Science.gov

Sample records for 1975-regulation s-k asset-backed

  1. 75 FR 23327 - Asset-Backed Securities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-03

    ...We are proposing significant revisions to Regulation AB and other rules regarding the offering process, disclosure and reporting for asset-backed securities. Our proposals would revise filing deadlines for ABS offerings to provide investors with more time to consider transaction-specific information, including information about the pool assets. Our proposals also would repeal the current......

  2. 76 FR 55308 - Treatment of Asset-Backed Issuers Under the Investment Company Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-07

    ... COMMISSION 17 CFR Part 270 RIN 3235-AL03 Treatment of Asset-Backed Issuers Under the Investment Company Act... Treatment of Structured Finance under the Investment Company Act 1-101 (May 1992) (``Protecting Investors.../craexamination070808.pdf . To assist the Commission in its review of the treatment of asset- backed issuers under...

  3. 17 CFR 229.1116 - (Item 1116) Tax matters.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1116 (Item... asset-backed securities transaction under federal income tax laws. (b) The material federal income...

  4. 17 CFR 229.1116 - (Item 1116) Tax matters.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1116 (Item... asset-backed securities transaction under federal income tax laws. (b) The material federal income...

  5. 76 FR 47947 - Re-Proposal of Shelf Eligibility Conditions for Asset-Backed Securities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-05

    ... help ensure a certain quality and character for asset-backed securities that are eligible for delayed... comparable character and quality (which could not), we expanded the ability to use ``shelf offerings'' to... known as ``risk retention'' or ``skin-in-the-game''); \\28\\ We use the term ``sponsor'' to mean...

  6. 17 CFR 232.314 - Accommodation for certain securitizers of asset-backed securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... Securities Rulemaking Board's Internet Web site. XBRL-Related Documents ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false Accommodation for certain securitizers of asset-backed securities. 232.314 Section 232.314 Commodity and Securities Exchanges...

  7. 17 CFR 229.1111 - (Item 1111) Pool assets.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1111 (Item...(a) of this Regulation AB and the compensation arrangements with such party. (iv) Whether the...

  8. 17 CFR 229.1111 - (Item 1111) Pool assets.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1111 (Item...(a) of this Regulation AB and the compensation arrangements with such party. (iv) Whether the...

  9. 17 CFR 229.1111 - (Item 1111) Pool assets.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1111 (Item...(a) of this Regulation AB and the compensation arrangements with such party. (iv) Whether the...

  10. 76 FR 54374 - Disclosure for Asset-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-01

    ... From the Federal Register Online via the Government Publishing Office SECURITIES AND EXCHANGE COMMISSION 17 CFR PART 240 RIN 3235-AK75 Disclosure for Asset-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street Reform and Consumer Protection Act AGENCY: Securities and...

  11. 17 CFR 230.167 - Communications in connection with certain registered offerings of asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Communications in connection with certain registered offerings of asset-backed securities. 230.167 Section 230.167 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION GENERAL RULES AND REGULATIONS, SECURITIES ACT OF...

  12. 17 CFR 232.312 - Accommodation for certain information in filings with respect to asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Accommodation for certain information in filings with respect to asset-backed securities. 232.312 Section 232.312 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION REGULATION S-T-GENERAL RULES AND REGULATIONS...

  13. 17 CFR 230.167 - Communications in connection with certain registered offerings of asset-backed securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false Communications in connection with certain registered offerings of asset-backed securities. 230.167 Section 230.167 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION GENERAL RULES AND REGULATIONS, SECURITIES ACT OF...

  14. 17 CFR 232.312 - Accommodation for certain information in filings with respect to asset-backed securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false Accommodation for certain information in filings with respect to asset-backed securities. 232.312 Section 232.312 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION REGULATION S-T-GENERAL RULES AND REGULATIONS...

  15. 17 CFR 229.1100 - (Item 1100) General.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1100 (Item 1100) General. (a) Application of Regulation AB. Regulation AB (§§ 229.1100 through 229.1123) is the... this Regulation AB, including the definition of “asset-backed security,” are set forth in Item 1101....

  16. 17 CFR 229.1100 - (Item 1100) General.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1100 (Item 1100) General. (a) Application of Regulation AB. Regulation AB (§§ 229.1100 through 229.1123) is the... this Regulation AB, including the definition of “asset-backed security,” are set forth in Item 1101....

  17. 17 CFR 229.1100 - (Item 1100) General.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1100 (Item 1100) General. (a) Application of Regulation AB. Regulation AB (§§ 229.1100 through 229.1123) is the... this Regulation AB, including the definition of “asset-backed security,” are set forth in Item 1101....

  18. 17 CFR 229.1100 - (Item 1100) General.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1100 (Item 1100) General. (a) Application of Regulation AB. Regulation AB (§§ 229.1100 through 229.1123) is the... this Regulation AB, including the definition of “asset-backed security,” are set forth in Item 1101....

  19. 17 CFR 240.15d-23 - Reporting regarding certain securities underlying asset-backed securities under section 15(d) of...

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... filing with respect to the asset-backed securities. See Item 1100(d) of Regulation AB (§ 229.1100(d) of this chapter). (d) Terms used in this section have the same meaning as in Item 1101 of Regulation...

  20. 17 CFR 240.15d-23 - Reporting regarding certain securities underlying asset-backed securities under section 15(d) of...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... filing with respect to the asset-backed securities. See Item 1100(d) of Regulation AB (§ 229.1100(d) of this chapter). (d) Terms used in this section have the same meaning as in Item 1101 of Regulation...

  1. 17 CFR 229.1117 - (Item 1117) Legal proceedings.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229..., depositor, trustee, issuing entity, servicer contemplated by Item 1108(a)(3) of this Regulation AB, originator contemplated by Item 1110(b) of this Regulation AB, or other party contemplated by Item...

  2. 17 CFR 229.1107 - (Item 1107) Issuing entities.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229...(a)(2) of this Regulation AB, depositor, issuing entity, originator contemplated by Item 1110 of this Regulation AB, underwriter, or any affiliate of the foregoing, separately identify the type and amount...

  3. 17 CFR 229.1106 - (Item 1106) Depositors.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1106 (Item... information regarding the depositor called for by paragraphs (a) and (b) of Item 1104 of this Regulation AB..., paragraphs (c) and (d) of Item 1104 of this Regulation AB. In addition, provide the following information:...

  4. 17 CFR 229.1101 - (Item 1101) Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1101 (Item 1101) Definitions. The following definitions apply to the terms used in Regulation AB (§§ 229.1100... 1105 of this Regulation AB, such as for the sponsor's and/or servicer's portfolio, prior...

  5. 17 CFR 229.1107 - (Item 1107) Issuing entities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229...(a)(2) of this Regulation AB, depositor, issuing entity, originator contemplated by Item 1110 of this Regulation AB, underwriter, or any affiliate of the foregoing, separately identify the type and amount...

  6. 17 CFR 229.1113 - (Item 1113) Structure of the transaction.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229... Regulation AB or if such person has rights that may alter the transaction structure beyond receipt of... identified in Item 1119(a) of this Regulation AB. (iii) The amount of the redemption or repurchase price...

  7. 17 CFR 229.1107 - (Item 1107) Issuing entities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229...(a)(2) of this Regulation AB, depositor, issuing entity, originator contemplated by Item 1110 of this Regulation AB, underwriter, or any affiliate of the foregoing, separately identify the type and amount...

  8. 17 CFR 229.1113 - (Item 1113) Structure of the transaction.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229... Regulation AB or if such person has rights that may alter the transaction structure beyond receipt of... identified in Item 1119(a) of this Regulation AB. (iii) The amount of the redemption or repurchase price...

  9. 17 CFR 229.1117 - (Item 1117) Legal proceedings.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229..., depositor, trustee, issuing entity, servicer contemplated by Item 1108(a)(3) of this Regulation AB, originator contemplated by Item 1110(b) of this Regulation AB, or other party contemplated by Item...

  10. 17 CFR 229.1107 - (Item 1107) Issuing entities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229...(a)(2) of this Regulation AB, depositor, issuing entity, originator contemplated by Item 1110 of this Regulation AB, underwriter, or any affiliate of the foregoing, separately identify the type and amount...

  11. 17 CFR 229.1106 - (Item 1106) Depositors.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1106 (Item... information regarding the depositor called for by paragraphs (a) and (b) of Item 1104 of this Regulation AB..., paragraphs (c) and (d) of Item 1104 of this Regulation AB. In addition, provide the following information:...

  12. 17 CFR 229.1101 - (Item 1101) Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1101 (Item 1101) Definitions. The following definitions apply to the terms used in Regulation AB (§§ 229.1100... 1105 of this Regulation AB, such as for the sponsor's and/or servicer's portfolio, prior...

  13. 17 CFR 229.1113 - (Item 1113) Structure of the transaction.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229... Regulation AB or if such person has rights that may alter the transaction structure beyond receipt of... identified in Item 1119(a) of this Regulation AB. (iii) The amount of the redemption or repurchase price...

  14. 17 CFR 229.1101 - (Item 1101) Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1101 (Item 1101) Definitions. The following definitions apply to the terms used in Regulation AB (§§ 229.1100... 1105 of this Regulation AB, such as for the sponsor's and/or servicer's portfolio, prior...

  15. 17 CFR 229.1106 - (Item 1106) Depositors.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1106 (Item... information regarding the depositor called for by paragraphs (a) and (b) of Item 1104 of this Regulation AB..., paragraphs (c) and (d) of Item 1104 of this Regulation AB. In addition, provide the following information:...

  16. 17 CFR 229.1113 - (Item 1113) Structure of the transaction.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229... Regulation AB or if such person has rights that may alter the transaction structure beyond receipt of... identified in Item 1119(a) of this Regulation AB. (iii) The amount of the redemption or repurchase price...

  17. 17 CFR 229.1117 - (Item 1117) Legal proceedings.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229..., depositor, trustee, issuing entity, servicer contemplated by Item 1108(a)(3) of this Regulation AB, originator contemplated by Item 1110(b) of this Regulation AB, or other party contemplated by Item...

  18. 17 CFR 229.1117 - (Item 1117) Legal proceedings.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229..., depositor, trustee, issuing entity, servicer contemplated by Item 1108(a)(3) of this Regulation AB, originator contemplated by Item 1110(b) of this Regulation AB, or other party contemplated by Item...

  19. 17 CFR 229.1106 - (Item 1106) Depositors.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1106 (Item... information regarding the depositor called for by paragraphs (a) and (b) of Item 1104 of this Regulation AB..., paragraphs (c) and (d) of Item 1104 of this Regulation AB. In addition, provide the following information:...

  20. 17 CFR 229.1107 - (Item 1107) Issuing entities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229...(a)(2) of this Regulation AB, depositor, issuing entity, originator contemplated by Item 1110 of this Regulation AB, underwriter, or any affiliate of the foregoing, separately identify the type and amount...

  1. 17 CFR 229.1106 - (Item 1106) Depositors.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1106 (Item... information regarding the depositor called for by paragraphs (a) and (b) of Item 1104 of this Regulation AB..., paragraphs (c) and (d) of Item 1104 of this Regulation AB. In addition, provide the following information:...

  2. 17 CFR 229.1117 - (Item 1117) Legal proceedings.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229..., depositor, trustee, issuing entity, servicer contemplated by Item 1108(a)(3) of this Regulation AB, originator contemplated by Item 1110(b) of this Regulation AB, or other party contemplated by Item...

  3. 17 CFR 229.1111 - (Item 1111) Pool assets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., including a description of any differences from the criteria used to select the current asset pool. (8... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1111) Pool assets. 229... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1111...

  4. 17 CFR 229.1111 - (Item 1111) Pool assets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., including a description of any differences from the criteria used to select the current asset pool. (8... 17 Commodity and Securities Exchanges 2 2011-04-01 2011-04-01 false (Item 1111) Pool assets. 229... AND CONSERVATION ACT OF 1975-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1111...

  5. Branching fraction and CP asymmetries of B0-->K0(S)K0(S)K0(S).

    PubMed

    Aubert, B; Barate, R; Boutigny, D; Couderc, F; Karyotakis, Y; Lees, J P; Poireau, V; Tissserand, V; Zghiche, A; Grauges-Pous, E; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Ronan, M T; Wenzel, W A; Barrett, M; Ford, K E; Harrison, T J; Hart, A J; Hawkes, C M; Morgan, S E; Watson, A T; Fritsch, M; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schroeder, T; Steinke, M; Boyd, J T; Burke, J P; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Wilson, F F; Cuhadar-Donszelmann, T; Hearty, C; Knecht, N S; Mattison, T S; McKenna, J A; Thiessen, D; Khan, A; Kyberd, P; Teodorescu, L; Blinov, A E; Blinov, V E; Druzhinin, V P; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Eschrich, I; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Weinstein, A J R; Foulkes, S D; Gary, J W; Long, O; Shen, B C; Wang, K; del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Cunha, A; Dahmes, B; Hong, T M; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Eisner, A M; Flacco, C J; Heusch, C A; Kroseberg, J; Lockman, W S; Nesom, G; Schalk, T; Schumm, B A; Seiden, A; Spradlin, P; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Blanc, F; Bloom, P; Chen, S; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Ruddick, W O; Smith, J G; Ulmer, K A; Zhang, J; Zhang, L; Chen, A; Eckhart, E A; Harton, J L; Soffer, A; Toki, W H; Wilson, R J; Zeng, Q; Spaan, B; Altenburg, D; Brandt, T; Brose, J; Dickopp, M; Feltresi, E; Hauke, A; Lacker, H M; Maly, E; Nogowski, R; Otto, S; Petzold, A; Schott, G; Schubert, J; Schubert, K R; Schwierz, R; Sundermann, J E; Bernard, D; Bonnneaud, G R; Grenier, P; Schrenk, S; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Bard, D J; Clark, P J; Muheim, F; Playfer, S; Xie, Y; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Brandenburg, G; Chaisanguanthum, K S; Morii, M; Won, E; Dubitzky, R S; Langenegger, U; Marks, J; Uwer, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Gaillard, J R; Morton, G W; Nash, J A; Nikolich, M B; Taylor, G P; Charles, M J; Grenier, G J; Mallik, U; Mohapatra, A K; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Rubin, A E; Yi, J; Arnaud, N; Davier, M; Giroux, X; Grosdidier, G; Höcker, A; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Pierini, M; Plaszczynski, S; Schune, M H; Wormser, G; Cheng, C H; Lange, D J; Simani, M C; Wright, D M; Bevan, A J; Chavez, C A; Coleman, J P; Forster, I J; Fry, J R; Gabathuler, E; Gamet, R; Hutchhcroft, D E; Parry, R J; Payne, D J; Touramanis, C; Cormack, C M; Di Lodovico, F; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; Green, M G; Jackson, P S; McMahon, T R; Ricciardi, S; Salvatore, F; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Hodgkinson, M C; Lafferty, G D; Naisbit, M T; Williams, J C; Chen, C; Farbin, A; Hulsbergen, W D; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Koeneke, K; Sciolla, G; Sekula, S J; Taylor, F; Yamamoto, R K; Patel, P M; Robertson, S H; Lazzaro, A; Lombardo, V; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Côté, D; Taras, P; Nicholson, H; Cavallo, N; Fabozzi, F; Gatto, C; Lista, L; Monorchio, D; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M; Bulten, H; Raven, G; Snoek, H L; Wilden, L; Jessop, C P; LoSecco, J M; Allmendinger, T; Bennelli, G; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Rahimi, A M; Ter-Antonyan, R; Wong, Q K; Brau, J; Frey, R; Igonkina, O; Lu, M; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; Del Buono, L; de la Vaissière, Ch; Hamon, O; John, M J J; Leruste, Ph; Malclès, J; Ocariz, J; Roos, L; Therin, G; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Biasini, M; Covarelli, R; Pioppi, M; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Simi, G; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lau, Y P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Telnov, A V; Bellini, F; Cavoto, G; D'Orazio, A; Di Marco, E; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Mazzoni, M A; Morganti, S; Piredda, G; Polci, F; Safai Tehrani, F; Voena, C; Christ, S; Schröder, H; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Gopal, G P; Olaiya, E O; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Legendre, M; London, G W; Mayer, B; Vasseur, G; Yèche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Wilson, J R; Yumiceva, F X; Abe, T; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Claus, R; Convery, M R; Cristinziani, M; De Nardo, G; Dingfelder, J C; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Fan, S; Field, R C; Glanzman, T; Gowdy, S J; Hadig, T; Halyo, V; Hast, C; Hrny'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Libby, J; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Snyder, A; Soha, A; Stelzer, J; Strube, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Wisniewski, W J; Wittgen, M; Wright, D H; Yarritu, A K; Young, C C; Burchat, P R; Edwards, A J; Majewski, S A; Petersen, B A; Roat, C; Ahmed, M; Ahmed, S; Alam, M S; Ernst, J A; Saeed, M A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Satpathy, A; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Bosisio, L; Cartaro, C; Cossutti, F; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Martinez-Vidal, F; Panvini, R S; Banerjee, Sw; Bhuyan, B; Brown, C M; Fortin, D; Hamano, K; Jackson, P D; Kowalewski, R; Roney, J M; Sobie, R J; Back, J J; Harrison, P F; Mohanty, G B; Band, H R; Chen, X; Cheng, B; Dasu, S; Datta, M; Eichenbaum, A M; Flood, K T; Graham, M; Hollar, J J; Johnson, J R; Kutter, P E; Li, H; Liu, R; Mihalyi, A; Pan, Y; Prepost, R; Tan, P; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Greene, M G; Neal, H

    2005-07-01

    We present measurements of the branching fraction and time-dependent CP-violating asymmetries in B0-->K0(S)K0(S)K0(S) decays based on 227 x 10(6) Upsilon4S-->BB decays collected with the BABAR detector at the PEP-II asymmetric-energy B factory at SLAC. We obtain a branching fraction of (6.9(+0.9)(-0.8)+/-0.6) x 10(-6), and CP asymmetries C=-0.34(+0.28)(-0.25)+/-0.05 and S=-0.71(+0.38)(-0.32)+/-0.04, where the first uncertainties are statistical and the second systematic.

  6. Observation of the decay B‾s0 → ψ (2 S)K+π-

    NASA Astrophysics Data System (ADS)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Affolder, A.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Anderson, J.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Aquines Gutierrez, O.; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Bettler, M.-O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bird, T.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borsato, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Brett, D.; Britsch, M.; Britton, T.; Brodzicka, J.; Brook, N. H.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Calabrese, R.; Calvi, M.; Calvo Gomez, M.; Campana, P.; Campora Perez, D.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casanova Mohr, R.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch.; Cavallero, G.; Cenci, R.; Charles, M.; Charpentier, Ph.; Chefdeville, M.; Chen, S.; Cheung, S.-F.; Chiapolini, N.; Chrzaszcz, M.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collazuol, G.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombes, M.; Coquereau, S.; Corti, G.; Corvo, M.; Counts, I.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A. C.; Cruz Torres, M.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Dalseno, J.; David, P. N. Y.; Davis, A.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Silva, W.; De Simone, P.; Dean, C.-T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Déléage, N.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Ruscio, F.; Dijkstra, H.; Donleavy, S.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Dossett, D.; Dovbnya, A.; Dreimanis, K.; Dujany, G.; Dupertuis, F.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; El Rifai, I.; Elsasser, Ch.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Färber, C.; Farinelli, C.; Farley, N.; Farry, S.; Fay, R.; Ferguson, D.; Fernandez Albor, V.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fol, P.; Fontana, M.; Fontanelli, F.; Forty, R.; Francisco, O.; Frank, M.; Frei, C.; Frosini, M.; Fu, J.; Furfaro, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; García Pardiñas, J.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gastaldi, U.; Gauld, R.; Gavardi, L.; Gazzoni, G.; Geraci, A.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianelle, A.; Gianì, S.; Gibson, V.; Giubega, L.; Gligorov, V. V.; Göbel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gotti, C.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greening, E.; Gregson, S.; Griffith, P.; Grillo, L.; Grünberg, O.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Hampson, T.; Han, X.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; He, J.; Head, T.; Heijne, V.; Hennessy, K.; Henrard, P.; Henry, L.; Hernando Morata, J. A.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hoballah, M.; Hombach, C.; Hulsbergen, W.; Humair, T.; Hussain, N.; Hutchcroft, D.; Hynds, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; Jing, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Kanso, W.; Karacson, M.; Karbach, T. M.; Karodia, S.; Kelsey, M.; Kenyon, I. R.; Kenzie, M.; Ketel, T.; Khanji, B.; Khurewathanakul, C.; Klaver, S.; Klimaszewski, K.; Kochebina, O.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Korolev, M.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kurek, K.; Kvaratskheliya, T.; La Thi, V. N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R. W.; Lanfranchi, G.; Langenbruch, C.; Langhans, B.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.-P.; Lefèvre, R.; Leflat, A.; Lefrançois, J.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Likhomanenko, T.; Liles, M.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, B.; Lohn, S.; Longstaff, I.; Lopes, J. H.; Lowdon, P.; Lucchesi, D.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Machefert, F.; Maciuc, F.; Maev, O.; Malde, S.; Malinin, A.; Manca, G.; Mancinelli, G.; Manning, P.; Mapelli, A.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marino, P.; Märki, R.; Marks, J.; Martellotti, G.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurin, B.; Mazurov, A.; McCann, M.; McCarthy, J.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Merk, M.; Milanes, D. A.; Minard, M.-N.; Mitzel, D. S.; Molina Rodriguez, J.; Monteil, S.; Morandin, M.; Morawski, P.; Mordà, A.; Morello, M. J.; Moron, J.; Morris, A.-B.; Mountain, R.; Muheim, F.; Müller, K.; Mussini, M.; Muster, B.; Naik, P.; Nakada, T.; Nandakumar, R.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Niess, V.; Niet, R.; Nikitin, N.; Nikodem, T.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Onderwater, C. J. G.; Osorio Rodrigues, B.; Otalora Goicochea, J. M.; Otto, A.; Owen, P.; Oyanguren, A.; Palano, A.; Palombo, F.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parkes, C.; Passaleva, G.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Picatoste Olloqui, E.; Pietrzyk, B.; Pilař, T.; Pinci, D.; Pistone, A.; Playfer, S.; Plo Casasus, M.; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Popov, A.; Popov, D.; Popovici, B.; Potterat, C.; Price, E.; Price, J. D.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rakotomiaramanana, B.; Rama, M.; Rangel, M. S.; Raniuk, I.; Rauschmayr, N.; Raven, G.; Redi, F.; Reichert, S.; Reid, M. M.; dos Reis, A. C.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Roiser, S.; Romanovsky, V.; Romero Vidal, A.; Rotondo, M.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Ruiz Valls, P.; Saborido Silva, J. J.; Sagidova, N.; Sail, P.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepp, I.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Simi, G.; Sirendi, M.; Skidmore, N.; Skillicorn, I.; Skwarnicki, T.; Smith, N. A.; Smith, E.; Smith, E.; Smith, J.; Smith, M.; Snoek, H.; Sokoloff, M. D.; Soler, F. J. P.; Soomro, F.; Souza, D.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Steinkamp, O.; Stenyakin, O.; Sterpka, F.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Stroili, R.; Sun, L.; Sutcliffe, W.; Swientek, K.; Swientek, S.; Syropoulos, V.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teklishyn, M.; Tellarini, G.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Todd, J.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Torr, N.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valenti, G.; Vallier, A.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vázquez Sierra, C.; Vecchi, S.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Vesterinen, M.; Viana Barbosa, J. V.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Vilasis-Cardona, X.; Vollhardt, A.; Volyanskyy, D.; Voong, D.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wandernoth, S.; Wang, J.; Ward, D. R.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wiedner, D.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wright, S.; Wyllie, K.; Xie, Y.; Xu, Z.; Yang, Z.; Yuan, X.; Yushchenko, O.; Zangoli, M.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zhokhov, A.; Zhong, L.

    2015-07-01

    The decay B‾s0 → ψ (2 S)K+π- is observed using a data set corresponding to an integrated luminosity of 3.0 fb-1 collected by the LHCb experiment in pp collisions at centre-of-mass energies of 7 and 8 TeV. The branching fraction relative to the B0 → ψ (2 S)K+π- decay mode is measured to be

  7. Observation of the decay B- → D(s)((*)+) K- ℓ- ν(ℓ).

    PubMed

    Sanchez, P del Amo; Lees, J P; Poireau, V; Prencipe, E; Tisserand, V; Garra Tico, J; Grauges, E; Martinelli, M; Palano, A; Pappagallo, M; Eigen, G; Stugu, B; Sun, L; Battaglia, M; Brown, D N; Hooberman, B; Kerth, L T; Kolomensky, Yu G; Lynch, G; Osipenkov, I L; Tanabe, T; Hawkes, C M; Watson, A T; Koch, H; Schroeder, T; Asgeirsson, D J; Hearty, C; Mattison, T S; McKenna, J A; Khan, A; Randle-Conde, A; Blinov, V E; Buzykaev, A R; Druzhinin, V P; Golubev, V B; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Yushkov, A N; Bondioli, M; Curry, S; Kirkby, D; Lankford, A J; Mandelkern, M; Martin, E C; Stoker, D P; Atmacan, H; Gary, J W; Liu, F; Long, O; Vitug, G M; Campagnari, C; Hong, T M; Kovalskyi, D; Richman, J D; Eisner, A M; Heusch, C A; Kroseberg, J; Lockman, W S; Martinez, A J; Schalk, T; Schumm, B A; Seiden, A; Winstrom, L O; Cheng, C H; Doll, D A; Echenard, B; Hitlin, D G; Ongmongkolkul, P; Porter, F C; Rakitin, A Y; Andreassen, R; Dubrovin, M S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Bloom, P C; Ford, W T; Gaz, A; Nagel, M; Nauenberg, U; Smith, J G; Wagner, S R; Ayad, R; Toki, W H; Jasper, H; Karbach, T M; Merkel, J; Petzold, A; Spaan, B; Wacker, K; Kobel, M J; Schubert, K R; Schwierz, R; Bernard, D; Verderi, M; Clark, P J; Playfer, S; Watson, J E; Andreotti, M; Bettoni, D; Bozzi, C; Calabrese, R; Cecchi, A; Cibinetto, G; Fioravanti, E; Franchini, P; Luppi, E; Munerato, M; Negrini, M; Petrella, A; Piemontese, L; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Nicolaci, M; Pacetti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Contri, R; Guido, E; Lo Vetere, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Tosi, S; Bhuyan, B; Prasad, V; Lee, C L; Morii, M; Adametz, A; Marks, J; Schenk, S; Uwer, U; Bernlochner, F U; Ebert, M; Lacker, H M; Lueck, T; Volk, A; Dauncey, P D; Tibbetts, M; Behera, P K; Mallik, U; Chen, C; Cochran, J; Crawley, H B; Dong, L; Meyer, W T; Prell, S; Rosenberg, E I; Rubin, A E; Gao, Y Y; Gritsan, A V; Guo, Z J; Arnaud, N; Davier, M; Derkach, D; da Costa, J Firmino; Grosdidier, G; Le Diberder, F; Lutz, A M; Malaescu, B; Perez, A; Roudeau, P; Schune, M H; Serrano, J; Sordini, V; Stocchi, A; Wang, L; Wormser, G; Lange, D J; Wright, D M; Bingham, I; Chavez, C A; Coleman, J P; Fry, J R; Gabathuler, E; Gamet, R; Hutchcroft, D E; Payne, D J; Touramanis, C; Bevan, A J; Di Lodovico, F; Sacco, R; Sigamani, M; Cowan, G; Paramesvaran, S; Wren, A C; Brown, D N; Davis, C L; Denig, A G; Fritsch, M; Gradl, W; Hafner, A; Alwyn, K E; Bailey, D; Barlow, R J; Jackson, G; Lafferty, G D; West, T J; Anderson, J; Cenci, R; Jawahery, A; Roberts, D A; Simi, G; Tuggle, J M; Dallapiccola, C; Salvati, E; Cowan, R; Dujmic, D; Fisher, P H; Sciolla, G; Zhao, M; Lindemann, D; Patel, P M; Robertson, S H; Schram, M; Biassoni, P; Lazzaro, A; Lombardo, V; Palombo, F; Stracka, S; Cremaldi, L; Godang, R; Kroeger, R; Sonnek, P; Summers, D J; Nguyen, X; Simard, M; Taras, P; De Nardo, G; Monorchio, D; Onorato, G; Sciacca, C; Raven, G; Snoek, H L; Jessop, C P; Knoepfel, K J; LoSecco, J M; Wang, W F; Corwin, L A; Honscheid, K; Kass, R; Morris, J P; Rahimi, A M; Blount, N L; Brau, J; Frey, R; Igonkina, O; Kolb, J A; Rahmat, R; Sinev, N B; Strom, D; Strube, J; Torrence, E; Castelli, G; Feltresi, E; Gagliardi, N; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Ben-Haim, E; Bonneaud, G R; Briand, H; Calderini, G; Chauveau, J; Hamon, O; Leruste, Ph; Marchiori, G; Ocariz, J; Prendki, J; Sitt, S; Biasini, M; Manoni, E; Rossi, A; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Casarosa, G; Cervelli, A; Forti, F; Giorgi, M A; Lusiani, A; Neri, N; Paoloni, E; Rizzo, G; Walsh, J J; Pegna, D Lopes; Lu, C; Olsen, J; Smith, A J S; Telnov, A V; Anulli, F; Baracchini, E; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Mazzoni, M A; Piredda, G; Renga, F; Hartmann, T; Leddig, T; Schröder, H; Waldi, R; Adye, T; Franek, B; Olaiya, E O; Wilson, F F; Emery, S; de Monchenault, G Hamel; Vasseur, G; Yèche, Ch; Zito, M; Allen, M T; Aston, D; Bard, D J; Bartoldus, R; Benitez, J F; Cartaro, C; Convery, M R; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Field, R C; Sevilla, M Franco; Fulsom, B G; Gabareen, A M; Graham, M T; Grenier, P; Hast, C; Innes, W R; Kelsey, M H; Kim, H; Kim, P; Kocian, M L; Leith, D W G S; Li, S; Lindquist, B; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Marsiske, H; Muller, D R; Neal, H; Nelson, S; O'Grady, C P; Ofte, I; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Santoro, V; Schindler, R H; Schwiening, J; Snyder, A; Su, D; Sullivan, M K; Sun, S; Suzuki, K; Thompson, J M; Va'vra, J; Wagner, A P; Weaver, M; West, C A; Wisniewski, W J; Wittgen, M; Wright, D H; Wulsin, H W; Yarritu, A K; Young, C C; Ziegler, V; Chen, X R; Park, W; Purohit, M V; White, R M; Wilson, J R; Sekula, S J; Bellis, M; Burchat, P R; Edwards, A J; Miyashita, T S; Ahmed, S; Alam, M S; Ernst, J A; Pan, B; Saeed, M A; Zain, S B; Guttman, N; Soffer, A; Lund, P; Spanier, S M; Eckmann, R; Ritchie, J L; Ruland, A M; Schilling, C J; Schwitters, R F; Wray, B C; Izen, J M; Lou, X C; Bianchi, F; Gamba, D; Pelliccioni, M; Bomben, M; Lanceri, L; Vitale, L; Lopez-March, N; Martinez-Vidal, F; Milanes, D A; Oyanguren, A; Albert, J; Banerjee, Sw; Choi, H H F; Hamano, K; King, G J; Kowalewski, R; Lewczuk, M J; Nugent, I M; Roney, J M; Sobie, R J; Gershon, T J; Harrison, P F; Latham, T E; Puccio, E M T; Band, H R; Dasu, S; Flood, K T; Pan, Y; Prepost, R; Vuosalo, C O; Wu, S L

    2011-07-22

    We report the observation of the decay B- → D(s)((*)+) K- ℓ- ν(ℓ) based on 342  fb(-1) of data collected at the Υ(4S) resonance with the BABAR detector at the PEP-II e+ e- storage rings at SLAC. A simultaneous fit to three D(s)(+) decay chains is performed to extract the signal yield from measurements of the squared missing mass in the B meson decay. We observe the decay B- → D(s)((*)+) K- ℓ- ν(ℓ) with a significance greater than 5 standard deviations (including systematic uncertainties) and measure its branching fraction to be B(B- → D(s)((*)+) K- ℓ- ν(ℓ)) = [6.13(-1.03)(+1.04)(stat)±0.43(syst)±0.51(B(D(s)))]×10(-4), where the last error reflects the limited knowledge of the D(s) branching fractions.

  8. Angiotensin II stimulates basolateral 50-pS K channels in the thick ascending limb.

    PubMed

    Wang, Mingxiao; Luan, Haiyan; Wu, Peng; Fan, Lili; Wang, Lijun; Duan, Xinpeng; Zhang, Dandan; Wang, Wen-Hui; Gu, Ruimin

    2014-03-01

    We used the patch-clamp technique to examine the effect of angiotensin II (ANG II) on the basolateral K channels in the thick ascending limb (TAL) of the rat kidney. Application of ANG II increased the channel activity and the current amplitude of the basolateral 50-pS K channel. The stimulatory effect of ANG II on the K channels was completely abolished by losartan, an inhibitor of type 1 angiotensin receptor (AT1R), but not by PD123319, an AT2R antagonist. Moreover, inhibition of phospholipase C (PLC) and protein kinase C (PKC) also abrogated the stimulatory effect of ANG II on the basolateral K channels in the TAL. This suggests that the stimulatory effect of ANG II on the K channels was induced by activating PLC and PKC pathways. Western blotting demonstrated that ANG II increased the phosphorylation of c-Src at tyrosine residue 416, an indication of c-Src activation. This effect was mimicked by PKC stimulator but abolished by calphostin C. Moreover, inhibition of NADPH oxidase (NOX) also blocked the effect of ANG II on c-Src tyrosine phosphorylation. The role of Src-family protein tyrosine kinase (SFK) in mediating the effect of ANG II on the basolateral K channel was further suggested by the experiments in which inhibition of SFK abrogated the stimulatory effect of ANG II on the basolateral 50-pS K channel. We conclude that ANG II increases basolateral 50-pS K channel activity via AT1R and that activation of AT1R stimulates SFK by a PLC-PKC-NOX-dependent mechanism.

  9. Extending Ripley’s K-Function to Quantify Aggregation in 2-D Grayscale Images

    PubMed Central

    Amgad, Mohamed; Itoh, Anri; Tsui, Marco Man Kin

    2015-01-01

    In this work, we describe the extension of Ripley’s K-function to allow for overlapping events at very high event densities. We show that problematic edge effects introduce significant bias to the function at very high densities and small radii, and propose a simple correction method that successfully restores the function’s centralization. Using simulations of homogeneous Poisson distributions of events, as well as simulations of event clustering under different conditions, we investigate various aspects of the function, including its shape-dependence and correspondence between true cluster radius and radius at which the K-function is maximized. Furthermore, we validate the utility of the function in quantifying clustering in 2-D grayscale images using three modalities: (i) Simulations of particle clustering; (ii) Experimental co-expression of soluble and diffuse protein at varying ratios; (iii) Quantifying chromatin clustering in the nuclei of wt and crwn1 crwn2 mutant Arabidopsis plant cells, using a previously-published image dataset. Overall, our work shows that Ripley’s K-function is a valid abstract statistical measure whose utility extends beyond the quantification of clustering of non-overlapping events. Potential benefits of this work include the quantification of protein and chromatin aggregation in fluorescent microscopic images. Furthermore, this function has the potential to become one of various abstract texture descriptors that are utilized in computer-assisted diagnostics in anatomic pathology and diagnostic radiology. PMID:26636680

  10. First observation of B(s)(0) --> D(s)(+/-)K(-/+) and measurement of the ratio of branching fractions B(B(s)(0) --> D(s)(+/-)K(-/+)/B(B(s)(0) --> D(s)(+)pi(-)).

    PubMed

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Copic, K; Cordelli, M; Cortiana, G; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner-Kuhr, J; Wagner, W; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zheng, Y; Zucchelli, S

    2009-11-06

    A combined mass and particle identification fit is used to make the first observation of the decay B(s)(0) --> D(s)(+/-)K(-/+) and measure the branching fraction of B(s)(0) --> D(s)(+/-)K(-/+) relative to B(s)(0) --> D(s)(+)pi(-). This analysis uses 1.2 fb(-1) integrated luminosity of pp collisions at square root(s) = 1.96 TeV collected with the CDF II detector at the Fermilab Tevatron collider. We observe a B(s)(0) --> D(s)(+/-)K(-/+) signal with a statistical significance of 8.1 sigma and measure B(B(s)(0) --> D(s)(+/-)K(-/+) /B(B(s)(0) --> D(s)(+)pi(-) 0.097+/-0.018(stat) +/- 0.009(syst).

  11. Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter.

    PubMed Central

    Kleinert, H; Benecke, B J

    1988-01-01

    We have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S1-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence. Images PMID:2450332

  12. Branching fractions of B{sup plus} {r_arrow} {Psi}(2S)K{sup plus} and B{sup O} {r_arrow} {Psi}(2S)K{sup {asterisk}0} decays at CDF

    SciTech Connect

    Warburton, A.

    1996-07-01

    This paper describes the observation of the decays B{sup {plus}} {r_arrow} {psi}(2S)K{sup {plus}} and B{sup 0} {r_arrow} {psi}(2S)K{sup {asterisk}}(892){sup 0} in 1.8 TeV p{ovr p} collisions and presents measurements of the branching fractions Br(B{sup {plus}} {r_arrow} {psi}(2S)K{sup {plus}}) and Br(B{sup 0} {r_arrow} {psi}(2S)K{sup {asterisk}}(892){sup 0}) relative to Br(B{sup {plus}} {r_arrow} J/{psi}K{sup {plus}}) and Br(B{sup 0} {r_arrow} J/{psi}K{sup {asterisk}}(892){sup 0}), respectively. The {psi}(2S) mesons are reconstructed in both the {psi}(2S) {r_arrow} {mu}{sup {plus}}{mu}{sup {minus}} and {psi}(2S) {r_arrow} J/{psi}{pi}{sup {plus}}{pi}{sup {minus}} channels. The world average branching fractions for the J/{psi} channels are used to extract the absolute branching fractions Br(B{sup {plus}} {r_arrow} {psi}(2S)K{sup {plus}}) = (6.8{plus_minus}1.0(stat.){plus_minus}1.4(syst.)){times}10{sup {minus}4} and Br(B{sup 0} {r_arrow} {psi}(2S)K{sup {asterisk}}(892){sup 0}) = (9.0{plus_minus}2.1(stat.){plus_minus}2. 0(syst.)){times}10{sup {minus}4}. 9 refs., 13 figs., 8 tabs.

  13. Study of the Rare Decays B0→D(*)+sπ- and B0→D(*)-sK+

    NASA Astrophysics Data System (ADS)

    Aubert, B.; Boutigny, D.; Gaillard, J.-M.; Hicheur, A.; Karyotakis, Y.; Lees, J. P.; Robbe, P.; Tisserand, V.; Zghiche, A.; Palano, A.; Pompili, A.; Chen, J. C.; Qi, N. D.; Rong, G.; Wang, P.; Zhu, Y. S.; Eigen, G.; Ofte, I.; Stugu, B.; Abrams, G. S.; Borgland, A. W.; Breon, A. B.; Brown, D. N.; Button-Shafer, J.; Cahn, R. N.; Charles, E.; Gill, M. S.; Gritsan, A. V.; Groysman, Y.; Jacobsen, R. G.; Kadel, R. W.; Kadyk, J.; Kerth, L. T.; Kolomensky, Yu. G.; Kral, J. F.; Leclerc, C.; Levi, M. E.; Lynch, G.; Mir, L. M.; Oddone, P. J.; Orimoto, T. J.; Pripstein, M.; Roe, N. A.; Romosan, A.; Ronan, M. T.; Shelkov, V. G.; Telnov, A. V.; Wenzel, W. A.; Harrison, T. J.; Hawkes, C. M.; Knowles, D. J.; O'Neale, S. W.; Penny, R. C.; Watson, A. T.; Watson, N. K.; Deppermann, T.; Goetzen, K.; Koch, H.; Lewandowski, B.; Peters, K.; Schmuecker, H.; Steinke, M.; Barlow, N. R.; Bhimji, W.; Boyd, J. T.; Chevalier, N.; Clark, P. J.; Cottingham, W. N.; Mackay, C.; Wilson, F. F.; Abe, K.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Thiessen, D.; Jolly, S.; McKemey, A. K.; Blinov, V. E.; Bukin, A. D.; Buzykaev, A. R.; Golubev, V. B.; Ivanchenko, V. N.; Korol, A. A.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Yushkov, A. N.; Best, D.; Chao, M.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; McMahon, S.; Stoker, D. P.; Buchanan, C.; Chun, S.; Hadavand, H. K.; Hill, E. J.; Macfarlane, D. B.; Paar, H.; Prell, S.; Rahatlou, Sh.; Raven, G.; Schwanke, U.; Sharma, V.; Berryhill, J. W.; Campagnari, C.; Dahmes, B.; Hart, P. A.; Kuznetsova, N.; Levy, S. L.; Long, O.; Lu, A.; Mazur, M. A.; Richman, J. D.; Verkerke, W.; Beringer, J.; Eisner, A. M.; Grothe, M.; Heusch, C. A.; Lockman, W. S.; Pulliam, T.; Schalk, T.; Schmitz, R. E.; Schumm, B. A.; Seiden, A.; Turri, M.; Walkowiak, W.; Williams, D. C.; Wilson, M. G.; Chen, E.; Dubois-Felsmann, G. P.; Dvoretskii, A.; Hitlin, D. G.; Porter, F. C.; Ryd, A.; Samuel, A.; Yang, S.; Jayatilleke, S.; Mancinelli, G.; Meadows, B. T.; Sokoloff, M. D.; Barillari, T.; Bloom, P.; Ford, W. T.; Nauenberg, U.; Olivas, A.; Rankin, P.; Roy, J.; Smith, J. G.; van Hoek, W. C.; Zhang, L.; Harton, J. L.; Hu, T.; Krishnamurthy, M.; Soffer, A.; Toki, W. H.; Wilson, R. J.; Zhang, J.; Altenburg, D.; Brandt, T.; Brose, J.; Colberg, T.; Dickopp, M.; Dubitzky, R. S.; Hauke, A.; Maly, E.; Müller-Pfefferkorn, R.; Otto, S.; Schubert, K. R.; Schwierz, R.; Spaan, B.; Wilden, L.; Bernard, D.; Bonneaud, G. R.; Brochard, F.; Cohen-Tanugi, J.; Ferrag, S.; T'jampens, S.; Thiebaux, Ch.; Vasileiadis, G.; Verderi, M.; Anjomshoaa, A.; Bernet, R.; Khan, A.; Lavin, D.; Muheim, F.; Playfer, S.; Swain, J. E.; Tinslay, J.; Falbo, M.; Borean, C.; Bozzi, C.; Piemontese, L.; Sarti, A.; Treadwell, E.; Anulli, F.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Falciai, D.; Finocchiaro, G.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Zallo, A.; Bagnasco, S.; Buzzo, A.; Contri, R.; Crosetti, G.; Lo Vetere, M.; Macri, M.; Monge, M. R.; Passaggio, S.; Pastore, F. C.; Patrignani, C.; Robutti, E.; Santroni, A.; Tosi, S.; Bailey, S.; Morii, M.; Bartoldus, R.; Grenier, G. J.; Mallik, U.; Cochran, J.; Crawley, H. B.; Lamsa, J.; Meyer, W. T.; Rosenberg, E. I.; Yi, J.; Davier, M.; Grosdidier, G.; Höcker, A.; Lacker, H. M.; Laplace, S.; Le Diberder, F.; Lepeltier, V.; Lutz, A. M.; Petersen, T. C.; Plaszczynski, S.; Schune, M. H.; Tantot, L.; Trincaz-Duvoid, S.; Wormser, G.; Bionta, R. M.; Brigljević, V.; Lange, D. J.; van Bibber, K.; Wright, D. M.; Bevan, A. J.; Fry, J. R.; Gabathuler, E.; Gamet, R.; George, M.; Kay, M.; Payne, D. J.; Sloane, R. J.; Touramanis, C.; Aspinwall, M. L.; Bowerman, D. A.; Dauncey, P. D.; Egede, U.; Eschrich, I.; Morton, G. W.; Nash, J. A.; Sanders, P.; Smith, D.; Taylor, G. P.; Back, J. J.; Bellodi, G.; Dixon, P.; Harrison, P. F.; Potter, R. J.; Shorthouse, H. W.; Strother, P.; Vidal, P. B.; Cowan, G.; Flaecher, H. U.; George, S.; Green, M. G.; Kurup, A.; Marker, C. E.; McMahon, T. R.; Ricciardi, S.; Salvatore, F.; Vaitsas, G.; Winter, M. A.; Brown, D.; Davis, C. L.; Allison, J.; Barlow, R. J.; Forti, A. C.; Jackson, F.; Lafferty, G. D.; Lyon, A. J.; Savvas, N.; Weatherall, J. H.; Williams, J. C.; Farbin, A.; Jawahery, A.; Lillard, V.; Roberts, D. A.; Schieck, J. R.; Blaylock, G.; Dallapiccola, C.; Flood, K. T.; Hertzbach, S. S.; Kofler, R.; Koptchev, V. B.; Moore, T. B.; Staengle, H.; Willocq, S.; Brau, B.; Cowan, R.; Sciolla, G.; Taylor, F.; Yamamoto, R. K.; Milek, M.; Patel, P. M.; Palombo, F.; Bauer, J. M.; Cremaldi, L.; Eschenburg, V.; Kroeger, R.; Reidy, J.; Sanders, D. A.; Summers, D. J.; Hast, C.; Taras, P.; Nicholson, H.; Cartaro, C.; Cavallo, N.; de Nardo, G.; Fabozzi, F.; Gatto, C.; Lista, L.; Paolucci, P.; Piccolo, D.; Sciacca, C.; Losecco, J. M.; Alsmiller, J. R.; Gabriel, T. A.; Brau, J.; Frey, R.; Iwasaki, M.; Potter, C. T.; Sinev, N. B.; Strom, D.; Torrence, E.; Colecchia, F.; Dorigo, A.; Galeazzi, F.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Voci, C.; Benayoun, M.; Briand, H.; Chauveau, J.; David, P.; de La Vaissière, Ch.; del Buono, L.; Hamon, O.; Leruste, Ph.; Ocariz, J.; Pivk, M.; Roos, L.; Stark, J.; Manfredi, P. F.; Re, V.; Speziali, V.; Gladney, L.; Guo, Q. H.; Panetta, J.; Angelini, C.; Batignani, G.; Bettarini, S.; Bondioli, M.; Bucci, F.; Calderini, G.; Campagna, E.; Carpinelli, M.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Marchiori, G.; Martinez-Vidal, F.; Morganti, M.; Neri, N.; Paoloni, E.; Rama, M.; Rizzo, G.; Sandrelli, F.; Triggiani, G.; Walsh, J.; Haire, M.; Judd, D.; Paick, K.; Turnbull, L.; Wagoner, D. E.; Albert, J.; Danielson, N.; Elmer, P.; Lu, C.; Miftakov, V.; Olsen, J.; Schaffner, S. F.; Smith, A. J.; Tumanov, A.; Varnes, E. W.; Bellini, F.; Cavoto, G.; del Re, D.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Leonardi, E.; Mazzoni, M. A.; Morganti, S.; Piredda, G.; Tehrani, F. Safai; Serra, M.; Voena, C.; Christ, S.; Wagner, G.; Waldi, R.; Adye, T.; de Groot, N.; Franek, B.; Geddes, N. I.; Gopal, G. P.; Xella, S. M.; Aleksan, R.; Emery, S.; Gaidot, A.; Giraud, P.-F.; Hamel de Monchenault, G.; Kozanecki, W.; Langer, M.; London, G. W.; Mayer, B.; Schott, G.; Serfass, B.; Vasseur, G.; Yeche, Ch.; Zito, M.; Purohit, M. V.; Weidemann, A. W.; Yumiceva, F. X.; Adam, I.; Aston, D.; Berger, N.; Boyarski, A. M.; Convery, M. R.; Coupal, D. P.; Dong, D.; Dorfan, J.; Dunwoodie, W.; Field, R. C.; Glanzman, T.; Gowdy, S. J.; Grauges, E.; Haas, T.; Hadig, T.; Halyo, V.; Himel, T.; Hryn'ova, T.; Huffer, M. E.; Innes, W. R.; Jessop, C. P.; Kelsey, M. H.; Kim, P.; Kocian, M. L.; Langenegger, U.; Leith, D. W.; Luitz, S.; Luth, V.; Lynch, H. L.; Marsiske, H.; Menke, S.; Messner, R.; Muller, D. R.; O'Grady, C. P.; Ozcan, V. E.; Perazzo, A.; Perl, M.; Petrak, S.; Quinn, H.; Ratcliff, B. N.; Robertson, S. H.; Roodman, A.; Salnikov, A. A.; Schietinger, T.; Schindler, R. H.; Schwiening, J.; Simi, G.; Snyder, A.; Soha, A.; Spanier, S. M.; Stelzer, J.; Su, D.; Sullivan, M. K.; Tanaka, H. A.; Va'Vra, J.; Wagner, S. R.; Weaver, M.; Weinstein, A. J.; Wisniewski, W. J.; Wright, D. H.; Young, C. C.; Burchat, P. R.; Cheng, C. H.; Meyer, T. I.; Roat, C.; Henderson, R.; Bugg, W.; Cohn, H.; Izen, J. M.; Kitayama, I.; Lou, X. C.; Bianchi, F.; Bona, M.; Gamba, D.; Bosisio, L.; della Ricca, G.; Dittongo, S.; Lanceri, L.; Poropat, P.; Vitale, L.; Vuagnin, G.; Panvini, R. S.; Banerjee, Sw.; Brown, C. M.; Fortin, D.; Jackson, P. D.; Kowalewski, R.; Roney, J. M.; Band, H. R.; Dasu, S.; Datta, M.; Eichenbaum, A. M.; Hu, H.; Johnson, J. R.; Liu, R.; Lodovico, F. Di; Mohapatra, A.; Pan, Y.; Prepost, R.; Scott, I. J.; Sekula, S. J.; von Wimmersperg-Toeller, J. H.; Wu, J.; Wu, S. L.; Yu, Z.; Neal, H.

