Furthermore, overexpression of the dominant-negative mutant of RhoA (RhoA-T19N) blocked sweetener-induced dephosphorylation of Akt and repression of PPARγ and C/EBPα in the early phase of adipogenic differentiation. These results suggest that the T1R3 homomeric sweet taste receptor negatively regulates adipogenesis through Gαs-mediated microtubule disassembly and consequent activation of the Rho/ROCK pathway.

  15. Stability and Unimolecular Reactivity of Palladate(II) Complexes [Ln PdR3 ](-) (L=Phosphine, R=Organyl, n=0 and 1).

    PubMed

    Kolter, Marlene; Koszinowski, Konrad

    2016-10-24

    The reduction of Pd(II) precatalysts to catalytically active Pd(0) species is a key step in many palladium-mediated cross-coupling reactions. Besides phosphines, the stoichiometrically used organometallic reagents can afford this reduction, but do so in a poorly understood way. To elucidate the mechanism of this reaction, we have treated solutions of Pd(OAc)2 and a phosphine ligand L in tetrahydrofuran with RMgCl (R=Ph, Bn, Bu) as well as other organometallic reagents. Analysis of these model systems by electrospray- ionization mass spectrometry found palladate(II) complexes [Ln PdR3 ](-) (n=0 and 1), thus pointing to the occurrence of transmetallation reactions. Upon gas-phase fragmentation, the [Ln PdR3 ](-) anions preferentially underwent a reductive elimination to yield Pd(0) species. The sequence of the transmetallation and reductive elimination, thus, constitutes a feasible mechanism for the reduction of the Pd(OAc)2 precatalyst. Other species of interest observed include the Pd(IV) complex [PdBn5 ](-) , which did not fragment via a reductive elimination but lost BnH instead. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis.

    PubMed

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D; Douglas, Carl J

    2014-05-23

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.

  17. Comparison of the Tastes of L-Alanine and Monosodium Glutamate in C57BL/6J Wild Type and T1r3 Knockout Mice.

    PubMed

    Eddy, Meghan C; Eschle, Benjamin K; Delay, Eugene R

    2017-09-01

    Previous research showed that L-alanine and monosodium L-glutamate elicit similar taste sensations in rats. This study reports the results of behavioral experiments designed to compare the taste capacity of C57BL/6J wild type and T1r3- mice for these 2 amino acids. In conditioned taste aversion (CTA) experiments, wild-type mice exhibited greater sensitivity than knockout mice for both L-amino acids, although knockout mice were clearly able to detect both amino acids at 50 mM and higher concentrations. Generalization of CTA between L-alanine and L-glutamate was bidirectionally equivalent for both mouse genotypes, indicating that both substances elicited similar tastes in both genotypes. This was verified by the discrimination experiments in which both mouse genotypes performed at or near chance levels at 75 and 150 mM. Above 150 mM, discrimination performance improved, suggesting the taste qualities of the 2 L-amino acids are not identical. No differences between knockout and wild-type mice in discrimination ability were detected. These results indicate that while the T1r3 receptor is important for tasting L-alanine and L-glutamate, other receptors are also important for tasting these amino acids. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis

    PubMed Central

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D.; Douglas, Carl J.

    2014-01-01

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes. PMID:24852237

  19. PacMYBA, a sweet cherry R2R3-MYB transcription factor, is a positive regulator of salt stress tolerance and pathogen resistance.

    PubMed

    Shen, Xinjie; Guo, Xinwei; Guo, Xiao; Zhao, Di; Zhao, Wei; Chen, Jingsheng; Li, Tianhong

