Sample records for 1balpha guanine nucleotides

  1. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes

    PubMed Central

    Randazzo, Paul A; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K


    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs),1 15 Arf GEFs,2 81 Rho GEFs,3 8 Ras GEFs,4 and others for other families of GTPases,5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically.5–13 In some cases, kinetic analysis has been simplistic leading to erroneous conclusions about mechanism (as discussed in a recent review14). In this paper, we compare two approaches for determining the kinetic properties of exchange factors: (i) examining individual equilibria, and; (ii) analyzing the exchange factors as enzymes. Each approach, when thoughtfully used,14,15 provides important mechanistic information about the exchange factors. The analysis as enzymes is described in further detail. With the focus on the production of the biologically relevant guanine nucleotide binding protein complexed with GTP (G•GTP), we believe it is conceptually simpler to connect the kinetic properties to cellular effects. Further, the experiments are often more tractable than those used to analyze the equilibrium system and, therefore, more widely accessible to scientists interested in the function of exchange factors. PMID:25332840

  2. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.


    Lane, B Josh; Mutchler, Charla; Al Khodor, Souhaila; Grieshaber, Scott S; Carabeo, Rey A


    Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein). TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs), Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K), appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  3. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    SciTech Connect

    Boulias, C.; Moscarello, M.A. )


    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides.

  4. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E


    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  5. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    USDA-ARS?s Scientific Manuscript database

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  6. Human Sos1: A guanine nucleotide exchange factor for ras that binds to GRB2

    SciTech Connect

    Chardin, P. ); Camonis, J.; Gale, N.W.; Aelst, L. Van; Wigler, M.H.; Bar-Sagi, D. ); Schlessinger, J. )


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1. 42 refs., 5 figs.

  7. Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.


    Chardin, P; Camonis, J H; Gale, N W; van Aelst, L; Schlessinger, J; Wigler, M H; Bar-Sagi, D


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1.

  8. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    SciTech Connect

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.


    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated with 1 pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.

  9. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    PubMed Central

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5′-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches. PMID:26558346

  10. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  11. Oxidation of the guanine nucleotide pool underlies cell death by bactericidal antibiotics.


    Foti, James J; Devadoss, Babho; Winkler, Jonathan A; Collins, James J; Walker, Graham C


    A detailed understanding of the mechanisms that underlie antibiotic killing is important for the derivation of new classes of antibiotics and clinically useful adjuvants for current antimicrobial therapies. Our efforts to understand why DinB (DNA polymerase IV) overproduction is cytotoxic to Escherichia coli led to the unexpected insight that oxidation of guanine to 8-oxo-guanine in the nucleotide pool underlies much of the cell death caused by both DinB overproduction and bactericidal antibiotics. We propose a model in which the cytotoxicity of beta-lactams and quinolones predominantly results from lethal double-strand DNA breaks caused by incomplete repair of closely spaced 8-oxo-deoxyguanosine lesions, whereas the cytotoxicity of aminoglycosides might additionally result from mistranslation due to the incorporation of 8-oxo-guanine into newly synthesized RNAs.

  12. Thiol-modifying phenylarsine oxide inhibits guanine nucleotide binding of Rho but not of Rac GTPases.


    Gerhard, Ralf; John, Harald; Aktories, Klaus; Just, Ingo


    Phenylarsine oxide (PAO) is a phosphotyrosine phosphatase inhibitor that cross-links vicinal thiol groups, thereby inactivating phosphatases possessing XCysXXCysX motifs. The RhoA-GTPase, but not the Rac1-GTPase, also possesses vicinal cysteines within the guanine nucleotide-binding region (aa 13-20) and the phosphohydrolase activity site. Treatment of Caco-2 cells with PAO showed a dose-dependent reorganization of the actin cytoskeleton, indicating involvement of Rho GTPases. As tested by pull-down experiments, RhoA, but not Rac1, from cell lysates was inactivated by PAO in a concentration-dependent manner. Modification of RhoA by PAO resulted in altered mobility on SDS-polyacrylamide gel electrophoresis, and PAO-modified RhoA was no longer substrate for C3-catalyzed ADP-ribosylation. Furthermore, RhoA treated with PAO, but not Rac1 treated with PAO, lost its property to bind to guanine nucleotides. Matrix-assisted laser desorption ionization-mass analysis of PAO-modified RhoA showed a mass shift according to an adduction of a single PAO molecule per molecule RhoA. Further analysis of Glu-C-generated RhoA peptides confirmed binding of PAO to a peptide harboring the guanine nucleotide binding region. Thus, PAO does not exclusively inhibit phosphotyrosine phosphatases but also inactivates RhoA by alteration of nucleotide binding.

  13. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    SciTech Connect

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.


    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity (/sup 3/H)fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity (/sup 3/H)fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils.

  14. Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic intellectual disability

    PubMed Central

    Shoubridge, Cheryl; Tarpey, Patrick S; Abidi, Fatima; Ramsden, Sarah L; Rujirabanjerd, Sinitdhorn; Murphy, Jessica A; Boyle, Jackie; Shaw, Marie; Gardner, Alison; Proos, Anne; Puusepp, Helen; Raymond, F Lucy; Schwartz, Charles E; Stevenson, Roger E; Turner, Gill; Field, Michael; Walikonis, Randall S; Harvey, Robert J; Hackett, Anna; Futreal, P Andrew; Stratton, Michael R; Gécz, Jozef


    The first family identified as having a nonsyndromic intellectual disability was mapped in 1988. Here we show that a mutation of IQSEC2, encoding a guanine nucleotide exchange factor for the ADP-ribosylation factor family of small GTPases, caused this disorder. In addition to MRX1, IQSEC2 mutations were identified in three other families with X-linked intellectual disability. This discovery was made possible by systematic and unbiased X chromosome exome resequencing. PMID:20473311

  15. Stimulation of phospholipase C by guanine-nucleotide-binding protein beta gamma subunits.


    Camps, M; Hou, C; Sidiropoulos, D; Stock, J B; Jakobs, K H; Gierschik, P


    We have previously shown that soluble fractions obtained from human HL-60 granulocytes contain a phospholipase C which is markedly stimulated by the stable GTP analogue guanosine 5'-[3-O-thio]triphosphate (Camps, M., Hou, C., Jakobs, K. H. and Gierschik, P. (1990) Biochem. J. 271, 743-748]. To investigate whether this stimulation was due to a soluble alpha subunit of a heterotrimeric guanine-nucleotide-binding protein or a soluble low-molecular-mass GTP-binding protein, we have examined the effect of purified guanine-nucleotide-binding protein beta gamma dimers on the phospholipase-C-mediated formation of inositol phosphates by HL-60 cytosol. We found that beta gamma subunits, purified from bovine retinal transducin (beta gamma t), markedly stimulated the hydrolysis of phosphatidylinositol 4,5-bisphosphate by this phospholipase C preparation. The stimulation of phospholipase C by beta gamma t was not secondary to a phospholipase-A2-mediated generation of arachidonic acid, was prevented by the GDP-liganded transducin alpha subunit and was additive to activation of phospholipase C by guanosine 5'-[3-O-thio]triphosphate. Beta gamma t also stimulated soluble phospholipase C from human and bovine peripheral neutrophils, as well as membrane-bound, detergent-solubilized phospholipase C from HL-60 cells. Stimulation of soluble HL-60 phospholipase C was not restricted to beta gamma t, but was also observed with highly purified beta gamma subunits from bovine brain. Fractionation of HL-60 cytosol by anion-exchange chromatography revealed the existence of at least two distinct forms of phospholipase C in HL-60 granulocytes. Only one of these forms was sensitive to stimulation by beta gamma t, demonstrating that stimulation of phospholipase C by beta gamma subunits is isozyme specific. Taken together, our results suggest that guanine-nucleotide-binding protein beta gamma subunits may play an important and active role in mediating the stimulation of phospholipase C by

  16. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.


    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  17. Guanine nucleotide-induced polymerization of actin in electropermeabilized human neutrophils

    PubMed Central


    The effects of exogenous guanine nucleotides on the polymerization of actin in human neutrophils were tested in an electropermeabilized cell preparation. Close to 40% permeabilization was achieved with a single electric discharge as measured by nucleic acid staining with ethidium bromide or propidium iodide with minimal (less than 2%) release of the cytoplasmic marker lactate dehydrogenase. In addition, electropermeabilized neutrophils retained their capacity to produce superoxide anions and to sustain a polymerization of actin in response to surface-receptor dependent stimuli such as chemotactic factors. Electropermeabilization produced a rapid and transient permeabilization that allowed the entry of guanine nucleotides into the cells. GTP and, to a larger extent, its nonhydrolyzable analog guanosine 5'-O-2- thiotriphosphate (GTP[S]), induced a time- and concentration-dependent polymerization of actin, as determined by increased staining with 7- nitrobenz-2-oxa-1,3-diazolylphallacidin. The effects of the aforementioned guanine nucleotides were antagonized by GDP[S], but were insensitive to pertussis toxin. Cholera toxin potentiated to a small degree the amount of actin polymerization induced by GTP[S]. These results provided direct evidence for the involvement of GTP-binding proteins in the regulation of the organization of the cytoskeleton of neutrophils, an event that is of crucial importance to the performance of the defense-oriented functions of these cells. PMID:2768336

  18. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    SciTech Connect

    Edenbrandt, C.M.; Murphy, S. )


    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation.

  19. Identification and characterization of a novel Rho-specific guanine nucleotide exchange factor.

    PubMed Central

    Blomquist, A; Schwörer, G; Schablowski, H; Psoma, A; Lehnen, M; Jakobs, K H; Rümenapp, U


    Rho GTPases are implicated in a multitude of cellular processes regulated by membrane receptors, such as cytoskeletal rearrangements, gene transcription and cell growth and motility. Activation of these GTPases is under the direct control of guanine nucleotide exchange factors (GEFs), the Dbl family proteins. By searching protein databases we have identified a novel Rho-GEF, termed p114-Rho-GEF, which similarly to other Rho-GEFs contains a Dbl homology domain followed by a pleckstrin homology domain. p114-Rho-GEF interacted specifically with RhoA, in its nucleotide-free and guanosine 5'-[gamma-thio]triphosphate-bound states, but not with Rac1 and Cdc42, and efficiently catalysed guanine nucleotide exchange of RhoA. Consistent with these results in vitro was our finding that the overexpression of p114-Rho-GEF in J82 and HEK-293 cells induced the formation of actin stress fibres and stimulated serum-response-factor-mediated gene transcription in a Rho-dependent manner. Rho-mediated transcriptional activation induced by M(3) muscarinic acetylcholine and lysophosphatidic acid receptors was enhanced by p114-Rho-GEF, suggesting that the activity of this novel Rho-GEF, which is widely expressed in human tissues, can be controlled by G-protein-coupled receptors. PMID:11085924

  20. Interactions of. beta. -adrenergic receptors with guanine nucleotide-binding proteins

    SciTech Connect

    Abramson, S.N.


    The properties of ..beta..-adrenergic receptors were investigated with radioligand binding assays using the agonists (/sup 3/H)hydroxybenzyl-isoproterenol (/sup 3/H-HBI) and (/sup 3/H)epinephrine (/sup 3/H-EPI), and the antagonist (/sup 125/I)iodopindolol (/sup 125/I-IPIN). Membranes prepared from L6 myoblasts bound (/sup 3/H)HBI, (/sup 3/H)EPI, and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 222 +/- 23, 111 +/- 7, and 325 +/- 37 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI and (/sup 3/H)EPI was inhibited allosterically by guanine nucleotides. Membranes prepared from wild-type S49 lymphoma cells bound (/sup 3/H)HBI and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 48.9 +/- 7.1 and 196 +/- 29 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI was inhibited allosterically by GTP. Similar results were obtained with membranes prepared from the adenylate cyclase deficient variant of S49 lymphoma cells (cyc-), which does not contain a functional stimulatory guanine nucleotide-binding protein (N/sub s/), but does contain a functional inhibitory guanine nucleotide-binding protein (N/sub i/). Binding of (/sup 3/H)HBI to membranes prepared from cyc- S49 cells was inhibited by pretreatment of cells with pertussis toxin. These results suggest that ..beta..-adrenergic receptors on membranes prepared from cyc- S49 cells interact with N/sub i/ to form a ternary complex composed of agonist, receptor, and N/sub i/.

  1. Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

    PubMed Central

    Murray, D W; Didier, S; Chan, A; Paulino, V; Van Aelst, L; Ruggieri, R; Tran, N L; Byrne, A T; Symons, M


    Background: Glioblastoma multiforme (GBM), a highly invasive primary brain tumour, remains an incurable disease. Rho GTPases and their activators, guanine nucleotide exchange factors (GEFs), have central roles in GBM invasion. Anti-angiogenic therapies may stimulate GBM invasion via HGF/c-Met signalling. We aim to identify mediators of HGF-induced GBM invasion that may represent targets in a combination anti-angiogenic/anti-invasion therapeutic paradigm. Methods: Guanine nucleotide exchange factor expression was measured by microarray analysis and western blotting. Specific depletion of proteins was accomplished using siRNA. Cell invasion was determined using matrigel and brain slice assays. Cell proliferation and survival were monitored using sulforhodamine B and colony formation assays. Guanine nucleotide exchange factor and GTPase activities were determined using specific affinity precipitation assays. Results: We found that expression of Dock7, a GEF, is elevated in human GBM tissue in comparison with non-neoplastic brain. We showed that Dock7 mediates serum- and HGF-induced glioblastoma cell invasion. We also showed that Dock7 co-immunoprecipitates with c-Met and that this interaction is enhanced upon HGF stimulation in a manner that is dependent on the adaptor protein Gab1. Dock7 and Gab1 also co-immunoprecipitate in an HGF-dependent manner. Furthermore, Gab1 is required for HGF-induced Dock7 and Rac1 activation and glioblastoma cell invasion. Conclusions: Dock7 mediates HGF-induced GBM invasion. Targeting Dock7 in GBM may inhibit c-MET-mediated invasion in tumours treated with anti-angiogenic regimens. PMID:24518591

  2. Insights into the biological functions of Dock family guanine nucleotide exchange factors.


    Laurin, Mélanie; Côté, Jean-François


    Rho GTPases play key regulatory roles in many aspects of embryonic development, regulating processes such as differentiation, proliferation, morphogenesis, and migration. Two families of guanine nucleotide exchange factors (GEFs) found in metazoans, Dbl and Dock, are responsible for the spatiotemporal activation of Rac and Cdc42 proteins and their downstream signaling pathways. This review focuses on the emerging roles of the mammalian DOCK family in development and disease. We also discuss, when possible, how recent discoveries concerning the biological functions of these GEFs might be exploited for the development of novel therapeutic strategies.

  3. Insights into the biological functions of Dock family guanine nucleotide exchange factors

    PubMed Central

    Laurin, Mélanie; Côté, Jean-François


    Rho GTPases play key regulatory roles in many aspects of embryonic development, regulating processes such as differentiation, proliferation, morphogenesis, and migration. Two families of guanine nucleotide exchange factors (GEFs) found in metazoans, Dbl and Dock, are responsible for the spatiotemporal activation of Rac and Cdc42 proteins and their downstream signaling pathways. This review focuses on the emerging roles of the mammalian DOCK family in development and disease. We also discuss, when possible, how recent discoveries concerning the biological functions of these GEFs might be exploited for the development of novel therapeutic strategies. PMID:24637113

  4. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad


    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  5. The guanine nucleotide exchange factor Tiam1: a Janus-faced molecule in cellular signaling.


    Boissier, P; Huynh-Do, U


    The Rho family of GTPases consists of several small proteins that have been described as molecular switches, playing important roles in a wide variety of fundamental cellular processes and in human diseases such as cancer. These proteins, active in the GTP conformation and inactive in the GDP form, are in turn regulated by guanine nucleotide exchange factors (GEFs), guanine nucleotide activating proteins (GAPs) and guanine dissociation inhibitors (GDIs). Two decades ago, Tiam1 (T-lymphoma invasion and metastasis) was identified as a GEF specific for Rac1 activation, but also for Cdc42 and in a lesser extent RhoA. Acting principally upstream of Rac1, Tiam1 is mainly involved in the regulation of Rac1 mediated signaling pathways including cytoskeletal activities, cell polarity, endocytosis and membrane trafficking, cell migration, adhesion and invasion, cell growth and survival, metastasis and carcinogenesis. However, given the large number of protein interaction domains found in its structure, it is possible that Tiam1 affects cellular processes in another way than through its GEF activity by interactions with other signaling proteins. Due to its functional diversity, Tiam1 is involved in multiple steps of tumorigenesis. As its name suggests, Tiam1 has been shown to increase T-cell lymphoma invasion and metastasis. It also promotes migration of fibroblasts, neuronal and cancer cells. On the contrary, Tiam1-induced cell adhesion has also been described, as opposed to cell migration. Moreover, studies indicate that Tiam1 is involved in both anti-apoptotic and pro-apoptotic mechanisms. While increasing evidence has demonstrated Tiam1's contribution to tumorigenesis and metastasis, others suggest that Tiam1 could have anti-cancer properties. In the present review, we discuss the current knowledge about the controversial roles of Tiam1 in cellular signaling. In particular, we will focus on Tiam1's regulation, its biological functions and implication in cancer. Copyright

  6. Cytosolic Na+ controls and epithelial Na+ channel via the Go guanine nucleotide-binding regulatory protein.

    PubMed Central

    Komwatana, P; Dinudom, A; Young, J A; Cook, D I


    In tight Na+-absorbing epithelial cells, the fate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-beta-S, pertussis toxin, and antibodies against the alpha-subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-. Images Fig. 4 PMID:8755611

  7. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    SciTech Connect

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. )


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  8. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.


    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  9. Human Rho Guanine Nucleotide Exchange Factor 11 (ARHGEF11) Regulates Dendritic Morphogenesis

    PubMed Central

    Mizuki, Yutaka; Takaki, Manabu; Sakamoto, Shinji; Okamoto, Sojiro; Kishimoto, Makiko; Okahisa, Yuko; Itoh, Masahiko; Yamada, Norihito


    Disturbances of synaptic connectivity during perinatal and adolescent periods have been hypothesized to be related to the pathophysiology of schizophrenia. Rho guanine nucleotide exchange factor 11 (ARHGEF11) is a specific guanine nucleotide exchange factors (GEF) for RhoA, which is a critical regulator of actin cytoskeleton dynamics and organization of dendritic spines and inhibitor of spine maintenance. ARHGEF11 variants are reported to be associated with a higher risk for the onset of schizophrenia in a Japanese population; however, how ARHGEF11 contributes to the pathogenesis of schizophrenia in dendritic spines is unknown. Therefore, we first studied the distribution, binding, and function of ARHGEF11 in the dendritic spines of the rat cerebral cortex. After subcellular fractionation of the rat cerebral cortex, ARHGEF11 was detected with synaptophysin and post-synaptic density protein 95 (PSD-95) in the P2 fractions including synaptosomal fractions containing presynaptic and postsynaptic density proteins. Endogenous ARHGEF11 was coimmunoprecipitated with synaptophysin or PSD-95. In cortical primary neurons at 28 days in vitro, immunostaining revealed that ARHGEF11 located in the dendrites and dendritic spines and colocalized with PSD-95 and synaptophysin. Overexpression of exogenous ARHGEF11 significantly decreased the number of spines (p = 0.008). These results indicate that ARHGEF11 is likely to be associated with synaptic membranes and regulation of spine. PMID:28036092

  10. Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy?


    Lazer, Galit; Katzav, Shulamit


    Rho guanosine triphosphatases (GTPases) are a family of small proteins which function as molecular switches in a variety of signaling pathways following stimulation of cell surface receptors. RhoGTPases regulate numerous cellular processes including cytoskeleton organization, gene transcription, cell proliferation, migration, growth and cell survival. Because of their central role in regulating processes that are dysregulated in cancer, it seems reasonable that defects in the RhoGTPase pathway may be involved in the development of cancer. RhoGTPase activity is regulated by a number of protein families: guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs) and guanine nucleotide-dissociation inhibitors (GDIs). This review discusses the participation of RhoGTPases and their regulators, especially GEFs in human cancers. In particular, we focus on the involvement of the RhoGTPase GEF, Vav1, a hematopoietic specific signal transducer which is involved in human neuroblastoma, pancreatic ductal carcinoma and lung cancer. Finally, we summarize recent advances in the design and application of a number of molecules that specifically target individual RhoGTPases or their regulators or effectors, and discuss their potential for cancer therapy.

  11. Recognition and activation of Rho GTPases by Vav1 and Vav2 guanine nucleotide exchange factors.


    Heo, Jongyun; Thapar, Roopa; Campbell, Sharon L


    Vav proteins are Rho GTPase-specific guanine nucleotide exchange factors (GEFs) that are distinguished by the tandem arrangement of Dbl homology (DH), Pleckstrin homology (PH), and cysteine rich domains (CRD). Whereas the tandem DH-PH arrangement is conserved among Rho GEFs, the presence of the CRD is unique to Vav family members and is required for efficient nucleotide exchange. We provide evidence that Vav2-mediated nucleotide exchange of Rho GTPases follows the Theorell-Chance mechanism in which the Vav2.Rho GTPase complex is the major species during the exchange process and the Vav2.GDP-Mg(2+).Rho GTPase ternary complex is present only transiently. The GTPase specificity for the DH-PH-CRD Vav2 in vitro follows this order: Rac1 > Cdc42 > RhoA. Results obtained from fluorescence anisotropy and NMR chemical shift mapping experiments indicate that the isolated Vav1 CRD is capable of directly associating with Rac1, and residues K116 and S83 that are in the proximity of the P-loop and the guanine base either are part of this binding interface or undergo a conformational change in response to CRD binding. The NMR studies are supported by kinetic measurements on Rac1 mutants S83A, K116A, and K116Q and Vav2 CRD mutant K533A in that these mutants affect both the initial binding event of Vav2 with Rac1 (k(on)) and the rate-limiting dissociation of Vav2 from the Vav2.Rac1 binary complex (thereby influencing the enzyme turnover number, k(cat)). The results suggest that the CRD domain in Vav proteins plays an active role, affecting both the k(on) and the k(cat) for Vav-mediated nucleotide exchange on Rho GTPases.

  12. Guanine-centric self-assembly of nucleotides in water: an important consideration in prebiotic chemistry.


    Cassidy, Lauren M; Burcar, Bradley T; Stevens, Wyatt; Moriarty, Elizabeth M; McGown, Linda B


    Investigations of plausible prebiotic chemistry on early Earth must consider not only chemical reactions to form more complex products such as proto-biopolymers but also reversible, molecular self-assembly that would influence the availability, organization, and sequestration of reactant molecules. The self-assembly of guanosine compounds into higher-order structures and lyotropic liquid crystalline "gel" phases through formation of hydrogen-bonded guanine tetrads (G-tetrads) is one such consideration that is particularly relevant to an RNA-world scenario. G-tetrad-based gelation has been well studied for individual guanosine compounds and was recently observed in mixtures of guanosine with 5'-guanosine monophosphate (GMP) as well. The present work investigates the self-assembly of GMP in the presence of the other RNA nucleotides. Effects of the total concentration and relative proportion of the nucleotides in the mixtures, the form (disodium salt vs. free acid) of the nucleotides, temperature, pH, and salt concentration were determined by visual observations and circular dichroism (CD) spectroscopy. The results show that formation of cholesteric G-tetrad phases is influenced by interactions with other nucleotides, likely through association (e.g., intercalation) of the nucleotides with the G-tetrad structures. These interactions affect the structure and stability of the G-tetrad gel phase, as well as the formation of alternate self-assembled GMP structures such as a continuous, hydrogen-bonded GMP helix or dimers and aggregates of GMP. These interactions and multiple equilibria are influenced by the presence of cations, especially in the presence of K(+). This work could have important implications for the emergence of an RNA or proto-RNA world, which would require mixtures of nucleotides at sufficiently high, local concentrations for abiotic polymerization to occur.

  13. Base and Nucleotide Excision Repair of Oxidatively Generated Guanine Lesions in DNA.


    Shafirovich, Vladimir; Kropachev, Konstantin; Anderson, Thomas; Liu, Zhi; Kolbanovskiy, Marina; Martin, Brooke D; Sugden, Kent; Shim, Yoonjung; Chen, Xuejing; Min, Jung-Hyun; Geacintov, Nicholas E


    The well known biomarker of oxidative stress, 8-oxo-7,8-dihydroguanine, is more susceptible to further oxidation than the parent guanine base and can be oxidatively transformed to the genotoxic spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) lesions. Incubation of 135-mer duplexes with single Sp or Gh lesions in human cell extracts yields a characteristic nucleotide excision repair (NER)-induced ladder of short dual incision oligonucleotide fragments in addition to base excision repair (BER) incision products. The ladders were not observed when NER was inhibited either by mouse monoclonal antibody (5F12) to human XPA or in XPC(-/-) fibroblast cell extracts. However, normal NER activity appeared when the XPC(-/-) cell extracts were complemented with XPC-RAD23B proteins. The Sp and Gh lesions are excellent substrates of both BER and NER. In contrast, 5-guanidino-4-nitroimidazole, a product of the oxidation of guanine in DNA by peroxynitrite, is an excellent substrate of BER only. In the case of mouse embryonic fibroblasts, BER of the Sp lesion is strongly reduced in NEIL1(-/-) relative to NEIL1(+/+) extracts. In summary, in human cell extracts, BER and NER activities co-exist and excise Gh and Sp DNA lesions, suggesting that the relative NER/BER product ratios may depend on competitive BER and NER protein binding to these lesions.

  14. Zizimin and Dock guanine nucleotide exchange factors in cell function and disease

    PubMed Central

    Pakes, Nicholl K.; Veltman, Douwe M.; Williams, Robin S.B.


    Zizimin proteins belong to the Dock (Dedicator of Cytokinesis) superfamily of Guanine nucleotide Exchange Factor (GEF) proteins. This family of proteins plays a role in the regulation of Rho family small GTPases. Together the Rho family of small GTPases and the Dock/Zizimin proteins play a vital role in a number of cell processes including cell migration, apoptosis, cell division and cell adhesion. Our recent studies of Zizimin proteins, using a simple biomedical model, the eukaryotic social amoeba Dictyostelium discoideum, have helped to elucidate the cellular role of these proteins. In this article, we discuss the domain structure of Zizimin proteins from an evolutionary viewpoint. We also compare what is currently known about the mammalian Zizimin proteins to that of related Dock proteins. Understanding the cellular functions of these proteins will provide a better insight into their role in cell signaling, and may help in treating disease pathology associated with mutations in Dock/Zizimin proteins. PMID:23247359

  15. Zizimin and Dock guanine nucleotide exchange factors in cell function and disease.


    Pakes, Nicholl K; Veltman, Douwe M; Williams, Robin S B


    Zizimin proteins belong to the Dock (Dedicator of Cytokinesis) superfamily of Guanine nucleotide Exchange Factor (GEF) proteins. This family of proteins plays a role in the regulation of Rho family small GTPases. Together the Rho family of small GTPases and the Dock/Zizimin proteins play a vital role in a number of cell processes including cell migration, apoptosis, cell division and cell adhesion. Our recent studies of Zizimin proteins, using a simple biomedical model, the eukaryotic social amoeba Dictyostelium discoideum, have helped to elucidate the cellular role of these proteins. In this article, we discuss the domain structure of Zizimin proteins from an evolutionary viewpoint. We also compare what is currently known about the mammalian Zizimin proteins to that of related Dock proteins. Understanding the cellular functions of these proteins will provide a better insight into their role in cell signaling, and may help in treating disease pathology associated with mutations in Dock/Zizimin proteins.

  16. Molecular evolution of the Rab-escort-protein/guanine-nucleotide-dissociation-inhibitor superfamily.


    Alory, Christelle; Balch, William E


    Prenylation of Rab GTPases regulating vesicle traffic by Rab geranylgeranyltransferase (RabGGTase) requires a complex formed by the association of newly synthesized Rab proteins with Rab-escort-protein (REP), the choroideremia-gene-product that is mutated in disease, leading to loss of vision. After delivery to the membrane by the REP-Rab complex, subsequent recycling to the cytosol requires the REP-related guanine-nucleotide-dissociation-inhibitor (GDI). Although REP and GDI share common Rab-binding properties, GDI cannot assist in Rab prenylation and REP cannot retrieve Rab proteins from the membranes. We have now isolated REP mutant proteins that are able to partially function as both REP and GDI. These results provide molecular insight into the functional and evolutionary organization of the REP/GDI superfamily.

  17. Molecular Evolution of the Rab-Escort-Protein/Guanine-Nucleotide-Dissociation-Inhibitor Superfamily

    PubMed Central

    Alory, Christelle; Balch, William E.


    Prenylation of Rab GTPases regulating vesicle traffic by Rab geranylgeranyltransferase (RabGGTase) requires a complex formed by the association of newly synthesized Rab proteins with Rab-escort-protein (REP), the choroideremia-gene-product that is mutated in disease, leading to loss of vision. After delivery to the membrane by the REP–Rab complex, subsequent recycling to the cytosol requires the REP-related guanine-nucleotide-dissociation-inhibitor (GDI). Although REP and GDI share common Rab-binding properties, GDI cannot assist in Rab prenylation and REP cannot retrieve Rab proteins from the membranes. We have now isolated REP mutant proteins that are able to partially function as both REP and GDI. These results provide molecular insight into the functional and evolutionary organization of the REP/GDI superfamily. PMID:12972569

  18. Synaptic functions of the IQSEC family of ADP-ribosylation factor guanine nucleotide exchange factors.


    Um, Ji Won


    Postsynaptic scaffolding proteins interact with numerous synaptic proteins to ensure the organization and specialization of functional excitatory and inhibitory synapses. IQSECs (IQ motif and SEC7 domain-containing proteins) are a class of ADP ribosylation factor-guanine nucleotide exchange factors (ARF-GEFs), whose functions are beginning to be understood as both scaffolding and signaling proteins. Specifically, IQSEC1 binds to PSD-95, and IQSEC2 functions as a regulator of AMPA receptor trafficking at excitatory synapses, whereas IQSEC3 interacts with gephyrin to promote inhibitory synapse development. Here, I review the currently known findings on IQSECs and discuss the possible relations between dysfunctions of IQSECs and the pathophysiology of brain disorders. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

  19. Guanine nucleotide binding properties of the mammalian RalA protein produced in Escherichia coli.


    Frech, M; Schlichting, I; Wittinghofer, A; Chardin, P


    The simian ralA cDNA was inserted in a ptac expression vector, and high amounts of soluble ral protein were expressed in Escherichia coli. The purified p24ral contains 1 mol of bound nucleotide/mol of protein that can be exchanged against external nucleotide. The ral protein exchanges GDP with a t 1/2 of 90 min at 37 degrees C in the presence of Mg2+, and has a low GTPase activity (0.07 min-1 at 37 degrees C). We have also studied its affinity for various guanine nucleotides and analogs. NMR measurements show that the three-dimensional environment around the nucleotide is similar in p21ras and p24ral. In addition to these studies on the wild-type ral protein, we used in vitro mutagenesis to introduce substitutions corresponding to the Val12, Val12 + Thr59, and Leu61 substitutions of p21ras. These mutant ral proteins display altered nucleotide exchange kinetics and GTPase activities, however, the effects of the substitutions are less pronounced than in the ras proteins. p24ralVal12 + Thr59 autophosphorylates on the substituted Thr, as a side reaction of the GTP hydrolysis, but the rate is much lower than those of the Thr59 mutants of p21ras. These results show that ras and ral proteins have similar structures and biochemical properties. Significant differences are found, however, in the contribution of the Mg2+ ion to GDP binding, in the rate of the GTPase reaction and in the sensitivity of these two proteins to substitutions around the phosphate-binding site, suggesting that the various "small G-proteins" of the ras family perform different functions.

  20. Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

    SciTech Connect

    Senogles, S.E.; Caron, M.G.


    The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 NPA. /sup 35/S-GTP..gamma..S binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.

  1. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.


    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  2. Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix.


    Feng, Qiyu; Baird, Daniel; Cerione, Richard A


    The Cool-2 (cloned-out of library-2) protein (identical to alpha-Pix for Pak-interactive exchange factor) has been implicated in various biological responses including chemoattractant signaling and in certain forms of mental retardation. We show that when Cool-2 exists as a dimer, it functions as a Rac-specific guanine nucleotide exchange factor (GEF). Dimerization of Cool-2 enables its Dbl (diffuse B-cell lymphoma) and pleckstrin homology domains to work together (in trans) to bind specifically to Rac-GDP. Dissociation of dimeric Cool-2 into its monomeric form allows it to act as a GEF for Cdc42 as well as for Rac. The binding of either PAK (p21-activated kinase) or Cbl (Casitas B-lymphoma) to the SH3 domain of monomeric Cool-2 is necessary for the functional interactions between GDP-bound Cdc42 or Rac and the Cool-2 monomer. The betagamma subunit complex of large GTP-binding proteins, by interacting with PAK, stimulates the dissociation of the Cool-2 dimer and activates its GEF activity for Cdc42. Overall, these findings highlight novel mechanisms by which extracellular signals can direct the specific activation of Rac versus Cdc42 by Cool-2/alpha-Pix.

  3. The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis

    PubMed Central

    Kroon, Jeffrey; Welch, Christopher; Bakker, Erik N.; Matlung, Hanke L.; van den Berg, Timo K.; Sharek, Lisa; Doerschuk, Claire; Hahn, Klaus; Burridge, Keith


    The passage of leukocytes across the endothelium and into arterial walls is a critical step in the development of atherosclerosis. Previously, we showed in vitro that the RhoG guanine nucleotide exchange factor SGEF (Arhgef26) contributes to the formation of ICAM-1-induced endothelial docking structures that facilitate leukocyte transendothelial migration. To further explore the in vivo role of this protein during inflammation, we generated SGEF-deficient mice. When crossed with ApoE null mice and fed a Western diet, mice lacking SGEF showed a significant decrease in the formation of atherosclerosis in multiple aortic areas. A fluorescent biosensor revealed local activation of RhoG around bead-clustered ICAM-1 in mouse aortic endothelial cells. Notably, this activation was decreased in cells from SGEF-deficient aortas compared to wild type. In addition, scanning electron microscopy of intimal surfaces of SGEF−/− mouse aortas revealed reduced docking structures around beads that were coated with ICAM-1 antibody. Similarly, under conditions of flow, these beads adhered less stably to the luminal surface of carotid arteries from SGEF−/− mice. Taken together, these results show for the first time that a Rho-GEF, namely SGEF, contributes to the formation of atherosclerosis by promoting endothelial docking structures and thereby retention of leukocytes at athero-prone sites of inflammation experiencing high shear flow. SGEF may therefore provide a novel therapeutic target for inhibiting the development of atherosclerosis. PMID:23372835

  4. How not to do kinetics: examples involving GTPases and guanine nucleotide exchange factors.


    Goody, Roger S


    Guanine nucleotide exchange factors (GEFs) are crucial regulators of the action of GTPases in signal transduction and cellular regulation. Although their basic mechanism of action has been apparent for almost 20 years, there are still misconceptions concerning their properties, and these are confounded by superficial or incorrect interpretation of experimental results in individual cases. Here, an example is described in which an incorrect mechanism was derived because of an inadequate analysis of kinetic results. In a second example, a case is discussed where certain GTP analogs were erroneously described as being able to function as low molecular mass GEFs. In both cases, a lack of distinction between rates, rate constants, and apparent rate constants, together with a disregard of relative signal amplitudes, led to the misinterpretations. In a final example, it is shown how the lack of an appropriate kinetic investigation led to the false conclusion that a secreted protein from Legionella pneumophila can act not only as a GEF towards eukaryotic Rab1 but also as a factor that is able to actively dissociate the stable complex between Rab1 and GDP dissociation inhibitor.

  5. Diverse roles of guanine nucleotide exchange factors in regulating collective cell migration.


    Zaritsky, Assaf; Tseng, Yun-Yu; Rabadán, M Angeles; Krishna, Shefali; Overholtzer, Michael; Danuser, Gaudenz; Hall, Alan


    Efficient collective migration depends on a balance between contractility and cytoskeletal rearrangements, adhesion, and mechanical cell-cell communication, all controlled by GTPases of the RHO family. By comprehensive screening of guanine nucleotide exchange factors (GEFs) in human bronchial epithelial cell monolayers, we identified GEFs that are required for collective migration at large, such as SOS1 and β-PIX, and RHOA GEFs that are implicated in intercellular communication. Down-regulation of the latter GEFs differentially enhanced front-to-back propagation of guidance cues through the monolayer and was mirrored by down-regulation of RHOA expression and myosin II activity. Phenotype-based clustering of knockdown behaviors identified RHOA-ARHGEF18 and ARHGEF3-ARHGEF28-ARHGEF11 clusters, indicating that the latter may signal through other RHO-family GTPases. Indeed, knockdown of RHOC produced an intermediate between the two phenotypes. We conclude that for effective collective migration, the RHOA-GEFs → RHOA/C → actomyosin pathways must be optimally tuned to compromise between generation of motility forces and restriction of intercellular communication. © 2017 Zaritsky et al.

  6. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy


    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  7. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.


    Côté, Jean-François; Vuori, Kristiina


    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  8. Guanine and inosine nucleotides, nucleosides and oxypurines in snail muscles as potential biomarkers of fluoride toxicity.