    2003-05-01

    We report evidence for the decays B0→D+sπ- and B0→D-sK+ and the results of a search for B0→D*+sπ- and B0→D*-sK+ in a sample of 84×106 ϒ(4S) decays into BB¯ pairs collected with the BABAR detector at the PEP-II asymmetric-energy e+e- storage ring. We measure the branching fractions B(B0→D+sπ-)=[3.2±0.9(stat)±1.0(syst)]×10-5 and B(B0→D-sK+)=[3.2±1.0(stat)±1.0(syst)]×10-5. We also set 90% C.L. limits B(B0→D*+sπ-)<4.1×10-5 and B(B0→D*-sK+)<2.5×10-5.

  14. 17 CFR 240.15d-18 - Compliance with servicing criteria for asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...)). Terms used in this section have the same meaning as in Item 1101 of Regulation AB (§ 229.1101 of this... compliance with the servicing criteria specified in paragraph (d) of Item 1122 of Regulation AB (§ 229.1122(d... of Regulation AB (§ 229.1122(d) of this chapter), unless such entity's activities relate only to...

  15. 17 CFR 240.15d-18 - Compliance with servicing criteria for asset-backed securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...)). Terms used in this section have the same meaning as in Item 1101 of Regulation AB (§ 229.1101 of this... compliance with the servicing criteria specified in paragraph (d) of Item 1122 of Regulation AB (§ 229.1122(d... of Regulation AB (§ 229.1122(d) of this chapter), unless such entity's activities relate only to...

  16. 17 CFR 240.13a-18 - Compliance with servicing criteria for asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...)). Terms used in this section have the same meaning as in Item 1101 of Regulation AB (§ 229.1101 of this... compliance with the servicing criteria specified in paragraph (d) of Item 1122 of Regulation AB (§ 229.1122(d... of Regulation AB (§ 229.1122(d) of this chapter), unless such entity's activities relate only to...

  17. 17 CFR 240.13a-18 - Compliance with servicing criteria for asset-backed securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...)). Terms used in this section have the same meaning as in Item 1101 of Regulation AB (§ 229.1101 of this... compliance with the servicing criteria specified in paragraph (d) of Item 1122 of Regulation AB (§ 229.1122(d... of Regulation AB (§ 229.1122(d) of this chapter), unless such entity's activities relate only to...

  18. 17 CFR 270.3a-7 - Issuers of asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... sale, in one of the four highest categories assigned long-term debt or in an equivalent short-term...) Eligible assets means financial assets, either fixed or revolving, that by their terms convert into cash... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Issuers of...

  19. 17 CFR 230.139a - Publications by brokers or dealers distributing asset-backed securities.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... meeting the criteria of General Instruction I.B.5 of Form S-3 (§ 239.13 of this chapter) (“S-3 ABS”) shall not be deemed to constitute an offer for sale or offer to sell S-3 ABS registered or proposed to be... ABS backed directly (or, with respect to securitizations of other securities, indirectly)...

  20. 17 CFR 230.139a - Publications by brokers or dealers distributing asset-backed securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... meeting the criteria of General Instruction I.B.5 of Form S-3 (§ 239.13 of this chapter) (“S-3 ABS”) shall not be deemed to constitute an offer for sale or offer to sell S-3 ABS registered or proposed to be... ABS backed directly (or, with respect to securitizations of other securities, indirectly)...

  1. 17 CFR 230.139a - Publications by brokers or dealers distributing asset-backed securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... meeting the criteria of General Instruction I.B.5 of Form S-3 (§ 239.13 of this chapter) (“S-3 ABS”) shall not be deemed to constitute an offer for sale or offer to sell S-3 ABS registered or proposed to be... ABS backed directly (or, with respect to securitizations of other securities, indirectly)...

  2. 17 CFR 230.139a - Publications by brokers or dealers distributing asset-backed securities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... meeting the criteria of General Instruction I.B.5 of Form S-3 (§ 239.13 of this chapter) (“S-3 ABS”) shall not be deemed to constitute an offer for sale or offer to sell S-3 ABS registered or proposed to be... ABS backed directly (or, with respect to securitizations of other securities, indirectly)...

  3. 17 CFR 230.139a - Publications by brokers or dealers distributing asset-backed securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... meeting the criteria of General Instruction I.B.5 of Form S-3 (§ 239.13 of this chapter) (“S-3 ABS”) shall not be deemed to constitute an offer for sale or offer to sell S-3 ABS registered or proposed to be... ABS backed directly (or, with respect to securitizations of other securities, indirectly)...

  4. 75 FR 64182 - Issuer Review of Assets in Offerings of Asset-Backed Securities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-19

    ... proposing new requirements in order to implement Section 945 and a portion of Section 932 of the Dodd-Frank...,\\9\\ which was added by Section 945 of the Act. In addition, we are proposing a new rule and form to...). Section 945 of the Act amends Section 7 of the Securities Act to require the Commission to issue...

  5. 76 FR 4231 - Issuer Review of Assets in Offerings of Asset-Backed Securities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-25

    ... requirements in order to implement Section 945 of the Dodd-Frank Wall Street Reform and Consumer Protection Act... October 13, 2010, we proposed new requirements in order to implement Section 945 and a portion of Section 932 of the Dodd-Frank Act.\\5\\ As discussed in the Proposing Release, Section 945 of the Act...

  6. 17 CFR 270.3a-7 - Issuers of asset-backed securities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Securities Act by section 3(a)(3) thereof (15 U.S.C. 77c(a)(3)), the issuer: (i) Appoints a trustee that... at least one nationally recognized statistical rating organization that is not an affiliated person... persons (other than any rating organization rating the issuer's securities) involved in the...

  7. Acute application of TNF stimulates apical 70-pS K+ channels in the thick ascending limb of rat kidney.

    PubMed

    Wei, Yuan; Babilonia, Elisa; Pedraza, Paulina L; Ferreri, Nicholas R; Wang, Wen-Hui

    2003-09-01

    TNF has been shown to be synthesized by the medullary thick ascending limb (mTAL) (21). In the present study, we used the patch-clamp technique to study the acute effect of TNF on the apical 70-pS K+ channel in the mTAL. Addition of TNF (10 nM) significantly stimulated activity of the 70-pS K+ channel and increased NPo [a product of channel open probability (Po) and channel number (N)] from 0.20 to 0.97. The stimulatory effect of TNF was observed only in cell-attached patches but not in excised patches. Moreover, addition of TNF had no effect on the ROMK-like small-conductance K+ channels in the TAL. The dose-response curve of the TNF effect yielded a Km value of 1 nM, a concentration that increased channel activity to 50% maximal stimulatory effect of TNF. The concentrations required for reaching the plateau of the TNF effect were between 5 and 10 nM. The stimulatory effect of TNF on the 70-pS K+ channel was observed in the presence of N(omega)-nitro-L-arginine methyl ester. This indicated that the effect of TNF was not mediated by a nitric oxide-dependent pathway. Also, inhibition of PKA did not affect the stimulatory effect of TNF. In contrast, inhibition of protein tyrosine kinase not only increased activity of the 70-pS K+ channel but also abolished the effect of TNF. Moreover, inhibition of protein tyrosine phosphatase (PTP) blocked the stimulatory effect of TNF on the 70-pS K+ channel. The notion that the TNF effect results from stimulation of PTP activity is supported by PTP activity assay in which treatment of mTAL cells with TNF significantly increased the activity of PTP. We conclude that TNF stimulates the 70-pS K+ channel via stimulation of PTP in the mTAL.

  8. Determining the Sulfur species in the dispersants Corexit 9500A and 9527A applying S K-edge XANES spectroscopy

    NASA Astrophysics Data System (ADS)

    Bovenkamp-Langlois, Lisa; Roy, Amitava

    2016-05-01

    The dispersants Corexit 9500A and 9527A were used extensively during the Deepwater Horizon oil spill in the Gulf of Mexico. Sulfur K-edge X-ray absorption near edge structure (XANES) spectroscopy was used to investigate the dispersants for the sulfur based components. The main sulfur containing component should be dioctyl sodium sulfosuccinate (DOSS). S K-edge XANES analysis shows that indeed the major sulfur species in both kinds of Corexit (9500A and 9527A) is sulfonic acid which is a part of DOSS. In addition some fraction of sulfone was detected.

  9. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and other... external credit enhancement or other support, other than those described in Item 1115 of this Regulation...

  10. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and other... external credit enhancement or other support, other than those described in Item 1115 of this Regulation...

  11. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and other... external credit enhancement or other support, other than those described in Item 1115 of this Regulation...

  12. From laboratory to pilot plant: the solid-state process development of a highly potent cathepsin S/K inhibitor.

    PubMed

    Feth, Martin Philipp; Heyse, Winfried; Baumgartner, Bruno; Nagel, Norbert; Tappertzhofen, Christoph; Olpp, Thomas; Jurascheck, Jörg; Ulrich, Joachim; Helmdach, Lydia; Petzoldt, Christine

    2013-04-01

    The solid-state development for the low dose drug molecule SAR114137, a selective and reversible inhibitor of cysteine cathepsin S/K, is reported. Six polymorphic forms as well as various solvate phases were discovered by an extensive polymorphism screening. The solid phase characterizations revealed that phase 1, from which a single crystal structure could be obtained, is the thermodynamically most stable form and therefore it was chosen for pharmaceutical development. The successful scale-up from development laboratory into pilot plant for the crystallization and drying processes is presented. Testing of different drying techniques, like agitated drying in conical or filter dryers as well as spray drying, proved them to be very promising alternatives to the conventional tray drying process and might be used during the industrialization phase of the project. The use of online analytical tools (e.g., Raman spectroscopy) for a better process understanding and as tools for process optimization is shown. Furthermore, wet milling by ultrasound was performed on laboratory scale and discussed as potential option to reach the desired particle size distribution necessary for a good content uniformity of the API in an oral formulation.

  13. Training Assistants for Special Kids T.A.S.K.: Training for Paraprofessional Personnel for Work with Moderately/Severely/Profoundly/Multi-Handicapped Youngsters.

    ERIC Educational Resources Information Center

    Indianapolis Public Schools, IN.

    Presented is a training program for paraprofessional personnel serving as classroom assistants with multi-handicapped mentally handicapped school-age children. It is noted that this model training packet, T.A.S.K. (Training Assistants for Special Kids) was developed by Cold Spring School, Indianapolis, Indiana, for training of their special…

  14. The State of Wiki Usage in U.S. K-12 Schools: Leveraging Web 2.0 Data Warehouses to Study Quality and Equality in Online Learning Environments

    ERIC Educational Resources Information Center

    Reich, Blair Justin Fire

    2012-01-01

    In the first part of this dissertation, I document wiki usage in U.S. K-12 settings by analyzing data on a representative sample drawn from a population of nearly 180,000 wikis. My research group, which I lead and managed, measured the opportunities wikis provide for students to develop 21st century skills such as expert thinking, complex…

  15. The State of Wiki Usage in U.S. K-12 Schools: Leveraging Web 2.0 Data Warehouses to Assess Quality and Equity in Online Learning Environments

    ERIC Educational Resources Information Center

    Reich, Justin; Murnane, Richard; Willett, John

    2012-01-01

    To document wiki usage in U.S. K-12 settings, this study examined a representative sample drawn from a population of nearly 180,000 wikis. The authors measured the opportunities wikis provide for students to develop 21st-century skills such as expert thinking, complex communication, and new media literacy. The authors found four types of wiki…

  16. 76 FR 4489 - Disclosure for Asset-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-26

    ...-stocks-rise-after-bank-of-america-settles-mortgage-putback-claims.html (noting recent settlements of... Exchange- Act ABS such as student loan bonds, housing and mortgage bonds, bond- bank issuances,...

  17. 17 CFR 230.167 - Communications in connection with certain registered offerings of asset-backed securities.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... § 230.415, ABS informational and computational material regarding such securities used after the... number for the related registration statement; (iii) A statement that such communication is ABS informational and computational material used in reliance on Securities Act Rule 167 (§ 230.167); and (iv)...

  18. 17 CFR 230.167 - Communications in connection with certain registered offerings of asset-backed securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... § 230.415, ABS informational and computational material regarding such securities used after the... number for the related registration statement; (iii) A statement that such communication is ABS informational and computational material used in reliance on Securities Act Rule 167 (§ 230.167); and (iv)...

  19. 17 CFR 230.167 - Communications in connection with certain registered offerings of asset-backed securities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... § 230.415, ABS informational and computational material regarding such securities used after the... number for the related registration statement; (iii) A statement that such communication is ABS informational and computational material used in reliance on Securities Act Rule 167 (§ 230.167); and (iv)...

  20. 75 FR 65442 - Disclosure for Asset-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-25

    ... Securities Required by Section 943 of the Dodd-Frank Wall Street Reform and Consumer Protection Act AGENCY...-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street Reform and Consumer Protection... Exchange Commission, 100 F Street, NE., Washington, DC 20549-3628 or, with respect to proposed Rule...

  1. 75 FR 62718 - Disclosure for Asset-Backed Securities Required by Section 943 of the Dodd-Frank Wall Street...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-13

    ... regarding the representations, warranties and enforcement mechanisms available to investors in an asset... offering, a description of (A) the representations, warranties and enforcement mechanisms available to investors; and (B) how they differ from the representations, warranties and enforcement mechanisms...

  2. Resolving the sign ambiguity in {delta}{gamma}{sub s} with B{sub s}{yields}D{sub s}K

    SciTech Connect

    Nandi, Soumitra; Nierste, Ulrich

    2008-03-01

    The analysis of tagged B{sub s}{yields}J/{psi}{phi} decays determines the CP phase {phi}{sub s} in B{sub s}-B{sub s} mixing with a twofold ambiguity. The solutions differ in the sign of cos{phi}{sub s} which equals the sign of the width difference {delta}{gamma}{sub s} among the two B{sub s} mass eigenstates. We point out that this ambiguity can be removed with the help of B{sub s}{yields}D{sub s}K decays. We compare untagged and tagged strategies and find the tagged analysis more promising. The removal of the sign ambiguity in {delta}{gamma}{sub s} can be done with relatively low statistics and could therefore be a target for the early stage of B{sub s}{yields}D{sub s}K studies.

  3. Branching fractions and CP asymmetries in B0-->K+ K- K0 S and B+-->K+ K0 S K0 S.

    PubMed

    Aubert, B; Barate, R; Boutigny, D; Couderc, F; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Ronan, M T; Shelkov, V G; Wenzel, W A; Barrett, M; Ford, K E; Harrison, T J; Hart, A J; Hawkes, C M; Morgan, S E; Watson, A T; Fritsch, M; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Steinke, M; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Wilson, F F; Cuhadar-Donszelmann, T; Hearty, C; Knecht, N S; Mattison, T S; McKenna, J A; Thiessen, D; Khan, A; Kyberd, P; Teodorescu, L; Blinov, V E; Druzhinin, V P; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Eschrich, I; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Foulkes, S D; Gary, J W; Shen, B C; Wang, K; del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Eisner, A M; Heusch, C A; Lockman, W S; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spradlin, P; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Smith, J G; Zhang, J; Zhang, L; Chen, A; Harton, J L; Soffer, A; Toki, W H; Wilson, R J; Zeng, Q L; Altenburg, D; Brandt, T; Brose, J; Dickopp, M; Feltresi, E; Hauke, A; Lacker, H M; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Petzold, A; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Sundermann, J E; Bernard, D; Bonneaud, G R; Brochard, F; Grenier, P; Schrenk, S; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Bard, D J; Clark, P J; Lavin, D; Muheim, F; Playfer, S; Xie, Y; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Patteri, P; Piccolo, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Brandenburg, G; Morii, M; Won, E; Dubitzky, R S; Langenegger, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Gaillard, J R; Morton, G W; Nash, J A; Taylor, G P; Charles, M J; Grenier, G J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Cheng, C H; Lange, D J; Simani, M C; Wright, D M; Bevan, A J; Chavez, C A; Coleman, J P; Forster, I J; Fry, J R; Gabathuler, E; Gamet, R; Parry, R J; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Cormack, C M; Harrison, P F; Di Lodovico, F; Mohanty, G B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; Green, M G; Jackson, P S; McMahon, T R; Ricciardi, S; Salvatore, F; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Hart, P A; Hodgkinson, M C; Lafferty, G D; Lyon, A J; Williams, J C; Farbin, A; Hulsbergen, W D; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Patel, P M; Robertson, S H; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Côté, D; Taras, P; Nicholson, H; Cavallo, N; Fabozzi, F; Gatto, C; Lista, L; Monorchio, D; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M; Bulten, H; Raven, G; Wilden, L; Jessop, C P; LoSecco, J M; Gabriel, T A; Allmendinger, T; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Rahimi, A M; Ter-Antonyan, R; Wong, Q K; Brau, J; Frey, R; Igonkina, O; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Malcles, J; Ocariz, J; Pivk, M; Roos, L; T'Jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Anulli, F; Biasini, M; Peruzzi, I M; Pioppi, M; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Del Gamba, V; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lau, Y P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Telnov, A V; Bellini, F; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yèche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Wilson, J R; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Convery, M R; Cristinziani, M; De Nardo, G; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Elsen, E E; Fan, S; Field, R C; Glanzman, T; Gowdy, S J; Hadig, T; Halyo, V; Hast, C; Hryn'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Libby, J; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wittgen, M; Wright, D H; Yarritu, A K; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, S; Alam, M S; Ernst, J A; Saeed, M A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Satpathy, A; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Cartaro, C; Cossutti, F; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Graham, M; Hollar, J J; Johnson, J R; Kutter, P E; Li, H; Liu, R; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Rubin, A E; Sekula, S J; Tan, P; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Greene, M G; Neal, H

    2004-10-29

    We measure the branching fractions and CP asymmetries in the decays B0-->K(+)K(-)K(0)(S) and B+-->K(+)K(0)(S)K(0)(S) using a sample of approximately 122x10(6) BB pairs collected by the BABAR detector. From a time-dependent analysis of the K(+)K(-)K(0)(S) sample that excludes phiK(0)(S), the values of the CP-violation parameters are S=-0.56+/-0.25+/-0.04 and C=-0.10+/-0.19+/-0.10, where the first uncertainty is statistical and the second is systematic. We confirm that the final state is nearly purely CP even and extract the standard model parameter sin(2beta=0.57+/-0.26+/-0.04(+0.17)(-0) where the last error is due to uncertainty on the CP content. We present the first measurement of the CP-violating charge asymmetry A(CP)(B+-->K(+)K(0)(S)K(0)(S))=-0.04+/-0.11+/-0.02. The branching fractions are B(B0-->K+K-K0)=(23.8+/-2.0+/-1.6)x10(-6) and B(B+-->K(+)K(0)(S)K(0)(S))=(10.7+/-1.2+/-1.0)x10(-6).

  4. In situ S-K XANES study of polymer electrolyte fuel cells: changes in the chemical states of sulfonic groups depending on humidity.

    PubMed

    Isegawa, Kazuhisa; Nagami, Tetsuo; Jomori, Shinji; Yoshida, Masaaki; Kondoh, Hiroshi

    2016-09-14

    Changes in the chemical states of sulfonic groups of Nafion in polymer electrolyte fuel cells (PEFCs) under gas-flowing conditions were studied using in situ S-K XANES spectroscopy. The applied potential to the electrodes and the humidity of the cell were changed under flowing H2 gas in the anode and He gas in the cathode. While the potential shows no significant effect on the S-K XANES spectra, the humidity is found to induce reversible changes in the spectra. Comparison of the spectral changes with simulations based on the density functional theory calculations indicates that the humidity influences the chemical state of the sulfonic group; under wet conditions the sulfonic group is in the form of a sulfonate ion. By drying treatment the sulfonate ion binds to hydrogen and becomes sulfonic acid. Furthermore, a small fraction of the sulfonic acid irreversibly decomposes to atomic sulfur. The peak energy of the atomic sulfur suggests that the generated atomic sulfur is adsorbed on the Pt catalyst surfaces.

  5. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... geothermal steam or water, need not include such disclosure. (b) To the extent that Items 1202 through...

  6. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... geothermal steam or water, need not include such disclosure. (b) To the extent that Items 1202 through...

  7. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... geothermal steam or water, need not include such disclosure. (b) To the extent that Items 1202 through...

  8. 17 CFR 229.1204 - (Item 1204) Oil and gas production, production prices and production costs.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... before royalty” production figures are furnished, the change from the usage of “net production” should...

  9. 17 CFR 229.1204 - (Item 1204) Oil and gas production, production prices and production costs.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... before royalty” production figures are furnished, the change from the usage of “net production” should...

  10. 17 CFR 229.702 - (Item 702) Indemnification of directors and officers.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Miscellaneous § 229.702 (Item 702) Indemnification of directors and officers. State the general effect of any statute, charter provisions,...

  11. 17 CFR 229.702 - (Item 702) Indemnification of directors and officers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Miscellaneous § 229.702 (Item 702) Indemnification of directors and officers. State the general effect of any statute, charter provisions,...

  12. 17 CFR 229.308 - (Item 308) Internal control over financial reporting.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Financial Information... reporting or an attestation report of the company's registered public accounting firm due to a...

  13. 17 CFR 229.308T - (Item 308T) Internal control over financial reporting.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Financial Information... firm due to a transition period established by rules of the Securities and Exchange Commission...

  14. First observation of the decay $\\bar{B}$$0\\atop{s}$ →; D$+\\atop{s}$ K and measurement of B($\\bar{B}$$0\\atop{s}$ →; D$±\\atop{s}$K)/Br($\\bar{B}$$0\\atop{s}$→; D$+\\atop{s}$ π-)

    SciTech Connect

    Muelmenstaedt, Johannes

    2007-01-01

    We present the first observation of the decay $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ K and measure the relative branching fraction of $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ K to $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ π-. The measurement of the relative branching fraction is performed by applying a fit in invariant mass and specific ionization to 1.2 fb-1 of Ds(φπ)X data collected with the CDF II detector in pp collisions at √s = 1.96 TeV at the Fermilab Tevatron collider. We measure B($\\bar{B}$$0\\atop{s}$ → D± s K∓¢/B($\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ π-) = 0.107±0.019(stat)±0.008(sys). The statistical significance of the $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ K signal is 7.9σ. To cross-check our analysis method, we also measure B($\\bar{B0}$ → D+K-)/B($\\bar{B0}$ → D+π-) and B($\\bar{B0}$ → D*+K-)/B($\\bar{B0}$ → D*+π-) and verify that our results are in agreement with the world average.

  15. Solvation Effects on S K-edge XAS Spectra of Fe-S Proteins: Normal and Inverse Effects on WT and Mutant Rubredoxin

    PubMed Central

    Sun, Ning; Dey, Abhishek; Xiao, Zhiguang; Wedd, Anthony G.; Hodgson, Keith O.; Hedman, Britt; Solomon, Edward I.

    2010-01-01

    S K-edge X-ray Absorption Spectroscopy (XAS) was performed on wild type Cp rubredoxin and its Cys->Ser mutants in both solution and lyophilized forms. For wild type rubredoxin and for the mutants where an interior cysteine residue (C6 or C39) is substituted by serine, a normal solvent effect is observed, that is, the S covalency increases upon lyophilization. For the mutants where a solvent accessible surface cysteine residue is substituted by serine, the S covalency decreases upon lyophilization which is an inverse solvent effect. Density functional theory (DFT) calculations reproduce these experimental results and show that the normal solvent effect reflects the covalency decrease due to solvent H-bonding to the surface thiolates and that the inverse solvent effect results from the covalency compensation from the interior thiolates. With respect to the Cys->Ser substitution, the S covalency decreases. Calculations indicate that the stronger bonding interaction of the alkoxide with the Fe relative to that of thiolate increases the energy of the Fe d orbitals and reduces their bonding interaction with the remaining cysteines. The solvent effects support a surface solvent tuning contribution to electron transfer and the Cys->Ser result provides an explanation for the change in properties of related iron-sulfur sites with this mutation. PMID:20726554

  16. 17 CFR 229.1102 - (Item 1102) Forepart of registration statement and outside cover page of the prospectus.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1102 (Item 1102) Forepart of registration... provider referenced in Items 1114(b) or 1115 of this Regulation AB. Instruction to Item 1102: Also see Item 1113(f)(2) of this Regulation AB regarding the title of any class of securities with an...

  17. 17 CFR 229.1102 - (Item 1102) Forepart of registration statement and outside cover page of the prospectus.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1102 (Item 1102) Forepart of registration... provider referenced in Items 1114(b) or 1115 of this Regulation AB. Instruction to Item 1102: Also see Item 1113(f)(2) of this Regulation AB regarding the title of any class of securities with an...

  18. 17 CFR 229.1102 - (Item 1102) Forepart of registration statement and outside cover page of the prospectus.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1102 (Item 1102) Forepart of registration... provider referenced in Items 1114(b) or 1115 of this Regulation AB. Instruction to Item 1102: Also see Item 1113(f)(2) of this Regulation AB regarding the title of any class of securities with an...

  19. 17 CFR 229.1102 - (Item 1102) Forepart of registration statement and outside cover page of the prospectus.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1102 (Item 1102) Forepart of registration... provider referenced in Items 1114(b) or 1115 of this Regulation AB. Instruction to Item 1102: Also see Item 1113(f)(2) of this Regulation AB regarding the title of any class of securities with an...

  20. 17 CFR 229.1102 - (Item 1102) Forepart of registration statement and outside cover page of the prospectus.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1102 (Item 1102) Forepart of registration... provider referenced in Items 1114(b) or 1115 of this Regulation AB. Instruction to Item 1102: Also see Item 1113(f)(2) of this Regulation AB regarding the title of any class of securities with an...

  1. 76 FR 2049 - Suspension of the Duty To File Reports for Classes of Asset-Backed Securities Under Section 15(d...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-12

    ... any additional benefits and costs. VII. Consideration of Burden on Competition and Promotion of... or more; A major increase in costs or prices for consumers or individual industries; or Significant...; Any potential increase in costs or prices for consumers or individual industries; and Any...

  2. 76 FR 52549 - Suspension of the Duty To File Reports for Classes of Asset-Backed Securities Under Section 15(D...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-23

    ...- backed securities (``ABS'') issuers and granted the Commission the authority to issue rules providing for... the suspension of reporting obligations for ABS issuers under certain circumstances and to revise our... persons. As a result, the reporting obligations of ABS issuers,\\8\\ other than those with master...

  3. Using Solution- and Solid-State S K-edge X-ray Absorption Spectroscopy with Density Functional Theory to Evaluate M–S Bonding for MS42- (M = Cr, Mo, W) Dianions

    PubMed Central

    Olson, Angela C.; Keith, Jason M.; Batista, Enrique R.; Boland, Kevin S.; Daly, Scott R.; Kozimor, Stosh A.; MacInnes, Molly M.; Martin, Richard L.; Scott, Brian L.

    2014-01-01

    Herein, we have evaluated relative changes in M–S electronic structure and orbital mixing in Group 6 MS42- dianions using solid- and solution-phase S K-edge X-ray absorption spectroscopy (XAS; M = Mo, W), as well as density functional theory (DFT; M = Cr, Mo, W) and time-dependent density functional theory (TDDFT) calculations. To facilitate comparison with solution measurements (conducted in acetonitrile), theoretical models included gas-phase calculations as well as those that incorporated an acetonitrile dielectric, the latter of which provided better agreement with experiment. Two pre-edge features arising from S 1s → e* and t2* electron excitations were observed in the S K-edge XAS spectra and were reasonably assigned as 1A1 → 1T2 transitions. For MoS42-, both solution-phase pre-edge peak intensities were consistent with results from the solid-state spectra. For WS42-, solution- and solid-state pre-edge peak intensities for transitions involving e* were equivalent, while transitions involving the t2* orbitals were less intense in solution. Experimental and computational results have been presented in comparison to recent analyses of MO42- dianions, which allowed M–S and M–O orbital mixing to be evaluated as the principle quantum number (n) for the metal valence d orbitals increased (3d, 4d, 5d). Overall, the M–E (E = O, S) analyses revealed distinct trends in orbital mixing. For example, as the Group 6 triad was descended, e* (π*) orbital mixing remained constant in the M–S bonds, but increased appreciably for M–O interactions. For the t2* orbitals (σ* + π*), mixing decreased slightly for M–S bonding and increased only slightly for the M–O interactions. These results suggested that the metal and ligand valence orbital energies and radial extensions delicately influenced the orbital compositions for isoelectronic ME42- (E = O, S) dianions. PMID:25311904

  4. Using solution- and solid-state S K-edge X-ray absorption spectroscopy with density functional theory to evaluate M-S bonding for MS4(2-) (M = Cr, Mo, W) dianions.

    PubMed

    Olson, Angela C; Keith, Jason M; Batista, Enrique R; Boland, Kevin S; Daly, Scott R; Kozimor, Stosh A; MacInnes, Molly M; Martin, Richard L; Scott, Brian L

    2014-12-14

    Herein, we have evaluated relative changes in M-S electronic structure and orbital mixing in Group 6 MS4(2-) dianions using solid- and solution-phase S K-edge X-ray absorption spectroscopy (XAS; M = Mo, W), as well as density functional theory (DFT; M = Cr, Mo, W) and time-dependent density functional theory (TDDFT) calculations. To facilitate comparison with solution measurements (conducted in acetonitrile), theoretical models included gas-phase calculations as well as those that incorporated an acetonitrile dielectric, the latter of which provided better agreement with experiment. Two pre-edge features arising from S 1s → e* and t electron excitations were observed in the S K-edge XAS spectra and were reasonably assigned as (1)A1 → (1)T2 transitions. For MoS4(2-), both solution-phase pre-edge peak intensities were consistent with results from the solid-state spectra. For WS4(2-), solution- and solid-state pre-edge peak intensities for transitions involving e* were equivalent, while transitions involving the t orbitals were less intense in solution. Experimental and computational results have been presented in comparison to recent analyses of MO4(2-) dianions, which allowed M-S and M-O orbital mixing to be evaluated as the principle quantum number (n) for the metal valence d orbitals increased (3d, 4d, 5d). Overall, the M-E (E = O, S) analyses revealed distinct trends in orbital mixing. For example, as the Group 6 triad was descended, e* (π*) orbital mixing remained constant in the M-S bonds, but increased appreciably for M-O interactions. For the t orbitals (σ* + π*), mixing decreased slightly for M-S bonding and increased only slightly for the M-O interactions. These results suggested that the metal and ligand valence orbital energies and radial extensions delicately influenced the orbital compositions for isoelectronic ME4(2-) (E = O, S) dianions.

  5. Search for the decay B^0 --> K^0_S K^0_S K^0_L

    SciTech Connect

    Aubert, B.

    2006-06-27

    The authors present the first search for the decay B{sup 0} {yields} K{sub S}{sup 0} K{sub S}{sup 0} K{sub L}{sup 0} using a data sample of 232 million B{bar B} pairs. They find no statistically significant evidence for the non-resonant component of this decay. Our central value for the branching fraction, assuming the tru Dalitz distribution is uniform and excluding the {phi} resonance, is {Beta}(B{sup 0} {yields} K{sub S}{sup 0} K{sub S}{sup 0} K{sub L}{sup 0}) = (2.4{sub -2.5}{sup +2.7} {+-} 0.6) x 10{sup -6} where the errors are statistical and systematic, respectively. They set a single-side Bayesian upper limit of {Beta}(B{sup 0} {yields} K{sub S}{sup 0} K{sub S}{sup 0} K{sub L}{sup 0}) < 6.4 x 10{sup -6} at 90% confidence level using a uniform prior probability for physical values. Assuming the worst-case true Dalitz distribution, where the signal is entirely in the region of lowest efficiency, the 90% confidence level upper limit is {Beta}(B{sup 0} {yields} K{sub S}{sup 0} K{sub S}{sup 0} K{sub L}{sup 0}) < 14 x 10{sup -6}.

  6. 17 CFR 229.1007 - (Item 1007) Source and amount of funds or other consideration.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false (Item 1007) Source and amount..., SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Mergers and Acquisitions (Regulation M-A) § 229.1007 (Item 1007) Source and amount of funds or other consideration....

  7. 17 CFR 229.1007 - (Item 1007) Source and amount of funds or other consideration.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1007) Source and amount..., SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Mergers and Acquisitions (Regulation M-A) § 229.1007 (Item 1007) Source and amount of funds or other consideration....

  8. 17 CFR 229.301 - (Item 301) Selected financial data.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 301) Selected financial... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Financial Information § 229.301 (Item 301) Selected financial data. Furnish in comparative columnar form the selected financial data for...

  9. 17 CFR 229.902 - (Item 902) Individual partnership supplements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... partnership supplements. 229.902 Section 229.902 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.902 (Item 902) Individual partnership supplements. (a) If two or more entities are proposed to be included...

  10. 17 CFR 229.913 - (Item 913) Other provisions of the transaction.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.913 (Item... applicable state law, under the partnership's governing instruments or will be voluntarily accorded by the... under such law. (b) If any provision has been made to allow investors to obtain access to the books...

  11. 17 CFR 229.911 - (Item 911) Reports, opinions and appraisals.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 2 2012-04-01 2012-04-01 false (Item 911) Reports, opinions and appraisals. 229.911 Section 229.911 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.911...

  12. 17 CFR 229.911 - (Item 911) Reports, opinions and appraisals.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 2 2011-04-01 2011-04-01 false (Item 911) Reports, opinions and appraisals. 229.911 Section 229.911 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.911...

  13. 17 CFR 229.911 - (Item 911) Reports, opinions and appraisals.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false (Item 911) Reports, opinions and appraisals. 229.911 Section 229.911 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.911...

  14. 17 CFR 229.911 - (Item 911) Reports, opinions and appraisals.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 3 2014-04-01 2014-04-01 false (Item 911) Reports, opinions and appraisals. 229.911 Section 229.911 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.911...

  15. 17 CFR 229.913 - (Item 913) Other provisions of the transaction.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Roll-Up Transactions § 229.913 (Item... applicable state law, under the partnership's governing instruments or will be voluntarily accorded by the... under such law. (b) If any provision has been made to allow investors to obtain access to the books...

  16. 17 CFR 229.801 - Securities Act industry guides.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Securities Act industry guides... AND CONSERVATION ACT OF 1975-REGULATION S-K List of Industry Guides § 229.801 Securities Act industry guides. (a)-(b) (c) Guide 3. Statistical disclosure by bank holding companies. (d) Guide 4....

  17. 17 CFR 229.802 - Exchange Act industry guides.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Exchange Act industry guides... AND CONSERVATION ACT OF 1975-REGULATION S-K List of Industry Guides § 229.802 Exchange Act industry guides. (a)-(b) (c) Guide 3. Statistical disclosure by bank holding companies. (d) Guide 4....

  18. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... geothermal steam or water, need not include such disclosure. (b) To the extent that Items 1202 through 1208... means, as appropriate for meaningful disclosure in the circumstances: (1) By individual country; (2)...

  19. 17 CFR 229.1201 - (Item 1201) General instructions to oil and gas industry-specific disclosures.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 1933, SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K... geothermal steam or water, need not include such disclosure. (b) To the extent that Items 1202 through 1208... means, as appropriate for meaningful disclosure in the circumstances: (1) By individual country; (2)...

  20. 17 CFR 229.801 - Securities Act industry guides.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false Securities Act industry guides... AND CONSERVATION ACT OF 1975-REGULATION S-K List of Industry Guides § 229.801 Securities Act industry... and claim adjustment expenses of property-casualty insurance underwriters. (g) Guide 7. Description...

  1. 17 CFR 229.801 - Securities Act industry guides.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 2 2012-04-01 2012-04-01 false Securities Act industry guides... AND CONSERVATION ACT OF 1975-REGULATION S-K List of Industry Guides § 229.801 Securities Act industry... and claim adjustment expenses of property-casualty insurance underwriters. (g) Guide 7. Description...

  2. 17 CFR 229.801 - Securities Act industry guides.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 2 2011-04-01 2011-04-01 false Securities Act industry guides... AND CONSERVATION ACT OF 1975-REGULATION S-K List of Industry Guides § 229.801 Securities Act industry... and claim adjustment expenses of property-casualty insurance underwriters. (g) Guide 7. Description...

  3. 17 CFR 229.302 - (Item 302) Supplementary financial information.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... paragraphs 9-34 of Statement of Financial Accounting Standards (“SFAS”) No. 69, “Disclosures about Oil and... financial information. 229.302 Section 229.302 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Financial Information §...

  4. 17 CFR 229.303 - (Item 303) Management's discussion and analysis of financial condition and results of operations.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... discussion and analysis of financial condition and results of operations. 229.303 Section 229.303 Commodity... 1975-REGULATION S-K Financial Information § 229.303 (Item 303) Management's discussion and analysis of... registrant's discussion and analysis shall be of the financial statements and other statistical data that...

  5. 17 CFR 229.303 - (Item 303) Management's discussion and analysis of financial condition and results of operations.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... discussion and analysis of financial condition and results of operations. 229.303 Section 229.303 Commodity... 1975-REGULATION S-K Financial Information § 229.303 (Item 303) Management's discussion and analysis of... registrant's discussion and analysis shall be of the financial statements and other statistical data that...

  6. 17 CFR 229.1001 - (Item 1001) Summary term sheet.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 2 2013-04-01 2013-04-01 false (Item 1001) Summary term sheet... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Mergers and Acquisitions (Regulation M-A) § 229.1001 (Item 1001) Summary term sheet. Summary term sheet. Provide security holders with a summary...

  7. 17 CFR 229.1205 - (Item 1205) Drilling and other exploratory and development activities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., SECURITIES EXCHANGE ACT OF 1934 AND ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Disclosure by..., disclose: (1) The number of net productive and dry exploratory wells drilled; and (2) The number of net productive and dry development wells drilled. (b) Definitions. For purposes of this Item 1205, the...

  8. 17 CFR 229.1206 - (Item 1206) Present activities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... ENERGY POLICY AND CONSERVATION ACT OF 1975-REGULATION S-K Disclosure by Registrants Engaged in Oil and..., the registrant's present activities, such as the number of wells in the process of being drilled (including wells temporarily suspended), waterfloods in process of being installed, pressure...

  9. First observation of the decay $\\bar{B}$$0\\atop{s}$ → D$±\\atop{s}$ K and measurement of the relative branching fraction B($\\bar{B}$$0\\atop{s}$→ D$±\\atop{s}$ K)/B($\\bar{B}$$0\\atop{s}$→ D$+\\atop{s}$ π-).

    SciTech Connect

    Muelmenstaedt, Johannes

    2007-01-01

    We present the first observation of the decay $\\bar{B}$$0\\atop{s}$→ D$±\\atop{s}$ K∓ and measure the relative branching fraction of $\\bar{B}$$0\\atop{s}$ → D$±\\atop{s}$ K∓ to $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ π-. The measurement of the relative branching fraction is performed by applying a fit in invariant mass and specific ionization to 1.2 fb-1 of Ds(φπ)X data collected with the CDF II detector in pp collisions at √ s = 1.96 TeV at the Fermilab Tevatron collider. We measure B $\\bar{B}$$0\\atop{s}$ → D$±\\atop{s}$ K∓ /B $\\bar{B}$$0\\atop{s}$ → D$+\\atop{s}$ π- = 0.107±0.019(stat)±0.008(sys). The statistical significance of the $\\bar{B}$$0\\atop{s}$ → D$±\\atop{s}$ K signal is 7.9σ. To cross-check our analysis method, we also measure B $\\bar{B0}$→ D+K- /B $\\bar{B0}$ → D+π- and B $\\bar{B0}$ → D+*K- /B $\\bar{B0}$ → D*+π- and verify that our results are in agreement with the world average.

  10. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and other...-K (§ 229.301) for each such entity or group of affiliated entities. (ii) If any entity or group of... requirements of Regulation S-X (§§ 210.1-01 through 210.12-29 of this chapter), except § 210.3-05 of...

  11. 17 CFR 229.1114 - (Item 1114) Credit enhancement and other support, except for certain derivatives instruments.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...-REGULATION S-K Asset-Backed Securities (Regulation AB) § 229.1114 (Item 1114) Credit enhancement and other...-K (§ 229.301) for each such entity or group of affiliated entities. (ii) If any entity or group of... requirements of Regulation S-X (§§ 210.1-01 through 210.12-29 of this chapter), except § 210.3-05 of...

  12. Search for B^0 meson decays to \\pi^0 K^0_S K^0_S, \\eta K^0_S K^0_S, and \\eta^{\\prime}K^0_S K^0_S

    SciTech Connect

    Aubert, B.

    2009-05-08

    We describe searches for B{sup 0} meson decays to the charmless final states {pi}{sup 0}K{sub S}{sup 0}K{sub S}{sup 0}, {eta}K{sub S}{sup 0}K{sub S}{sup 0}, and {eta}{prime}K{sub S}{sup 0}K{sub S}{sup 0}. The data sample corresponds to 467 x 10{sup 6} B{bar B} pairs produced in e{sup +}e{sup -} annihilation and collected with the BABAR detector at the SLAC National Accelerator Laboratory. We find no significant signals and determine the 90% confidence level upper limits on the branching fractions, in units of 10{sup -7}, {Beta}(B{sup 0} {yields} {pi}{sup 0}K{sub S}{sup 0}K{sub S}{sup 0}) < 12, {Beta}(B{sup 0} {yields} {eta}K{sub S}{sup 0}K{sub S}{sup 0}) < 10, and {Beta}(B{sup 0} {yields} {eta}{prime}K{sub S}{sup 0}K{sub S}{sup 0}) < 20.

  13. Observation of the Rare Decay B0 to K0(s)K+-pi-+

    SciTech Connect

    del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Battaglia, M.; Brown, David Nathan; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /more authors..

    2010-07-30

    We report an analysis of charmless hadronic decays of neutral B mesons to the final state K{sub S}{sup 0}K{sup {+-}}{pi}{sup {-+}}, using a data sample of (465 {+-} 5) x 10{sup 6} B{bar B} events collected with the BABAR detector at the {Upsilon}(4S) resonance. We observe an excess of signal events with a significance of 5.2 standard deviations including systematic uncertainties and measure the branching fraction to be {Beta}(B{sup 0} {yields} K{sub S}{sup 0}K{sup {+-}}{pi}{sup {-+}}) = (3.2 {+-} 0.5 {+-} 0.3) x 10{sup -6}, where the uncertainties are statistical and systematic, respectively.

  14. Ca and S K-edge XANES studies of calcite-acid mine water interactions

    SciTech Connect

    Myneni, S.C.B.; Perera, R.C.C.