    2017-03-01

    Plant R2R3-MYB transcription factors play crucial roles in stress responses. We previously isolated a R2R3-MYB homolog from sweet cherry cv. Hong Deng, designated PacMYBA (GenBank accession No. KF974774). To explore the role of PacMYBA in the plant stress response, we heterologously expressed PacMYBA in transgenic Arabidopsis thaliana plants. In a previous study, we demonstrated that PacMYBA is mainly localized to the nucleus and could be induced by abscisic acid (ABA). Analysis of the promoter sequence of PacMYBA revealed that it contains several stress-related cis-elements. QPCR results showed that PacMYBA is induced by salt, salicylic (SA), and jasmonic acid (JA) in sweet cherry leaves. Transgenic Arabidopsis plants heterologously expressing PacMYBA exhibited enhanced salt-tolerance and increased resistance to Pseudomonas syringe pv. tomato (Pst) DC3000 infection. Overexpression of PacMYBA decreased the osmotic potential (OP), increased the free proline content, and increased the peroxidase content in transgenic Arabidopsis plants. Furthermore, overexpression of PacMYBA also affected the expression levels of salt stress- and pathogen defense-related genes in the transgenic plants. These results indicate that PacMYBA is a positive regulator of salt stress tolerance and pathogen resistance. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture

    DOEpatents

    Sanfilippo, Antonio; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2009-12-22

    Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture are described. In one aspect, a document clustering method includes providing a document set comprising a plurality of documents, providing a cluster comprising a subset of the documents of the document set, using a plurality of terms of the documents, providing a cluster label indicative of subject matter content of the documents of the cluster, wherein the cluster label comprises a plurality of word senses, and selecting one of the word senses of the cluster label.

  1. Cluster-cluster correlations and constraints on the correlation hierarchy

    NASA Technical Reports Server (NTRS)

    Hamilton, A. J. S.; Gott, J. R., III

    1988-01-01

    The hypothesis that galaxies cluster around clusters at least as strongly as they cluster around galaxies imposes constraints on the hierarchy of correlation amplitudes in hierachical clustering models. The distributions which saturate these constraints are the Rayleigh-Levy random walk fractals proposed by Mandelbrot; for these fractal distributions cluster-cluster correlations are all identically equal to galaxy-galaxy correlations. If correlation amplitudes exceed the constraints, as is observed, then cluster-cluster correlations must exceed galaxy-galaxy correlations, as is observed.

  2. Evolution Properties of Clusters and AXAF Contributions to understanding Clusters

    NASA Technical Reports Server (NTRS)

    Jones, Christine

    1998-01-01

    Our ROSAT survey for distant clusters of galaxies contains the largest solid angle of all ROSAT pointed surveying and thus has sufficient area to test the previously reported cluster evolution. We find significant negative cluster evolution, i.e,, at high redshifts there are fewer luminous clusters than at present. We compare optical cluster properties for the most distant clusters in the ROSAT survey with those measured for nearby clusters. We also present AXAF capabilities and show how AXAF will significantly extend our understanding of cluster properties and their cosmological evolution.

  3. Formation and Reactivity of Organo-Functionalized Tin Selenide Clusters.

    PubMed

    Rinn, Niklas; Eußner, Jens P; Kaschuba, Willy; Xie, Xiulan; Dehnen, Stefanie

    2016-02-24

    Reactions of R(1) SnCl3 (R(1) =CMe2 CH2 C(O)Me) with (SiMe3 )2 Se yield a series of organo-functionalized tin selenide clusters, [(SnR(1) )2 SeCl4 ] (1), [(SnR(1) )2 Se2 Cl2 ] (2), [(SnR(1) )3 Se4 Cl] (3), and [(SnR(1) )4 Se6 ] (4), depending on the solvent and ratio of the reactants used. NMR experiments clearly suggest a stepwise formation of 1 through 4 by subsequent condensation steps with the concomitant release of Me3 SiCl. Furthermore, addition of hydrazines to the keto-functionalized clusters leads to the formation of hydrazone derivatives, [(Sn2 (μ-R(3) )(μ-Se)Cl4 ] (5, R(3) =[CMe2 CH2 CMe(NH)]2 ), [(SnR(2) )3 Se4 Cl] (6, R(2) =CMe2 CH2 C(NNH2 )Me), [(SnR(4) )3 Se4 ][SnCl3 ] (7, R(4) =CMe2 CH2 C(NNHPh)Me), [(SnR(2) )4 Se6 ] (8), and [(SnR(4) )4 Se6 ] (9). Upon treatment of 4 with [Cu(PPh3 )3 Cl] and excess (SiMe3 )2 Se, the cluster fragments to form [(R(1) Sn)2 Se2 (CuPPh3 )2 Se2 ] (10), the first discrete Sn/Se/Cu cluster compound reported in the literature. The derivatization reactions indicate fundamental differences between organotin sulfide and organotin selenide chemistry.