    Rać, Monika E; Safranow, Krzysztof; Dołegowska, Barbara; Machoy, Zygmunt


    The aim of the present study was to determine the toxicity of fluorides on energy metabolism in muscles of the Helix aspersa maxima snail. Qualitative and quantitative analysis of purine compounds was performed in slices of foot from mature snails with high-performance liquid chromatography. Fluoride concentrations were measured using an ion-selective electrode and gas chromatography. The results show that exposure to fluoride pollution was accompanied by a statistically significant increase in fluoride concentrations in soft tissues. This effect was already noticeable with the smallest fluoride dose. Accumulation was greatest in the shell. There is a significant and positive correlation between fluoride concentrations in foot muscles and guanine and inosine nucleotides or uridine content. The content of low-energy guanylate, inosylate and oxypurine in foot muscles significantly increased with rising dose of fluoride. The difference as compared with controls was significant only for the highest dose of fluoride. Interestingly, uric acid, the final product of purine catabolism, dominated quantitatively in the foot muscles of snails. In conclusion, increased low-energy guanylate and inosylate as well as decreased xanthine concentrations in snail muscle can be indicators of the toxic influence of fluoride on the organism. The measuring of fluoride accumulation in the shell is the most suitable bioindicator of fluoride pollution in the environment.

  9. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.


    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen


    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  10. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma

    PubMed Central

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai


    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery. PMID:27462139

  11. Influence of gamma subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes.

    PubMed Central

    Muntz, K H; Sternweis, P C; Gilman, A G; Mumby, S M


    Two approaches were taken to address the possible role of gamma-subunit prenylation in dictating the cellular distribution of guanine nucleotide-binding regulatory proteins. Prenylation of gamma subunits was prevented by site-directed mutagenesis or by inhibiting the synthesis of mevalonate, the precursor of cellular isoprenoids. When beta or gamma subunits were transiently expressed in COS-M6 simian kidney cells (COS) cells, the proteins were found in the membrane fraction by immunoblotting. Immunofluorescence experiments indicated that the proteins were distributed to intracellular structures in addition to plasma membranes. Replacement of Cys68 of gamma with Ser prevented prenylation of the mutant protein and association of the protein with the membrane fraction of COS cells. Immunoblotting results demonstrated that some of the beta subunits were found in the cytoplasm when coexpressed with the nonprenylated mutant gamma subunit. When Neuro 2A cells were treated with compactin to inhibit protein prenylation, a fraction of endogenous beta and gamma was distributed in the cytoplasm. It is concluded that prenylation facilitates association of gamma subunits with membranes, that the cellular location of gamma influences the distribution of beta, and that prenylation is not an absolute requirement for interaction of beta and gamma. Images PMID:1550955

  12. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.


    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo


    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  13. A Homogenous Bioluminescent System for Measuring GTPase, GTPase Activating Protein, and Guanine Nucleotide Exchange Factor Activities

    PubMed Central

    Mondal, Subhanjan; Hsiao, Kevin


    Abstract GTPases play a major role in various cellular functions such as cell signaling, cell proliferation, cell differentiation, cytoskeleton modulation, and cell motility. Deregulation or mutation of these proteins has considerable consequences resulting in multiple pathological conditions. Targeting GTPases and its regulators has been challenging due to paucity of convenient assays. In this study, we describe a homogenous bioluminescent assay for monitoring the activities of GTPase and its immediate regulators: GTPase activating proteins (GAPs) and guanine nucleotide exchange factors (GEFs). Since Mg2+ plays a critical role in influencing the affinity of GTPases with guanosine triphosphate/guanosine diphosphate (GTP/GDP) and the process of nucleotide exchange, manipulating Mg2+ concentrations in the GTPase reaction buffer allows continuous progression of the GTPase cycle and faster hydrolysis of GTP. The assay relies on enzymatic conversion of GTP that remains after the GTPase reaction to ATP and detection of the generated ATP using the luciferin/luciferase combination. The GTPase/GAP/GEF-Glo assay system enables monitoring of GTPase, GAP-stimulated GTPase, GAP, and GEF activities. The system can also be used to analyze these proteins when expressed in cells as fusion proteins by performing the assay in a pulldown format. The assays showed minimal false hits upon testing for compound interference using the library of pharmacologically active compounds and its robustness was demonstrated by a high Z′-factor of 0.93 and CV of 2.2%. The assay system has a high dynamic range, formatted in a convenient add–mix–read, and applicable to high-throughput screening. PMID:26167953

  14. Molecular mechanism of the effects of guanine nucleotide and sulfhydryl reagent on muscarinic receptors in smooth muscles studied by radiation inactivation

    SciTech Connect

    Uchida, S.; Matsumoto, K.; Takeyasu, K.; Higuchi, H.; Yoshida, H.


    The molecular sizes of the units concerned in 3-quinuclidinyl benzilate (QNB) binding and in the effects of guanine nucleotide and sulfhydryl reagent on the inhibition of QNB binding by carbachol in smooth muscle of guinea pig ileum were determined to be 76,000, 179,000 and 107,000, respectively by the radiation inactivation method. One or more subunits (GTP subunit) other than the receptor subunit in a muscarinic receptor appeared to be involved in the effect of guanine nucleotide. When guanine nucleotide was present, the receptor subunit seemed to be dissociated from the GTP subunit.

  15. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )


    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  16. Lpg0393 of Legionella pneumophila is a guanine-nucleotide exchange factor for Rab5, Rab21 and Rab22.


    Sohn, Young-Sik; Shin, Ho-Chul; Park, Wei Sun; Ge, Jianning; Kim, Chan-Hee; Lee, Bok Luel; Heo, Won Do; Jung, Jae U; Rigden, Daniel John; Oh, Byung-Ha


    Legionella pneumophila, a human intracellular pathogen, encodes about 290 effector proteins that are translocated into host cells through a secretion machinery. Some of these proteins have been shown to manipulate or subvert cellular processes during infection, but functional roles of a majority of them remain unknown. Lpg0393 is a newly identified Legionella effector classified as a hypothetical protein. Through X-ray crystallographic analysis, we show that Lpg0393 contains a Vps9-like domain, which is structurally most similar to the catalytic core of human Rabex-5 that activates the endosomal Rab proteins Rab5, Rab21 and Rab22. Consistently, Lpg0393 exhibited a guanine-nucleotide exchange factor activity toward the endosomal Rabs. This work identifies the first example of a bacterial guanine-nucleotide exchange factor that is active towards the Rab5 sub-cluster members, implying that the activation of these Rab proteins might be advantageous for the intracellular survival of Legionella.

  17. Genetic interactions in yeast between Ypt GTPases and Arf guanine nucleotide exchangers.

    PubMed Central

    Jones, S; Jedd, G; Kahn, R A; Franzusoff, A; Bartolini, F; Segev, N


    Two families of GTPases, Arfs and Ypt/rabs, are key regulators of vesicular transport. While Arf proteins are implicated in vesicle budding from the donor compartment, Ypt/rab proteins are involved in the targeting of vesicles to the acceptor compartment. Recently, we have shown a role for Ypt31/32p in exit from the yeast trans-Golgi, suggesting a possible function for Ypt/rab proteins in vesicle budding as well. Here we report the identification of a new member of the Sec7-domain family, SYT1, as a high-copy suppressor of a ypt31/32 mutation. Several proteins that belong to the Sec7-domain family, including the yeast Gea1p, have recently been shown to stimulate nucleotide exchange by Arf GTPases. Nucleotide exchange by Arf GTPases, the switch from the GDP- to the GTP-bound form, is thought to be crucial for their function. Sec7p itself has an important role in the yeast secretory pathway. However, its mechanism of action is not yet understood. We show that all members of the Sec7-domain family exhibit distinct genetic interactions with the YPT genes. Biochemical assays demonstrate that, although the homology between the members of the Sec7-domain family is relatively low (20-35%) and limited to a small domain, they all can act as guanine nucleotide exchange factors (GEFs) for Arf proteins, but not for Ypt GTPases. The Sec7-domain of Sec7p is sufficient for this activity. Interestingly, the Sec7 domain activity is inhibited by brefeldin A (BFA), a fungal metabolite that inhibits some of the Arf-GEFs, indicating that this domain is a target for BFA. These results demonstrate that the ability to act as Arf-GEFs is a general property of all Sec7-domain proteins in yeast. The genetic interactions observed between Arf GEFs and Ypt GTPases suggest the existence of a Ypt-Arf GTPase cascade in the secretory pathway. PMID:10430582

  18. Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.


    Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R


    Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented.

  19. ARF-GEP100, a guanine nucleotide-exchange protein for ADP-ribosylation factor 6

    PubMed Central

    Someya, Akimasa; Sata, Makoto; Takeda, Kazuyo; Pacheco-Rodriguez, Gustavo; Ferrans, Victor J.; Moss, Joel; Vaughan, Martha


    A human cDNA encoding an 841-aa guanine nucleotide-exchange protein (GEP) for ADP-ribosylation factors (ARFs), named ARF-GEP100, which contains a Sec7 domain, a pleckstrin homology (PH)-like domain, and an incomplete IQ-motif, was identified. On Northern blot analysis of human tissues, a ≈8-kb mRNA that hybridized with an ARF-GEP100 cDNA was abundant in peripheral blood leukocytes, brain, and spleen. ARF-GEP100 accelerated [35S]GTPγS binding to ARF1 (class I) and ARF5 (class II) 2- to 3-fold, and to ARF6 (class III) ca. 12-fold. The ARF-GEP100 Sec7 domain contains Asp543 and Met555, corresponding to residues associated with sensitivity to the inhibitory effect of the fungal metabolite brefeldin A (BFA) in yeast Sec7, but also Phe535 and Ala536, associated with BFA-insensitivity. The PH-like domain differs greatly from those of other ARF GEPs in regions involved in phospholipid binding. Consistent with its structure, ARF-GEP100 activity was not affected by BFA or phospholipids. After subcellular fractionation of cultured T98G human glioblastoma cells, ARF6 was almost entirely in the crude membrane fraction, whereas ARF-GEP100, a 100-kDa protein detected with antipeptide antibodies, was cytosolic. On immunofluorescence microscopy, both proteins had a punctate pattern of distribution throughout the cells, with apparent colocalization only in peripheral areas. The coarse punctate distribution of EEA-1 in regions nearer the nucleus appeared to coincide with that of ARF-GEP100 in those areas. No similar coincidence of ARF-GEP100 with AP-1, AP-2, catenin, LAMP-1, or 58K was observed. The new human BFA-insensitive GEP may function with ARF6 in specific endocytic processes. PMID:11226253

  20. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    SciTech Connect

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M. )


    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increased the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.

  1. The atypical Guanine-nucleotide exchange factor, dock7, negatively regulates schwann cell differentiation and myelination.


    Yamauchi, Junji; Miyamoto, Yuki; Hamasaki, Hajime; Sanbe, Atsushi; Kusakawa, Shinji; Nakamura, Akane; Tsumura, Hideki; Maeda, Masahiro; Nemoto, Noriko; Kawahara, Katsumasa; Torii, Tomohiro; Tanoue, Akito


    In development of the peripheral nervous system, Schwann cells proliferate, migrate, and ultimately differentiate to form myelin sheath. In all of the myelination stages, Schwann cells continuously undergo morphological changes; however, little is known about their underlying molecular mechanisms. We previously cloned the dock7 gene encoding the atypical Rho family guanine-nucleotide exchange factor (GEF) and reported the positive role of Dock7, the target Rho GTPases Rac/Cdc42, and the downstream c-Jun N-terminal kinase in Schwann cell migration (Yamauchi et al., 2008). We investigated the role of Dock7 in Schwann cell differentiation and myelination. Knockdown of Dock7 by the specific small interfering (si)RNA in primary Schwann cells promotes dibutyryl cAMP-induced morphological differentiation, indicating the negative role of Dock7 in Schwann cell differentiation. It also results in a shorter duration of activation of Rac/Cdc42 and JNK, which is the negative regulator of myelination, and the earlier activation of Rho and Rho-kinase, which is the positive regulator of myelination. To obtain the in vivo evidence, we generated Dock7 short hairpin (sh)RNA transgenic mice. They exhibited a decreased expression of Dock7 in the sciatic nerves and enhanced myelin thickness, consistent with in vitro observation. The effects of the in vivo knockdown on the signals to Rho GTPases are similar to those of the in vitro knockdown. Collectively, the signaling through Dock7 negatively regulates Schwann cell differentiation and the onset of myelination, demonstrating the unexpected role of Dock7 in the interplay between Schwann cell migration and myelination.

  2. Guanine nucleotide induced conformational change of Cdc42 revealed by hydrogen/deuterium exchange mass spectrometry.


    Yang, Sheng-Wei; Ting, Hsiu-Chi; Lo, Yi-Ting; Wu, Ting-Yuan; Huang, Hung-Wei; Yang, Chia-Jung; Chan, Jui-Fen Riva; Chuang, Min-Chieh; Hsu, Yuan-Hao Howard


    Cdc42 regulates pathways related to cell division. Dysregulation of Cdc42 can lead to cancer, cardiovascular diseases and neurodegenerative diseases. GTP induced activation mechanism plays an important role in the activity and biological functions of Cdc42. P-loop, Switch I and Switch II are critical regions modulating the enzymatic activity of Cdc42. We applied amide hydrogen/deuterium exchange coupled with liquid chromatography mass spectrometry (HDXMS) to investigate the dynamic changes of apo-Cdc42 after GDP, GTP and GMP-PCP binding. The natural substrate GTP induced significant decreases of deuteration in P-loop and Switch II, moderate changes of deuteration in Switch I and significant changes of deuteration in the α7 helix, a region far away from the active site. GTP binding induced similar effects on H/D exchange to its non-hydrolysable analog, GMP-PCP. HDXMS results indicate that GTP binding blocked the solvent accessibility in the active site leading to the decrease of H/D exchange rate surrounding the active site, and further triggered a conformational change resulting in the drastic decrease of H/D exchange rate at the remote α7 helix. Comparing the deuteration levels in three activation states of apo-Cdc42, Cdc42-GDP and Cdc42-GMP-PCP, the apo-Cdc42 has the most flexible structure, which can be stabilized by guanine nucleotide binding. The rates of H/D exchange of Cdc42-GDP are between the GMP-PCP-bound and the apo form, but more closely to the GMP-PCP-bound form. Our results show that the activation of Cdc42 is a process of conformational changes involved with P-loop, Switch II and α7 helix for structural stabilization.

  3. Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein.

    PubMed Central

    Gulbins, E; Coggeshall, K M; Langlet, C; Baier, G; Bonnefoy-Berard, N; Burn, P; Wittinghofer, A; Katzav, S; Altman, A


    We recently identified Vav, the product of the vav proto-oncogene, as a guanine nucleotide exchange factor (GEF) for Ras. Vav is enzymatically activated by lymphocyte antigen receptor-coupled protein tyrosine kinases or independently by diglycerides. To further evaluate the physiological role of Vav, we assessed its GDP-GTP exchange activity against several Ras-related proteins in vitro and determined whether Vav activation in transfected NIH 3T3 fibroblasts correlates with the activity status of Ras and mitogen-activated protein (MAP) kinases. In vitro translated purified Vav activated by phorbol myristate acetate (PMA) or phosphorylation with recombinant p56lck displayed GEF activity against Ras but not against recombinant RacI, RacII, Ral, or RhoA proteins. Expression of vav or proto-vav in stably transfected NIH 3T3 cells led to a approximately 10-fold increase in basal or PMA-stimulated Ras exchange activity, respectively, in total-cell lysates and Vav immunoprecipitates. Elevated GEF activity was paralleled in each case by a significant increase in the proportion of active, GTP-bound Ras. PMA had a minimal effect on the low Ras. GTP level in untransfected control fibroblasts but increased it from 20 to 37% in proto-vav-transfected cells. vav-transfected cells displayed a constitutively elevated Ras. GTP level (35%), which was not increased further by PMA treatment. MAP kinases, known downstream intermediates in Ras-dependent signaling pathways, similarly exhibited increased basal or PMA-stimulated activity in Vav-expressing cells by comparison with normal NIH 3T3 cells. These results demonstrate a physiologic interaction between Vav and its target, Ras, leading to MAP kinase activation. Images PMID:8289830

  4. Catching Functional Modes and Structural Communication in Dbl Family Rho Guanine Nucleotide Exchange Factors.


    Raimondi, Francesco; Felline, Angelo; Fanelli, Francesca


    Computational approaches such as Principal Component Analysis (PCA) and Elastic Network Model-Normal Mode Analysis (ENM-NMA) are proving to be of great value in investigating relevant biological problems linked to slow motions with no demand in computer power. In this study, these approaches have been coupled to the graph theory-based Protein Structure Network (PSN) analysis to dissect functional dynamics and structural communication in the Dbl family of Rho Guanine Nucleotide Exchange Factors (RhoGEFs). They are multidomain proteins whose common structural feature is a DH-PH tandem domain deputed to the GEF activity that makes them play a central role in cell and cancer biology. While their common GEF action is accomplished by the DH domain, their regulatory mechanisms are highly variegate and depend on the PH and the additional domains as well as on interacting proteins. Major evolutionary-driven deformations as inferred from PCA concern the α6 helix of DH that dictates the orientation of the PH domain. Such deformations seem to depend on the mechanisms adopted by the GEF to prevent Rho binding, i.e. functional specialization linked to autoinhibition. In line with PCA, ENM-NMA indicates α6 and the linked PH domain as the portions of the tandem domain holding almost the totality of intrinsic and functional dynamics, with the α6/β1 junction acting as a hinge point for the collective motions of PH. In contrast, the DH domain holds a static scaffolding and hub behavior, with structural communication playing a central role in the regulatory actions by other domains/proteins. Possible allosteric communication pathways involving essentially DH were indeed found in those RhoGEFs acting as effectors of small or heterotrimeric RasGTPases. The employed methodology is suitable for deciphering structure/dynamics relationships in large sets of homologous or analogous proteins.

  5. A Minimal Rac Activation Domain in the Unconventional Guanine Nucleotide Exchange Factor Dock180†

    PubMed Central

    Wu, Xin; Ramachandran, Sekar; Cerione, Richard A.; Erickson, Jon W.


    Guanine nucleotide exchange factors (GEFs) activate Rho GTPases by catalyzing the exchange of bound GDP for GTP, thereby resulting in downstream effector recognition. Two metazoan families of GEFs have been described: Dbl-GEF family members that share conserved Dbl homology (DH) and Pleckstrin homology (PH) domains and the more recently described Dock180 family members that share little sequence homology with the Dbl family and are characterized by conserved Dock homology regions 1 and 2 (DHR-1 and -2). While extensive characterization of the Dbl family has been performed, less is known about how Dock180 family members act as GEFs, with only a single x-ray structure having recently been reported for the Dock9-Cdc42 complex. In order to learn more about the mechanisms used by the founding member of the family, Dock180, to act as a Rac-specific GEF, we set out to identify and characterize its limit functional GEF domain. A C-terminal portion of the DHR-2 domain, composed of approximately 300 residues (designated as Dock180DHR-2c), is shown to be necessary and sufficient for robust Rac-specific GEF activity both in vitro and in vivo. We further show that Dock180DHR-2c binds to Rac in a manner distinct from Rac-GEFs of the Dbl family. Specifically, Ala27 and Trp56 of Rac appear to provide a bipartite binding site for the specific recognition of Dock180DHR-2c, whereas, for Dbl family Rac-GEFs, Trp56 of Rac is the sole primary determinant of GEF specificity. Based on our findings, we are able to define the core of Dock180 responsible for its Rac-GEF activity as well as highlight key recognition sites that distinguish different Dock180 family members and determine their corresponding GTPase specificities. PMID:21033699

  6. Activation of JNK by Epac is independent of its activity as a Rap guanine nucleotide exchanger.


    Hochbaum, Daniel; Tanos, Tamara; Ribeiro-Neto, Fernando; Altschuler, Daniel; Coso, Omar A


    Guanine nucleotide exchange factors (GEFs) and their associated GTP-binding proteins (G-proteins) are key regulatory elements in the signal transduction machinery that relays information from the extracellular environment into specific intracellular responses. Among them, the MAPK cascades represent ubiquitous downstream effector pathways. We have previously described that, analogous to the Ras-dependent activation of the Erk-1/2 pathway, members of the Rho family of small G-proteins activate the JNK cascade when GTP is loaded by their corresponding GEFs. Searching for novel regulators of JNK activity we have identified Epac (exchange protein activated by cAMP) as a strong activator of JNK-1. Epac is a member of a growing family of GEFs that specifically display exchange activity on the Rap subfamily of Ras small G-proteins. We report here that while Epac activates the JNK severalfold, a constitutively active (G12V) mutant of Rap1b does not, suggesting that Rap-GTP is not sufficient to transduce Epac-dependent JNK activation. Moreover, Epac signaling to the JNKs was not blocked by inactivation of endogenous Rap, suggesting that Rap activation is not necessary for this response. Consistent with these observations, domain deletion mutant analysis shows that the catalytic GEF domain is dispensable for Epac-mediated activation of JNK. These studies identified a region overlapping the Ras exchange motif domain as critical for JNK activation. Consistent with this, an isolated Ras exchange motif domain from Epac is sufficient to activate JNK. We conclude that Epac signals to the JNK cascade through a new mechanism that does not involve its canonical catalytic action, i.e. Rap-specific GDP/GTP exchange. This represents not only a novel way to activate the JNKs but also a yet undescribed mechanism of downstream signaling by Epac.

  7. Solution structures of oligonucleotides containing either a guanine or a cytosine in front of a gap of one nucleotide

    NASA Astrophysics Data System (ADS)

    Boulard, Y.; Faibis, V.; Fazakerley, G. V.


    We report NMR and molecular modelling studies on two DNA duplexes containing a gap of one nucleotides. The difference between the two oligonucleotides lies in the central base face to the gap, a guanine or a cytosine. For the gapG, we observed in solution a B-form conformation where the guanine stacks in the helix. For the gapC, we reveal the existence of two species, one majority where the cytosine is inside the helix and a second for which the cytosine is extrahelical. Nous présentons une étude par RMN et modélisation moléculaire sur deux duplexes d'ADN contenant une lacune de un nucléotide. La différence entre les deux oligonucléotides réside dans la base centrale en face de la lacune, une guanine ou une cytosine. Pour le duplex appelé gapG, nous observons en solution une hélice de type B dans laquelle la guanine est empilée à l'intérieur de l'hélice. Dans le cas du duplex gapC, nous montrons l'existence de deux formes, l'une où la cytosine est à l'intérieur de l'hélice; la seconde où la cytosine est extra hélicale.

  8. A Rab1 mutant affecting guanine nucleotide exchange promotes disassembly of the Golgi apparatus

    PubMed Central


    The Golgi apparatus is a dynamic organelle whose structure is sensitive to vesicular traffic and to cell cycle control. We have examined the potential role for rab1a, a GTPase previously associated with ER to Golgi and intra-Golgi transport, in the formation and maintenance of Golgi structure. Bacterially expressed, recombinant rab1a protein was microinjected into rat embryonic fibroblasts, followed by analysis of Golgi morphology by fluorescence and electron microscopy. Three recombinant proteins were tested: wild-type rab, mutant rab1a(S25N), a constitutively GDP-bound form (Nuoffer, C., H. W. Davidson, J. Matteson, J. Meinkoth, and W. E. Balch, 1994. J. Cell Biol. 125: 225- 237), and mutant rab1a(N124I) defective in guanine nucleotide binding. Microinjection of wild-type rab1a protein or a variety of negative controls (injection buffer alone or activated ras protein) did not affect the appearance of the Golgi, as visualized by immunofluorescence of alpha-mannosidase II (Man II), used as a Golgi marker. In contrast, microinjection of the mutant forms promoted the disassembly of the Golgi stacks into dispersed vesicular structures visualized by immunofluorescence. When S25N-injected cells were analyzed by EM after immunoperoxidase labeling, Man II was found in isolated ministacks and large vesicular elements that were often surrounded by numerous smaller unlabeled vesicles resembling carrier vesicles. Golgi disassembly caused by rab1a mutants differs from BFA-induced disruption, since beta- COP remains membrane associated, and Man II does not redistribute to the ER. BFA can still cause these residual Golgi elements to fuse and disperse, albeit at a slower rate. Moreover, BFA recovery is incomplete in the presence of rab1 mutants or GTP gamma S. We conclude that GTP exchange and hydrolysis by GTPases, specifically rab1a, are required to form and maintain normal Golgi stacks. The similarity of Golgi disassembly seen with rab1a mutants to that occurring during

  9. The Rho guanine nucleotide exchange factor ARHGEF5 promotes tumor malignancy via epithelial–mesenchymal transition

    PubMed Central

    Komiya, Y; Onodera, Y; Kuroiwa, M; Nomimura, S; Kubo, Y; Nam, J-M; Kajiwara, K; Nada, S; Oneyama, C; Sabe, H; Okada, M


    Epithelial tumor cells often acquire malignant properties, such as invasion/metastasis and uncontrolled cell growth, by undergoing epithelial–mesenchymal transition (EMT). However, the mechanisms by which EMT contributes to malignant progression remain elusive. Here we show that the Rho guanine nucleotide exchange factor (GEF) ARHGEF5 promotes tumor malignancy in a manner dependent on EMT status. We previously identified ARHGEF5, a member of the Dbl family of GEFs, as a multifunctional mediator of Src-induced cell invasion and tumor growth. In the present study, ARHGEF5 was upregulated during tumor growth factor-β-induced EMT in human epithelial MCF10A cells, and promoted cell migration by activating the Rho-ROCK pathway. ARHGEF5 was necessary for the invasive and in vivo metastatic activity of human colorectal cancer HCT116 cells. These findings underscore the crucial role of ARHGEF5 in cell migration and invasion/metastasis. An in vivo tumorigenesis assay revealed that ARHGEF5 had the potential to promote tumor growth via the phosphatidylinositol 3-kinase (PI3K) pathway. However, ARHGEF5 was not required for tumor growth in epithelial-like human colorectal cancer HCT116 and HT29 cells, whereas the growth of mesenchymal-like SW480 and SW620 cells depended on ARHGEF5. Induction of EMT by tumor necrosis factor-α or Slug in HCT116 cells resulted in the dependence of tumor growth on ARHGEF5. In these mesenchymal-like cells, Akt was activated via ARHGEF5 and its activity was required for tumor growth. Analysis of a transcriptome data set revealed that the combination of ARHGEF5 upregulation and E-cadherin downregulation or Snail upregulation was significantly correlated with poor prognosis in patients with colorectal cancers. Taken together, our findings suggest that EMT-induced ARHGEF5 activation contributes to the progression of tumor malignancy. ARHGEF5 may serve as a potential therapeutic target in a subset of malignant tumors that have undergone EMT. PMID

  10. Peripheral Nerve Demyelination Caused by a Mutant Rho GTPase Guanine Nucleotide Exchange Factor, Frabin/FGD4

    PubMed Central

    Stendel, Claudia ; Roos, Andreas ; Deconinck, Tine ; Pereira, Jorge ; Castagner, François ; Niemann, Axel ; Kirschner, Janbernd ; Korinthenberg, Rudolf ; Ketelsen, Uwe-Peter ; Battaloglu, Esra ; Parman, Yesim ; Nicholson, Garth ; Ouvrier, Robert ; Seeger, Jürgen ; Jonghe, Peter De ; Weis, Joachim ; Krüttgen, Alexander ; Rudnik-Schöneborn, Sabine ; Bergmann, Carsten ; Suter, Ueli ; Zerres, Klaus ; Timmerman, Vincent ; Relvas, João B. ; Senderek, Jan 


    GTPases of the Rho subfamily are widely involved in the myelination of the vertebrate nervous system. Rho GTPase activity is temporally and spatially regulated by a set of specific guanine nucleotide exchange factors (GEFs). Here, we report that disruption of frabin/FGD4, a GEF for the Rho GTPase cell-division cycle 42 (Cdc42), causes peripheral nerve demyelination in patients with autosomal recessive Charcot-Marie-Tooth (CMT) neuropathy. These data, together with the ability of frabin to induce Cdc42-mediated cell-shape changes in transfected Schwann cells, suggest that Rho GTPase signaling is essential for proper myelination of the peripheral nervous system. PMID:17564972

  11. Peripheral nerve demyelination caused by a mutant Rho GTPase guanine nucleotide exchange factor, frabin/FGD4.


    Stendel, Claudia; Roos, Andreas; Deconinck, Tine; Pereira, Jorge; Castagner, Francois; Niemann, Axel; Kirschner, Janbernd; Korinthenberg, Rudolf; Ketelsen, Uwe-Peter; Battaloglu, Esra; Parman, Yesim; Nicholson, Garth; Ouvrier, Robert; Seeger, Jürgen; De Jonghe, Peter; Weis, Joachim; Krüttgen, Alexander; Rudnik-Schöneborn, Sabine; Bergmann, Carsten; Suter, Ueli; Zerres, Klaus; Timmerman, Vincent; Relvas, João B; Senderek, Jan


    GTPases of the Rho subfamily are widely involved in the myelination of the vertebrate nervous system. Rho GTPase activity is temporally and spatially regulated by a set of specific guanine nucleotide exchange factors (GEFs). Here, we report that disruption of frabin/FGD4, a GEF for the Rho GTPase cell-division cycle 42 (Cdc42), causes peripheral nerve demyelination in patients with autosomal recessive Charcot-Marie-Tooth (CMT) neuropathy. These data, together with the ability of frabin to induce Cdc42-mediated cell-shape changes in transfected Schwann cells, suggest that Rho GTPase signaling is essential for proper myelination of the peripheral nervous system.

  12. From the ganglioside GQ1balpha to glycomimetic antagonists of the myelin-associated glycoprotein (MAG).


    Ernst, Beat; Schwardt, Oliver; Mesch, Stefanie; Wittwer, Matthias; Rossato, Gianluca; Vedani, Angelo


    The tetrasaccharide 4, a substructure of ganglioside GQ1balpha, shows a remarkable affinity for the myelin-associated glycoprotein (MAG) and was therefore selected as starting point for a lead optimization program. In our search for structurally simplified and pharmacokinetically improved mimics of 4, antagonists with modifications of the core disaccharide Galbeta(1-3)GalNAc, as well as the terminal alpha(2-3)- and the internal alpha(2-6)-linked neuraminic acid were synthesized and tested in target-based binding assays. Compared to the reference tetrasaccharide 4, the most potent antagonist 17 exhibits a 360-fold improved affinity. Furthermore, pharmacokinetic parameters such as stability in the cerebrospinal fluid, logD and permeation through the BBB indicate the drug-like properties of antagonist 17.

  13. ERK1/2 phosphorylate GEF-H1 to enhance its guanine nucleotide exchange activity toward RhoA

    SciTech Connect

    Fujishiro, Shuh-hei; Tanimura, Susumu; Mure, Shogo; Kashimoto, Yuji; Watanabe, Kazushi; Kohno, Michiaki


    Rho GTPases play an essential role in the regulation of many cellular processes. Although various guanine nucleotide exchange factors (GEFs) are involved in the activation of Rho GTPases, the precise mechanism regulating such activity remains unclear. We have examined whether ERK1/2 are involved in the phosphorylation of GEF-H1, a GEF toward RhoA, to modulate its activity. Expression of GEF-H1 in HT1080 cells with constitutive ERK1/2 activation induced its phosphorylation at Thr{sup 678}, which was totally abolished by treating the cells with PD184352, an ERK pathway inhibitor. Stimulation of HeLa S3 cells with 12-O-tetradecanoyl-phorbol-13-acetate induced the phosphorylation of GEF-H1 in an ERK-dependent manner. ERK1/2-mediated Thr{sup 678}-phosphorylation enhanced the guanine nucleotide exchange activity of GEF-H1 toward RhoA. These results suggest that the ERK pathway, by enhancing the GEF-H1 activity, contributes to the activation of RhoA to regulate the actin assembly, a necessary event for the induction of cellular responses including proliferation and motility.

  14. ARHGEF7 (Beta-PIX) acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.


    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  15. The guanine nucleotide exchange factor Vav3 regulates differentiation of progenitor cells in the developing mouse retina.


    Luft, Veronika; Reinhard, Jacqueline; Shibuya, Masabumi; Fischer, Klaus D; Faissner, Andreas


    The seven main cell types in the mammalian retina arise from multipotent retinal progenitor cells, a process that is tightly regulated by intrinsic and extrinsic signals. However, the molecular mechanisms that control proliferation, differentiation and cell-fate decisions of retinal progenitor cells are not fully understood yet. Here, we report that the guanine nucleotide exchange factor Vav3, a regulator of Rho-GTPases, is involved in retinal development. We demonstrate that Vav3 is expressed in the mouse retina during the embryonic period. In order to study the role of Vav3 in the developing retina, we generate Vav3-deficient mice. The loss of Vav3 results in an accelerated differentiation of retinal ganglion cells and cone photoreceptors during early and late embryonic development. We provide evidence that more retinal progenitor cells express the late progenitor marker Sox9 in Vav3-deficient mice than in wild-types. This premature differentiation is compensated during the postnatal period and late-born cell types such as bipolar cells and Müller glia display normal numbers. Taken together, our data imply that Vav3 is a regulator of retinal progenitor cell differentiation, thus highlighting a novel role for guanine nucleotide exchange factors in retinogenesis.

  16. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    SciTech Connect

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.

  17. Role of guanine nucleotide binding protein(s) in vasopressin-induced responses of a vascular smooth muscle cell line

    SciTech Connect

    Nambi, P.; Aiyar, N.; Whitman, M.; Stassen, F.L.; Crooke, S.T.


    Rat aortic smooth muscle cells (A-10) carry vascular V1 vasopressin receptors. In these cells, vasopressin inhibits isoproterenol-induced cAMP accumulation and stimulates phosphatidylinositol turnover and Ca/sup 2 +/ mobilization. Pretreatment of the cells with phorbol esters resulted in inhibition of the vasopressin-induced responses. The inactive phorbol ester aPDD was ineffective. These data suggested that phorbol ester might cause phosphorylation of the vasopressin receptor and/or coupling protein(s). Here, they studied the role of guanine nucleotide binding proteins by employing the novel radiolabeled vasopressin antagonist (/sup 3/H)-SKF 101926. In competition experiments with cell membranes, Gpp(NH)p shifted the vasopressin curve to the right indicating decreased agonist affinity. Phorbol ester pretreatment abolished the Gpp(NH)p effect. Pretreatment of the cells with N-ethylmaleimide (NEM) resulted in inhibition of vasopressin-induced phosphatidyinositol turnover. NEM also abolished the decrease in agonist affinity caused by Gpp(NH)p. These data showed that NEM and phorbol ester pretreatment of smooth muscle cells functionally uncoupled the vasopressin receptors and suggested that vasopressin V1 receptor responses are mediated through guanine nucleotide binding protein(s).

  18. The Crystal Structure of Cdc42 in Complex with Collybisin II, a Gephyrin-Interacting Guanine Nucleotide Exchange Factor

    SciTech Connect

    Xiang,S.; Kim, E.; Connelly, J.; Nassar, N.; Kirsch, J.; WinkingSchwartz, G.; Schindelin, H.


    The synaptic localization of ion channel receptors is essential for efficient synaptic transmission and the precise regulation of diverse neuronal functions. In the central nervous system, ion channel receptors reside in the postsynaptic membrane where they are juxtaposed to presynaptic terminals. For proper function, these ion channels have to be anchored to the cytoskeleton, and in the case of the inhibitory glycine and {gamma}-amino-butyric acid type A (GABA{sub A}) receptors this interaction is mediated by a gephyrin centered scaffold. Highlighting its central role in this receptor anchoring scaffold, gephyrin interacts with a number of proteins, including the neurospecific guanine nucleotide exchange factor collybistin. Collybistin belongs to the Dbl family of guanine nucleotide exchange factors, occurs in multiple splice variants, and is specific for Cdc42, a small GTPase belonging to the Rho family. The 2.3 Angstroms resolution crystal structure of the Cdc42--collybistin II complex reveals a novel conformation of the switch I region of Cdc42. It also provides the first direct observation of structural changes in the relative orientation of the Dbl-homology domain and the pleckstrin-homology domain in the same Dbl family protein. Biochemical data indicate that gephyrin negatively regulates collybistin activity.

  19. Involvement of cAMP-guanine nucleotide exchange factor II in hippocampal long-term depression and behavioral flexibility.


    Lee, Kyungmin; Kobayashi, Yuki; Seo, Hyunhyo; Kwak, Ji-Hye; Masuda, Akira; Lim, Chae-Seok; Lee, Hye-Ryeon; Kang, SukJae Joshua; Park, Pojeong; Sim, Su-Eon; Kogo, Naomi; Kawasaki, Hiroaki; Kaang, Bong-Kiun; Itohara, Shigeyoshi


    Guanine nucleotide exchange factors (GEFs) activate small GTPases that are involved in several cellular functions. cAMP-guanine nucleotide exchange factor II (cAMP-GEF II) acts as a target for cAMP independently of protein kinase A (PKA) and functions as a GEF for Rap1 and Rap2. Although cAMP-GEF II is expressed abundantly in several brain areas including the cortex, striatum, and hippocampus, its specific function and possible role in hippocampal synaptic plasticity and cognitive processes remain elusive. Here, we investigated how cAMP-GEF II affects synaptic function and animal behavior using cAMP-GEF II knockout mice. We found that deletion of cAMP-GEF II induced moderate decrease in long-term potentiation, although this decrease was not statistically significant. On the other hand, it produced a significant and clear impairment in NMDA receptor-dependent long-term depression at the Schaffer collateral-CA1 synapses of hippocampus, while microscopic morphology, basal synaptic transmission, and depotentiation were normal. Behavioral testing using the Morris water maze and automated IntelliCage system showed that cAMP-GEF II deficient mice had moderately reduced behavioral flexibility in spatial learning and memory. We concluded that cAMP-GEF II plays a key role in hippocampal functions including behavioral flexibility in reversal learning and in mechanisms underlying induction of long-term depression.