    1997-04-01

    Heavy metal-rich acidic waters (SO{sub 4}{sup 2{minus}}, AsO{sub 4}{sup 3{minus}}, SeO{sub 4}{sup 2{minus}}, Fe{sup 2+}, Fe{sup 3+}, Al{sup 3+}, Cu{sup 2+}, Zn{sup 2+}, Cd{sup 2+}) and related ochreous coatings are common around abandoned sulfide and coal mine sites. This is mainly caused by the natural weathering of pyrite (FeS{sub 2}), arsenopyrite (FeAsS), and other metal sulfide containing shales. Acid generation in the case of pyrite can be explained by a general reaction: FeS{sub 2} + 3.5 O{sub 2} + H{sub 2}O {leftrightarrow} Fe{sup 2+} + SO{sub 4}{sup 2{minus}} + 2H{sup +}. Also, these low pH waters interact with the soils, and mobilize their soluble elements. One of the common remediation strategies is to allow these acid waters to react with limestone (CaCO{sub 3}-rich rock) and neutralize the pH and precipitate out soluble metals. Yet, the associated problem is the precipitation of Fe and Al oxides and hydroxy sulfate coatings on limestone surfaces, which block calcite reactive sites, and make them ineffective a few hours after initiation of treatment. The main objectives of this research are to examine: (1) the chemistry of limestone surface coatings, and (2) their toxic metal uptake and the conditions that inhibit their formation. Previous molecular studies using X-ray diffraction, and vibrational spectroscopy on limestone surface coatings (sampled from Athens, OH) indicate that the surface-most layer (the layer in contact with water) is composed of schwertmannite (Fe(III)-hydroxy sulfate) like phases. However, white, X-ray amorphous; Al-, sulfate- and carbonate-rich; and Ca-poor phases appeared at the interface between the limestone and the iron oxide coatings. The structure, morphology, and coordination chemistry of component major and trace elements of these white precipitate phases have not previously been examined.

  15. California’s K-12 Public Schools: How Are They Doing?

    DTIC Science & Technology

    2005-01-01

    California has an abundance of English learners and linguistically isolated households, both of which are disparities that heighten educational costs...for affected school districts— English learners by imposing spe- cialized and/or higher per capita staffing needs, and linguistic isola- tion by...California has an abundance of “ English learners ” and linguistically isolated house- holds.2 California ranks nationally as the state with the highest per

  16. A Critical Review of the Canadian Empirical Literature: Documenting Generation 1.5's K-16 Trajectories

    ERIC Educational Resources Information Center

    Garnett, Bruce

    2012-01-01

    Little empirical research has ever systematically documented the academic trajectories of Generation 1.5 in Canadian schools. Indeed, this label has not even been used to define the population of interest in the studies reviewed here. Nonetheless, some earlier work, along with more current studies made possible by recent availability of data, has…

  17. Observation of Decays $B^0\\to D_s^{(*)+}\\pi^-$ and$B^0\\to D_s^{(*)-}K^+$

    SciTech Connect

    Aubert, B.

    2006-04-19

    The authors report the observation of decays B{sup 0} {yields} D{sub s}{sup (*)+} {pi}{sup -} and B{sup 0} {yields} D{sub s}{sup (*)-} K{sup +} in a sample of 230 x 10{sup 6} {Upsilon}(4S) {yields} B{bar B} events recorded with the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} storage ring. They measure the branching fractions {Beta}(B{sup 0} {yields} D{sub s}{sup +}{pi}{sup -}) = (1.3 {+-} 0.3(stat) {+-} 0.2(syst)) x 10{sup -5}, {Beta}(B{sup 0} {yields} D{sub s}{sup -}K{sup +}) = (2.5 {+-} 0.4(stat) {+-} 0.4(syst)) x 10{sup -5}, {Beta}(B{sup 0} {yields} D*{sub s}{sup +} {pi}{sup -}) = (2.8 {+-} 0.6(stat) {+-} 0.5 (syst)) x 10{sup -5}, and {Beta}(B{sup 0} {yields} D*{sub s}{sup -} K{sup +}) = (2.0 {+-} 0.5(stat) {+-} 0.4(syst)) x 10{sup -5}. The significance of the measurements to differ from zero are 5, 9, 6, and 5 standard deviations, respectively.

  18. Isothermal density derivative of S(k) and the triplet correlation function: an experimental study in liquid Kr

    NASA Astrophysics Data System (ADS)

    Fontana, Raffaella; Magli, Renato

    1993-08-01

    Recent accurate measurements performed on liquid Kr have been used to test some of the models proposed in the literature for the triplet correlation function g 3( r, s). It turns out that neither the superposition approximation suggested by Kirkwood (J.P. Hansen and I.R. McDonald, Theory of simple liquids, Academic Press, London, 1986), nor a modification of it which partially takes into account linear density effects (H. Fredrikze, Ph.D. Thesis, Delft, 1985) are able to satisfactorily reproduce the experimental isothermal derivatives of the structure factor. Also the uniform fluid model (P.A. Egelstaff, D.I. Page and C.R.T. Heard, J. Phys. C, 4 (1971) 1453), gives a poor representation especially at lower densities. It is concluded that, in order to correctly describe triplet correlation effects, a full account of the irreducible contributions to g 3( r, s) is necessary.

  19. Search for Lambda+(c) ---> p K+ pi- and D+(s) ---> K+ K+ pi- using genetic programming event selection

    SciTech Connect

    Link, J.M.; Yager, P.M.; Anjos, J.C.; Bediaga, I.; Castromonte, C.; Machado, A.A.; Magnin, J.; Massafferri, A.; de Miranda, J.M.; Pepe, I.M.; Polycarpo, E.; dos Reis, A.C.; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sanchez-Hernandez, A.; Uribe, C.; Vazquez, F.; Agostino, L.; Cinquini, L.; Cumalat, J.P.; /Wisconsin U., Madison

    2005-07-01

    The authors apply a genetic programming technique to search for the doubly Cabibbo suppressed decays {Lambda}{sub c}{sup +} {yields} pK{sup +} {pi}{sup -} and D{sub s}{sup +} {yields} K{sup +}K{sup +}{pi}{sup -}. They normalize these decays to their Cabibbo favored partners and find BR({Lambda}{sub c}{sup +} {yields} pK{sup +}{pi}{sup -})/BR({Lambda}{sub c}{sup +} {yields} pK{sup -}{pi}{sup +}) = (0.05 {+-} 0.26 {+-} 0.02)% and BR(D{sub s}{sup +} {yields} K{sup +}K{sup +}{pi}{sup -})/BR(D{sub s}{sup +} {yields} K{sup -}K{sup +}{pi}{sup +}) = (0.52 {+-} 0.17 {+-} 0.11)% where the first errors are statistical and the second are systematic. Expressed as 90% confidence levels (CL), they find < 0.46% and < 0.78% respectively. This is the first successful use of genetic programming in a high energy physics data analysis.

  20. T.S.K.H.: Tickle Snug Kiss Hug; Exercises and Tricks for Parent-Child Fun.

    ERIC Educational Resources Information Center

    May, Betty

    This book presents a collection of physical activities for parents and children. Although all of the activities provide some exercise and physical conditioning, the book emphasizes having fun. The book encourages the physical closeness of tickling, snuggling, kissing and hugging (TSKH) as an important part of each activity. Each activity…

  1. 12 CFR 567.1 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... § 567.1 Definitions. For the purposes of this subpart: Adjusted total assets. The term adjusted total assets means: (1) A savings association's total assets as that term is defined in this section; (2) Plus.... Asset-backed commercial paper program. The term asset-backed commercial paper program (ABCP...

  2. 17 CFR 210.1-02 - Definitions of terms used in Regulation S-X (17 CFR part 210).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... disclosures: (i) Current assets, noncurrent assets, current liabilities, noncurrent liabilities, and, when... with servicing criteria for asset-backed securities. The term attestation report on assessment of compliance with servicing criteria for asset-backed securities means a report in which a registered...

  3. 17 CFR 210.1-02 - Definitions of terms used in Regulation S-X (17 CFR part 210).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... disclosures: (i) Current assets, noncurrent assets, current liabilities, noncurrent liabilities, and, when... with servicing criteria for asset-backed securities. The term attestation report on assessment of compliance with servicing criteria for asset-backed securities means a report in which a registered...

  4. 75 FR 80296 - Extension of Filing Accommodation for Static Pool Information in Filings With Respect to Asset...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-22

    ... From the Federal Register Online via the Government Publishing Office SECURITIES AND EXCHANGE... Filings With Respect to Asset-Backed Securities AGENCY: Securities and Exchange Commission. ACTION: Final... with respect to asset-backed securities that allows static pool information required to be disclosed...

  5. 12 CFR Appendix C to Part 704 - Risk-Based Capital Credit Risk-Weight Categories

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... substitute. Direct credit substitutes include: (1) Financial standby letters of credit that support financial... tranche of asset-backed securities that is not the most senior tranche; (4) Credit derivative contracts... direct credit substitutes; and (8) Liquidity facilities that provide support to asset-backed...

  6. 76 FR 4966 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-27

    ... Proposed Rule Change Relating to the Trading Activity Fee Rate for Transactions in Asset-Backed Securities...'s Statement of the Terms of Substance of the Proposed Rule Change FINRA is proposing to amend... Activity Fee (``TAF'') for transactions in Asset-Backed Securities. The text of the proposed rule change...

  7. 78 FR 62788 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-22

    ... (``Agency Data Set'') and Asset-Backed Securities (``ABS Data Set'').\\11\\ The Rule 144A Data Set will... market data sets (i.e., the Corporate Bond Data Set, the Agency Data Set and the ABS Data Set) to the...''), Agency Debt Securities (``Historic Agency Data Set'') and Asset-Backed Securities (``Historic ABS...

  8. 17 CFR 242.101 - Activities by distribution participants.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... conducted pursuant to § 240.13e-4(h)(5) of this chapter; or (4) Exercises of securities. The exercise of any..., and asset-backed securities, that are rated by at least one nationally recognized statistical...

  9. 17 CFR 240.13a-13 - Quarterly reports on Form 10-Q (§ 249.308a of this chapter).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...; and (3) Asset-backed issuers required to file reports pursuant to § 240.13a-17. (c) Part I of the... mineral deposits other than oil, gas or coal, if all of the following conditions are met: (i)...

  10. 17 CFR 229.1121 - (Item 1121) Distribution and pool performance information.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... period, and updated pool composition information, such as weighted average coupon, weighted average life... Central Index Key (CIK) code regarding a subsequent issuance of asset-backed securities backed by a...

  11. Test Review: L. Brown, R. J. Sherbenou, & S. K. Johnsen "Test of Nonverbal Intelligence-4" (Toni-4). Austin, TX--PRO-ED, 2010

    ERIC Educational Resources Information Center

    Ritter, Nicola; Kilinc, Emin; Navruz, Bilgin; Bae, Yunhee

    2011-01-01

    This article reviews Test of Nonverbal Intelligence-Fourth Edition (TONI-4), an individually administered instrument created to assess intelligence. The distinguishing characteristic of the TONI-4 is the nonverbal, motor-reduced format that assesses common elements of intelligence without the confounding effects of motor or linguistic skills. The…

  12. Dependence of RNA:DNA ratios and Fulton’s K condition indices on environmental characteristics of plaice and dab nursery grounds

    NASA Astrophysics Data System (ADS)

    De Raedemaecker, F.; Brophy, D.; O'Connor, I.; O'Neill, B.

    2012-02-01

    This field study showed a lack of a correlation between a morphometric (Fulton's K) and biochemical (RNA:DNA ratio) condition index in juvenile plaice ( Pleuronectes platessa) and dab ( Limanda limanda) studied to assess habitat quality in four sandy beach nursery grounds in Galway Bay, Ireland. Based on monthly surveys from June to September in 2008 and 2009, fish growth, indicated by RNA:DNA ratios and Fulton's K, displayed considerable spatio-temporal variability. Site-related patterns in Fulton's K for plaice and dab were consistent between years whereas RNA:DNA ratios displayed annual and interspecific variability among nursery habitats. This indicates a higher sensitivity of RNA:DNA ratios to short-term environmental fluctuations which is not apparent in Fulton's K measurements of juvenile flatfish. Generalized Additive Modelling (GAM) revealed non-linear relationships between the condition indices and (biotic and abiotic) habitat characteristics as well as diet features, derived from gut content analyses. Density of predators, sediment grain size and salinity were the most important predictors of both condition indices. Temperature also affected condition indices in dab whereas plaice condition indices varied with depth. Diet features did not contribute to the explained variability in the models predicting RNA:DNA ratios whereas certain prey groups significantly improved the explained variability in the models predicting Fulton's K of plaice and dab. The value of both indices for assessing fish condition and habitat quality in field studies is discussed. These findings aid understanding of the biological and physical mechanisms promoting fast growth and high survival which will help to identify high quality nursery areas for juvenile plaice and dab.

  13. S K-edge X-ray absorption studies of tetranuclear iron-sulfur clusters: mu-sulfide bonding and its contribution to electron delocalization.

    PubMed

    Glaser, T; Rose, K; Shadle, S E; Hedman, B; Hodgson, K O; Solomon, E I

    2001-01-24

    X-ray absorption spectroscopy (XAS) at the sulfur ( approximately 2470 eV) and chlorine ( approximately 2822 eV) K-edges has been applied to a series of 4Fe-4S model complexes. These are compared to 2Fe-2S model complexes to obtain insight into the localized ground state in the mixed-valence dimer versus the delocalized ground state in the mixed-valence tetramer. The preedges of hypothetical delocalized mixed-valence dimers [Fe(2)S(2)](+) are estimated using trends from experimental data and density functional calculations, for comparison to the delocalized mixed-valence tetramer [Fe(4)S(4)](2+). The differences between these two mixed-valence sites are due to the change of the sulfide-bridging mode from micro(2) to micro(3). The terminal chloride and thiolate ligands are used as spectator ligands for the electron density of the iron center. From the intensity of the preedge, the covalency of the terminal ligands is found to increase in the tetramer as compared to the dimer. This is associated with a higher effective nuclear charge on the iron in the tetramer (derived from the energies of the preedge). The micro(3)-bridging sulfide in the tetramer has a reduced covalency per bond (39%) as compared to the micro(2)-bridging sulfide in the dimer (51%). A simple perturbation model is used to derive a quadratic dependence of the superexchange coupling constant J on the covalency of the metal ions with the bridging ligands. This relationship is used to estimate the superexchange contribution in the tetramer (J = -156 cm(-)(1)) as compared to the mixed-valence dimer (J = -360 cm(-)(1)). These results, combined with estimates for the double exchange and the vibronic coupling contributions of the dimer sub-site of the tetramer, lead to a delocalized S(t) = (9)/(2) spin ground state for the mixed-valence dimer in the tetramer. Thus, the decrease in the covalency, hence the superexchange pathway associated with changing the bridging mode of the sulfides from micro(2) to micro(3) on going from the dimer to the tetramer, significantly contributes to the delocalization of the excess electron over the dimer sub-site in the tetramer.

  14. S K-edge XAS and DFT calculations on cytochrome P450: covalent and ionic contributions to the cysteine-Fe bond and their contribution to reactivity.

    PubMed

    Dey, Abhishek; Jiang, Yonging; Ortiz de Montellano, Paul; Hodgson, Keith O; Hedman, Britt; Solomon, Edward I

    2009-06-10

    Experimental covalencies of the Fe-S bond for the resting low-spin and substrate-bound high-spin active site of cytochrome P450 are reported. DFT calculations on the active site indicate that one H-bonding interaction from the protein backbone is needed to reproduce the experimental values. The H-bonding to the thiolate from the backbone decreases the anisotropic pi covalency of the Fe-S bond lowering the barrier of free rotation of the exchangeable axial ligand, which is important for reactivity. The anionic axial thiolate ligand is calculated to lower the Fe(III/II) reduction potential of the active site by more than 1 V compared to a neutral imidazole ligand. About half of this derives from its covalent bonding and half from its electrostatic interaction with the oxidized Fe. This axial thiolate ligand increases the pK(a) of compound 0 (Fe(III)-hydroperoxo) favoring its protonation which promotes O-O bond heterolysis forming compound I. The reactivity of compound I is calculated to be relatively insensitive to the nature of the axial ligand due to opposing reduction potential and proton affinity contributions to the H-atom abstraction energy.

  15. 76 FR 11946 - Emergency Homeowners' Loan Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-04

    ... resulting from a homeowner's substantial reduction income. Although the 1975 regulations were quickly put in..., quickly put in place by HUD in 1975, was not utilized and, in 1995, as part of HUD's effort to...

  16. Sifting noisy data for truths about noisy systems. Comment on "Extracting physics of life at the molecular level: A review of single-molecule data analyses" by W. Colomb and S.K. Sarkar

    NASA Astrophysics Data System (ADS)

    Flyvbjerg, Henrik; Mortensen, Kim I.

    2015-06-01

    With each new aspect of nature that becomes accessible to quantitative science, new needs arise for data analysis and mathematical modeling. The classical example is Tycho Brahe's accurate and comprehensive observations of planets, which made him hire Kepler for his mathematical skills to assist with the data analysis. We all learned what that lead to: Kepler's three laws of planetary motion, phenomenology in purely mathematical form. Newton built on this, and the scientific revolution was over, completed.

  17. Beyond experimental noise: Analyzing single-molecule data of heterogeneous systems. Comment on "Extracting physics of life at the molecular level: A review of single-molecule data analyses" by W. Colomb and S.K. Sarkar

    NASA Astrophysics Data System (ADS)

    Meroz, Yasmine

    2015-06-01

    In the 1980s the world witnessed the advent of single-molecule experiments. The first atomic resolution characterization of a surface was reported by scanning tunneling microscope (STM) in 1982 [1], followed by atomic force microscope (AFM) in 1986 [2]. The first optical detection and spectroscopy of a single molecule in a solid took place in 1989 [3,4], in a time where essentially all chemical experiments were made on bulk, i.e. averaging over millions of copies of the same molecule.

  18. 17 CFR 229.1119 - (Item 1119) Affiliations and certain relationships and related transactions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Asset-Backed Securities (Regulation AB) § 229.1119 (Item 1119) Affiliations and certain relationships... other following parties: (1) Servicer contemplated by Item 1108(a)(3) of this Regulation AB. (2) Trustee. (3) Originator contemplated by Item 1110 of this Regulation AB. (4) Significant obligor...

  19. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive information..., that for a significant obligor under Item 1101(k)(2) of this Regulation AB, only net operating income... Items 1104 through 1115, 1117 and 1119 of this Regulation AB regarding such asset-backed securities;...

  20. 17 CFR 229.1119 - (Item 1119) Affiliations and certain relationships and related transactions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... Asset-Backed Securities (Regulation AB) § 229.1119 (Item 1119) Affiliations and certain relationships... other following parties: (1) Servicer contemplated by Item 1108(a)(3) of this Regulation AB. (2) Trustee. (3) Originator contemplated by Item 1110 of this Regulation AB. (4) Significant obligor...

  1. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive information..., that for a significant obligor under Item 1101(k)(2) of this Regulation AB, only net operating income... Items 1104 through 1115, 1117 and 1119 of this Regulation AB regarding such asset-backed securities;...

  2. 17 CFR 229.1119 - (Item 1119) Affiliations and certain relationships and related transactions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Asset-Backed Securities (Regulation AB) § 229.1119 (Item 1119) Affiliations and certain relationships... other following parties: (1) Servicer contemplated by Item 1108(a)(3) of this Regulation AB. (2) Trustee. (3) Originator contemplated by Item 1110 of this Regulation AB. (4) Significant obligor...

  3. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive information..., that for a significant obligor under Item 1101(k)(2) of this Regulation AB, only net operating income... Items 1104 through 1115, 1117 and 1119 of this Regulation AB regarding such asset-backed securities;...

  4. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive information..., that for a significant obligor under Item 1101(k)(2) of this Regulation AB, only net operating income... Items 1104 through 1115, 1117 and 1119 of this Regulation AB regarding such asset-backed securities;...

  5. 17 CFR 229.1119 - (Item 1119) Affiliations and certain relationships and related transactions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... Asset-Backed Securities (Regulation AB) § 229.1119 (Item 1119) Affiliations and certain relationships... other following parties: (1) Servicer contemplated by Item 1108(a)(3) of this Regulation AB. (2) Trustee. (3) Originator contemplated by Item 1110 of this Regulation AB. (4) Significant obligor...

  6. 17 CFR 229.1119 - (Item 1119) Affiliations and certain relationships and related transactions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... Asset-Backed Securities (Regulation AB) § 229.1119 (Item 1119) Affiliations and certain relationships... other following parties: (1) Servicer contemplated by Item 1108(a)(3) of this Regulation AB. (2) Trustee. (3) Originator contemplated by Item 1110 of this Regulation AB. (4) Significant obligor...

  7. 17 CFR 229.1112 - (Item 1112) Significant obligors of pool assets.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (Regulation AB) § 229.1112 (Item 1112) Significant obligors of pool assets. (a) Descriptive information..., that for a significant obligor under Item 1101(k)(2) of this Regulation AB, only net operating income... Items 1104 through 1115, 1117 and 1119 of this Regulation AB regarding such asset-backed securities;...

  8. 77 FR 7647 - Self-Regulatory Organizations; NYSE Arca, Inc.; Order Granting Approval of Proposed Rule Change...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-13

    ... Allocation ETF; and SPDR SSgA Aggressive Global Allocation ETF Under NYSE Arca Equities Rule 8.600 February 7... SSgA Conservative Global Allocation ETF; SPDR SSgA Global Allocation ETF; and SPDR SSgA Aggressive... mortgage backed securities, asset backed securities, commodities, and REITs. SPDR SSgA Aggressive...

  9. 78 FR 4917 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Order Approving...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-23

    ... From the Federal Register Online via the Government Publishing Office SECURITIES AND EXCHANGE... for corporate bonds and Agency Debt Securities (``Corporate/Agency Debt Securities''). The FINRA ADDS... was a party that were reported on that date either in Asset-Backed Securities or Corporate/Agency...

  10. 17 CFR 240.15d-13 - Quarterly reports on Form 10-Q (§ 249.308 of this chapter).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... pursuant to § 240.15d-16; and (3) Asset-backed issuers required to file reports pursuant to § 240.15d-17... the development of mineral deposits other than oil, gas or coal, if all of the following...

  11. 12 CFR Appendix B to Part 704 - Expanded Authorities and Requirements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... investments with long-term ratings no lower than A- (or equivalent); (2) Purchase investments with short-term...- (or equivalent) or the investment is a domestically-issued asset-backed security; (3) Engage in short... any single obligor is not to exceed 25 percent of capital; (2) Purchase investments with...

  12. 12 CFR 704.5 - Investments.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... related to credit risk management, asset and liability management, and liquidity management. The policy... convertible into the stock of the corporation; and (5) Domestically-issued asset-backed securities. (d... maintains adequate margin that reflects a risk assessment of the repurchase securities and the term of...

  13. 12 CFR 12.2 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    .... (b) Collective investment fund means any fund established pursuant to 12 CFR 9.18. (c) Completion of... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Definitions. 12.2 Section 12.2 Banks and... REQUIREMENTS FOR SECURITIES TRANSACTIONS § 12.2 Definitions. (a) Asset-backed security means a security that...

  14. 12 CFR 12.2 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    .... (b) Collective investment fund means any fund established pursuant to 12 CFR 9.18. (c) Completion of... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Definitions. 12.2 Section 12.2 Banks and... REQUIREMENTS FOR SECURITIES TRANSACTIONS § 12.2 Definitions. (a) Asset-backed security means a security that...

  15. 17 CFR 270.2a-7 - Money market funds.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Money market funds. 270.2a-7... AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.2a-7 Money market funds. (a) Definitions—(1... current market factors. (3) Asset Backed Security means a fixed income security (other than a...

  16. 17 CFR 270.2a-7 - Money market funds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Money market funds. 270.2a-7... AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.2a-7 Money market funds. Link to an amendment... accretion of discount rather than at their value based on current market factors. (3) Asset Backed...

  17. 17 CFR 229.1108 - (Item 1108) Servicers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... that may be material to an analysis of the servicing of the assets or the asset-backed securities, as... assets and the effect of any such ability, if material, on the potential cash flows from the assets. (7... pool assets; and (iv) Any other material servicer responsible for calculating or making...

  18. 17 CFR 229.1108 - (Item 1108) Servicers.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... that may be material to an analysis of the servicing of the assets or the asset-backed securities, as... assets and the effect of any such ability, if material, on the potential cash flows from the assets. (7... pool assets; and (iv) Any other material servicer responsible for calculating or making...

  19. 17 CFR 240.10b-10 - Confirmation of transactions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... may be extended by the issuer thereof, with a variable interest payable thereon; or (B) Is an asset... issuer thereof, with a variable interest rate payable thereon; or (B) Is an asset-backed security, that..., including but not limited to: research, clearance, custody, products or services; reciprocal agreements...

  20. 12 CFR Appendix A to Part 3 - Risk-Based Capital Guidelines

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... of transactions, structures or programs. A liquidity facility that supports asset-backed commercial... Holding Company Act (12 U.S.C. 1843(k)). (24) The OECD-based group of countries comprises all full members...)(iii) of this appendix A. (ii) Consolidated groups. The amount of deferred tax assets that a bank...

  1. 12 CFR Appendix A to Part 3 - Risk-Based Capital Guidelines

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... of transactions, structures or programs. A liquidity facility that supports asset-backed commercial... Holding Company Act (12 U.S.C. 1843(k)). (24) The OECD-based group of countries comprises all full members...)(iii) of this appendix A. (ii) Consolidated groups. The amount of deferred tax assets that a bank...

  2. 12 CFR Appendix C to Part 325 - Risk-Based Capital for State Nonmember Banks: Market Risk

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... substance, acts as a liquidity facility that provides support to asset-backed commercial paper; (iv) A... reference exposure in a group of reference exposures. Over-the-counter (OTC) derivative means a derivative... trading and hedging strategies for its trading positions that are approved by senior management of...

  3. 78 FR 35078 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-11

    ... Immediate Effectiveness of a Proposed Rule Change Relating to Dissemination of Agency-Pass Through Mortgage... protocols to provide a limited exception to dissemination requirements for certain Agency Pass-Through... transaction is reported.\\4\\ \\4\\ The terms Agency Pass-Through Mortgage-Backed Security, Asset-Backed...

  4. 77 FR 23524 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-19

    ... Proposed Rule Change Relating to Post-Trade Transparency for Agency Pass-Through Mortgage-Backed Securities... reporting and dissemination of transactions in TRACE- Eligible Securities that are: (1) Agency Pass-Through... Security, Agency Pass-Through Mortgage-Backed Security, Specified Pool Transaction, Asset-Backed...

  5. 77 FR 65436 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Order Granting...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-26

    ... Approval of Proposed Rule Change Relating to Post-Trade Transparency for Agency Pass-Through Mortgage... proposed rule change relating to post-trade transparency for Agency Pass-Through Mortgage-Backed Securities....19b-4. \\3\\ The terms ``Asset-Backed Security,'' ``TBA,'' ``Agency Pass- Through...

  6. 17 CFR 230.426 - Filing of certain prospectuses under § 230.167 in connection with certain offerings of asset...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... section, ABS informational and computational material made in reliance on § 230.167 that meet the...) ABS informational and computational material that relate to abandoned structures or that are furnished... intention to purchase the asset-backed securities. (2) Any ABS informational and computational material if...

  7. 17 CFR 230.426 - Filing of certain prospectuses under § 230.167 in connection with certain offerings of asset...

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... section, ABS informational and computational material made in reliance on § 230.167 that meet the...) ABS informational and computational material that relate to abandoned structures or that are furnished... intention to purchase the asset-backed securities. (2) Any ABS informational and computational material if...

  8. 17 CFR 230.426 - Filing of certain prospectuses under § 230.167 in connection with certain offerings of asset...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... section, ABS informational and computational material made in reliance on § 230.167 that meet the...) ABS informational and computational material that relate to abandoned structures or that are furnished... intention to purchase the asset-backed securities. (2) Any ABS informational and computational material if...

  9. 17 CFR 230.426 - Filing of certain prospectuses under § 230.167 in connection with certain offerings of asset...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... section, ABS informational and computational material made in reliance on § 230.167 that meet the...) ABS informational and computational material that relate to abandoned structures or that are furnished... intention to purchase the asset-backed securities. (2) Any ABS informational and computational material if...

  10. 77 FR 74896 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-18

    ... Statutory Basis for, the Proposed Rule Change 1. Purpose In general, Asset-Backed Securities (``ABS'') \\3\\ are traded on a principal basis and only a small number of ABS transactions are traded on an agency basis and charge a commission.\\4\\ In the limited instances when a member executes an ABS...

  11. 12 CFR 704.2 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...'s credit and investment policy. Asset-backed security (ABS) means a security that is primarily... financial statements of the credit union present fairly, in all material respects, the financial position... material to the financial statements. Internal control framework means criteria such as that established...

  12. 78 FR 15790 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Order Granting...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-12

    ... in an Asset-Backed Security ``(ABS'') (except ABS traded To Be Announced (``TBA'')), in the limited... information on ABS transactions but, until recently, FINRA's rules did not provide for the dissemination of... dissemination of information regarding, among other things, certain ABS traded in Specified Pool...

  13. 78 FR 57634 - Proposed Agency Information Collection Activities; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-19

    ... section would include asset-backed commercial paper (single-seller and multi-seller arrangements), term... backed commercial paper issued to fund the assets of a single or several unrelated sellers. Section 12... commitments provided to external counterparties. Section 13-18: Parent Company Only Tab: Institutions...

  14. 12 CFR 1267.3 - Prohibited investments and prudential rules.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... highest credit rating from an NRSRO, where the purchase of such obligations by the Bank provides to the... funding for housing or community lending; (iv) Mortgage-backed securities, or asset-backed securities... under an assumed instantaneous interest rate change of 300 basis points, unless the instrument...

  15. 12 CFR 1267.3 - Prohibited investments and prudential rules.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... highest credit rating from an NRSRO, where the purchase of such obligations by the Bank provides to the... funding for housing or community lending; (iv) Mortgage-backed securities, or asset-backed securities... under an assumed instantaneous interest rate change of 300 basis points, unless the instrument...

  16. 12 CFR 223.56 - What transactions are exempt from the market-terms requirement of section 23B?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... of asset-backed commercial paper from an affiliated SEC-registered open-end investment company that holds itself out as a money market mutual fund under SEC Rule 2a-7 (17 CFR 270.2a-7), if the member...

  17. 17 CFR 270.2a-7 - Money market funds.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Money market funds. 270.2a-7... AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.2a-7 Money market funds. (a) Definitions—(1... current market factors. (3) Asset backed security means a fixed income security (other than a...

  18. 17 CFR 270.2a-7 - Money market funds.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Money market funds. 270.2a-7... AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.2a-7 Money market funds. (a) Definitions—(1... current market factors. (3) Asset backed security means a fixed income security (other than a...

  19. 17 CFR 270.2a-7 - Money market funds.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 3 2013-04-01 2013-04-01 false Money market funds. 270.2a-7... AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.2a-7 Money market funds. (a) Definitions—(1... current market factors. (3) Asset backed security means a fixed income security (other than a...

  20. 17 CFR 240.13a-15 - Controls and procedures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Asset-Backed Issuer (as defined in § 229.1101 of this chapter), a small business investment company registered on Form N-5 (§§ 239.24 and 274.5 of this chapter), or a unit investment trust as defined in section 4(2) of the Investment Company Act of 1940 (15 U.S.C. 80a-4(2)), must maintain disclosure...

  1. 78 FR 28569 - Nondiscrimination on the Basis of Age in Federally Assisted Programs or Activities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-15

    ... Nondiscrimination on the Basis of Age in Federally Assisted Programs or Activities AGENCY: National Endowment for... National Endowment for the Humanities (NEH) is issuing Age Discrimination Act of 1975 regulations at 45 CFR part 1172. These regulations implement provisions of the Age Discrimination Act of 1975 and the...

  2. [Book review] Cowbirds and Other Brood Parasites by Catherine Ortega. Tucson, Arizona: University of Arizona Press (1998). The Avian Brood Parasites: Deception at the Nest by Paul A. Johnsgard. New York: Oxford University Press (1997) Parasitic Birds and their Hosts: Studies in Coevolution edited by S.I. Rothstein & S.K. Robinson. New York: Oxford University Press (1998)

    USGS Publications Warehouse

    Hahn, D.C.

    1999-01-01

    We are in a golden age for the study of brood parasitism, judging from both the quantity and quality of recent scientific publications on cuckoos, cowbirds and parasitic finches by investigators working in Europe, the Americas, Africa and Asia. As Johnsgard (1997) remarks in his preface, the evolutionary, ecological, and behavioural questions posed by obligate brood parasites are among the most intriguing contemporary ornithological topics. Rothstein & Robinson (1998) explain that brood parasites make ideal subjects for testing the generality of models for the evolution of social and mating behaviour, foraging behaviour, spatial distribution, and vocal development, because the strategy of providing no parental care removes constraints imposed on other birds. Since Aristotle, people have been fascinated by brood parasites, but only in the past two decades has the number of investigators working on this topic reached a critical mass and created momentum that promises many breakthroughs. New studies are being completed so rapidly that a general book is inevitably out of date on some topics by the time it is published. A complete library on brood parasitism should add two recent volumes (Morrison et al. 1999; Smith et al., in press).to the three reviewed here.

  3. Observation of B0 (s) ---> K+ K- and Measurements of Branching Fractions of Charmless Two-body Decays of B0 and B0(s) Mesons in anti-p p Collisions at s**(1/2) = 1.96-TeV

    SciTech Connect

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst. Phys. /Argonne /Barcelona, IFAE /Baylor U. /INFN, Bologna /Bologna U. /Brandeis U. /UC, Davis /UCLA /UC, San Diego /UC, Santa Barbara

    2006-07-01

    The authors search for decays of the type B{sub (s)}{sup 0} {yields} h{sup +}h'{sup -} (where h,h' = K or {pi}) in 180 pb{sup -1} of data collected by the CDF II detector at the Fermilab Tevatron. They observe the new mode B{sub s}{sup 0} {yields} K{sup +}K{sup -} with a yield of 236 {+-} 32 events, corresponding to (f{sub s}/f{sub d}) x {Beta}(B{sub s}{sup 0} {yields} K{sup +}K{sup -})/{Beta}(B{sup 0} {yields} K{sup +}{pi}{sup -}) = 0.46 {+-} 0.08(stat.) {+-} 0.07(syst.), where f{sub s}/f{sub d} is the ratio of production fractions of B{sub s}{sup 0} and B{sup 0}. They find results in agreement with world averages for the modes B{sup 0} {yields} {pi}{sup +}{pi}{sup -} and B{sup 0} {yields} K{sup +}{pi}{sup -}, and set the following upper limits at 90% CL: {Beta}(B{sup 0} {yields} K{sup +}K{sup -}) < 1.8 x 10{sup -6}, {Beta}(B{sub s}{sup 0} {yields} K{sup -}{pi}{sup +}) < 5.6 x 10{sup -6}, and {Beta}(B{sub s}{sup 0} {yields} {pi}{sup +}{pi}{sup -}) < 1.7 x 10{sup -6}.

  4. Lang, S. K. W. and Gardiner, B. D. (2014). "As They Like It--Culture-Centred Counsellor Education in the Context of Aotearoa New Zealand: A Play on Bicultural Pluralism." "British Journal of Guidance and Counselling", 42 (1), 73-85. doi.org./10.1080/03069885.2013.824949

    ERIC Educational Resources Information Center

    Au Yeung, Helen

    2016-01-01

    In their article, Lang and Gardiner draw support from the Treaty of Waitangi to deconstruct cultural dominance and reconstruct a framework, which promotes bicultural pluralism in the new counsellor education programme at the Massey University. However, they omit significant details of the Treaty and therefore mislead the audience to think that the…

  5. Determinant of securitization asset pricing in Malaysia

    NASA Astrophysics Data System (ADS)

    Bakri, M. H.; Ali, R.; Ismail, S.; Sufian, F.; Baharom, A. H.

    2014-12-01

    Malaysian firms have been reported involve in Asset Back Securities since 1986s where Cagamas is a pioneer. This research aims to examine the factor influencing primary market spread. Least square method and regression analysis are applied for the study period 2004-2012. The result shows one determinants in internal regression model and three determinants in external regression influence or contribute to the primary market spread and are statistically significant in developing the securitization in Malaysia. It can be concluded that transaction size significantly contribute to the determinant primary market spread in internal regression model while liquidity, transaction size and crisis is significant in both regression model. From five hypotheses, three hypotheses support that the determinants have a relationship with primary market spread.

  6. Observation of tree-level B decays with ss production from gluon radiation.

    PubMed

    Aubert, B; Bona, M; Boutigny, D; Karyotakis, Y; Lees, J P; Poireau, V; Prudent, X; Tisserand, V; Zghiche, A; Garra Tico, J; Grauges, E; Lopez, L; Palano, A; Eigen, G; Stugu, B; Sun, L; Abrams, G S; Battaglia, M; Brown, D N; Button-Shafer, J; Cahn, R N; Groysman, Y; Jacobsen, R G; Kadyk, J A; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; Lopes Pegna, D; Lynch, G; Mir, L M; Orimoto, T J; Ronan, M T; Tackmann, K; Wenzel, W A; Del Amo Sanchez, P; Hawkes, C M; Watson, A T; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Schroeder, T; Steinke, M; Walker, D; Asgeirsson, D J; Cuhadar-Donszelmann, T; Fulsom, B G; Hearty, C; Mattison, T S; McKenna, J A; Khan, A; Saleem, M; Teodorescu, L; Blinov, V E; Bukin, A D; Druzhinin, V P; Golubev, V B; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Bondioli, M; Curry, S; Eschrich, I; Kirkby, D; Lankford, A J; Lund, P; Mandelkern, M; Martin, E C; Stoker, D P; Abachi, S; Buchanan, C; Foulkes, S D; Gary, J W; Liu, F; Long, O; Shen, B C; Zhang, L; Paar, H P; Rahatlou, S; Sharma, V; Berryhill, J W; Campagnari, C; Cunha, A; Dahmes, B; Hong, T M; Kovalskyi, D; Richman, J D; Beck, T W; Eisner, A M; Flacco, C J; Heusch, C A; Kroseberg, J; Lockman, W S; Schalk, T; Schumm, B A; Seiden, A; Williams, D C; Wilson, M G; Winstrom, L O; Chen, E; Cheng, C H; Fang, F; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Andreassen, R; Mancinelli, G; Meadows, B T; Mishra, K; Sokoloff, M D; Blanc, F; Bloom, P C; Chen, S; Ford, W T; Hirschauer, J F; Kreisel, A; Nagel, M; Nauenberg, U; Olivas, A; Smith, J G; Ulmer, K A; Wagner, S R; Zhang, J; Gabareen, A M; Soffer, A; Toki, W H; Wilson, R J; Winklmeier, F; Zeng, Q; Altenburg, D D; Feltresi, E; Hauke, A; Jasper, H; Merkel, J; Petzold, A; Spaan, B; Wacker, K; Brandt, T; Klose, V; Kobel, M J; Lacker, H M; Mader, W F; Nogowski, R; Schubert, J; Schubert, K R; Schwierz, R; Sundermann, J E; Volk, A; Bernard, D; Bonneaud, G R; Latour, E; Lombardo, V; Thiebaux, Ch; Verderi, M; Clark, P J; Gradl, W; Muheim, F; Playfer, S; Robertson, A I; Xie, Y; Andreotti, M; Bettoni, D; Bozzi, C; Calabrese, R; Cecchi, A; Cibinetto, G; Franchini, P; Luppi, E; Negrini, M; Petrella, A; Piemontese, L; Prencipe, E; Santoro, V; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Pacetti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Buzzo, A; Contri, R; Lo Vetere, M; Macri, M M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Chaisanguanthum, K S; Morii, M; Wu, J; Dubitzky, R S; Marks, J; Schenk, S; Uwer, U; Bard, D J; Dauncey, P D; Flack, R L; Nash, J A; Nikolich, M B; Panduro Vazquez, W; Tibbetts, M; Behera, P K; Chai, X; Charles, M J; Mallik, U; Meyer, N T; Ziegler, V; Cochran, J; Crawley, H B; Dong, L; Eyges, V; Meyer, W T; Prell, S; Rosenberg, E I; Rubin, A E; Gritsan, A V; Guo, Z J; Lae, C K; Denig, A G; Fritsch, M; Schott, G; Arnaud, N; Béquilleux, J; Davier, M; Grosdidier, G; Höcker, A; Lepeltier, V; Le Diberder, F; Lutz, A M; Pruvot, S; Rodier, S; Roudeau, P; Schune, M H; Serrano, J; Sordini, V; Stocchi, A; Wang, W F; Wormser, G; Lange, D J; Wright, D M; Bingham, I; Chavez, C A; Forster, I J; Fry, J R; Gabathuler, E; Gamet, R; Hutchcroft, D E; Payne, D J; Schofield, K C; Touramanis, C; Bevan, A J; George, K A; Di Lodovico, F; Menges, W; Sacco, R; Cowan, G; Flaecher, H U; Hopkins, D A; Paramesvaran, S; Salvatore, F; Wren, A C; Brown, D N; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Chia, Y M; Edgar, C L; Lafferty, G D; West, T J; Yi, J I; Anderson, J; Chen, C; Jawahery, A; Roberts, D A; Simi, G; Tuggle, J M; Blaylock, G; Dallapiccola, C; Hertzbach, S S; Li, X; Moore, T B; Salvati, E; Saremi, S; Cowan, R; Dujmic, D; Fisher, P H; Koeneke, K; Sciolla, G; Sekula, S J; Spitznagel, M; Taylor, F; Yamamoto, R K; Zhao, M; Zheng, Y; McLachlin, S E; Patel, P M; Robertson, S H; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Côté, D; Simard, M; Taras, P; Viaud, F B; Nicholson, H; De Nardo, G; Fabozzi, F; Lista, L; Monorchio, D; Sciacca, C; Baak, M A; Raven, G; Snoek, H L; Jessop, C P; Losecco, J M; Benelli, G; Corwin, L A; Honscheid, K; Kagan, H; Kass, R; Morris, J P; Rahimi, A M; Regensburger, J J; Wong, Q K; Blount, N L; Brau, J; Frey, R; Igonkina, O; Kolb, J A; Lu, M; Rahmat, R; Sinev, N B; Strom, D; Strube, J; Torrence, E; Gagliardi, N; Gaz, A; Margoni, M; Morandin, M; Pompili, A; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Voci, C; Ben-Haim, E; Briand, H; Calderini, G; Chauveau, J; David, P; Del Buono, L; de la Vaissière, Ch; Hamon, O; Leruste, Ph; Malclès, J; Ocariz, J; Perez, A; Gladney, L; Biasini, M; Covarelli, R; Manoni, E; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Cenci, R; Cervelli, A; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Mazur, M A; Morganti, M; Neri, N; Paoloni, E; Rizzo, G; Walsh, J J; Haire, M; Biesiada, J; Elmer, P; Lau, Y P; Lu, C; Olsen, J; Smith, A J S; Telnov, A V; Baracchini, E; Bellini, F; Cavoto, G; D'Orazio, A; Del Re, D; Di Marco, E; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Jackson, P D; Li Gioi, L; Mazzoni, M A; Morganti, S; Piredda, G; Polci, F; Renga, F; Voena, C; Ebert, M; Hartmann, T; Schröder, H; Waldi, R; Adye, T; Castelli, G; Franek, B; Olaiya, E O; Ricciardi, S; Roethel, W; Wilson, F F; Aleksan, R; Emery, S; Escalier, M; Gaidot, A; Ganzhur, S F; Hamel de Monchenault, G; Kozanecki, W; Vasseur, G; Yèche, Ch; Zito, M; Chen, X R; Liu, H; Park, W; Purohit, M V; Wilson, J R; Allen, M T; Aston, D; Bartoldus, R; Bechtle, P; Berger, N; Claus, R; Coleman, J P; Convery, M R; Dingfelder, J C; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Field, R C; Glanzman, T; Gowdy, S J; Graham, M T; Grenier, P; Hast, C; Hryn'ova, T; Innes, W R; Kaminski, J; Kelsey, M H; Kim, H; Kim, P; Kocian, M L; Leith, D W G S; Li, S; Luitz, S; Luth, V; Lynch, H L; Macfarlane, D B; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ofte, I; Perazzo, A; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Snyder, A; Stelzer, J; Su, D; Sullivan, M K; Suzuki, K; Swain, S K; Thompson, J M; Va'vra, J; van Bakel, N; Wagner, A P; Weaver, M; Wisniewski, W J; Wittgen, M; Wright, D H; Yarritu, A K; Yi, K; Young, C C; Burchat, P R; Edwards, A J; Majewski, S A; Petersen, B A; Wilden, L; Ahmed, S; Alam, M S; Bula, R; Ernst, J A; Jain, V; Pan, B; Saeed, M A; Wappler, F R; Zain, S B; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Ritchie, J L; Ruland, A M; Schilling, C J; Schwitters, R F; Izen, J M; Lou, X C; Ye, S; Bianchi, F; Gallo, F; Gamba, D; Pelliccioni, M; Bomben, M; Bosisio, L; Cartaro, C; Cossutti, F; Della Ricca, G; Lanceri, L; Vitale, L; Azzolini, V; Lopez-March, N; Martinez-Vidal, F; Milanes, D A; Oyanguren, A; Albert, J; Banerjee, Sw; Bhuyan, B; Hamano, K; Kowalewski, R; Nugent, I M; Roney, J M; Sobie, R J; Back, J J; Harrison, P F; Ilic, J; Latham, T E; Mohanty, G B; Pappagallo, M; Band, H R; Chen, X; Dasu, S; Flood, K T; Hollar, J J; Kutter, P E; Pan, Y; Pierini, M; Prepost, R; Wu, S L; Neal, H

    2008-05-02

    We report on our search for decays proceeding via a tree-level b-->c quark transition in which a gluon radiates into an ss[over ] pair. We present observations of the decays B;{-}-->D_{s};{+}K;{-}pi;{-} and B[over ];{0}-->D_{s};{+}K_{S};{0}pi;{-} and evidence for B;{-}-->D_{s};{+}K;{-}K;{-} and set upper limits on the branching fractions for B[over ];{0}-->D_{s};{+}K_{S};{0}pi;{-} and B;{-}-->D_{s};{+}K;{-}K;{-} using 383x10;{6} Upsilon(4S)-->BB[over ] events collected by the BABAR detector at SLAC. We present evidence that the invariant mass distributions of D_{s};{+}K;{-} pairs from B;{-}-->D_{s};{+}K;{-}pi;{-} decays are inconsistent with the phase-space model, suggesting the presence of charm resonances lying below the D_{s};{+}K;{-} threshold.