  4. Nuclear Star Clusters

    NASA Astrophysics Data System (ADS)

    Neumayer, Nadine

    2017-03-01

    The centers of galaxies host two distinct, compact components: massive black holes and nuclear star clusters. Nuclear star clusters are the densest stellar systems in the universe, with masses of ~ 107M⊙ and sizes of ~ 5pc. They are almost ubiquitous at the centres of nearby galaxies with masses similar to, or lower than the Milky Way. Their occurrence both in spirals and dwarf elliptical galaxies appears to be a strong function of total galaxy light or mass. Nucleation fractions are up to 100% for total galaxy magnitudes of M B = -19mag or total galaxy luminosities of about L B = 1010 L ⊙ and falling nucleation fractions for both smaller and higher galaxy masses. Although nuclear star clusters are so common, their formation mechanisms are still under debate. The two main formation scenarios proposed are the infall and subsequent merging of star clusters and the in-situ formation of stars at the center of a galaxy. Here, I review the state-of-the-art of nuclear star cluster observations concerning their structure, stellar populations and kinematics. These observations are used to constrain the proposed formation scenarios for nuclear star clusters. Constraints from observations show, that likely both cluster infall and in-situ star formation are at work. The relative importance of these two mechanisms is still subject of investigation.

  5. Studies in clustering theory

    NASA Astrophysics Data System (ADS)

    Stell, George

    In recent years the properties of percolation models have been studied intensively. The purpose of our project was to develop a general theory of percolation and clustering between particles of arbitrary size and shape, with arbitrary correlations between them. The goal of such a theory includes the treatment of continuum percolation as well as a novel treatment of lattice percolation. We made substantial progress toward this goal. The quantities basic to a description of clustering, the mean cluster size, mean number of clusters, etc., were developed. Concise formulas were given for the terms in such series, and proved, at least for sufficiently low densities, that the series are absolutely convergent. These series can now be used to construct Pade approximants that will allow one to probe the percolation transition. A scaled-particle theory of percolation was developed which gives analytic approximants for the mean number of clusters in a large class of two and three dimensional percolation models. Although this quantity is essential in many applications, e.g., explaining colligative properties, and interpreting low-angle light-scattering data, no systematic studies of it have been done before this work. Recently carried out detailed computer simulations show that the mean number of clusters is given to high accuracy by several of there approximations. Extensions of this work will allow calculation of the complete cluster size distribution.

  6. Allodynia in Cluster Headache.

    PubMed

    Wilbrink, Leopoldine A; Louter, Mark A; Teernstra, Onno Pm; van Zwet, Erik W; Huygen, Frank Jpm; Haan, Joost; Ferrari, Michel D; Terwindt, Gisela M

    2017-03-04

    Cutaneous allodynia is an established marker for central sensitization in migraine. There is debate whether cutaneous allodynia may also occur in cluster headache, another episodic headache disorder. Here we examined the presence and severity of allodynia in a large well-defined nation-wide population of people with cluster headache.Using validated questionnaires we assessed, cross-sectionally, ictal allodynia and comorbid depression and migraine in the nation-wide "Leiden University Cluster headache neuro-Analysis" (LUCA) study. Participants with cluster headache were diagnosed according to the International Classification of Headache Disorders criteria. Multivariate regression models were used, with correction for demographic factors and cluster headache subtype (chronic vs. episodic; recent attacks < 1 month vs. no recent attacks).In total 606/798 (75.9%) participants with cluster headache responded of whom 218/606 (36%) had allodynia during attacks. Female gender (OR 2.05, 95% CI 1.28-3.29), low age at onset (OR 0.98, 95% CI 0.96- 0.99), lifetime depression (OR 1.63; 95% CI 1.06-2.50), comorbid migraine (OR 1.96; 95% CI 1.02-3.79), and having recent attacks (OR 1.80; 95% CI 1.13-2.86), but not duration of attacks and chronic cluster headache, were independent risk factors for allodynia.The high prevalence of cutaneous allodynia with similar risk factors for allodynia as found for migraine suggests that central sensitization, like in migraine, also occurs in cluster headache. In clinical practice, awareness that people with cluster headache may suffer from allodynia can in the future be an important feature in treatment options.