  20. ARHGEF7 (BETA-PIX) Acts as Guanine Nucleotide Exchange Factor for Leucine-Rich Repeat Kinase 2

    PubMed Central

    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Background Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Methodology/Principal Findings Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Conclusions/Significance Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis. PMID:21048939

  1. Activation of ras p21 transforming properties associated with an increase in the release rate of bound guanine nucleotide.

    PubMed Central

    Lacal, J C; Aaronson, S A


    An Ala-to-Thr substitution at position 59 activates the transforming properties of the p21ras protein without impairment of GTPase activity, a biochemical alteration associated with other activating mutations. To investigate the basis for the transforming properties of the Thr-59 mutant, we characterized guanine nucleotide release. This reaction exhibited a slow rate and stringent temperature requirements. To further dissect the release reaction, we used monoclonal antibodies directed against different epitopes of the p21 molecule. One monoclonal specifically interfered with nucleotide release, while others which recognized different regions of the molecule blocked nucleotide binding. Mutants with the Thr-59 substitution exhibited a three- to ninefold-higher rate of GDP and GTP release than normal p21 or mutants with other activating lesions. This alteration in the Thr-59 mutant would have the effect of increasing its rate of nucleotide exchange. In an intracellular environment with a high GTP/GDP ratio, this would favor the association of GTP with the Thr-59 mutant. Consistent with knowledge of known G-regulatory proteins, these findings support a model in which the p21-GTP complex is the biologically active form of the p21 protein. PMID:3540608

  2. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    PubMed Central

    Zavialov, Andrey V; Hauryliuk, Vasili V; Ehrenberg, Måns


    Background During the translation of mRNA into polypeptide, elongation factor G (EF-G) catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF). Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3. PMID:15985150

  3. GDP-bound and Nucleotide-free Intermediates of the Guanine Nucleotide Exchange in the Rab5·Vps9 System*

    PubMed Central

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi


    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg2+ and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction. PMID:20833725

  4. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.


    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi


    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  5. Frabin and other related Cdc42-specific guanine nucleotide exchange factors couple the actin cytoskeleton with the plasma membrane

    PubMed Central

    Nakanishi, Hiroyuki; Takai, Yoshimi


    Frabin, together with, at least, FGD1, FGD2, FGD3 and FGD1-related Cdc42-GEF (FRG), is a member of a family of Cdc42-specific gua-nine nucleotide exchange factors (GEFs). These proteins have multiple phosphoinositide-binding domains, including two pleckstrin homology (PH) domains and an FYVE or FERM domain. It is likely that they couple the actin cytoskeleton with the plasma membrane. Frabin associates with a specific actin structure(s) and induces the direct activation of Cdc42 in the vicinity of this structure(s), resulting in actin reorganization. Furthermore, frabin associates with a specific membrane structure(s) and induces the indirect activation of Rac in the vicinity of this structure(s), resulting in the reorganization of the actin cytoskeleton. This reorganization of the actin cytoskeleton induces cell shape changes such as the formation of filopodia and lamellipodia. PMID:18410521

  6. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    PubMed Central

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki


    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  7. Superoxide Inhibits Guanine Nucleotide Exchange Factor (GEF) Action on Ras, but not on Rho, through Desensitization of Ras to GEF

    PubMed Central


    Ras and Rho GTPases are molecular switches for various vital cellular signaling pathways. Overactivation of these GTPases often causes development of cancer. Guanine nucleotide exchange factors (GEFs) and oxidants function to upregulate these GTPases through facilitation of guanine nucleotide exchange (GNE) of these GTPases. However, the effect of oxidants on GEF functions, or vice versa, has not been known. We show that, via targeting Ras Cys51, an oxidant inhibits the catalytic action of Cdc25—the catalytic domain of RasGEFs—on Ras. However, the enhancement of Ras GNE by an oxidant continues regardless of the presence of Cdc25. Limiting RasGEF action by an oxidant may function to prevent the pathophysiological overactivation of Ras in the presence of both RasGEFs and oxidants. The continuous exposure of Ras to nitric oxide and its derivatives can form S-nitrosated Ras (Ras-SNO). This study also shows that an oxidant not only inhibits the catalytic action of Cdc25 on Ras-SNO but also fails to enhance Ras-SNO GNE. This lack of enhancement then populates the biologically inactive Ras-SNO in cells, which may function to prevent the continued redox signaling of the Ras pathophysiological response. Finally, this study also demonstrates that, unlike the case with RasGEFs, an oxidant does not inhibit the catalytic action of RhoGEF—Vav or Dbs—on Rho GTPases such as Rac1, RhoA, RhoC, and Cdc42. This result explains the results of the previous study in which, despite the presence of an oxidant, the catalytic action of Dbs in cells continued to enhance RhoC GNE. PMID:24422478

  8. Guanine Nucleotide Exchange Factors (GEFs) Have a Critical but Not Exclusive Role in Organelle Localization of Rab GTPases*

    PubMed Central

    Cabrera, Margarita; Ungermann, Christian


    Membrane fusion at eukaryotic organelles is initiated by Rab GTPases and tethering factors. Rabs in their GDP-bound form are kept soluble in the cytoplasm by the GDP dissociation inhibitor (GDI) chaperone. Guanine nucleotide exchange factors (GEFs) are found at organelles and are critical for Rab function. Here, we surveyed the overall role of GEFs in Rab localization. We show that GEFs, but none of the proposed GDI displacement factors, are essential for the correct membrane localization of yeast Rabs. In the absence of the GEF, Rabs lost their primary localization to the target organelle. Several Rabs, such as vacuolar Ypt7, were found at the endoplasmic reticulum and thus were still membrane-bound. Surprisingly, a Ypt7 mutant that undergoes facilitated nucleotide exchange localized to vacuoles independently of its GEF Mon1-Ccz1 and rescued vacuole morphology. In contrast, wild-type Ypt7 required its GEF for localization and to counteract the extraction by GDI. Our data agree with the emerging model that GEFs are critical for Rab localization but raise the possibility that additional factors can contribute to this process. PMID:23979137

  9. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    PubMed Central

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José


    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  10. The domain architecture of large guanine nucleotide exchange factors for the small GTP-binding protein Arf.


    Mouratou, Barbara; Biou, Valerie; Joubert, Alexandra; Cohen, Jean; Shields, David J; Geldner, Niko; Jürgens, Gerd; Melançon, Paul; Cherfils, Jacqueline


    Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs) that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7). Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.

  11. Different Effects of Guanine Nucleotides (GDP and GTP) on Protein-Mediated Mitochondrial Proton Leak

    PubMed Central

    Woyda-Ploszczyca, Andrzej M.; Jarmuszkiewicz, Wieslawa


    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP. PMID:24904988

  12. Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak.


    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa


    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

  13. Structural basis for the inhibitory effect of brefeldin A on guanine nucleotide-exchange proteins for ADP-ribosylation factors

    PubMed Central

    Sata, Makoto; Moss, Joel; Vaughan, Martha


    Protein secretion through the endoplasmic reticulum and Golgi vesicular trafficking system is initiated by the binding of ADP-ribosylation factors (ARFs) to donor membranes, leading to recruitment of coatomer, bud formation, and eventual vesicle release. ARFs are ≈20-kDa GTPases that are active with bound GTP and inactive with GDP bound. Conversion of ARF-GDP to ARF-GTP is regulated by guanine nucleotide-exchange proteins. All known ARF guanine nucleotide-exchange proteins contain a Sec7 domain of ≈200 amino acids that includes the active site and fall into two classes that differ in molecular size and susceptibility to inhibition by the fungal metabolite brefeldin A (BFA). To determine the structural basis of BFA sensitivity, chimeric molecules were constructed by using sequences from the Sec7 domains of BFA-sensitive yeast Sec7 protein (ySec7d) and the insensitive human cytohesin-1 (C-1Sec7). Based on BFA inhibition of the activities of these molecules with recombinant yeast ARF2 as substrate, the Asp965–Met975 sequence in ySec7d was shown to be responsible for BFA sensitivity. A C-1Sec7 mutant in which Ser199, Asn204, and Pro209 were replaced with the corresponding ySec7d amino acids, Asp965, Gln970, and Met975, exhibited BFA sensitivity similar to that of recombinant ySec7d (rySec7d). Single replacement in C-1Sec7 of Ser199 or Pro209 resulted in partial inhibition by BFA, whereas replacement of Gln970 in ySec7d with Asn (as found in C-1Sec7) had no effect. As predicted, the double C-1Sec7 mutant with S199D and P209M was BFA-sensitive, demonstrating that Asp965 and Met975 in ySec7d are major molecular determinants of BFA sensitivity. PMID:10077583

  14. Expanding functions of GIT Arf GTPase-activating proteins, PIX Rho guanine nucleotide exchange factors and GIT-PIX complexes.


    Zhou, Wu; Li, Xiaobo; Premont, Richard T


    The GIT proteins, GIT1 and GIT2, are GTPase-activating proteins (inactivators) for the ADP-ribosylation factor (Arf) small GTP-binding proteins, and function to limit the activity of Arf proteins. The PIX proteins, α-PIX and β-PIX (also known as ARHGEF6 and ARHGEF7, respectively), are guanine nucleotide exchange factors (activators) for the Rho family small GTP-binding protein family members Rac1 and Cdc42. Through their multi-domain structures, GIT and PIX proteins can also function as signaling scaffolds by binding to numerous protein partners. Importantly, the constitutive association of GIT and PIX proteins into oligomeric GIT-PIX complexes allows these two proteins to function together as subunits of a larger structure that coordinates two distinct small GTP-binding protein pathways and serves as multivalent scaffold for the partners of both constituent subunits. Studies have revealed the involvement of GIT and PIX proteins, and of the GIT-PIX complex, in numerous fundamental cellular processes through a wide variety of mechanisms, pathways and signaling partners. In this Commentary, we discuss recent findings in key physiological systems that exemplify current understanding of the function of this important regulatory complex. Further, we draw attention to gaps in crucial information that remain to be filled to allow a better understanding of the many roles of the GIT-PIX complex in health and disease. © 2016. Published by The Company of Biologists Ltd.

  15. The Garz Sec7 domain guanine nucleotide exchange factor for Arf regulates salivary gland development in Drosophila

    PubMed Central

    Szul, Tomasz; Burgess, Jason; Jeon, Mili; Zinn, Kai; Marques, Guillermo; Brill, Julie A


    Surface delivery of proteins involved in cell-cell and cell-matrix interactions in cultured mammalian cells requires the GBF1 guanine nucleotide exchange factor. However, the role of GBF1 in delivery of adhesion proteins during organogenesis in intact animals has not been characterized. Here, we report the function of the fly GBF1 homolog, Gartenzwerg (Garz) in the development of the salivary gland in Drosophila melanogaster. We used the GAL4/UAS system to selectively deplete Garz from salivary gland cells. We show that depletion of Garz disrupts the secretory pathway as evidenced by the collapse of Golgi-localized Lava lamp (Lva) and the TGN-localized γ subunit of the clathrin-adaptor protein complex (AP-1). Additionally, Garz depletion inhibits trafficking of cell-cell adhesion proteins cadherin (DE-cad) and Flamingo to the cell surface. Disregulation of trafficking correlates with mistargeting of the tumor suppressor protein Discs large involved in epithelial polarity determination. Garz-depleted salivary cells are smaller and lack well-defined plasma membrane domains. Garz depletion also inhibits normal elongation and positioning of epithelial cells, resulting in a disorganized salivary gland that lacks a well defined luminal duct. Our findings suggest that Garz is essential for establishment of epithelial structures and demonstrate an absolute requirement for Garz during Drosophila development. PMID:21686256

  16. The Garz Sec7 domain guanine nucleotide exchange factor for Arf regulates salivary gland development in Drosophila.


    Szul, Tomasz; Burgess, Jason; Jeon, Mili; Zinn, Kai; Marques, Guillermo; Brill, Julie A; Sztul, Elizabeth


    Surface delivery of proteins involved in cell-cell and cell-matrix interactions in cultured mammalian cells requires the GBF1 guanine nucleotide exchange factor. However, the role of GBF1 in delivery of adhesion proteins during organogenesis in intact animals has not been characterized. Here, we report the function of the fly GBF1 homolog, Gartenzwerg (Garz) in the development of the salivary gland in Drosophila melanogaster. We used the GAL4/UAS system to selectively deplete Garz from salivary gland cells. We show that depletion of Garz disrupts the secretory pathway as evidenced by the collapse of Golgi-localized Lava lamp (Lva) and the TGN-localized γ subunit of the clathrin-adaptor protein complex (AP-1). Additionally, Garz depletion inhibits trafficking of cell-cell adhesion proteins cadherin (DE-cad) and Flamingo to the cell surface. Disregulation of trafficking correlates with mistargeting of the tumor suppressor protein Discs large involved in epithelial polarity determination. Garz-depleted salivary cells are smaller and lack well-defined plasma membrane domains. Garz depletion also inhibits normal elongation and positioning of epithelial cells, resulting in a disorganized salivary gland that lacks a well defined luminal duct. Our findings suggest that Garz is essential for establishment of epithelial structures and demonstrate an absolute requirement for Garz during Drosophila development.

  17. Myosin II directly binds and inhibits Dbl family guanine nucleotide exchange factors: a possible link to Rho family GTPases

    PubMed Central

    Lee, Chan-Soo; Choi, Chang-Ki; Schwartz, Martin Alexander


    Cell migration requires the coordinated spatiotemporal regulation of actomyosin contraction and cell protrusion/adhesion. Nonmuscle myosin II (MII) controls Rac1 and Cdc42 activation, and cell protrusion and focal complex formation in migrating cells. However, these mechanisms are poorly understood. Here, we show that MII interacts specifically with multiple Dbl family guanine nucleotide exchange factors (GEFs). Binding is mediated by the conserved tandem Dbl homology–pleckstrin homology module, the catalytic site of these GEFs, with dissociation constants of ∼0.3 µM. Binding to the GEFs required assembly of the MII into filaments and actin-stimulated ATPase activity. Binding of MII suppressed GEF activity. Accordingly, inhibition of MII ATPase activity caused release of GEFs and activation of Rho GTPases. Depletion of βPIX GEF in migrating NIH3T3 fibroblasts suppressed lamellipodial protrusions and focal complex formation induced by MII inhibition. The results elucidate a functional link between MII and Rac1/Cdc42 GTPases, which may regulate protrusion/adhesion dynamics in migrating cells. PMID:20713598

  18. Assay of Rab17 and its guanine nucleotide exchange factor Rabex-5 in the dendrites of hippocampal neurons.


    Mori, Yasunori; Fukuda, Mitsunori


    Neurons are functionally and morphologically compartmentalized into axons and dendrites, and the localization of specific proteins within these compartments is critical to the proper formation of neuronal networks, which includes neurite morphogenesis and synapse formation. The small GTPase Rab17 is specifically localized in dendrites and is not found in axons, and it regulates the dendrite morphogenesis and postsynaptic development of mouse hippocampal neurons. However, the spatiotemporal regulation of Rab17 is poorly understood. We recently identified Rabex-5, originally described as a Rab5-guanine nucleotide exchange factor (GEF), as a physiological Rab17-GEF that promotes translocation of Rab17 from the cell body to the dendrites of developing hippocampal neurons. Knockdown of Rab17 in mouse hippocampal neurons resulted in reductions in dendrite growth, branch numbers, filopodium density, and active synapse numbers. Knockdown of Rab17-GEF Rabex-5 in hippocampal neurons resulted in decreased targeting of Rab17 to the dendrites, which led to a reduction in dendrite growth. In this chapter we describe the assay procedures for analyzing Rab17 and Rabex-5 in cultured mouse hippocampal neurons, and we particularly focus on the measurement of total dendrite (or axon) length and total dendrite (or axon) branch numbers, filopodium density, number of active synapses, and dendritic Rab17 signals.

  19. Emerging role of Cdc42-specific guanine nucleotide exchange factors as regulators of membrane trafficking in health and disease.


    Egorov, M V; Polishchuk, R S


    It is widely accepted that the Golgi complex operates as a main sorting station in the biosynthetic pathway. On the other hand, the Golgi complex harbors numerous signaling molecules that generate the platform for the coordination of the transduction of specific signals and of membrane transport events. A part of these processes, which require the complex integration of transport-, cytoskeleton- and polarity-associated mechanisms, is tightly regulated by molecular machineries comprising guanine nucleotide exchange factors (GEF) and their down-stream effectors, such as the small GTPase Cdc42. Dysfunction of several Cdc42-specific GEFs has been shown to cause a number of human diseases, which are associated with impaired intracellular trafficking at the level of the Golgi complex as well as in other compartments. Here we briefly overview how mutations in Cdc42-specific GEFs have an impact on the organization of intracellular trafficking fluxes and how such trafficking aberrations could be associated with a number of human disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.


    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G


    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs.

  1. RIC8 is a guanine-nucleotide exchange factor for Galpha subunits that regulates growth and development in Neurospora crassa.


    Wright, Sara J; Inchausti, Regina; Eaton, Carla J; Krystofova, Svetlana; Borkovich, Katherine A


    Heterotrimeric (αβγ) G proteins are crucial components of eukaryotic signal transduction pathways. G-protein-coupled receptors (GPCRs) act as guanine nucleotide exchange factors (GEFs) for Gα subunits. Recently, facilitated GDP/GTP exchange by non-GPCR GEFs, such as RIC8, has emerged as an important mechanism for Gα regulation in animals. RIC8 is present in animals and filamentous fungi, such as the model eukaryote Neurospora crassa, but is absent from the genomes of baker's yeast and plants. In Neurospora, deletion of ric8 leads to profound defects in growth and asexual and sexual development, similar to those observed for a mutant lacking the Gα genes gna-1 and gna-3. In addition, constitutively activated alleles of gna-1 and gna-3 rescue many defects of Δric8 mutants. Similar to reports in Drosophila, Neurospora Δric8 strains have greatly reduced levels of G-protein subunits. Effects on cAMP signaling are suggested by low levels of adenylyl cyclase protein in Δric8 mutants and suppression of Δric8 by a mutation in the protein kinase A regulatory subunit. RIC8 acts as a GEF for GNA-1 and GNA-3 in vitro, with the strongest effect on GNA-3. Our results support a role for RIC8 in regulating GNA-1 and GNA-3 in Neurospora.

  2. The Rho-guanine nucleotide exchange factor Trio controls leukocyte transendothelial migration by promoting docking structure formation.


    van Rijssel, Jos; Kroon, Jeffrey; Hoogenboezem, Mark; van Alphen, Floris P J; de Jong, Renske J; Kostadinova, Elena; Geerts, Dirk; Hordijk, Peter L; van Buul, Jaap D


    Leukocyte transendothelial migration involves the active participation of the endothelium through the formation of apical membrane protrusions that embrace adherent leukocytes, termed docking structures. Using live-cell imaging, we find that prior to transmigration, endothelial docking structures form around 80% of all neutrophils. Previously we showed that endothelial RhoG and SGEF control leukocyte transmigration. In this study, our data reveal that both full-length Trio and the first DH-PH (TrioD1) domain of Trio, which can activate Rac1 and RhoG, interact with ICAM-1 and are recruited to leukocyte adhesion sites. Moreover, upon clustering of ICAM-1, the Rho-guanine nucleotide exchange factor Trio activates Rac1, prior to activating RhoG, in a filamin-dependent manner. We further show that docking structure formation is initiated by ICAM-1 clustering into ring-like structures, which is followed by apical membrane protrusion. Interestingly, we find that Rac1 is required for ICAM-1 clustering, whereas RhoG controls membrane protrusion formation. Finally, silencing endothelial Trio expression or reducing TrioD1 activity without affecting SGEF impairs both docking structure formation and leukocyte transmigration. We conclude that Trio promotes leukocyte transendothelial migration by inducing endothelial docking structure formation in a filamin-dependent manner through the activation of Rac1 and RhoG.

  3. Functional characterization of the guanine nucleotide exchange factor (GEF) motif of GIV protein reveals a threshold effect in signaling.


    Garcia-Marcos, Mikel; Kietrsunthorn, Patrick S; Pavlova, Yelena; Adia, Michelle A; Ghosh, Pradipta; Farquhar, Marilyn G


    Heterotrimeric G proteins are critical signal-transducing molecules controlled by a complex network of regulators. GIV (a.k.a. Girdin) is a unique component of this network and a nonreceptor guanine nucleotide exchange factor (GEF) that functions via a signature motif. GIV's GEF motif is involved in the regulation of critical biological processes such as phosphoinositide 3 kinase (PI3K)-Akt signaling, actin cytoskeleton remodeling, cell migration, and cancer metastasis. Here we investigated how the GEF function of GIV affects the wiring of its signaling pathway to shape different biological responses. Using a structure-guided approach, we designed a battery of GIV mutants with different Gαi-binding and -activating properties and used it to dissect the specific impact of changes in GIV's GEF activity on several cellular responses. In vivo signaling assays revealed a threshold effect of GEF activity for the activation of Akt by GIV in different cell lines and by different stimuli. Akt signaling is minimal at low GEF activity and is sharply increased to reach a maximum above a threshold of GEF activity, suggesting that GIV is a critical signal amplifier and that activation of Akt is ultrasensitive to changes in GIV's GEF activity. A similar threshold dependence was observed for other biological functions promoted by GIV such as remodeling of the actin cytoskeleton and cell migration. This functional characterization of GIV's GEF motif provides insights into the molecular interactions between nonreceptor GEFs and G proteins and the mechanisms that govern this signal transduction pathway.

  4. A novel oncogene, ost, encodes a guanine nucleotide exchange factor that potentially links Rho and Rac signaling pathways.

    PubMed Central

    Horii, Y; Beeler, J F; Sakaguchi, K; Tachibana, M; Miki, T


    Transfection of NIH3T3 cells with an osteosarcoma expression cDNA library led to the appearance of foci of morphologically transformed cells which were found to harbor a novel oncogene, ost. The ost product was activated by truncation of the N-terminal domain of the ost proto-oncogene and was highly tumorigenic in nude mouse assays. The proto-ost cDNA, isolated subsequently, encodes a predicted protein of 100 kDa containing DH (Db1 homology) and PH (pleckstrin homology) domains. Ost is mainly phosphorylated on serine and localized in the cytoplasm. Purified Ost protein catalyzed guanine nucleotide exchange on RhoA and Cdc42 among the Rho and Ras family members tested, indicating that Ost can activate these small GTP-binding proteins. Ost did not detectably associate with RhoA or Cdc42, but interacted specifically with the GTP-bound form of Rac1, suggesting that Ost can function as an effector of Rac1. These results suggest that Ost is a critical regulatory component which links pathways that signal through Rac1, RhoA and Cdc42. Of the tissues examined, expression of ost was the highest in brain and could be localized to neurons and alpha-tanycytes, suggesting that Ost may participate in axonal transport in these specialized cells. Images PMID:7957046

  5. Guanine Nucleotide Exchange Factor OSG-1 Confers Functional Aging via Dysregulated Rho Signaling in Caenorhabditis elegans Neurons

    PubMed Central

    Duan, Zhibing; Sesti, Federico


    Rho signaling regulates a variety of biological processes, but whether it is implicated in aging remains an open question. Here we show that a guanine nucleotide exchange factor of the Dbl family, OSG-1, confers functional aging by dysregulating Rho GTPases activities in C. elegans. Thus, gene reporter analysis revealed widespread OSG-1 expression in muscle and neurons. Loss of OSG-1 gene function was not associated with developmental defects. In contrast, suppression of OSG-1 lessened loss of function (chemotaxis) in ASE sensory neurons subjected to conditions of oxidative stress generated during natural aging, by oxidative challenges, or by genetic mutations. RNAi analysis showed that OSG-1 was specific toward activation of RHO-1 GTPase signaling. RNAi further implicated actin-binding proteins ARX-3 and ARX-5, thus the actin cytoskeleton, as one of the targets of OSG-1/RHO-1 signaling. Taken together these data suggest that OSG-1 is recruited under conditions of oxidative stress, a hallmark of aging, and contributes to promote loss of neuronal function by affecting the actin cytoskeleton via altered RHO-1 activity. PMID:25527286

  6. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.


    Kajiho, Hiroaki; Fukushima, Shinichi; Kontani, Kenji; Katada, Toshiaki


    The Rab family of small guanosine triphosphatases (GTPases) plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs). Ras and Rab interactor (or Ras interaction/interference)-like (RINL), which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM) domain-containing (Anks) protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  7. RINL, Guanine Nucleotide Exchange Factor Rab5-Subfamily, Is Involved in the EphA8-Degradation Pathway with Odin

    PubMed Central

    Kontani, Kenji; Katada, Toshiaki


    The Rab family of small guanosine triphosphatases (GTPases) plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs). Ras and Rab interactor (or Ras interaction/interference)-like (RINL), which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM) domain-containing (Anks) protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin. PMID:22291991

  8. The Guanine Nucleotide Exchange Factor Brx: A Link between Osmotic Stress, Inflammation and Organ Physiology and Pathophysiology

    PubMed Central

    Kino, Tomoshige; Segars, James H.; Chrousos, George P.


    SUMMARY Dehydration, and consequent intracellular hyperosmolarity, is a major challenge to land organisms, as it is associated with extraction of water from cells and disturbance of global cellular function. Organisms have thus developed a highly conserved regulatory mechanism that transduces the hyperosmolarity signal from the cell surface to the cell nucleus and adjusts the expression of cellular osmolarity-regulating genes. We recently found that the Rho-type guanine nucleotide exchange factor Brx, or AKAP13, is essential for osmotic stress-stimulated expression of nuclear factor of activated T-cells 5 (NFAT5), a key transcription factor of intracellular osmolarity. It accomplishes this by first attracting cJun kinase (JNK)-interacting protein (JIP) 4 and then coupling activated Rho-type small G-proteins to cascade components of the p38 MAPK signaling pathway, ultimately activating NFAT5. We describe the potential implications of osmotic stress and Brx activation in organ physiology and pathophysiology and connect activation of this system to key human homeostatic states. PMID:21037977

  9. Critical function of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in mouse spermatogenesis.


    Okada, Keisuke; Miyake, Hideaki; Yamaguchi, Kohei; Chiba, Koji; Maeta, Kazuhiro; Bilasy, Shymaa E; Edamatsu, Hironori; Kataoka, Tohru; Fujisawa, Masato


    Small GTPase Rap1 has been implicated in the proper differentiation of testicular germ cells. In the present study, we investigated the functional significance of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in testicular differentiation using mice lacking RA-GEF-2. RA-GEF-2 was expressed predominantly on the luminal side of the seminiferous tubules in wild-type mice. No significant differences were observed in the body weights or hormonal parameters of RA-GEF-2(-)(/)(-) and wild-type mice. However, the testes of RA-GEF-2(-)(/)(-) male mice were significantly smaller than those of wild-type mice and were markedly atrophied as well as hypospermatogenic. The concentration and motility of epididymal sperm were also markedly reduced and frequently had an abnormal shape. The pregnancy rate and number of fetuses were markedly lower in wild-type females after they mated with RA-GEF-2(-)(/)(-) males than with wild-type males, which demonstrated the male infertility phenotype of RA-GEF-2(-)(/)(-) mice. Furthermore, a significant reduction and alteration were observed in the expression level and cell junctional localization of N-cadherin, respectively, in RA-GEF-2(-)(/)(-) testes, which may, at least in part, account for the defects in testicular differentiation and spermatogenesis in these mice. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Biochemical, Biophysical and Cellular Techniques to Study the Guanine Nucleotide Exchange Factor, GIV/Girdin.


    Ghosh, Pradipta; Aznar, Nicolas; Swanson, Lee; Lo, I-Chung; Lopez-Sanchez, Inmaculada; Ear, Jason; Rohena, Cristina; Kalogriopoulos, Nicholas; Joosen, Linda; Dunkel, Ying; Sun, Nina; Nguyen, Peter; Bhandari, Deepali


    Canonical signal transduction via heterotrimeric G proteins is spatiotemporally restricted, i.e., triggered exclusively at the plasma membrane, only by agonist activation of G protein-coupled receptors via a finite process that is terminated within a few hundred milliseconds. Recently, a rapidly emerging paradigm has revealed a noncanonical pathway for activation of heterotrimeric G proteins via the nonreceptor guanidine-nucleotide exchange factor, GIV/Girdin. Biochemical, biophysical, and functional studies evaluating this pathway have unraveled its unique properties and distinctive spatiotemporal features. As in the case of any new pathway/paradigm, these studies first required an in-depth optimization of tools/techniques and protocols, governed by rationale and fundamentals unique to the pathway, and more specifically to the large multimodular GIV protein. Here we provide the most up-to-date overview of protocols that have generated most of what we know today about noncanonical G protein activation by GIV and its relevance in health and disease. © 2016 by John Wiley & Sons, Inc.

  11. Role of protein-phospholipid interactions in the activation of ARF1 by the guanine nucleotide exchange factor Arno.


    Paris, S; Béraud-Dufour, S; Robineau, S; Bigay, J; Antonny, B; Chabre, M; Chardin, P


    Arno is a 47-kDa human protein recently identified as a guanine nucleotide exchange factor for ADP ribosylation factor 1 (ARF1) with a central Sec7 domain responsible for the exchange activity and a carboxyl-terminal pleckstrin homology (PH) domain (Chardin, P., Paris, S., Antonny, B., Robineau, S., Béraud-Dufour, S., Jackson, C. L., and Chabre, M. (1996) Nature 384, 481-484). Binding of the PH domain to phosphatidylinositol 4,5-bisphosphate (PIP2) greatly enhances Arno-mediated activation of myristoylated ARF1. We show here that in the absence of phospholipids, Arno promotes nucleotide exchange on [Delta17]ARF1, a soluble mutant of ARF1 lacking the first 17 amino acids. This reaction is unaffected by PIP2, which suggests that the PIP2-PH domain interaction does not directly regulate the catalytic activity of Arno but rather serves to recruit Arno to membranes. Arno catalyzes the release of GDP more efficiently than that of GTP from [Delta17]ARF1, and a stable complex between Arno Sec7 domain and nucleotide-free [Delta17]ARF1 can be isolated. In contrast to [Delta17]ARF1, full-length unmyristoylated ARF1 is not readily activated by Arno in solution. Its activation requires the presence of phospholipids and a reduction of ionic strength and Mg2+ concentration. PIP2 is strongly stimulatory, indicating that binding of Arno to phospholipids is involved, but in addition, electrostatic interactions between phospholipids and the amino-terminal portion of unmyristoylated ARF1GDP seem to be important. We conclude that efficient activation of full-length ARF1 by Arno requires a membrane surface and two distinct protein-phospholipid interactions: one between the PH domain of Arno and PIP2, and the other between amino-terminal cationic residues of ARF1 and anionic phospholipids. The latter interaction is normally induced by insertion of the amino-terminal myristate into the bilayer but can also be artificially facilitated by decreasing Mg2+ and salt concentrations.

  12. Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no guanine nucleotide exchange activity toward Arl1 GTPase

    NASA Astrophysics Data System (ADS)

    Mahajan, Divyanshu; Boh, Boon Kim; Zhou, Yan; Chen, Li; Cornvik, Tobias Carl; Hong, Wanjin; Lu, Lei


    Arl1 is a member of Arf family small GTPases that is essential for the organization and function of Golgi complex. Mon2/Ysl2, which shares significant homology with Sec7 family Arf guanine nucleotide exchange factors, was poorly characterized in mammalian cells. Here, we report the first in depth characterization of mammalian Mon2. We found that Mon2 localized to trans-Golgi network which was dependent on both its N and C termini. The depletion of Mon2 did not affect the Golgi localized or cellular active form of Arl1. Furthermore, our in vitro assay demonstrated that recombinant Mon2 did not promote guanine nucleotide exchange of Arl1. Therefore, our results suggest that Mon2 could be neither necessary nor sufficient for the guanine nucleotide exchange of Arl1. We demonstrated that Mon2 was involved in endosome-to-Golgi trafficking as its depletion accelerated the delivery of furin and CI-M6PR to Golgi after endocytosis.

  13. Calcium channel currents and their inhibition by (-)-baclofen in rat sensory neurones: modulation by guanine nucleotides.

    PubMed Central

    Dolphin, A C; Scott, R H


    significantly increased by GTP-gamma-S and reduced by GDP-beta-S. 6. The ability of baclofen to inhibit calcium-channel currents was not affected by 1 microM-forskolin or 50 microM-intracellular cyclic AMP. 7. It is concluded that calcium channels in d.r.g.s are associated with a nucleotide binding protein, and that this mediates the effect of baclofen and 2-CA on calcium-channel currents. The ability of GTP-gamma-S to inhibit the transient component of calcium-channel currents in the absence of agonist may represent a means of differentially regulating calcium-channel activity. PMID:2445960

  14. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.


    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli


    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  15. The Guanine Nucleotide Exchange Factor (GEF) Asef2 Promotes Dendritic Spine Formation via Rac Activation and Spinophilin-dependent Targeting*

    PubMed Central

    Evans, J. Corey; Robinson, Cristina M.; Shi, Mingjian; Webb, Donna J.


    Dendritic spines are actin-rich protrusions that establish excitatory synaptic contacts with surrounding neurons. Reorganization of the actin cytoskeleton is critical for the development and plasticity of dendritic spines, which is the basis for learning and memory. Rho family GTPases are emerging as important modulators of spines and synapses, predominantly through their ability to regulate actin dynamics. Much less is known, however, about the function of guanine nucleotide exchange factors (GEFs), which activate these GTPases, in spine and synapse development. In this study we show that the Rho family GEF Asef2 is found at synaptic sites, where it promotes dendritic spine and synapse formation. Knockdown of endogenous Asef2 with shRNAs impairs spine and synapse formation, whereas exogenous expression of Asef2 causes an increase in spine and synapse density. This effect of Asef2 on spines and synapses is abrogated by expression of GEF activity-deficient Asef2 mutants or by knockdown of Rac, suggesting that Asef2-Rac signaling mediates spine development. Because Asef2 interacts with the F-actin-binding protein spinophilin, which localizes to spines, we investigated the role of spinophilin in Asef2-promoted spine formation. Spinophilin recruits Asef2 to spines, and knockdown of spinophilin hinders spine and synapse formation in Asef2-expressing neurons. Furthermore, inhibition of N-methyl-d-aspartate receptor (NMDA) activity blocks spinophilin-mediated localization of Asef2 to spines. These results collectively point to spinophilin-Asef2-Rac signaling as a novel mechanism for the development of dendritic spines and synapses. PMID:25750125

  16. The guanine nucleotide exchange factor (GEF) Asef2 promotes dendritic spine formation via Rac activation and spinophilin-dependent targeting.


    Evans, J Corey; Robinson, Cristina M; Shi, Mingjian; Webb, Donna J


    Dendritic spines are actin-rich protrusions that establish excitatory synaptic contacts with surrounding neurons. Reorganization of the actin cytoskeleton is critical for the development and plasticity of dendritic spines, which is the basis for learning and memory. Rho family GTPases are emerging as important modulators of spines and synapses, predominantly through their ability to regulate actin dynamics. Much less is known, however, about the function of guanine nucleotide exchange factors (GEFs), which activate these GTPases, in spine and synapse development. In this study we show that the Rho family GEF Asef2 is found at synaptic sites, where it promotes dendritic spine and synapse formation. Knockdown of endogenous Asef2 with shRNAs impairs spine and synapse formation, whereas exogenous expression of Asef2 causes an increase in spine and synapse density. This effect of Asef2 on spines and synapses is abrogated by expression of GEF activity-deficient Asef2 mutants or by knockdown of Rac, suggesting that Asef2-Rac signaling mediates spine development. Because Asef2 interacts with the F-actin-binding protein spinophilin, which localizes to spines, we investigated the role of spinophilin in Asef2-promoted spine formation. Spinophilin recruits Asef2 to spines, and knockdown of spinophilin hinders spine and synapse formation in Asef2-expressing neurons. Furthermore, inhibition of N-methyl-d-aspartate receptor (NMDA) activity blocks spinophilin-mediated localization of Asef2 to spines. These results collectively point to spinophilin-Asef2-Rac signaling as a novel mechanism for the development of dendritic spines and synapses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. A mammalian Rho-specific guanine-nucleotide exchange factor (p164-RhoGEF) without a pleckstrin homology domain.

    PubMed Central

    Rümenapp, Ulrich; Freichel-Blomquist, Andrea; Wittinghofer, Burkhard; Jakobs, Karl H; Wieland, Thomas


    Rho GTPases, which are activated by specific guanine-nucleotide exchange factors (GEFs), play pivotal roles in several cellular functions. We identified a recently cloned human cDNA, namely KIAA0337, encoding a protein containing 1510 amino acids (p164). It contains a RhoGEF-specific Dbl homology (DH) domain but lacks their typical pleckstrin homology domain. The expression of the mRNA encoding p164 was found to be at least 4-fold higher in the heart than in other tissues. Recombinant p164 interacted with and induced GDP/GTP exchange at RhoA but not at Rac1 or Cdc42. p164-DeltaC and p164-DeltaN are p164 mutants that are truncated at the C- and N-termini respectively but contain the DH domain. In contrast with the full-length p164, expression of p164-DeltaC and p164-DeltaN strongly induced actin stress fibre formation and activated serum response factor-mediated and Rho-dependent gene transcription. Interestingly, p164-DeltaN2, a mutant containing the C-terminus but having a defective DH domain, bound to p164-DeltaC and suppressed the p164-DeltaC-induced gene transcription. Overexpression of the full-length p164 inhibited M(3) muscarinic receptor-induced gene transcription, whereas co-expression with Gbeta(1)gamma(2) dimers induced transcriptional activity. It is concluded that p164-RhoGEF is a Rho-specific GEF with novel structural and regulatory properties and predominant expression in the heart. Apparently, its N- and C-termini interact with each other, thereby inhibiting its GEF activity. PMID:12071859

  18. Guanine nucleotide exchange factor Vav1 regulates perivascular homing and bone marrow retention of hematopoietic stem and progenitor cells.