  7. Spectra of prompt electrons from decays of B^+ and B^0 mesons and ratio of inclusive semielectronic branching fractions [rapid communication] Belle Collaboration, T. Okabe, K. Abe, K. Abe, I. Adachi, H. Aihara, M. Akatsu, Y. Asano, T. Aushev, A.M. Bakich, Y. Ban, S. Banerjee, A. Bay, I. Bedny, U. Bitenc, I. Bizjak, S. Blyth, A. Bondar, A. Bozek, M. Bracko, J. Brodzicka, T.E. Browder, Y. Chao, A. Chen, K.F. Chen, W.T. Chen, B.G. Cheon, R. Chistov, S.K. Choi, Y. Choi, Y.K. Choi, A. Chuvikov, S. Cole, J. Dalseno, M. Danilov, M. Dash, A. Drutskoy, S. Eidelman, V. Eiges, Y. Enari,

    NASA Astrophysics Data System (ADS)

    Fratina, S.; Gabyshev, N.; Garmash, A.; Gershon, T.; Go, A.; Gokhroo, G.; Golob, B.; Haba, J.; Hara, T.; Hayasaka, K.; Hayashii, H.; Hazumi, M.; Higuchi, T.; Hinz, L.; Hokuue, T.; Hoshi, Y.; Hou, S.; Hou, W. S.; Iijima, T.; Imoto, A.; Inami, K.; Ishikawa, A.; Itoh, R.; Iwasaki, Y.; Kang, J. H.; Kang, J. S.; Kapusta, P.; Katayama, N.; Kawai, H.; Kawasaki, T.; Kichimi, H.; Kim, H. J.; Kim, J. H.; Kim, S. M.; Kinoshita, K.; Koppenburg, P.; Korpar, S.; Krokovny, P.; Kuo, C. C.; Kwon, Y. J.; Lange, J. S.; Lee, S. E.; Lee, S. H.; Lesiak, T.; Li, J.; Limosani, A.; Lin, S. W.; Liventsev, D.; MacNaughton, J.; Majumder, G.; Mandl, F.; Matsumoto, T.; Matyja, A.; Mitaroff, W.; Miyake, H.; Miyata, H.; Mizuk, R.; Mohapatra, D.; Moloney, G. R.; Nagamine, T.; Nagasaka, Y.; Nakano, E.; Nakao, M.; Natkaniec, Z.; Nishida, S.; Nitoh, O.; Nozaki, T.; Ogawa, S.; Ohshima, T.; Okuno, S.; Olsen, S. L.; Ostrowicz, W.; Palka, H.; Park, C. W.; Park, H.; Park, K. S.; Parslow, N.; Pestotnik, R.; Piilonen, L. E.; Rozanska, M.; Sagawa, H.; Sakai, Y.; Sarangi, T. R.; Schietinger, T.; Schneider, O.; Schumann, J.; Schwanda, C.; Semenov, S.; Seuster, R.; Sevior, M. E.; Shibuya, H.; Singh, J. B.; Somov, A.; Soni, N.; Stamen, R.; Stanic, S.; Staric, M.; Sugiyama, A.; Sumisawa, K.; Sumiyoshi, T.; Suzuki, S.; Suzuki, S. Y.; Tajima, O.; Takasaki, F.; Tamura, N.; Tanaka, M.; Teramoto, Y.; Tian, X. C.; Tsukamoto, T.; Uehara, S.; Ueno, K.; Uglov, T.; Uno, S.; Varner, G.; Varvell, K. E.; Wang, C. C.; Wang, C. H.; Wang, M. Z.; Watanabe, M.; Watanabe, Y.; Yabsley, B. D.; Yamaguchi, A.; Yamashita, Y.; Yamauchi, M.; Yang, H.; Ying, J.; Yusa, Y.; Zhang, J.; Zhang, L. M.; Zhang, Z. P.; Zhilich, V.; Zontar, D.

    2005-05-01

    We present spectra of prompt electrons from decays of neutral and charged B mesons. The results are based on 140 /fb of data collected by the Belle detector on the Upsilon(4S) resonance at the KEKB e+e- asymmetric collider. We tag Upsilon(4S) -> B \\bar{B} events by reconstructing a B meson in one of several hadronic decay modes; the semileptonic decay of the other B meson is inferred from the presence of an identified electron. We obtain for charged and neutral B mesons the partial rates of semileptonic decay, to electrons with momentum greater than 0.6 GeV/c in the B rest frame, and their ratio b_+/b_0 = 1.08 +- 0.05 +- 0.02, where the first and second errors are statistical and systematic, respectively.

  8. [Financing problems of capital goods. Part 2: procedure for investment appraisal].

    PubMed

    Clausen, C C; Bauer, M; Saleh, A; Picker, O

    2008-07-01

    In part 1 of this series about problems of financing capital goods the multiple and partly diametric economic effects of financing instruments were presented using the leasing procedure as an example. The result indicated that due to the complexity of these effects the choice of a specific financing instrument requires an individual consideration. Therefore, part 2 of the series introduces the method of dynamic capital budgeting which allows the instruments discussed in part 1 to be compared with each other and helps to evaluate their economic benefits. More precisely this paper focuses on a comparative analysis of the most common alternatives, leasing, credit financing and investment financing by the state. In this context, after having identified the total costs of ownership of anesthesia devices, the final asset values of the three financing instruments can be compared with each other using the method of dynamic capital budgeting. In contrast to the prevailing opinion, the results show that from a purely fiscal perspective leasing anesthesia devices is the most expensive alternative. Given the fact that no financial support is available from the state, the option of credit financing turns out to be the most preferable alternative from a relatively limited pool of possibilities. However, it still remains to be answered whether credit financing can defend this position against further, innovative forms of debt financing (e.g., factoring, asset-backed securities, hedge funds, mezzanine capital, etc.).

  9. Stable and Metastable InGaAs/GaAs Island Shapes and Surfactant-like Suppression of the Wetting Transformation

    NASA Technical Reports Server (NTRS)

    Leon, R.; Lobo, C.; Zou, J.; Romeo, T.; Cockayne, D. J. H.

    1998-01-01

    Diverging behaviors are observed in the InGaAs/GaAs Stranski-Krastanow (S-K) island formation during vapor phase epitaxy: varying group V partial pressures gives different critical thicknesses for the onset of the S-K transformation, island surface coverages, ratios between coherent and incoherent islands, and dissimilar morphologies upon annealing.

  10. Membrane-Mediated Extraction and Biodegradation of Volatile Organic Compounds From Air

    DTIC Science & Technology

    2005-01-01

    mixtures through PTMSP.” Makromol. Chem. Rapid Commun. 7: 43. Ji, W., S.K. Sikdar , and S.–T. Hwang (1994a). “Modeling of multicomponent...pervaporation for removal of volatile organic compounds from water.” J. Membrane Sci. 93: 1. Ji, W., A. Hilaly, S.K. Sikdar , and S.–T. Hwang (1994b

  11. Neurophysiological Research Supporting the Investigation of Adaptive Network Architectures

    DTIC Science & Technology

    1985-08-14

    Publications Aou, S., Ooinura, Y., Nishino, H., Ono, T., Yamabe, K., Sikdar , S.K., and Noda, T. Functional heterogeneity of single neuronal activity in the...Oomura, Y., Nishino, H., Aou, S., Sikdar , S*K., Hynes, M., Mizuno, Y., and Katafuchi, T. Cholinergic role in monkey dorsolateral prefrontal cortex during

  12. Dynamic structure factor of vibrating fractals.

    PubMed

    Reuveni, Shlomi; Klafter, Joseph; Granek, Rony

    2012-02-10

    Motivated by novel experimental work and the lack of an adequate theory, we study the dynamic structure factor S(k,t) of large vibrating fractal networks at large wave numbers k. We show that the decay of S(k,t) is dominated by the spatially averaged mean square displacement of a network node, which evolves subdiffusively in time, ((u[over →](i)(t)-u[over →](i)(0))(2))∼t(ν), where ν depends on the spectral dimension d(s) and fractal dimension d(f). As a result, S(k,t) decays as a stretched exponential S(k,t)≈S(k)e(-(Γ(k)t)(ν)) with Γ(k)∼k(2/ν). Applications to a variety of fractal-like systems are elucidated.

  13. Self Assembled Spin Coated and Bulk Films of a Novel Polydiacetylene as Second Order NLO Polymers

    DTIC Science & Technology

    1994-05-31

    NLO Polymers 6. AUTHOm(m) R&T Code: 4132016 W.H. Kim, B. Bihari, R. Moody, N. B. Kodali , J.Kumar,S.K. Dr. JoAnn MilUiken Tripathy. 7. PERFORMING...Polymers by W.H. Kim, B. Bihari, R. Moody, N. B. Kodali , J.Kumar,S.K. Tripathy. Submitted to Macromolecules University of Massachusetts Lowell Department...FILMS OF A NOVEL POLYDIACETYLENE AS SECOND ORDER NLO POLYMERS W. H. Kim, B. Bihari+, R. Moody+, N. B. Kodali , J. Kumar+, and S. K. Tripathy, University

  14. Observational Studies on Association between Eastward Equatorial Jet and Indian Ocean Dipole

    DTIC Science & Technology

    2010-01-01

    School sponsored this re- search. References Chang, P., T. Yamagata, P. Schopf, S. K. Behera , J. Carton, W. S. Kessler, G. Meyers, T. Qu, F. Schott...J. Atmos. Oceanic Technol., 24, 688–701. Rao, A. S., S. K. Behera , Y. Masumoto and T. Yamagata (2002): Interannual variability in the subsurface...T., S. K. Behera , J.-J. Luo, S. Masson, M. Jury and S. A. Rao (2004): Coupled ocean-atmosphere variability in the tropical Indian Ocean. p. 189–212

  15. Using Averaging-Based Factorization to Compare Seismic Hazard Models Derived from 3D Earthquake Simulations with NGA Ground Motion Prediction Equations

    NASA Astrophysics Data System (ADS)

    Wang, F.; Jordan, T. H.

    2012-12-01

    Seismic hazard models based on empirical ground motion prediction equations (GMPEs) employ a model-based factorization to account for source, propagation, and path effects. An alternative is to simulate these effects directly using earthquake source models combined with three-dimensional (3D) models of Earth structure. We have developed an averaging-based factorization (ABF) scheme that facilitates the geographically explicit comparison of these two types of seismic hazard models. For any fault source k with epicentral position x, slip spatial and temporal distribution f, and moment magnitude m, we calculate the excitation functions G(s, k, x, m, f) for sites s in a geographical region R, such as 5% damped spectral acceleration at a particular period. Through a sequence of weighted-averaging and normalization operations following a certain hierarchy over f, m, x, k, and s, we uniquely factorize G(s, k, x, m, f) into six components: A, B(s), C(s, k), D(s, k, x), E(s, k, x, m), and F(s, k, x, m, f). Factors for a target model can be divided by those of a reference model to obtain six corresponding factor ratios, or residual factors: a, b(s), c(s, k), d(s, k, x), e(s, k, x, m), and f(s, k, x, m, f). We show that these residual factors characterize differences in basin effects primarily through b(s), distance scaling primarily through c(s, k), and source directivity primarily through d(s, k, x). We illustrate the ABF scheme by comparing CyberShake Hazard Model (CSHM) for the Los Angeles region (Graves et. al. 2010) with the Next Generation Attenuation (NGA) GMPEs modified according to the directivity relations of Spudich and Chiou (2008). Relative to CSHM, all NGA models underestimate the directivity and basin effects. In particular, the NGA models do not account for the coupling between source directivity and basin excitation that substantially enhance the low-frequency seismic hazards in the sedimentary basins of the Los Angeles region. Assuming Cyber

  16. 1993 annual report of hazardous waste activities for the Oak Ridge K-25 site

    SciTech Connect

    Not Available

    1994-02-01

    This report is a detailed listing of all of the Hazardous Waste activities occurring at Martin Marietta`s K-25 site. Contained herein are hazardous waste notification forms, waste stream reports, generator fee forms and various TSDR reports.

  17. CP Violation in b to s Penguins at the B Factories

    SciTech Connect

    Payne, David; /Liverpool U.

    2007-09-26

    Measurements of CP violating observables of the decays B{sup 0} {yields} {phi}K{sup 0}, B{sup 0} {yields} {eta}'K{sub S}, B{sup 0} {yields} {rho}K{sub S}, B{sup 0} {yields} K{sup +}K{sup -}K{sup 0} and B{sup 0} {yields} K{sub S}K{sub S}K{sub S} are presented. In addition limits on the branching functions of B{sup 0} {yields} {phi}{pi}{sup 0}, B{sup 0} {yields} {phi}{pi}{sup +}, B {yields} K{sup *}K{sub S}, B {yields} {eta}'{pi}{sup 0}, B {yields} {eta}'{eta}, and B{sup 0} {yields} K{sub S}K{sub S}K{sub L} are reported.

  18. 77 FR 59193 - Notice of Agreement Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-26

    ....; Hyundai Merchant Marine Co., Ltd.; and Mitsui O.S.K. Lines, Ltd. (``MOL''). Filing Party: David F. Smith, Esquire; Cozen O'Connor; 1627 I Street NW., Suite 1100; Washington, DC 20006-4007. Synopsis: The...

  19. 75 FR 17917 - Notice of Agreement Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-08

    ..., Ltd.; Hyundai Merchant Marine Co., Ltd.; and Mitsui O.S.K. Lines, Ltd. (``MOL''). Filing Party: Robert.... Synopsis: The amendment updates the address of American President ] Lines, Ltd. and allows MOL to...

  20. 12 CFR Appendix A to Part 1273 - Exceptions to the General Disclosure Standards

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ..., where the advances of all affiliates within a holding company are aggregated. B. Biographical information. The biographical information required by Items 401 and 405 of Regulation S-K, 17 CFR 229.401...

  1. Global Upper Ocean Heat Content and Climate Variability

    DTIC Science & Technology

    2011-01-01

    References Ashok K, Behera S, Rao A. S, Weng H., and Yamagata, T., 2007. El Nino Modoki and...2027–2033. Rao, S. A., S. K. Behera , Y. Masumoto, and T. Yamagata, 2002. Interannual subsurface variability in the tropical Indian Ocean with a...W., 1937. World weather VI. Mem. Roy. Meteor. Soc., 4, 119–139. Weng, H., Ashok, S. K., Behera , S., . Rao, A., Yamagata, T., 2007

  2. Pressure distribution in the humeroradial joint and force transmission to the capitellum during rotation of the forearm: effects of the Sauvé-Kapandji procedure and incision of the interosseous membrane.

    PubMed

    Ofuchi, S; Takahashi, K; Yamagata, M; Rokkaku, T; Moriya, H; Hara, T

    2001-01-01

    A biomechanical study was undertaken, using four fresh cadaveric arms, to evaluate the changes in pressure distribution in the humeroradial joint (H-R joint) during rotation of the forearm before and after the Sauvé-Kapandji procedure (S-K procedure) and also after incision of the interosseous membrane (IOM) following the S-K procedure. The pressure distribution was measured with a pressure-sensitive conductive rubber sensor while the forearm was rotated. Force transmitted to the capitellum was calculated from the measured pressure. In the intact specimens, pressure was concentrated on the medial side of the capitellum in pronation and on the posterolateral side in supination. The pattern of change after the S-K procedure and that after incision of the IOM following the S-K procedure were almost the same as that in the intact forearm. Although the force transmitted to the capitellum increased after the S-K procedure, there were no significant differences between the forces before and after the S-K procedure. However, the force increased significantly after incision of the IOM following the S-K procedure when the forearm was supinated more than 35 degrees, and it was concentrated on the posterior side of the capitellum. The IOM seemed to have an important axial load-bearing function in the forearm position supinated more than 35 degrees. The S-K procedure in patients suffering from distal radioulnar joint disorders with IOM injury is likely to induce H-R joint osteoarthritis, so it should be avoided in these patients.

  3. Evaluation of Marsh/Estuarine Water Quality and Ecological Models: An Interim Guide

    DTIC Science & Technology

    1982-01-01

    Simulations," Report R-709-NYC, Rand Corporation , Santa Monica, Calif. Leendertse, J. J., and Liu, S-K. 1975. "A Three Dimensional Model for Estuaries and...Coastal Seas: Vol II - Aspects of Computation," Report 5-1764-OWRT, Rand Corporation , Santa Monica, Calif. • 1977. "A Three Dimensional Model for...Estuaries and Coastal Seas: Vol IV - Turbulent Energy Computation," Report R-2187-OWRT, Rand Corporation , Santa Monica, Calif. Liu, S-K., and Leendertse, J

  4. Quantifying Hurricane Wind Speed with Undersea Sound

    DTIC Science & Technology

    2006-06-01

    138]. These second order non-linear or perturbation-based theories should not be con- fused with the linear theories proposed by Banerji [5] and Bowen...October 2001. Technical report, National Hurricane Center, 2001. [5] S. K. Banerji . Microseisms associated with disturbed weather in the indian seas...Phil. Trans. Roy. Soc. Lon. Ser. A., 229:287-328, 1930. [6] S. K. Banerji . Theory of microseisms. Proc. Indian Acad. Sci., 1:727-753, 1935. [7] R. L

  5. Polyaminoacid-Induced Growth of Metal Nanoparticles on Layer-by-Layer Templates

    DTIC Science & Technology

    2008-08-21

    Prozorov, T.; Mallapragada, S. K .; Narasimhan, B.; Wang, L.; Palo, P .; Nilsen-Hamilton, M.; Williams, T. J.; Bazylinski, D. A.; Prozorov, R.; Canfield...Srisathiyanarayanan, D.; Shirude, P . S.; Pasricha, R.; Mandale, A. B.; Sastry, M. Langmuir 2004, 20, 7825. (16) Bhargava, S. K .; Booth, J. M.; Agrawal, S...Coloe, P .; Kar, G. Langmuir 2005, 21, 5949. (17) Si, S.; Bhattacharjee, R. R.; Banerjee, A.; Mandal, T. K . Chem.sEur. J. 2006, 12, 1256. (18

  6. Decrease in serum potassium concentration during epidural anaesthesia.

    PubMed

    Hahn, R G

    1987-11-01

    A mean decrease in the arterial serum potassium concentration (S-K) of 0.40 mmol/l (range 0-1.0) was found in 45 elderly men who were studied before and after induction of epidural anaesthesia (using mepivacaine 2% with adrenaline). The decrease was similar in patients who received acetated Ringer solution or dextran 40 in normal saline as intravenous fluid supplementation. No difference in S-K change was found between patients with a normal (less than 115 mumol/l) or elevated serum creatinine concentration. The decrease in S-K prevailed at the end of surgery except in patients with an elevated serum creatinine. Corrections of S-K for changes in arterial blood pH and rectal temperature during induction of anaesthesia did not explain the decrease in S-K. Correlations of clinical parameters such as the extension of anaesthesia, amount of intravenous fluid given and blood pressure changes gave conflicting results. A smaller decrease or no change in S-K was usually seen in arterial (n = 7) and venous (n = 7) samples when no intravenous fluid was given, as well as in venous samples when acetated Ringer solution was given (n = 6).

  7. Suppressed decays of D(s)(+) mesons to two pseudoscalar mesons.

    PubMed

    Adams, G S; Anderson, M; Cummings, J P; Danko, I; Hu, D; Moziak, B; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Artuso, M; Blusk, S; Khalil, S; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Naik, P; Briere, R A; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Cassel, D G; Duboscq, J E; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Mohapatra, D; Onyisi, P U E; Patterson, J R; Peterson, D; Riley, D; Ryd, A; Sadoff, A J; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Athar, S B; Patel, R; Yelton, J; Rubin, P; Eisenstein, B I; Karliner, I; Lowrey, N; Selen, M; White, E J; Wiss, J; Mitchell, R E; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Zweber, P; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Ernst, J; Ecklund, K M; Severini, H; Love, W; Savinov, V; Lopez, A; Mehrabyan, S; Mendez, H; Ramirez, J; Ge, J Y; Miller, D H; Sanghi, B; Shipsey, I P J; Xin, B

    2007-11-09

    Using data collected near the D{s}{*+}D{s}{-} peak production energy E_{cm}=4170 MeV by the CLEO-c detector, we study the decays of D{s}{+} mesons to two pseudoscalar mesons. We report on searches for the singly Cabibbo-suppressed D{s}{+} decay modes K{+}eta, K{+}eta', pi{+}K{S}{0}, K{+}pi{0}, and the isospin-forbidden decay mode D{s}{+}-->pi{+}pi{0}. We normalize with respect to the Cabibbo-favored D{s}{+} modes pi{+}eta, pi{+}eta', and K{+}K{S}{0}, and obtain ratios of branching fractions: B(D{s}{+}-->K{+}eta)/B(D{s}{+}-->pi{+}eta)=(8.9+/-1.5+/-0.4)%, B(D{s}{+}-->K{+}eta')/B(D{s}{+}-->pi{+}eta')=(4.2+/-1.3+/-0.3)%, B(D{s}{+}-->pi{+}K{S}{0})/B(D{s}{+}-->K{+}K{S}{0})=(8.2+/-0.9+/-0.2)%, B(D{s}{+}-->K{+}pi{0})/B(D{s}{+}-->K{+}K{S}{0})=(5.5+/-1.3+/-0.7)%, and B(D{s}{+}-->pi{+}pi{0})/B(D{s}{+}-->K{+}K{S}{0})<4.1% at 90% C.L., where the uncertainties are statistical and systematic, respectively.

  8. Assaying multiple 125I seeds with the well-ionization chamber SourceCheck4π 33005 and a new insert

    PubMed Central

    Ballester, Facundo; Perez-Calatayud, Jose; Vijande, Javier

    2015-01-01

    Purpose To provide a practical solution that can be adopted in clinical routine to fulfill the AAPM-ESTRO recommendations regarding quality assurance of seeds used in prostate permanent brachytherapy. The aim is to design a new insert for the well-ionization chamber SourceCheck4π 33005 (PTW, Germany) that allows evaluating the mean air-kerma strength of up to ten 125I seeds with one single measurement instead of measuring each seed individually. Material and methods The material required is: a) the SourceCheck4π 33005 well-ionization chamber provided with a PTW insert to measure the air-kerma strength S K of one single seed at a time; b) a newly designed insert that accommodates ten seeds in one column, which allows measuring the mean S K of the ten seeds in one single measurement; and c) a container with ten seeds from the same batch and class of the seeds used for the patient implant, and a set of nine non-radioactive seeds. The new insert is characterized by determining its calibration coefficient, used to convert the reading of the well-chamber when ten seeds are measured to their mean S K. The proposed method is validated by comparing the mean S K of the ten seeds obtained from the new insert with the individual measurement of S K of each seed, evaluated with the PTW insert. Results The ratio between the calibration coefficient of the new insert and the calibration coefficient of the PTW insert for the SourceCheck4π 33005 is 1.135 ± 0.007 (k = 1). The mean S K of a set of ten seeds evaluated with this new system is in agreement with the mean value obtained from measuring independently the S K of each seed. Conclusions The new insert and procedure allow evaluating the mean S K of ten seeds prior to the implant in a single measurement. The method is faster and more efficient from radiation protection point of view than measuring the individual S K of each seed. PMID:26816507

  9. The short-term outcome of the modified Sauvé-Kapandji procedure regarding range of motion, carpal bone translation and bony shelf size.

    PubMed

    Toyama, Shogo; Tamai, Kazuo; Sakamoto, Atsuto; Hirashima, Toshiko

    2011-02-01

    The Sauvé-Kapandji (S-K) procedure is a common treatment for rheumatoid wrists, but in some cases severe bone destruction makes this operative modality difficult to perform, while also resulting in a poor outcome. A modified S-K procedure for these wrists has been reported, but the clinical outcomes of the modified procedure are unclear. This study evaluated 24 wrists in 20 patients who underwent the modified S-K procedure. The mean follow-up period was 34.5 months. The clinical assessments were range of motion, carpal bone translation and bony shelf size. The range of motion and carpal bone translation were similar to those produced by the S-K procedure. In regard to bony shelf size, wrists with an excessively large bony shelf tended to have a progression of carpal bone translation toward the palmar direction due to the residual malposition of the ECU tendon. The modified S-K procedure appears to be a safe and effective surgical alternative for the treatment of severely destroyed rheumatoid wrists. Although the modified procedure allows for the adjustment of the bony shelf size, it should not be used with wrists that have an excessively large bony shelf.

  10. Clinical and radiological manifestations of the rheumatoid wrist after the Sauvé-Kapandji procedure.

    PubMed

    Momohara, Shigeki; Mamizuka, Kyoko; Yonemoto, Kouichi; Tomatsu, Taisuke; Inoue, Kazuhiko

    2004-01-01

    A retrospective study was performed to investigate the clinical and radiological results of the Sauvé-Kapandji (S-K) procedure for the rheumatoid wrist. One hundred and eight rheumatoid wrists in 98 patients were operated on in our institute from 1992 to 2000, and in 82 wrists we used the S-K procedure. In other cases, synovectomy alone was performed on 16 wrists, and partial and total arthrodeses were performed concurrently on 5 wrists each. Carpal bones and/or radiocarpal joints in which the union could not be assessed radiologically were found in 49 wrists (59.8%) after the S-K procedure, and among them there was definite non-fusion of the carpal bone and radiocarpal joints in 29 wrists (35.4%). However, definite fusion of carpal bones and/or radiocarpal joints was found in 33 wrists (40.2%). The formation of carpal bones and partial radiocarpal fusion with some mobility was detected in some cases. Therefore, the S-K procedure may stabilize the carpus in the rheumatoid wrist to some extent while maintaining a functionally important range of motion and relieving pain. However, it does not stop the disease process and cannot reestablish or maintain carpal height. We concluded that the S-K procedure is the treatment of choice for the rheumatoid wrist, and if the wrist is unstable, as seen with arthritis mutilans, we then perform either radio-lunate partial arthrodesis or total wrist arthrodesis.

  11. Defect Identification in Composite Structures Using Enhanced Signal Analysis

    DTIC Science & Technology

    2011-01-07

    sdss ss k k k kk k k ds dd k k k k ss ss ss ss sd k k k k k k k ds ss k k n n n n k...matrix-vector form, is 11,1 | 1 | 1 | 1 | 1, , 1 | 1 | 1 | 1 | 1, 1, , 1,1 | 1 | 1 , , 1, , j i ji ss sd k k k k ds dd k k k k sdss ss k k k k k k d dds...1, , 1, , 1, , 1, , , [ ] i ji s s di j j i i ji d dds d s k k k k i j k k sdss ss k k k k k k i j sdss k k k kss d s k k k k i j d dd s k k k n n

  12. Observation of B ^+ → J/ψ 3π ^+ 2π ^- and B ^+ → ψ (2S) π ^+ π ^+ π ^- decays

    NASA Astrophysics Data System (ADS)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baszczyk, M.; Batozskaya, V.; Batsukh, B.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Bird, T.; Birnkraut, A.; Bitadze, A.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bonivento, W.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britsch, M.; Britton, T.; Brodzicka, J.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Calabrese, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch.; Cavallero, G.; Cenci, R.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S.-F.; Chobanova, V.; Chrzaszcz, M.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collazuol, G.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Dall'Occo, E.; Dalseno, J.; David, P. N. Y.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C.-T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Dungs, K.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Déléage, N.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fay, R.; Fazzini, D.; Ferguson, D.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Furfaro, E.; Färber, C.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Griffith, P.; Grillo, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Han, X.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hatch, M.; He, J.; Head, T.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; Hernando Morata, J. A.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hombach, C.; Hopchev, H.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hussain, N.; Hutchcroft, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Kanso, W.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kecke, M.; Kelsey, M.; Kenyon, I. R.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Koliiev, S.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Kosmyntseva, A.; Kozachuk, A.; Kozeiha, M.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.-P.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Likhomanenko, T.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, B.; Liu, X.; Loh, D.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Maev, O.; Maguire, K.; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Manning, P.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurin, B.; Mazurov, A.; McCann, M.; McCarthy, J.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Minard, M.-N.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morawski, P.; Mordà, A.; Morello, M. J.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Mussini, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Otalora Goicochea, J. M.; Otto, A.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palombo, F.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pistone, A.; Piucci, A.; Playfer, S.; Plo Casasus, M.; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Popov, A.; Popov, D.; Popovici, B.; Poslavskii, S.; Potterat, C.; Price, E.; Price, J. D.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schubert, K.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Snoek, H.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Toriello, F.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vallier, A.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Vernet, M.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y.; Xing, Z.; Xu, Z.; Yang, Z.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhokhov, A.; Zhu, X.; Zhukov, V.; Zucchelli, S.

    2017-02-01

    The decays B ^+ → J/ψ 3π ^+ 2π ^- and B ^+ → ψ (2S) π ^+ π ^+ π ^- are observed for the first time using a data sample corresponding to an integrated luminosity of 3.0 fb^-1, collected by the LHCb experiment in proton-proton collisions at the centre-of-mass energies of 7 and 8 TeV. The branching fractions relative to that of B ^+ → ψ (2S) K ^+ are measured to be dfrac B ( B ^+ → J/ψ 3π ^+ 2π ^- )B ( B ^+ → ψ (2S) K ^+ )= & ( 1.88± 0.17± 0.09)× 10^-2, dfrac B ( B ^+ → ψ (2S) π ^+ π ^+ π ^- )B ( B ^+ → ψ (2S) K ^+ )= & ( 3.04± 0.50± 0.26)× 10^-2, where the first uncertainties are statistical and the second are systematic.

  13. Elementary modes of coupled oscillators as whispering-gallery microresonators

    NASA Astrophysics Data System (ADS)

    Banerjee, Rabin; Mukherjee, Pradip

    2015-10-01

    We obtain the elementary modes of a system of parity-time reversal (PT)-symmetric coupled oscillators with balanced loss and gain. These modes are used to give a physical picture of the phase transition recently reported [C. M. Bender, M. Gianfreda, B. Peng, S. K. Özdemir and L. Yang, Phys. Rev. A 88, 062111 (2013); L. Yang, S. K. Özdemir and B. Peng, 12th Int. Workshop and Conf. Pseudo-Hermitian Hamiltonians in Quantum Physics, Istanbul, Turkey, July 2013; B. Peng, S. K. Özdemir, F. Lei, F. Monifi, M. Gianfreda, G. L. Long, S. Fan, F. Nori, C. M. Bender and L. Yang, Nat. Phys. 10, 394 (2014)] in experiments with whispering-gallery microresonators.

  14. Optimal cloning of qubits from replicas of a qubit and its orthogonal states

    SciTech Connect

    Kato, Go

    2010-09-15

    We consider the situation where s replicas of a qubit with an unknown state and its orthogonal k replicas are given as an input, and we try to make c clones of the qubit with the unknown state. As a function of s, k, and c, we obtain the optimal fidelity between the qubit with an unknown state and the clone by explicitly giving a completely positive trace-preserving (CPTP) map that represents a cloning machine. We discuss dependency of the fidelity on the values of the parameters s, k, and c.

  15. National Defense Authorization Act for Fiscal Year 2014

    DTIC Science & Technology

    2013-06-20

    C on gr es s. #1 3 rm aj et te o n D S K 2T P T V N 1P R O D w ith H E A R IN G N A TIO N A L D EFEN...SR044 E: \\S ea ls \\ C on gr es s. #1 3 rm aj et te o n D S K 2T P T V N 1P R O D w ith H E A R IN G (II) COMMITTEE ON ARMED SERVICES CARL LEVIN... H E A R IN G (III) C O N T E N T S Page Purpose of the

  16. SIRT3 is a Mitochondrial Tumor Suppressor and Genetic Loss Results in a Murine Model for ER/PR-Positive Mammary Tumors Connecting Metabolism and Carcinogenesis SIRT3 is a Mitochondrial Tumor Suppressor

    DTIC Science & Technology

    2012-09-01

    443, 2011. 4. Park, S-K., Ozden, O., Jiang, H., Cha, Y.I., Pennington, J.D., Aykin- Burns , N., Spitz, D.R., Gius, D., Kim, S-K. Sirt3, mitochondrial... arginine , mimicking deacetylation (lenti-MnSODK122-R), increased MnSOD activity when expressed in MnSOD-/- MEFs, suggesting acetylation directly...demonstrated that OSCP lysine 139 is deacetylated by Sirt3. Finally, OSCP lysine 139 was mutated to arginine , mimicking deacetylation (CMV-OSCPK139-R) and

  17. Self Assembled Spin Coated and Bulk Films of a Novel Polydiacetylene as Second Order NLO Polymers

    DTIC Science & Technology

    1994-05-31

    T Code: 4132016 W.H. Kim, B. Bihari, R. Moody, N. B. Kodali , J.KumarS.K. Dr. JoAnn Milliken Tripathy. 7. PHI-OUHMING OFH-NIZATION NAMIE(S) AND...Self Assembled Spin Coated and Bulk Films of a Novel Polydiacetylene as Second Order NLO Polymers by W.H. Kim, B. Bihari, R. Moody, N. B. Kodali ...POLYMERS W. H. Kim, B. Bihari+, R. Moody+, N. B. Kodali , J. Kumar+, and S. K. Tripathy, University of Massachusetts-Lowell, Center for Advanced Materials

  18. Radio Implementation of a Testbed For Cognitive Radio Source Localization Using USRPS and GNU Radio

    DTIC Science & Technology

    2014-09-01

    pp. 116–130, 2009. [4] R.A. Rashid , M.A. Sarijari, N. Fisal, S.K.S. Yusof and N.H. Mahalin, “Spectrum sensing measurement using GNU Radio and...USRP software radio platform,” in Proc. 7th Int. Conf. Wireless and Mobile Commun., Luxembourg, 2011. [5] R.A. Rashid , M.A. Sarijari, N. Fisal...Sarijari, A. Marwanto, N. Fisal, S.K.S. Yusof and R.A Rashid , “Energy detection sensing based on GNU Radio and USRP: An analysis study,” in Proc

  19. World at Risk: The Report of the Commission on the Prevention of WMD Proliferation and Terrorism

    DTIC Science & Technology

    2008-12-01

    members contaminated 10 restaurant salad bars in a town in Oregon with salmonella, a common bacterium that causes food poisoning. The attack sickened 751...i c a l a n d N u c l e a r R i s k s Sufaat fled; he was captured by authorities as he tried to sneak back into Malaysia . The cases of the... waste associated with the spent nuclear fuel—the number of states possessing the knowledge and capa- B i o l o g i c a l a n d N u c l e a r R i s k s

  20. The Effects of Orientation and Elevated Acceleration on the Cooling Performance of a Centrifuge-Mounted Spray Cooling System

    DTIC Science & Technology

    2010-09-01

    the range of 0.01 to 1.8g’s in both single phase ( Yerkes , et al. 2006) and two-phase(Michalak, et al. 2010) operation. Spray cooled arrays have been...technician support in the experimental setup and testing phases. 29 6. Bibliography Elston, L. J., K. L. Yerkes , S. K. Thomas, and J. McQuillen...Conference. 2005. Michalak, T. E., K. L. Yerkes , S. K. Thomas, and J. McQuillen. "Acceleration Effects on the Cooling Performance of a Partially Confined FC

  1. Training Head Start Coordinators for Workplace Preparedness. NCCU Head Start Monograph, October 1995.

    ERIC Educational Resources Information Center

    North Carolina Central Univ., Durham.

    This monograph summarizes results from academic capstone activities of graduate students and faculty advisors regarding issues consistent with Head Start national priorities and practice needs. The following theses are summarized: (1) "Multicultural Education in Head Start Programs in North Carolina" (S.K. Gant); (2) "The Impact of…

  2. Cross-National Survey of Educational Issues as Expressed by Botswana and American Public School Teachers.

    ERIC Educational Resources Information Center

    Shaw, Larry J.; Tlou, Josiah

    The report of a study that investigated the views held by Botswana and U.S. K-12 teachers on a variety of contemporary educational issues prominent in the United States is presented. The study concerned itself with the level of agreement or disagreement between the views of the two groups of teachers, and contends that interpretations of such…

  3. Incidence of Visible and Occult Blood on Laryngoscope Blades and Handles

    DTIC Science & Technology

    1996-05-01

    Mississippi Board of Nursing # : R748757 II MILITARY EXPERIENCE : 1992-1994 Staff Nurse Adult / Pediatric Intensive Care Unit Keesler Medical Center...Infectious diseases and the anaesthetist. Canadian Journal of Anaesthesiology 35 (6), 655-665. Burns, N., & Grove, S. K. (1993). The Practice of Nursing

  4. Invitational Papers Submitted to the Select Education Subcommittee of the Education and Labor Committee of the U. S. House of Resprsentatives.

    ERIC Educational Resources Information Center

    Educational Testing Service, Princeton, NJ.

    These invitational papers submitted by ETS staff members to the Select Education Subcommittee discuss various aspects of educational change and improvement, planning and evaluation. Papers include: "Open Education: Changing Schools for Children," (Edward A. Chittenden); "Planning for New Students to Higher Education in the 70's," (K. Patricia…

  5. Teacher Dress Codes in Employee Handbooks: An Analysis

    ERIC Educational Resources Information Center

    Workman, Jane E.; Freeburg, Beth Winfrey

    2010-01-01

    This study used role theory to analyze dress codes for teachers to discern what dress items expressed role embracement and role distance. Inductive content analysis of teacher dress codes in 103 U.S. K-12 school handbooks revealed three categories of dress: (a) conventional dress (mentioned in 97.1% of the dress codes); (b) casual dress (mentioned…

  6. 78 FR 66713 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-06

    ... Shipping Container Lines Co., Ltd; China Shipping Container Lines (Hong Kong) Co., Ltd.; Companhia Libra de....; Mediterranean Shipping Company, S.A.; Mitsui O.S.K. Lines Ltd.; Nippon Yusen Kaisha Line; Norasia Container... agreements under the Shipping Act of 1984. Interested parties may submit comments on the agreements to...

  7. Automatic Organ Localization for Adaptive Radiation Therapy for Prostate Cancer

    DTIC Science & Technology

    2005-05-01

    13 716-724 Zou K H, Warfield S K, Baharatha A, Tempany C, Kaus M R, Haker S J, Wells W M, Jolesz F A and Kikinis R 2004 Statistical validation of image segmentation quality based on a spatial overlap index Academic Radiology 11 178-189

  8. High-Speed Broadband: A Need for Speed

    ERIC Educational Resources Information Center

    Rivero, Victor

    2006-01-01

    Nearly all US schools are now connected to the Internet. However, slow connectivity is creating bottlenecks in schools, frustrating students and leaving them disarmed in the battle to stay competitive in the 21st century. Slow connectivity is imperiling the quality of U.S. K-12 education, while the rest of the world sets the pace technologically.…

  9. Six-Month Evaluation of Extended Wear Soft Contact Lenses Among Armored Troops. Part 1. Clinical Findings

    DTIC Science & Technology

    1989-06-01

    Doctini Cou i Id s K.. ’rned A’ ’is TeSI I oumicroscorry onl asyr iptoirnac coritact-lens-wearing recruits Ar. I vili riili a I To a, QiiuviiridW ,’a...Optometry The University of Alabama, Birmingham Birmingham, AL 35294 About the Authors William G. Bachman received the Doctor of Op- tometry degree from

  10. Assessing Multicultural Competence: Perceived versus Demonstrated Performance

    ERIC Educational Resources Information Center

    Cartwright, Brenda Y.; Daniels, Judy; Zhang, Shuqiang

    2008-01-01

    This study compares self-report scores generated by the Multicultural Awareness Knowledge Skills Survey-Counselor Edition-Revised (B. S. K. Kim, B. Y. Cartwright, P. A. Asay, & M. J. D'Andrea, 2003) with independent observer ratings of actual videotaped demonstrations of multicultural competence in response to a preselected case vignette.…

  11. Breast Cancer Vaccines That Overcome Tolerance and Immune Suppression

    DTIC Science & Technology

    2011-01-01

    detector (resolving power 100,000) and consecutive low-resolution, collision -induced dissociation of up to five most abundant ions in the linear ion...8200- 8208 9. Bunt, S.K., Clements, V.K., Hanson, E.M., Sinha, P. and Ostrand-Rosenberg, S. (2009) Inflammation enhances myeloid-derived suppressor

  12. Turbulent Flow and Large Surface Wave Events in the Marine Boundary Layers

    DTIC Science & Technology

    2009-01-01

    tank observations described by Veron et al. (2007). These are demanding test cases as they include regions of extensive flow separation. IMPACT...Geometric conservation law and its application to flow computations on moving grids. AIAA Journal, 17, 1030-1037. Veron , F., G. Saxena & S. K

  13. Assessing Stress Responses in Beaked and Sperm Whales in the Bahamas

    DTIC Science & Technology

    2012-09-30

    Wasser, S.K. 2012. Distinguishing the impacts of inadequate prey and vessel traffic on an endangered killer whale (Orcinus orca) population. PLoS One...1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Assessing Stress Responses in Beaked and Sperm Whales ...hormone assays to assess stress responses in Blainville’s beaked whales (Mesoplodon densirostris) and sperm whales (Physeter macrocephalus

  14. Towards Collective Work and Responsibility: Sources of Support within a Freedom School Teacher Community

    ERIC Educational Resources Information Center

    Jackson, Tambra O.

    2009-01-01

    Alternative and parallel schooling contexts such as the Children's Defense Fund Freedom Schools[R] provide educational experiences for U.S. K-12 students grounded in notions of social justice and culturally responsive teaching. College-aged young adults known as "servant-leader interns" are the teachers in this context. In this article, the author…

  15. Segmented K-mer and its application on similarity analysis of mitochondrial genome sequences.

    PubMed

    Yu, Hong-Jie

    2013-04-15

    K-mer-based approach has been widely used in similarity analyses so as to discover similarity/dissimilarity among different biological sequences. In this study, we have improved the traditional K-mer method, and introduce a segmented K-mer approach (s-K-mer). After each primary sequence is divided into several segments, we simultaneously transform all these segments into corresponding K-mer-based vectors. In this approach, it is vital how to determine the optimal combination of distance metric with the number of K and the number of segments, i.e., (K(⁎), s(⁎), and d(⁎)). Based on the cascaded feature vectors transformed from s(⁎) segmented sequences, we analyze 34 mammalian genome sequences using the proposed s-K-mer approach. Meanwhile, we compare the results of s-K-mer with those of traditional K-mer. The contrastive analysis results demonstrate that s-K-mer approach outperforms the traditionally K-mer method on similarity analysis among different species.

  16. Research Techniques in Wave Propagation and Scattering. Program and Abstracts of Workshop/Symposium held at the Ohio State University on 18-21 October 1982.

    DTIC Science & Technology

    1982-01-01

    EXPANSIONS APPLIED TO -. DIFFRACTION OF ELASTIC WAVES S.K. Vatta, Univeu,,a o6 Colouado F.J. Sabina, In6titto de Inve.tigacione. en Matematica ., Mexico 10:20...Colorado Boulder, CO 80309 F.J. Sabina Instituto de Investigaciones en Matematicas Aplicadas y en Sistemas 04510 Mexico, D.F. Diffraction of elastic

  17. 17 CFR 230.463 - Report of offering of securities and use of proceeds therefrom.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... of Regulation D-B or S-K or Item 14(e) of Form 20-F, as applicable, on its first periodic report... of 1934 after effectiveness, and thereafter on each of its subsequent periodic reports filed pursuant... law; or (9) In an exchange offer for the securities of the issuer or another entity....

  18. A Typology for Analyzing Digital Curricula in Mathematics Education

    ERIC Educational Resources Information Center

    Choppin, Jeffrey; Carson, Cynthia; Borys, Zenon; Cerosaletti, Cathleen; Gillis, Rob

    2014-01-01

    Digital content is increasingly present in U.S. K-12 classrooms, with a current push by federal officials to increase the rate at which digital textbooks are adopted. While some teachers' use of electronic resources involves locating activities and lessons from various internet sites, textbook and educational software companies have begun to…

  19. Factors Affecting Early Elementary (K-4) Teachers' Introduction of the Nature of Science: A National Survey

    ERIC Educational Resources Information Center

    Sweeney, Sophia Jean

    2010-01-01

    A researcher-developed questionnaire regarding the importance and developmental appropriateness of 12 specific elements of the nature of science (Alshamrani, 2008) for early elementary (kindergarten through fourth grade [K-4]) science instruction was mailed to a random sample of U.S. K-4 teachers. At least half (N = 377) of the respondents…

  20. 75 FR 82025 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-29

    ... Working Agreement. Parties: American President Lines, Ltd.; APL Co., Pte. Ltd; Hapag- Lloyd AG; Hyundai Merchant Marine Co., Ltd.; Mitsui O.S.K. Lines, Ltd.; Nippon Yusen Kaisha; Orient Overseas Container Line (Europe) Limited; Orient Overseas Container Line, Inc. Orient Overseas Container Line, Inc. Filing...

  1. Mechanical Properties of Nb25Mo25Ta25W25 and V20Nb20Mo20Ta20W20 Refractory High-Entropy Alloys (Preprint)

    DTIC Science & Technology

    2011-07-01

    stability, oxidation resistance and other properties, rather than forming the conventionally expected complex and brittle intermetallic phases. Using...W. Yeh, Annales de Chimie: Science des Materiaux , 31 (2006) 633-648. 6 J.-W. Yeh, Y.-L. Chen, S.-J. Lin, S.-K. Chen, Mater. Sci. Forum, 560 (2007

  2. Field Localization and Enhancement of Phase Locked Second and Third Harmonic Generation in Absorbing Semiconductor Cavities

    DTIC Science & Technology

    2010-01-01

    reported by Palik [22]. The GaAs Fabry-Perot etalon length (760 nm) is such that the sample is resonant at the pump wavelength, transmits ~3% of the...2008). [20] J. Jerphagnon and S. K. Kurtz, J. Appl. Phys. 41, 1667 (1970). [21] E. Fazio et al., Opt. Express 17, 3141 (2009). [22] E. D. Palik

  3. 78 FR 64504 - Advisory Committee to the Director (ACD), Centers for Disease Control and Prevention-Health...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-29

    ... HUMAN SERVICES Centers for Disease Control and Prevention (CDC) Advisory Committee to the Director (ACD... Disparities Subcommittee, Advisory Committee to the Director, CDC, 1600 Clifton Road, NE., M/S K-77, Atlanta, GA 30333; Telephone (770) 488-8200, Email: LEL1@cdc.gov . This notice is published less than...

  4. 77 FR 71193 - Breast and Cervical Cancer Early Detection Federal Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-29

    ... HUMAN SERVICES Centers for Disease Control and Prevention (CDC) Breast and Cervical Cancer Early...: Alicia Ortner, Committee Specialist, CDC, 4770 Buford Hwy, M/S K-57, Atlanta, Georgia 30341. Telephone (770) 488-4880. Email: aortner@cdc.gov . The Director, Management Analysis and Services Office,...