  7. Binary Galaxies in Clusters

    NASA Astrophysics Data System (ADS)

    Ip, Peter Shun Sang

    1994-01-01

    CCD images of the binary-rich clusters of galaxies A373, A408, A667, A890, and A1250 taken at the Canada-France-Hawaii telescope show that about half the binary galaxies' are actually star-galaxy or star-star pairs. These clusters are not binary-rich. N-body simulations are used to study the effect of static cluster potentials on binary and single galaxies. The softening procedure is discussed in detail. Since Plummer softening is not self-consistent, and since the force laws for various other density models are similar to each other, uniform-density softening is used. The choice of the theoretical galaxy model in terms of the potential at various locations. A fixed cluster potential cannot stabilize binary galaxies against merger, but can disrupt even quite tightly bound binaries. A moderately good predictor of whether a binary merges or disrupts is the mean torque over a quarter of the initial binary period. But the dynamics of the situation is quite complicated, and depends on an interplay between the motion of the binary through the cluster and the absorption of orbital energy by the galaxies. There is also a substantial amount of mass loss. Simulations of single galaxies in cluster show that this mass loss is due mainly to the cluster potential, and not to an interplay between the merging binary and the cluster. This mass loss is driven partially by virial equilibrium responding to the initial tidal truncation by the cluster. Besides verifying some general results of mass loss from satellite systems in the tidal field of larger bodies, it was found that the galaxy loses mass at an exponential rate.

  8. Atomic cluster collisions

    NASA Astrophysics Data System (ADS)

    Korol, Andrey V.; Solov'yov, Andrey

    2013-01-01

    Atomic cluster collisions are a field of rapidly emerging research interest by both experimentalists and theorists. The international symposium on atomic cluster collisions (ISSAC) is the premier forum to present cutting-edge research in this field. It was established in 2003 and the most recent conference was held in Berlin, Germany in July of 2011. This Topical Issue presents original research results from some of the participants, who attended this conference. This issues specifically focuses on two research areas, namely Clusters and Fullerenes in External Fields and Nanoscale Insights in Radiation Biodamage.

  9. H-cluster stars

    NASA Astrophysics Data System (ADS)

    Lai, X. Y.; Gao, C. Y.; Xu, R. X.

    2013-06-01

    The study of dense matter at ultrahigh density has a very long history, which is meaningful for us to understand not only cosmic events in extreme circumstances but also fundamental laws of physics. It is well known that the state of cold matter at supranuclear density depends on the non-perturbative nature of quantum chromodynamics (QCD) and is essential for modelling pulsars. A so-called H-cluster matter is proposed in this paper as the nature of dense matter in reality. In compact stars at only a few nuclear densities but low temperature, quarks could be interacting strongly with each other there. That might render quarks grouped in clusters, although the hypothetical quark clusters in cold dense matter have not been confirmed due to the lack of both theoretical and experimental evidence. Motivated by recent lattice QCD simulations of the H-dibaryons (with structure uuddss), we therefore consider here a possible kind of quark clusters, H-clusters, that could emerge inside compact stars during their initial cooling as the dominant components inside (the degree of freedom could then be H-clusters there). Taking into account the in-medium stiffening effect, we find that at baryon densities of compact stars H-cluster matter could be more stable than nuclear matter. We also find that for the H-cluster matter with lattice structure, the equation of state could be so stiff that it would seem to be `superluminal' in the most dense region. However, the real sound speed for H-cluster matter is in fact difficult to calculate, so at this stage we do not put constraints on our model from the usual requirement of causality. We study the stars composed of H-clusters, i.e. H-cluster stars, and derive the dependence of their maximum mass on the in-medium stiffening effect, showing that the maximum mass could be well above 2 M⊙ as observed and that the resultant mass-radius relation fits the measurement of the rapid burster under reasonable parameters. Besides a general