    Sanchez-Aguilera, Abel; Lee, Yun-Jung; Lo Celso, Cristina; Ferraro, Francesca; Brumme, Kristina; Mondal, Subhanjan; Kim, Chaekyun; Dorrance, Adrienne; Luo, Hongbo R; Scadden, David T; Williams, David A


    Engraftment and maintenance of hematopoietic stem and progenitor cells (HSPC) depend on their ability to respond to extracellular signals from the bone marrow microenvironment, but the critical intracellular pathways integrating these signals remain poorly understood. Furthermore, recent studies provide contradictory evidence of the roles of vascular versus osteoblastic niche components in HSPC function. To address these questions and to dissect the complex upstream regulation of Rac GTPase activity in HSPC, we investigated the role of the hematopoietic-specific guanine nucleotide exchange factor Vav1 in HSPC localization and engraftment. Using intravital microscopy assays, we demonstrated that transplanted Vav1(-/-) HSPC showed impaired early localization near nestin(+) perivascular mesenchymal stem cells; only 6.25% of Vav1(-/-) HSPC versus 45.8% of wild-type HSPC were located less than 30 μm from a nestin(+) cell. Abnormal perivascular localization correlated with decreased retention of Vav1(-/-) HSPC in the bone marrow (44-60% reduction at 48 h posttransplant, compared with wild-type) and a very significant defect in short- and long-term engraftment in competitive and noncompetitive repopulation assays (<1.5% chimerism of Vav1(-/-) cells vs. 53-63% for wild-type cells). The engraftment defect of Vav1(-/-) HSPC was not related to alterations in proliferation, survival, or integrin-mediated adhesion. However, Vav1(-/-) HSPC showed impaired responses to SDF1α, including reduced in vitro migration in time-lapse microscopy assays, decreased circadian and pharmacologically induced mobilization in vivo, and dysregulated Rac/Cdc42 activation. These data suggest that Vav1 activity is required specifically for SDF1α-dependent perivascular homing of HSPC and suggest a critical role for this localization in retention and subsequent engraftment.

  19. Guanine nucleotide exchange factor Vav1 regulates perivascular homing and bone marrow retention of hematopoietic stem and progenitor cells

    PubMed Central

    Sanchez-Aguilera, Abel; Lee, Yun-Jung; Lo Celso, Cristina; Ferraro, Francesca; Brumme, Kristina; Mondal, Subhanjan; Kim, Chaekyun; Dorrance, Adrienne; Luo, Hongbo R.; Scadden, David T.; Williams, David A.


    Engraftment and maintenance of hematopoietic stem and progenitor cells (HSPC) depend on their ability to respond to extracellular signals from the bone marrow microenvironment, but the critical intracellular pathways integrating these signals remain poorly understood. Furthermore, recent studies provide contradictory evidence of the roles of vascular versus osteoblastic niche components in HSPC function. To address these questions and to dissect the complex upstream regulation of Rac GTPase activity in HSPC, we investigated the role of the hematopoietic-specific guanine nucleotide exchange factor Vav1 in HSPC localization and engraftment. Using intravital microscopy assays, we demonstrated that transplanted Vav1−/− HSPC showed impaired early localization near nestin+ perivascular mesenchymal stem cells; only 6.25% of Vav1−/− HSPC versus 45.8% of wild-type HSPC were located less than 30 μm from a nestin+ cell. Abnormal perivascular localization correlated with decreased retention of Vav1−/− HSPC in the bone marrow (44–60% reduction at 48 h posttransplant, compared with wild-type) and a very significant defect in short- and long-term engraftment in competitive and noncompetitive repopulation assays (<1.5% chimerism of Vav1−/− cells vs. 53–63% for wild-type cells). The engraftment defect of Vav1−/− HSPC was not related to alterations in proliferation, survival, or integrin-mediated adhesion. However, Vav1−/− HSPC showed impaired responses to SDF1α, including reduced in vitro migration in time-lapse microscopy assays, decreased circadian and pharmacologically induced mobilization in vivo, and dysregulated Rac/Cdc42 activation. These data suggest that Vav1 activity is required specifically for SDF1α-dependent perivascular homing of HSPC and suggest a critical role for this localization in retention and subsequent engraftment. PMID:21606370

  20. The Tiam1 Guanine Nucleotide Exchange Factor is Auto-inhibited by its Pleckstrin Homology Coiled-Coil Extension Domain.


    Xu, Zhen; Gakhar, Lokesh; Bain, Fletcher E; Spies, Maria; Fuentes, Ernesto J


    T-cell lymphoma invasion and metastasis 1 (Tiam1) is a Dbl-family guanine nucleotide exchange factor (GEF) that specifically activates the Rho-family GTPase Rac1 in response to upstream signals, thereby regulating cellular processes including cell adhesion and migration. Tiam1 contains multiple domains, including an N-terminal Pleckstrin homology coiled-coiled extension (PHn-CC-Ex) and catalytic Dbl-homology and C-terminal Pleckstrin homology (DH-PHc) domain. Previous studies indicate that larger fragments of Tiam1, such the region encompassing the N-terminal to C-terminal Pleckstrin homology domains (PHn-PHc) are auto-inhibited. However, the domains in this region responsible for inhibition remain unknown. Here, we show that the PHn-CC-Ex domain inhibits Tiam1 GEF activity by directly interacting with the catalytic DH-PHc domain, preventing Rac1 binding and activation. Enzyme kinetics experiments suggested that Tiam1 is auto-inhibited through occlusion of the catalytic site, rather than by allostery. Small angle X-ray scattering and ensemble modeling yielded models of the PHn-PHc fragment that indicate it is in equilibrium between open and closed conformational states. Finally, single-molecule experiments support a model in which conformational sampling between the open and closed states of Tiam1 contributes to Rac1 dissociation. Our results highlight the role of the PHn-CC-Ex domain in Tiam1 GEF regulation, and suggest a combinatorial model for GEF inhibition and activation of the Rac1 signaling pathway. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  1. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

    PubMed Central

    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders. PMID:25485589

  2. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.


    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng


    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (P<0.05) than that in normal controls (5/36, 13.89%). Moreover, the overexpression rate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  3. Norbin Stimulates the Catalytic Activity and Plasma Membrane Localization of the Guanine-Nucleotide Exchange Factor P-Rex1*

    PubMed Central

    Pan, Dingxin; Barber, Mark A.; Hornigold, Kirsti; Baker, Martin J.; Toth, Judit M.; Oxley, David; Welch, Heidi C. E.


    P-Rex1 is a guanine-nucleotide exchange factor (GEF) that activates the small G protein (GTPase) Rac1 to control Rac1-dependent cytoskeletal dynamics, and thus cell morphology. Three mechanisms of P-Rex1 regulation are currently known: (i) binding of the phosphoinositide second messenger PIP3, (ii) binding of the Gβγ subunits of heterotrimeric G proteins, and (iii) phosphorylation of various serine residues. Using recombinant P-Rex1 protein to search for new binding partners, we isolated the G-protein-coupled receptor (GPCR)-adaptor protein Norbin (Neurochondrin, NCDN) from mouse brain fractions. Coimmunoprecipitation confirmed the interaction between overexpressed P-Rex1 and Norbin in COS-7 cells, as well as between endogenous P-Rex1 and Norbin in HEK-293 cells. Binding assays with purified recombinant proteins showed that their interaction is direct, and mutational analysis revealed that the pleckstrin homology domain of P-Rex1 is required. Rac-GEF activity assays with purified recombinant proteins showed that direct interaction with Norbin increases the basal, PIP3- and Gβγ-stimulated Rac-GEF activity of P-Rex1. Pak-CRIB pulldown assays demonstrated that Norbin promotes the P-Rex1-mediated activation of endogenous Rac1 upon stimulation of HEK-293 cells with lysophosphatidic acid. Finally, immunofluorescence microscopy and subcellular fractionation showed that coexpression of P-Rex1 and Norbin induces a robust translocation of both proteins from the cytosol to the plasma membrane, as well as promoting cell spreading, lamellipodia formation, and membrane ruffling, cell morphologies generated by active Rac1. In summary, we have identified a novel mechanism of P-Rex1 regulation through the GPCR-adaptor protein Norbin, a direct P-Rex1 interacting protein that promotes the Rac-GEF activity and membrane localization of P-Rex1. PMID:26792863

  4. Association of genetic variants in the Rho guanine nucleotide exchange factor AKAP13 with familial breast cancer.


    Wirtenberger, Michael; Tchatchou, Sandrine; Hemminki, Kari; Klaes, Rüdiger; Schmutzler, Rita K; Bermejo, Justo L; Chen, Bowang; Wappenschmidt, Barbara; Meindl, Alfons; Bartram, Claus R; Burwinkel, Barbara


    The A-kinase anchor protein 13 (AKAP13, alias BRX and lbc) tethers cAMP-dependent protein kinase to its subcellular environment and catalyses Rho GTPases activity as a guanine nucleotide exchange factor. The crucial role of members of the Rho family of GTPases in carcinogenesis is well established and targeting Rho proteins with antineoplastic compounds has become a major effort in the fight against cancer. Thus, genetic alterations within the candidate cancer susceptibility gene AKAP13 would be expected to provoke a constitutive Rho signalling, thereby facilitating the development of cancer. Here, we analysed the potential impact of four polymorphic non-conservative amino acid exchanges (Arg494Trp, Lys526Gln, Asn1086Asp and Gly2461Ser) in AKAP13 on familial breast cancer. We performed a case-control study using genomic DNA of BRCA1/2 mutation-negative German female index patients from 601 unrelated families, among a subset of 356 high-risk families, and 1053 German female unrelated controls. The newfound Lys526Gln polymorphism revealed a significant association with familial breast cancer (OR = 1.58, 95% CI = 1.07-2.35) and an even stronger association with high-risk familial breast cancer (OR = 1.85, 95% CI = 1.19-2.88). Haplotype analyses were in line with genotype results displaying a similar significance as analyses of individual polymorphisms. Due to the pivotal role of AKAP13 in the Rho GTPases signalling network, this variant might affect the susceptibility to other cancers as well.

  5. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling.


    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders.

  6. Reduced expression of Rho guanine nucleotide dissociation inhibitor-alpha modulates the cytotoxic effect of busulfan in HEK293 cells.


    Reimer, Janka; Bien, Sandra; Sonnemann, Jürgen; Beck, James F; Wieland, Thomas; Kroemer, Heyo K; Ritter, Christoph A


    High-dose busulfan is an important component in many conditioning protocols for hematopoietic stem cell or bone marrow transplantation. Treatment with busulfan results in the inhibition of cell cycle progression and apoptosis of tumor cells. As Rho GTPases are involved in cell cycle regulation, we investigated the influence of modified Rho guanine nucleotide dissociation inhibitor-alpha (GDI), a physiological inhibitor of Rho GTPases, on busulfan activity in cancer cells. RhoGDIalpha has been shown to be overexpressed in multiple types of tumors such as ovarian and breast cancer. To investigate the role of RhoGDIalpha, we established a RhoGDIalpha knockdown by the transient transfection of HEK293 cells with specific small interfering RNA resulting in strongly reduced RhoGDIalpha mRNA and protein expression. Other members of the RhoGDI family such as RhoGDIbeta and RhoGDIgamma were not affected. In RhoGDIalpha knockdown cells, cell cycle regulation was not altered by the downregulation of RhoGDIalpha; however, the rate of apoptotic cells increased when compared with the control small interfering RNA-transfected cells. In addition, treatment of cells with busulfan resulted in a further increased apoptotic rate, as determined by fluorescence-activated cell sorter analysis and caspase-3 activation. Such a sensitization of RhoGDIalpha small interfering RNA transfected cells was also found upon treatment with doxorubicin and taxol. In summary, we could demonstrate that the expression of RhoGDIalpha influences the sensitivity of cells toward busulfan-induced cytotoxicity.

  7. The ect2 rho Guanine nucleotide exchange factor is essential for early mouse development and normal cell cytokinesis and migration.


    Cook, Danielle R; Solski, Patricia A; Bultman, Scott J; Kauselmann, Gunther; Schoor, Michael; Kuehn, Ralf; Friedman, Lori S; Cowley, Dale O; Van Dyke, Terry; Yeh, Jen Jen; Johnson, Leisa; Der, Channing J


    Ect2 is a member of the human Dbl family of guanine nucleotide exchange factors (RhoGEFs) that serve as activators of Rho family small GTPases. Although Ect2 is one of at least 25 RhoGEFs that can activate the RhoA small GTPase, cell culture studies using established cell lines determined that Ect2 is essential for mammalian cell cytokinesis and proliferation. To address the function of Ect2 in normal mammalian development, we performed gene targeting to generate Ect2 knockout mice. The heterozygous Ect2(+/-) mice showed normal development and life span, indicating that Ect2 haplodeficiency was not deleterious for development or growth. In contrast, Ect2(-/-) embryos were not found at birth or postimplantation stages. Ect2(-/-) blastocysts were recovered at embryonic day 3.5 but did not give rise to viable outgrowths in culture, indicating that Ect2 is required for peri-implantation development. To further assess the importance of Ect2 in normal cell physiology, we isolated primary fibroblasts from Ect2(fl/fl) embryos (MEFs) and ablated Ect2 using adenoviral delivery of Cre recombinase. We observed a significant increase in multinucleated cells and accumulation of cells in G2/M phase, consistent with a role for Ect2 in cytokinesis. Ect2 deficiency also caused enlargement of the cytoplasm and impaired cell migration. Finally, although Ect2-dependent activation of RhoA has been implicated in cytokinesis, Ect2 can also activate Rac1 and Cdc42 to cause growth transformation. Surprisingly, ectopic expression of constitutively activated RhoA, Rac1, or Cdc42, known substrates of Ect2, failed to phenocopy Ect2 and did not rescue the defect in cytokinesis caused by loss of Ect2. In summary, our results establish the unique role of Ect2 in development and normal cell proliferation.

  8. The gall bladder cholecystokinin receptor exists in two guanine nucleotide-binding protein-regulated affinity states

    SciTech Connect

    Molero, X.; Miller, L.J. )


    To study proximal events in cholecystokinin (CCK) action on bovine gall bladder smooth muscle, we used the hormone analogue D-Tyr-Gly-((N1e28,31)CCK-26-32)-phenethyl ester (OPE), which has unique biological properties. This fully efficacious agonist differs from native CCK by not expressing supramaximal inhibition of cell shortening, yet it clearly interacts with the same receptor molecule. This was demonstrated in binding and affinity labeling studies, where both peptides label the same Mr 70,000-85,000 protein and both fully compete for binding of the other ligand. Further, its relatively high affinity for the low affinity CCK receptor permits the clear demonstration of two affinity states of a CCK receptor on a membrane preparation and makes possible evaluation of the molecular basis of these affinity states and their regulation. Analysis of homologous and heterologous binding curves performed with both CCK and OPE peptides and radioligands demonstrated the presence of two affinity states, with CCK being able to distinguish them (Kd1 = 0.48 +/- 0.04 nM and Kd2 = 56.5 +/- 7.4 nM) and OPE recognizing them equally (Kd1 = 0.94 +/- 0.31 nM and Kd2 = 0.96 +/- 0.23 nM). In the presence of nonhydrolyzable GTP analogues, there was a shift in distribution of receptors toward the low affinity state, with the total number of receptors and their absolute affinities for each peptide remaining constant. Thus, the gall bladder CCK receptor is a single molecule capable of assuming two interconvertible affinity states, regulated by a guanine nucleotide-binding protein. Two full agonists are capable of interacting with this molecule to yield different biological responses via different molecular events.

  9. Calcium- and guanine-nucleotide-dependent exocytosis in permeabilized rat mast cells. Modulation by protein kinase C.

    PubMed Central

    Koopmann, W R; Jackson, R C


    We have used a digitonin-permeabilized cell system to study the signal transduction pathways responsible for stimulus-secretion coupling in the rat peritoneal mast cell. Conditions were established for permeabilizing the mast cell plasma membrane without disrupting secretory vesicles. Exocytotic release of histamine from digitonin-permeabilized cells required a combination of micromolar concentrations of Ca2+ and the stable guanine nucleotide analogue guanosine 5'-[gamma-thio]triphosphate (GTP[S]), but was independent of exogenous ATP. In the presence of 40 microM-GTP[S], exocytosis was half-maximal at 1.3 microM-Ca2+ and maximal at 10 microM-Ca2+; GTP[S] alone (100 microM) had no effect on histamine release in the absence of added Ca2+. In the presence of 10 microM free Ca2+, 5 microM-GTP[S] was required for half-maximal exocytosis. To examine the possible role of protein kinase C (PKC) in exocytosis, we utilized 12-O-tetradecanoylphorbol 13-acetate (TPA) to activate PKC and studied its effect on histamine release from permeabilized mast cells. Cells that had been incubated with TPA (25 nM for 5 min) exhibited increased sensitivity to both GTP[S] and Ca2+. The PKC inhibitor staurosporine blocked the effect of TPA without inhibiting normal exocytosis in response to the combination of GTP[S] and Ca2+. In addition, down-regulation of mast-cell PKC by long-term TPA treatment (25 nM for 20 h) blocked the ability of the cells to respond to TPA and inhibited exocytosis in response to Ca2+ and GTP[S] by 40-50%. These results suggest that the sensitivity of the exocytotic machinery of the mast cell can be altered by PKC-catalysed phosphorylation events, but that activation of PKC is not required for exocytosis to occur. Images Fig. 7. PMID:1689146

  10. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria


    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  11. The role of Mg2+ cofactor in the guanine nucleotide exchange and GTP hydrolysis reactions of Rho family GTP-binding proteins.


    Zhang, B; Zhang, Y; Wang, Z; Zheng, Y


    The biological activities of Rho family GTPases are controlled by their guanine nucleotide binding states in cells. Here we have investigated the role of Mg(2+) cofactor in the guanine nucleotide binding and hydrolysis processes of the Rho family members, Cdc42, Rac1, and RhoA. Differing from Ras and Rab proteins, which require Mg(2+) for GDP and GTP binding, the Rho GTPases bind the nucleotides in the presence or absence of Mg(2+) similarly, with dissociation constants in the submicromolar concentration. The presence of Mg(2+), however, resulted in a marked decrease in the intrinsic dissociation rates of the nucleotides. The catalytic activity of the guanine nucleotide exchange factors (GEFs) appeared to be negatively regulated by free Mg(2+), and GEF binding to Rho GTPase resulted in a 10-fold decrease in affinity for Mg(2+), suggesting that one role of GEF is to displace bound Mg(2+) from the Rho proteins. The GDP dissociation rates of the GTPases could be further stimulated by GEF upon removal of bound Mg(2+), indicating that the GEF-catalyzed nucleotide exchange involves a Mg(2+)-independent as well as a Mg(2+)-dependent mechanism. Although Mg(2+) is not absolutely required for GTP hydrolysis by the Rho GTPases, the divalent ion apparently participates in the GTPase reaction, since the intrinsic GTP hydrolysis rates were enhanced 4-10-fold upon binding to Mg(2+), and k(cat) values of the Rho GTPase-activating protein (RhoGAP)-catalyzed reactions were significantly increased when Mg(2+) was present. Furthermore, the p50RhoGAP specificity for Cdc42 was lost in the absence of Mg(2+) cofactor. These studies directly demonstrate a role of Mg(2+) in regulating the kinetics of nucleotide binding and hydrolysis and in the GEF- and GAP-catalyzed reactions of Rho family GTPases. The results suggest that GEF facilitates nucleotide exchange by destabilizing both bound nucleotide and Mg(2+), whereas RhoGAP utilizes the Mg(2+) cofactor to achieve high catalytic efficiency

  12. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    SciTech Connect

    Feltner, D.E.; Marasco, W.A.


    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of (3H)FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM (3H)FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. (3H)FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of (3H)FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM (3H)FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state.

  13. Influence of carrier ligand NH hydrogen bonding to the O6 and phosphate group of guanine nucleotides in platinum complexes with a single guanine ligand.


    Carlone, M; Fanizzi, F P; Intini, F P; Margiotta, N; Marzilli, L G; Natile, G


    Coordinated N,N',N"-trimethyldiethylenetriamine (Me3dien) has several possible configurations: two have mirror symmetry (R,S configurations at the terminal nitrogens) and the terminal N-Me's anti or syn with respect to the central N-Me (anti-(R,S) and syn-(R,S) isomers, respectively), and two are nonsymmetrical (R,R and S,S configurations at terminal nitrogens, rac denotes a 1:1 mixture of the two isomers). For each configuration, two Me3dienPtG atropisomers can be formed (anti or syn orientation of central N-Me and G 06, G = guanine derivative), and these can be observed since the terminal N-Me's decrease the rate of G rotation about the Pt-N7 bond. In symmetrical syn-(R,S)-Me3dienPtG derivatives with G = 9-EtG and 3'-GMP, the anti rotamer, which can form O6-NH H-bonds, was slightly favored over the syn rotamer but never more than 2:1. This anti rotamer is also favored by lower steric repulsion between the terminal N-Me's and G O6; thus, the contribution of O6-NH H-bonding to the stability of the anti rotamer could be rather small. With G = 5'-GMP, an O6-NH H-bond in the anti rotamer and a phosphate-NH H-bond in the syn rotamer can form. Only the syn rotamer was detected in solution, indicating that NH H-bonds to 5'-phosphate are far more important than to O6, particularly since steric factors favor the anti rotamer. Interconversion between rotamers was faster for syn-(R,S)- than for rac-Me3dien derivatives. This appears to be determined by a smaller steric impediment to G rotation of two "quasi equatorial" N-Me's, both on one side of the platinum coordination plane (syn-(R,S) isomer), than one "quasi equatorial" and one "quasi axial" N-Me on either side of the coordination plane (rac isomer).

  14. Isolation of a gene encoding a developmentally regulated T cell-specific protein with a guanine nucleotide triphosphate-binding motif

    SciTech Connect

    Carlow, D.A.; Teh, H.S.; Marth, J.


    In this study, we describe a novel full length cDNA clone designated Tgtp that encodes a predicted 415-amino acid a T cell-specific guanine nucleotide triphosphate-binding protein (TGTP) bearing the characteristic motifs of a guanine nucleotide triphosphate (GTP) binding protein. Tgtp is expressed preferentially, if not exclusively, in T cells, and is up-regulated in both unfractionated and in purified CD4{sup +}8{sup +} thymocytes upon TCR cross-linking. In contrast, expression of Tgtp in peripheral T cells is maintained at relatively high levels and is not grossly affected by TCR cross-linking. Antiserum generated against synthetic peptides from the predicted TGTP amino acid sequence recognized a single protein with a molecular mass of {approx}50 kDa, corresponding well with the computed molecular mass of 47 kDa. The only known relative of Tgtp is MUSGTP, which is reportedly expressed in B cells and bears a GTP binding motif. Thus, the discovery of Tgtp resolves a subfamily of molecules with GTP binding motifs and apparent lymphoid lineage-restricted expression. Given the restricted expression pattern in T cells, the up-regulated expression observed in response to TCR signaling in immature thymocytes, and the presence of the motifs characteristic of GTP binding proteins, we suggest that TGTP may have an important function in T cell development and/or T cell activation. 51 refs., 6 figs.

  15. Phospholipase C-gamma1 is a guanine nucleotide exchange factor for dynamin-1 and enhances dynamin-1-dependent epidermal growth factor receptor endocytosis.


    Choi, Jang Hyun; Park, Jong Bae; Bae, Sun Sik; Yun, Sanguk; Kim, Hyeon Soo; Hong, Won-Pyo; Kim, Il-Shin; Kim, Jae Ho; Han, Mi Young; Ryu, Sung Ho; Patterson, Randen L; Snyder, Solomon H; Suh, Pann-Ghill


    Phospholipase C-gamma1 (PLC-gamma1), which interacts with a variety of signaling molecules through its two Src homology (SH) 2 domains and a single SH3 domain has been implicated in the regulation of many cellular functions. We demonstrate that PLC-gamma1 acts as a guanine nucleotide exchange factor (GEF) of dynamin-1, a 100 kDa GTPase protein, which is involved in clathrin-mediated endocytosis of epidermal growth factor (EGF) receptor. Overexpression of PLC-gamma1 increases endocytosis of the EGF receptor by increasing guanine nucleotide exchange activity of dynamin-1. The GEF activity of PLC-gamma1 is mediated by the direct interaction of its SH3 domain with dynamin-1. EGF-dependent activation of ERK and serum response element (SRE) are both up-regulated in PC12 cells stably overexpressing PLC-gamma1, but knockdown of PLC-gamma1 by siRNA significantly reduces ERK activation. These results establish a new role for PLC-gamma1 in the regulation of endocytosis and suggest that endocytosis of activated EGF receptors may mediate PLC-gamma1-dependent proliferation.

  16. Arf6 Guanine Nucleotide Exchange Factor Cytohesin-2 Binds to CCDC120 and Is Transported Along Neurites to Mediate Neurite Growth*

    PubMed Central

    Torii, Tomohiro; Miyamoto, Yuki; Tago, Kenji; Sango, Kazunori; Nakamura, Kazuaki; Sanbe, Atsushi; Tanoue, Akito; Yamauchi, Junji


    The mechanism of neurite growth is complicated, involving continuous cytoskeletal rearrangement and vesicular trafficking. Cytohesin-2 is a guanine nucleotide exchange factor for Arf6, an Arf family molecular switch protein, controlling cell morphological changes such as neuritogenesis. Here, we show that cytohesin-2 binds to a protein with a previously unknown function, CCDC120, which contains three coiled-coil domains, and is transported along neurites in differentiating N1E-115 cells. Transfection of the small interfering RNA (siRNA) specific for CCDC120 into cells inhibits neurite growth and Arf6 activation. When neurites start to extend, vesicles containing CCDC120 and cytohesin-2 are transported in an anterograde manner rather than a retrograde one. As neurites continue extension, anterograde vesicle transport decreases. CCDC120 knockdown inhibits cytohesin-2 localization into vesicles containing CCDC120 and diffuses cytohesin-2 in cytoplasmic regions, illustrating that CCDC120 determines cytohesin-2 localization in growing neurites. Reintroduction of the wild type CCDC120 construct into cells transfected with CCDC120 siRNA reverses blunted neurite growth and Arf6 activity, whereas the cytohesin-2-binding CC1 region-deficient CCDC120 construct does not. Thus, cytohesin-2 is transported along neurites by vesicles containing CCDC120, and it mediates neurite growth. These results suggest a mechanism by which guanine nucleotide exchange factor for Arf6 is transported to mediate neurite growth. PMID:25326380

  17. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    SciTech Connect

    Hepler, J.R.; Harden, T.K.


    Formation of the inositol phosphates (InsP), InsP/sub 3/, InsP/sub 2/, and InsP/sub 1/ was increased in a concentration dependent manner (K/sub 0.5/ approx. 5 by GTP..sigma..S in washed membranes prepared from /sup 3/H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTP..gamma..S and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 GTP..gamma..S, carbachol stimulated (K/sub 0.5/ approx. 10 M) the formation of InsP above the level achieved with GTP..gamma..S alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 carbachol was GTP..gamma..S > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTP..gamma..S or GTP..gamma..S plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTP..gamma..S in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells.

  18. Architecture and mechanism of the late endosomal Rab7-like Ypt7 guanine nucleotide exchange factor complex Mon1–Ccz1

    PubMed Central

    Kiontke, Stephan; Langemeyer, Lars; Kuhlee, Anne; Schuback, Saskia; Raunser, Stefan; Ungermann, Christian; Kümmel, Daniel


    The Mon1–Ccz1 complex (MC1) is the guanine nucleotide exchange factor (GEF) for the Rab GTPase Ypt7/Rab7 and is required for endosomal maturation and fusion at the vacuole/lysosome. Here we present the overall architecture of MC1 from Chaetomium thermophilum, and in combining biochemical studies and mutational analysis in yeast, we identify the domains required for catalytic activity, complex assembly and localization of MC1. The crystal structure of a catalytic MC1 core complex bound to Ypt7 provides mechanistic insight into its function. We pinpoint the determinants that allow for a discrimination of the Rab7-like Ypt7 over the Rab5-like Vps21, which are both located on the same membrane. MC1 shares structural similarities with the TRAPP complex, but employs a novel mechanism to promote nucleotide exchange that utilizes a conserved lysine residue of Ypt7, which is inserted upon MC1 binding into the nucleotide-binding pocket of Ypt7 and contributes to specificity. PMID:28051187

  19. The Rho guanine nucleotide exchange factors Intersectin 1L and β-Pix control calcium-regulated exocytosis in neuroendocrine PC12 cells.


    Momboisse, F; Ory, S; Ceridono, M; Calco, V; Vitale, N; Bader, M-F; Gasman, S


    GTPases of the Rho family are molecular switches that play an important role in a wide range of membrane-trafficking processes including neurotransmission and hormone release. We have previously demonstrated that RhoA and Cdc42 regulate calcium-dependent exocytosis in chromaffin cells by controlling actin dynamics, whereas Rac1 regulates lipid organisation. These findings raised the question of the upstream mechanism activating these GTPases during exocytosis. The guanine nucleotide exchange factors (GEFs) that catalyse the exchange of GDP for GTP are crucial elements regulating Rho signalling. Using an RNA interference approach, we have recently demonstrated that the GEFs Intersectin-1L and β-Pix, play essential roles in neuroendocrine exocytosis by controlling the activity of Cdc42 and Rac1, respectively. This review summarizes these results and discusses the functional importance of Rho GEFs in the exocytotic machinery in neuroendocrine cells.

  20. Regulation of presynaptic terminal organization by C. elegans RPM-1, a putative guanine nucleotide exchanger with a RING-H2 finger domain.


    Zhen, M; Huang, X; Bamber, B; Jin, Y


    Presynaptic terminals contain highly organized subcellular structures to facilitate neurotransmitter release. In C. elegans, the typical presynaptic terminal has an electron-dense active zone surrounded by synaptic vesicles. Loss-of-function mutations in the rpm-1 gene result in abnormally structured presynaptic terminals in GABAergic neuromuscular junctions (NMJs), most often manifested as a single presynaptic terminal containing multiple active zones. The RPM-1 protein has an RCC1-like guanine nucleotide exchange factor (GEF) domain and a RING-H2 finger. RPM-1 is most similar to the Drosophila presynaptic protein Highwire (HIW) and the mammalian Myc binding protein Pam. RPM-1 is localized to the presynaptic region independent of synaptic vesicles and functions cell autonomously. The temperature-sensitive period of rpm-1 coincides with the time of synaptogenesis. rpm-1 may regulate the spatial arrangement, or restrict the formation, of presynaptic structures.

  1. The effects of acute exposure to ethanol on neurotensin and guanine nucleotide-stimulation of phospholipase C activity in intact NIE-115 neuroblastoma cells

    SciTech Connect

    Smith, T.L. )


    Both ethanol and neurotensin produce sedation and hypothermia. When administered in combination the behavioral effects of these two substances are potentiated. In order to better understand the biochemical nature of this interaction, the direct effects of ethanol on neurotensin receptors and an associated signal transduction process were determined in NIE-115 neuroblastoma cells. Ethanol in physiologically relevant concentrations significantly reduced neurotensin stimulated ({sup 3}H)inositol phosphate production while having no effect on the specific binding of ({sup 3}H)neurotensin. In addition, ethanol up to 200 mM had no effect on GTPYS mediated ({sup 3}H)inositol phosphate production. The results indicate that acute exposure ethanol partially disrupts the normal coupling of activated neurotensin receptors to the guanine nucleotide binding protein associated with phospholipase C.

  2. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    SciTech Connect

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. )


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  3. Overexpression of the Rho-guanine nucleotide exchange factor ECT2 inhibits nuclear translocation of nuclear receptor CAR in the mouse liver.


    Hosseinpour, Fardin; Timsit, Yoav; Koike, Chika; Matsui, Kenji; Yamamoto, Yukio; Moore, Rick; Negishi, Masahiko


    Various drugs such as phenobarbital (PB) trigger translocation of constitutive active/adrostane receptor (CAR) from the cytoplasm into the nucleus of mouse liver cells without directly binding to the receptor. We have now characterized the guanine nucleotide exchange factor epithelial cell-transforming gene 2 (ECT2) as a PB-inducible factor as well as a cellular signal that represses PB-triggered nuclear translocation of CAR. When CFP-tagged ECT2 was co-expressed with YFP-tagged CAR in the liver of Car(-/-) mice, ECT2 repressed CAR nuclear translocation. Coexpression of various deletion mutants delineated this repressive activity to the tandem Dbl homology/pleckstrin homology domains of ECT2 and to their cytosolic expression. CAR directly bound to the PH domain. Thus, ECT2 may comprise a part of the PB response signal regulating the intracellular trafficking of CAR.

  4. Modeling and stochastic simulation of the Ras/cAMP/PKA pathway in the yeast Saccharomyces cerevisiae evidences a key regulatory function for intracellular guanine nucleotides pools.


    Cazzaniga, Paolo; Pescini, Dario; Besozzi, Daniela; Mauri, Giancarlo; Colombo, Sonia; Martegani, Enzo


    In the yeast Saccharomyces cerevisiae, the Ras/cAMP/PKA pathway is involved in the regulation of metabolism and cell cycle progression. The pathway is tightly regulated by several control mechanisms, as the feedback cycle ruled by the activity of phosphodiesterase. Here, we present a discrete mathematical model for the Ras/cAMP/PKA pathway that considers its principal cytoplasmic components and their mutual interactions. The tau-leaping algorithm is then used to perform stochastic simulations of the model. We investigate this system under various conditions, and we test how different values of several stochastic reaction constants affect the pathway behaviour. Finally, we show that the level of guanine nucleotides, GTP and GDP, could be relevant metabolic signals for the regulation of the whole pathway.

  5. Refinement of DNA structures through near-edge X-ray absorption fine structure analysis: applications on guanine and cytosine nucleobases, nucleosides, and nucleotides.


    Hua, Weijie; Gao, Bin; Li, Shuhua; Agren, Hans; Luo, Yi


    In this work we highlight the potential of NEXAFS—near-edge X-ray absorption fine structure—analysis to perform refinements of hydrogen-bond structure in DNA. For this purpose we have carried out first-principle calculations of the N1s NEXAFS spectra of the guanine and cytosine nucleobases and their tautomers, nucleosides, and nucleotides in the gas phase, as well as for five crystal structures of guanine, cytosine, or guanosine. The spectra all clearly show imine (π1*) and amine (π2*) nitrogen absorption bands with a characteristic energy difference (Δ). Among all of the intramolecule covalent connections, the tautomerism of hydrogens makes the largest influence, around ±0.4−0.5 eV change of Δ, to the spectra due to a switch of single−double bonds. Deoxyribose and ribose sugars can cause at most 0.2 eV narrowing of Δ, while the phosphate groups have nearly negligible effects on the spectra. Two kinds of intermolecule interactions are analyzed, the hydrogen bonds and the stacking effect, by comparing “compressed” and “expanded” models or by comparing models including or excluding the nearest stacking molecules. The shortening of hydrogen-bond length by 0.2−0.3 Å can result in the reduction of Δ by 0.2−0.8 eV. This is because the hydrogen bonds make the electrons more delocalized, and the amine and imine nitrogens become less distinguishable. Moreover, the hydrogen bond has a different ability to influence the spectra of different crystals, with guanine crystals as the largest (change by 0.8 eV) and the guanosine crystal as the smallest (change by 0.2 eV). The stacking has negligible effects on the spectra in all studied systems. A comparison of guanosine to guanine crystals shows that the sugars in the crystal could create “blocks” in the π-and hydrogen bonds network of bases and thus makes the imine and amine nitrogens more distinguishable with a larger Δ. Our theoretical calculations offer a good match with experimental findings

  6. The brefeldin A-inhibited guanine nucleotide-exchange protein, BIG2, regulates the constitutive release of TNFR1 exosome-like vesicles.


    Islam, Aminul; Shen, Xiaoyan; Hiroi, Toyoko; Moss, Joel; Vaughan, Martha; Levine, Stewart J


    The type I, 55-kDa tumor necrosis factor receptor (TNFR1) is released from cells to the extracellular space where it can bind and modulate TNF bioactivity. Extracellular TNFR1 release occurs by two distinct pathways: the inducible proteolytic cleavage of TNFR1 ectodomains and the constitutive release of full-length TNFR1 in exosome-like vesicles. Regulation of both TNFR1 release pathways appears to involve the trafficking of cytoplasmic TNFR1 vesicles. Vesicular trafficking is controlled by ADP-ribosylation factors (ARFs), which are active in the GTP-bound state and inactive when bound to GDP. ARF activation is enhanced by guanine nucleotide-exchange factors that catalyze replacement of GDP by GTP. We investigated whether the brefeldin A (BFA)-inhibited guanine nucleotide-exchange proteins, BIG1 and/or BIG2, are required for TNFR1 release from human umbilical vein endothelial cells. Effects of specific RNA interference (RNAi) showed that BIG2, but not BIG1, regulated the release of TNFR1 exosome-like vesicles, whereas neither BIG2 nor BIG1 was required for the IL-1beta-induced proteolytic cleavage of TNFR1 ectodomains. BIG2 co-localized with TNFR1 in diffusely distributed cytoplasmic vesicles, and the association between BIG2 and TNFR1 was disrupted by BFA. Consistent with the preferential activation of class I ARFs by BIG2, ARF1 and ARF3 participated in the extracellular release of TNFR1 exosome-like vesicles in a nonredundant and additive fashion. We conclude that the association between BIG2 and TNFR1 selectively regulates the extracellular release of TNFR1 exosome-like vesicles from human vascular endothelial cells via an ARF1- and ARF3-dependent mechanism.