  5. 17 CFR 229.102 - (Item 102) Description of property.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... extractive enterprise, not involved in oil and gas producing activities, material information shall be given... engaged in oil and gas producing activities shall provide the information required by Subpart 1200 of Regulation S-K. 5. In the case of extractive reserves other than oil and gas reserves, estimates other...

  6. 17 CFR 229.102 - (Item 102) Description of property.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... extractive enterprise, not involved in oil and gas producing activities, material information shall be given... engaged in oil and gas producing activities shall provide the information required by Subpart 1200 of Regulation S-K. 5. In the case of extractive reserves other than oil and gas reserves, estimates other...

  7. Scaling relations for galaxies of all types with CALIFA and MaNGA surveys.

    NASA Astrophysics Data System (ADS)

    Aquino-Ortíz, E.; Sánchez-Sánchez, S. F.; Valenzuela, O.; Cano-Díaz, M.; Hernández-Toledo, H.

    2016-06-01

    We used gas and stellar kinematics for the final Data Release of 667 spatially resolved galaxies publicly available from Calar Alto Legacy Integral Field Area survey (CALIFA) with the aim of study dynamical scaling relations as Tully & Fisher for rotation velocity, Faber & Jackson for velocity dispersion and also a combination of them through the S_{K} parameter defined as S_{K}^2 = KV_{rot}^2 + σ^2. We found a offset between gas and stellar kinematics in Tully & Fisher and Faber & Jackson relations, however when we used the S_{K} parameter all galaxies regardless of the morphological type lie in this M_{*} vs S_{k} scaling relation with a significant improvement compared with the M_{*} vs V_{rot} and M_{*} vs σ relations, in agreement with previous studies with SAMI survey, however the slope ant zero-point are different with them. We also explored different values of the K parameter, as well as different proxys to estimate V_{rot} in order to understand and characterize the physical source of scatter, slope and zero-point.

  8. XAFS STUDIES OF NICKEL AND SULFUR SPECIATION IN RESIDENTIAL OIL FLY-ASH PARTICULATE MATTERS (ROFA PM)

    EPA Science Inventory

    XAFS spectroscopy has been employed to evaluate the effect of fuel compositions and combustion conditions on the amount, form, and distribution of sulfur and nickel in size-fractionated ROFA PM. Analysis of S K-edge XANES establish that sulfate is abundant in all PM. However, dep...

  9. 17 CFR 250.103A - Liability for certain statements by issuers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Exchange Act of 1934 and which relates to: (i) The effects of changing prices on the business enterprise, presented voluntarily or pursuant to Item 303 of Regulation S-K (§ 229.303 of this chapter), “Management's... to: (1) A statement containing a projection of revenues, income (loss), earnings (loss) per...

  10. 17 CFR 230.175 - Liability for certain statements by issuers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... this chapter) and that relates to: (i) The effects of changing prices on the business enterprise, presented voluntarily or pursuant to Item 303 of Regulation S-K (§ 229.303 of this chapter), “Management's... revenues, income (loss), earnings (loss) per share, capital expenditures, dividends, capital structure...

  11. Numerical analysis of initial stage of thermal shock

    NASA Astrophysics Data System (ADS)

    Demidov, V. N.

    2016-07-01

    The paper studies a problem of a thermal shock at the surface of a half-space, which properties are described by elastic-plastic model taking into account dynamic effects, heat inertia, coupling between thermal and mechanical fields. The problem is solved numerically using finite-difference method of S.K. Godunov.

  12. Observation of decays B0-->Ds(*)+ pi- and B0-->Ds(*)- K+.

    PubMed

    Aubert, B; Barate, R; Bona, M; Boutigny, D; Couderc, F; Karyotakis, Y; Lees, J P; Poireau, V; Tisserand, V; Zghiche, A; Grauges, E; Palano, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Battaglia, M; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Gill, M S; Groysman, Y; Jacobsen, R G; Kadyk, J A; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Ronan, M T; Suzuki, A; Troost, D; Wenzel, W A; Barrett, M; Ford, K E; Harrison, T J; Hart, A J; Hawkes, C M; Morgan, S E; Watson, A T; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schroeder, T; Steinke, M; Boyd, J T; Burke, J P; Cottingham, W N; Walker, D; Cuhadar-Donszelmann, T; Fulsom, B G; Hearty, C; Knecht, N S; Mattison, T S; McKenna, J A; Khan, A; Kyberd, P; Saleem, M; Teodorescu, L; Blinov, V E; Bukin, A D; Druzhinin, V P; Golubev, V B; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Best, D S; Bondioli, M; Bruinsma, M; Chao, M; Curry, S; Eschrich, I; Kirkby, D; Lankford, A J; Lund, P; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Abachi, S; Buchanan, C; Foulkes, S D; Gary, J W; Long, O; Shen, B C; Wang, K; Zhang, L; Hadavand, H K; Hill, E J; Paar, H P; Rahatlou, S; Sharma, V; Berryhill, J W; Campagnari, C; Cunha, A; Dahmes, B; Hong, T M; Kovalskyi, D; Richman, J D; Beck, T W; Eisner, A M; Flacco, C J; Heusch, C A; Kroseberg, J; Lockman, W S; Nesom, G; Schalk, T; Schumm, B A; Seiden, A; Spradlin, P; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dvoretskii, A; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Andreassen, R; Mancinelli, G; Meadows, B T; Sokoloff, M D; Blanc, F; Bloom, P C; Chen, S; Ford, W T; Hirschauer, J F; Kreisel, A; Nauenberg, U; Olivas, A; Ruddick, W O; Smith, J G; Ulmer, K A; Wagner, S R; Zhang, J; Chen, A; Eckhart, E A; Soffer, A; Toki, W H; Wilson, R J; Winklmeier, F; Zeng, Q; Altenburg, D D; Feltresi, E; Hauke, A; Jasper, H; Spaan, B; Brandt, T; Klose, V; Lacker, H M; Mader, W F; Nogowski, R; Petzold, A; Schubert, J; Schubert, K R; Schwierz, R; Sundermann, J E; Volk, A; Bernard, D; Bonneaud, G R; Grenier, P; Latour, E; Thiebaux, Ch; Verderi, M; Bard, D J; Clark, P J; Gradl, W; Muheim, F; Playfer, S; Robertson, A I; Xie, Y; Andreotti, M; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Petrella, A; Piemontese, L; Prencipe, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Pacetti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Lo Vetere, M; Macri, M M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Brandenburg, G; Chaisanguanthum, K S; Morii, M; Wu, J; Dubitzky, R S; Marks, J; Schenk, S; Uwer, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Flack, R L; Gaillard, J R; Nash, J A; Nikolich, M B; Panduro Vazquez, W; Chai, X; Charles, M J; Mallik, U; Meyer, N T; Ziegler, V; Cochran, J; Crawley, H B; Dong, L; Eyges, V; Meyer, W T; Prell, S; Rosenberg, E I; Rubin, A E; Gritsan, A V; Fritsch, M; Schott, G; Arnaud, N; Davier, M; Grosdidier, G; Höcker, A; Le Diberder, F; Lepeltier, V; Lutz, A M; Oyanguren, A; Pruvot, S; Rodier, S; Roudeau, P; Schune, M H; Stocchi, A; Wang, W F; Wormser, G; Cheng, C H; Lange, D J; Wright, D M; Chavez, C A; Forster, I J; Fry, J R; Gabathuler, E; Gamet, R; George, K A; Hutchcroft, D E; Payne, D J; Schofield, K C; Touramanis, C; Bevan, A J; Di Lodovico, F; Menges, W; Sacco, R; Brown, C L; Cowan, G; Flaecher, H U; Hopkins, D A; Jackson, P S; McMahon, T R; Ricciardi, S; Salvatore, F; Brown, D N; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Chia, Y M; Edgar, C L; Kelly, M P; Lafferty, G D; Naisbit, M T; Williams, J C; Yi, J I; Chen, C; Hulsbergen, W D; Jawahery, A; Lae, C K; Roberts, D A; Simi, G; Blaylock, G; Dallapiccola, C; Hertzbach, S S; Li, X; Moore, T B; Saremi, S; Staengle, H; Willocq, S Y; Cowan, R; Koeneke, K; Sciolla, G; Sekula, S J; Spitznagel, M; Taylor, F; Yamamoto, R K; Kim, H; Patel, P M; Robertson, S H; Lazzaro, A; Lombardo, V; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Côté, D; Taras, P; Viaud, F B; Nicholson, H; Cavallo, N; De Nardo, G; del Re, D; Fabozzi, F; Gatto, C; Lista, L; Monorchio, D; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M; Bulten, H; Raven, G; Snoek, H L; Jessop, C P; LoSecco, J M; Allmendinger, T; Benelli, G; Gan, K K; Honscheid, K; Hufnagel, D; Jackson, P D; Kagan, H; Kass, R; Pulliam, T; Rahimi, A M; Ter-Antonyan, R; Wong, Q K; Blount, N L; Brau, J; Frey, R; Igonkina, O; Lu, M; Potter, C T; Rahmat, R; Sinev, N B; Strom, D; Strube, J; Torrence, E; Galeazzi, F; Gaz, A; Margoni, M; Morandin, M; Pompili, A; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Voci, C; Benayoun, M; Chauveau, J; David, P; Del Buono, L; de la Vaissière, Ch; Hamon, O; Hartfiel, B L; John, M J J; Malclès, J; Ocariz, J; Roos, L; Therin, G; Behera, P K; Gladney, L; Panetta, J; Biasini, M; Covarelli, R; Pioppi, M; Angelini, C; Batignani, G; Bettarini, S; Bucci, F; Calderini, G; Carpinelli, M; Cenci, R; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Mazur, M A; Morganti, M; Neri, N; Paoloni, E; Rizzo, G; Walsh, J; Haire, M; Judd, D; Wagoner, D E; Biesiada, J; Danielson, N; Elmer, P; Lau, Y P; Lu, C; Olsen, J; Smith, A J S; Telnov, A V; Bellini, F; Cavoto, G; D'Orazio, A; Di Marco, E; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Mazzoni, M A; Morganti, S; Piredda, G; Polci, F; Safai Tehrani, F; Voena, C; Ebert, M; Schröder, H; Waldi, R; Adye, T; De Groot, N; Franek, B; Olaiya, E O; Wilson, F F; Emery, S; Gaidot, A; Ganzhur, S F; Hamel de Monchenault, G; Kozanecki, W; Legendre, M; Vasseur, G; Yèche, Ch; Zito, M; Park, W; Purohit, M V; Wilson, J R; Allen, M T; Aston, D; Bartoldus, R; Bechtle, P; Berger, N; Boyarski, A M; Claus, R; Coleman, J P; Convery, M R; Cristinziani, M; Dingfelder, J C; Dong, D; Dorfan, J; Dubois-Felsmann, G P; Dujmic, D; Dunwoodie, W; Field, R C; Glanzman, T; Gowdy, S J; Graham, M T; Halyo, V; Hast, C; Hryn'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Li, S; Libby, J; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perl, M; Perazzo, A; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Snyder, A; Stelzer, J; Su, D; Sullivan, M K; Suzuki, K; Swain, S K; Thompson, J M; Va'vra, J; van Bakel, N; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wittgen, M; Wright, D H; Yarritu, A K; Yi, K; Young, C C; Burchat, P R; Edwards, A J; Majewski, S A; Petersen, B A; Roat, C; Wilden, L; Ahmed, S; Alam, M S; Bula, R; Ernst, J A; Jain, V; Pan, B; Saeed, M A; Wappler, F R; Zain, S B; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Ritchie, J L; Satpathy, A; Schilling, C J; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Gallo, F; Gamba, D; Bomben, M; Bosisio, L; Cartaro, C; Cossutti, F; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Vitale, L; Azzolini, V; Martinez-Vidal, F; Banerjee, Sw; Bhuyan, B; Brown, C M; Fortin, D; Hamano, K; Kowalewski, R; Nugent, I M; Roney, J M; Sobie, R J; Back, J J; Harrison, P F; Latham, T E; Mohanty, G B; Pappagallo, M; Band, H R; Chen, X; Cheng, B; Dasu, S; Datta, M; Eichenbaum, A M; Flood, K T; Hollar, J J; Kutter, P E; Li, H; Liu, R; Mellado, B; Mihalyi, A; Mohapatra, A K; Pan, Y; Pierini, M; Prepost, R; Tan, P; Wu, S L; Yu, Z; Neal, H

    2007-02-23

    We report the observation of decays B{0}-->D{s}{(*)+}pi- and B{0}-->D{s}{(*)-}K+ in a sample of 230 x 10(6) Upsilon(4S)-->BB[over] events recorded with the BABAR detector at the SLAC PEP-II asymmetric-energy e+ e- storage ring. We measure the branching fractions B(B{0}-->D{s}{+}pi-)=(1.3+/-0.3(stat)+/-0.2(syst))x10(-5), B(B{0}-->D{s}{-} K+)=(2.5+/-0.4(stat)+/-0.4(syst))x10(-5), B(B{0}-->D{s}{*+}pi-)=(2.8+/-0.6(stat)+/-0.5(syst))x10(-5), and B(B{0}-->D{s}{*-}K+)=(2.0+/-0.5(stat)+/-0.4(syst))x10(-5). The significances of the measurements to differ from zero are 5, 9, 6, and 5 standard deviations, respectively. This is the first observation of B{0}-->D{s}{+}pi-, B{0}-->D{s}{*+}pi-, and B{0}-->D{s}{*-}K+ decays.

  13. Yaws

    MedlinePlus

    ... pdf (7) Eradicating successfully yaws from India: The strategy & global lessons. Jai P. Narain, S.K. Jain, D. Bora, and S. Venkatesh. Indian J Med Res. 2015 May; 141(5): 608–613. doi: ... strategy Yaws Eradication Strategy (the Morges Strategy) PDF, 3. ...

  14. Anomalous Tropical Ocean Circulation Associated with La Nina Modoki

    DTIC Science & Technology

    2011-12-02

    Behera , S. A. Rao, H. Weng, and T. Yamagata (2007), El Nifio Modoki and its possible telcconncction, J. Geophys. Res., 112, C11007, doi.10.1029...Oscillation, Geophys. Res. Lett., 24, 779-782, doi:10.1029/97GL00689. Weng, H., S. K. Behera , and T. Yamagata (2009), Anomalous winter cli- mate

  15. 17 CFR 232.304 - Graphic, image, audio and video material.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... documents contained in the file. (d) For electronically filed ASCII documents, the performance graph that is... required by Item 201(e) of Regulation S-K (§ 229.201(e) of this chapter), and the line graph that is to... compliance with the formatting requirements of the EDGAR Filer Manual: The performance graph that is...

  16. 17 CFR 232.304 - Graphic, image, audio and video material.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... documents contained in the file. (d) For electronically filed ASCII documents, the performance graph that is... required by Item 201(e) of Regulation S-K (§ 229.201(e) of this chapter), and the line graph that is to... compliance with the formatting requirements of the EDGAR Filer Manual: The performance graph that is...

  17. 17 CFR 232.304 - Graphic, image, audio and video material.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... documents contained in the file. (d) For electronically filed ASCII documents, the performance graph that is... required by Item 201(e) of Regulation S-K (§ 229.201(e) of this chapter), and the line graph that is to... compliance with the formatting requirements of the EDGAR Filer Manual: The performance graph that is...

  18. 17 CFR 232.304 - Graphic, image, audio and video material.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... documents contained in the file. (d) For electronically filed ASCII documents, the performance graph that is... required by Item 201(e) of Regulation S-K (§ 229.201(e) of this chapter), and the line graph that is to... compliance with the formatting requirements of the EDGAR Filer Manual: The performance graph that is...

  19. 17 CFR 232.304 - Graphic, image, audio and video material.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... documents contained in the file. (d) For electronically filed ASCII documents, the performance graph that is... required by Item 201(e) of Regulation S-K (§ 229.201(e) of this chapter), and the line graph that is to... compliance with the formatting requirements of the EDGAR Filer Manual: The performance graph that is...

  20. Response to the American Textbook Council Report, "Islam and the Textbooks."

    ERIC Educational Resources Information Center

    Douglass, Susan

    The Council on Islamic Education (CIE) is a nonprofit resource organization comprised of a diverse body of scholars of history, education, religion, and related disciplines. CIE strives to improve the U.S. K-12 education system by fostering the cultivation of knowledge, critical thinking, and global awareness among the nation's young citizens. CIE…

  1. An Experimental Apparatus for Investigating the Kinetic Reactions in Solid Rocket Nozzles

    DTIC Science & Technology

    1979-06-01

    reliability FORM , DD JAN73 1473 EDITION OF INOV 6IS OBSOLETE UNCLASSIFIED SECURITY CLASSIFICATION OF THIS PAGE (I+)en D&.. Entereo) . UNCLASSIFIED...coefficient (g/cm2-s-K a-atmn ) 0 a = temperature exponent E = activation energy (cal/gmole) R = universal gas constant (1.986 cal/gmole-K) (PH2)w= hydrogen

  2. Feasibility Analysis For Heating Tribal Buildings with Biomass

    SciTech Connect

    Steve Clairmont; Micky Bourdon; Tom Roche; Colene Frye

    2009-03-03

    This report provides a feasibility study for the heating of Tribal buildings using woody biomass. The study was conducted for the Confederated Salish and Kootenai Tribes of the Flathead Reservation in western Montana. S&K Holding Company and TP Roche Company completed the study and worked together to provide the final report. This project was funded by the DOE's Tribal Energy Program.

  3. Electrochemical Fabrication of Cadmium Chalcogenide Microdiode Arrays

    DTIC Science & Technology

    1993-04-09

    These materials may also be useful for template-synthesis of semiconductors. 10. R. J. Tonucci , B. L. Justus, A. J. Campillo, C. E. Ford, Science 258...1981). 35. R. B. Gore, R. K. Pandey, S. K. Kulkarni, J. Appl. Phys. 65, 2693 (1989). 36. L. Stryer, Biochemistry (W. H. Freeman, San Francisco , 198 1), p

  4. QED's School Market Trends: Teacher Buying Behavior & Attitudes, 2001-2002. Research Report.

    ERIC Educational Resources Information Center

    Quality Education Data, Inc., Denver, CO.

    This study examined teachers' classroom material buying behaviors and trends. Data came from Quality Education Data's National Education Database, which includes U.S. K-12 public, private, and Catholic schools and districts. Researchers surveyed K-8 teachers randomly selected from QED's National Education Database. Results show that teachers spend…

  5. Educational Entrepreneurship: Realities, Challenges, Possibilities

    ERIC Educational Resources Information Center

    Hess, Frederick M., Ed.

    2006-01-01

    This lively and provocative book introduces this burgeoning field for readers concerned with K-12 education in the United States--and with efforts to reform and improve it. Entrepreneurship has emerged in recent years as an unprecedented and influential force in U.S. K-12 education. Yet the topic has received surprisingly little serious or…

  6. Gender Identity and Adjustment in Black, Hispanic, and White Preadolescents

    ERIC Educational Resources Information Center

    Corby, Brooke C.; Hodges, Ernest V. E.; Perry, David G.

    2007-01-01

    The generality of S. K. Egan and D. G. Perry's (2001) model of gender identity and adjustment was evaluated by examining associations between gender identity (felt gender typicality, felt gender contentedness, and felt pressure for gender conformity) and social adjustment in 863 White, Black, and Hispanic 5th graders (mean age = 11.1 years).…

  7. Review of Literature on Probability of Detection for Magnetic Particle Nondestructive Testing

    DTIC Science & Technology

    2013-01-01

    series. Magnetic particle testing is a mature nondestructive inspection method for the detection of surface-breaking or near-surface...UNCLASSIFIED Review of Literature on Probability of Detection for Magnetic Particle Nondestructive Testing S.K. Burke and R.J...UNCLASSIFIED UNCLASSIFIED UNCLASSIFIED Review of Literature on Probability of Detection for Magnetic Particle Nondestructive Testing

  8. Pre-Service Teachers' Perceptions towards Multicultural Education & Teaching of Culturally & Linguistically Diverse Learners

    ERIC Educational Resources Information Center

    Taylor, Roben; Kumi-Yeboah, Alex; Ringlaben, Ravic P.

    2016-01-01

    The issue of diversity in U.S. K-12 schools requires significant training and experiences for preservice teachers to recognize the importance of students' socio-cultural, religious values, and the influence their cultural background have in their quest to succeed in their educational endeavors. This study provides significant information to…

  9. Spatio-temporal analysis of an HLB epidemic in Florida and implications for spread.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Data for Huanglongbing (HLB) epidemics was collected during 5 assessment dates over a 2-year period from 11, 4-ha commercial citrus blocks in Florida. Data were analyzed for regional spatial characteristics via Ripley’s K analyses. Data were fitted to the logistic and Gompertz temporal models, the...

  10. Fluorescent nitrile-based inhibitors of cysteine cathepsins.

    PubMed

    Frizler, Maxim; Mertens, Matthias D; Gütschow, Michael

    2012-12-15

    Cysteine cathepsins play an important role in many (patho)physiological conditions. Among them, cathepsins L, S, K and B are subjects of several drug discovery programs. Besides their role as drug targets, cysteine cathepsins are additionally considered to be possible biomarkers for inflammation and cancer. Herein, we describe the design, synthesis, biological evaluation and spectral properties of fluorescently labeled dipeptide- and azadipeptide nitriles.

  11. Sci-Fi, Storytelling, and New-Media Literacy

    ERIC Educational Resources Information Center

    Subramaniam, Mega; Ahn, June; Waugh, Amanda; Druin, Allison

    2012-01-01

    Understanding how to better engage young students in science, technology, engineering, and math (STEM) is essential. The constraints of U.S. K-12 schools (e.g. insufficient institutional supports, lack of technology access, testing pressures, etc.) often make it difficult to create truly engaging STEM curricula with which students can deeply…

  12. G-Proteins and Signal Transduction Annual Symposium (43rd), Held in Woods Hole, Massachusetts on September 6-9, 1989

    DTIC Science & Technology

    1989-12-31

    Necturus lactotrophs. S.K. Sikdar, R. Zorec and W.T. Mason, gallbladder: Common antigenic determinants from A.F.R.C. Institute of Animal Physiology...College of Medicine, Houston, TX. Dunham, Departments de Fisiologia , Universidad de la Laguna, Tenerife, Canary Islands, Spain, Department of 45. In vitro

  13. 76 FR 69271 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ....); Wan Hai Lines Ltd.; Yang Ming Transport Marine Corp.; and Zim Integrated Shipping Services Ltd. Filing...: Evergreen Line Joint Service Agreement and Mitsui O.S.K. Lines, Ltd. Filing Party: Robert B. Yoshitomi, Esq... Company, Ltd. and Pacific International Lines (PTE) Ltd. Filing Party: Robert B. Yoshitomi, Esq.;...

  14. A Psychometric Revision of the Asian Values Scale Using the Rasch Model

    ERIC Educational Resources Information Center

    Kim, Bryan S. K.; Hong, Sehee

    2004-01-01

    In this article, the 36-item Asian Values Scale (B. S. K. Kim, D. R. Atkinson, & P. H. Yang, 1999) was revised on the basis of G. Rasch's (1960) model and data from 618 Asian Americans. The results led to the establishment of a 25-item measure named the Asian Values Scale-Revised.

  15. Design, Synthesis and Characterization of Novel Nonlinear Optical Polymers

    DTIC Science & Technology

    1993-05-31

    to-Digital Converter Research Grant, February 1, 1992 - January 31, 1993 - $5,000.00 Electric Power Research Institute Evaluation of Unique Solar ...Chittibabu, M. Kamath, J. Kumar and S.K. Tripathy) Materials Research Society, Boston, Massachusetts, December 1992. 7. "Novel Solvato- and Thermochromic

  16. A Nation at Risk Revisited: Did "Wrong" Reasoning Result in "Right" Results? At What Cost?

    ERIC Educational Resources Information Center

    Guthrie, James W.; Springer, Matthew G.

    2004-01-01

    A Nation at Risk (NAR; National Commission on Excellence in Education, 1983) proclaimed in 1983 that U.S. K-12 educational achievement was on a downward trajectory and that American technological and economic preeminence was consequently imperiled. Both assertions were incorrect. American education achievement was not then declining and the…

  17. 76 FR 79184 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-21

    ...: Wayne Rohde, Esq.; Cozen O'Connor; 1627 I Street NW.; Suite 1100; Washington, DC 20006. Synopsis: The.... Smith, Esq., Cozen O'Connor, 1627 I Street NW., Washington, DC 20006. Synopsis: The amendment removes..., Ltd.; Hyundai Merchant Marine Co., Ltd.; and Mitsui O.S.K. Lines, Ltd. (``MOL''). Filing...

  18. Self-Regulated Strategy Development for Students with Emotional Behavioral Disorders

    ERIC Educational Resources Information Center

    Bak, Nicole; Asaro-Saddler, Kristie

    2013-01-01

    Writing is a foundational skill that can support and extend student learning across the curriculum. Writing is used to communicate stories, opinions, and information, and to express one's understanding of concepts and ideas during an individual's K-12 educational career and well beyond. Despite written expression's importance and…

  19. Textured Image Segmentation

    DTIC Science & Technology

    1980-01-01

    rs t-end to 42 line up or occupy low-dimensional subspaces. Classification functions, one for each texture group, can be derived from the discriminant...equalization algorithm see S.-K. Chang and Y.-W. Wong, Communications of the ACM, Oct. 1978. The algorithm used here is similar to the EPQ method of

  20. An Exploratory Study of the Implementation of an Interactive Learning System in Two Eighth Grade Mathematics Classes.

    ERIC Educational Resources Information Center

    FitzPatrick, Sarah B.; Faux, Russell

    During the last decade, U.S. K-12 schools have approximately tripled their spending on increasingly powerful computers, expanded network access, and novel computer applications. The number of questions being asked by educators, policymakers, and the general public about the extent to which these technologies are being used in classrooms, for what…

  1. Protecting Black Girls

    ERIC Educational Resources Information Center

    Morris, Monique W.

    2016-01-01

    Statistics show that black girls in U.S. K-12 public schools are overrepresented among students who face disciplinary approaches (such as suspensions) that exclude or even criminalize them. Morris explains how black girls face conditions that make them vulnerable to a phenomenon she calls "school to confinement pathways"--conditions like…

  2. Learning in 140 Characters: Teachers' Perceptions of Twitter for Professional Development

    ERIC Educational Resources Information Center

    Davis, Kerry J.

    2012-01-01

    Web 2.0 technologies provide school administrators the opportunity to offer teachers meaningful professional development. The purpose of the qualitative case study was to investigate ways in which U.S. K-12 public school teachers who participated in weekly Twitter Edchat discussions perceived the use of a social network site for professional…

  3. Instituting a Standards-Based K--12 Science Curriculum Supplement Program at the National Institutes of Health: A Case Study

    ERIC Educational Resources Information Center

    Witherly, Jeffre

    2010-01-01

    Research on student achievement indicates the U.S. K-12 education system is not adequately preparing American students to compete in the 21st century global economy in the areas of science and mathematics. Congress has asked the scientific entities of the federal government to help increase K-12 science learning by creating standards-based…

  4. Comparison of the Sauvé-Kapandji procedure and the Darrach procedure for the treatment of rheumatoid wrists.

    PubMed

    Nakagawa, Natsuko; Abe, Shuji; Kimura, Hiroshi; Imura, Shigeaki; Nishibayashi, Yasuro; Yoshiya, Sinichi

    2003-09-01

    Abstract In surgical treatment of the rheumatoid wrist, the Darrach procedure combined with synovectomy has been the treatment of choice in the past. However, owing to the significant ulnar carpal shift observed after the Darrach procedure, the Sauvé-Kapandji (S-K) procedure has become increasingly popular. The purpose of this study was to compare the clinical results of the S-K and Darrach procedures. Thirty-two wrists in the S-K-procedure group and 31 wrists in Darrach-procedure group were examined. Before and after surgery, clinical evaluations of pain, swelling, range of motion, grip strength, and radiological findings were performed and the results were compared. Both procedures resulted in decreased pain and swelling, as well as improved rotatory motion of the forearm. The S-K procedure was shown to be superior to the Darrach procedure in reducing ulnar carpal migration and improving grip strength. On the other hand, the prevention of carpal bone destruction could not be completely achieved in either procedure.

  5. East Asian Heritage Language Education for a Plurilingual Reality in the United States: Practices, Potholes, and Possibilities

    ERIC Educational Resources Information Center

    Li, Guofang; Wen, Keying

    2015-01-01

    Drawing on research about East Asian (mainly Chinese, Korean, and Japanese) heritage language (HL) teaching and learning in three contexts--the home, community heritage language schools, and programs in U.S. K-12 schools--this article discusses the challenges that East Asian subethnic groups face in improving HL education in each context.…

  6. Estimating the branching fraction for B0 → ψ(2S)π0 decay

    NASA Astrophysics Data System (ADS)

    Mohammadi, Behnam

    2017-03-01

    I present estimates of the branching fractions in the non-leptonic charmonium two-body decay rates for B0 → ψ(2S)π0 decay and the same decays of B+ → ψ(2S)π+, B0 → ψ(2S)K0 and B+ → ψ(2S)K+. These estimates are based on a generalized factorization approach making use of leading order (LO) and next-to-leading order (NLO) contributions. I find that when the large enhancements from the known NLO contributions by using the QCD factorization approach are taken into account, the branching ratios are the following: BR(B0 → ψ(2S)π0) = (1.067±0.059)×10-5, BR(B+ → ψ(2S)π+) = (2.134±0.0.118)×10-5, BR(B0 → ψ(2S)K0) = (6.344±0.376)×10-4 and BR(B+ → ψ(2S)K+) = (6.344±0.376)×10-4, while the experimental results are (1.17 ± 0.17)×10-5, (2.44 ± 0.30) × 10-5, (6.20 ± 0.50)×10-4 and (6.39±0.33) × 10-4 respectively. All estimates are in good agreement with the experimental results.

  7. Crystal Field Study of Gd(3+)-Doped La(x)RE(1-x)F3 (RE=Ce,Pr,Nd) Single Crystals

    DTIC Science & Technology

    2001-01-01

    the vacuum ultraviolet:LalCeF 3 " Appl. Optics 12, pp. 138-139, 1973. 6. W. Korczak and P. Mikolajczak , "Crystal growth and temperature variation of...spin-phonon interactions and spin-lattice relaxations" Acta Phys. Pol. A 95, pp. 367-380, 1999. 12. L. E. Misiak, S. K. Misra and P. Mikolajczak

  8. 17 CFR 250.103A - Liability for certain statements by issuers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... oil and gas reserves as set forth in paragraphs 30-34 of Statement of Financial Accounting Standards... discussion and analysis of financial condition and results of operations,” or Item 302 of Regulation S-K (§ 229.302 of this chapter), “Supplementary financial information,” or (ii) The value of proved oil...

  9. 17 CFR 230.175 - Liability for certain statements by issuers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... paragraphs 30-34 of Statement of Financial Accounting Standards No. 69) presented voluntarily or pursuant to... Discussion and Analysis of Financial Condition and Results of Operations,” Item 5 of Form 20-F (§ 249.220(f) of this chapter), “Operating and Financial Review and Prospects,” Item 302 of Regulation S-K (§...

  10. 17 CFR 240.3b-6 - Liability for certain statements by issuers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... proved oil and gas reserves as set forth in paragraphs 30-34 of Statement of Financial Accounting... Regulation S-K (§ 229.303 of this chapter), “Management's Discussion and Analysis of Financial Condition and Results of Operations,” Item 5 of Form 20-F (§ 240.220(f) of this chapter), “Operating and...

  11. Financial Support and Challenges for Educational Technology Companies: Then, Now, and Looking Ahead

    ERIC Educational Resources Information Center

    Billings, Karen J.; Blaschke, Charles L.

    2016-01-01

    The authors review past and current funding/support for U.S. K-12 educational technology companies. They review both who provided the funding for product development and the reasons why. They look back to the 1960s and 1970s, when federal government agencies helped produce computer-based materials, then how the schools' access to technology…

  12. Treatments to Relieve Symptoms of Polycystic Ovary Syndrome (PCOS)

    MedlinePlus

    ... PDF - 273 KB) [top] Moran, L. J., Pasquali, R., Teede, H. J., Hoeger, K. M., & Norman, R. J. (2009). Treatment of obesity in polycystic ovary ... htm [top] Moran, L. J., Hutchison, S. K., Norman, R. J., & Teede, H. J. (2011). Lifestyle changes in ...

  13. 17 CFR 229.304 - (Item 304) Changes in and disagreements with accountants on accounting and financial disclosure.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... disagreements with accountants on accounting and financial disclosure. 229.304 Section 229.304 Commodity and...-REGULATION S-K Financial Information § 229.304 (Item 304) Changes in and disagreements with accountants on... subsequent interim period, an independent accountant who was previously engaged as the principal...

  14. 17 CFR 229.304 - (Item 304) Changes in and disagreements with accountants on accounting and financial disclosure.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... disagreements with accountants on accounting and financial disclosure. 229.304 Section 229.304 Commodity and...-REGULATION S-K Financial Information § 229.304 (Item 304) Changes in and disagreements with accountants on... subsequent interim period, an independent accountant who was previously engaged as the principal...

  15. Metal Transfer in Gas Metal Arc Welding

    DTIC Science & Technology

    1988-03-17

    their measurements. Predictions can also be compared to integral measurements as by Halmoy [1980] for melting rate and by Ueguri, Hara and Komura ...10 No. 3. Ue-,uri, S., K. Hara and H. Komura , 1985. Welding J., 64 pp. 242s-250s. van Doormaal, J.P. and G.D. Raithby, 1985. ASME paper 85-HT-9

  16. On Sensitivity Analysis within the 4DVAR Framework

    DTIC Science & Technology

    2014-02-01

    number of authors (e.g., Torn andHakim 2009; Zack et al. 2010) in application to the ensemble methods that keep the ensemble size fixed in the process of...Hydrological Applica- tions, S. K. Park and L. Xu, Eds., Vol. 2, Springer, 177–203. Zack , J., E. Natenberg, S. Young, G. V. Knowe, K. Waight

  17. Acquisition for the Future: Imagination, Innovation, and Implementation. Research and Reality: Closing the Gap

    DTIC Science & Technology

    1993-01-01

    measure learning by administering an objective 8. The class demography pattern: ages andnumbers of students, past learning and life knowledge or skill ...test. performance, socioeconomic grouping, A literature review quickly provided more than a language and literature skills ... thousand references which...CONSTRAINTS , = DEFINITO N SCENARIOS .0 O00 [AACTIONfSI S k . . . . . . 0MODELIa) SELECTION/ FUNDING A PERFORMANCE DEVELOPMENT GOALS IMILESTONE I

  18. An Educational Methodology for Enhancing Familiarity with United States Air Force Combat Logistics.

    DTIC Science & Technology

    1983-09-01

    ICOMBAT i LOGISTICS FUNCTION IREADINES aenc[Tasotio _____ I 1 dentitication of Units ___ __ __ a b_ _ _ _ c- d e_ _ _ _ ecepn tion K~atons Reqorntro...UNCTION ACTIVITY Sun’IV. ainterianc Tasnortation!Loqi~ic~P!e s .k-f7: o i dentitication of Units __ __ __ a b c d e_ _ _ _ nitiat Unitflono ;Sortie

  19. Market- and Performance-Based Reforms of Teacher Compensation: A Review of Recent Practices, Policies, and Research. Program on Education Policy and Governance Working Papers Series. PEPG 10-09

    ERIC Educational Resources Information Center

    Podgursky, Michael J.; Springer, Matthew

    2010-01-01

    This paper provides a review of recent policy initiatives to reform teacher compensation systems and evidence regarding the effect of these policies. The first section examines the current structure of teacher compensation in the U.S. K-12 public education system. The compensation "system" for teachers is fragmented and uncoordinated. Teacher…

  20. Instructional Alignment as a Measure of Teaching Quality

    ERIC Educational Resources Information Center

    Polikoff, Morgan S.; Porter, Andrew C.

    2014-01-01

    Recent years have seen the convergence of two major policy streams in U.S. K-12 education: standards/accountability and teacher quality reforms. Work in these areas has led to the creation of multiple measures of teacher quality, including measures of their instructional alignment to standards/assessments, observational and student survey measures…

  1. Human-Computer Interaction Software: Lessons Learned, Challenges Ahead

    DTIC Science & Technology

    1989-01-01

    domain communi- Iatelligent s t s s Me cation. Users familiar with problem Inteligent support systes. High-func- anddomains but inxperienced with comput...8217i. April 1987, pp. 7.3-78. His research interests include artificial intel- Creating better HCI softw-are will have a 8. S.K Catrd. I.P. Moran. arid

  2. Nano-Material and Structural Engineering for Thermal Highways

    DTIC Science & Technology

    2013-06-14

    85, 3476 (2000). 11. S. K. Panda , D. Han, H. Yoo, H. Shin, H. Park, and J. Xu, “Synthesis of step-shaped bismuth nanowires - An approach towards...2013). 6. G.E. Fernandes, J-H Kim, A. Sood, and J.M. Xu, “ Giant temperature coefficient of resistance in carbon nanotube / phase-change polymer

  3. 12 CFR 194.3 - Liability for certain statements by Federal savings associations.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... and analysis of financial condition and results of operations, or item 302 of Regulation S-K (17 CFR 229.302), supplementary financial information, and disclosed in a document filed with the OCC or in an... contained in management's discussion and analysis of financial condition and results of operations...

  4. 17 CFR 229.914 - (Item 914) Pro forma financial statements: selected financial data.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... the information required by Item 301 of Regulation S-K, Selected Financial Data (§ 229.301), and Item... to be included in a roll-up transaction provide: Ratio of earnings to fixed charges, cash and cash... Supplementary Financial Information are required to be provided. Additional or other information should...

  5. Investigation of Oblique Shocks and Edge Effects for Underground Targets. Volume 2. Edge Effects

    DTIC Science & Technology

    1977-01-01

    mid-span point from which breach will occur (feet) k is span factor s k is corner factor. c This formulation is based on the following...span point. This relation sug- fests a linear decreasing function span factor such as: Ks = (1 - a)/l where 1 is span length a is transverse

  6. Damage Precursor Investigation of Fiber-Reinforced Composite Materials Under Fatigue Loads

    DTIC Science & Technology

    2013-09-01

    Ripley’s K function computed based on optical micrographs for independent experimental observations: (a) shows the short and long range response while...INTENTIONALLY LEFT BLANK. 1 1. Introduction Fiber-reinforced composite materials ( laminated composites and polymer matrix composites...necking or striations). In resin polymers during the damage nucleation process, the interplay between crazing and shear bands has been observed. Depending

  7. What Chinese Children and Youth Are Learning about the United States. Working Papers in Education.

    ERIC Educational Resources Information Center

    Gross, Richard E.

    This study examines history and social science textbooks used in China to see how the United States is presented in order to make inferences about what Chinese students are learning about the United States. The report also reflects the U.S. examination of Chinese textbooks. As part of the same study, U.S. K-12 textbooks were sent to China. The…

  8. Automated Quantification of Gradient Defined Features

    DTIC Science & Technology

    2008-09-01

    195, College Station TX. [4] Rowland, S. K., 1996, Slopes, lava flow volumes, and vent distributions on volcan Fernandina, Galapagos islands , J...the islands of Guam, Saipan, and Pagan. U.S. Government work not protected by U.S. copyright Report Documentation Page Form ApprovedOMB No. 0704-0188

  9. “Quadrangular-construct” modification of Sauve-Kapandji procedure

    PubMed Central

    Gupta, Ravi K; Soni, Ashwani; Malhotra, Anubhav; Masih, Gladson D

    2017-01-01

    Background: Subluxation of ulna in distal radioulnar joint disorders causes pain on motion, loss of grip strength, and a restriction of forearm rotation. Several procedures have been described to salvage DRUJ disorders including the Darrach procedure, the matched distal ulnar resection, the hemiresection interposition arthroplasty (Bowers procedure) and the Sauve-Kapandji (S-K) procedure. All these procedures are associated with either loss of grip, pain over proximal ulnar stump or instability. We describe our modification of S-K procedure with good functional outcome. Materials and Methods: Twenty patients, 12 male and 8 female, underwent S-K procedure, with our modification, were included in this study. Patients were evaluated preoperatively, postoperatively, and on followup visits using Modified Mayo Wrist Score and wrist radiographs. Average followup period was 34.55 months (range 24-64 months). Results: Excellent results were found in one patient, good in 15 patients, and fair in four patients. Mean Modified Mayo Wrist Score improved from 32 to 79.75, which was statistically significant. Conclusions: Our modification of S-K procedure provides good functional outcome with stable ulnar stump and without significant procedure-related complications. PMID:28216758

  10. A Brain-Machine-Brain Interface for Rewiring of Cortical Circuitry after Traumatic Brain Injury

    DTIC Science & Technology

    2013-09-01

    book of Engineering Statistics, H. Pham, Ed. New York, NY, USA: Springer, 2006, pp. 291–325. [25] S. W. Roberts , “Control chart tests based on geometric...A. V. Oppenheim and R. W. Schafer, Discrete-Time Signal Pro- cessing. Upper Saddle River, NJ, USA: Prentice-Hall, 2010. [29] S. K. Mitra, Digital

  11. ARPA-NRL Laser Program - Semiannual Technical Report to Defense Advanced Research Projects Agency, 1 January 1974-30 June 1974

    DTIC Science & Technology

    1975-04-01

    Quan. bloc. Conf., San Francisco (June 1974). 80 ■ • • - . 10, 1 ] li.l,. Patterson, J.D, Gorardo, and A. Wayne Johnson...and A Wayne .lulinson, Appl. Phy«, Lett., Vol. 26, No. 1, 1 July 1974 99 tm 82 S.K. Searles and G.A. Hart: Laser emission in Ar N, mixtures 82

  12. Harnessing Technology to Improve K-12 Education. Discussion Paper 2012-05

    ERIC Educational Resources Information Center

    Chatterji, Aaron; Jones, Benjamin

    2012-01-01

    Technological progress has consistently driven remarkable advances in the U.S. economy, yet K-12 education sees little technological change compared to other sectors, even as U.S. K-12 students increasingly lag behind students in other nations. This proposal considers how we can take a signature American strength--innovation--and apply it to K-12…

  13. Perspectives

    ERIC Educational Resources Information Center

    Tarone, Elaine

    2013-01-01

    The topic of this "Perspectives" column is "Requiring a Proficiency Level as a Requirement for U.S. K-12 Teacher Licensure." In 1998, the American Council of Teachers of Foreign Languages (ACTFL) began to work with the National Council for Accreditation of Teacher Education (NCATE), which accredits teacher education programs…

  14. 12 CFR Appendix A to Part 985 - Exceptions to the General Disclosure Standards

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... statement of financial information required by Items 301 and 302 of Rule S-K, 17 CFR 229.301 and 302, is... to members an officer of which serves as a Bank director, and list the top ten holders of advances in... which of these members had an officer that served as a Bank director. B. Biographical information....

  15. SCHOOL LIGHTING

    ERIC Educational Resources Information Center

    1965

    SEVERAL ARTICLES ON SCHOOL LIGHTING ARE CONTAINED IN THIS JOURNAL. THE TITLES AND AUTHORS INCLUDED ARE AS FOLLOWS--(1) "TODAY'S CONCEPTS IN SCHOOL LIGHTING" BY CHARLES D. GIBSON, (2) "CHALLENGE OF TOMMORROW'S LIGHTING" BY S.K. GUTH AND E.H. WITTE, (3) "PEEK PREVIEW OF THE WINDOWLESS SCHOOL" BY JAMES J. MORISSEAU, (4) "MAINTENANCE BEGINS BEFORE…

  16. Radiographic Parameter Analysis on Modified Sauvé-Kapandji Procedure

    PubMed Central

    Ota, Norikazu; Nakamura, Toshiyasu; Iwamoto, Takuji; Sato, Kazuki; Toyama, Yoshiaki

    2013-01-01

    Purpose The Sauvé-Kapandji (S-K) procedure is now an established treatment option for symptomatic distal radioulnar joint (DRUJ) dysfunction. However, for patients with poor bone quality (frequently as a result of advanced-stage rheumatoid arthritis [RA]), the conventional S-K procedure is difficult to perform without reducing the radioulnar diameter of the wrist, which may result in a loss of grip strength and pain over the proximal ulnar stump. The purpose of this study was to review the radiographic outcomes of patients who underwent a modified S-K procedure that involves rotating the resected ulnar segment 90 degrees and using it to bridge the gap between the sigmoid notch and the ulnar head. Methods The modified S-K procedure was performed in 29 wrists of 23 patients. Twenty-one patients had severe RA, while two had malunited radius fractures. The mean follow-up period was 43 months (range, 23 to 95). The radiographic evaluation included a measurement of the radioulnar width, the pseudarthrosis gap between the proximal and distal ulnar stump, the radioulnar distance, and the ulnar translation of the carpus. Results The radioulnar width of the wrist, pseudarthrosis gap, and radioulnar distance were well maintained throughout the period. A postoperative loss in the radioulnar width of the wrists appeared to correlate with a postoperative additional ulnar translocation of the carpus. Conclusion Narrowing of the radioulnar width of the wrist is a potential cause of progressive ulnar translocation of the carpus. The modified technique for the S-K procedure maintains the distal ulna in the proper position and provides sufficient ulnar support for the carpus. It is a useful reconstruction procedure in patients with severe RA with poor bone quality. PMID:24436785

  17. Radiographic parameter analysis on modified sauvé-kapandji procedure.

    PubMed

    Ota, Norikazu; Nakamura, Toshiyasu; Iwamoto, Takuji; Sato, Kazuki; Toyama, Yoshiaki

    2013-02-01

    Purpose The Sauvé-Kapandji (S-K) procedure is now an established treatment option for symptomatic distal radioulnar joint (DRUJ) dysfunction. However, for patients with poor bone quality (frequently as a result of advanced-stage rheumatoid arthritis [RA]), the conventional S-K procedure is difficult to perform without reducing the radioulnar diameter of the wrist, which may result in a loss of grip strength and pain over the proximal ulnar stump. The purpose of this study was to review the radiographic outcomes of patients who underwent a modified S-K procedure that involves rotating the resected ulnar segment 90 degrees and using it to bridge the gap between the sigmoid notch and the ulnar head. Methods The modified S-K procedure was performed in 29 wrists of 23 patients. Twenty-one patients had severe RA, while two had malunited radius fractures. The mean follow-up period was 43 months (range, 23 to 95). The radiographic evaluation included a measurement of the radioulnar width, the pseudarthrosis gap between the proximal and distal ulnar stump, the radioulnar distance, and the ulnar translation of the carpus. Results The radioulnar width of the wrist, pseudarthrosis gap, and radioulnar distance were well maintained throughout the period. A postoperative loss in the radioulnar width of the wrists appeared to correlate with a postoperative additional ulnar translocation of the carpus. Conclusion Narrowing of the radioulnar width of the wrist is a potential cause of progressive ulnar translocation of the carpus. The modified technique for the S-K procedure maintains the distal ulna in the proper position and provides sufficient ulnar support for the carpus. It is a useful reconstruction procedure in patients with severe RA with poor bone quality.