  10. Dwarfs in Coma Cluster

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Click on image for larger poster version

    This false-color mosaic of the central region of the Coma cluster combines infrared and visible-light images to reveal thousands of faint objects (green). Follow-up observations showed that many of these objects, which appear here as faint green smudges, are dwarf galaxies belonging to the cluster. Two large elliptical galaxies, NGC 4889 and NGC 4874, dominate the cluster's center. The mosaic combines visible-light data from the Sloan Digital Sky Survey (color coded blue) with long- and short-wavelength infrared views (red and green, respectively) from NASA's Spitzer Space Telescope.

  11. Small clusters: aerosol precursors

    SciTech Connect

    Castleman, A.W. Jr.; Keesee, R.G.

    1983-01-01

    Studies of the structure, stability, electronic properties, and formation kinetics of small clusters provide information useful in furthering an understanding of nucleation processes, the formation and stability of collodial media, and the nature of surfaces. Using mass spectrometry, coupled with various high pressure ion clustering and molecular beam techniques, the details of the primary clustering steps leading to nucleation from the vapor are obtained by direct observation. This paper is devoted to a review of some recent results on these subjects obtained in the authors' laboratory.

  12. Dwarfs in Coma Cluster

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Click on image for larger poster version

    This false-color mosaic of the central region of the Coma cluster combines infrared and visible-light images to reveal thousands of faint objects (green). Follow-up observations showed that many of these objects, which appear here as faint green smudges, are dwarf galaxies belonging to the cluster. Two large elliptical galaxies, NGC 4889 and NGC 4874, dominate the cluster's center. The mosaic combines visible-light data from the Sloan Digital Sky Survey (color coded blue) with long- and short-wavelength infrared views (red and green, respectively) from NASA's Spitzer Space Telescope.

  13. Magnetization of ferromagnetic clusters

    SciTech Connect

    Onishi, Naoki; Bertsch, G.; Yabana, Kazuhiro

    1995-02-01

    The magnetization and deflection profiles of magnetic clusters in a Stern-Gerlach magnet are calculated for conditions under which the magnetic moment is fixed in the intrinsic frame of the cluster, and the clusters enter the magnetic field adiabatically. The predicted magnetization is monotonic in the Langevin parameter, the ratio of magnetic energy {mu}{sub 0}B to thermal energy k{sub B}T. In low field the average magnetization is 2/3 of the Langevin function. The high-field moment approaches saturation asymptotically as B{sup {minus}1/2} instead of the B{sup {minus}1} dependence in the Langevin function.

  14. Partially supervised speaker clustering.

    PubMed

    Tang, Hao; Chu, Stephen Mingyu; Hasegawa-Johnson, Mark; Huang, Thomas S

    2012-05-01

    Content-based multimedia indexing, retrieval, and processing as well as multimedia databases demand the structuring of the media content (image, audio, video, text, etc.), one significant goal being to associate the identity of the content to the individual segments of the signals. In this paper, we specifically address the problem of speaker clustering, the task of assigning every speech utterance in an audio stream to its speaker. We offer a complete treatment to the idea of partially supervised speaker clustering, which refers to the use of our prior knowledge of speakers in general to assist the unsupervised speaker clustering process. By means of an independent training data set, we encode the prior knowledge at the various stages of the speaker clustering pipeline via 1) learning a speaker-discriminative acoustic feature transformation, 2) learning a universal speaker prior model, and 3) learning a discriminative speaker subspace, or equivalently, a speaker-discriminative distance metric. We study the directional scattering property of the Gaussian mixture model (GMM) mean supervector representation of utterances in the high-dimensional space, and advocate exploiting this property by using the cosine distance metric instead of the euclidean distance metric for speaker clustering in the GMM mean supervector space. We propose to perform discriminant analysis based on the cosine distance metric, which leads to a novel distance metric learning algorithm—linear spherical discriminant analysis (LSDA). We show that the proposed LSDA formulation can be systematically solved within the elegant graph embedding general dimensionality reduction framework. Our speaker clustering experiments on the GALE database clearly indicate that 1) our speaker clustering methods based on the GMM mean supervector representation and vector-based distance metrics outperform traditional speaker clustering methods based on the “bag of acoustic features” representation and statistical