  7. The auto-inhibitory state of Rho guanine nucleotide exchange factor ARHGEF5/TIM can be relieved by targeting its SH3 domain with rationally designed peptide aptamers.


    He, Ping; Tan, De-Li; Liu, Hong-Xiang; Lv, Feng-Lin; Wu, Wei


    The short isoform of Rho guanine nucleotide exchange factor ARHGEF5 is known as TIM, which plays diverse roles in, for example, tumorigenesis, neuronal development and Src-induced podosome formation through the activation of its substrates, the Rho family of GTPases. The activation is auto-inhibited by a putative helix N-terminal to the DH domain of TIM, which is stabilized by the intramolecular interaction of C-terminal SH3 domain with a poly-proline sequence between the putative helix and the DH domain. In this study, we systematically investigated the structural basis, energetic landscape and biological implication underlying TIM auto-inhibition by using atomistic molecular dynamics simulations and binding free energy analysis. The computational study revealed that the binding of SH3 domain to poly-proline sequence is the prerequisite for the stabilization of TIM auto-inhibition. Thus, it is suggested that targeting SH3 domain with competitors of the poly-proline sequence would be a promising strategy to relieve the auto-inhibitory state of TIM. In this consideration, we rationally designed a number of peptide aptamers for competitively inhibiting the SH3 domain based on modeled TIM structure and computationally generated data. Peptide binding test and guanine nucleotide exchange analysis solidified that these designed peptides can both bind to the SH3 domain potently and activate TIM-catalyzed RhoA exchange reaction effectively. Interestingly, a positive correlation between the peptide affinity and induced exchange activity was observed. In addition, separate mutation of three conserved residues Pro49, Pro52 and Lys54 - they are required for peptide recognition by SH3 domain -- in a designed peptide to Ala would completely abolish the capability of this peptide activating TIM. All these come together to suggest an intrinsic relationship between peptide binding to SH3 domain and the activation of TIM.

  8. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein regulates neurite development via PI3K-AKT and ERK signaling pathways.


    Zhou, C; Li, C; Li, D; Wang, Y; Shao, W; You, Y; Peng, J; Zhang, X; Lu, L; Shen, X


    The elongation of neuron is highly dependent on membrane trafficking. Brefeldin A (BFA)-inhibited guanine nucleotide-exchange protein 1 (BIG1) functions in the membrane trafficking between the Golgi apparatus and the plasma membrane. BFA, an uncompetitive inhibitor of BIG1 can inhibit neurite outgrowth and polarity development. In this study, we aimed to define the possible role of BIG1 in neurite development and to further investigate the potential mechanism. By immunostaining, we found that BIG1 was extensively colocalized with synaptophysin, a marker for synaptic vesicles in soma and partly in neurites. The amount of both protein and mRNA of BIG1 were up-regulated during rat brain development. BIG1 depletion significantly decreased the neurite length and inhibited the phosphorylation of phosphatidylinositide 3-kinase (PI3K) and protein kinase B (AKT). Inhibition of BIG1 guanine nucleotide-exchange factor (GEF) activity by BFA or overexpression of the dominant-negative BIG1 reduced PI3K and AKT phosphorylation, indicating regulatory effects of BIG1 on PI3K-AKT signaling pathway is dependent on its GEF activity. BIG1 siRNA or BFA treatment also significantly reduced extracellular signal-regulated kinase (ERK) phosphorylation. Overexpression of wild-type BIG1 significantly increased ERK phosphorylation, but the dominant-negative BIG1 had no effect on ERK phosphorylation, indicating the involvement of BIG1 in ERK signaling regulation may not be dependent on its GEF activity. Our result identified a novel function of BIG1 in neurite development. The newly recognized function integrates the function of BIG1 in membrane trafficking with the activation of PI3K-AKT and ERK signaling pathways which are critical in neurite development. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  9. Flow cytometry for real-time measurement of guanine nucleotide binding and exchange by Ras-like GTPases.


    Schwartz, Samantha L; Tessema, Mathewos; Buranda, Tione; Pylypenko, Olena; Rak, Alexey; Simons, Peter C; Surviladze, Zurab; Sklar, Larry A; Wandinger-Ness, Angela


    Ras-like small GTPases cycle between GTP-bound active and GDP-bound inactive conformational states to regulate diverse cellular processes. Despite their importance, detailed kinetic or comparative studies of family members are rarely undertaken due to the lack of real-time assays measuring nucleotide binding or exchange. Here we report a bead-based flow cytometric assay that quantitatively measures the nucleotide binding properties of glutathione-S-transferase (GST) chimeras for prototypical Ras family members Rab7 and Rho. Measurements are possible in the presence or absence of Mg(2+), with magnesium cations principally increasing affinity and slowing nucleotide dissociation rates 8- to 10-fold. GST-Rab7 exhibited a 3-fold higher affinity for guanosine diphosphate (GDP) relative to guanosine triphosphate (GTP) that is consistent with a 3-fold slower dissociation rate of GDP. Strikingly, GST-Rab7 had a marked preference for GTP with ribose ring-conjugated BODIPY FL. The more commonly used gamma-NH-conjugated BODIPY FL GTP analogue failed to bind to GST-Rab7. In contrast, both BODIPY analogues bound equally well to GST-RhoA and GST-RhoC. Comparisons of the GST-Rab7 and GST-RhoA GTP binding pockets provide a structural basis for the observed binding differences. In sum, the flow cytometric assay can be used to measure nucleotide binding properties of GTPases in real time and to quantitatively assess differences between GTPases.

  10. A glutamic finger in the guanine nucleotide exchange factor ARNO displaces Mg2+ and the beta-phosphate to destabilize GDP on ARF1.

    PubMed Central

    Béraud-Dufour, S; Robineau, S; Chardin, P; Paris, S; Chabre, M; Cherfils, J; Antonny, B


    The Sec7 domain of the guanine nucleotide exchange factor ARNO (ARNO-Sec7) is responsible for the exchange activity on the small GTP-binding protein ARF1. ARNO-Sec7 forms a stable complex with the nucleotide-free form of [Delta17]ARF1, a soluble truncated form of ARF1. The crystal structure of ARNO-Sec7 has been solved recently, and a site-directed mutagenesis approach identified a hydrophobic groove and an adjacent hydrophilic loop as the ARF1-binding site. We show that Glu156 in the hydrophilic loop of ARNO-Sec7 is involved in the destabilization of Mg2+ and GDP from ARF1. The conservative mutation E156D and the charge reversal mutation E156K reduce the exchange activity of ARNO-Sec7 by several orders of magnitude. Moreover, [E156K]ARNO-Sec7 forms a complex with the Mg2+-free form of [Delta17]ARF1-GDP without inducing the release of GDP. Other mutations in ARNO-Sec7 and in [Delta17]ARF1 suggest that prominent hydrophobic residues of the switch I region of ARF1 insert into the groove of the Sec7 domain, and that Lys73 of the switch II region of ARF1 forms an ion pair with Asp183 of ARNO-Sec7. PMID:9649435

  11. Escherichia coli UMP-kinase, a member of the aspartokinase family, is a hexamer regulated by guanine nucleotides and UTP.


    Serina, L; Blondin, C; Krin, E; Sismeiro, O; Danchin, A; Sakamoto, H; Gilles, A M; Bârzu, O


    The pyrH gene, encoding UMP-kinase from Escherichia coli, was cloned using as a genetic probe the property of the carAB operon to be controlled for its expression by the concentration of cytoplasmic UTP. The open reading frame of the pyrH gene of 723 bp was found to be identical to that of the smbA gene [Yamanaka, K., et al. (1992) J. Bacteriol. 174, 7517-7526], previously described as being involved in chromosome partitioning in E. coli. The bacterial UMP-kinase did not display significant sequence similarity to known nucleoside monophosphate kinases. On the contrary, it exhibited similarity with three families of enzymes including aspartokinases, glutamate kinases, and Pseudomonas aeruginosa carbamate kinase. UMP-kinase overproduced in E. coli was purified to homogeneity and analyzed for its structural and catalytic properties. The protein consists of six identical subunits, each of 240 amino acid residues (the N-terminal methionine residue is missing in the expressed protein). Upon excitation at 295 nm, the bacterial enzyme exhibits a fluorescence emission spectrum with maximum at 332 nm which indicates that the single tryptophan residue of the protein (Trp119) is located in a hydrophobic environment. Like other enzymes involved in the de novo synthesis of pyrimidine nucleotides, UMP-kinase of E. coli is subject to regulation by nucleotides: GTP is an allosteric activator, whereas UTP serves as an allosteric inhibitor. UTP and UDP, but none of the other nucleotides tested such as GTP, ATP, and UMP, enhanced the fluorescence of the protein. The sigmoidal shape of the dose-response curve indicated cooperativity in binding of UTP and UDP.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Two forms of the bovine brain Go that stimulate the inositol trisphosphate-mediated Cl- currents in Xenopus oocytes. Distinct guanine nucleotide binding properties.


    Padrell, E; Carty, D J; Moriarty, T M; Hildebrandt, J D; Landau, E M; Iyengar, R


    Heterotrimeric GTP-binding proteins from bovine brain were resolved by fast protein liquid chromatography chromatography using Mono Q columns. Two distinct forms of the protein Go were identified. Both forms had stochiometric amounts of alpha- and beta gamma-subunits. The a-subunits of both forms were recognized by an alpha o-specific antiserum, but not by any of the alpha i-specific antisera. The two forms showed distinct migration patterns on 9% sodium dodecyl sulfate-polyacrylamide gels containing 4-8 M urea gradients. Neither form comigrated with the recombinant alpha o1. Both the recombinant alpha o1 and the most abundant form of Go were recognized by an antiserum, H-660, against a peptide encoding amino acids 3-17 of alpha i2. H-660 has been shown previously to recognize alpha o and alpha i (Mumby, S. M., Pang, I. K., Gilman, A. G., and Sternweis, P. C. (1988) J. Biol. Chem. 263, 2020-2026). This more abundant form is called Go A most likely corresponds to the cloned alpha o1. The less abundant form, Go B, was not recognized by H-660. However, both forms of bovine brain Go were recognized by GC/2, an antiserum against the N-terminal region of alpha o1. Hence alpha oA and alpha oB may be different in their N terminus regions. Neither form of bovine brain Go was recognized by an antisera made to a peptide encoding the unique regions of the cloned alpha o2 from HIT cells (Hsu W. H., Rudolph, U., Sanford, J., Bertrand, P., Olate, J., Nelson, C., Moss, L.E., Boyd, A. E., III, Codina, J., and Birnbaumer, L. (1990) J. Biol. Chem. 265, 11220-11226). Go A and Go B have similar guanine nucleotide binding and release properties. Both release GDP within 1 min in the absence of added Mg2+. Both bind guanosine (GTP gamma S) rapidly as well. However Go A binds GTP gamma S about 2.5-fold faster than Go B, in the absence of added Mg2+ ion. Both forms of Go as well as the recombinant alpha o (alpha o1) can increase muscarinic stimulation of inositol trisphosphate-mediated Cl

  13. New ribose-modified fluorescent analogs of adenine and guanine nucleotides available as substrates for various enzymes.


    Hiratsuka, T


    The synthesis of fluorescent derivatives of nucleosides and nucleotides, by reaction with isatoic anhydride in aqueous solution at mild pH and temperature, yielding their 3'-O-anthraniloyl derivatives, is here described. The N-methylanthraniloyl derivatives were also synthesized by reaction with N-methylisatoic anhydride. Upon excitation at 330-350 nm these derivatives exhibited maximum fluorescence emission at 430-445 nm in aqueous solution with quantum yields of 0.12-0.24. Their fluorescence was sensitive to the polarity of the solvent; in N,N-dimethylformamide the quantum yields were 0.83-0.93. The major differences between the two fluorophores were the longer wavelength of the emission maximum of the N-methylanthraniloyl group and its greater quantum yield in water. All anthraniloyl derivatives, as well as the N-methylanthraniloyl ones, had virtually identical fluorescent properties, regardless of their base structures. The ATP derivatives showed considerable substrate activity as a replacement of ATP with adenylate kinase, guanylate kinase, glutamine synthetase, myosin ATPase and sodium-potassium transport ATPase. The ADP derivatives were good substrates for creatine kinase and glutamine synthetase (gamma-glutamyl transfer activity). The GMP and adenosine derivatives were substrates for guanylate kinase and adenosine deaminase, respectively. All derivatives had only slightly altered Km values for these enzymes. While more fluorescent in water, the N-methylanthraniloyl derivatives were found to show relatively low substrate activities against some of these enzymes. The results indicate that these ribose-modified nucleosides and nucleotides can be versatile fluorescent substrate analogs for various enzymes.

  14. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1.


    Fleming, Ian N; Batty, Ian H; Prescott, Alan R; Gray, Alex; Kular, Gursant S; Stewart, Hazel; Downes, C Peter


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P(2) to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P(2) breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P(3) concentrations, rather than the closely related lipid, PtdIns(3,4)P(2). Finally, the data demonstrate that PtdIns(4,5)P(2) and PtdIns(3,4,5)P(3) bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo.

  15. The GIT/PIX complex: an oligomeric assembly of GIT family ARF GTPase-activating proteins and PIX family Rac1/Cdc42 guanine nucleotide exchange factors.


    Premont, Richard T; Perry, Stephen J; Schmalzigaug, Robert; Roseman, J Tyler; Xing, Yanghui; Claing, Audrey


    GIT proteins are GTPase-activating proteins (GAPs) for ADP-ribosylation factor (ARF) small GTP-binding proteins, and interact with the PIX family of Rac1/Cdc42 guanine nucleotide exchange factors. GIT and PIX transiently localize p21-activated protein kinases (PAKs) to remodeling focal adhesions through binding to paxillin. To understand the role of these interactions, the association of GIT and PIX proteins was examined in detail. Two separable binding interactions link GIT and PIX proteins, GIT and PIX proteins each dimerize and a beta-PIX fragment containing the GIT-binding region failed to inhibit the association of the GIT and PIX proteins. Endogenous GIT and PIX co-fractionate at a very high molecular size. Purified 6xHis-tagged beta-PIX from Sf9 cells co-expressing untagged GIT1 yields recombinant GIT1/beta-PIX complexes that have equal amounts of beta-PIX and GIT1 and co-fractionate at the same large size as native GIT/PIX complexes. Thus, GIT and PIX proteins are tightly associated as a multimeric nexus capable of linking together important signaling molecules, including PAKs.

  16. The Shank family of postsynaptic density proteins interacts with and promotes synaptic accumulation of the beta PIX guanine nucleotide exchange factor for Rac1 and Cdc42.


    Park, Eunhye; Na, Moonseok; Choi, Jeonghoon; Kim, Seho; Lee, Jae-Ran; Yoon, Jiyoung; Park, Dongeun; Sheng, Morgan; Kim, Eunjoon


    The Shank/ProSAP family of multidomain proteins is known to play an important role in organizing synaptic multiprotein complexes. Here we report a novel interaction between Shank and beta PIX, a guanine nucleotide exchange factor for the Rac1 and Cdc42 small GTPases. This interaction is mediated by the PDZ domain of Shank and the C-terminal leucine zipper domain and the PDZ domain-binding motif at the extreme C terminus of beta PIX. Shank colocalizes with beta PIX at excitatory synaptic sites in cultured neurons. In brain, Shank forms a complex with beta PIX and beta PIX-associated signaling molecules including p21-associated kinase (PAK), an effector kinase of Rac1/Cdc42. Importantly, overexpression of Shank in cultured neurons promotes synaptic accumulation of beta PIX and PAK. Considering the involvement of Rac1 and PAK in spine dynamics, these results suggest that Shank recruits beta PIX and PAK to spines for the regulation of postsynaptic structure.

  17. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1

    PubMed Central


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P2 to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P2 breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P3 concentrations, rather than the closely related lipid, PtdIns(3,4)P2. Finally, the data demonstrate that PtdIns(4,5)P2 and PtdIns(3,4,5)P3 bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo. PMID:15242348

  18. The guanine nucleotide exchange factor Net1 facilitates the specification of dorsal cell fates in zebrafish embryos by promoting maternal β-catenin activation.


    Wei, Shi; Dai, Miaomiao; Liu, Zhaoting; Ma, Yuanqing; Shang, Hanqiao; Cao, Yu; Wang, Qiang


    Wnt/β-catenin signaling is essential for the initiation of dorsal-ventral patterning during vertebrate embryogenesis. Maternal β-catenin accumulates in dorsal marginal nuclei during cleavage stages, but its critical target genes essential for dorsalization are silent until mid-blastula transition (MBT). Here, we find that zebrafish net1, a guanine nucleotide exchange factor, is specifically expressed in dorsal marginal blastomeres after MBT, and acts as a zygotic factor to promote the specification of dorsal cell fates. Loss- and gain-of-function experiments show that the GEF activity of Net1 is required for the activation of Wnt/β-catenin signaling in zebrafish embryos and mammalian cells. Net1 dissociates and activates PAK1 dimers, and PAK1 kinase activation causes phosphorylation of S675 of β-catenin after MBT, which ultimately leads to the transcription of downstream target genes. In summary, our results reveal that Net1-regulated β-catenin activation plays a crucial role in the dorsal axis formation during zebrafish development.

  19. In vivo expression of the Arf6 Guanine-nucleotide exchange factor cytohesin-1 in mice exhibits enhanced myelin thickness in nerves.


    Torii, Tomohiro; Miyamoto, Yuki; Onami, Naoko; Tsumura, Hideki; Nemoto, Noriko; Kawahara, Katsumasa; Kato, Minoru; Kotera, Jun; Nakamura, Kazuaki; Tanoue, Akito; Yamauchi, Junji


    The myelin sheath consists of a unique multiple layer structure that acts as an insulator between neuronal axons to enhance the propagation of the action potential. In neuropathies such as demyelinating or dismyelinating diseases, chronic demyelination and defective remyelination occur repeatedly, leading to more severe neuropathy. As yet, little is known about the possibility of drug target-specific medicine for such diseases. In the developing peripheral nervous system (PNS), myelin sheaths form as Schwann cells wrap individual axons. It is thought that the development of a drug promoting myelination by Schwann cells would provide effective therapy against peripheral nerve disorders: to test such treatment, genetically modified mice overexpressing the drug target molecules are needed. We previously identified an Arf6 activator, the guanine-nucleotide exchange factor cytohesin-1, as the signaling molecule controlling myelination of peripheral axons by Schwann cells; yet, the important issue of whether cytohesin-1 itself promotes myelin thickness in vivo has remained unclear. Herein, we show that, in mouse PNS nerves, Schwann cell-specific expression of wild-type cytohesin-1 exhibits enhanced myelin thickness. Downstream activation of Arf6 is also seen in these transgenic mice, revealing the involvement of the cytohesin-1 and Arf6 signaling unit in promoting myelination. These results suggest that cytohesin-1 may be a candidate for the basis of a therapy for peripheral neuropathies through its enhancement of myelin thickness.

  20. Assessment of roles for the Rho-specific guanine nucleotide dissociation inhibitor Ly-GDI in platelet function: a spatial systems approach.


    Ngo, Anh T P; Thierheimer, Marisa L D; Babur, Özgün; Rocheleau, Anne D; Huang, Tao; Pang, Jiaqing; Rigg, Rachel A; Mitrugno, Annachiara; Theodorescu, Dan; Burchard, Julja; Nan, Xiaolin; Demir, Emek; McCarty, Owen J T; Aslan, Joseph E


    On activation at sites of vascular injury, platelets undergo morphological alterations essential to hemostasis via cytoskeletal reorganizations driven by the Rho GTPases Rac1, Cdc42, and RhoA. Here we investigate roles for Rho-specific guanine nucleotide dissociation inhibitor proteins (RhoGDIs) in platelet function. We find that platelets express two RhoGDI family members, RhoGDI and Ly-GDI. Whereas RhoGDI localizes throughout platelets in a granule-like manner, Ly-GDI shows an asymmetric, polarized localization that largely overlaps with Rac1 and Cdc42 as well as microtubules and protein kinase C (PKC) in platelets adherent to fibrinogen. Antibody interference and platelet spreading experiments suggest a specific role for Ly-GDI in platelet function. Intracellular signaling studies based on interactome and pathways analyses also support a regulatory role for Ly-GDI, which is phosphorylated at PKC substrate motifs in a PKC-dependent manner in response to the platelet collagen receptor glycoprotein (GP) VI-specific agonist collagen-related peptide. Additionally, PKC inhibition diffuses the polarized organization of Ly-GDI in spread platelets relative to its colocalization with Rac1 and Cdc42. Together, our results suggest a role for Ly-GDI in the localized regulation of Rho GTPases in platelets and hypothesize a link between the PKC and Rho GTPase signaling systems in platelet function. Copyright © 2017 the American Physiological Society.

  1. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange factor, is required for GABA-gated Cl⁻ influx through regulation of GABAA receptor trafficking.


    Li, Cuixian; Chen, Shaorui; Yu, Yang; Zhou, Chun; Wang, Ying; Le, Kang; Li, Dong; Shao, Weiwei; Lu, Liang; You, Yan; Peng, Jin; Huang, Heqing; Liu, Peiqing; Shen, Xiaoyan


    GABAA receptors (GABAARs) mediate the majority of fast synaptic inhibition. Trafficking regulation and protein-protein interactions that maintain the appropriate number of GABAARs at the cell surface are considered to be important mechanisms for controlling the strength of synaptic inhibition. Here, we report that BIG1, a brefeldin A (BFA)-inhibited guanine nucleotide-exchange factor (GEF) which has a known role in vesicle trafficking, is a new binding partner of GABAARs. Treatment of neurons with BFA, an uncompetitive inhibitor of BIG1 GEF activity, or depletion of BIG1 by small RNA interference (siRNA) significantly decreased GABAARs at the neuronal surface and suppressed GABA-gated influx of chloride ions. Over-expression of HA-tagged BIG1-E793K, a dominant-negative mutant, also significantly decreased GABAARs at the neuronal surface, but had no effect on the total amount of GABAARs. Inhibition of GABAAR endocytosis by muscimol increased both GABAARs and BIG1 at the neuronal surface in a time-dependent fashion, and this increase could be abolished by bicuculline. Finally, depletion of BIG1 by siRNA inhibited the muscimol-stimulated increase of GABAARs. Those data suggest an important function of BIG1 in trafficking of GABAARs to the cell surface through its GEF activity. Thus, we identify an important role of BIG1 in modulating GABA-gated Cl(-) influx through the regulation of cell surface expression of GABAARs.

  2. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila

    PubMed Central

    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it’s functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila. PMID:27015411

  3. Reconstitution of rate brain /mu/ opioid receptors with purified guanine nucleotide-binding regulatory proteins, G/sub i/ and G/sub o/

    SciTech Connect

    Ueda, Hiroshi; Harada, Hitoshi; Nozaki, Masakatsu; Katada, Toshiaki; Ui, Michio; Satoh, Masamichi; Takagi, Hiroshi


    Reconstitution of purified /mu/ opioid receptors with purified guanine nucleotide-binding regulatory proteins (G proteins) was investigated. The purified /mu/ opioid receptor (pI 5.6) migrated as a single M/sub r/ 58,000 polypeptide by NaDodSO/sub 4//PAGE, a value identical to that obtained by affinity cross-linking purified /mu/ receptors. When purified /mu/ receptors were reconstituted with purified G/sub i/, the G protein that mediates the inhibition of adenylate cyclase, the displacement of (/sup 3/H)naloxone binding by (D-Ala/sup 2/,MePhe/sup 4/,Gly-ol/sup 5/)enkephalin was increased 215-fold; this increase was abolished by adding 100 /mu/M guanosine 5'-(/gamma/-thio)triphosphate. Similar increases in agonist displacement of (/sup 3/H)naloxone binding (33-fold) and its abolition by guanosine 5'-(/gamma/-thio)triphosphate were observed with G/sub o/, the G protein of unknown function, but not with the v-Ki-ras protein p.21. The stoichiometry was such that the stimulation of 1 mol of /mu/ receptor led to the binding of (/sup 3/H)guanosine 5'-(/beta/,/gamma/-imido)triphosphate to 2.5 mol of G/sub i/ or to 1.37 mol of G/sub o/. These results suggest that the purified /mu/ opioid receptor is functionally coupled to G/sub i/ and G/sub o/ in the reconstituted phospholipid vesicles.

  4. The RhoA guanine nucleotide exchange factor, LARG, mediates ICAM-1-dependent mechanotransduction in endothelial cells to stimulate transendothelial migration.


    Lessey-Morillon, Elizabeth C; Osborne, Lukas D; Monaghan-Benson, Elizabeth; Guilluy, Christophe; O'Brien, E Timothy; Superfine, Richard; Burridge, Keith


    RhoA-mediated cytoskeletal rearrangements in endothelial cells (ECs) play an active role in leukocyte transendothelial cell migration (TEM), a normal physiological process in which leukocytes cross the endothelium to enter the underlying tissue. Although much has been learned about RhoA signaling pathways downstream from ICAM-1 in ECs, little is known about the consequences of the tractional forces that leukocytes generate on ECs as they migrate over the surface before TEM. We have found that after applying mechanical forces to ICAM-1 clusters, there is an increase in cellular stiffening and enhanced RhoA signaling compared with ICAM-1 clustering alone. We have identified that leukemia-associated Rho guanine nucleotide exchange factor (LARG), also known as Rho GEF 12 (ARHGEF12) acts downstream of clustered ICAM-1 to increase RhoA activity, and that this pathway is further enhanced by mechanical force on ICAM-1. Depletion of LARG decreases leukocyte crawling and inhibits TEM. To our knowledge, this is the first report of endothelial LARG regulating leukocyte behavior and EC stiffening in response to tractional forces generated by leukocytes.

  5. Intersectin 1L Guanine Nucleotide Exchange Activity Is Regulated by Adjacent src Homology 3 Domains That Are Also Involved in Endocytosis

    PubMed Central

    Zamanian, Jennifer L.; Kelly, Regis B.


    Intersectin 1L is a scaffolding protein involved in endocytosis that also has guanine nucleotide exchange activity for Cdc42. In the context of the full-length protein, the catalytic exchange activity of the DH domain is repressed. Here we use biochemical methods to dissect the mechanism for this inhibition. We demonstrate that the intersectin 1L SH3 domains, which bind endocytic proteins, directly inhibit the activity of the DH domain in assays for both binding and exchange of Cdc42. This inhibitory mechanism seems to act through steric hindrance of Cdc42 binding by an intramolecular interaction between the intersectin 1L SH3 domain region and the adjacent DH domain. Surprisingly, the mode of SH3 domain binding is other than through the proline peptide binding pocket. The dual role of the SH3 domains in endocytosis and repression of exchange activity suggests that the intersectin 1L exchange activity is regulated by endocytosis. We show that the endocytic protein, dynamin, competes for binding to the SH3 domains with the neural Wiskott-Aldrich Syndrome protein, an actin filament nucleation protein that is a substrate for activated Cdc42. Swapping of SH3 domain binding partners might act as a switch controlling the actin nucleation activity of intersectin 1L. PMID:12686614

  6. Dock6, a Dock-C subfamily guanine nucleotide exchanger, has the dual specificity for Rac1 and Cdc42 and regulates neurite outgrowth.


    Miyamoto, Yuki; Yamauchi, Junji; Sanbe, Atsushi; Tanoue, Akito


    Small GTPases of the Rho family, Rho, Rac, and Cdc42, are critical regulators of the changes in the actin cytoskeleton. Rho GTPases are typically activated by Dbl-homology (DH)-domain-containing guanine nucleotide exchange factors (GEFs). Recent genetic and biochemical studies revealed a new type of GEF for the Rho GTPases. This family is composed of 11 genes, designated as Dock1 to Dock11, and is structurally divided into four classes Dock-A, -B, -C, and -D. Dock-A and -B subfamilies are typically GEFs specific for Rac1, while the Dock-D subfamily is specific for Cdc42. Here we show that Dock6, a member of the Dock-C subfamily, exchanges GDP for GTP for Rac1 and Cdc42 in vitro and in vivo. Furthermore, we find that, in mouse N1E-115 neuroblastoma cells, expression of Dock6 is increased following differentiation. Transfection of the catalytic Dock Homology Region-2 (DHR-2) domain of Dock6 promotes neurite outgrowth mediated by Rac1 and Cdc42. Conversely, knockdown of endogenous Dock6 by small interference RNA reduces activation of Rac1 and Cdc42 and neurite outgrowth. Taken together, these results suggest that Dock6 differs from all of the identified Dock180-related proteins, in that it is the GEF specific for both Rac1 and Cdc42 and may be one of physiological regulators of neurite outgrowth.

  7. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge.


    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock-ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis.

  8. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila.


    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it's functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila.

  9. Role of the guanine nucleotide exchange factor in Akt2-mediated plasma membrane translocation of GLUT4 in insulin-stimulated skeletal muscle.


    Takenaka, Nobuyuki; Yasuda, Naoto; Nihata, Yuma; Hosooka, Tetsuya; Noguchi, Tetsuya; Aiba, Atsu; Satoh, Takaya


    The small GTPase Rac1 plays a key role in insulin-promoted glucose uptake mediated by the GLUT4 glucose transporter in skeletal muscle. Our recent studies have demonstrated that the serine/threonine protein kinase Akt2 is critically involved in insulin-dependent Rac1 activation. The purpose of this study is to clarify the role of the guanine nucleotide exchange factor FLJ00068 in Akt2-mediated Rac1 activation and GLUT4 translocation in mouse skeletal muscle and cultured myocytes. Constitutively activated FLJ00068 induced GLUT4 translocation in a Rac1-dependent and Akt2-independent manner in L6 myocytes. On the other hand, knockdown of FLJ00068 significantly reduced constitutively activated Akt2-triggered GLUT4 translocation. Furthermore, Rac1 activation and GLUT4 translocation induced by constitutively activated phosphoinositide 3-kinase were inhibited by knockdown of FLJ00068. In mouse gastrocnemius muscle, constitutively activated FLJ00068 actually induced GLUT4 translocation to the sarcolemma. GLUT4 translocation by constitutively activated FLJ00068 was totally abolished in rac1 knockout mouse gastrocnemius muscle. Additionally, we were successful in detecting the activation of Rac1 following the expression of constitutively activated FLJ00068 in gastrocnemius muscle by immunofluorescence microscopy using an activation-specific probe. Collectively, these results strongly support the notion that FLJ00068 regulates Rac1 downstream of Akt2, leading to the stimulation of glucose uptake in skeletal muscle.

  10. Guanine nucleotide dissociation inhibitor is essential for Rab1 function in budding from the endoplasmic reticulum and transport through the Golgi stack

    PubMed Central


    The small GTPase Rab1 is required for vesicular traffic from the ER to the cis-Golgi compartment, and for transport between the cis and medial compartments of the Golgi stack. In the present study, we examine the role of guanine nucleotide dissociation inhibitor (GDI) in regulating the function of Rab1 in the transport of vesicular stomatitis virus glycoprotein (VSV-G) in vitro. Incubation in the presence of excess GDI rapidly (t1/2 < 30 s) extracted Rab1 from membranes, inhibiting vesicle budding from the ER and sequential transport between the cis-, medial-, and trans-Golgi cisternae. These results demonstrate a direct role for GDI in the recycling of Rab proteins. Analysis of rat liver cytosol by gel filtration revealed that a major pool of Rab1 fractionates with a molecular mass of approximately 80 kD in the form of a GDI-Rab1 complex. When the GDI-Rab1 complex was depleted from cytosol by use of a Rab1-specific antibody, VSV-G failed to exit the ER. However, supplementation of depleted cytosol with a GDI-Rab1 complex prepared in vitro from recombinant forms of Rab1 and GDI efficiently restored export from the ER, and transport through the Golgi stack. These results provide evidence that a cytosolic GDI-Rab1 complex is required for the formation of non-clathrin-coated vesicles mediating transport through the secretory pathway. PMID:8089173

  11. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge

    PubMed Central

    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R.


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock–ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis. PMID:25908317

  12. Essential role for vav Guanine nucleotide exchange factors in brain-derived neurotrophic factor-induced dendritic spine growth and synapse plasticity.


    Hale, Carly F; Dietz, Karen C; Varela, Juan A; Wood, Cody B; Zirlin, Benjamin C; Leverich, Leah S; Greene, Robert W; Cowan, Christopher W


    Brain-derived neurotrophic factor (BDNF) and its cognate receptor, TrkB, regulate a wide range of cellular processes, including dendritic spine formation and functional synapse plasticity. However, the signaling mechanisms that link BDNF-activated TrkB to F-actin remodeling enzymes and dendritic spine morphological plasticity remain poorly understood. We report here that BDNF/TrkB signaling in neurons activates the Vav family of Rac/RhoA guanine nucleotide exchange factors through a novel TrkB-dependent mechanism. We find that Vav is required for BDNF-stimulated Rac-GTP production in cortical and hippocampal neurons. Vav is partially enriched at excitatory synapses in the postnatal hippocampus but does not appear to be required for normal dendritic spine density. Rather, we observe significant reductions in both BDNF-induced, rapid, dendritic spine head growth and in CA3-CA1 theta burst-stimulated long-term potentiation in Vav-deficient mouse hippocampal slices, suggesting that Vav-dependent regulation of dendritic spine morphological plasticity facilitates normal functional synapse plasticity.

  13. Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions.

    PubMed Central

    Nakafuku, M; Obara, T; Kaibuchi, K; Miyajima, I; Miyajima, A; Itoh, H; Nakamura, S; Arai, K; Matsumoto, K; Kaziro, Y


    In a previous paper, we demonstrated that a gene coding for a protein homologous to the alpha subunit of mammalian guanine nucleotide-binding regulatory (G) proteins occurs in Saccharomyces cerevisiae. The gene, designated GPA1, encodes a protein (GP1 alpha) of 472 amino acids with a calculated Mr of 54,075. Here we report the isolation of another G-protein-homologous gene, GPA2, which encodes an amino acid sequence of 449 amino acid residues with a Mr of 50,516. The predicted primary structure of the GPA2-encoded protein (GP2 alpha) is homologous to mammalian G proteins [inhibitory and stimulatory G proteins (Gi and Gs, respectively), a G protein of unknown function (Go), and transducins (Gt)] as well as yeast GP1 alpha. When aligned with the alpha subunit of Gi (Gi alpha) to obtain maximal homology, GP2 alpha was found to contain a stretch of 83 additional amino acid residues near the NH2 terminus. The gene was mapped in chromosome V, close to the centromere. Haploid cells carrying a disrupted GPA2 gene are viable. Cells carrying a high copy number of plasmid GPA2 (YEpGPA2) had markedly elevated levels of cAMP and could suppress a temperature-sensitive mutation of RAS2. These results suggest that GPA2 may be involved in the regulation of cAMP levels in S. cerevisiae. Images PMID:2830616

  14. Wsc1 and Mid2 Are Cell Surface Sensors for Cell Wall Integrity Signaling That Act through Rom2, a Guanine Nucleotide Exchange Factor for Rho1

    PubMed Central

    Philip, Bevin; Levin, David E.


    Wsc1 and Mid2 are highly O-glycosylated cell surface proteins that reside in the plasma membrane of Saccharomyces cerevisiae. They have been proposed to function as mechanosensors of cell wall stress induced by wall remodeling during vegetative growth and pheromone-induced morphogenesis. These proteins are required for activation of the cell wall integrity signaling pathway that consists of the small G-protein Rho1, protein kinase C (Pkc1), and a mitogen-activated protein kinase cascade. We show here by two-hybrid experiments that the C-terminal cytoplasmic domains of Wsc1 and Mid2 interact with Rom2, a guanine nucleotide exchange factor (GEF) for Rho1. At least with regard to Wsc1, this interaction is mediated by the Rom2 N-terminal domain. This domain is distinct from the Rho1-interacting domain, suggesting that the GEF can interact simultaneously with a sensor and with Rho1. We also demonstrate that extracts from wsc1 and mid2 mutants are deficient in the ability to catalyze GTP loading of Rho1 in vitro, providing evidence that the function of the sensor-Rom2 interaction is to stimulate nucleotide exchange toward this G-protein. In a related line of investigation, we identified the PMT2 gene in a genetic screen for mutations that confer an additive cell lysis defect with a wsc1 null allele. Pmt2 is a member of a six-protein family in yeast that catalyzes the first step in O mannosylation of target proteins. We demonstrate that Mid2 is not mannosylated in a pmt2 mutant and that this modification is important for signaling by Mid2. PMID:11113201

  15. Insights into the Molecular Activation Mechanism of the RhoA-specific Guanine Nucleotide Exchange Factor, PDZRhoGEF

    SciTech Connect

    Bielnicki, Jakub A.; Shkumatov, Alexander V.; Derewenda, Urszula; Somlyo, Avril V.; Svergun, Dmitri I.; Derewenda, Zygmunt S.


    PDZRhoGEF (PRG) belongs to a small family of RhoA-specific nucleotide exchange factors that mediates signaling through select G-protein-coupled receptors via G{alpha}{sub 12/13} and activates RhoA by catalyzing the exchange of GDP to GTP. PRG is a multidomain protein composed of PDZ, regulators of G-protein signaling-like (RGSL), Dbl-homology (DH), and pleckstrin-homology (PH) domains. It is autoinhibited in cytosol and is believed to undergo a conformational rearrangement and translocation to the membrane for full activation, although the molecular details of the regulation mechanism are not clear. It has been shown recently that the main autoregulatory elements of PDZRhoGEF, the autoinhibitory 'activation box' and the 'GEF switch,' which is required for full activation, are located directly upstream of the catalytic DH domain and its RhoA binding surface, emphasizing the functional role of the RGSL-DH linker. Here, using a combination of biophysical and biochemical methods, we show that the mechanism of PRG regulation is yet more complex and may involve an additional autoinhibitory element in the form of a molten globule region within the linker between RGSL and DH domains. We propose a novel, two-tier model of autoinhibition where the activation box and the molten globule region act synergistically to impair the ability of RhoA to bind to the catalytic DH-PH tandem. The molten globule region and the activation box become less ordered in the PRG-RhoA complex and dissociate from the RhoA-binding site, which may constitute a critical step leading to PRG activation.