  18. A Study of Exclusive Nonleptonic Decays of B Mesons into Final States of Strange Mesons and 1S or 2S Charmonia

    NASA Astrophysics Data System (ADS)

    Warburton, Andreas T.

    2001-08-01

    [abridged] Bound states of heavy quarks can serve as a laboratory for inquiry into the behaviour of the fundamental strong and electroweak interactions. This thesis examines observations of B0, B0bar, and B+- mesons produced in proton-antiproton collisions at centre-of-mass energies of sqrt{s}=1.8 TeV. The B-meson decay products are recorded using the Collider Detector at Fermilab (CDF) located on the Tevatron collider at Fermilab, USA. Four B-meson decays and their charge conjugates are studied: B+ -> J/psi K+, B0 -> J/psi K*(892)0, B+ -> psi(2S) K+, and B0 -> psi(2S) K*(892)0. Using a data sample corresponding to a time-integrated luminosity of (109 +- 7)/pb, statistically significant signals are observed in all the channels. Topological similarities between the B decays are exploited to measure the six relative branching fractions (Br) of each channel with respect to the other channels. The ratios involving the B+ -> J/psi K+ mode are Br(B0 -> J/psi K*(892)0) / Br(B+ -> J/psi K+) = 1.76 +- 0.14[stat] +- 0.15[syst], Br(B+ -> psi(2S) K+) / Br(B+ -> J/psi K+) = 0.558 +- 0.082[stat] +- 0.056[syst], and Br(B0 -> psi(2S) K*(892)0) / Br(B+ -> J/psi K+) = 0.908 +- 0.194[stat] +- 0.100[syst]. The indicated uncertainties are statistical and systematic, respectively. In ratios involving unlike B-meson species, equal production rates for B+ and B0 mesons have been assumed. The B+ -> psi(2S) K+ and B0 -> psi(2S) K*(892)0 reconstructions are the first observations of these processes at a hadron collider. The branching-fraction ratio measurements are consistent with phenomenological predictions that employ the factorization Ansatz, and the derived absolute branching-fraction measurements are consistent with previous world-average limits and values from e+e- colliders. [abridged

  19. Analysis of Local Variations in Free Field Seismic Ground Motion.

    DTIC Science & Technology

    1981-01-01

    s )/(sq- k 2) B s (k2 - )/ (sq - k2) - q (k2 _ s 2 )/(sq - 12) -* sk ( s - q)/(sq - k2) (4.32) 102 hee 2 k2 - o2 / 2 2 k2 2 where q 2 , s = k -2 2 /V...JAN Al .J CHEN. J LYSMER. H B SEED DAAG29-76-6-0257 UNCLASSIFIED UCB/EERC-Al/03 ARD-13838.2G 44S IIIJIIL15 fO RtOP f S (OLUTRIN If ,l UN9LASSIFIED...those of the author( s ) and should not be construed as an official Department of the Army Position, policy, or decision, unless so designated by other

  20. Effects of phonon scattering on the magneto-conductance in single and double quantum wires

    NASA Astrophysics Data System (ADS)

    Huang, D.; Lyo, S. K.

    2003-03-01

    We present an exact numerical formalism for the solution of the Boltzmann equation dominated by elastic (e.g., interface-roughness) and phonon scattering in a quasi-one-dimensional system. The result is employed to study the temperature-dependent conductance of a single and tunnel-coupled double quantum wells (DQWs) as a function of a perpendicular magnetic field. According to recent studies, the zero-temperature conductance is enhanced dramatically as a function of the field when the Fermi level lies inside the anticrossing gap of the DQWs. [S. K. Lyo, J. Phys.-Condens. Matter 8, L703 (1996), D. Huang and S. K. Lyo, ibid, 12, 3383 (2000), S. V. Korepov and M. A. Liberman, Phys. Rev. B 60, 13770 (1999)] Our results show that phonon scattering modifies the conductance and its enhancement significantly at temperatures corresponding to the gap energy or the sublevel separation or higher.

  1. The Observability of Abundance Ratio Effects in Dynamically Hot Stellar Systems

    NASA Astrophysics Data System (ADS)

    Serven, Jedidiah; Worthey, Guy; Briley, Michael M.

    2005-07-01

    Using synthetic spectra, we construct a simple model of an elliptical galaxy with a velocity dispersion σ=200 km s-1. Absorption feature indices are defined that are sensitive to the abundances of C, N, O, Na, Mg, Al, Si, S, K, Ca, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Sr, Ba, and Eu as a first step in determining the abundances of these elements in stellar populations such as elliptical galaxies for which integrated spectra are available. Using these indices and assuming a photon statistical error such that S/N=100 around 5000 Å, the feasibility of measuring individual elements in real galaxies is assessed. Of the elements studied, only S, K, Cu, Zn, and Eu appear to be difficult to determine. The rest appear to be measurable with high-quality data and models. The effects of abundance changes on Lick IDS indices, Rose indices, and BRVI colors are also tabulated.

  2. The Observability of Abundance Ratio Effects in Elliptical Galaxies

    NASA Astrophysics Data System (ADS)

    Serven, J. L.; Worthey, G.; Briley, M. M.

    2004-12-01

    Using synthetic spectra we construct a simple model of an elliptical galaxy, with a velocity dispersion σ = 200 km s-1. Absorption feature indices are defined for C, N, O, Na, Mg, Al, Si, S, K, Ca, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Sr, Ba, and Eu as a first step in determining the abundances of these elements in stellar populations, such as elliptical galaxies, for which integrated light spectra are available. Then using these indices and assuming a photon error such that S/N = 100 around 5000 Å , the feasibility of measuring individual elements in real galaxies is assessed. Of the elements studied only S, K, Cu, Zn, and Eu appear to be difficult to determine; the rest appear to be at least feasible.

  3. A Comparison of Nuclear Thermal and Nuclear Electric Propulsion for Interplanetary Missions

    DTIC Science & Technology

    2007-11-02

    0.6 0.7 0.8 0.9 FIGURE 6: 1000 kg Jupiter NEP mission Dumbkopff Chart - Pluto NTR 500 kg 0 18000 0 500 1000 1500 Isp (sec) In iti al M as s (k g...sec) In iti al M as s (k g) 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 FIGURE 8: 500 kg Pluto NEP mission 5 These graph yield starting points for the...were low; an actual scientific mission to Jupiter and possibly Pluto would require more ∆V to insert the spacecraft into orbit and maneuver along the

  4. Regulation of ROMK (Kir1.1) channels: new mechanisms and aspects

    PubMed Central

    Wang, Wen-Hui

    2010-01-01

    This brief review attempts to provide an overview regarding recent developments in the regulation of ROMK channels. Studies performed in ROMK null mice suggest that ROMK cannot only form hometetramers such as the small-conductance (30-pS) K channels but also construct heterotetramers such as the 70-pS K channel in the thick ascending limb (TAL). The expression of ROMK channels in the plasma membrane is regulated by protein tyrosine kinase (PTK), serum and glucorticoid-induced kinase (SGK), and with-no-lysine-kinase 4. PTK is involved in mediating the effect of low K intake on ROMK channel activity. Increases in superoxide anions induced by low dietary K intake are responsible for the stimulation of PTK expression and tyrosine phosphorylation of ROMK channels. Finally, a recent study indicated that ROMK channels can be monoubiquitinated and monoubiquitination regulates the surface expression of ROMK channels. PMID:16339961

  5. Multidimensional scaling of ideological landscape on social network sites

    NASA Astrophysics Data System (ADS)

    Lee, Deokjae; Hahn, Kyu S.; Park, Juyong

    2012-02-01

    Social network sites (SNSs) are valuable source of information on various subjects in network science. Recently, political activity of SNSs users has increasing attention and is an interesting interdisciplinary subject of physical and social science. In this work, we measure ideological positions of the legislators of U.S. and South Korea (S.K.) evaluated by Twitter users, using the information employed in the bipartite network structure of the legislators and their Twitter followers. We compare the result with ideological positions constructed from roll call record of the legislators. This shows there is a discrepancy between the ideological positions evaluated by Twitter users and actual positions estimated from roll call votes in S.K. We also asses the ideological positions of the Twitter users themselves and analyze the distribution of the positions.

  6. The mixed coupled nonlinear Schrödinger equation on the half-line via the Fokas method.

    PubMed

    Tian, Shou-Fu

    2016-11-01

    In this paper, we implement the Fokas method to study initial-boundary value problems of the mixed coupled nonlinear Schrödinger equation formulated on the half-line with Lax pairs involving 3×3 matrices. The solution can be written in terms of the solution to a 3×3 Riemann-Hilbert problem. The relevant jump matrices are explicitly expressed in terms of the matrix-value spectral functions s(k) and S(k), which are determined by the initial values and boundary values at x=0, respectively. Some of these boundary values are unknown; however, using the fact that these specific functions satisfy a certain global relation, the unknown boundary values can be expressed in terms of the given initial and boundary data.

  7. The mixed coupled nonlinear SchrxF6dinger equation on the half-line via the Fokas method

    NASA Astrophysics Data System (ADS)

    Tian, Shou-Fu

    2016-11-01

    In this paper, we implement the Fokas method to study initial-boundary value problems of the mixed coupled nonlinear Schrödinger equation formulated on the half-line with Lax pairs involving 3×3 matrices. The solution can be written in terms of the solution to a 3×3 Riemann-Hilbert problem. The relevant jump matrices are explicitly expressed in terms of the matrix-value spectral functions s(k) and S(k), which are determined by the initial values and boundary values at x=0, respectively. Some of these boundary values are unknown; however, using the fact that these specific functions satisfy a certain global relation, the unknown boundary values can be expressed in terms of the given initial and boundary data.

  8. A New Pumpjet Design Theory

    DTIC Science & Technology

    1988-06-30

    THRU K &N* 0103 DOOZOKI,NFR,2 0104 COAK =COA(K) 0105 CUO~T2* COAK +CCK) 0106 DS(K,ISEC) 0Q4*COAK4.0S(K,ISEC) 0107 DT(K,ISEC) -06*COAIC4OT(K,ISEC) 0108 DG...KISEC) 0119 END DO 0120 520 CONTINUE 0121 00540K*2,NFR,2 0122 COAKzCOA(K) 0123 C(K)sT1* COAK +C(K) 0124 0S(K, ISEC)-03- COAK .06(K, ISEC) 0125 OT(K,ISEC...05CAK𔃺T(K,ISEC) 0126 DG(1,K,iSEC)= COAK *RSS .0G(1,K,ISEC) 0127 DH(1,K.ISEC)zCOAK*FCCS+ONC1,K,ISEC) 0128 19 = COAK *RSIA2 0129 17 ZCOAK*FCD 0130 T8 = COAK

  9. Chemistry Related to Possible Outgassing Sources on Mars

    NASA Technical Reports Server (NTRS)

    Wong, A. S.; Atreya, S. K.; Renno, N. O.

    2003-01-01

    An earlier paper, Chemical markers of possible hot spots on Mars by A. S. Wong, S. K. Atreya and Th. Encrenaz, explored the modification of the atmosphere of Mars following an influx of methane, sulfur dioxide and hydrogen sulfide (CH4, SO2, H2S) from any outgassing sources which are referred to as hot spots. The feasibility of detection of the new species by Planetary Fourier Spectrometer on Mars Express is reported in a subsequent paper, Atmospheric photochemistry above possible martian hot spots by A. S. Wong, S. K. Atreya, V. Formisano, Th. Encrenaz and N. Ignatiev. This abstract is a follow-up on the previous two papers. Here we treat the effect of any outgassed halogens rigorously. We also make estimates of dilution factors relative to the source location following convection and meridional transport.

  10. Space Assembly, Maintenance And Servicing Study Final Report, Volume 5: Simulation Report.

    DTIC Science & Technology

    2007-11-02

    use, and provided more tactile feedback to the operator, because the hands were relaxed during most phases of connector positioning and engagement...i p p e d s k i p p e d ■a 0 a. a CO O < < z z < z u CO OJ OJ c efl OJ u z z < Z 3 o tu o u a 4J c 3 4-1 CO 3 < < z z

  11. Status Report on Speech Research, 1 April-30 June 1982.

    DTIC Science & Technology

    1982-01-01

    Katchalsky, S. K., Rowland, V., & Blumenthal, R. Dynamic patterns of brain cell assemblies. Neurosciences Research Program Bulletin, 1974, 12. ----.ih e-23 J...the street" could be accomplished by a training program that concentrated on those factors most responsible for the differences between listeners. In...Molfese, D. L., & Molfese, V. J. VOT distinctions in infants: Learned or innate? In H. A. Whitaker & H. Whitaker (Eds.), Studies in neurolinguistics

  12. DARPA Status Report - November 1988

    DTIC Science & Technology

    1988-11-01

    chatturt. pages 44:3-451. 19M8. [9) J. P. Hayes et ad. A Microprocessor Based Hybrid Su- percomputer. IEEE Mifcro. 6. October 1986. [10] S. K. Heller...follow. 3 ---- ----- ----- I Main Process I <---> microprocessor + -- / I \\ / I \\ + .. -- + ....- + +-...--+ I Imt I I Synclcv I I Asyncacv I...by Hermod for two CPU chips: FRISC microprocessor , a stack- based 16-bit microprocessor [22], and PDP-8 CPU [21]. 4.1 FRISC Design The top-level

  13. International Biodeterioration Symposium (5th), Aberdeen, Scotland, 7-11 September 1981.

    DTIC Science & Technology

    1981-12-02

    Scopulariopsi8 brevicauli8 isolates obtained from broiler litter. S.K. Ogundana & N. Onwubuya (Nigeria): Fungal deterioration of maize in Butler storage. A...Anaerobic digestion of paper mill sludges, a potential sources of energy. A. Maccubbin, R. Benner & R.E. Hodson (US): Interaction of pulp mill effluents...with microbial populations in coastal waters and sediments. R.M. Madden and P. Forget (France): Anaerobic digestion of paper mill effluent. Thursday 10

  14. New Developments in Second-Order Nonlinear Optical Polymeric Materials

    DTIC Science & Technology

    1994-03-17

    spectrophotometer. SHG measurements were carried out according to the method reported earlier[151. RESULTS AND DISCUSSION SHG in spin coated film An...monolayers of poly(4-BCMU) were obtained by similar method . Fiber formation was not observed even at higher surface pressure and no measurable SH...1984). 12. W. H. Kim, N. B. Kodali , J. Kumar, and S. K. Tripathy, To be published in Macromolecules. 13. T. P. Russel, H. Gugger, and J. D. Swalen

  15. The Absorption Spectrum of an Electron Solvated in Sodalite

    DTIC Science & Technology

    1992-05-15

    S. FUNDING NUMBERS The Absorption Spectrum of an Electron N00014-90-J-1159 Solvated in Sodalite C AUTHOR(S) K. Haug, V. Srdanov, G. Stucky, and H...words) We use a simple model to study the color change taking place when sodium atoms are absorbed in the zeolite sodalite . The Hamiltonian is that...the absorption spectrum on the magnitude of framework charges, the orientation of the Na 4 cluster in the sodalite cells, the localization of the

  16. Mutant Proteins--Enzymes to Hydrolyze Toxic Organophosphates

    DTIC Science & Technology

    1991-06-17

    nearly superimposable with the peptide (12). Figure 11. Examination of the low resolution crystal structures of the 8- lactamase from Bacillus lichenifori...V L L B. licheniformis R F A F A S T I K A L T B. cereus R F A F A S T Y K A L A S. aureus R F A Y A S T S K A I N StreptomycesR61 R F R V G S V I K

  17. Optical Design for Photonics. Organization of the 1993 Photonics Science Topical Meetings Held in Palm Springs, California on March 22 - 24, 1993. Technical Digest Series, Volume 9

    DTIC Science & Technology

    1993-03-24

    from detailed diffraction analysis are applied to a variety of applications including waveguide grating couplers, high numerical aperture images...P.E. LAGASSE and P. VANDENBULCKE, "Finite Element Analysis of Optical Waveguides ", IEEE Trans. Mic. Theory Tech. MIT-29 (6) pp 660-605 (1981). 5. J.P...Applications", IEEE Trans. Mic. Theory Tech., MT-33, 1985. 9. S.T. CHU, W.P. HUANG and S.K. CHAUDHURI, "Simulation and analysis of waveguide based optical

  18. Effects of Atmospheric Water Vapor and Clouds on NOAA (National Oceanic and Atmospheric Administration) AVHRR (Advanced Very High Resolution Radiometer) Satellite Data.

    DTIC Science & Technology

    1984-07-01

    smoke , smog, dust and water ;erosols usually falls within the Mie Regime. The combination of Rayleigh and Mie scattering causes the selective...T. L., 1984. Department of Commerce, NOAA, NESDIS, Assesment Services Center, Columbia, MO, Personal Communications. Barnett, T. L. and Thompson, D...Washington, D.C., NOAA Technical Memorandum, NESS 107, 73 pp. LeDuc, S. K., 1984. U.S. Department of Commerce, NOAA, NESDIS, Assesment Information Services

  19. Microstructure and Properties of a Refractory NbCrMo0.5Ta0.5TiZr Alloy (Postprint)

    DTIC Science & Technology

    2014-04-01

    phases was con- ucted with the use of an EDS detector attached to the field mission gun SEM. The results are given in Table 2. It is found that he...Microstruc- ture and properties of a refractory TaNbHfZrTi alloy, Unpublished paper, 2011. 10] J.-W. Yeh, S.-K. Chen, S.-J. Lin, J.-Y. Gan, T.-S. Chin , T

  20. Study of the Influence of Metallurgical Factors on Fatigue and Fracture of Aerospace Structural Materials.

    DTIC Science & Technology

    1987-01-30

    e0 W2’ .IUJU .’ !P . ’W J W’ W’U’ W’ F. jW V . 1 9. W*-.. , V WJ W V J -. -- i U. -J - - 28 [ill A. N. Brown, O. J. Skinner, 0. Raybould , S. K. Das, R...1. Bye, and C. M. Adams, Int. Conf. on Aluminum Alloy, Charlottesville, VA, June 15-20, 1986. p [12] D. J. Skinner, R. L. Bye, 0. Raybould , and A. M

  1. 17 CFR 240.3b-6 - Liability for certain statements by issuers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... (§ 240.14a-3(b) and (c) or § 240.14c-3(a) and (b) of this chapter) and that relates to: (i) The effects... Regulation S-K (§ 229.303 of this chapter), “Management's Discussion and Analysis of Financial Condition and... limited to: (1) A statement containing a projection of revenues, income (loss), earnings (loss) per...

  2. A New Family of Schroder's Method and Its Variants Based on Power Means for Multiple Roots of Nonlinear Equations

    ERIC Educational Resources Information Center

    Kanwar, V.; Sharma, Kapil K.; Behl, Ramandeep

    2010-01-01

    In this article, we derive one-parameter family of Schroder's method based on Gupta et al.'s (K.C. Gupta, V. Kanwar, and S. Kumar, "A family of ellipse methods for solving non-linear equations", Int. J. Math. Educ. Sci. Technol. 40 (2009), pp. 571-575) family of ellipse methods for the solution of nonlinear equations. Further, we introduce new…

  3. Basic Studies in Combinatorial and Nondifferentiable Optimization.

    DTIC Science & Technology

    1978-03-01

    control problems with linear dynamics, convex cost, and convex inequality state and control constraints is analyzed...points. S.K. MITTER, Lagrange Duality Theory for Convex Control Problems , (with W.W. Hager), Journal of Control and Optimization , 14, August 1976, pp...Lagrange Duality Theory for Convex Control Problems ,” Journal of Control and Optimization , 14, August 1976, pp. 843—856. T.

  4. Chemistry of Lava-seawater Interactions

    DTIC Science & Technology

    1997-09-30

    enters the ocean along the shoreline of Kilauea Volcano (Sansone and Resing, 1995), at the Submarine Volcano of Loihi (Duennebier et al., 1997) where an...of Kilauea Volcano , Hawaii. PhD Dissertation, University of Hawaii, 258 pgs. Harris, A.J., L.P. Flynn, S.K. Rowland, L. Keszthelyi, P.J. Mouganis...we continued analyses of samples collected previously as well as participated in a follow up cruise in September 1997 to Loihi Volcano , a Seamount

  5. Need for Agility in Security Constraints for Distributed Simulation

    DTIC Science & Technology

    2014-06-01

    Submission to: 19th ICCRTS Title: Need for Agility in Security Constraints for Distributed Simulation (024) Topics: Primary Topic: 5...Modelling and Simulation , Alternates: 4. Experimentation, Metrics and Analysis, and 1. Concepts, Theory, and Policy S. K. Numrich, Ph.D...REPORT TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Need for Agility in Security Constraints for Distributed Simulation

  6. Nondestructive Vibratory Testing of Airport Pavements. Volume 1. Experimental Test Results and Development of Evaluation Methodology and Procedure

    DTIC Science & Technology

    1975-09-01

    Municipal Airport, J Jackson, Miss. Nashville Metropolitan Airport, NV Nashville, Tenn . Weir Cook Municipal Airport, I Indianapolis, Ind. Waterways...SrANDAA’o ERROR- OF Esr/MAr0 rr A 0 0 0 00 00 3 0 CAL/ PORN /A DVVS/ON OF HIGHWAYS 3-/N. ASPHALT/C CONCRErE - EOU/VALE S-K/P WHEEL LOADS HWAY ോ

  7. Modeling Modal Transient Behavior of GaAs Laser Diodes with Temperature Dependent Rate Equations and Comparison to Experimental Data

    DTIC Science & Technology

    1991-12-26

    Bernstein, "Lateral beam collimation of a phased array semiconductor laser", Appl. Phys. Lett., 41(7), 614 -616 (1982). [22] J. S. Manning, "Thermal...1. f[(k,31]*((L width dtbicknoe/ota Inergy) (I/tp 2 20^9) 1O^3/(top As.s)))( (k,1.Lonqthjfl (I Pioticined -> True, Flt3 .ag-( (timtazt~tiaead). (0

  8. Eagle and Double-Eagle

    DTIC Science & Technology

    1983-06-01

    Ashby, L.J. Demeter, M. Di Capua, J. Douglas, S.C. Glidden, H.G. Hammon, III; B. Huff , S.K. Lam, A. Rutherford, R. Ryan, P. Sincerny, and D.F...Argon Puff ," 19a2 IEEE International Conference on Plasma Science, Paper 2D3, IEEE a2CH1770-7 (19a2). 15. G. B. Frazier, ~ al., Proceedings of the 4th

  9. Theoretical Studies of Time Dependent/Independent Radiative Transfer Including Inelastic Scattering for Both Active and Passive Sources

    DTIC Science & Technology

    2003-09-30

    D. Travis, Light Scattering by Nonspherical Particles , Academic Press, 2000. 4. S. K Yee,. Numerical solution of initial boundary value problems...time domain method for light scattering by nonspherical and inhomogeneous particles ” in Light Scattering by Nonspherical Particles , M.I Mischenko,., J...of the National Academy of Sciences (2003) c) We have a completed a study of the sensitivity of the backscattering Mueller matrix to particle shape

  10. Sulfur Implanted Black Silicon for Metal Semiconductor Metal (MSM) Photodetectors

    DTIC Science & Technology

    2012-12-01

    MD, 2012. 5. Prasad, A.; Balakrishnan, S.; Jain, S. K.; Jain, C. G. J. Electrochem.Soc. 1995, 129, 596. 6. Green, M. A. Silicon Solar Cells ...reflectivity in a broad spectral range, leading to a black surface Si. Si with various structural morphologies is widely used for solar cells and other...of crucial importance, in particular, for high efficiency solar cells , and hence, a variety of approaches has been developed to this end, in many

  11. Analysis of three-body B decays to heavy vector and light pseudoscalar mesons

    NASA Astrophysics Data System (ADS)

    Mohammadi, Behnam; Mehraban, Hossein

    2014-09-01

    In this research, we analysis the three-body decays of the B0 meson to J/\\psi {{K}^{+}}{{\\pi }^{-}} and \\psi (2S){{K}^{+}}{{\\pi }^{-}} final-state mesons. By taking the factorization approach, for these decay modes, color-suppressed internal W-emission and penguin Feynman diagrams can be plotted. The transition matrix elements of {{B}^{0}}\\to J/\\psi (\\psi (2S)){{K}^{+}}{{\\pi }^{-}} are factorized into a {{B}^{0}}\\to {{K}^{+}}{{\\pi }^{-}} form factor multiplied by the J/\\psi (\\psi (2S)) decay constant. We investigate these decays by using the Dalitz plot analysis with an important assumption. We assume that, in the {{B}^{0}}\\to J/\\psi (\\psi (2S)){{K}^{+}}{{\\pi }^{-}} decays, because the mass of the J/\\psi (\\psi (2S)) is too heavy against the K and π mesons, therefore it carries a small momentum. In particular, the backlash of the J/\\psi (\\psi (2S)) can be neglected. With this assumption we get that the J/\\psi (\\psi (2S)) meson remains stationary, and the K and π mesons move back to back. We calculate the nonresonant contribution of {{B}^{0}}\\to J/\\psi {{K}^{+}}{{\\pi }^{-}} and {{B}^{0}}\\to \\psi (2S){{K}^{+}}{{\\pi }^{-}} decays and the branching ratios become 1.15_{-0.64}^{+0.89}\\times {{10}^{-3}} and 0.69_{-0.04}^{+0.05}\\times {{10}^{-3}}, respectively, and the experimental results for them are (1.20+/- 0.60)\\times {{10}^{-3}} and (0.57+/- 0.04)\\times {{10}^{-3}}, respectively. Note that the resonant contributions are very small, so we ignore them in our calculations.

  12. Modeling and Simulation of Texture Evolution During the Thermomechanical Processing of Titanium Alloys (PREPRINT)

    DTIC Science & Technology

    2008-09-01

    AFRL-RX-WP-TP-2008-4352 MODELING AND SIMULATION OF TEXTURE EVOLUTION DURING THE THERMOMECHANICAL PROCESSING OF TITANIUM ALLOYS (PREPRINT...the present article. 15. SUBJECT TERMS crystallographic texture, mechanical texturing, mechanical fibering, titanium alloy, thermomechanical...Thermomechanical Processing of Titanium Alloys S.L. Semiatin, S.V. Shevchenko*, O.M. Ivasishin*, M.G. Glavicic** Y.B. Chun***, and S.K. Hwang*** Air

  13. Prediction, Diagnosis, and Casual Thinking in Forecasting.

    DTIC Science & Technology

    1981-09-03

    consider the difficulties of evaluating forecast accuracy without a causal model of what generates DD 1473 O.TO.oi Nov 6s Is OBSOLETE UncDO, ,i S /k...details of the principles of deductive logic, prob- ability theory, access to computational equipment, etc. However, your level of substantive knowledge...interest is large (i.e., is of substantial duration and/or strength), we expect that the suspected cause( s ) are judged to be of compar- able size

  14. Understanding the Delay in Onset of Paget’s Disease of Bone

    DTIC Science & Technology

    2014-09-01

    of the measles virus   5 genome in which all three reading frames encode distinct genes (MVP, MVV and MVC ) using the same sequence. Our problem...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

  15. Trigonometric Parallaxes of Central Stars of Planetary Nebulae

    DTIC Science & Technology

    2007-02-01

    TRIGONOMETRIC PARALLAXES OF CENTRAL STARS OF PLANETARY NEBULAE Hugh C. Harris,1 Conard C. Dahn, Blaise Canzian, Harry H. Guetter, S. K. Leggett,2...parallaxes of 16 nearby planetary nebulae are presented, including reduced errors for seven objects with previous initial results and results for six new...unresolved close companions are detected. Key words: astrometry — planetary nebulae: general — stars: AGB and post-AGB — stars: distances 1. INTRODUCTION

  16. Campylobacter jejuni Induces Secretion of Proinflammatory Chemokines from Human Intestinal Epithelial Cells

    DTIC Science & Technology

    2005-07-01

    Gudis, T. Tsukui, and C. Sakamoto. 2003. Monocyte chemoat- tractant protein 1 (MCP-1) released from Helicobacter pylori stimulated gastric epithelial...S. Day. 2004. Gastric epithelial cell CXC chemokine secretion following Helicobacter pylori infection in vitro. J. Gastroenterol. Hepatol. 19:982...K. Kashima, and J. Imanishi. 1998. Chemokines in the gastric mucosa in Helicobacter pylori infection. Gut 42:609–617. 15. Yang, S. K., L. Eckmann, A

  17. Computational Study of Combustion Dynamics in a Single-Element Lean Direct Injection Gas Turbine Combustor

    DTIC Science & Technology

    2013-12-01

    VV V V K KV K  (2) The quantities; ρ, V and p represent the density, velocity vector and pressure, respectively; h0 is the stagnation enthalpy and...and w; In the viscous flux, D is the molecular diffusion coefficient; τ is the stress tensor and q is the heat flux; w and sK are the reaction rate... reaction rate. Although flamelets and transported-FMDF models are popular in unsteady LES simulations, their capabilities for predicting combustion

  18. Neurotoxin Binding Site on the Acetylcholine Receptor

    DTIC Science & Technology

    1987-03-01

    8794. 40. Neumann,D., D. Barchan , A. Safran, J.M. Gershoni, and S. Fuchs (1986) Proc. Nat. Acad. Sci. USA 83:3008-3011. 41. Juillerat, M.A., B... Barchan , M. Fridkin, and S. Fuchs (1986) Proc. Nat. Acad. Sci. USA 83:9250-9253. 57. Burl ey, S.K. and G.A. Petsko (19855’Science 229:23-28. 58 ;a

  19. Assessing Model Assumptions for Turbulent Premixed Combustion at High Karlovitz Number

    DTIC Science & Technology

    2015-09-03

    1309. [26] P. Carroll , G. Blanquart, A proposed modification to Lundgren’s physical space velocity forcing method for isotropic turbulence, Phys...Combust. Flame 159 (2012) 317–335. [30] P. Carroll , G. Blanquart, The effect of velocity field forcing techniques on the Karman-Howarth equation, J...331–368. [43] S. K. Lele, Compressibility effects on turbulence, Ann. Rev. Fluid Mech. 26 (1994) 211 – 254. [44] P. L. Carroll , G. Blanquart, A

  20. Time-Resolved and Spectroscopic Three-Dimensional Optical Breast Tomography

    DTIC Science & Technology

    2009-03-01

    targets embedded in m odel media of Intral ipid10% suspension in water (concen tration adjusted to m imic the average s cattering co efficient...im ages recorded with earlier arriving light highlight cancerous ti ssues , whi le t hose r ecorded with later arriving light highlight normal tissues...Spectroscopy of Ti ssue VII of SPIE’s Bi OS 2007/ Photonics W est, January 20-25, 2007, San Jose, California. 10. M. Xu, M. Alrubaiee, S. K. Gayen

  1. Flavius Vegetius Renatus: Great Roman Thinker

    DTIC Science & Technology

    1984-08-01

    research reDorts or educational pursuits contingent upon the following stipulations: -- Reproduction rights do not extend to any copyrighted material that...unioniza- tion of troops that began during the reign of Emperor Septimius * Severus (193-211 AD). The Emperor permitted or encouraged 3 S ’S - .,k , f...the Battle of Mursa (in what is now Yugoslavia), pitted the Roman army of the East against the Roman army of the West. (81247) 0 o*,. 6 The Emperor of

  2. Electronic Properties of High-Temperature Superconductors

    DTIC Science & Technology

    1989-08-01

    presented at the International Superconductor Applications Convention, San Francisco, 1989 (unpublished). SJ. %I. Tranquada , S. 2M. Heald, A. R. Moodenbaugh...Lett. 62, 102 (1989). 151 J. M. Tranquada , D. E. Cox, WV. Kunnmann, H. Moudden, G. Shirane, %I. Suenaga, P. Zolliker, D. Vaknin, S. K. Sinha, M. S...Alvarez, A. J. Jacobson, and D. C. Johnston, Phys. Rev. Lett. 60, 136 (1988); J. M. Tranquada , A. H. Nioudden, A. 1. Goldman, P. Zolliker, D. E. Cox, G

  3. Hierarchical and Multiscale Modeling for Elucidating the Androgren Receptor Signaling Pathway in Prostate Cancer

    DTIC Science & Technology

    2009-10-01

    cancers as a guide to targeted therapies. Nature 439:353-57. [34] Prasad, T. S . K., Goel, R., Kandasamy , K., Keerthikumar, S ., et al. (2009) Human...The views, opinions and/or findings contained in this report are those of the author( s ) and should not be construed as an official...Pathway in Prostate Cancer 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER Justin Guinney 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e

  4. Coarse-Graining Parameterization and Multiscale Simulation of Hierarchical Systems. Part I: Theory and Model Formulation

    DTIC Science & Technology

    2010-01-01

    Semiquantitative Lipid Simulations. Journal of Physical Chemistry B 108:750–760. 46. Monticelli, L., S . K. Kandasamy , X. Periole, R. G. Larson, D. P...NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND...LAMM),Cambridge,MA,02139 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME( S ) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S

  5. 17 CFR 200.800 - OMB control numbers assigned pursuant to the Paperwork Reduction Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false OMB control numbers assigned.... Regulation S-X PART 210 3235-0009 Regulation S-B PART 228 3235-0417 Regulation S-K PART 229 3235-0071 Rule... thru 230.905 3235-0357 Regulation S-T Part 232 3235-0424 Form SB-1 239.9 3235-0423 Form SB-2...

  6. The Muslim Brotherhood in America: Orthodox and Active

    DTIC Science & Technology

    2012-05-17

    determine His word.57 56 Phillip C. Jessup , forward to The Islamic Law of Nations by...wrote The Quranic Concept of War. According to General M . Zia-Ul-Haq, the Pakistani Army Chief of Staff at the time, the Quranic Concept of War...72 M . Zia-Ul-Haq, “Foreward” The Qur’anic Concept of War by S.K. Malik (Delhi: Adam Publishers and Distributors, 1992

  7. Hole Trapping in Thermal Oxides Grown under Various Oxidation Conditions Using Avalanche Injection in Poly-Silicon Gate Structures

    DTIC Science & Technology

    2014-05-01

    Hole Trapping in Thermal Oxides Grown under Vaious Oxidation Conditions Using Avalanche Injection in Poly-Silicon Gate Structures Contractor... Avalanche In ection in Poly-Silicon Gate Structureac 12. PERSONAL AUTHOR(S) K.V. Anand, B.R. Cairns, R.J. Strain 13a. TYPE OF REPORT 13b. TIME...Trapping, Oxidation Conditions, Avalanche Injection, Poly-Silicon Gates, Oxide Traps 19. ABSTRACT (Continue on reverse If necenry W Identify by block

  8. Bibliography of Soviet Developments in Superconductivity, January 1975 - June 1976

    DTIC Science & Technology

    1976-08-31

    period of flux quantization In hollow superconducting cylinders, due to quantom effects In the normal state. Phys. st. solidl (b), v. 67, no...and S. K. Uvarova. ’Plasmon and exciton mechanisms of superconductivity in layered structures. Fiz. m nizk. temp., no. 8, 1975, 984-995. — 65...1975, 686-690. 73. Gasparyan, R. A.,, and V. Z. Kresin. Thermal dissipation mechanism in type II superconductors. ZhETF, v. 69, no. 1

  9. Global Ocean Tides. Part IV. The Diurnal Luni-Solar Declination Tide (K1), Atlas of Tidal Charts and Maps.

    DTIC Science & Technology

    1981-05-15

    1979). Private Communications: I). (. Simpson ((1977). National Ocean Survey, Rockville, Maryland, S. K. Gill and D. L. Porter ( IlIXS), National...80303 National Geodetic Survey ATTN: Dr. W. R. Holland Rockville, MD 20852 ATTN: Dr. B. Chovitz NASA/Goddard Space Flight (’enter Dr. J. M. Diamante ... Porter Branch R. A. Smith Wallops Island, VA 23337 B. B. Parker ATTN: C. I). Leitao N. I.. Huang NOAA Atlantic Oceanographic and W. B. Krabill

  10. Global Ocean Tides. Part VI. The Semidiurnal Elliptical Lunar Tide (N2), Atlas of Tidal Charts and Maps.

    DTIC Science & Technology

    1981-05-01

    Rockville, Maryland; S. K. Gill and D. L. Porter (1978), National Ocean Survey, Rockville, Maryland; K. Wyrtki (1978), University of Hawaii, Honolulu...ATTN: Dr. B. Chovitz Dr. J. M. Diamante Dr. B. C. Douglas Dr. C. C. Goad Dr. F. Morrison NOAA/National Ocean Survey Oceangraphic Division...Rockville, MD 20852 ATTN: D.C.Simpson D. L. Porter R. A. Smith B. B. Parker NOAA/Atlantic Oceanographic and Meteorological Lab. Physical

  11. Case-Based Parameter Selection for Plans: Coordinating Autonomous Vehicle Teams

    DTIC Science & Technology

    2014-10-01

    Solution[] // A vector of parameter settings for q Legend : Nq // q’s k-Neighborhood of cases s // A parameter among those in q’s predicted solution S V otes...Case-based game play in the robocup four-legged league : Part I The theoretical model. In: RoboCup 2003: Robot Soccer World Cup VII. pp. 739–747 (2003) 7

  12. Development of a Bioaccumulation Test Method with the Amphipod Leptocheirus plumulosus

    DTIC Science & Technology

    2011-04-01

    Marine Environmental Research 64 (5): 541-555. Driscoll, S. K., and A . E. McElroy. 1996. Bioaccumulation and metabolism of benzo [ a ] pyrene in three... A ., A . M. B. Giessing, L. J. Rasmussen, and O. Andersen. 2005. Biotransformation of the polycyclic aromatic hydrocarbon pyrene in the marine...ERDC TN-DOER-R15 April 2011 Development of a Bioaccumulation Test Method with the Amphipod Leptocheirus plumulosus by J. Daniel Farrar

  13. Configuration Synthesis and Efficient Motion Programming of Robot Manipulators

    DTIC Science & Technology

    1991-03-15

    Efficient Motion Programming of Robot Manipulators P og DAAL 03-87-K-0041 6. AUTHOR(S) K.C. Gupta 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) B...this research was to study the factors which influ- ence the design of robot arms and wrists (configuration synthesis). Another objective was to...develop efficient computational software tools for the manipulation of industrial robots . These software tools were to address the critical problems which

  14. Environmental Constraints in Earth-Space Propagaton.

    DTIC Science & Technology

    1980-11-20

    SOON) and radio ( RSTN ) stations to augment the traditional solar monitoring technologies. Other nearly real-time data sets available at AFGWC include x...may arise in some instances given the conditions above. It is of interest to note that a precise description of the channel using complex signal...Services", J. Telecomm. 46 (XTI. BENT R. B., S. K. LLEWELLYN, and M. K. WALLOCK, 1972, " Description and Evaluation of the BENT Ionospheric Model

  15. SERS Engineering Collaboration

    DTIC Science & Technology

    2012-06-01

    Publications: E1. “ Femtosecond Laser-Nanostructured Substrates for Surface-Enhanced Raman Scattering” Diebold, E. D.; Mack, N.H.; Doorn, S. K; Mazur...performed research on the design and realization of high performance substrates for surface enhanced Raman scattering (SERS), and elucidated the role of...We demonstrated that by optimizing the design of metallic nanostructures, the average enhancement factor (EF) for surface-enhanced Raman

  16. Understanding Bandwidth Limitations in Robot Force Control.

    DTIC Science & Technology

    1987-08-01

    we have the root locus plot shape (for varying kf) drawn in Figure 17. The PI controller adds a pole at the origin and * adds a zero at s-k...implementation analysis are: w. * Digital effects are significant, but should not present a problem in modem computer-based systems. *Low-pass filtering and PI ... control add destabilizing poles, which introduce phase lag and limit closed-loop bandwidth. 6 * PD control and lead compensation add zeros which

  17. Application of the AM1 and MNDO Semiempirical Quantum Mechanical Molecular Models.

    DTIC Science & Technology

    1986-12-01

    basic role in chemistry, in particular in biochemistry . A knowledge of the proton affinities (PA) of bases, and of the deprotonation enthalpies (DPE) of...moderate cost, AMI should prove useful as an aid in interpretating FIR proton transfer in chemistry and biochemistry . 4.’% -I,. 5...Buttrill, S.E., Jr. Org. Mass Spectrom. 1976, 11, 762. 23(a). Pollack, S. K.; Devlin , J.L., III; Suxnmerhays, K.D.; Taft, R.W.; Hehre, W. J. J. Am. Chem

  18. In Vitro Cytotoxic Potential of Afghanistan Sand Extract

    DTIC Science & Technology

    2013-02-05

    Kaul S , Kanthasamy A, Kitazawa M, Anantharam V, Kanthasamy AG (2003). Caspase-3 dependent proteolytic activation of protein kinase C delta mediates...In Vitro Cytotoxic Potential of Afghanistan Sand Extract 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) K...Prabhakaran; P. Gunasekar 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 60769 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) Naval Medical

  19. Examining the Effectiveness of Mindfulness Meditation for Chronic Pain Management in Combat Veterans with Traumatic Brain Injury

    DTIC Science & Technology

    2013-01-01

    Hudson, J. I., Hess, E. V., Ware, A. E., Fritz, D. A., Auchenbach, M. B., et al. (2004). Family study of fibromyalgia . Arthritis Rheum, 50(3), 944...Disruption of cognitive function in fibromyalgia syndrome. Pain, 139(3), 610-616. Dobscha, S. K., Corson, K., Flores, J. A., Tansill, E. C...responses to pain among persons with fibromyalgia . Brain, 127(Pt 4), 835-843. Grant, J. A., & Rainville, P. (2009). Pain sensitivity and analgesic

  20. Parametric Antenna Analysis Software Package. Volume 2. Computer Program Documentation and User Manuals

    DTIC Science & Technology

    1978-09-01

    DEVICE NAME- (ST1, DS1 ,...) ZNN ...... NNN -OCTAL REPR.ESENITATION OF THE SEEK ADDRESS AAA ...... AAA =12 BCD CHARACTERS OF THE CATALOG ELE’:.NT IN ERROR...READ(LUDIN ’IBLK)A DO 1400 KK-1,16 DO 1300 JJ-1,1S K-Kl+KK J-J1 +JJ XJD-ABS(ICNTJ-J) 2ABS(ICNTJ-J) 2{KD-ABS (ICNTK-K) *ABS (ICNTK- K) DST -SQRT(XJD

  1. Aircraft Structural Fatigue. Proceedings of a Symposium held in Melbourne on 19-20 October, 1976.

    DTIC Science & Technology

    1977-04-01

    Between Ferstat, Q. Perth and Darwin . CSiR Div. of Aero. Rep. SM!35, 1949 12. Hooke, F. H. Load Frequency Measurements on a Linc-n Aircraft. CSIR Div. of...Aeronautical Research Laboratories, Aus- tralia, 1967 28. Cartwright , D. I., and Methods of Determining Stress Intensity Factors. Rooke, D. P. RAE TR 73031...Stress Intensity Factors. Cartwright , D. J. Her Majesty’s Stationery Office, London, 1976. 33. Chan, S. K., On the Finite Element Method in Linear

  2. Influence of Small Scale Yielding on Dynamic Fracture.

    DTIC Science & Technology

    1980-05-01

    MAT-16. 10 10. CHEVERTON, R.D. and ISKANDER, S.K., "Application of Static and Dynamic Crack Arrest Theory to Thermal Shock Experiment TSE-4," NUREG /CR...0767, ORNL/ NUREG -57, June 1979. 11. KANNINEN, M.P., MUKHERJEE, A.K., ROSENFIELD, A.R. and HAHN, G.T., "The Speed of Ductile-Crack Propagation and the

  3. Reprographics Career Ladder AFSC 703X0.

    DTIC Science & Technology

    1981-07-01

    APPENDIX A -------------------------------------------- 62 APPENDIX B-------------------------------- - 63 : K : t 1c,;l .: • . C V ’,, ," ii LUI CrA...relative degree of difficulty for each task in the inventory. Job Difficulty index (JDI). After computing a task difficulty value for each ta-s- k tm...percent time spent on tasks, independent of classification, grade, rank , o . rio’ background a ,ar- mation. in this case, the creer iadder structu

  4. Plasmonic Paper as a Highly Efficient SERS Substrate

    DTIC Science & Technology

    2012-09-01

    trinitrotoluene (TNT), which inherently have low vapor pressure (~10 ppbv at room temperature), intentional packaging further lowers the actual vapor ...invariably present on the surface of objects exposed to the explosive. Physical swabbing, puffer systems (aerodynamic), and direct vapor sniffing...C. R.; Thompson, L. B.; Maria, J.; Gray, S. K.; Rogers, J. A.; Nuzzo, R. G. Chem. Rev. 2008, 108, 494-521. 7 Haynes , C. L.; Van Duyne, R. P. J

  5. Nocturnal hypoxemia in children and adolescents with cystic fibrosis*

    PubMed Central

    Ramos, Regina Terse Trindade; Santana, Maria Angélica Pinheiro; Almeida, Priscila de Carvalho; Machado, Almério de Souza; Araújo-Filho, José Bouzas; Salles, Cristina

    2013-01-01

    OBJECTIVE: To determine the prevalence of nocturnal hypoxemia and its association with pulmonary function, nutritional status, sleep macrostructure, and obstructive respiratory events during sleep in a population of clinically stable children and adolescents with cystic fibrosis (CF). METHODS: This was a cross-sectional study involving 67 children and adolescents with CF between 2 and 14 years of age. All of the participants underwent polysomnography, and SpO2 was measured by pulse oximetry. We also evaluated the Shwachman-Kulczycki (S-K) scores, spirometry findings, and nutritional status of the patients. RESULTS: The study involved 67 patients. The mean age of the patients was 8 years. The S-K scores differed significantly between the patients with and without nocturnal hypoxemia, which was defined as an SpO2 < 90% for more than 5% of the total sleep time (73.75 ± 6.29 vs. 86.38 ± 8.70; p < 0.01). Nocturnal hypoxemia correlated with the severity of lung disease, FEV1 (rs = −0.42; p = 0.01), FVC (rs = −0.46; p = 0.01), microarousal index (rs = 0.32; p = 0.01), and apnea-hypopnea index (rs = 0.56; p = 0.01). CONCLUSIONS: In this sample of patients with CF and mild-to-moderate lung disease, nocturnal oxygenation correlated with the S-K score, spirometry variables, sleep macrostructure variables, and the apnea-hypopnea index. PMID:24473760

  6. Exact solutions of kinetic equations in an autocatalytic growth model.

    PubMed

    Jędrak, Jakub

    2013-02-01

    Kinetic equations are introduced for the transition-metal nanocluster nucleation and growth mechanism, as proposed by Watzky and Finke [J. Am. Chem. Soc. 119, 10382 (1997)]. Equations of this type take the form of Smoluchowski coagulation equations supplemented with the terms responsible for the chemical reactions. In the absence of coagulation, we find complete analytical solutions of the model equations for the autocatalytic rate constant both proportional to the cluster mass, and the mass-independent one. In the former case, ξ(k)=s(k)(ξ(1))[proportionality]ξ(1)(k)/k was obtained, while in the latter, the functional form of s(k)(ξ(1)) is more complicated. In both cases, ξ(1)(t)=h(μ)(M(μ)(t)) is a function of the moments of the mass distribution. Both functions, s(k)(ξ(1)) and h(μ)(M(μ)), depend on the assumed mechanism of autocatalytic growth and monomer production, and not on other chemical reactions present in a system.