  15. Extending Beowulf Clusters

    USGS Publications Warehouse

    Steinwand, Daniel R.; Maddox, Brian; Beckmann, Tim; Hamer, George

    2003-01-01

    Beowulf clusters can provide a cost-effective way to compute numerical models and process large amounts of remote sensing image data. Usually a Beowulf cluster is designed to accomplish a specific set of processing goals, and processing is very efficient when the problem remains inside the constraints of the original design. There are cases, however, when one might wish to compute a problem that is beyond the capacity of the local Beowulf system. In these cases, spreading the problem to multiple clusters or to other machines on the network may provide a cost-effective solution.

  16. Transcriptional Profiling of Cultured, Embryonic Epicardial Cells Identifies Novel Genes and Signaling Pathways Regulated by TGFβR3 In Vitro

    PubMed Central

    DeLaughter, Daniel M.; Clark, Cynthia R.; Christodoulou, Danos C.; Seidman, Christine E.; Baldwin, H. Scott; Seidman, J. G.; Barnett, Joey V.

    2016-01-01

    The epicardium plays an important role in coronary vessel formation and Tgfbr3-/- mice exhibit failed coronary vessel development associated with decreased epicardial cell invasion. Immortalized Tgfbr3-/- epicardial cells display the same defects. Tgfbr3+/+ and Tgfbr3-/- cells incubated for 72 hours with VEH or ligands known to promote invasion via TGFβR3 (TGFβ1, TGFβ2, BMP2), for 72 hours were harvested for RNA-seq analysis. We selected for genes >2-fold differentially expressed between Tgfbr3+/+ and Tgfbr3-/- cells when incubated with VEH (604), TGFβ1 (515), TGFβ2 (553), or BMP2 (632). Gene Ontology (GO) analysis of these genes identified dysregulated biological processes consistent with the defects observed in Tgfbr3-/- cells, including those associated with extracellular matrix interaction. GO and Gene Regulatory Network (GRN) analysis identified distinct expression profiles between TGFβ1-TGFβ2 and VEH-BMP2 incubated cells, consistent with the differential response of epicardial cells to these ligands in vitro. Despite the differences observed between Tgfbr3+/+ and Tgfbr3-/- cells after TGFβ and BMP ligand addition, GRNs constructed from these gene lists identified NF-ĸB as a key nodal point for all ligands examined. Tgfbr3-/- cells exhibited decreased expression of genes known to be activated by NF-ĸB signaling. NF-ĸB activity was stimulated in Tgfbr3+/+ epicardial cells after TGFβ2 or BMP2 incubation, while Tgfbr3-/- cells failed to activate NF-ĸB in response to these ligands. Tgfbr3+/+ epicardial cells incubated with an inhibitor of NF-ĸB signaling no longer invaded into a collagen gel in response to TGFβ2 or BMP2. These data suggest that NF-ĸB signaling is dysregulated in Tgfbr3-/- epicardial cells and that NF-ĸB signaling is required for epicardial cell invasion in vitro. Our approach successfully identified a signaling pathway important in epicardial cell behavior downstream of TGFβR3. Overall, the genes and signaling pathways identified

  17. Transcriptional Profiling of Cultured, Embryonic Epicardial Cells Identifies Novel Genes and Signaling Pathways Regulated by TGFβR3 In Vitro.