  16. Guanine Nucleotides in the Meiotic Maturation of Starfish Oocytes: Regulation of the Actin Cytoskeleton and of Ca2+ Signaling

    PubMed Central

    Kyozuka, Keiichiro; Chun, Jong T.; Puppo, Agostina; Gragnaniello, Gianni; Garante, Ezio; Santella, Luigia


    Background Starfish oocytes are arrested at the first prophase of meiosis until they are stimulated by 1-methyladenine (1-MA). The two most immediate responses to the maturation-inducing hormone are the quick release of intracellular Ca2+ and the accelerated changes of the actin cytoskeleton in the cortex. Compared with the later events of oocyte maturation such as germinal vesicle breakdown, the molecular mechanisms underlying the early events involving Ca2+ signaling and actin changes are poorly understood. Herein, we have studied the roles of G-proteins in the early stage of meiotic maturation. Methodology/Principal Findings By microinjecting starfish oocytes with nonhydrolyzable nucleotides that stabilize either active (GTPγS) or inactive (GDPβS) forms of G-proteins, we have demonstrated that: i) GTPγS induces Ca2+ release that mimics the effect of 1-MA; ii) GDPβS completely blocks 1-MA-induced Ca2+; iii) GDPβS has little effect on the amplitude of the Ca2+ peak, but significantly expedites the initial Ca2+ waves induced by InsP3 photoactivation, iv) GDPβS induces unexpectedly striking modification of the cortical actin networks, suggesting a link between the cytoskeletal change and the modulation of the Ca2+ release kinetics; v) alteration of cortical actin networks with jasplakinolide, GDPβS, or actinase E, all led to significant changes of 1-MA-induced Ca2+ signaling. Conclusions/Significance Taken together, these results indicate that G-proteins are implicated in the early events of meiotic maturation and support our previous proposal that the dynamic change of the actin cytoskeleton may play a regulatory role in modulating intracellular Ca2+ release. PMID:19617909

  17. Role of a guanine nucleotide-binding protein in. cap alpha. /sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells

    SciTech Connect

    Cornett, L.E.; Norris, J.S.


    In this study the mechanisms involved in ..cap alpha../sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization at the level of the plasma membrane were investigated. Stimulation of /sup 45/Ca/sup 2 +/ efflux from saponin-permeabilized DDT/sub 1/ MF-2 cells was observed with the addition of either the ..cap alpha../sub 1/-adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of (/sup 32/P) NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT/sub 1/, MF-2 cells, possibly the ..cap alpha..-subunit of N/sub i/. However, stimulation of unidirectional /sup 45/Ca/sup 2 +/ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the ..cap alpha../sub 1/-adrenergic receptor to Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family.

  18. Architecture of the eIF2B regulatory subcomplex and its implications for the regulation of guanine nucleotide exchange on eIF2

    PubMed Central

    Kuhle, Bernhard; Eulig, Nora K.; Ficner, Ralf


    Eukaryal translation initiation factor 2B (eIF2B) acts as guanine nucleotide exchange factor (GEF) for eIF2 and forms a central target for pathways regulating global protein synthesis. eIF2B consists of five non-identical subunits (α–ϵ), which assemble into a catalytic subcomplex (γ, ϵ) responsible for the GEF activity, and a regulatory subcomplex (α, β, δ) which regulates the GEF activity under stress conditions. Here, we provide new structural and functional insight into the regulatory subcomplex of eIF2B (eIF2BRSC). We report the crystal structures of eIF2Bβ and eIF2Bδ from Chaetomium thermophilum as well as the crystal structure of their tetrameric eIF2B(βδ)2 complex. Combined with mutational and biochemical data, we show that eIF2BRSC exists as a hexamer in solution, consisting of two eIF2Bβδ heterodimers and one eIF2Bα2 homodimer, which is homologous to homohexameric ribose 1,5-bisphosphate isomerases. This homology is further substantiated by the finding that eIF2Bα specifically binds AMP and GMP as ligands. Based on our data, we propose a model for eIF2BRSC and its interactions with eIF2 that is consistent with previous biochemical and genetic data and provides a framework to better understand eIF2B function, the molecular basis for Gcn−, Gcd− and VWM/CACH mutations and the evolutionary history of the eIF2B complex. PMID:26384431

  19. Regulated Localization Is Sufficient for Hormonal Control of Regulator of G Protein Signaling Homology Rho Guanine Nucleotide Exchange Factors (RH-RhoGEFs)*

    PubMed Central

    Carter, Angela M.; Gutowski, Stephen; Sternweis, Paul C.


    The regulator of G protein signaling homology (RH) Rho guanine nucleotide exchange factors (RhoGEFs) (p115RhoGEF, leukemia-associated RhoGEF, and PDZ-RhoGEF) contain an RH domain and are specific GEFs for the monomeric GTPase RhoA. The RH domains interact specifically with the α subunits of G12 heterotrimeric GTPases. Activated Gα13 modestly stimulates the exchange activity of both p115RhoGEF and leukemia-associated RhoGEF but not PDZ-RhoGEF. Because all three RH-RhoGEFs can localize to the plasma membrane upon expression of activated Gα13, cellular localization of these RhoGEFs has been proposed as a mechanism for controlling their activity. We use a small molecule-regulated heterodimerization system to rapidly control the localization of RH-RhoGEFs. Acute localization of the proteins to the plasma membrane activates RhoA within minutes and to levels that are comparable with activation of RhoA by hormonal stimulation of G protein-coupled receptors. The catalytic activity of membrane-localized RhoGEFs is not dependent on activated Gα13. We further show that the conserved RH domains can rewire two different RacGEFs to activate Rac1 in response to a traditional activator of RhoA. Thus, RH domains act as independent detectors for activated Gα13 and are sufficient to modulate the activity of RhoGEFs by hormones via mediating their localization to substrate, membrane-associated RhoA. PMID:24855647

  20. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin

    PubMed Central

    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M.; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na+-H+ exchanger activity which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a Guanine-nucleotide Dissociation Inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organellar rearrangements that occur during oogenesis and embryonic development. PMID:21492154

  1. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    SciTech Connect

    Tsukamoto, Yuta; Kagiwada, Satoshi; Shimazu, Sayuri; Takegawa, Kaoru; Noguchi, Tetsuko; Miyamoto, Masaaki


    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  2. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin.


    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na(+) -H(+) exchanger activity, which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a guanine-nucleotide dissociation inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organelle rearrangements that occur during oogenesis and embryonic development.

  3. Odontogenic Ameloblast-associated Protein (ODAM) Mediates Junctional Epithelium Attachment to Teeth via Integrin-ODAM-Rho Guanine Nucleotide Exchange Factor 5 (ARHGEF5)-RhoA Signaling*

    PubMed Central

    Lee, Hye-Kyung; Ji, Suk; Park, Su-Jin; Choung, Han-Wool; Choi, Youngnim; Lee, Hyo-Jung; Park, Shin-Young; Park, Joo-Cheol


    Adhesion of the junctional epithelium (JE) to the tooth surface is crucial for maintaining periodontal health. Although odontogenic ameloblast-associated protein (ODAM) is expressed in the JE, its molecular functions remain unknown. We investigated ODAM function during JE development and regeneration and its functional significance in the initiation and progression of periodontitis and peri-implantitis. ODAM was expressed in the normal JE of healthy teeth but absent in the pathologic pocket epithelium of diseased periodontium. In periodontitis and peri-implantitis, ODAM was extruded from the JE following onset with JE attachment loss and detected in gingival crevicular fluid. ODAM induced RhoA activity and the expression of downstream factors, including ROCK (Rho-associated kinase), by interacting with Rho guanine nucleotide exchange factor 5 (ARHGEF5). ODAM-mediated RhoA signaling resulted in actin filament rearrangement. Reduced ODAM and RhoA expression in integrin β3- and β6-knockout mice revealed that cytoskeleton reorganization in the JE occurred via integrin-ODAM-ARHGEF5-RhoA signaling. Fibronectin and laminin activated RhoA signaling via the integrin-ODAM pathway. Finally, ODAM was re-expressed with RhoA in regenerating JE after gingivectomy in vivo. These results suggest that ODAM expression in the JE reflects a healthy periodontium and that JE adhesion to the tooth surface is regulated via fibronectin/laminin-integrin-ODAM-ARHGEF5-RhoA signaling. We also propose that ODAM could be used as a biomarker of periodontitis and peri-implantitis. PMID:25911094

  4. Serotonin-induced muscle contraction in rat stomach fundus is mediated by a G alpha z-like guanine nucleotide binding protein.


    Wang, H Y; Eberle-Wang, K; Simansky, K J; Friedman, E


    Serotonin (5-HT) potently contracts the fundus of the rat stomach; however, the associated transduction pathway has not been described fully. Experiments were performed in an attempt to gain insight into the coupling mechanism associated with this fundal 5-HT receptor. 5-HT-stimulated [35S]GTP gamma S binding to a protein which was recognized by anti-G alpha Z antiserum in a Mg(++)-dependent fashion. 5-HT increased [35S]GTP gamma S binding in the fundus, but not in the corpus of the rat stomach. 5-HT also enhanced the binding of [alpha-32P]GTP to the fundal protein and increased the hydrolysis of GTP to GDP in fundal membranes. The fundal protein which binds GTP is 25 to 29 kDa in size whereas the brain G alpha Z protein which is recognized by the anti-G alpha Z antibody is a 41 kDa protein. Mixing experiments revealed that the fundal guanine nucleotide binding protein does not appear to be a proteolytic product of the 41 kDa G alpha Z protein. Activating protein kinase C with phorbol-12-myristate, 13-acetate induced a concentration-dependent, noncompetitive inhibition of [35S]GTP gamma S binding to the fundal protein, and of 5-HT-induced contraction of fundal strips. Phorbol-12-myristate, 13-acetate did not alter carbachol- or KCl-mediated fundus contraction. Furthermore, the activation of [35S]GTP gamma S binding by serotonergic agonists and its inhibition by pharmacological antagonists corresponded to the known actions of these agents on contraction of fundal muscle. The results provide evidence that the 5-HT receptor in the rat stomach fundus is coupled directly or indirectly to a G alpha z-like protein which may mediate 5-HT-induced contraction in this tissue.

  5. Measurement of thyroid stimulating immunoglobulins using a novel thyroid stimulating hormone receptor-guanine nucleotide-binding protein, (GNAS) fusion bioassay.


    Pierce, M; Sandrock, R; Gillespie, G; Meikle, A W


    Hyperthyroidism, defined by overproduction of thyroid hormones, has a 2-3% prevalence in the population. The most common form of hyperthyroidism is Graves' disease. A diagnostic biomarker for Graves' disease is the presence of immunoglobulins which bind to, and stimulate, the thyroid stimulating hormone receptor (TSHR), a G-protein coupled receptor (GPCR). We hypothesized that the ectopically expressed TSHR gene in a thyroid stimulating immunoglobulin (TSI) assay could be engineered to increase the accumulation of the GPCR pathway second messenger, cyclic AMP (cAMP), the molecule measured in the assay as a marker for pathway activation. An ectopically expressing TSHR-mutant guanine nucleotide-binding protein, (GNAS) Chinese hamster ovary (CHO) cell clone was constructed using standard molecular biology techniques. After incubation of the new clone with sera containing various levels of TSI, GPCR pathway activation was then quantified by measuring cAMP accumulation in the clone. The clone, together with a NaCl-free cell assay buffer containing 5% polyethylene glycol (PEG)6000, was tested against 56 Graves' patients, 27 toxic thyroid nodule patients and 119 normal patients. Using receiver operating characteristic analysis, when comparing normal with Graves' sera, the assay yielded a sensitivity of 93%, a specificity of 99% and an efficiency of 98%. Total complex precision (within-run, across runs and across days), presented as a percentage coefficient of variation, was found to be 7·8, 8·7 and 7·6% for low, medium and high TSI responding serum, respectively. We conclude that the performance of the new TSI assay provides sensitive detection of TSI, allowing for accurate, early detection of Graves' disease.

  6. The pattern of expression of guanine nucleotide-binding protein β3 (GNB3) in the retina is conserved across vertebrate species

    PubMed Central

    Ritchey, Eric R.; Bongini, Rachel E.; Code, Kimberly A.; Zelinka, Christopher; Petersen-Jones, Simon; Fischer, Andy J.


    Guanine nucleotide-binding protein β3 (GNB3) is an isoform of the β subunit of the heterotrimeric G protein second messenger complex that is commonly associated with transmembrane receptors. The presence of GNB3 in photoreceptors, and possibly bipolar cells, has been confirmed in murine, bovine and primate retinas (Lee et al., 1992, Peng et al., 1992, Huang et al., 2003). Studies have indicated that a mutation in the GNB3 gene causes progressive retinopathy and globe enlargement (RGE) in chickens. The goals of this study were to 1) examine the expression pattern of GNB3 in wild-type and RGE mutant chickens, 2) characterize the types of bipolar cells that express GNB3 and 3) examine whether the expression of GNB3 in the retina is conserved across vertebrate species. We find that chickens homozygous for the RGE allele completely lack GNB3 protein. We find that the pattern of expression of GNB3 in the retina is highly conserved across vertebrate species, including teleost fish (Carassius auratus), frogs (Xenopus laevis), chickens (Gallus domesticus), mice (Mus musculata), guinea pigs (Cavia porcellus), dogs (Canis familiaris) and non-human primates (Macaca fasicularis). Regardless of the species, we find that GNB3 is expressed by Islet1-positive cone ON-bipolar cells and by cone photoreceptors. In some vertebrates, GNB3-immunoreactivity was observed in both rod and cone photoreceptors. A protein-protein alignment of GNB3 across different vertebrates, from fish to humans, indicates a high degree (>92%) of sequence conservation. Given that analogous types of retinal neurons express GNB3 in different species, we propose that the functions and the mechanisms that regulate the expression of GNB3 are highly conserved. PMID:20538044

  7. Identification of a plasma membrane-associated guanine nucleotide exchange factor for ARF6 in chromaffin cells. Possible role in the regulated exocytotic pathway.


    Caumont, A S; Vitale, N; Gensse, M; Galas, M C; Casanova, J E; Bader, M F


    ADP-ribosylation factors (ARFs) constitute a family of structurally related proteins that forms a subset of the Ras superfamily of regulatory GTP-binding proteins. Like other GTPases, activation of ARFs is facilitated by specific guanine nucleotide exchange factors (GEFs). In chromaffin cells, ARF6 is associated with the membrane of secretory granules. Stimulation of intact cells or direct elevation of cytosolic calcium in permeabilized cells triggers the rapid translocation of ARF6 to the plasma membrane and the concomitant activation of phospholipase D (PLD) in the plasma membrane. Both calcium-evoked PLD activation and catecholamine secretion in permeabilized cells are strongly inhibited by a synthetic peptide corresponding to the N-terminal domain of ARF6, suggesting that the ARF6-dependent PLD activation near the exocytotic sites represents a key event in the exocytotic reaction in chromaffin cells. In the present study, we demonstrate the occurrence of a brefeldin A-insensitive ARF6-GEF activity in the plasma membrane and in the cytosol of chromaffin cells. Furthermore, reverse transcriptase-polymerase chain reaction and immunoreplica analysis indicate that ARNO, a member of the brefeldin A-insensitive ARF-GEF family, is expressed and predominantly localized in the cytosol and in the plasma membrane of chromaffin cells. Using permeabilized chromaffin cells, we found that the introduction of anti-ARNO antibodies into the cytosol inhibits, in a dose-dependent manner, both PLD activation and catecholamine secretion in calcium-stimulated cells. Furthermore, co-expression in PC12 cells of a catalytically inactive ARNO mutant with human growth hormone as a marker of secretory granules in transfected cells resulted in a 50% inhibition of growth hormone secretion evoked by depolarization with high K(+). The possibility that the plasma membrane-associated ARNO participates in the exocytotic pathway by activating ARF6 and downstream PLD is discussed.

  8. Phosphorylated cortactin recruits Vav2 guanine nucleotide exchange factor to activate Rac3 and promote invadopodial function in invasive breast cancer cells

    PubMed Central

    Rosenberg, Brian J.; Gil-Henn, Hava; Mader, Christopher C.; Halo, Tiffany; Yin, Taofei; Condeelis, John; Machida, Kazuya; Wu, Yi I.; Koleske, Anthony J.


    Breast carcinoma cells use specialized, actin-rich protrusions called invadopodia to degrade and invade through the extracellular matrix. Phosphorylation of the actin nucleation–promoting factor and actin-stabilizing protein cortactin downstream of the epidermal growth factor receptor–Src-Arg kinase cascade is known to be a critical trigger for invadopodium maturation and subsequent cell invasion in breast cancer cells. The functions of cortactin phosphorylation in this process, however, are not completely understood. We identify the Rho-family guanine nucleotide exchange factor Vav2 in a comprehensive screen for human SH2 domains that bind selectively to phosphorylated cortactin. We demonstrate that the Vav2 SH2 domain binds selectively to phosphotyrosine-containing peptides corresponding to cortactin tyrosines Y421 and Y466 but not to Y482. Mutation of the Vav2 SH2 domain disrupts its recruitment to invadopodia, and an SH2-domain mutant form of Vav2 cannot support efficient matrix degradation in invasive MDA-MB-231 breast cancer cells. We show that Vav2 function is required for promoting invadopodium maturation and consequent actin polymerization, matrix degradation, and invasive migratory behavior. Using biochemical assays and a novel Rac3 biosensor, we show that Vav2 promotes Rac3 activation at invadopodia. Rac3 knockdown reduces matrix degradation by invadopodia, whereas a constitutively active Rac3 can rescue the deficits in invadopodium function in Vav2-knockdown cells. Together these data indicate that phosphorylated cortactin recruits Vav2 to activate Rac3 and promote invadopodial maturation in invasive breast cancer cells. PMID:28356423

  9. Family-wide Analysis of the Inhibition of Arf Guanine Nucleotide Exchange Factors with Small Molecules: Evidence of Unique Inhibitory Profiles.


    Benabdi, Sarah; Peurois, François; Nawrotek, Agata; Chikireddy, Jahnavi; Cañeque, Tatiana; Yamori, Takao; Shiina, Isamu; Ohashi, Yoshimi; Dan, Shingo; Rodriguez, Raphaël; Cherfils, Jacqueline; Zeghouf, Mahel


    Arf GTPases and their guanine nucleotide exchange factors (ArfGEFs) are major regulators of membrane traffic and organelle structure in cells. They are associated with a variety of diseases and are thus attractive therapeutic targets for inhibition by small molecules. Several inhibitors of unrelated chemical structures have been discovered, which have shown their potential in dissecting molecular pathways and blocking disease-related functions. However, their specificity across the ArfGEF family has remained elusive. Importantly, inhibitory responses in the context of membranes, which are critical determinants of Arf and ArfGEF cellular functions, have not been investigated. Here, we compare the efficiency and specificity of four structurally distinct ArfGEF inhibitors, Brefeldin A, SecinH3, M-COPA, and NAV-2729, toward six ArfGEFs (human ARNO, EFA6, BIG1, and BRAG2 and Legionella and Rickettsia RalF). Inhibition was assessed by fluorescence kinetics using pure proteins, and its modulation by membranes was determined with lipidated GTPases in the presence of liposomes. Our analysis shows that despite the intra-ArfGEF family resemblance, each inhibitor has a specific inhibitory profile. Notably, M-COPA is a potent pan-ArfGEF inhibitor, and NAV-2729 inhibits all GEFs, the strongest effects being against BRAG2 and Arf1. Furthermore, the presence of the membrane-binding domain in Legionella RalF reveals a strong inhibitory effect of BFA that is not measured on its GEF domain alone. This study demonstrates the value of family-wide assays with incorporation of membranes, and it should enable accurate dissection of Arf pathways by these inhibitors to best guide their use and development as therapeutic agents.

  10. The product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein.

    PubMed Central

    Maier, T; Jacobi, A; Sauter, M; Böck, A


    The products of the hyp operon genes are essential for the formation of catalytically active hydrogenases in Escherichia coli. At least one of these auxiliary proteins, HYPB, appears to be involved in nickel liganding to the hydrogenase apoprotein, since mutations in hypB can be phenotypically suppressed by high nickel concentrations in the medium (R. Waugh and D. H. Boxer, Biochimie 68:157-166, 1986). To approach the identification of the specific function of HYPB, we overexpressed the hypB gene and purified and characterized the gene product. HYPB is a homodimer of 31.6-kDa subunits, and it binds guanine nucleotides, with a Kd for GDP of 1.2 microM. The protein displays a low level of GTPase activity, with a kcat of 0.17 min-1. The apparent Km for GTP, as measured in the GTP hydrolysis reaction, was determined to be 4 microM. A chromatography system was established to measure nickel insertion into hydrogenase 3 from E. coli and to determine the effects of lesions in hypB. Nickel appears to be associated only with the processed large subunit of hydrogenase 3 in the wild type, and hypB mutants accumulate the precursor form of this subunit, which is devoid of nickel. The results are discussed in terms of a model in which HYPB is involved in nickel donation to the hydrogenase apoprotein and in which GTP hydrolysis is thought to reverse the interaction between either HYPB or another nickel-binding protein and the hydrogenase apoprotein after the nickel has been released. Images PMID:8423137

  11. The distinct role of guanine nucleotide exchange factor Vav1 in Bcl-2 transcription and apoptosis inhibition in Jurkat leukemia T cells

    PubMed Central

    Yin, Jie; Wan, Ya-juan; Li, Shi-yang; Du, Ming-juan; Zhang, Cui-zhu; Zhou, Xing-long; Cao, You-jia


    Aim: To investigate a novel function of proto-oncogene Vav1 in the apoptosis of human leukemia Jurkat cells. Methods: Jurkat cells, Jurkat-derived vav1-null cells (J.Vav1) and Vav1-reconstituted J.WT cells were treated with a Fas agonist antibody, IgM clone CH11. Apoptosis was determined using propidium iodide (PI) staining, Annexin-V staining, DNA fragmentation, cleavage of caspase 3/caspase 8, and poly (ADP-ribose) polymerase (PARP). Mitochondria transmembrane potential (ΔΨm) was measured using DiOC6(3) staining. Transcription and expression of the Bcl-2 family of proteins were evaluated using semi-quantitative RT-PCR and Western blot, respectively. Bcl-2 promoter activity was analyzed using luciferase reporter assays. Results: Cells lacking Vav1 were more sensitive to Fas-mediated apoptosis than Jurkat and J.WT cells. J.Vav1 cells lost mitochondria transmembrane potential (ΔΨm) more rapidly upon Fas induction. These phenotypes could be rescued by re-expression of Vav1 in J.Vav1 cells. The expression of Vav1 increased the transcription of pro-survival Bcl-2. The guanine nucleotide exchange activity of Vav1 was required for enhancing Bcl-2 promoter activity, and the Vav1 downstream substrate, small GTPase Rac2, was likely involved in the control of Bcl-2 expression. Conclusion: Vav1 protects Jurkat cells from Fas-mediated apoptosis by promoting Bcl-2 transcription through its GEF activity. PMID:21151158

  12. Regulation of follitropin-sensitive adenylate cyclase by stimulatory and inhibitory forms of the guanine nucleotide regulatory protein in immature rat Sertoli cells

    SciTech Connect

    Johnson, G.P.


    Studies have been designed to examine the role of guanine nucleotides in mediating FSH-sensitive adenylate cyclase activity in Sertoli cell plasma membranes. Analysis of ({sup 3}H)GDP binding to plasma membranes suggested a single high affinity site with a K{sub d} = 0.24 uM. Competition studies indicated that GTP{sub {gamma}}S was 7-fold more potent than GDP{sub {beta}}S. Bound GDP could be released by FSH in the presence of GTP{sub {gamma}}S, but not by FSH alone. Adenylate cyclase activity was enhanced 5-fold by FSH in the presence of GTP. Addition of GDP{sub {beta}}S to the activated enzyme (FSH plus GTP) resulted in a time-dependent decay to basal activity within 20 sec. GDP{sub {beta}}S competitively inhibited GTP{sub {gamma}}S-stimulated adenylate cyclase activity with a K{sub i} = 0.18 uM. Adenylate cyclase activity was also demonstrated to be sensitive to the nucleotide bound state. In the presence of FSH, only the GTP{sub {gamma}}S-bound form persisted even if GDP{sub {beta}}S previously occupied all available binding sites. Two membrane proteins, M{sub r} = 43,000 and 48,000, were ADP{centered dot}ribosylated using cholera toxin and labeling was enhanced 2 to 4-fold by GTP{sub {gamma}}S but not by GDP{sub {beta}}S. The M{sub r} = 43,000 and 48,000 proteins represented variant forms of G{sub S}. A single protein of M{sub r} = 40,000 (G{sub i}) was ADP-ribosylated by pertussis toxin in vitro. GTP inhibited forskolin-stimulated adenylate cyclase activity with an IC{sub 50} = 0.1 uM. The adenosine analog, N{sup 6}{centered dot}phenylisopropyl adenosine enhanced GTP inhibition of forskolin-stimulated adenylate cyclase activity by an additional 15%. GTP-dependent inhibition of forskolin-sensitive adenylate cyclase activity was abolished in membranes prepared from Sertoli cells treated in culture with pertussis toxin.

  13. (3H)WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    SciTech Connect

    Norman, A.B.; Battaglia, G.; Creese, I.


    In the presence of a 30 nM prazosin mask, (/sup 3/H)-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ((/sup 3/H)WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for (/sup 3/H) WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at (/sup 3/H)WB4101-binding sites in the presence of 30 nM prazosin and (/sup 3/H) lysergic acid diethylamide ((/sup 3/H)LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of (/sup 3/H)WB4101 is significantly lower than the Bmax of (/sup 3/H)LSD in various brain regions. WB4101 competition for (/sup 3/H) LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of (/sup 3/H)WB4101 binding derived from saturation experiments. This suggests that (/sup 3/H)WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by (/sup 3/H)LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for (/sup 3/H)WB4101 but compete for multiple (/sup 3/H)LSD 5-HT1 binding sites. These data indicate that (/sup 3/H)WB4101 selectively labels the 5-HT1A serotonin receptor, whereas (/sup 3/H) LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of (/sup 3/H)WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of (/sup 3/H)WB4101 binding.

  14. Activation of Escherichia coli heat-labile enterotoxins by native and recombinant adenosine diphosphate-ribosylation factors, 20-kD guanine nucleotide-binding proteins.

    PubMed Central

    Lee, C M; Chang, P P; Tsai, S C; Adamik, R; Price, S R; Kunz, B C; Moss, J; Twiddy, E M; Holmes, R K


    Escherichia coli heat-labile enterotoxins (LT) are responsible in part for "traveler's diarrhea" and related diarrheal illnesses. The family of LTs comprises two serogroups termed LT-I and LT-II; each serogroup includes two or more antigenic variants. The effects of LTs result from ADP ribosylation of Gs alpha, a stimulatory component of adenylyl cyclase; the mechanism of action is identical to that of cholera toxin (CT). The ADP-ribosyltransferase activity of CT is enhanced by 20-kD guanine nucleotide-binding proteins, known as ADP-ribosylation factors or ARFs. These proteins directly activate the CTA1 catalytic unit and stimulate its ADP ribosylation of Gs alpha, other proteins, and simple guanidino compounds (e.g., agmatine). Because of the similarities between CT and LTs, we investigated the effects of purified bovine brain ARF and a recombinant form of bovine ARF synthesized in Escherichia coli on LT activity. ARF enhanced the LT-I-, LT-IIa-, and LT-IIb-catalyzed ADP ribosylation of agmatine, as well as the auto-ADP ribosylation of the toxin catalytic unit. Stimulation of ADP-ribosylagmatine formation by LTs and CT in the presence of ARF was GTP dependent and enhanced by sodium dodecyl sulfate. With agmatine as substrate, LT-IIa and LT-IIb exhibited less than 1% the activity of CT and LT-Ih. CT and LTs catalyzed ADP-ribosyl-Gs alpha formation in a reaction dependent on ARF, GTP, and dimyristoyl phosphatidylcholine/cholate. With Gs alpha as substrate, the ADP-ribosyltransferase activities of the toxins were similar, although CT and LT-Ih appeared to be slightly more active than LT-IIa and LT-IIb. Thus, LT-IIa and LT-IIb appear to differ somewhat from CT and LT-Ih in substrate specificity. Responsiveness to stimulation by ARF, GTP, and phospholipid/detergent as well as the specificity of ADP-ribosyltransferase activity are functions of LTs from serogroups LT-I and LT-II that are shared with CT. Images PMID:1902492

  15. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    PubMed Central


    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  16. Guanine nucleotide exchange factor 2 for Rab5 proteins coordinated with GLUP6/GEF regulates the intracellular transport of the proglutelin from the Golgi apparatus to the protein storage vacuole in rice endosperm.


    Wen, Liuying; Fukuda, Masako; Sunada, Mariko; Ishino, Sonoko; Ishino, Yoshizumi; Okita, Thomas W; Ogawa, Masahiro; Ueda, Takashi; Kumamaru, Toshihiro


    Rice glutelin polypeptides are initially synthesized on the endoplasmic reticulum (ER) membrane as a proglutelin, which are then transported to the protein storage vacuole (PSV) via the Golgi apparatus. Rab5 and its cognate activator guanine nucleotide exchange factor (GEF) are essential for the intracellular transport of proglutelin from the Golgi apparatus to the PSV. Results from previous studies showed that the double recessive type of glup4/rab5a and glup6/gef mutant accumulated much higher amounts of proglutelin than either parent line. The present study demonstrates that the double recessive type of glup4/rab5a and glup6/gef mutant showed not only elevated proglutelin levels and much larger paramural bodies but also reduced the number and size of PSVs, indicating a synergistic mutation effect. These observations led us to the hypothesis that other isoforms of Rab5 and GEF also participate in the intracellular transport of rice glutelin. A database search identified a novel guanine nucleotide exchange factor, Rab5-GEF2. Like GLUP6/GEF, Rab5-GEF2 was capable of activating Rab5a and two other Rab5 isoforms in in vitro GTP/GDP exchange assays. GEF proteins consist of the helical bundle (HB) domain at the N-terminus, Vps9 domain, and a C-terminal region. By the deletion analysis of GEFs, the HB domain was found essential for the activation of Rab5 proteins.

  17. Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the. alpha. subunit of the stimulatory guanine nucleotide-binding regulatory protein

    SciTech Connect

    Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G. )


    ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the {alpha} subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost, a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5{prime}-({alpha}-{sup 32}P)triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an {alpha} subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera.

  18. Small-GTPase-Associated Signaling by the Guanine Nucleotide Exchange Factors CpDock180 and CpCdc24, the GTPase Effector CpSte20, and the Scaffold Protein CpBem1 in Claviceps purpurea

    PubMed Central

    Herrmann, Andrea; Tillmann, Britta A. M.; Schürmann, Janine; Bölker, Michael


    Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea. PMID:24489041

  19. Allosteric interactions between the binding sites of receptor agonists and guanine nucleotides: a comparative study of the 5-hydroxytryptamine1A and adenosine A1 receptor systems in rat hippocampal membranes.


    Mahle, C D; Wiener, H L; Yocca, F D; Maayani, S


    The ternary complex formed between agonist, receptor and guanine nucleotide binding protein and its destabilization by guanine nucleotides (GN) was utilized to study early events in signal transduction, by characterizing the allosteric interactions between agonist and GN binding to the receptor/guanine nucleotide binding protein, G complex for adenosine A1 and 5-hydroxytryptamine1A receptors. The functional interaction between the ternary complex and GTP was examined by assaying adenylyl cyclase activity. Binding of a full adenosine A1 agonist ([3H]-R-(-)-N6-(2-phenylisopropyl)adenosine), and a full [(+-)-[3H]-8-hydroxydipropylaminotetralin] and partial ([3H]-8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8- azaspirol[4.5]-decane-7,9-dione) 5-hydroxytryptamine1A agonist was examined in relation to the binding of GN. The amount of ternary complex formed depended upon receptor type and drug relative efficacy. The ratio between the drug's EC50 value (adenylyl cyclase) and dissociation constant (binding) was also receptor and drug relative efficacy dependent. 5'-Guanylylimidodiphosphate (100 microM) caused an approximately 50% decrease in the Bmax for all drugs without affecting Kd values. 5'-Guanylylimidodiphosphate and guanosine 5'-O-(3-thiotriphosphate) attenuated [3H]-agonist binding in a concentration-dependent and saturable manner, with IC50 values increased 2- to 6-fold with increasing receptor occupancy. IC50 values were approximately one-tenth lower at the 5-hydroxytryptamine1A receptor than adenosine A1 receptor; similar values were obtained for inhibition of (+-)-[3H]-8-hydroxydipropylaminotetralin and [3H]-8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8- azaspirol[4.5]-decane-7,9-dione binding, suggesting an independence of agonist efficacy. We propose that the stabilization of the ternary complex by hormone binding, measured by Bmax values, is related to drug-relative efficacy, thus the amount of ternary complex available for destabilization by GN is

  20. Specific and nonspecific metal ion-nucleotide interactions at aqueous/solid interfaces functionalized with adenine, thymine, guanine, and cytosine oligomers.


    Holland, Joseph G; Malin, Jessica N; Jordan, David S; Morales, Esmeralda; Geiger, Franz M


    This article reports nonlinear optical measurements that quantify, for the first time directly and without labels, how many Mg(2+) cations are bound to DNA 21-mers covalently linked to fused silica/water interfaces maintained at pH 7 and 10 mM NaCl, and what the thermodynamics are of these interactions. The overall interaction of Mg(2+) with adenine, thymine, guanine, and cytosine is found to involve -10.0 ± 0.3, -11.2 ± 0.3, -14.0 ± 0.4, and -14.9 ± 0.4 kJ/mol, and nonspecific interactions with the phosphate and sugar backbone are found to contribute -21.0 ± 0.6 kJ/mol for each Mg(2+) ion bound. The specific and nonspecific contributions to the interaction energy of Mg(2+) with oligonucleotide single strands is found to be additive, which suggests that within the uncertainty of these surface-specific experiments, the Mg(2+) ions are evenly distributed over the oligomers and not isolated to the most strongly binding nucleobase. The nucleobases adenine and thymine are found to bind only three Mg(2+) ions per 21-mer oligonucleotide, while the bases cytosine and guanine are found to bind eleven Mg(2+) ions per 21-mer oligonucleotide.

  1. Regulation of neutrophil NADPH oxidase activation in a cell-free system by guanine nucleotides and fluoride. Evidence for participation of a pertussis and cholera toxin-insensitive G protein.


    Gabig, T G; English, D; Akard, L P; Schell, M J


    Guanine nucleotide-binding regulatory proteins (G proteins) transduce a remarkably diverse group of extracellular signals to a relatively limited number of intracellular target enzymes. In the neutrophil, transduction of the signal following fMet-Leu-Phe receptor-ligand interaction is mediated by a pertussis toxin substrate (Gi) that activates inositol-specific phospholipase C. We have utilized a plasma membrane-containing fraction from unstimulated human neutrophils as the target enzyme to explore the role of G proteins in arachidonate and cytosolic cofactor-dependent activation of the NADPH-dependent O-2-generating oxidase. When certain guanine nucleotides or their nonhydrolyzable analogues were present during arachidonate and cytosolic cofactor-dependent activation, they exerted substantial dose-dependent effects. The GTP analogue, GTP gamma S, caused a 2-fold increase in NADPH oxidase activation (half-maximal stimulation, 1.1 microM). Either GDP or its nonhydrolyzable analogue, GDP beta S, inhibited up to 80% of the basal NADPH oxidase activation (Ki GDP = 0.12 mM, GDP beta S = 0.23 mM). GTP caused only slight and variable stimulation, whereas F-, an agent known to promote the active conformation of G proteins, caused a 1.6-fold stimulation of NADPH oxidase activation. NADPH oxidase activation in the cell-free system was absolutely and specifically dependent on Mg2+. Although O2- production in response to fMet-Leu-Phe was inhibited greater than 90% in neutrophils pretreated with pertussis toxin, cytosolic cofactor and target oxidase membranes from neutrophils treated with pertussis toxin showed no change in basal- or GTP gamma S-stimulated NADPH oxidase activation. Cholera toxin treatment of neutrophils also had no effect on the cell-free activation system. Our results suggest a role for a G protein that is distinct from Gs or Gi in the arachidonate and cytosolic cofactor-dependent NADPH oxidase cell-free activation system.