  7. Forward cw CO/sub 2/-laser scattering on a high density plasma column

    SciTech Connect

    Lachambre, J.L.; Decoste, R.; Robert, A.; Noel, P.

    1983-09-01

    Wave-number and frequency spectra S(k,..omega..) associated with spontaneous electrostatic fluctuations in a high-density (5 x 10/sup 21/ m/sup -3/) current-driven plasma are measured using forward CO/sub 2/-laser scattering with homodyne detection. Scattering measurements during the quiescent plateau phase of the discharge show fluctuation levels several orders of magnitude above the thermal level with k/sup -4/ and ..omega../sup -2/ spectral amplitude dependences. The fluctuations are found to be isotropic in a plane transverse to the magnetic axis with S(k/sub parallel/,..omega..)<<S(k/sub perpendicular/,..omega..). The scattering apparatus is also shown to be a valuable diagnostic tool for basic studies of plasma current transport across magnetic field lines. In fact, a clear correlation is observed between the appearance of strong fluctuations and the rapid current penetration during fast plasma current reversal experiments. Finally, cw scattering results are used to find a set of experimental conditions suitable for the measurement of the ion temperature using a CO/sub 2/ pulsed scattering system.

  8. The use of regression equations for quality control in a pesticide physical property database

    NASA Astrophysics Data System (ADS)

    Johnson, Bruce; Johnson, Carol; Seiber, James

    1995-01-01

    Quality control is a crucial aspect of database management, particularly for physicochemical parameters that are widely used in modeling environmental fate processes. Complete rechecking of original studies to verify environmental fate parameters is time consuming and difficult. This paper evaluates an alternative, more efficient approach to identifying database errors. The approach focuses verification efforts on a targeted subset of entries by making use of the relationship between water solubility (S) and soil organic carbon partition coefficient ( K oc ). Two regression equations, one selected from the literature and one calculated from entries in the database, were used to evaluate the reasonableness of ( S, K oc ) pairs among control compared to the targeted outlier group from a total of 59 pesticides. Our hypothesis was that ( S, K oc ) pairs that lay far from the regression line were more likely to be in error than those that fit the regression. Database values were checked against original studies. Identified errors in the database included coding mistakes, miscalculations, and incorrect chemical identification codes. The error rate in outlier ( S, K oc ) pairs was about twice that of pairs that conformed to the regression equation; however, the error rate differential was probably not large enough to justify the use of this quality control method. Through our close scrutiny of database entries we were able to identify administrative practices that led to mistakes in the data base. Resolution of these problems will significantly decrease the number of future mistakes.

  9. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    NASA Astrophysics Data System (ADS)

    Kim, Yeongho; Ban, Keun-Yong; Honsberg, Christiana B.

    2015-06-01

    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950-1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300-880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%).

  10. Electronic structure and hybridization of CaS by means of X-ray absorption spectroscopy at Ca and S K-edges.

    PubMed

    Xu, Wei; Liu, Lijuan; Cui, Mingqi; Zheng, Lei; Hu, Yongfeng; Marcelli, Augusto; Wu, Ziyu

    2013-01-01

    The cubic calcium sulfide (CaS) is a well known system and an attractive building block material for many luminescence technological applications. However, it is essential to achieve an accurate understanding of its electronic structure in order to engineer its band structure for optimized applications. Here a study of the electronic structure of CaS by means of X-ray absorption spectroscopy performed at both Ca and S K-edges, and calculations performed in the framework of the multiple-scattering theory and of the finite difference method are presented. At the Ca K-edge the presence of an anomalous d states feature is discussed while in the S K-edge spectrum the presence of a pre-edge shoulder owing to the hybridization among Ca d states and S p states is pointed out. Although the l-projected density of states of CaS is in good agreement with previous first-principles calculations, the standard muffin-tin potential is inadequate to reproduce near-edge structures at both Ca and S K-edges in this system. Indeed, with its highly symmetric and less compact structure, CaS is characterized by a large set of collinear atomic configurations that pose severe constraints on the construction of the atomic potential. On the contrary, the finite-difference method with no muffin-tin approximation is more suitable for X-ray absorption calculations in this system.

  11. Structure, thermodynamic and surface properties of liquid metals investigated by Square well potential

    NASA Astrophysics Data System (ADS)

    Lalneihpuii, R.; Mishra, Raj Kumar

    2016-10-01

    The auto correlation function, S(k) (where k = 4π/λsinθ) and its Fourier component g(r) are important quantities characterizing the structure of a liquid. Experimentally these quantities have been determined using neutron or X-ray scattering intensities. Wertheim's solution of the fundamental statistical mechanical equation given by Percus and Yevick for hard spheres mixture is invoked with square well attractive part as a perturbation tail to evaluate the direct correlation function C(k) in momentum space through which structure factor, S(k) of liquid metals were derived. Radial distribution function, g(r) is obtained by Fourier analysis of computed S(k) from which the coordination numbers of ten liquid metals were computed. Surface tension of atomic liquids in terms of diffusion coefficient has been determined under square well interaction. The computed values of structural dependent coordination number, diffusion coefficient and surface tension of these liquid metals are compared with the available experimental results and a good agreement is found between the computed and experimental results

  12. The Sauvé-Kapandji Procedure

    PubMed Central

    Lluch, Alberto

    2013-01-01

    Arthrodesis is the most reliable and durable surgical procedure for the treatment of a joint disorder, and its only disadvantage is the loss of motion of the fused joint. The distal radioulnar joint can be arthrodesed, while forearm pronation and supination are maintained or even improved by creating a pseudoarthrosis of the ulna just proximal to the arthrodesis. This is known as the Sauvé-Kapandji (S-K) procedure. The Sauvé-Kapandji differs from the Darrach procedure in that it preserves ulnar support of the wrist, as the distal radioulnar ligaments and ulnocarpal ligaments are maintained. Aesthetic appearance is also superior after the S-K procedure, as the normal prominence of the ulnar head, most noticeable when the forearm is in pronation, is maintained. However, the S-K is not free of possible complications, such as nonunion or delayed union of the arthrodesis, fibrous or osseous union at the pseudoarthrosis, and painful instability at the proximal ulna stump. All of these complications can be prevented if a careful surgical technique is used. PMID:24436787

  13. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    SciTech Connect

    Kim, Yeongho; Ban, Keun-Yong Honsberg, Christiana B.

    2015-06-01

    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950–1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300–880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%)

  14. [Effect of mutations affecting coat color on the blood lymphocyte structure in the American mink (Mustela vison Schreber, 1777)].

    PubMed

    Uzenbaeva, L B; Trapezov, O V; Kizhina, A G; Iliukha, V A; Trapezova, L I; Tiutiunnik, N N

    2011-01-01

    American minks with different genotypes containing the Aleutian coat color allele in the homozygous state, including the single recessive Aleutian (a/a); double recessive sapphire (a/a p/p) and lavender (m/m a/a); triple recessive violet (m/m a/a p/p); and dominant-recessive cross sapphire (S/+ a/a p/p), sapphire leopard (S(K)/+ a/a p/p), and shadow sapphire (S(H)/+ a/a p/p) minks, as well as American minks without the Aleutian allele, including the standard (+/+); single recessive silver-blue (p/p) and hedlund-white (h/h); double recessive pearl (k/k p/p), Finnish topaz (t(S)/t(S) b/b); incompletely dominant royal silver (S(R)/+), standard leopard (S(K)/+), and black crystal (C(R)/+); and dominant-recessive snowy topaz (C(R)/+ t(S)/t(S) b/b) and Kujtezhy-spotted (S(K)/+ b/b) minks have been studied. Homozygosity for the a allele has been found to disturb the subcellular structure of leukocyte, namely the formation of abnormally large granules.

  15. Radiographic comparative evaluation of the Sauve-Kapandji procedure and the Darrach procedure for rheumatoid wrist reconstruction.

    PubMed

    Kobayashi, Akimasa; Futami, Toshirou; Tadano, Isao; Fujita, Mamoru; Watanabe, Tetsuya; Moriguchi, Takao

    2005-01-01

    For surgical treatment of rheumatoid wrists, we have routinely selected the Sauve-Kapandji (S-K) procedure or the Darrach procedure based on predetermined indications. In this study, we conducted a retrospective radiographic comparative evaluation of the changes in the carpus after the two procedures. The S-K group and the Darrach group each consisted of 13 wrists of 10 patients (all women). The indications for the Darrach procedure were the presence of radiolunate fusion, radial shelf formation, and old age. The carpal height ratio (CHR) and the ulnocarpal distance ratio (UCDR) were determined on wrist radiograms obtained before operation and at the final follow-up. The mean follow-up period was 4 years. Fisher's test was used to analyze the differences between the two groups. Both groups showed a decrease in mean CHR and an increase in mean UCDR at the final follow-up compared to the values before the operation, and there were no statistically significant differences. Furthermore, in the Darrach group, no significant differences in changes of the carpus were observed between patients with or without a radial shelf. We concluded that the present results do not support the superiority of the S-K method over the Darrach procedure for rheumatoid wrist reconstruction based on a radiographic evaluation.

  16. The sauvé-kapandji procedure.

    PubMed

    Lluch, Alberto

    2013-02-01

    Arthrodesis is the most reliable and durable surgical procedure for the treatment of a joint disorder, and its only disadvantage is the loss of motion of the fused joint. The distal radioulnar joint can be arthrodesed, while forearm pronation and supination are maintained or even improved by creating a pseudoarthrosis of the ulna just proximal to the arthrodesis. This is known as the Sauvé-Kapandji (S-K) procedure. The Sauvé-Kapandji differs from the Darrach procedure in that it preserves ulnar support of the wrist, as the distal radioulnar ligaments and ulnocarpal ligaments are maintained. Aesthetic appearance is also superior after the S-K procedure, as the normal prominence of the ulnar head, most noticeable when the forearm is in pronation, is maintained. However, the S-K is not free of possible complications, such as nonunion or delayed union of the arthrodesis, fibrous or osseous union at the pseudoarthrosis, and painful instability at the proximal ulna stump. All of these complications can be prevented if a careful surgical technique is used.

  17. Usefulness of absorbable screws in the Sauvé-Kapandji procedure for rheumatoid wrist reconstruction.

    PubMed

    Nakamura, K; Oda, H; Tanaka, S; Kuga, Y; Yamamoto, M; Nishikawa, T; Juji, T; Shimizu, M

    2002-06-01

    Abstract  In the Sauvé-Kapandji (S-K) procedure for rheumatoid wrist reconstruction, the distal end of the ulna is fixed to the radius with screws. Recently, absorbable screws have increasingly been used instead of metal ones. However, the clinical usefulness of absorbable screws in S-K procedures for rheumatoid patients is still unknown. The purpose of this article is to evaluate the effect of absorbable screws in this procedure by comparing their clinical results with those of metal screws. Poly-l-lactic acid (PLLA) absorbable screws were used in 23 wrists, and metal screws were used in 20 wrists. We evaluated the presence of general or local reactions to PLLA, the stability of the ulnar head, the time to bone union, changes in the shape of the distal ulna, and the presence of bone resorption around the screws. There were no complications with the use of PLLA screws, and their fixation stability was adequate to form sufficient bone union. In five cases in the metal screw group, bone resorption around the screws occurred between 1 and 2 years after surgery. Bone resorption around the PLLA screws was not observed. We conclude that absorbable screws may be more useful than metal screws in the S-K procedure for rheumatoid wrist reconstruction.

  18. Histone H3R2 symmetric dimethylation and histone H3K4 trimethylation are tightly correlated in eukaryotic genomes

    PubMed Central

    Yuan, Chih-Chi; Matthews, Adam G.W.; Jin, Yi; Chen, Chang Feng; Chapman, Brad A.; Ohsumi, Toshiro K.; Glass, Karen C.; Kutateladze, Tatiana G.; Borowsky, Mark L.; Struhl, Kevin; Oettinger, Marjorie A.

    2012-01-01

    Summary The preferential in vitro interaction of the PHD finger of RAG2, a subunit of the V(D)J recombinase, with histone H3 tails simultaneously trimethylated at lysine 4 and symmetrically dimethylated at arginine 2 (H3R2me2sK4me3) predicted the existence of the previously unknown histone modification, H3R2me2s. Here, we report the in vivo identification of H3R2me2s . Consistent with the binding specificity of the RAG2 PHD finger, high levels of H3R2me2sK4me3 are found at antigen receptor gene segments ready for rearrangement. However, this double modification is much more general; it is conserved throughout eukaryotic evolution. In mouse, H3R2me2s is tightly correlated with H3K4me3 at active promoters throughout the genome. Mutational analysis in S. cerevisiae reveals that deposition of H3R2me2s requires the same Set1 complex that deposits H3K4me3. Our work suggests that H3R2me2sK4me3, not simply H3K4me3 alone, is the mark of active promoters, and that factors that recognize H3K4me3 will have their binding modulated by their preference for H3R2me2s. PMID:22720264

  19. Classical mutual information in mean-field spin glass models

    NASA Astrophysics Data System (ADS)

    Alba, Vincenzo; Inglis, Stephen; Pollet, Lode

    2016-03-01

    We investigate the classical Rényi entropy Sn and the associated mutual information In in the Sherrington-Kirkpatrick (S-K) model, which is the paradigm model of mean-field spin glasses. Using classical Monte Carlo simulations and analytical tools we investigate the S-K model in the n -sheet booklet. This is achieved by gluing together n independent copies of the model, and it is the main ingredient for constructing the Rényi entanglement-related quantities. We find a glassy phase at low temperatures, whereas at high temperatures the model exhibits paramagnetic behavior, consistent with the regular S-K model. The temperature of the paramagnetic-glassy transition depends nontrivially on the geometry of the booklet. At high temperatures we provide the exact solution of the model by exploiting the replica symmetry. This is the permutation symmetry among the fictitious replicas that are used to perform disorder averages (via the replica trick). In the glassy phase the replica symmetry has to be broken. Using a generalization of the Parisi solution, we provide analytical results for Sn and In and for standard thermodynamic quantities. Both Sn and In exhibit a volume law in the whole phase diagram. We characterize the behavior of the corresponding densities, Sn/N and In/N , in the thermodynamic limit. Interestingly, at the critical point the mutual information does not exhibit any crossing for different system sizes, in contrast with local spin models.

  20. Carbonatite-silicate immiscible melt inclusion in lamprophyre from Kutch, western India: Implication for plume-lithosphere interaction and initiation of Deccan Trap magmatism

    NASA Astrophysics Data System (ADS)

    Ray, Arijit; Paul, Dalim Kumar; Sen, Gautam; Biswas, Sanjib Kumar

    2014-05-01

    lherzolite layer of upper mantle prior to eruption of alkali basalt lava. It has been proposed that carbonatite melt was generated below the lithosphere by low degree melting of the Deccan plume (Sen et al., 2009). In this model, this low-degree, volatle-rich melts detached as tiny blobs from the cooler edge of the Deccan plume head and permeated the Kutch lithosphere as it was extending and fracturing due to plate-driving forces and caused carbonatite metasomatism of upper mantle. Partial melting of this carbonated peridotite yields CaCO3 rich alkaline silicate melt. The carbonatite-silicate immiscible melt pair and its host lamprophyre possibly originated during the interaction of Reunion Plume with the rifted lithosphere beneath Kutch and these together with alkali basalt of central Kutch mark the initiation of Deccan Trap magmatic activity. Das, B., Paul, D.K., Chaudhary, A K., Ray, Arijit., Patil, S.K., and Biswas, S.K. 2007. Jour. Geological Society of India. vol.70, p.771-779. Paul, D.K., Ray, Arijit., Das, B., Patil, S.K., and Biswas, S.K., 2008. Lithos, vol. 102, p. 237-259. Ray, Arijit., Paul, D.K., Patil, S.K., Das, B., and Biswas, S.K., 2006. Journal of Asian Earth sciences, vol. 27, p. 907-921. Sen, G., Bizimis, M., Das, R., Paul, D.K., Ray, Arijit., and Biswas, S.K. 2009 EPSL. Vol. 27(7), Issue 1-2, p. 101-111.

  1. Dynamic structure factor of vibrating fractals: proteins as a case study.

    PubMed

    Reuveni, Shlomi; Klafter, Joseph; Granek, Rony

    2012-01-01

    We study the dynamic structure factor S(k,t) of proteins at large wave numbers k, kR(g)≫1, where R(g) is the gyration radius. At this regime measurements are sensitive to internal dynamics, and we focus on vibrational dynamics of folded proteins. Exploiting the analogy between proteins and fractals, we perform a general analytic calculation of the displacement two-point correlation functions, <[u(−>)(i)(t)-u(−>)(j)(0)](2)>. We confront the derived expressions with numerical evaluations that are based on protein data bank (PDB) structures and the Gaussian network model (GNM) for a few proteins and for the Sierpinski gasket as a controlled check. We use these calculations to evaluate S(k,t) with arrested rotational and translational degrees of freedom, and show that the decay of S(k,t) is dominated by the spatially averaged mean-square displacement of an amino acid. The latter has been previously shown to evolve subdiffusively in time, <[u(−>)(i)(t)-u(−>)(i)(0)](2)> ~t(ν), where ν is the anomalous diffusion exponent that depends on the spectral dimension d(s) and fractal dimension d(f). As a result, for wave numbers obeying k(2))(2)>≳1, S(k,t) effectively decays as a stretched exponential S(k,t)≃S(k)e(-(Γ(k)t)(β)) with β≃ν, where the relaxation rate is Γ(k)~(k(B)T/mω(o)(2))(1/β)k(2/β), T is the temperature, and mω(o)(2) the GNM effective spring constant describing the interaction between neighboring amino acids. The static structure factor is dominated by the fractal character of the native fold, S(k)~k(-d(f)), with negligible to marginal influence of vibrations. The analytical expressions are first confronted with numerically based calculations on the Sierpinski gasket, and very good agreement is found between simulations and theory. We then perform PDB-GNM-based numerical calculations for a few proteins, and an effective stretched exponential decay of the dynamic structure factor is found, albeit their relatively small size

  2. Characterization of single potassium channels in mouse pancreatic acinar cells.

    PubMed Central

    Schmid, A; Schulz, I

    1995-01-01

    1. Single K(+)-selective channels with a conductance of about 48 pS (pipette, 145 mM KCl; bath, 140 mM NaCl + 4.7 mM KCl) were recorded in the patch-clamp whole-cell configuration in isolated mouse pancreatic acinar cells. 2. Neither application of the secretagogues acetylcholine (second messenger, inositol 1,4,5-trisphosphate) or secretin (second messenger, cAMP), nor addition of the catalytic subunit of protein kinase A to the pipette solution changed the activity of the 48 pS K+ channel. 3. Intracellular acidification with sodium propionate (20 mM) diminished activity of the 48 pS channel, whereas channel open probability was increased by cytosolic alkalization with 20 mM NH4Cl. 4. BaCl2 (5 mM), TEA (10 mM) or apamin (1 microM) added to the bath solution had no obvious effect on the kinetics of the 48 pS channel. Similarly, glibenclamide and diazoxide failed to influence the channel activity. 5. When extracellular NaCl was replaced by KCl, whole-cell recordings revealed an inwardly rectifying K+ current carried by a 17 pS K+ channel. 6. The inwardly rectifying K+ current was not pH dependent and could largely be blocked by Ba2+ but not by TEA. 7. Since the 48 pS K+ channel is neither Ca2+ nor cAMP regulated, we suggest that this channel could play a role in the maintenance of the negative cell resting potential. PMID:7623283

  3. A Model of Glial Scarring Analogous to the Environment of a Traumatically Injured Spinal Cord Using Kainate

    PubMed Central

    2016-01-01

    Objective To develop an in vitro model analogous to the environment of traumatic spinal cord injury (SCI), the authors evaluated change of astrogliosis following treatments with kainate and/or scratch, and degree of neurite outgrowth after treatment with a kainate inhibitor. Methods Astrocytes were obtained from the rat spinal cord. Then, 99% of the cells were confirmed to be GFAP-positive astrocytes. For chemical injury, the cells were treated with kainate at different concentrations (10, 50 or 100 µM). For mechanical injury, two kinds of uniform scratches were made using a plastic pipette tip by removing strips of cells. For combined injury (S/K), scratch and kainate were provided. Cord neurons from rat embryos were plated onto culture plates immediately after the three kinds of injuries and some cultures were treated with a kainate inhibitor. Results Astro-gliosis (glial fibrillary acidic protein [GFAP], vimentin, chondroitin sulfate proteoglycan [CSPG], rho-associated protein kinase [ROCK], and ephrin type-A receptor 4 [EphA4]) was most prominent after treatment with 50 µM kainate and extensive scratch injury in terms of single arm (p<0.001) and in the S/K-induced injury model in view of single or combination (p<0.001). Neurite outgrowth in the seeded spinal cord (β-III tubulin) was the least in the S/K-induced injury model (p<0.001) and this inhibition was reversed by the kainate inhibitor (p<0.001). Conclusion The current in vitro model combining scratch and kainate induced glial scarring and inhibitory molecules and restricted neurite outgrowth very strongly than either the mechanically or chemically-induced injury model; hence, it may be a useful tool for research on SCI. PMID:27847705

  4. N-sulfation of heparan sulfate regulates early branching events in the developing mammary gland.

    PubMed

    Bush, Kevin T; Crawford, Brett E; Garner, Omai B; Nigam, Kabir B; Esko, Jeffrey D; Nigam, Sanjay K

    2012-12-07

    Branching morphogenesis, a fundamental process in the development of epithelial organs (e.g. breast, kidney, lung, salivary gland, prostate, pancreas), is in part dependent on sulfation of heparan sulfate proteoglycans. Proper sulfation is mediated by biosynthetic enzymes, including exostosin-2 (Ext2), N-deacetylase/N-sulfotransferases and heparan sulfate O-sulfotransferases. Recent conditional knockouts indicate that whereas primary branching is dependent on heparan sulfate, other stages are dependent upon selective addition of N-sulfate and/or 2-O sulfation (Crawford, B .E., Garner, O. B., Bishop, J. R., Zhang, D. Y., Bush, K. T., Nigam, S. K., and Esko, J. D. (2010) PLoS One 5, e10691; Garner, O .B., Bush, K. T., Nigam, S .K., Yamaguchi, Y., Xu, D., Esko, J. D., and Nigam, S. K. (2011) Dev. Biol. 355, 394-403). Here, we analyzed the effect of deleting both Ndst2 and Ndst1. Whereas deletion of Ndst1 has no major effect on primary or secondary branching, deletion of Ndst2 appears to result in a mild increase in branching. When both genes were deleted, ductal growth was variably diminished (likely due to variable Cre-recombinase activity), but an overabundance of branched structures was evident irrespective of the extent of gland growth or postnatal age. "Hyperbranching" is an unusual phenotype. The effects on N-sulfation and growth factor binding were confirmed biochemically. The results indicate that N-sulfation or a factor requiring N-sulfation regulates primary and secondary branching events in the developing mammary gland. Together with previous work, the data indicate that different stages of ductal branching and lobuloalveolar formation are regulated by distinct sets of heparan sulfate biosynthetic enzymes in an appropriate growth factor context.

  5. Linkage of organic anion transporter-1 to metabolic pathways through integrated "omics"-driven network and functional analysis.

    PubMed

    Ahn, Sun-Young; Jamshidi, Neema; Mo, Monica L; Wu, Wei; Eraly, Satish A; Dnyanmote, Ankur; Bush, Kevin T; Gallegos, Tom F; Sweet, Douglas H; Palsson, Bernhard Ø; Nigam, Sanjay K

    2011-09-09

    The main kidney transporter of many commonly prescribed drugs (e.g. penicillins, diuretics, antivirals, methotrexate, and non-steroidal anti-inflammatory drugs) is organic anion transporter-1 (OAT1), originally identified as NKT (Lopez-Nieto, C. E., You, G., Bush, K. T., Barros, E. J., Beier, D. R., and Nigam, S. K. (1997) J. Biol. Chem. 272, 6471-6478). Targeted metabolomics in knockouts have shown that OAT1 mediates the secretion or reabsorption of many important metabolites, including intermediates in carbohydrate, fatty acid, and amino acid metabolism. This observation raises the possibility that OAT1 helps regulate broader metabolic activities. We therefore examined the potential roles of OAT1 in metabolic pathways using Recon 1, a functionally tested genome-scale reconstruction of human metabolism. A computational approach was used to analyze in vivo metabolomic as well as transcriptomic data from wild-type and OAT1 knock-out animals, resulting in the implication of several metabolic pathways, including the citric acid cycle, polyamine, and fatty acid metabolism. Validation by in vitro and ex vivo analysis using Xenopus oocyte, cell culture, and kidney tissue assays demonstrated interactions between OAT1 and key intermediates in these metabolic pathways, including previously unknown substrates, such as polyamines (e.g. spermine and spermidine). A genome-scale metabolic network reconstruction generated some experimentally supported predictions for metabolic pathways linked to OAT1-related transport. The data support the possibility that the SLC22 and other families of transporters, known to be expressed in many tissues and primarily known for drug and toxin clearance, are integral to a number of endogenous pathways and may be involved in a larger remote sensing and signaling system (Ahn, S. Y., and Nigam, S. K. (2009) Mol. Pharmacol. 76, 481-490, and Wu, W., Dnyanmote, A. V., and Nigam, S. K. (2011) Mol. Pharmacol. 79, 795-805). Drugs may alter metabolism by

  6. Respiratory therapy: a problem among children and adolescents with cystic fibrosis

    PubMed Central

    Feiten, Taiane dos Santos; Flores, Josani Silva; Farias, Bruna Luciano; Rovedder, Paula Maria Eidt; Camargo, Eunice Gus; Dalcin, Paulo de Tarso Roth; Ziegler, Bruna

    2016-01-01

    Objective : To evaluate the level of self-reported adherence to physical therapy recommendations in pediatric patients (6-17 years) with cystic fibrosis (CF) and to ascertain whether the different levels of adherence correlate with pulmonary function, clinical aspects, and quality of life. Methods : This was a cross-sectional study. The patients and their legal guardians completed a questionnaire regarding adherence to physical therapy recommendations and a CF quality of life questionnaire. We collected demographic, spirometric, and bacteriological data, as well as recording the frequency of hospitalizations and Shwachman-Kulczycki (S-K) clinical scores. Results : We included 66 patients in the study. Mean age, FEV1 (% of predicted), and BMI were 12.2 ± 3.2 years, 90 ± 24%, and 18.3 ± 2.5 kg/m2, respectively. The patients were divided into two groups: high-adherence (n = 39) and moderate/poor-adherence (n = 27). No statistically significant differences were found between the groups regarding age, gender, family income, and total S-K clinical scores. There were statistically significant differences between the high-adherence group and the moderate/poor-adherence group, the latter showing lower scores for the "radiological findings" domain of the S-K clinical score (p = 0.030), a greater number of hospitalizations (p = 0.004), and more days of hospitalization in the last year (p = 0.012), as well as lower scores for the quality of life questionnaire domains emotion (p = 0.002), physical (p = 0.019), treatment burden (p < 0.001), health perceptions (p = 0.036), social (p = 0.039), and respiratory (p = 0.048). Conclusions : Low self-reported adherence to physical therapy recommendations was associated with worse radiological findings, a greater number of hospitalizations, and decreased quality of life in pediatric CF patients. PMID:26982038

  7. Contribution to the benchmark for ternary mixtures: Measurement of the Soret and thermodiffusion coefficients of tetralin+isobutylbenzene+n-dodecane at a composition of (0.8/0.1/0.1) mass fractions by two-color optical beam deflection.

    PubMed

    Gebhardt, M; Köhler, W

    2015-04-01

    Within the framework of an international benchmark test we have performed measurements of the Soret and thermodiffusion coefficients of the organic ternary mixture (0.8/0.1/0.1 mass fraction) of 1,2,3,4-tetrahydronaphthaline (THN), isobutylbenzene (IBB) and n -dodecane (n C12) at 298.15K by means of a two-color optical beam deflection technique (OBD). The data evaluation procedure is based on a least squares fitting routine for an approximate analytical solution for the Soret cell problem. The condition number of the contrast factor matrix and standard error propagation are used for an error estimation for the measured Soret and thermodiffusion coefficients. The Soret coefficients obtained are S (') T(THN) = (1.20±0.09)×10(-3) K^-1, S (') T(IBB) = (- 0.34±0.14)×10(-3) K^-1, and S (') T(nC12) = (- 0.86±0.06)×10(-3) K^-1 and the corresponding thermodiffusion coefficients are D (') T(THN) = (0.72±0.26)×10(-12) m^2(s K)^-1, D (') T(IBB) = (- 0.22±0.42)×10(-12) m^2(s K)^-1, and D (') T(nC12) = (- 0.50±0.16)×10(-12) m^2(s K)^-1. These results will be used as ground-based reference data for the DCMIX project, where thermodiffusion experiments of ternary mixtures are measured in a microgravity environment aboard the International Space Station (ISS).

  8. [Non-equilibrium thermodynamic separation theory of nonlinear chromatography. II. The 0-1 model for nonlinear-mass transfer kinetic processes].

    PubMed

    Liang, Heng; Jia, Zhenbin

    2007-11-01

    In the optimal design and control of preparative chromatographic processes, the obstacles appear when one tries to link the Wilson' s framework of chromatographic theories based on partial differential equations (PDEs) with the Eulerian presentation to optimal control approaches based on discrete time states, such as Markov decision processes (MDP) or Model predictive control (MPC). In this paper, the 0-1 model is presented to overcome the obstacles for nonlinear transport chromatography (NTC). With the Lagrangian-Eulerian description (L-ED), one solute cell unit is split into two solute cells, one (SCm) in the mobile phase with the linear velocity of the mobile phase, and the other (SCs) in the stationary phase with zero-velocity. The thermodynamic state vector, S(k), which comprises four vector components, i.e., the sequence number, the position and the local solute concentrations in both SCms and SCses, is introduced to describe the local thermodynamic path (LTP) and the macroscopical thermodynamic path (MTP). For the NTC, the LTP is designed for a solute zone to evolve from the state, S(k), to the virtual migration state, S(M), undergoing the virtual net migration sub-process, and then to the state, S(k+1), undergoing the virtual net inter phase mass transfer sub-process in a short time interval. Complete thermodynamic state iterations with the Markov characteristics are derived by using the local equilibrium isotherm and the local lumped mass transfer coefficient. When the local thermodynamic equilibrium is retained, excellent properties, such as consistency, stability, conservation, accuracy, etc., of the numerical solution of the 0-1 model are observed in the theoretical analysis and in the numerical experiments of the nonlinear ideal chromatography. It is found that the 0-1 model could properly link up with the MDP or optimal control approaches based on discrete time states.

  9. Renormalized one-loop theory of correlations in polymer blends.

    PubMed

    Qin, Jian; Morse, David C

    2009-06-14

    The renormalized one-loop theory is a coarse-grained theory of corrections to the random phase approximation (RPA) theory of composition fluctuations. We present predictions of corrections to the RPA for the structure function S(k) and to the random walk model of single-chain statics in binary homopolymer blends. We consider an apparent interaction parameter chi(a) that is defined by applying the RPA to the small k limit of S(k). The predicted deviation of chi(a) from its long chain limit is proportional to N(-1/2), where N is the chain length. This deviation is positive (i.e., destabilizing) for weakly nonideal mixtures, with chi(a)N less than or approximately 1, but negative (stabilizing) near the critical point. The positive correction to chi(a) for low values of chi(a)N is a result of the fact that monomers in mixtures of shorter chains are slightly less strongly shielded from intermolecular contacts. The predicted depression in chi(a) near the critical point is a result of long-wavelength composition fluctuations. The one-loop theory predicts a shift in the critical temperature of O(N(-1/2)), which is much greater than the predicted O(N(-1)) width of the Ginzburg region. Chain dimensions are found to deviate slightly from those of a random walk even in a one-component melt and contract slightly as thermodynamic repulsion is increased. Predictions for S(k) and single-chain properties are compared to published lattice Monte Carlo simulations.

  10. Saclantcen’s Use of Scuba Diving in Oceanographic and Acoustic Research,

    DTIC Science & Technology

    2014-09-26

    measurements of the acmustic pardmnters of the ocean bottom. 14 11. Stereophotojraphy and photogrammetry of the ocean bottom. 15 1?. Ocean-hottom...FIG. 11 STEREOPHOTOGRAPHY AND PHOTOGRAMMETRY OF THE ..OCEAN BOTTOM SACLANTCEN SM-175 SEAFLOOR SURFACE y 12Scmr X -- % x -U0 121aem TWO - DIMENSIONAL...POWER SPECTRUM 0.21 vS K uni. TW-IESONL0 6 0 TW IESOA 40 -64 AUTCOORRLATTOO LENGTTIONm 00 Ll(. i -,!Uk(,II’IO;R[’IYAND PHOTOGRAMMETRY OF THE OCEAN

  11. Rotor Dynamic Inflow Derivatives and Time Constants from Various Inflow Models.

    DTIC Science & Technology

    1980-12-01

    DEGREES Angle of the (3,1) is$ Element of COMPLEX LINV(3,1) Inverted Complex L(K) Matrix for a Sweep (Corrected P sk ,’ Pressure) HA S E A NC L E -So...66. Banerjee , D., Crews, S . T., Hohenemser, K. H., and Yin, S . K., "State and Parameter Identification Applied to Rotor Model Dynamic Test Results...34, Journal of the American Helicopter Society, April 1977. 67. Banerjee , D., Crews, S . T., and Hohenemser, K. H., "Parameter Identification Applied to

  12. The STRONG STAR Multidisciplinary PTSD Research Consortium

    DTIC Science & Technology

    2014-11-01

    B a b i c 2 l l s m t e c s K W m t p d s f f n d f s l r ( h a e o f P c v t P ( w o u c 4 a c M. K. Green...correction was used to determine GR levels. The A450 values for each t h d a a b t ( T g b a c c u r p c i e t s e a c F C b l p r p C r a a i M. K. Green et...unstressed controlsSEM,

  13. Contribution of the Receptor/Ligand Interaction Between CD44 and Osteopontin to Formation of Breast Cancer Metastases

    DTIC Science & Technology

    2001-07-01

    34A V L S E E E N D F AAB23989.1 Hirlp (s. cervisiae) N L T S _SS D E T N S F S K CAB90776.1 DNA polymerase (s. pombe ) "AV L S E E E N D F P32479...and ethanol amine in a humidified atmosphere of 5% CO 2 at 37°C. Conditioned media from confluent cultures were collected every 24 h. and stored frozen...suspended in either DMSO or absolute ethanol and were added to the culture media at 1:1000 dilution. Controls were carried out with the corresponding

  14. Asymmetrically Functionalized Graphene for Photodependent Diode Rectifying Behavior

    DTIC Science & Technology

    2011-06-06

    b) J. Du, L. Fu, Z. Liu, B. Han, Z. Li, Y. Liu, Z. Sun, D. Zhu, J. Phys. Chem. B 2005, 109, 12772 – 12776; c) K . Mohanta, S. K . Batabyal , A. J. Pal...2011 .Keywords: diodes · graphene · nanoparticles · photophysics · surface chemistry [1] a) S. Stankovich, D. A. Dikin, G. H. B. Dommett, K . M. Kohl...haas, E. J. Zimney, E. A. Stach, R. D. Piner, S. T. Nyugen, R. S. Ruoff, Nature 2006, 442, 282 – 286; b) K . S. Novoselov, A. K . Geim, S. V. Morozov, D

  15. Influence of Metal Ion and Polymer Core on the Melt Rheology of Metallosupramolecular Films

    DTIC Science & Technology

    2012-01-01

    33) For other examples see: (a) Zhao, Y.; Beck, J. B.; Rowan, S. J.; Jamieson, A. M. Macromolecules 2004, 37, 3529–3531. (b) Batabyal , S. K .; Leong, W...9) Rieth, S.; Baddeley, C.; Badjic, J. D. SoftMatter 2007, 3, 137–154. (10) Nair, K . P.; Breedveld, V.; Weck, M. Macromolecules 2011, 44, 3346–3357...11) For additional examples see: (a) Yuen, F.; Tam, K . C. Soft Matter 2010, 6, 4613–4630. (b) Liu, J.; Chen, G.; Goo, M.; Jiang, M. Macromolecules

  16. Articulated Total Body Model Enhancements. Volume 2. User’s Guide

    DTIC Science & Technology

    1988-01-01

    X, Y and Z axes) are arbitrary and should be chosen to accommodate available input data. The initial velocities and direction cosine matrices are...Subroutine DRIFT to * recompute the direction cosine matrices and angular velocity of adjacent segments connected by constrained 0 joints so as to...respect to the reference segment of the element. HF contains three 414 matrices ; WF(I,J,X), BY(X,J.4,X) and BF(I,J’S,K), where 1-1,4 and J*l,4. Theme

  17. Study of Laser Created Metal Vapour Plasmas.

    DTIC Science & Technology

    1981-09-01

    appended as Appendix F. However, in this analysis we had assumed that the resonance state population can be regarded as being in equilibrium with the...value expected on the basis of LTE (local thermo- dynamic equilibrium ) and laser saturation, i.e., N N xlO21e -3 0 4 /k Te’ LTE o ogS(kTe) 3x(kTe )3...1 + g)R 1 / "I , (1) studies,"’ (v) neutral-hydrogen measurements where the rate of stimulated emission in Tokamaks ,?.ls and (vi) fusion-plasma

  18. ’Short-Latency’ Somatosensory Evoked Potentials during Experimentally Induced Biodynamic Stress in Humans.

    DTIC Science & Technology

    1985-12-01

    BP, a negative-going * ."" near-field wave originating in the brachial plexus, the A and B waves of Chiappa , et a]. (1980), and the NI, N2, and P2...1981) and by Chiappa , et al. (1980). Table 2 shows the baseline means and standard deviations of the SSEP peaks for all five Ss, derived from the loose...Head and Spine. Charles Thomas, Springfield, 1982, 324-378. Chiappa , K.H., Choi, S.K. and Young, R.R. Short latency somatosensory evoked potentials

  19. Installation Restoration Program. Phase 1. Records Search, McGuire AFB, New Jersey

    DTIC Science & Technology

    1982-11-01

    was exposed to the earth and allowed for the percolation of liquid wastes entering the pit. The JP-X fuel spills were directed to a simi- larly...Symposium II, Washington, D.C., August 1981. (Co-Author: J. Jacobs) lo -S . K ~ K-"o0 EU GERING- SCIEMc BIOGRAPHICAL DATA Randal M. Reynolds, P.R...land surface in the saturated zone that is under atmospheric or artesian pressure GROUND-WATER RESERVOIR: The earth materials and the intervening open

  20. Environmental Perturbations, Behavioral Change, and Population Response in a Long-Term Northern Elephant Seal Study

    DTIC Science & Technology

    2012-01-01

    S. Rotstein, T. K . Rowles , S. E. Simmons, W. Van Bonn, P. K . Weathersby, M. J . Weise, T. M. Williams, and P. L. Tyack. 2012. Deadly diving...and Marine Mammals. Pages 225-233 in R. M. Sibly, J . H. Brown, and A. K . Brown, editors. Metabolic Ecology: A Scaling Approach. John Wiley & Sons...394. Hooker, S. K ., A. Fahlman, M. J . Moore, N. A. de Soto, Y. B. de Quiros, A. O. Brubakk, D. P. Costa, A. M. Costidis, S. Dennison, K . J . Falke, A

  1. Optimization of the Flapping Wing Systems for Micro Air Vehicle

    DTIC Science & Technology

    2010-09-01

    coefficient DC , and the pitch moment coefficient MC can be defined as 20.5 x D F C u S  (6) 20.5 y L F C u S  (7) 20.5 z M MC u SL...optimization (5) Publications: Choi, J. S., Zhao, L ., Park, G. J., Agrawal, S. K., and Kolonay, R. M., “Enhancement of a Flapping Wing Using Path...and Dynamic Topology Optimization,” submitted to AIAA Journal (peer-reviewed publication) (6) Interactions: Conference - Choi, J. S., Zhao, L

  2. Observation of the decay B+ → ψ(2S)ϕ(1020)K+ in pp collisions at √{ s} = 8TeV

    NASA Astrophysics Data System (ADS)

    Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Heracleous, N.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Forthomme, L.; Francois, B.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Nuttens, C.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Micanovic, S.; Sudic, L.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; El-khateeb, E.; Elgammal, S.; Mohamed, A.; Calpas, B.; Kadastik, M.; Murumaa, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Peltola, T.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Merlin, J. A.; Skovpen, K.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Bouvier, E.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Heister, A.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Ostapchuk, A.; Preuten, M.; Raupach, F.; Schael, S.; Schomakers, C.; Schulte, J. F.; Schulz, J.; Verlage, T.; Weber, H.; Zhukov, V.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Haj Ahmad, W.; Hoehle, F.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Nehrkorn, A.; Nowack, A.; Nugent, I. M.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kieseler, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Stefaniuk, N.; Trippkewitz, K. D.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Goebel, K.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Ott, J.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Poehlsen, J.; Sander, C.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Barth, C.; Baus, C.; Berger, J.; Butz, E.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Lobelle Pardo, P.; Maier, B.; Mildner, H.; Mozer, M. U.; Müller, T.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wagner-Kuhr, J.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Agapitos, A.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Bencze, G.; Hajdu, C.; Hidas, P.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Bahinipati, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhowmik, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Rane, A.; Sharma, S.; Behnamian, H.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Fahim, A.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Chiorboli, M.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Gori, V.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Lo Vetere, M.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Dinardo, M. E.; Dini, P.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malvezzi, S.; Manzoni, R. A.; Marzocchi, B.; Menasce, D.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Iorio, A. O. M.; Lanza, G.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Maron, G.; Michelotto, M.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Ventura, S.; Zanetti, M.; Zotto, P.; Zucchetta, A.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; D'imperio, G.; Del Re, D.; Diemoz, M.; Gelli, S.; Jorda, C.; Longo, E.; Margaroli, F.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Costa, M.; Covarelli, R.; Degano, A.; Dellacasa, G.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Mazza, G.; Migliore, E.; Monaco, V.; Monteil, E.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; La Licata, C.; Schizzi, A.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, B.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Oh, S. B.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Moisenz, P.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Chistov, R.; Danilov, M.; Rusinov, V.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Rusakov, S. V.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Castiñeiras De Saa, J. R.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Bonato, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; D'Alfonso, M.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Guio, F.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Hammer, J.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Mersi, S.; Meschi, E.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Ruan, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Simon, M.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Wardle, N.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Eller, P.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lecomte, P.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Lange, C.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Tzeng, Y. M.; Asavapibhop, B.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Gurpinar, E.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Sunar Cerci, D.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leslie, D.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Charaf, O.; Cooper, S. I.; Henderson, C.; Rumerio, P.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Berry, E.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Breto, G.; Burns, D.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Ricci-Tam, F.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Wilbur, S.; Yohay, R.; Cousins, R.; Everaerts, P.; Florent, A.; Hauser, J.; Ignatenko, M.; Saltzberg, D.; Takasugi, E.; Valuev, V.; Weber, M.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Malberti, M.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Flowers, K.; Franco Sevilla, M.; Geffert, P.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mccoll, N.; Mullin, S. D.; Ovcharova, A.; Richman, J.; Stuart, D.; Suarez, I.; West, C.; Yoo, J.; Anderson, D.; Apresyan, A.; Bendavid, J.; Bornheim, A.; Bunn, J.; Chen, Y.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Azzolini, V.; Carlson, B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; Newman-Holmes, C.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Ma, P.; Matchev, K.; Mei, H.; Milenovic, P.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, J. R.; Adams, T.; Askew, A.; Bein, S.; Diamond, B.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Khatiwada, A.; Prosper, H.; Santra, A.; Weinberg, M.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Kurt, P.; O'Brien, C.; Sandoval Gonzalez, I. D.; Turner, P.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Osherson, M.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Bowen, J.; Bruner, C.; Castle, J.; Kenny, R. P., III; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Khalil, S.; Makouski, M.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Lange, D.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Sumorok, K.; Tatar, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Zhukova, V.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Finkel, A.; Gude, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bartek, R.; Bloom, K.; Bose, S.; Claes, D. R.; Dominguez, A.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Knowlton, D.; Kravchenko, I.; Malta Rodrigues, A.; Meier, F.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; George, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Kumar, A.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Baumgartel, D.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Hahn, K. A.; Kubik, A.; Kumar, A.; Low, J. F.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Valls, N.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Brinson, J.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Mooney, M.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Zuranski, A.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Jung, K.; Miller, D. H.; Neumeister, N.; Radburn-Smith, B. C.; Shi, X.; Sun, J.; Svyatkovskiy, A.; Wang, F.; Xie, W.; Xu, L.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Redjimi, R.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Chou, J. P.; Contreras-Campana, E.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hidas, D.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Rose, A.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Delannoy, A. G.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Lamichhane, P.; Sturdy, J.; Belknap, D. A.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Sharma, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.