    PubMed

    DeLaughter, Daniel M; Clark, Cynthia R; Christodoulou, Danos C; Seidman, Christine E; Baldwin, H Scott; Seidman, J G; Barnett, Joey V

    2016-01-01

    The epicardium plays an important role in coronary vessel formation and Tgfbr3-/- mice exhibit failed coronary vessel development associated with decreased epicardial cell invasion. Immortalized Tgfbr3-/- epicardial cells display the same defects. Tgfbr3+/+ and Tgfbr3-/- cells incubated for 72 hours with VEH or ligands known to promote invasion via TGFβR3 (TGFβ1, TGFβ2, BMP2), for 72 hours were harvested for RNA-seq analysis. We selected for genes >2-fold differentially expressed between Tgfbr3+/+ and Tgfbr3-/- cells when incubated with VEH (604), TGFβ1 (515), TGFβ2 (553), or BMP2 (632). Gene Ontology (GO) analysis of these genes identified dysregulated biological processes consistent with the defects observed in Tgfbr3-/- cells, including those associated with extracellular matrix interaction. GO and Gene Regulatory Network (GRN) analysis identified distinct expression profiles between TGFβ1-TGFβ2 and VEH-BMP2 incubated cells, consistent with the differential response of epicardial cells to these ligands in vitro. Despite the differences observed between Tgfbr3+/+ and Tgfbr3-/- cells after TGFβ and BMP ligand addition, GRNs constructed from these gene lists identified NF-ĸB as a key nodal point for all ligands examined. Tgfbr3-/- cells exhibited decreased expression of genes known to be activated by NF-ĸB signaling. NF-ĸB activity was stimulated in Tgfbr3+/+ epicardial cells after TGFβ2 or BMP2 incubation, while Tgfbr3-/- cells failed to activate NF-ĸB in response to these ligands. Tgfbr3+/+ epicardial cells incubated with an inhibitor of NF-ĸB signaling no longer invaded into a collagen gel in response to TGFβ2 or BMP2. These data suggest that NF-ĸB signaling is dysregulated in Tgfbr3-/- epicardial cells and that NF-ĸB signaling is required for epicardial cell invasion in vitro. Our approach successfully identified a signaling pathway important in epicardial cell behavior downstream of TGFβR3. Overall, the genes and signaling pathways identified

  18. Allelic Variation of the Tas1r3 Taste Receptor Gene Selectively Affects Behavioral and Neural Taste Responses to Sweeteners in the F2 Hybrids between C57BL/6ByJ and 129P3/J Mice

    PubMed Central

    Inoue, Masashi; Reed, Danielle R.; Li, Xia; Tordoff, Michael G.; Beauchamp, Gary K.; Bachmanov, Alexander A.

    2006-01-01

    Recent studies have shown that the T1R3 receptor protein encoded by the Tas1r3 gene is involved in transduction of sweet taste. To assess ligand specificity of the T1R3 receptor, we analyzed the association of Tas1r3 allelic variants with taste responses in mice. In the F2 hybrids between the C57BL/6ByJ (B6) and 129P3/J (129) inbred mouse strains, we determined genotypes of markers on chromosome 4, where Tas1r3 resides, measured consumption of taste solutions presented in two-bottle preference tests, and recorded integrated responses of the chorda tympani gustatory nerve to lingual application of taste stimuli. For intakes and preferences, significant linkages to Tas1r3 were found for the sweeteners sucrose, saccharin, and d-phenylalanine but not glycine. For chorda tympani responses, significant linkages to Tas1r3 were found for the sweeteners sucrose, saccharin, d-phenylalanine, d-tryptophan, and SC-45647 but not glycine, l-proline, l-alanine, or l-glutamine. No linkages to distal chromosome 4 were detected for behavioral or neural responses to non-sweet quinine, citric acid, HCl, NaCl, KCl, monosodium glutamate, inosine 5′-monophosphate, or ammonium glutamate. These results demonstrate that allelic variation of the Tas1r3 gene affects gustatory neural and behavioral responses to some, but not all, sweeteners. This study describes the range of ligand sensitivity of the T1R3 receptor using an in vivo approach and, to our knowledge, is the first genetic mapping study of activity in gustatory nerves. PMID:14999080

  19. How Clusters Work

    EPA Pesticide Factsheets

    Technology innovation clusters are geographic concentrations of interconnected companies, universities, and other organizations with a focus on environmental technology. They play a key role in addressing the nation’s pressing environmental problems.