  2. Influence of simulated microgravity on the activation of the small GTPase Rho involved in cytoskeletal formation – molecular cloning and sequencing of bovine leukemia-associated guanine nucleotide exchange factor

    PubMed Central

    Higashibata, Akira; Imamizo-Sato, Mari; Seki, Masaya; Yamazaki, Takashi; Ishioka, Noriaki


    Background The irregular formation of cytoskeletal fibers in spaceflown experimental cells has been observed, but the disorganization process of fibers is still poorly understood. It is well known that the activation of the small GTPase Rho leads to actin stress fibers assembly. This study was performed to evaluate the effect of simulated microgravity on the activation of Rho that is involved in actin fiber remodeling in cells. Results Clinorotation influences actin fiber remodeling and its related signaling pathways that involve the small GTPase Rho. Actin stress fiber remodeling was significantly inhibited to a greater extent in cells cultured under clinorotation than in static cultured cells. From the gene and protein expression analyses, we found that the expression level of leukemia-associated Rho guanine nucleotide exchange factor (LARG), which activates Rho, was downregulated under clinorotation. Moreover, we identified the full-length LARG cDNA. The amount of GTP-bound RhoA, that is, the active form of RhoA, decreased under this condition. Conclusion The activation of the small GTPase Rho was influenced by simulated microgravity generated by a three-dimensional (3D) clinostat. Furthermore, the full-length cDNA of bovine LARG, a member of the Rho guanine nucleotide exchange factor (GEF) family, was identified, and its gene expression was observed to be downregulated under clinorotation. This downregulation subsequently resulted in the repression of RhoA activation. These results indicated that the disorganization of the actin fibers was caused by the inhibition of Rho activation by 3D clinorotation. PMID:16803636

  3. Evidence for Natural Selection in Nucleotide Content Relationships Based on Complete Mitochondrial Genomes: Strong Effect of Guanine Content on Separation between Terrestrial and Aquatic Vertebrates.


    Sorimachi, Kenji; Okayasu, Teiji


    The complete vertebrate mitochondrial genome consists of 13 coding genes. We used this genome to investigate the existence of natural selection in vertebrate evolution. From the complete mitochondrial genomes, we predicted nucleotide contents and then separated these values into coding and non-coding regions. When nucleotide contents of a coding or non-coding region were plotted against the nucleotide content of the complete mitochondrial genomes, we obtained linear regression lines only between homonucleotides and their analogs. On every plot using G or A content purine, G content in aquatic vertebrates was higher than that in terrestrial vertebrates, while A content in aquatic vertebrates was lower than that in terrestrial vertebrates. Based on these relationships, vertebrates were separated into two groups, terrestrial and aquatic. However, using C or T content pyrimidine, clear separation between these two groups was not obtained. The hagfish (Eptatretus burgeri) was further separated from both terrestrial and aquatic vertebrates. Based on these results, nucleotide content relationships predicted from the complete vertebrate mitochondrial genomes reveal the existence of natural selection based on evolutionary separation between terrestrial and aquatic vertebrate groups. In addition, we propose that separation of the two groups might be linked to ammonia detoxification based on high G and low A contents, which encode Glu rich and Lys poor proteins.

  4. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.


    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide

  5. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function.


    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Jia, Lei; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E


    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue-DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision

  6. Leucine Zipper Down-regulated in Cancer-1 (LDOC1) interacts with Guanine nucleotide binding protein-like 3-like (GNL3L) to modulate Nuclear Factor-kappa B (NF-κB) signaling during cell proliferation.


    Thoompumkal, Indu Jose; Rehna, Krishnan; Anbarasu, Kumaraswamy; Mahalingam, Sundarasamy


    Guanine nucleotide binding protein-like 3-like (GNL3L) is an evolutionarily conserved putative nucleolar GTPase belonging to the HSR1-MMR1 family. In the present study, using protein-protein interaction assays, we show that Leucine Zipper Down-regulated in Cancer-1 (LDOC1) is a novel interacting partner of GNL3L. Furthermore, our results reveal that ectopic expression of LDOC1 destabilizes endogenous GNL3L levels and down modulates GNL3L-induced cell proliferation, in contrast, the knockdown of LDOC1 potentiates cell proliferation upon GNL3L expression. Interestingly, GNL3L upregulates NF-κB dependent transcriptional activity by modulating the expression of NF-κB subunit p65, which is reversed upon co-expression of LDOC1 with GNL3L. GNL3L also potentiates TNF-α mediated NF-κB activity. In addition, anti-apoptotic function of GNL3L is impaired upon p65 knockdown, suggesting its critical role in GNL3L mediated cell proliferation/survival. An inverse correlation of GNL3L and LDOC1 expression profiles in various tumor tissues from BioXpress database indicate their critical role in cancer. Collectively, our data provides evidence that GNL3L-LDOC1 interplay regulates cell proliferation through the modulation of NF-κB pathway during tumorigenesis.

  7. Coiled-Coil Domain Containing Protein 124 Is a Novel Centrosome and Midbody Protein That Interacts with the Ras-Guanine Nucleotide Exchange Factor 1B and Is Involved in Cytokinesis

    PubMed Central

    Telkoparan, Pelin; Erkek, Serap; Yaman, Elif; Alotaibi, Hani; Bayık, Defne; Tazebay, Uygar H.


    Cytokinetic abscission is the cellular process leading to physical separation of two postmitotic sister cells by severing the intercellular bridge. The most noticeable structural component of the intercellular bridge is a transient organelle termed as midbody, localized at a central region marking the site of abscission. Despite its major role in completion of cytokinesis, our understanding of spatiotemporal regulation of midbody assembly is limited. Here, we report the first characterization of coiled-coil domain-containing protein-124 (Ccdc124), a eukaryotic protein conserved from fungi-to-man, which we identified as a novel centrosomal and midbody protein. Knockdown of Ccdc124 in human HeLa cells leads to accumulation of enlarged and multinucleated cells; however, centrosome maturation was not affected. We found that Ccdc124 interacts with the Ras-guanine nucleotide exchange factor 1B (RasGEF1B), establishing a functional link between cytokinesis and activation of localized Rap2 signaling at the midbody. Our data indicate that Ccdc124 is a novel factor operating both for proper progression of late cytokinetic stages in eukaryotes, and for establishment of Rap2 signaling dependent cellular functions proximal to the abscission site. PMID:23894443

  8. PKR and GCN2 kinases and guanine nucleotide exchange factor eukaryotic translation initiation factor 2B (eIF2B) recognize overlapping surfaces on eIF2alpha.


    Dey, Madhusudan; Trieselmann, Bruce; Locke, Emily G; Lu, Jingfang; Cao, Chune; Dar, Arvin C; Krishnamoorthy, Thanuja; Dong, Jinsheng; Sicheri, Frank; Dever, Thomas E


    Four stress-responsive protein kinases, including GCN2 and PKR, phosphorylate eukaryotic translation initiation factor 2alpha (eIF2alpha) on Ser51 to regulate general and gene-specific protein synthesis. Phosphorylated eIF2 is an inhibitor of its guanine nucleotide exchange factor, eIF2B. Mutations that block translational regulation were isolated throughout the N-terminal OB-fold domain in Saccharomyces cerevisiae eIF2alpha, including those at residues flanking Ser51 and around 20 A away in the conserved motif K79GYID83. Any mutation at Glu49 or Asp83 blocked translational regulation; however, only a subset of these mutations impaired Ser51 phosphorylation. Substitution of Ala for Asp83 eliminated phosphorylation by GCN2 and PKR both in vivo and in vitro, establishing the critical contributions of remote residues to kinase-substrate recognition. In contrast, mutations that blocked translational regulation but not Ser51 phosphorylation impaired the binding of eIF2B to phosphorylated eIF2alpha. Thus, two structurally distinct effectors of eIF2 function, eIF2alpha kinases and eIF2B, have evolved to recognize the same surface and overlapping determinants on eIF2alpha.

  9. Brefeldin A-Inhibited Guanine Nucleotide-Exchange Factor 1 (BIG1) Governs the Recruitment of Tumor Necrosis Factor Receptor-Associated Factor 2 (TRAF2) to Tumor Necrosis Factor Receptor 1 (TNFR1) Signaling Complexes

    PubMed Central

    Noguchi, Takuya; Tsuchida, Mei; Kogue, Yosuke; Spadini, Christian; Hirata, Yusuke; Matsuzawa, Atsushi


    Tumor necrosis factor receptor-associated factor 2 (TRAF2) is a critical mediator of tumor necrosis factor-α (TNF-α) signaling. However, the regulatory mechanisms of TRAF2 are not fully understood. Here we show evidence that TRAF2 requires brefeldin A-inhibited guanine nucleotide-exchange factor 1 (BIG1) to be recruited into TNF receptor 1 (TNFR1) signaling complexes. In BIG1 knockdown cells, TNF-α-induced c-Jun N-terminal kinase (JNK) activation was attenuated and the sensitivity to TNF-α-induced apoptosis was increased. Since these trends correlated well with those of TRAF2 deficient cells as previously demonstrated, we tested whether BIG1 functions as an upstream regulator of TRAF2 in TNFR1 signaling. As expected, we found that knockdown of BIG1 suppressed TNF-α-dependent ubiquitination of TRAF2 that is required for JNK activation, and impaired the recruitment of TRAF2 to the TNFR1 signaling complex (complex I). Moreover, we found that the recruitment of TRAF2 to the death-inducing signaling complex termed complex II was also impaired in BIG1 knockdown cells. These results suggest that BIG1 is a key component of the machinery that drives TRAF2 to the signaling complexes formed after TNFR1 activation. Thus, our data demonstrate a novel and unexpected function of BIG1 that regulates TNFR1 signaling by targeting TRAF2. PMID:27834853

  10. Regulatory roles for Tiam1, a guanine nucleotide exchange factor for Rac1, in glucose-stimulated insulin secretion in pancreatic beta-cells.


    Veluthakal, Rajakrishnan; Madathilparambil, Suresh Vasu; McDonald, Phillip; Olson, Lawrence Karl; Kowluru, Anjaneyulu


    Using various biochemical, pharmacological and molecular biological approaches, we have recently reported regulatory roles for Rac1, a small G-protein, in glucose-stimulated insulin secretion (GSIS). However, little is understood with respect to localization of, and regulation by, specific regulatory factors of Rac1 in GSIS. Herein, we investigated regulatory roles for Tiam1, a specific nucleotide exchange factor (GEF) for Rac1, in GSIS in pancreatic beta-cells. Western blot analysis indicated that Tiam1 is predominantly cytosolic in distribution. NSC23766, a specific inhibitor of Tiam1-mediated activation of Rac1, markedly attenuated glucose-induced, but not KCl-induced insulin secretion in INS 832/13 cells and normal rat islets. Further, NSC23766 significantly reduced glucose-induced activation (i.e. GTP-bound form) and membrane association of Rac1 in INS 832/13 cells and rat islets. Moreover, siRNA-mediated knock-down of Tiam1 markedly inhibited glucose-induced membrane trafficking and activation of Rac1 in INS 832/13 cells. Interestingly, however, in contrast to the inhibitory effects of NSC23766, Tiam1 gene depletion potentiated GSIS in these cells; such a potentiation of GSIS was sensitive to extracellular calcium. Together, our studies present the first evidence for a regulatory role for Tiam1/Rac1-sensitive signaling step in GSIS. They also provide evidence for the existence of a potential Rac1/Tiam1-independent, but calcium-sensitive component for GSIS in these cells.

  11. Evidence from photoaffinity labelling studies for coupling of the alpha/sub 1/-adrenergic receptor to a guanine-nucleotide (G) binding protein

    SciTech Connect

    Graham, R.M.; Sena, L.; Schwarz, K.R.; Homcy, C.J.


    In contrast to ..beta..- and ..cap alpha../sub 2/-adrenergic receptors the role of a G-protein in signal transduction at ..cap alpha..-adrenergic receptors has been difficult to define. Using rat hepatic membranes prepared to avoid retention of endogenous nucleotides and activation of Ca/sup 2 +/-sensitive proteases, a Gpp(NH)p shift in agonist ((-)epinephrine) affinity from an IC/sub 50/ 10/sup -6/ to 5 x 10/sup -5/ M was readily demonstrable in competition studies with the ..cap alpha../sub 1/-specific radioligand (/sup 3/H)prazosin, but was not observed in membranes prepared without protease inhibitors (PIs). Labelling of these membranes with the photolabile prazosin analog, (/sup 125/I)CP65,526, followed by SDS-PAGE/autoradiography revealed a predominant, specifically labelled protein of M/sub r/ = 80,000, whereas a M/sub r/ = 59,000 peptide was evident with membranes prepared in the absence of PIs. The IC/sub 50/ for inhibition of labelling of the M/sub r/ = 80,000 peptide by (-)epinephrine, as determined by radiochromatogram scanning of autoradiographs of the photolabelled receptor, shifted from 10/sup -7/ to 10/sup -6/ in the presence of Gpp(NH)p. However, no shift in agonist affinity at the M/sub r/ = 59,000 peptide was evident in membranes prepared without PIs. This approach provides visual evidence for a G-protein-mediated shift in agonist affinity at the ..cap alpha../sub 1/-adrenergic receptor and allows a correlation between subunit size analysis and ligand binding.

  12. Nucleotide excision repair of 2-acetylaminofluorene- and 2-aminofluorene-(C8)-guanine adducts: molecular dynamics simulations elucidate how lesion structure and base sequence context impact repair efficiencies.


    Mu, Hong; Kropachev, Konstantin; Wang, Lihua; Zhang, Lu; Kolbanovskiy, Alexander; Kolbanovskiy, Marina; Geacintov, Nicholas E; Broyde, Suse


    Nucleotide excision repair (NER) efficiencies of DNA lesions can vary by orders of magnitude, for reasons that remain unclear. An example is the pair of N-(2'-deoxyguanosin-8-yl)-2-aminofluorene (dG-C8-AF) and N-(2'-deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-C8-AAF) adducts that differ by a single acetyl group. The NER efficiencies in human HeLa cell extracts of these lesions are significantly different when placed at G(1), G(2) or G(3) in the duplex sequence (5'-CTCG(1)G(2)CG(3)CCATC-3') containing the NarI mutational hot spot. Furthermore, the dG-C8-AAF adduct is a better substrate of NER than dG-C8-AF in all three NarI sequence contexts. The conformations of each of these adducts were investigated by Molecular dynamics (MD) simulation methods. In the base-displaced conformational family, the greater repair susceptibility of dG-C8-AAF in all sequences stems from steric hindrance effects of the acetyl group which significantly diminish the adduct-base stabilizing van der Waals stacking interactions relative to the dG-C8-AF case. Base sequence context effects for each adduct are caused by differences in helix untwisting and minor groove opening that are derived from the differences in stacking patterns. Overall, the greater NER efficiencies are correlated with greater extents of base sequence-dependent local untwisting and minor groove opening together with weaker stacking interactions.

  13. Rad and Rem are non-canonical G-proteins with respect to the regulatory role of guanine nucleotide binding in Ca(V)1.2 channel regulation.


    Chang, Donald D; Colecraft, Henry M


    Rad and Rem are Ras-like G-proteins linked to diverse cardiovascular functions and pathophysiology. Understanding how Rad and Rem are regulated is important for deepened insights into their pathophysiological roles. As in other Ras-like G-proteins, Rad and Rem contain a conserved guanine-nucleotide binding domain (G-domain). Canonically, G-domains are key control modules, functioning as nucleotide-regulated switches of G-protein activity. Whether Rad and Rem G-domains conform to this canonical paradigm is ambiguous. Here, we used multiple functional measurements in HEK293 cells and cardiomyocytes (Ca(V)1.2 currents, Ca(2+) transients, Ca(V)β binding) as biosensors to probe the role of the G-domain in regulation of Rad and Rem function. We utilized Rad(S105N) and Rem(T94N), which are the cognate mutants to Ras(S17N), a dominant-negative variant of Ras that displays decreased nucleotide binding affinity. In HEK293 cells, over-expression of either Rad(S105N) or Rem(T94N) strongly inhibited reconstituted Ca(V)1.2 currents to the same extent as their wild-type (wt) counterparts, contrasting with reports that Rad(S105N) is functionally inert in HEK293 cells. Adenovirus-mediated expression of either wt Rad or Rad(S105N) in cardiomyocytes dramatically blocked L-type calcium current (I(Ca,L)) and inhibited Ca(2+)-induced Ca(2+) release, contradicting reports that Rad(S105N) acts as a dominant negative in heart. By contrast, Rem(T94N) was significantly less effective than wt Rem at inhibiting I(Ca,L) and Ca(2+) transients in cardiomyocytes. FRET analyses in cardiomyocytes revealed that both Rad(S105N) and Rem(T94N) had moderately reduced binding affinity for Ca(V)βs relative to their wt counterparts. The results indicate Rad and Rem are non-canonical G-proteins with respect to the regulatory role of their G-domain in Ca(V)1.2 regulation. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  14. A novel missense variant (Gln220Arg) of GNB4 encoding guanine nucleotide-binding protein, subunit beta-4 in a Japanese family with autosomal dominant motor and sensory neuropathy.


    Miura, Shiroh; Morikawa, Takuya; Fujioka, Ryuta; Noda, Kazuhito; Kosaka, Kengo; Taniwaki, Takayuki; Shibata, Hiroki


    Dominant intermediate Charcot-Marie-Tooth disease F (CMTDIF) is an autosomal dominant hereditary form of Charcot-Marie-Tooth disease (CMT) caused by variations in the guanine nucleotide-binding protein, subunit beta-4 gene (GNB4). We examined two Japanese familial cases with CMT. Case 1 was a 49-year-old male whose chief complaint was slowly progressive gait disturbance and limb dysesthesia that appeared at the age of 47. On neurological examination, he showed hyporeflexia or areflexia, distal limb muscle weakness, and distal sensory impairment with lower dominancy. Nerve conduction studies demonstrated demyelinating sensorimotor neuropathy with reduced action potentials in the lower limbs. Case 2 was an 80-year-old man, Case 1's father, who reported difficulty in riding a bicycle at the age of 76. On neurological examination, he showed areflexia in the upper and lower limbs. Distal sensory impairment in the lower limbs was also observed. Nerve conduction studies revealed mainly axonal involvement. Exome sequencing identified a novel heterozygous nonsynonymous variant (NM_021629.3:c.659T > C [p.Gln220Arg]) in GNB4 exon 8, which is known to be responsible for CMT. Sanger sequencing confirmed that both patients are heterozygous for the variation, which causes an amino acid substitution, Gln220Arg, in the highly conserved region of the WD40 domain of GNB4. The frequency of this variant in the Exome Aggregation Consortium Database was 0.000008247, and we confirmed its absence in 502 Japanese control subjects. We conclude that this novel GNB4 variant is causative for CMTDIF in these patients, who represent the first record of the disease in the Japanese population. Copyright © 2017. Published by Elsevier Masson SAS.

  15. Voltage-gated ion channel Kv4.3 is associated with Rap guanine nucleotide exchange factors and regulates angiotensin receptor type 1 signaling to small G-protein Rap.


    Potapova, Irina A; Cohen, Ira S; Doronin, Sergey V


    The voltage-gated potassium channel Kv4.3 was coexpressed with its beta-subunit Kv channel-interacting protein 2 and the angiotensin type 1 receptor in HEK-293 cells. Proteomic analysis of proteins coimmunoprecipitated with Kv4.3 revealed that Kv4.3 is associated with Rap guanine nucleotide exchange factors MR-GEF and EPAC-1. Previously, we demonstrated that Kv4.3 interacts with the angiotensin type 1 receptor in HE293 cells and cardiac myocytes. On the basis of this, we investigated the angiotensin type 1 receptor signaling to small G-proteins Ras and Rap-1 in the presence and absence of the Kv4.3-Kv channel-interacting protein 2 macromolecular complex. Ras activation was not significantly affected by coexpression of Kv4.3 and Kv channel-interacting protein 2. Ras exhibited a rapid activation-inactivation pattern with maximum activity at 2.5 min after addition of angiotensin II. In contrast, activation of Rap-1 was affected dramatically by coexpression of Kv4.3 and Kv channel-interacting protein 2 with the angiotensin type 1 receptor. In the absence of Kv4.3 and Kv channel-interacting protein 2, stimulation of the angiotensin type 1 receptor resulted in steady activation of Rap-1 that reached a plateau 25 min after addition of angiotensin II. In the presence of Kv4.3 and Kv channel-interacting protein 2, Rap-1 reaches a maximum activity 2.5 min after addition of angiotensin II and then deactivates rapidly, demonstrating a pattern of activation similar to that of Ras. Our findings show that Kv4.3 regulates angiotensin type 1 receptor signaling to the small G-protein Rap-1.

  16. Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific guanine nucleotide exchange factor, via the Ras/ERK/PAK2 pathway is required for basic fibroblast growth factor-induced neurite outgrowth.


    Shin, Eun-Young; Shin, Kyung-Sun; Lee, Chan-Soo; Woo, Kyung-Nam; Quan, Song-Hua; Soung, Nak-Kyun; Kim, Young Gyu; Cha, Choong Ik; Kim, Seung-Ryul; Park, Dongeun; Bokoch, Gary M; Kim, Eung-Gook


    Guanine nucleotide exchange factors (GEFs) have been implicated in growth factor-induced neuronal differentiation through the activation of small GTPases. Although phosphorylation of these GEFs is considered an activation mechanism, little is known about the upstream of PAK-interacting exchange factor (PIX), a member of the Dbl family of GEFs. We report here that phosphorylation of p85 betaPIX/Cool/p85SPR is mediated via the Ras/ERK/PAK2 pathway. To understand the role of p85 betaPIX in basic fibroblast growth factor (bFGF)-induced neurite outgrowth, we established PC12 cell lines that overexpress the fibroblast growth factor receptor-1 in a tetracycline-inducible manner. Treatment with bFGF induces the phosphorylation of p85 betaPIX, as determined by metabolic labeling and mobility shift upon gel electrophoresis. Interestingly, phosphorylation of p85 betaPIX is inhibited by PD98059, a specific MEK inhibitor, suggesting the involvement of the ERK cascade. PAK2, a major PAK isoform in PC12 cells as well as a binding partner of p85 betaPIX, also functions upstream of p85 betaPIX phosphorylation. Surprisingly, PAK2 directly binds to ERK, and its activation is dependent on ERK. p85 betaPIX specifically localizes to the lamellipodia at neuronal growth cones in response to bFGF. A mutant form of p85 betaPIX (S525A/T526A), in which the major phosphorylation sites are replaced by alanine, shows significant defect in targeting. Moreover, expression of the mutant p85 betaPIX efficiently blocks PC12 cell neurite outgrowth. Our study defines a novel signaling pathway for bFGF-induced neurite outgrowth that involves activation of the PAK2-p85 betaPIX complex via the ERK cascade and subsequent translocation of this complex.

  17. Ginseng (Panax quinquefolius) attenuates leptin-induced cardiac hypertrophy through inhibition of p115Rho guanine nucleotide exchange factor-RhoA/Rho-associated, coiled-coil containing protein kinase-dependent mitogen-activated protein kinase pathway activation.


    Moey, Melissa; Rajapurohitam, Venkatesh; Zeidan, Asad; Karmazyn, Morris


    Leptin is a 16-kDa peptide primarily derived from white adipocytes and is typically elevated in plasma of obese individuals. Although leptin plays a critical role in appetite regulation, leptin receptors have been identified in numerous tissues including the heart and have been shown to directly mediate cardiac hypertrophy through RhoA/ROCK (Ras homolog gene family, member A/Rho-associated, coiled-coil containing protein kinase)-dependent p38 mitogen-activated protein kinase (MAPK) activation; however, the basis for RhoA stimulation is unknown. Rho guanine nucleotide exchange factors (GEFs) catalyze the exchange of GDP for GTP resulting in Rho activation and may be the potential upstream factors mediating leptin-induced RhoA activation and therefore a potential target for inhibition. We investigated the effects of North American ginseng (Panax quinquefolius), reported to reduce cardiac hypertrophy, on RhoA/ROCK and MAPK activation in ventricular cardiomyocytes exposed to leptin (50 ng/ml) and the possible role of p115RhoGEF and p63RhoGEF in these responses. Leptin produced a robust hypertrophic response that was associated with RhoA/ROCK activation resulting in a significant increase in cofilin-2 phosphorylation and actin polymerization, the latter evidenced by a reduction in the G/F actin ratio. These effects were prevented by ginseng (10 μg/ml). The stimulation of RhoA/ROCK by leptin was associated with significantly increased p115RhoGEF gene and protein expression and exchange activity, all of which were completely prevented by ginseng. The ability of ginseng to prevent leptin-induced activation of RhoA/ROCK was further associated with diminished p38 MAPK activation and nuclear translocation. These results demonstrate a potent inhibitory effect of ginseng against leptin-induced cardiac hypertrophy, an effect associated with prevention of p115RhoGEF-RhoA/ROCK-dependent p38 MAPK activation.

  18. On the use of the transmembrane domain of bacteriorhodopsin as a template for modeling the three-dimensional structure of guanine nucleotide-binding regulatory protein-coupled receptors.

    PubMed Central

    Pardo, L; Ballesteros, J A; Osman, R; Weinstein, H


    The molecular architecture of bacteriorhodopsin (BR) is commonly regarded as a structural template for the three-dimensional structure of membrane receptors that are functionally coupled to guanine nucleotide-binding regulatory proteins (GPCR). More recently, specific molecular models of such GPCR were constructed on the basis of the functional and structural relation of rhodopsin to BR as well as the sequence homology between rhodopsin and the GPCR. Such models of GPCR leave unresolved the difficulty caused by the apparent lack of any significant degree of sequence homology between the seven transmembrane helices (TMH) of BR and the portions in the sequence of the various GPCR that are considered to constitute their transmembrane domains. Evolutionary arguments offered in favor of the structural relation between BR and the opsins, and hence the GPCR, prompted our investigation of the possibility that the sequence homology, including any similarity in the distribution of kink-inducing proline residues among the helices, might have been obscured by the assumption that the TMH maintained their sequential order from BR in the evolution of the mammalian proteins. With a definition of the TMH in the neurotransmitter GPCR guided by hydropathicity predictions, and additional criteria used to define the span of each helix, optimal alignment of each pair of sequences was determined with no gaps allowed in the matching. The resulting alignment proposed here reveals considerable homology between the TMH in BR and those in GPCR, if the sequential order of the helices is ignored. These findings suggest the possibility that exon shuffling could have occurred in the proposed evolution of the GPCR gene from BR and point to a modification of the BR template to account for the correct packing of the helices in the tertiary structures of GPCR. These findings could guide the construction of three-dimensional models of the neurotransmitter GPCR on the basis of specific interhelical

  19. The Tumor-suppressive Small GTPase DiRas1 Binds the Noncanonical Guanine Nucleotide Exchange Factor SmgGDS and Antagonizes SmgGDS Interactions with Oncogenic Small GTPases.


    Bergom, Carmen; Hauser, Andrew D; Rymaszewski, Amy; Gonyo, Patrick; Prokop, Jeremy W; Jennings, Benjamin C; Lawton, Alexis J; Frei, Anne; Lorimer, Ellen L; Aguilera-Barrantes, Irene; Mackinnon, Alexander C; Noon, Kathleen; Fierke, Carol A; Williams, Carol L


    The small GTPase DiRas1 has tumor-suppressive activities, unlike the oncogenic properties more common to small GTPases such as K-Ras and RhoA. Although DiRas1 has been found to be a tumor suppressor in gliomas and esophageal squamous cell carcinomas, the mechanisms by which it inhibits malignant phenotypes have not been fully determined. In this study, we demonstrate that DiRas1 binds to SmgGDS, a protein that promotes the activation of several oncogenic GTPases. In silico docking studies predict that DiRas1 binds to SmgGDS in a manner similar to other small GTPases. SmgGDS is a guanine nucleotide exchange factor for RhoA, but we report here that SmgGDS does not mediate GDP/GTP exchange on DiRas1. Intriguingly, DiRas1 acts similarly to a dominant-negative small GTPase, binding to SmgGDS and inhibiting SmgGDS binding to other small GTPases, including K-Ras4B, RhoA, and Rap1A. DiRas1 is expressed in normal breast tissue, but its expression is decreased in most breast cancers, similar to its family member DiRas3 (ARHI). DiRas1 inhibits RhoA- and SmgGDS-mediated NF-κB transcriptional activity in HEK293T cells. We also report that DiRas1 suppresses basal NF-κB activation in breast cancer and glioblastoma cell lines. Taken together, our data support a model in which DiRas1 expression inhibits malignant features of cancers in part by nonproductively binding to SmgGDS and inhibiting the binding of other small GTPases to SmgGDS.

  20. Epidermal growth factor (urogastrone)-mediated phosphorylation of a 35-kDa substrate in human placental membranes: relationship to the. beta. subunit of the guanine nucleotide regulatory complex

    SciTech Connect

    Valentine-Braun, K.A.; Northup, J.K.; Hollenberg, M.D.


    The authors have identified a component of about 35 kDa (pp35), present in human placental membrane preparations, that is a substrate for epidermal growth factor urogastrone) (EGF(Uro))-mediated phosphorylation. The EGF(Uro)-stimulated phosphorylation of pp35 was calcium-dependent and was markedly enhanced in membranes prepared in the presence (but not in the absence) of calcium. The (/sup 32/P)-phosphate incorporated into pp35 in the presence of EGF(Uro) was alkali-stable and was present as O/sup 4/-phosphotyrosine. Under identical conditions, insulin did not stimulate pp35 phosphorylation. Either in its native or in its phosphorylated form, pp35 could be released from the membranes in the presence of calcium-chelating agents (EDTA/EGTA); and EGF(Uro)-stimulated phosphorylation was reconstituted by adding back EDTA/EGTA eluates to EDTA/EGTA-washed membranes in the presence of calcium. The properties of pp35 were similar if not identical to those of ..beta..-35, a 35-kDa polypeptide similar to the ..beta.. subunit of the guanine nucleotide-binding oligomers that stimulate (G/sub s/) or inhibit (G/sub i/) the adenylate cyclase system. In contrast, the addition of ..beta.. subunits derived from rabbit liver G/sub i/ or bovine transducin did not result in phosphorylation of a 35-kDa substrate in the reconstituted system. They conclude that the human placental pp35 substrate likely represents the placental equivalent of the ..beta..-35 protein. The data point to a possible link between those receptors involved in growth-factor action and the regulatory systems that utilize GTP-binding proteins as transducing elements.

  1. A guanine nucleotide exchange factor for Rab5 proteins is essential for intracellular transport of the proglutelin from the Golgi apparatus to the protein storage vacuole in rice endosperm.


    Fukuda, Masako; Wen, Liuying; Satoh-Cruz, Mio; Kawagoe, Yasushi; Nagamura, Yoshiaki; Okita, Thomas W; Washida, Haruhiko; Sugino, Aya; Ishino, Sonoko; Ishino, Yoshizumi; Ogawa, Masahiro; Sunada, Mariko; Ueda, Takashi; Kumamaru, Toshihiro


    Rice (Oryza sativa) glutelins are synthesized on the endoplasmic reticulum as a precursor, which are then transported via the Golgi to protein storage vacuoles (PSVs), where they are proteolytically processed into acidic and basic subunits. The glutelin precursor mutant6 (glup6) accumulates abnormally large amounts of proglutelin. Map-base cloning studies showed that glup6 was a loss-of-function mutant of guanine nucleotide exchange factor (GEF), which activates Rab GTPase, a key regulator of membrane trafficking. Immunofluorescence studies showed that the transport of proglutelins and α-globulins to PSV was disrupted in glup6 endosperm. Secreted granules of glutelin and α-globulin were readily observed in young glup6 endosperm, followed by the formation of large dilated paramural bodies (PMBs) containing both proteins as the endosperm matures. The PMBs also contained membrane biomarkers for the Golgi and prevacuolar compartment as well as the cell wall component, β-glucan. Direct evidence was gathered showing that GLUP6/GEF activated in vitro GLUP4/Rab5 as well as several Arabidopsis (Arabidopsis thaliana) Rab5 isoforms to the GTP-bound form. Therefore, loss-of-function mutations in GEF or Rab5 disrupt the normal transport of proglutelin from the Golgi to PSVs, resulting in the initial extracellular secretion of these proteins followed, in turn, by the formation of PMBs. Overall, our results indicate that GLUP6/GEF is the activator of Rab5 GTPase and that the cycling of GTP- and GDP-bound forms of this regulatory protein is essential for the intracellular transport of proglutelin and α-globulin from the Golgi to PSVs and in the maintenance of the general structural organization of the endomembrane system in rice seeds.

  2. Ras-Guanine Nucleotide-Releasing Factor 1 (Ras-GRF1) Controls Activation of Extracellular Signal-Regulated Kinase (ERK) Signaling in the Striatum and Long-Term Behavioral Responses to Cocaine

    PubMed Central

    Fasano, Stefania; D’Antoni, Angela; Orban, Paul C.; Valjent, Emmanuel; Putignano, Elena; Vara, Hugo; Pizzorusso, Tommaso; Giustetto, Maurizio; Yoon, Bongjune; Soloway, Paul; Maldonado, Rafael; Caboche, Jocelyne; Brambilla, Riccardo


    Background Ras-extracellular signal-regulated kinase (Ras-ERK) signaling is central to the molecular machinery underlying cognitive functions. In the striatum, ERK1/2 kinases are co-activated by glutamate and dopamine D1/5 receptors, but the mechanisms providing such signaling integration are still unknown. The Ras-guanine nucleotide-releasing factor 1 (Ras-GRF1), a neuronal specific activator of Ras-ERK signaling, is a likely candidate for coupling these neurotransmitter signals to ERK kinases in the striatonigral medium spiny neurons (MSN) and for modulating behavioral responses to drug abuse such as cocaine. Methods We used genetically modified mouse mutants for Ras-GRF1 as a source of primary MSN cultures and organotypic slices, to perform both immunoblot and immunofluorescence studies in response to glutamate and dopamine receptor agonists. Mice were also subjected to behavioral and immunohistochemical investigations upon treatment with cocaine. Results Phosphorylation of ERK1/2 in response to glutamate, dopamine D1 agonist, or both stimuli simultaneously is impaired in Ras-GRF1– deficient striatal cells and organotypic slices of the striatonigral MSN compartment. Consistently, behavioral responses to cocaine are also affected in mice deficient for Ras-GRF1 or overexpressing it. Both locomotor sensitization and conditioned place preference are significantly attenuated in Ras-GRF1– deficient mice, whereas a robust facilitation is observed in overexpressing transgenic animals. Finally, we found corresponding changes in ERK1/2 activation and in accumulation of FosB/ΔFosB, a well-characterized marker for long-term responses to cocaine, in MSN from these animals. Conclusions These results strongly implicate Ras-GRF1 in the integration of the two main neurotransmitter inputs to the striatum and in the maladaptive modulation of striatal networks in response to cocaine. PMID:19446794

  3. Crucial Role of Rapgef2 and Rapgef6, a Family of Guanine Nucleotide Exchange Factors for Rap1 Small GTPase, in Formation of Apical Surface Adherens Junctions and Neural Progenitor Development in the Mouse Cerebral Cortex123

    PubMed Central

    Maeta, Kazuhiro; Edamatsu, Hironori; Nishihara, Kaori; Ikutomo, Junji; Bilasy, Shymaa E.


    Abstract Cerebral neocortex development in mammals requires highly orchestrated events involving proliferation, differentiation, and migration of neural progenitors and neurons. Rapgef2 and Rapgef6 constitute a unique family of guanine nucleotide exchange factors for Rap1 small GTPase, which is known to play crucial roles in migration of postmitotic neurons. We previously reported that conditional knockout of Rapgef2 in dorsal telencephalon (Rapgef2-cKO) resulted in the formation of an ectopic cortical mass (ECM) resembling that of subcortical band heterotopia. Here we show that double knockout of Rapgef6 in Rapgef2-cKO mice (Rapgef2/6-dKO) results in marked enlargement of the ECM. While Rapgef2-cKO affects late-born neurons only, Rapgef2/6-dKO affects both early-born and late-born neurons. The Rapgef2-cKO cortex at embryonic day (E) 15.5, and the Rapgef2/6-dKO cortex at E13.5 and E15.5 show disruption of the adherens junctions (AJs) on the apical surface, detachment of radial glial cells (RGCs) from the apical surface and disorganization of the radial glial fiber system, which are accompanied by aberrant distribution of RGCs and intermediate progenitors, normally located in the ventricular zone and the subventricular zone, respectively, over the entire cerebral cortex. Moreover, intrauterine transduction of Cre recombinase into the Rapgef2flox/flox brains also results in the apical surface AJ disruption and the RGC detachment from the apical surface, both of which are effectively suppressed by cotransduction of the constitutively active Rap1 mutant Rap1G12V. These results demonstrate a cell-autonomous role of the Rapgef2/6-Rap1 pathway in maintaining the apical surface AJ structures, which is necessary for the proper development of neural progenitor cells. PMID:27390776

  4. The Chromobacterium violaceum type III effector CopE, a guanine nucleotide exchange factor for Rac1 and Cdc42, is involved in bacterial invasion of epithelial cells and pathogenesis.


    Miki, Tsuyoshi; Akiba, Kinari; Iguchi, Mirei; Danbara, Hirofumi; Okada, Nobuhiko


    The type III secretion system (T3SS) encoded by Chromobacterium pathogenicity islands 1 and 1a (Cpi-1/-1a) is critical for Chromobacterium violaceum pathogenesis. T3SS-dependent virulence is commonly characterized by type III effector virulence function, but the full repertoire of the effector proteins of Cpi-1/-1a T3SS is unknown. In this study, we showed that expression of Cpi-1/-1a T3SS is controlled by the master regulator CilA. We used transcriptional profiling with DNA microarrays to define CilA regulon and identified genes encoding T3SS effectors whose translocation into host cells was dependent on Cpi-1/-1a T3SS. From these effectors, we found that CopE (CV0296) has similarities to a guanine nucleotide exchange factor (GEF) for Rho GTPases in its C-terminal portion. The N-terminal portions (1-81 amino acids) of CopE and a CivB as a putative chaperone were required for its translocation. CopE specifically activates Rac1 and Cdc42 followed by the induction of actin cytoskeletal rearrangement. Interestingly, C. violaceum invades human epithelial HeLa cells in a Cpi-1/-1a-encoded T3SS- and CopE-dependent manner. Finally, C. violaceum strains lacking copE and expressing a CopE-G168V deficient in GEF activity were attenuated for virulence in mice, suggesting that CopE contributes to the virulence of this pathogen.