    2017-01-01

    The decay B+ →ψ(2S)ϕ(1020)K+ is observed for the first time using data collected from pp collisions at √{ s} = 8TeV by the CMS experiment at the LHC, corresponding to an integrated luminosity of 19.6fb-1. The branching fraction of this decay is measured, using the mode B+ →ψ(2S)K+ as normalization, to be (4.0 ± 0.4(stat) ± 0.6(syst) ± 0.2 (B)) ×10-6, where the third uncertainty is from the measured branching fraction of the normalization channel.

  3. Digitally Controlled ’Programmable’ Active Filters.

    DTIC Science & Technology

    1985-12-01

    Mitra, S. K., Analysis and Synthesis of Linear Active .. Networks, Wiley, New York, 1969. * 6. Sedra , A. S. and Smith , K. C., "A Second-Generation...Current Conveyor and its Applications," IEEE Trans. Circuit Theory, Vol. CT-17, pp. 132-134, 1970. 7. Sedra , A. S., "A New Approach to Active Network...CT-18, pp. 358-361, May 1971. 27. Hamilton, T. A., and Sedra , A. S., "Some New IJ Configurations for Active Filters," IEEE Trans. Circuit Tehory, Vol

  4. The Culture of Rape

    DTIC Science & Technology

    2013-05-09

    that he is not still in his teenage years as Charlotte is. The next problem modern readers may have with tills passage is learning Charlotte’s age...without her consent, effected by force, duress, intimidation or deception as to the nature of the act" (Webster). As proved earlier, once K r o s k... alcohol and the details of her rape are fuzzy to her. Maybe her story changes because she cannot fully remember what happened. Maybe she is a stripper

  5. Software and Support Development for an Environmental Data Buoy System for Predicting Surf-Zone Characteristics

    DTIC Science & Technology

    1981-02-28

    stable to one millivolt or less .i ith the system .error never exceeding this amount. ’ Also- during this time.’ period tdere were no failures or...system are already CMOS. However, those that are not all have a corresponding CMOS version, most of the time pin -for- pin interchangeable. These...calculations an improved breaker calculation can be made based upon the following: •F Rb=H Kf K K b Sfr s K .98 Kr [ Cos(@b) SK = tanh2• hL) I+ sth4T hi/L

  6. Ballistic Testing of Armor Weldments

    DTIC Science & Technology

    1994-01-21

    Distribution unlimited %1 , A E S K T 5A •+ T K .4/ ¢ C+’ •; T . . .. This TOP describes ballistic tests to evaluate armor weldments for resistance to shock and...C-I 1. SCOPE. This TOP describes ballistic tests to evaluate armor weldments for resistance to shock and penetration...Operations Procedure (TOP) 2-2-711 Ballistic Testing of Armor Weldments WU A268445 6+ AuT I`S’•,+ r:’ 7. PERFORMING ORGANIZATION NAME(S) ANU; ADDRCSSI’t

  7. Fluid Flow and Sound Generation at Hydrothermal Vent Fields

    DTIC Science & Technology

    1988-04-01

    weeks or, the Ellen B. Scripps, to rendezvous with the Glomar Challenger and conduct the borehole seismic experiment south of the Costa Rica Rift in...H.P. Johnson, S.K. Juniper, J.L. Karsten, J.E. Lupton , S.D. Scott and V. Tunnicliffe. North caldera hydrothermal vent field, Axial Seamount, Juan de...Aikman, R. Embley, S. Hammond, A. Malahoff, and J. Lupton , The distribution of geothermal fields on the Juan de Fuca Ridge. J. Geophys, Res., 90, 727

  8. Simulation of Pores Sealing During Homoepitaxy on Si(111) Surface

    DTIC Science & Technology

    2000-06-23

    deposition rate. Simulation results of epitaxial growth on porous surface with 100 x 100 atomic sites (a.s.) at T = 1073 K [ , ] for different surface...s), v is vibration frequency (1/s), k is Boltzmann’s constant, T is substrate temperature (K). Taking v = 1013 s-1, Ed = 1.75 eV ],T = 1073 K for...surface at T = 1073 K for ndif = 10 (high deposition rate). Pores diameter is 10 atomic sites, height is 20 BL, surface porosity P• = 26 %. (a

  9. Collaborative Research and Development (CR&D). Task Order 0061: Modeling Complex Structural Geometry and Process Interaction

    DTIC Science & Technology

    2008-05-01

    a Titanium and Gamma-TiAl Alloy, JOM, September 2005, 50-54 4 Chapter 1 [ref3] Caton, M.J., Jha, S.K., Larsen, J.M., Rosenberger, A.H., TMS...Figure 5: Notch 3 strain distribution at 900MPa 25 Chapter 3 Figure 6 : Notch 3 inverse pole figure of local microstructure. Figure 7: Notch 4 ...showing the local grain structure Figure 6 : Local strain distribution at 986MPa calculated from 36 Chapter 4 Figure 7: Secondary electron

  10. Robust Adaptive Spread-Spectrum Receivers: SMART Antenna/Space Timer Interference Mitigation Techniques

    DTIC Science & Technology

    2004-09-01

    operator converges to the clipper . With respect to the linear lter post-processor w, we suggest as candidates and we investigate both the minimum-variance...vector b, the set of check sums -or syndrome - is the vector s = bHT . For a regular LDPC code, H has a constant column weight tc and a constant row...with corresponding syndrome vector s(k1) = b(k1)HT . The objective is to perturb b(k1) by one bit and create a new candidate bit vector b(k). To

  11. Optical Algorithm for Cloud Shadow Detection Over Water

    DTIC Science & Technology

    2013-02-01

    contextual information to detect cumulus clouds and cloud shadows in Landsat data," Int. J. Remote Sens., vol. 3, no. l.pp. 51-62,1982. [12] T...Betendes, S. K. Sengupta, R. M. Welch, B. A. Wielicki, and M. Navar, " Cumulus cloud base height estimation from high spatial resolution rr-r 740 IEEE...REPORT DATE (DD-MM-YYYY) 05-02-2013 2. REPORT TYPE Journal Article 3. DATES COVERED (From ■ To) 4. TITLE AND SUBTITLE Optical Algorithm for Cloud

  12. Reanalysis of the Schwertmannite structure and the incorporationof SO42- groups: An IR, XAS, WAXS and simulation study

    SciTech Connect

    Waychunas, G.A.; Myneni, S.C.B.; Traina, S.J.; Bigham, J.M.; Fuller, C.C.; Davis, J.A.

    2001-05-05

    Schwertmannite is a poorly crystallized iron oxyhydroxidewith essential structural sulfate that can be a major component in acidmine drainage environments. Original characterization work concluded thatthe sulfate was largely contained within tunnels of an orderedakaganeite-like structure based on powder XRD, analysis of IR spectra,and sulfate extraction procedures [1]. Since the original description,problems have emerged with the nature of the tunnel sulfate, and with theinterpretation of the IR spectra. Other related work has shown that it isnow possible to determine sulfate-iron oxide inner sphere bindingunambiguously from the S K-edge XANES spectrum. Hence a reassessment ofthe evidence for the original schwertmannite structure was deemednecessary and timely.

  13. Absolute measurement of hadronic branching fractions of the Ds+ meson.

    PubMed

    Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Mohapatra, D; Onyisi, P U E; Patterson, J R; Peterson, D; Riley, D; Ryd, A; Sadoff, A J; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Athar, S B; Patel, R; Yelton, J; Rubin, P; Eisenstein, B I; Karliner, I; Mehrabyan, S; Lowrey, N; Selen, M; White, E J; Wiss, J; Mitchell, R E; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Zweber, P; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Libby, J; Powell, A; Wilkinson, G; Ecklund, K M; Love, W; Savinov, V; Lopez, A; Mendez, H; Ramirez, J; Ge, J Y; Miller, D H; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Hu, D; Moziak, B; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Artuso, M; Blusk, S; Khalil, S; Li, J; Mountain, R; Nisar, S; Randrianarivony, K; Sultana, N; Skwarnicki, T; Stone, S; Wang, J C; Zhang, L M; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Rademacker, J; Asner, D M; Edwards, K W; Naik, P; Briere, R A; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L

    2008-04-25

    The branching fractions of D(s)(+/-) meson decays serve to normalize many measurements of processes involving charm quarks. Using 298 pb(-1) of e(+)e(-) collisions recorded at a center of mass energy of 4.17 GeV, we determine absolute branching fractions for eight D(s)(+/-) decays with a double tag technique. In particular we determine the branching fraction B(D(s)(+)-->K(-)K(+}pi(+))=(5.50+/-0.23+/-0.16)%, where the uncertainties are statistical and systematic, respectively. We also provide partial branching fractions for kinematic subsets of the K(-)K(+)pi(+) decay mode.

  14. Measurement of time-dependent CP-violating asymmetries in B0-->K*0gamma(K*0-->K(0)Spi0) decays.

    PubMed

    Aubert, B; Barate, R; Boutigny, D; Couderc, F; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kukartsev, G; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Ronan, M T; Shelkov, V G; Wenzel, W A; Barrett, M; Ford, K E; Harrison, T J; Hart, A J; Hawkes, C M; Morgan, S E; Watson, A T; Fritsch, M; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Steinke, M; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Wilson, F F; Cuhadar-Donszelmann, T; Hearty, C; Knecht, N S; Mattison, T S; McKenna, J A; Thiessen, D; Khan, A; Kyberd, P; Teodorescu, L; Blinov, A E; Blinov, V E; Druzhinin, V P; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Eschrich, I; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Foulkes, S D; Gary, J W; Shen, B C; Wang, K; Del Re, D; Hadavand, H K; Hill, E J; Macfarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Eisner, A M; Heusch, C A; Lockman, W S; Nesom, G; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spradlin, P; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Piatenko, T; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Smith, J G; Zhang, J; Zhang, L; Chen, A; Harton, J L; Soffer, A; Toki, W H; Wilson, R J; Zeng, Q L; Altenburg, D; Brandt, T; Brose, J; Dickopp, M; Feltresi, E; Hauke, A; Lacker, H M; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Petzold, A; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Sundermann, J E; Bernard, D; Bonneaud, G R; Brochard, F; Grenier, P; Schrenk, S; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Bard, D J; Clark, P J; Lavin, D; Muheim, F; Playfer, S; Xie, Y; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Finocchiaro, G; Patteri, P; Piccolo, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Brandenburg, G; Morii, M; Won, E; Dubitzky, R S; Langenegger, U; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Gaillard, J R; Morton, G W; Nash, J A; Nikolich, M B; Taylor, G P; Charles, M J; Grenier, G J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Cheng, C H; Lange, D J; Simani, M C; Wright, D M; Bevan, A J; Chavez, C A; Coleman, J P; Forster, I J; Fry, J R; Gabathuler, E; Gamet, R; Parry, R J; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Cormack, C M; Harrison, P F; Di Lodovico, F; Mohanty, G B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; Green, M G; Jackson, P S; McMahon, T R; Ricciardi, S; Salvatore, F; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, N R; Barlow, R J; Hodgkinson, M C; Lafferty, G D; Lyon, A J; Williams, J C; Farbin, A; Hulsbergen, W D; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Patel, P M; Robertson, S H; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Côté, D; Taras, P; Nicholson, H; Fabozzi, F; Gatto, C; Lista, L; Monorchio, D; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M; Bulten, H; Raven, G; Snoek, H L; Wilden, L; Jessop, C P; Losecco, J M; Gabriel, T A; Allmendinger, T; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Rahimi, A M; Ter-Antonyan, R; Wong, Q K; Brau, J; Frey, R; Igonkina, O; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Malcles, J; Ocariz, J; Pivk, M; Roos, L; T'jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Anulli, F; Biasini, M; Peruzzi, I M; Pioppi, M; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lau, Y P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Telnov, A V; Bellini, F; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yèche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Wilson, J R; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Claus, R; Convery, M R; Cristinziani, M; De Nardo, G; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Elsen, E E; Fan, S; Field, R C; Glanzman, T; Gowdy, S J; Hadig, T; Halyo, V; Hast, C; Hryn'ova, T; Innes, W R; Kelsey, M H; Kim, P; Kocian, M L; Leith, D W G S; Libby, J; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wittgen, M; Wright, D H; Yarritu, A K; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, S; Alam, M S; Ernst, J A; Saeed, M A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Satpathy, A; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Cartaro, C; Cossutti, F; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Sobie, R J; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Graham, M; Hollar, J J; Johnson, J R; Kutter, P E; Li, H; Liu, R; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Rubin, A E; Sekula, S J; Tan, P; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Greene, M G; Neal, H

    2004-11-12

    We present a measurement of the time-dependent CP-violating asymmetries in B0-->K(*0)gamma(K(*0)-->K(0)(S)pi(0)) decays based on 124 x 10(6) Upsilon(4S)-->BB decays collected with the BABAR detector at the PEP-II asymmetric-energy B Factory at the Stanford Linear Accelerator Center. In a sample containing 105+/-14 signal decays, we measure S(K(*)gamma)=0.25+/-0.63+/-0.14 and C(K(*)gamma)=-0.57+/-0.32+/-0.09, where the first error is statistical and the second, systematic.

  15. Structural Analysis and Bioengineering of Thermostable Pyrococcus Furiosus Prolidase for Optimization of Organophosphorus Nerve Agent Detoxification

    DTIC Science & Technology

    2006-06-01

    1980). Positive selection for loss of tetracycline resistance. J Bacteriol. 143(2): 926-33. Booth, M ., P . V. Jennings, I. Ni Fhaolain and G. O’Cuinn...Chem 258(10): 6147-54. 24 Burley, S. K., P . R. David, R. M . Sweet, A. Taylor, and W. N. Lipscomb (1992). Structure determination and refinement of...prolidase and molecular analyses of prolidase deficiency. J Inherit Metab Dis 12(3): 351-4. Fernandez-Espla, M . D., M . C. Martin-Hernandez and P . F

  16. Testing thread compounds for rotary-shouldered connections

    SciTech Connect

    Bailey, E.I. ); Smith, J.E. )

    1993-09-01

    Trouble-free rotary-shouldered-connection performance depends on proper joint makeup. Joints must be tight enough to prevent shoulder separation under bending and tensile loads but not so tight that their tensile capacity decreases or the pin or box is damaged. The preload in a connection from tightening depends on the makeup torque and frictional properties of the thread compound. In 1957, Farr developed and published a simplified torque formula to calculate makeup torque: T[sub mu] = ([sigma]A/12)[(p/2[pi])+(r[sub t]K[sub f]/cos [Theta])+r[sub s]K[sub f

  17. Gaseous Electronics Conference (35th) Held at Dallas, Texas, 19-22 October 1982.

    DTIC Science & Technology

    1982-12-31

    Multiphoton Ionization in Xenon and Xenon- Nitro - gen Mixtures-S.K. DHALI and P.F. WILLIAMS, Texas Tech*-- We studied the multiphoton ionization (MPI...molecules where X is Cl, Br, or I. Nitro - gen gas from an expanding nozzle is excited by a weak (ɝ watts) microwave discharge at the entrance to the...The value of E/N is 300 Td for helium and 1750 Td for nitro - gen. We will discuss the behavior of P(n,x) and c(n,x), with E/N as a parameter, with

  18. Regulation of Mammary Progenitor Cells by p53 and Parity

    DTIC Science & Technology

    2011-01-01

    2003). 12. Ibarra , I., Erlich, Y., Muthuswamy, S. K., Sachidanandam, R. & Hannon, G. J. A role for microRNAs in maintenance of mouse mammary...supplemented with 1mM EDTA, 25mM HEPES, 1%FBS and 100u/ml Pen/Strep. The FACS data were collected using LSRII (Becton Dickinson, San Jose CA). A total...epithelial stem/progenitor cells. BREAST CANCER RES. 2009;11(2):R20. 28. Ibarra I, Erlich Y, Muthuswamy SK et al. A role for microRNAs in maintenance

  19. Gauging U.S.-Indian Strategic Cooperation

    DTIC Science & Technology

    2007-03-01

    Discount Rate C os t ( U S ce nt s / kW h) Kaiga I&II Nuclear Plants Kaiga III&IV Nuclear Plants Raichur VII Coal Plant Figure 1. Levelized Cost of...REPORT DATE MAR 2007 2. REPORT TYPE 3. DATES COVERED 00-00-2007 to 00-00-2007 4. TITLE AND SUBTITLE Gauging U.S.-Indian Strategic Cooperation...5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7

  20. Hybridization of Block Copolymer Micelles

    DTIC Science & Technology

    1993-01-01

    J. Macromol. Sci., Part A 1973, 7,601. (10) Tiara, M.; Ramireddy, C.; Webber, S. K; Munk,P. Collect. Czer" (14) 0snford, C. In The Hydrophobic Effect ...equilibrate In the first series of experiments we have studied the within 20 min, similarly as ASA-10 micelles do. However, effect of the copolymer...high. This may happen after a sudden The Johnston-Ogston effect 2’ 6- also may play a role in jump in temperature or in the composition of the mixed

  1. The derivative of a continued fraction

    SciTech Connect

    Bowman, Kimiko o

    2009-01-01

    The paper considers second order continued fractions associated with (I) the Psi function {psi}(z), (II) the continued fraction component in ln {Gamma}(z) due to Stieltjes. The second order sequences k*{sub s}/k{sub s} provide approximants, some of which are remarkably close. In addition a series form for the convergent {chi}{sub s}={omega}{sub s} associated with a continued fraction provides an expression for the derivatives of a continued fraction. The implementation uses a Maple code for derivatives.

  2. Toxic Hazards in Aviation.

    DTIC Science & Technology

    1981-04-01

    Commun. 82, 1320-1324. 1S. JAIN, S.K., MAJUMDAR, S. AND SUBRAHAMANYAM, D. (1977). Effects of phenyl-hydrazine .0 on the plasma lipds of albino rat. Naunyn...obtained from the Jackson Laboratories, CDF (Fischer 344 derived) albino rats from Charles River, Engle Golden Syrian hamsters, and beagle dogs. The number...rat ions de 0I, - I - 2 ot 4 1.U.t lea preossona partiel lea inspi i- tea en (󈧆 varicrtt par consliquent so aol doP 2,2’t N 30 torr,N 211 i 1.81 N

  3. Mixed valent sites in biological electron transfer.

    PubMed

    Solomon, Edward I; Xie, Xiangjin; Dey, Abhishek

    2008-04-01

    Many of the active sites involved in electron transfer (ET) in biology have more than one metal and are mixed valent in at least one redox state. These include Cu(A), and the polynuclear Fe-S clusters which vary in their extent of delocalization. In this tutorial review the relative contributions to delocalization are evaluated using S K-edge X-ray absorption, magnetic circular dichroism and other spectroscopic methods. The role of intra-site delocalization in ET is considered.

  4. Prostate Cell Specific Regulation of Androgen Receptor Phosphorylation in Vivo

    DTIC Science & Technology

    2009-11-01

    Gene Anal Tech 1988; 5: 22. 7. Schott S, Coustham V, Simonet T, Bedet C and Palladino F: Unique and redundant functions of C . elegans HP1 proteins in... C ., Hittelman, A., Rogatsky, I., Logan, S.K., and Garabedian, M.J. Glucocorticoid receptor phosphorylation differentially affects target gene ...Endocr Relat Cancer 2002;9:61–73. 5. Abate-Shen C , Shen MM. Molecular genetics of prostate cancer. Genes Dev 2000;14:2410–34. 6. Shang Y, Myers M

  5. Avian Distribution Patterns Across the Cache River Floodplain, Arkansas

    DTIC Science & Technology

    1994-09-01

    northern waterthrush, and yellow-billed cuckoo ) were not asso- ciated with any of the habitat variables. During winter, most species showed no affinity for...8217• • Yellow-billed Cuckoo -0.1 Red-bellied Woodpecker Blue-gray Gnatcatcher CO 0.0- Northern Parula W Carolina Chickadee Z Brown-headed CowbirdI- 1L 0.1...Robinson, S. K. (1990). "Effects of forest fragmentation on nesting song - birds," Illinois Natural History Survey, Natural History Reports, No. 296

  6. Operation JUBILEE: The Allied Raid on Dieppe (1942) -- A Historical Analysis of a Planning Failure

    DTIC Science & Technology

    2008-03-06

    b. Air Force Commander: Air Vice Marshall Leigh-Mallory, RAP; and, 5 I 1- ,I ~, c. Naval Force Commander: Rear-Admiral H.T. Baillie-Grohman, RN.17...Lovat ~~ Air Vice- Marshall Trafford Leigh-Mallory F-ll2 APPENDIX F - DETAILED OBJECTIVES OPERATION JUBILEE! No.3 Commando -land at beaches Yellow I and...para. :i6:.!)..’ ~ ... -(iv) Mihtary,·~’tPP(lrt during-landing (para. 363),: .::i (b) The bombardment Clf ~Ianluy Island by JL~r.S... K~nya," a 6

  7. Analysis and Synthesis of Microstrip Antennas Including Mutual Coupling

    DTIC Science & Technology

    1988-09-01

    E N 11. TITLE (/b*I* Secwfty OuodlCaUOn~) Analysis and Synthesis of Microstrip Antennas Including Mutual Coupling 12. PERSONAL AUTHOR(S) K~oichiro...GROUP SUB-GROUP Array Antennas, Microstrip Antennas, Array Analysis, Array Synthesis, Array Theory, Microwave Network Analysi! 19. ABSTRACT (Continue...VIRGI-J~NIA TECH ANALYSIS AND SYNTHESIS OF [. MICROSTRIP ANTENNAS INCLUDING MUTUAL COUPLING o0000 0 0 a o 0 0 0 0 0 o 0 00 0 00 o00000 0o000 0 0 0 a 0 0 0o

  8. Characteristics of Incinerators with Heat Recovery Capability.

    DTIC Science & Technology

    1988-04-01

    p" R. Ducey U G. Schanche D A wide range of equipment is available for incinerating wastes and recovering the heat released as useful energy. These...With Heat Recovery Capability (Unclassified) 12 PERSONAL AUTHOR(S) K. Griggs; G. Chamberlin; R. Ducey ; C. Schanche-A 1aTPOFRPR13TIECOVERED 14DATE OF...for the plant site. 2 R. A. Ducey , et al., Heat Recovery Incineration: A Summary of Operational Ex- perience, Special Report E-85/06/ADA152236 (USA

  9. Status Survey of Bunkers 738A and 825A at Spangdahlem AB, Germany

    DTIC Science & Technology

    2015-10-02

    88ABW-2015-4768, 2 Oct 2015 13. SUPPLEMENTARY NOTES 14 . ABSTRACT The United States Air Force School of Aerospace Medicine, Consultative...USAFSAM/OEC d. Personnel Contacted: (1) Lt Col Scott Steige1wald, Flight Commander, 52 AMDS /SGPB (2) Mr. Craig Refosco, Health Physicist, AFMSA/SG3PB...C’. vf . Duo Date: P\\!·2;s K~Z7 oz-~ar-aa 3217 L.ucnum 500-1 10!𔃻)2 4 IJhC M!4 T c-99 MU658 30-S&.rC4 29751 !\\1~ 111 S11r11t :tf\\1, • n’ klot

  10. Repetitively Pulsed Electric Laser Acoustic Studies. Volume 1.

    DTIC Science & Technology

    1983-09-01

    INGARD ET AL. SEP 83 UNCLASSIFIED APHAL-IR-83-2858-VOL-1 F336i5 86-C 2848 F/ 0/ 8, EEEmohEEEomhiE EohEEmhohEEEEE mhhhmmomhhlm...TR-83-2058, Vol 9, 0 REPETITIVELY PULSED ELECTRIC LASER ACOUSTIC STUDIES Volume I K. U. INGARD , CHARLES F. MCMILLAN uDEPARTMENT OF AERONAUTICS AND...CONTRACT OR GRANT NUMBER(s) K.U. Ingard and Charles F. McMillan F33615.80-C-2040 9. PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGRAM ELEMENT. PROJECT

  11. Analysis of Biological Particles by Mass Spectrometry

    DTIC Science & Technology

    1984-10-23

    references therein. 19. Sinha, M.P.; Platz, R.M.; Friedlander, S.K.; Vilker, V.L. J. Appl. Env. Microbiol. 1984 (in press). 20. Cummins, C.S.; Harris ...from microuial aerosols " in densely populated urban region5. Appi. Environ. Microbiol. 39: o- 11. •’ 19 7. Cumins. C. S.. and H. J. Harris . 1956. The...Fraset , D. W., T. F. Tsai, W. Orenstein, W. E. Parkin. H. J. Beecham, R. G. S.arrar, J. Harris , G. F. Mallison, S. M. Martin, J. E. McDade. C. C

  12. Global Model for Sound Absorption in Sea Water

    DTIC Science & Technology

    1987-05-14

    scattering. -31 - A -(dBirm) Tasnen Sea pH7.9 4’C .01 .001 , // l A2 A .01 F1 . :’ Frequency (kHz) Figure 30: Tasman Sea data and mudel. In the deep... Tasman Sea by Bannister et. a1. 1241 in Figure 30 are typical. In both experiments shown, measurements were made In the deep channel and the maximum...in the South Tasman Sea ", J. Acoust. Soc. Am. 62 647-859 (1977) 25. A. C. Kibblewhite, N. R. Bedford and S. K. Mitchell, "Regional dependence of low

  13. Problems of Diffraction and Propagation of Electromagnetic Waves (Selected Pages),

    DTIC Science & Technology

    1982-08-02

    stands both under the integral sign and outside it) with the semi-infinite limits and the kernel, which depends on the absolute value of a difference...the integral sign , after which we will obtain g((x) = in -N(Z)_ g (y) dy. (5. 0t) After using the second law of mean, it is easy to consider integral...under the integral sign which gives to us +’VI -j e - ’ --K ( w) F ( t) d w +4 +N S _k(x-y)dy f e ’--F(w)dwv. (5-12) Here it is possible to pass to

  14. Physique et mathématique des solitons optiques managés endispersion

    NASA Astrophysics Data System (ADS)

    Turitsyn, Sergei K.; Shapiro, Elena G.; Medvedev, Sergei B.; Fedoruk, Mikhail P.; Mezentsev, Vladimir K.

    2003-02-01

    We review the main physical and mathematical properties of dispersion-managed (DM) optical solitons. Theory of DM solitons can be presented at two levels of accuracy: first, simple, but nevertheless, quantitative models based on ordinary differential equations governing evolution of the soliton width and phase parameter (the so-called chirp); and second, a comprehensive path-average theory that is capable of describing in detail both the fine structure of DM soliton form and its evolution along the fiber line. An analogy between DM soliton and a macroscopic nonlinear quantum oscillator model is also discussed. To cite this article: S.K. Turitsyn et al., C. R. Physique 4 (2003).

  15. Medical Services: Patient Administration

    DTIC Science & Technology

    2007-11-02

    participants in Domestic Action Programs (formerly para 4-63). o Rescinds eligibility references to the Citizens Military Training Corps (formerly para 5...consolidated regulation p r e s c r i b e s p o l i c i e s a n d m a n d a t e d t a s k s governing the management and adminis- tration of patients...Security beneficiaries • 3–34, page 25 Micronesian citizens • 3–35, page 25 American Samoan citizens • 3–36, page 25 Section VIII Miscellaneous Categories

  16. Quality Assurance/Quality Control in Waste Site Characterization and Remedial Action.

    DTIC Science & Technology

    1987-01-01

    Als 539 QUALITY ASSIJRANCE/-OWAITY CONTROL IN MASTE SITE vi1 71 CIARACTERIZATION AND REMEDIAL ACTIGN(U) OAK RIDGE ED NATIONAL LAB IN N P MASKAAINEC...and Remedial Action D T Final Report .L Co:i., M. P . Maskarinec NOV 2 3 1987 i’ ~S. K. Holladay P Supported by U.S. Army Toxic and Hazardous Materials...National Laboratory USATHAMA &6 ADDRESS (City, State, and ZIP Code) 7b ADDRESS (City, State, and ZIP Code) P . 0. Box X AMXTH-TE-A Oak Ridge, TN 37831

  17. Dating Indian corals by U-decay-series methods

    NASA Astrophysics Data System (ADS)

    Somayajulu, B. L. K.; Broecker, W. S.; Goddard, J.

    1985-09-01

    Nine samples of corals collected from seven locations in the Saurashtra Coastal region of India were dated by 238U series disequilibrium methods. Of the three age groups (6000, 30,000, and 120,000 yr) reported for this region by the earlier studies of S. K. Gupta and B. S. Amin (1974, Marine Geology16, 79-83), we could confirm only the 6000-yr group. Instead of a 120,000-yr group, we found a scatter of ages between 118,000 and 176,000 yr. There appears to be no evidence for 30,000-yr-old corals from this region.

  18. [Results for SHEBA/FIRE

    NASA Technical Reports Server (NTRS)

    Valero, Francisco P. J.

    2003-01-01

    The Atmospheric Research Laboratory's Radiation Measurement System (RAMS) was on the NCAR C-130 aircraft in May and July 1998, collecting radiometric data on the science flights conducted in the vicinity of the Surface Heat Budget of the Arctic Ocean (SHEBA) ship. These measurements were part of the FIRE Arctic Cloud Experiment (FIRE ACE). Analysis of some of the data focused on the absorption, reflection, and transmittance of Arctic clouds, especially compared to model results. In order to assess the absorption of solar radiation by the clear and cloudy atmosphere in the Arctic the measurements from the radiometers were combined in pairs of above-cloud segments and below-cloud segments. To get these pairs, the data for all sixteen of the flights (8 in May and 8 in July) were examined for occurrences of low-altitude segments in proximity to high-altitude segments. The low-altitude data are then treated as measurements of the bottom of a layer and the high-altitude data are taken as measurements of the top of the layer. With measurements of the upwelling and downwelling irradiances above and below a layer one can determine the reflectance, transmittance, and absorptance of the layer. Attachment: Doelling, D.R., P. Minnis, D.A. Spangenberg, V. Chakrapani, A. Mahesh, S.K. Pope, and F.P.J. Valero, Cloud radiative forcing at the top of the atmosphere during FIRE ACE derived from AVHRR data, J. Geophys. Res. 106, 15,279-15,296,2001. Minnis, P., D.R. Doelling, D.A. Spangenberg, A. Mahesh, S.K. Pope, and F.P.J. Valero, AVHRR-derived cloud radiative forcing over the ARM NSA and SHEBA site during FIRE ACE, abstract submitted to the ARM Science Team Meeting, San Antonio, TX, M a . 13-17,2000. Pope, S.K., and F.P.J. Valero, Measured and modeled radiometric fluxes in the Arctic during FIRE-ACE, presented as a poster at the American Geophysical Union meeting, San Francisco, CA, Dec. 13-17, 1999. Pope, S.K., and F.P.J. Valero, Measured and modeled radiometric fluxes in the Arctic

  19. Li-Ion Battery Cathodes: Enhancing Interfacial Bonding between Anisotropically Oriented Grains Using a Glue-Nanofiller for Advanced Li-Ion Battery Cathode (Adv. Mater. 23/2016).

    PubMed

    Kim, Hyejung; Lee, Sanghan; Cho, Hyeon; Kim, Junhyeok; Lee, Jieun; Park, Suhyeon; Joo, Se Hun; Kim, Su Hwan; Cho, Yoon-Gyo; Song, Hyun-Kon; Kwak, Sang Kyu; Cho, Jaephil

    2016-06-01

    The formation of a spinel Lix CoO2 layer in a Ni-rich secondary particle for lithium-ion batteries is reported by S. K. Kwak, J. Cho, and co-workers on page 4705, who find that the spinel-like Lix CoO2 layer, between layered primary particles, can enhance the mechanical strength of secondary particles by enhancing the interfacial binding energy among the grains. Moreover, the layer can effectively protect the unstable surface of the primary particles and offers a fast electron-ion pathway, resulting in overall enhancements of stability and kinetics in battery performance.

  20. Convex Digital Solids.

    DTIC Science & Technology

    1980-08-01

    where each face F. of 11(R) is represented by a sequence of its1 vertices. A lo)rithm CONVEXHULL(S,H(S) ,k) 2.1. Obtain CP(S), the set of corner...two. A chain is a finite sequence of digital points such that every element of the sequence except the first is a 6-neighbor of its predecessor. A set R...tno Lube wnosu edge is o1 length n. S is represented by a run lenqth code [121 such that RC(i,j) is a finite sequence of run lkLjntns of U’s

  1. The Saudi Arabian Heat Low: A Numerical Perspective.

    DTIC Science & Technology

    1984-01-01

    hours, the temperature trace • 1 o " " . , 81 SIGMA 0 .07 RADIUS 37.1 KN 3 (a) 270 0 2 4 36 40 .0 ~ * 64 I SIGMA 0 .47 RADIUS "?q.S K" 310 11146 -OS...AD-R45 575 THE SAUDI ARABIAN HEAT LOW: A NUMERICAL PERSPECTIVE(U) 1/ 3 AIR FORCE INST OF TECH WRIGHT-PRTTERSON AFB OH L E FREEMAN 1984 AFIT/CI/NR-84...your organization or another agency if AFIT had not?’ ( ) a. YES ( ) b. NO 3 . The benefits of AFIT research can often be expressed by the equivalent

  2. Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    confirmed by NMR and mass spectrometry. O Cl Cl N ACN , r.t., O/N NN+ Cl N CO2 - O S H Cl Cl O NN+ Cl HO2C CO2H MHI-clorgyline10 , EDC, 4-DMAP O...Cl Cl N O Cl Cl N MeOH, 85oC, 6 h 109 HCl O Cl Cl N H2 + BrAcS K2CO3, ACN , 50 oC, 5h 6 8 DCM, r.t, 8 min. O Cl Cl BocHN Br 1. NaH/DMF 2. 5 + DMF

  3. Effect of Physical Aging on Mechanical Behavior of an Elastomeric Glass under Combined Pressure and Temperature.

    DTIC Science & Technology

    1986-12-01

    NO. 3. RECIPIENT’S CATALOG NUMBER Technical Report No. 7 C.- 4. TITLE (and Subtitle) S . TYPE OF REPORT & PERIOD COVERED Effect of Physical Aging on...Mechanical Behavior of an Elastomeric Glass Under Combined Pressure and Temperature G. PERFORMING ORG. REPORT NUMBER 7. AUTHOR(e) S . CONTRACT OR GRANT...NUMBER( s ) K. Vijayan and K. D. Pae NOOO14-82-K-0608 9. PERFORMING r" GANIZATION NAME AND ADDRESS 10. PROGRAM ELEMENT. PROJECT, TASK High PrE 3,ure

  4. U.S. TAG for ISO/TC43 Acoustics and IEC/TC29 Electroacoustics (Minutes for the Accredited Standards Committee on Acoustics, S1)

    DTIC Science & Technology

    1991-05-02

    NOTE At the S3 meeting, Mr. Grason and Ms. Wilber also indicated their probable participation in the ISO/TC 43 meetings. 7. Review of Standards more...A. Wilber G. S. K. Wong R. W. Young S1/347 ATTACHMENT C-6 Not for reproduction 29(USA Original: English March 1990 INTERNATIONAL ELECTROTECHNICAL...Nielsen, the Secretary of TC 29, with copy to the Central Office, by April 15, 1991. encl. cc: A. V. Brenig R. L. Grason L. A. Wilber Not for

  5. Minutes: Accredited Standards Committee on Acoustics, S1 U.S. Tag for ISO/TC43 Acoustics and IEC/TC29 Electroacoustics

    DTIC Science & Technology

    1991-05-02

    S3 meeting, Mr. Grason and Ms. Wilber also indicated their probable participation in the ISO/TC 43 meetings. 7. Review of Standards more than five...Brenig without all encl.: K. N. Eldred D. L. Johnson R. W. Krug A. H. Marsh L. A. Wilber G. S. K. Wong R. W. Young S1/347 ATTACHMENT C-6 Not for...1991. encl. cc: A. V. Brenig R. L. Grason L. A. Wilber No for Reproduction U.S.A./29(SEC.) 210 Original: English April 1991 S1/347 INTERNATIONAL

  6. Global Ocean Tides. Part V. The Diurnal Principal Lunar Tide (O1), Atlas of Tidal Charts and Maps.

    DTIC Science & Technology

    1981-05-20

    Private Communications: D. C. Simnpson (1977), National Ocean Survey, Rockville, Maryland; S. K. Gill and 1). L. Porter (1978), National Ocean Survey...M. Diamante Greenbelt, MD 20771 Dr. B. C. Douglas ATTN: Dr. J. W. Siry IDr. C. C. Goad D. E. Smith Dr. F. Morrison J. G. Marsh I. L. F lsentreer...Analvsis 1). L. Porter Branch R. A. Smith Wallops siand. VA 23337 B. ti. Plarker ATTN: C. 1). Leitao N. I. Iuane N(O)AA Atlantic ()ceanographic and W. B. K

  7. Global Ocean Tides. Part VII. The Diurnal Principal Solar Tide (P1), Atlas of Tidal Charts and Maps.

    DTIC Science & Technology

    1981-05-01

    Survey, Rockville, Maryland; S. K. Gill and D. L. Porter (1978), National Ocean Survey, Rockville, Maryland; K. Wyrtki (1978), University of Hawaii...Rockville, M) 20852 ATTN: )r. B. (’hovitz NASA/Goddard Space Flight Center l)r. J. M. Diamante Greenbelt. MI) 20771 Dr. B. C. )ouglas ATTN: l)r. J. W. Siry Dr...20852 NASA/Wallops Station A I IN: 1). C. Simpson Inlormation Processing and Analysis 1). L. Porter Branch R. A. Smith Wallops Island, VA 23337 It. It

  8. Modelling Legal Argument: Reasoning with Cases and Hypotheticals, a Thesis Proposal.

    DTIC Science & Technology

    1986-06-30

    gument. In Antonio A . Martino and Fiorenza Socci Natali, editors, Atti preliminari del II Convegno internazionale di studi su Logica Informat- ica...80-R175 925 MODELLING LEGAL RGUMENT: REASONING HITH CSSRO / HYPOTHETICALS A THESIS.. (U) MASSACHUSETTS UNIY AMHERST DEPT OF COMPUTER AND INFORMATION...S.. K D ASHLEY 7UNCLSSIFIED 3JUN6 CPT- N9914-5-K-0017 F/ /7 NL Ehhhmhhhmmmhhu EhhEEmhEmhEEEI mhsohmhmhEmhohE A bh9P I, ~4 4~I us9., ,~,4 V. %~j. ’S

  9. Constrained dipole oscillator strength distributions, sum rules, and dispersion coefficients for Br2 and BrCN

    NASA Astrophysics Data System (ADS)

    Kumar, Ashok; Thakkar, Ajit J.

    2017-03-01

    Dipole oscillator strength distributions for Br2 and BrCN are constructed from photoabsorption cross-sections combined with constraints provided by the Kuhn-Reiche-Thomas sum rule, the high-energy behavior of the dipole-oscillator-strength density and molar refractivity data when available. The distributions are used to predict dipole sum rules S (k) , mean excitation energies I (k) , and van der Waals C6 coefficients. Coupled-cluster calculations of the static dipole polarizabilities of Br2 and BrCN are reported for comparison with the values of S (- 2) extracted from the distributions.

  10. Gd(3+)-Yb(3+) Exchange Interactions in LiYb(x)Y(1-x)F4 Single Crystals

    DTIC Science & Technology

    2001-01-01

    fluorolanthanate phases," Inorg. Chem. 9, pp. 1096-1101, 1970. 6. L. E. Misiak, P. Mikolajczak and M. Subotowicz, "Lithium rare-earth fluoride crystal growth and...of Gd 34 in LiYF 4 determined by EPR," Solid State Commun. 45, pp. 1093-1098, 1983. 8. S. K. Misra, M. Kahrizi, P. Mikolajczak and L. E. Misiak, "EPR...and P. Mikolajczak , "EPR of Gd34 -doped single crystals of LiYbxY_,-F 4," Phys. Rev. B 38, pp. 8673-8682, 1988. 10. M. R. St. John and R. J. Myers

  11. Application of Chiral Cellular Structures for the Design of Innovative Structural Assemblies

    DTIC Science & Technology

    2008-02-14

    Pages 280-289. 8. Scarpa F., Pastorino P., Garelli A., Patsias S., Ruzzene M., 2005 “ Auxetic Compliant Flexible PU Foams: Static and Dynamic...Global Buckling Chiral Hexagonal/ Auxetic Honeycombs C o ll a p s e s tr e n g th p e r u n it w e ig h t L/R ( e l ) 3 / * / s, [K P a...Pastorino P., Garelli A., Patsias S., Ruzzene M., 2005 “ Auxetic Compliant Flexible PU Foams: Static and Dynamic Properties” Physica Status Solidi B

  12. Thermal Stresses 97: Proceedings of the Second International Symposium on Thermal Stresses and Related Topics.

    DTIC Science & Technology

    1997-06-11

    method of characteristics and MacCormack’s method for relaxation time r i= 8.0*10-12s and for r = .5*10~12s for an aluminum alloy . The following... property values, typical for an aluminium alloy have been used, * = 2nW/mK, c = 946J/kgK, a = 7.7 * 10_5/A", Co = 6198m/s, K = 68.6Gpa...The alloy chosen for the experiments is St 52-3 be- cause of its similar chemical composition and me- chanical properties to the steel A used by [5

  13. The Horizontal Wire over Earth as a Transmission Line: A Model Surface-Impedance Approach.

    DTIC Science & Technology

    1982-07-01

    Heaviside step function 6(z) = 1 (z > 0), O(z) = 0 (z < 0). Finally, if we insert equation (18) into (16), and close the contour in the lower half plane...NUCLEAR AGENCY ATTN A. LAWRENCE WELLER ATTN DDST, E. E. CONRAD, DEP DIR M/S: K75-50 SCI & TECH 3801 SOUTH OLIVER ATTN RAEV, ELECTRONICS VULNERABILITY...BRIDE AVENUE CAMDEN COMPLEX ATTN TECH INFO CTR FRONT & COOPER STREETS LITTLE FALLS, NJ 07424 ATTN OLIVE WHITEHEAD ATTN R. W. ROSTROM SPERRY RAND

  14. Selective Chemosensitization of Rb Mutant Cells

    DTIC Science & Technology

    2000-07-01

    Oncogene 9, 359-73 (1994). 5. S. B. McMahon, H. A. Van Buskirk, K. A. Dugan, T. D. Copeland, M. D. Cole, Cell 94, 363-74. 6. E. Querido , J. G... Querido , E., Teodoro, J. G. & Branton, P. E. (1997) /. Virol. 71, 3526-3533. 39. Chiou, S. K. & White, E. (1997) /. Virol. 71, 3515-3525. 40. Mymryk, J...cells (Debbas and White 1993; Lowe and Ruley 1993; Querido et al. 1997; Samuelson and Lowe 1997), which is reflected by ElA’s remarkable ability to

  15. Deposition and Characterization of Barrier Metals

    DTIC Science & Technology

    2001-09-01

    sputtered WNx film fabricated by Yongjun [16] exhibited low stress, high surface smoothness and high thermal stability. It was found that a low nitrogen...T. Kim, C. Lee, J. Y. Lee, S.-K. Min and Y. W. Park, J. Vac. Sci. Technol. B 12(1), 69 (1994). 16. H. Yongjun , U. S. Patent No. 5633200, 1997. 17...Levine, B. Zheng and M. Chang, J. Vac. Sci. Technol. B 18(1), 237 (2000). 14. H. Yongjun , U. S. Patent No. 5633200, 1997. 15. K. D. Leedy, M. J

  16. Reactive Ion Etching of Selected Polymers in O2 and CF4/O2

    DTIC Science & Technology

    1991-12-18

    methyl ether and nitrate ). At a power density of 0.50 watt/rcm 2 the etch rates were about 75 to 80% higher than those at the lower power density. The...5. 2 . B. C. Dems, F. Rodriguez, C. M. Solbrig, Y. M. N. Namaste, and S. K. Obendorf, Int. Polym. Proc., 4, 183 (1989). 3. R. H. Hansen , J. V. Pascale...00 6H4 ----0HO00o )l* H PTFP - H -C6H-4-O-CO-CF 3 Table 3 Plasticizers Abbrev. Chemical name Supplier C DOS Di- 2 - ethylhexyl sebacate C. P. Hall 0.27

  17. Monocyte-Derived Interleukin 1: Effects on Aortic Contraction and Phosphatidylinositol Turnover

    DTIC Science & Technology

    1988-11-29

    TELEPHONE (Include Area Code) 2c. OFFICE SYMBOL Regina E. Hunt, Command Editor (202) 295-0198 NSB/ADMIN/NMRI DD FORM 1473, 84 MAR 83 APR edition may be...REPORT NUMBER(S) S MONITORING ORGANIZAflON REPORT NUMBER(S) K"Val 88-96 6a. NJAME OF PERFORMING ORGANIZAr;ON 6o OFFICE SYMBOL 7a. NJAME OF MONITORING...SPONSORING 8b, OFFICE SYMBOL 9 PROCUREMENT iNSTRUMENT IDENTIFICATION NUMBER ORGANIZATION Naval Medical- (if applicable) Research & Development CommiandI 8C

  18. Adaptive, Integrated Guidance and Control Design for Line-of-Sight Based Formation Flight

    DTIC Science & Technology

    2006-08-01

    PI ) controller acting on the side acceleration command error and whose output is a...Aeronautics and Astronautics 15 s K K y y I P + 0= comBYa comz BYa PI controller Inverting Controller Augmented...λλλλ &&&ΨΘΦ= state vector : Rhν Ehχ ν & + - + dczν trz& adzν PI Control BYa 0= comBY a 1st order Reference Filter trz zK+ - + - rCz r+= β NN

  19. History of the Subcommittee on Welding of Armor Ferrous Metallurgical Advisory Board Ordnance Department U.S. Army

    DTIC Science & Technology

    1946-07-01

    mothod othor than the skill o f the men you put in there. The qualifications will have to be rigid RS t o the degree of s k i l l used. You...rcsistance wolding Industrp should be 3.-mited to sit in on tha Sub- committee meetings but no definito decision was reach04 on t h i s point. With...We axe o d y an advisory Agency, so t o speak *" Since the East meeting of the Subcommittee some thought had been given t o Subcommittee

  20. Software Development Projects: Estimation of Cost and Effort (A Manager’s Digest).

    DTIC Science & Technology

    1982-12-01

    effo- estimatinq model. 1 I A A. k DEFINITION OF SOFTWARE ENGINEERING ECONOMICS The term software enqineering has been used extensively throughout...a large pcrtion of the programmer’s time and must be addressed in any estimation of cost and effort. 4. Cos- Cos" !:aS olaved a maicr ro!= in =v-cp...qua lificat ions: 1 . nambers should reflect a knowledgs of the sys--em techniques. The nature of the problem will determine nw; e_: nh’s k .-cw_=_g- be