  5. An Autosomal Dominant Cerebellar Ataxia Linked to Chromosome 16q22.1 Is Associated with a Single-Nucleotide Substitution in the 5′ Untranslated Region of the Gene Encoding a Protein with Spectrin Repeat and Rho Guanine-Nucleotide Exchange-Factor Domains

    PubMed Central

    Ishikawa, Kinya; Toru, Shuta; Tsunemi, Taiji; Li, Mingshun; Kobayashi, Kazuhiro; Yokota, Takanori; Amino, Takeshi; Owada, Kiyoshi; Fujigasaki, Hiroto; Sakamoto, Masaki; Tomimitsu, Hiroyuki; Takashima, Minoru; Kumagai, Jiro; Noguchi, Yoshihiro; Kawashima, Yoshiyuki; Ohkoshi, Norio; Ishida, Gen; Gomyoda, Manabu; Yoshida, Mari; Hashizume, Yoshio; Saito, Yuko; Murayama, Shigeo; Yamanouchi, Hiroshi; Mizutani, Toshio; Kondo, Ikuko; Toda, Tatsushi; Mizusawa, Hidehiro


    Autosomal dominant cerebellar ataxia (ADCA) is a group of heterogeneous neurodegenerative disorders. By positional cloning, we have identified the gene strongly associated with a form of degenerative ataxia (chromosome 16q22.1–linked ADCA) that clinically shows progressive pure cerebellar ataxia. Detailed examination by use of audiogram suggested that sensorineural hearing impairment may be associated with ataxia in our families. After restricting the candidate region in chromosome 16q22.1 by haplotype analysis, we found that all patients from 52 unrelated Japanese families harbor a heterozygous C→T single-nucleotide substitution, 16 nt upstream of the putative translation initiation site of the gene for a hypothetical protein DKFZP434I216, which we have called “puratrophin-1” (Purkinje cell atrophy associated protein-1). The full-length puratrophin-1 mRNA had an open reading frame of 3,576 nt, predicted to contain important domains, including the spectrin repeat and the guanine-nucleotide exchange factor (GEF) for Rho GTPases, followed by the Dbl-homologous domain, which indicates the role of puratrophin-1 in intracellular signaling and actin dynamics at the Golgi apparatus. Puratrophin-1—normally expressed in a wide range of cells, including epithelial hair cells in the cochlea—was aggregated in Purkinje cells of the chromosome 16q22.1–linked ADCA brains. Consistent with the protein prediction data of puratrophin-1, the Golgi-apparatus membrane protein and spectrin also formed aggregates in Purkinje cells. The present study highlights the importance of the 5′ untranslated region (UTR) in identification of genes of human disease, suggests that a single-nucleotide substitution in the 5′ UTR could be associated with protein aggregation, and indicates that the GEF protein is associated with cerebellar degeneration in humans. PMID:16001362

  6. Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    SciTech Connect

    Grasso, P.; Reichert, L.E. Jr. )


    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel.

  7. Detection and analysis of agonist-induced formation of the complex of the stimulatory guanine nucleotide-binding protein with adenylate cyclase in intact wild-type and beta 2-adrenoceptor-expressing NG108-15 cells.


    Kim, G D; Carr, I C; Milligan, G


    Neuroblastoma x glioma hybrid, NG108-15, cells appear to express the alpha-subunit of the guanine nucleotide-binding protein Gs in a substantial molar excess over its effector adenylate cyclase [Kim, Adie and Milligan (1994) Eur. J. Biochem. 219, 135-143]. Addition of the IP prostanoid receptor agonist iloprost to intact NG108-15 cells resulted in a dose-dependent increase in formation of the complex between Gs alpha and adenylate cyclase (GSAC) as measured by specific high-affinity binding of [3H]forskolin. NG108-15 cells transfected to express either relatively high (clone beta N22) or low (clone beta N17) levels of beta 2-adrenoceptor both showed dose-dependent increases in specific [3H]forskolin binding in response to the beta-adrenoceptor agonist isoprenaline, and maximally effective concentrations of isoprenaline resulted in the generation of similar numbers of GSAC complexes in both clones. The dose-effect curve for clone beta N22, however, was some 15-fold to the left of that for clone beta N17, which is similar to that noted for isoprenaline-mediated stimulation of adenylate cyclase activity [Adie and Milligan (1994) Biochem. J. 303, 803-808]. In contrast, dose-effect curves for iloprost stimulation of [3H]forskolin binding were not different in clones beta N22 and beta N17. Basal specific [3H]forskolin binding in the absence of agonist was significantly greater in cells of clone beta N22 than clone beta N17. This was not a reflection of higher immunological levels of adenylate cyclase, indicating that the higher basal formation of GSAC probably reflects empty-receptor activation of Gs. This higher basal specific [3H]forskolin binding was partially reversed by propranolol. The addition of the opioid peptide D-Ala-D-Leu-enkephalin to NG108-15 cells did not reduce iloprost-stimulated [3H]forskolin binding even though this peptide inhibits stimulated adenylate cyclase activity by activation of a delta opioid receptor.

  8. Pertussis toxin-sensitive guanine nucleotide-binding protein(S) couple adenosine A1 and 5-hydroxytryptamine1A receptors to the same effector systems in rat hippocampus: biochemical and electrophysiological studies.


    Zgombick, J M; Beck, S G; Mahle, C D; Craddock-Royal, B; Maayani, S


    electrophysiological preparations. The combination of saturating concentrations of 5-HT and (R)-PIA evoked nonadditive biochemical responses relative to those observed with (R)-PIA alone. Similarly, electrophysiological experiments conducted under voltage-clamp conditions demonstrated that maximally effective concentrations of AD and 5-CT exhibited nonadditive behavior. Because the amount of outward current elicited when these agonists were coperfused was significantly less than the algebraic sum of the currents evoked individually by these agents, we infer that a population of AD A1 and 5-HT1A receptors activates a common pool of guanine nucleotide-binding proteins.(ABSTRACT TRUNCATED AT 400 WORDS)

  9. 1,25-Dihydroxyvitamin D3 attenuates adenylyl cyclase activity in rat thyroid cells: reduction of thyrotropin receptor number and increase in guanine nucleotide-binding protein Gi-2 alpha.


    Berg, J P; Sandvik, J A; Ree, A H; Sørnes, G; Bjøro, T; Torjesen, P A; Gordeladze, J O; Haug, E


    1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] is the most potent of the naturally occurring vitamin D metabolites. In rat thyroid FRTL-5 cells, 1,25-(OH)2D3 attenuated the increase in TSH-stimulated adenylyl cyclase activity obtained by removing TSH from the culture medium. When cells were incubated with 1,25-(OH)2D3 (10 nmol/liter; 4 days), the binding capacity for specific [125I]TSH binding decreased from 20.1 +/- 1.8 to 8.8 +/- 1.6 fmol/10(6) cells (mean +/- SEM; n = 4; P < 0.01) compared to that in control cells. The Kd did not change (mean +/- SEM, 0.46 +/- 0.09 vs. 0.25 +/- 0.07 nmol/liter; n = 4; P = NS). Western blotting revealed no change in the membrane content of the adenylyl cyclase (AC) stimulatory guanine nucleotide-binding protein (G-protein) alpha-subunit (Gs alpha) during 1,25-(OH)2D3 treatment. Similarly, levels of the AC inhibitory G-protein Gi-3 alpha- and G-protein beta-subunits were not altered by 1,25-(OH)2D3. However, Western blotting with antibodies recognizing both Gi-1 alpha and Gi-2 alpha was augmented 4-fold, presumably representing an increase in Gi-2 alpha only, as Gi-1 alpha messenger RNA (mRNA) was not detected in FRTL-5 cells. 1,25-(OH)2D3 (10 nmol/liter; 4 days) reduced cholera toxin (10 nmol/liter)-stimulated AC activity to 85% of the control value (P < 0.05), whereas forskolin (100 mumol/liter)-stimulated direct activation of AC was inhibited by 39%. The TSH receptor mRNA level correlated to the beta-actin mRNA was 2-fold higher in control cells compared to that in 1,25-(OH)2D3-treated cells 12 h after TSH removal. Only minor alterations in the Gs alpha mRNA/beta-actin mRNA and Gi-3 alpha mRNA/beta-actin mRNA ratios were observed during 1,25-(OH)2D3 treatment, whereas Gi-2 alpha mRNA increased 3-fold compared to that in control cells. No change in the resting intracellular Ca2+ concentration could be detected after 4 days of 1,25-(OH)2D3 treatment. Our studies show that 1,25-(OH)2D3 attenuates AC activity by reducing the TSH receptor

  10. Kinetics of Interaction between ADP-ribosylation Factor-1 (Arf1) and the Sec7 Domain of Arno Guanine Nucleotide Exchange Factor, Modulation by Allosteric Factors, and the Uncompetitive Inhibitor Brefeldin A

    PubMed Central

    Rouhana, Jad; Padilla, André; Estaran, Sébastien; Bakari, Sana; Delbecq, Stephan; Boublik, Yvan; Chopineau, Joel; Pugnière, Martine; Chavanieu, Alain


    The GDP/GTP nucleotide exchange of Arf1 is catalyzed by nucleotide exchange factors (GEF), such as Arno, which act through their catalytic Sec7 domain. This exchange is a complex mechanism that undergoes conformational changes and intermediate complex species involving several allosteric partners such as nucleotides, Mg2+, and Sec7 domains. Using a surface plasmon resonance approach, we characterized the kinetic binding parameters for various intermediate complexes. We first confirmed that both GDP and GTP counteract equivalently to the free-nucleotide binary Arf1-Arno complex stability and revealed that Mg2+ potentiates by a factor of 2 the allosteric effect of GDP. Then we explored the uncompetitive inhibitory mechanism of brefeldin A (BFA) that conducts to an abortive pentameric Arf1-Mg2+-GDP-BFA-Sec7 complex. With BFA, the association rate of the abortive complex is drastically reduced by a factor of 42, and by contrast, the 15-fold decrease of the dissociation rate concurs to stabilize the pentameric complex. These specific kinetic signatures have allowed distinguishing the level and nature as well as the fate in real time of formed complexes according to experimental conditions. Thus, we showed that in the presence of GDP, the BFA-resistant Sec7 domain of Arno can also associate to form a pentameric complex, which suggests that the uncompetitive inhibition by BFA and the nucleotide allosteric effect combine to stabilize such abortive complex. PMID:23255605

  11. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.


    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides.

  12. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed Central

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides. PMID:7177848

  13. Conserved guanine-guanine stacking in tetraplex and duplex DNA.


    Kypr, J; Fialová, M; Chládková, J; Tůmová, M; Vorlícková, M


    Using a series of suitably chosen oligonucleotides, we demonstrate that the DNA duplex of d(CCCCGGGG) provides an almost identical CD spectrum as the parallel-stranded tetraplex of d(GGGG). The CD spectra are very sensitive to base stacking in DNA so that the above observation indicates that guanine-guanine stacking is essentially the same within the duplex of d(CCCCGGGG) and the tetraplex of d(GGGG). A very similar CD spectrum is also provided by the A-form of d(CCCCGGGG) induced by trifluoroethanol. These results reveal that guanine-guanine stacking is a structural invariant conserved in various nucleic acid conformers. The structural invariance is likely to cohere with evolution of the genetic molecules and be important for fundamental functions, e.g. initiation of transcription.

  14. Platinum complexes with NH groups on the carrier ligand and with only one guanine or hypoxanthine derivative. Informative models for assessing relative nucleobase and nucleotide hydrogen-bond interactions with amine ligands in solution.


    Carlone, Maria; Marzilli, Luigi G; Natile, Giovanni


    Complexes of the type syn-(R,S)-Me(3)dienPtL (Me(3)dien = N,N',N' '-trimethyldiethylenetriamine; L = guanine or hypoxanthine derivative) have two rotamers, a feature useful for assessing hydrogen-bond interactions between a Me(3)dien NH group and either the O6 or the phosphate group of the coordinated L. The two rotamers are defined as endo and exo for the rotamer with the six-membered ring of the purine on the same side and on the opposite side, respectively, of the coordination plane as the N-Me's. For L = 5'-GMP and 5'-IMP the endo rotamer is the exclusive form (at neutral and basic pH) or is present at 90% and more (low pH where 5'-phosphate group is protonated). A 5'-phosphate group can be positioned to form a direct H-bond with a Me(3)dien NH group only in the endo form; such an H-bond explains this high endo preference. Such a direct phosphate-NH H-bond is not possible for other complexes used in this study because either L has no phosphate group (9-EtG, Guo) or the phosphate is at the 3'-position (3'-GMP and 3'-IMP), too far for H-bonding. Nevertheless, a preference for the endo rotamer was observed for these L also. This result is opposite to that expected both from potential steric repulsion of the L O6 with the N-Me groups and also from the lack of a potential favorable H-bond interaction between L O6 and a Me(3)dien NH. For the 9-EtG adduct, the temperature dependence of the endo/exo equilibrium and the activation parameters for endo/exo interconversion suggest that the preference for the endo rotamer arises from the hydration of the Me(3)dien NH groups; such hydration is favorable in the endo rotamer. At basic pH, N1H deprotonation increases the H-bond capacity of O6, and the exo rotamer increases in stability, becoming the dominant rotamer for the 9-EtG and Guo adducts. For L = 3'-GMP and 3'-IMP, stabilization of the endo form upon phosphate deprotonation at neutral pH was observed. This result is attributed to an H-bonding network involving water

  15. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents listed...

  16. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  17. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  18. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  19. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents listed...

  20. Rho-guanine nucleotide exchange factors during development

    PubMed Central

    Mulinari, Shai


    The development of multicellular organisms is associated with extensive rearrangements of tissues and cell sheets. The driving force for these rearrangements is generated mostly by the actin cytoskeleton. In order to permit the reproducible development of a specific body plan, dynamic reorganization of the actin cytoskeleton must be precisely coordinated in space and time. GTP-exchange factors that activate small GTPases of the Rho family play an important role in this process. Here we review the role of this class of cytoskeletal regulators during important developmental processes such as epithelial morphogenesis, cytokinesis, cell migration, cell polarity, neuronal growth cone extension and phagocytosis in different model systems. PMID:21686118

  1. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR... color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  2. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR... color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  3. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is...

  4. Bacterial Ammeline Metabolism via Guanine Deaminase ▿

    PubMed Central

    Seffernick, Jennifer L.; Dodge, Anthony G.; Sadowsky, Michael J.; Bumpus, John A.; Wackett, Lawrence P.


    Melamine toxicity in mammals has been attributed to the blockage of kidney tubules by insoluble complexes of melamine with cyanuric acid or uric acid. Bacteria metabolize melamine via three consecutive deamination reactions to generate cyanuric acid. The second deamination reaction, in which ammeline is the substrate, is common to many bacteria, but the genes and enzymes responsible have not been previously identified. Here, we combined bioinformatics and experimental data to identify guanine deaminase as the enzyme responsible for this biotransformation. The ammeline degradation phenotype was demonstrated in wild-type Escherichia coli and Pseudomonas strains, including E. coli K12 and Pseudomonas putida KT2440. Bioinformatics analysis of these and other genomes led to the hypothesis that the ammeline deaminating enzyme was guanine deaminase. An E. coli guanine deaminase deletion mutant was deficient in ammeline deaminase activity, supporting the role of guanine deaminase in this reaction. Two guanine deaminases from disparate sources (Bradyrhizobium japonicum USDA 110 and Homo sapiens) that had available X-ray structures were purified to homogeneity and shown to catalyze ammeline deamination at rates sufficient to support bacterial growth on ammeline as a sole nitrogen source. In silico models of guanine deaminase active sites showed that ammeline could bind to guanine deaminase in a similar orientation to guanine, with a favorable docking score. Other members of the amidohydrolase superfamily that are not guanine deaminases were assayed in vitro, and none had substantial ammeline deaminase activity. The present study indicated that widespread guanine deaminases have a promiscuous activity allowing them to catalyze a key reaction in the bacterial transformation of melamine to cyanuric acid and potentially contribute to the toxicity of melamine. PMID:20023034

  5. Guanine riboswitch variants from Mesoplasma florum selectively recognize 2′-deoxyguanosine

    PubMed Central

    Kim, Jane N.; Roth, Adam; Breaker, Ronald R.


    Several mRNA aptamers have been identified in Mesoplasma florum that have sequence and structural features resembling those of guanine and adenine riboswitches. Two features distinguish these RNAs from established purine-sensing riboswitches. All possess shortened hairpin-loop sequences expected to alter tertiary contacts known to be critical for aptamer folding. The RNAs also carry nucleotide changes in the core of each aptamer that otherwise is strictly conserved in guanine and adenine riboswitches. Some aptamers retain the ability to selectively bind guanine or adenine despite these mutations. However, one variant type exhibits selective and high-affinity binding of 2′-deoxyguanosine, which is consistent with its occurrence in the 5′ untranslated region of an operon containing ribonucleotide reductase genes. The identification of riboswitch variants that bind nucleosides and reject nucleobases reveals that natural metabolite-sensing RNA motifs can accrue mutations that expand the diversity of ligand detection in bacteria. PMID:17911257

  6. Nucleotide capacitance calculation for DNA sequencing

    SciTech Connect

    Lu, Jun-Qiang; Zhang, Xiaoguang


    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nano-gap electrodes may not sufficient to be used as a stand alone method for rapid DNA sequencing, the capacitance of the nucleotides should be taken into consideration in any GHz-frequency electric measurements and may also serve as an additional criterion for identifying the DNA sequence.

  7. ESR study of the guanine cation

    NASA Astrophysics Data System (ADS)

    Close, David M.; Sagstuen, Einar; Nelson, William H.


    It has been proposed that the primary direct radiation damage products in DNA are guanine cations and thymine anions. Experiments reported here characterize a guanine cation observed in a single crystal of guanine:HCl:H2O. ESR experiments were performed by x-irradiating and observing the crystals at 15 K. Spectral parameters for the cation include N3 and N10 hyperfine couplings, a C8-Hα hyperfine coupling, and two small exchangeable couplings presumably from the N10 protons. The computed spin densities of ρ(N3)=0.283, ρ(N10)=0.168, and ρ(C8)=0.182 agree nicely with those observed for the guanine cation in DNA. In the single crystal the native molecule is protonated at N7. It is proposed that once the native molecule is oxidized it rapidly deprotonates at N7 to form the cation observed.

  8. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.


    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  9. Rates of Chemical Cleavage of DNA and RNA Oligomers Containing Guanine Oxidation Products

    PubMed Central


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design. PMID:25853314

  10. [Molecular forms of guanine aminohydrolase (author's transl)].


    Martínez-Farnós, L; Gubert, S; Bozal, J


    Guanine aminohydrolase (E.C. has been purified 11-fold from the supernatant fraction of guinea-pig liver homogenates in 0.25 M sucrose (centrifuged at 50,000 X g) through thermic denaturation at 60 degrees C and ammonium sulphate fractionation (30--60% saturation). The enzyme in the homogenates and purified preparations exhibited two Km values. In both preparations four enzymatic electrophoretic bands have been detected. Purified guanine aminohydrolase is chromatographically resolved on DEAE-sephadex in three components whose active forms appeared separately on their pherograms. The enzymatic form eluted at lower ionic strength has the least anodic mobility, is inhibited by guanine (4 X 10(-5) M) and presents only one Km value (1.5 X 10(-5) M). The enzymatic form eluted at greater ionic strength exhibits the highest anodic mobility, is also inhibited by guanine (7 X 10(-5) M) and its Km value seems to be 6.3 X 10(-6) M. Molecular weight of enzymatics forms determined by Sephadex G-200 chromatography, is 120,000 +/- 5,000. The preceding results, correlated with the chromatographic homogeneity of guanine aminohydrolase, purified in Sephadex G-100, suggests that the four molecular forms of the native enzyme may be considered as isozymes.

  11. Identification of N2-(1-carboxyethyl)guanine (CEG) as a guanine advanced glycosylation end product.


    Papoulis, A; al-Abed, Y; Bucala, R


    Reducing sugars such as glucose react nonenzymatically with protein amino groups to initiate a posttranslational modification process known as advanced glycosylation. Nucleotide bases also participate in advanced glycosylation reactions, producing DNA-linked advanced glycosylation endproducts (AGEs) that cause mutations and DNA transposition. Although several protein-derived AGEs have been isolated and structurally characterized, AGE-modified nucleotides have not yet been reported. We systematically examined the reactivities of the model nucleotide bases 9-methylguanine (9-mG), 9-methyladenine (9-mA), and 1-methylcytosine (1-mC) toward glucose and several glucose-derived reactants. In "fast" reactions performed at refluxing temperature and physiological pH, 1 equiv of nucleotide base was reacted with 10 equiv of D-glucose, D-glucose 6-phosphate (G-6-P), D-glucose 6-phosphate/lysine (G-6-P/Lys), the Schiff base 1-n-propylamino-N-D-glucoside (SB), or the Amadori product 1-n-propylamino-N-D-fructose (AP). In every reaction involving 9-mG, N2-(1-carboxyethyl)-9-methylguanine (CEmG) was a major product which was produced. N2-(1-carboxyethyl)-9-methylguanine also formed from 9-mG and AP in long-term incubations performed at 37 degrees C. Direct treatment of 9-mG with methylglyoxal (MG), a Maillard reaction propagator that forms from the decomposition of AP, also produced CEmG in high yield. N2-(1-Carboxyethyl)-9-methylguanine appears to result from the nucleophilic addition of the primary amino group of guanine to the ketone group of MG followed by an intramolecular rearrangement. Methylglyoxal is a known prokaryotic mutagen and was shown additionally to be mutagenic in a eukaryotic shuttle vector assay system.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Electronic properties of guanine traps in DNA

    NASA Astrophysics Data System (ADS)

    Apalkov, Vadim; Chakraborty, Tapash


    We report on our study of the electronic properties of guanine traps in the DNA surrounded by adenines. We have shown that for a typical range of DNA parameters, formation of the bound state of two holes at the same guanine trap is possible for the GGG and GGGG traps if the hole-hole interaction is weak, which can be achieved for the DNA in solutions. The origin of the two-hole bound state is the competition between the Coulomb repulsion and the phonon mediated attraction between the holes. For the hole-phonon coupling constant ≈1 two holes will be at the same trap if the on-site hole-hole repulsion energy is ≲0.9eV .

  13. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    SciTech Connect

    Yeh, Hsin-chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S


    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  14. Guanine tracts enhance sequence directed DNA bends.

    PubMed Central

    Milton, D L; Casper, M L; Wills, N M; Gesteland, R F


    Synthetic DNA fragments were constructed to determine the effect of G tracts, in conjunction with periodically spaced A tracts, on DNA bends. Relative length measurements showed that the G tracts spaced at the half helical turn enhanced the DNA bend. When the G tract was interrupted with a thymine or shortened to one or two guanines, the relative lengths decreased. If the G tract was replaced with either an A tract or a T tract, the bend was cancelled. Replacement with a C tract decreased the relative length to that of a thymine interruption suggesting that bend enhancement due to G tracts requires A tracts on the same strand. PMID:2315040

  15. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.


    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi


    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  16. The post-SCF quantum chemistry characteristics of the guanine-guanine stacking B-DNA.


    Cysewski, Piotr; Czyznikowska, Zaneta; Zaleśny, Robert; Czeleń, Przemysław


    The stacking interactions of two guanine molecules were analyzed detail at the DF-MP2/aug-cc-pVDZ level of theory for conformations appearing B-DNA. The dependence of intermolecular interaction energies on the pairs of step parameters (shift, slide, rise, tilt, roll and twist) was determined. The values of these parameters were chosen to cover the whole range of variability appearing crystallographic data. The scanning procedure was performed by subsequent changes of two variables with fixed values of the remaining base-pair and base-step BDNA parameters. Additionally, the hybrid variational-perturbational scheme was applied for the decomposition of the interaction energy into physically meaningful contributions at the MP2 level of theory. The significant impact of the mutual orientations of guanine bases was observed not only on the total intermolecular energy but also on its components. The second-order dispersion interaction is the most significant contribution to stabilization energy and is about eight times larger compared to the first-order electrostatic term with relaxation effects, which is also of stabilizing character. The dispersion interactions may vary up to 9.6 kcal mol(-1) between different guanine-guanine conformations. The parameters defining the mutual orientation of stacked guanine molecules have a different impact on the stabilization of the investigated complex. The following base-step parameters have only a minor impact on the stabilization energies: shift-slide, shift-roll, shift-twist, slide-twist and roll-twist. On the other hand, parameters such as rise and tilt significantly influence intermolecular interactions, i.e. strong attraction occurs only for a limited range of their values.

  17. Guanyl nucleotides modulate binding to steroid receptors in neuronal membranes.

    PubMed Central

    Orchinik, M; Murray, T F; Franklin, P H; Moore, F L


    The recently characterized corticosteroid receptor on amphibian neuronal membranes appears to mediate rapid, stress-induced changes in male reproductive behaviors. Because the transduction mechanisms associated with this receptor are unknown, we performed radioligand binding studies to determine whether this steroid receptor is negatively modulated by guanyl nucleotides. The binding of [3H]corticosterone to neuronal membranes was inhibited by nonhydrolyzable guanyl nucleotides in both equilibrium saturation binding and titration studies. The addition of guanyl nucleotide plus unlabeled corticosterone induced a rapid phase of [3H]corticosterone dissociation from membranes that was not induced by addition of unlabeled ligand alone. Furthermore, the equilibrium binding of [3H]corticosterone and the sensitivity of the receptor to modulation by guanyl nucleotides were both enhanced by Mg2+. These results are consistent with the formation of a ternary complex of steroid, receptor, and guanine nucleotide-binding protein that is subject to regulation by guanyl nucleotides. Therefore, rapid signal transduction through corticosteroid receptors on neuronal membranes appears to be mediated by guanine nucleotide-binding proteins. PMID:1570300

  18. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.


    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  19. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    SciTech Connect

    Hazelton, Keith Z.; Ho, Meng-Chaio; Cassera, Maria B.; Clinch, Keith; Crump, Douglas R.; Rosario Jr., Irving; Merino, Emilio F.; Almo, Steve C.; Tyler, Peter C.; Schramm, Vern L.


    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  20. Cap analog substrates reveal three clades of cap guanine-N2 methyltransferases with distinct methyl acceptor specificities.


    Benarroch, Delphine; Jankowska-Anyszka, Marzena; Stepinski, Janusz; Darzynkiewicz, Edward; Shuman, Stewart


    The Tgs proteins are structurally homologous AdoMet-dependent eukaryal enzymes that methylate the N2 atom of 7-methyl guanosine nucleotides. They have an imputed role in the synthesis of the 2,2,7-trimethylguanosine (TMG) RNA cap. Here we exploit a collection of cap-like substrates to probe the repertoire of three exemplary Tgs enzymes, from mammalian, protozoan, and viral sources, respectively. We find that human Tgs (hTgs1) is a bona fide TMG synthase adept at two separable transmethylation steps: (1) conversion of m(7)G to m(2,7)G, and (2) conversion of m(2,7)G to m(2,2,7)G. hTgs1 is unable to methylate G or m(2)G, signifying that both steps require an m(7)G cap. hTgs1 utilizes a broad range of m(7)G nucleotides, including mono-, di-, tri-, and tetraphosphate derivatives as well as cap dinucleotides with triphosphate or tetraphosphate bridges. In contrast, Giardia lamblia Tgs (GlaTgs2) exemplifies a different clade of guanine-N2 methyltransferase that synthesizes only a dimethylguanosine (DMG) cap structure and cannot per se convert DMG to TMG under any conditions tested. Methylation of benzyl(7)G and ethyl(7)G nucleotides by hTgs1 and GlaTgs2 underscored the importance of guanine N7 alkylation in providing a key pi-cation interaction in the methyl acceptor site. Mimivirus Tgs (MimiTgs) shares with the Giardia homolog the ability to catalyze only a single round of methyl addition at guanine-N2, but is distinguished by its capacity for guanine-N2 methylation in the absence of prior N7 methylation. The relaxed cap specificity of MimiTgs is revealed at alkaline pH. Our findings highlight both stark and subtle differences in acceptor specificity and reaction outcomes among Tgs family members.

  1. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B


    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  2. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals

    NASA Astrophysics Data System (ADS)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi


    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  3. Identification, expression, and characterization of Escherichia coli guanine deaminase.


    Maynes, J T; Yuan, R G; Snyder, F F


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a K(m) of 15 microM with guanine and a k(cat) of 3.2 s(-1). The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3' from an open reading frame which shows homology to a bacterial purine base permease.

  4. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

    PubMed Central

    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of 15 μM with guanine and a kcat of 3.2 s−1. The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3′ from an open reading frame which shows homology to a bacterial purine base permease. PMID:10913105

  5. Experimental observation of guanine tautomers with VUV photoionization

    SciTech Connect

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  6. Guanine oxidation: one- and two-electron reactions.


    Pratviel, Geneviève; Meunier, Bernard


    Guanine bases in DNA are the most sensitive to oxidation. A lot of effort has been devoted to the understanding of the chemical modifications of guanine under different oxidizing conditions, the final goal being to know which lesions in DNA can be expected in vivo and their biological consequences. This article analyses the mechanisms underlying guanine oxidation by the comparison between one- and two-electron transfer processes. The different oxidants used in vitro give complementary answers. This overview presents a choice of some key intermediates and the predictive description of G-oxidation products that can be generated from these intermediates depending on the reaction conditions.

  7. Adenine and guanine 8CH exchange in nucleic acids: resolution and measurement by Raman optical multichannel analysis.


    Lamba, O P; Becka, R; Thomas, G J

    Deuterium exchange of 8C protons of adenine and guanine in nucleic acids is conveniently monitored by laser Raman spectrophotometry, and the average exchange rate so determined [kA + kG] can be exploited as a dynamic probe of the secondary structure of DNA or RNA [J. M. Benevides and G. J. Thomas, Jr. (1985) Biopolymers 24, 667-682]. The present work describes a rapid Raman procedure, based upon optical multichannel analysis, which permits discrimination of the different 8CH exchange rates, kA of adenine and kG of guanine, in a single experimental protocol. For this procedure, simultaneous measurements are made of the intensity decay or frequency shift in separately resolved Raman bands of adenine and guanine, each of which is sensitive only to 8C deuteration of its respective purine. Resolution of the rates kA and kG is demonstrated for the mononucleotide mixtures, 5'-rAMP + 5'-rGMP and 5'-dAMP + 5'-dGMP, for the polynucleotides poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC), for calf thymus DNA, and for the 17 base-pair operator OR3. We show that the different exchange rates of adenine and guanine, in nucleotide mixtures and in DNA, may also be calculated independently from intensity decay of the composite 1481-cm-1 band, comprising overlapped adenine and guanine components, over a time domain that encompasses two distinct regimes: (1) a relatively more rapid exchange of guanine, and (2) a concurrent slower exchange of adenine. Both methods developed here yield consistent results. We find, first, that exchange of guanine is approximately twofold more rapid than that of adenine when both purines are present in the same structure and solvent environment, presumably a consequence of the greater basicity of the 7N site of guanine. Second, we find that adenine suffers greater retardation of exchange than guanine when both purines are incorporated into a "classical" B-DNA secondary structure, such as that of calf thymus DNA. This finding suggests different

  8. De Novo Guanine Biosynthesis but Not the Riboswitch-Regulated Purine Salvage Pathway Is Required for Staphylococcus aureus Infection In Vivo

    PubMed Central

    Yan, Donghong; Katakam, Anand K.; Reichelt, Mike; Lin, Baiwei; Kim, Janice; Park, Summer; Date, Shailesh V.; Monk, Ian R.; Xu, Min; Austin, Cary D.; Maurer, Till


    ABSTRACT De novo guanine biosynthesis is an evolutionarily conserved pathway that creates sufficient nucleotides to support DNA replication, transcription, and translation. Bacteria can also salvage nutrients from the environment to supplement the de novo pathway, but the relative importance of either pathway during Staphylococcus aureus infection is not known. In S. aureus, genes important for both de novo and salvage pathways are regulated by a guanine riboswitch. Bacterial riboswitches have attracted attention as a novel class of antibacterial drug targets because they have high affinity for small molecules, are absent in humans, and regulate the expression of multiple genes, including those essential for cell viability. Genetic and biophysical methods confirm the existence of a bona fide guanine riboswitch upstream of an operon encoding xanthine phosphoribosyltransferase (xpt), xanthine permease (pbuX), inosine-5′-monophosphate dehydrogenase (guaB), and GMP synthetase (guaA) that represses the expression of these genes in response to guanine. We found that S. aureus guaB and guaA are also transcribed independently of riboswitch control by alternative promoter elements. Deletion of xpt-pbuX-guaB-guaA genes resulted in guanine auxotrophy, failure to grow in human serum, profound abnormalities in cell morphology, and avirulence in mouse infection models, whereas deletion of the purine salvage genes xpt-pbuX had none of these effects. Disruption of guaB or guaA recapitulates the xpt-pbuX-guaB-guaA deletion in vivo. In total, the data demonstrate that targeting the guanine riboswitch alone is insufficient to treat S. aureus infections but that inhibition of guaA or guaB could have therapeutic utility. IMPORTANCE De novo guanine biosynthesis and purine salvage genes were reported to be regulated by a guanine riboswitch in Staphylococcus aureus. We demonstrate here that this is not true, because alternative promoter elements that uncouple the de novo pathway from

  9. An empirical approach for detecting nucleotide-binding sites on proteins.


    Saito, Mihoko; Go, Mitiko; Shirai, Tsuyoshi


    Protein structure data in the PDB (Protein Data Bank) were used to construct empirical scores of nucleotide-protein interactions. A simple strategy to evaluate the spatial distribution of protein atoms around the base moieties of nucleotides was applied to categorize adenine, guanine, nicotinamide and flavin nucleotide-binding sites. In addition to the known nucleotide-binding motifs, the empirical scores detected several other features that were shared among proteins with different folds. The empirical scores were also used to predict the binding sites on protein molecules and a comprehensive test of the prediction system was performed. As a result, adenine, guanine, nicotinamide and flavin sites were detected with efficiencies of 31, 29, 32 and 40%, respectively. The predictions were judged to be successful if the predicted base with the best score was located within a 3.0 A r.m.s.d. from the known ligand positions.

  10. 32P-post-labelling of 7-(3-chloro-2-hydroxypropyl)guanine in white blood cells of workers occupationally exposed to epichlorohydrin.


    Plna, K; Osterman-Golkar, S; Nogradi, E; Segerbäck, D


    Epichlorohydrin (ECH) is a simple 3-carbon epoxide of industrial importance. It has been shown to be genotoxic in several systems and carcinogenic in experimental animals. The aim of the present investigation was to study DNA adducts of ECH as a biomarker of occupational exposure to this chemical. 7-(3-Chloro-2-hydroxypropyl)guanine (7-CHP-guanine) was analysed in DNA from white blood cells using an anion exchange-based adduct enrichment protocol of the (32)P-post-labelling/HPLC-based assay. Blood samples were collected from seven workers handling ECH (exposed), nine workers not handling ECH but normally present in the premises where this chemical is used (potentially exposed) and 13 office and factory workers from locations in the plant where ECH is not handled (controls). 7-CHP-guanine was detected in five of the seven workers exposed to ECH (1.6-7.1 mol/10(9) mol nucleotides) and in two of the nine workers potentially exposed to ECH (0.8-1.5 mol/10(9) mol nucleotides). This adduct was not detected in any of the 13 controls. The difference in adduct levels between exposed workers and controls was statistically significant (Mann-Whitney test, P < 0.001), as was the difference between exposed workers and potentially exposed workers (P = 0.017). The recovery of 7-CHP-guanine in the (32)P-post-labelling assay was on average 48 +/- 7%, which is considerably higher than previously reported for other 7-alkylguanines. The method used had a limit of detection of approximately 0.4 mol adduct/10(9) mol nucleotides using 20 microg DNA. This study shows for the first time ECH-induced DNA adducts in humans and suggests that 7-CHP-guanine may be used as a biomarker of occupational exposure to ECH.

  11. Guanine- Formation During the Thermal Polymerization of Amino Acids

    NASA Technical Reports Server (NTRS)

    Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.


    The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

  12. Unapparent hypoxanthine-guanine phosphoribosyltransferase deficiency.


    Torres, R J; Puente, S; Menendez, A; Fernandez-Garcia, N


    Complete deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity causes Lesch Nyhan disease (LND), characterized by hyperuricemia, severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit and self-injurious behavior. Partial HPRT deficiency is present in patients with Lesch-Nyhan variant (LNV), who present with HPRT-related gout and a variable degree of neurological involvement. The diagnosis of HPRT deficiency relies on clinical, biochemical, enzymatic and molecular data. Patients with HPRT deficiency present low or undetectable HPRT activity in hemolysates, with increased adenine phosphoribosyltransferase (APRT) activity. We present a 9-year-old boy who experienced an episode of macroscopic hematuria with dysuria and left flank pain. He presented hyperuricemia and hyperuricosuria. HPRT and APRT activities were both normal in hemolysate; however, HPRT activity assayed in intact erythrocytes was 50% of control levels. A new missense point mutation c.424 A>G (T142A) was found in the HPRT1 gene. The apparent Michaelis constant (Km) for 5-phosphoribosyl-pyrophosphate assayed in patient hemolysate was 20-fold of control levels. In conclusion, we report a patient with HPRT deficiency who presented with both normal HPRT and APRT activity in hemolysate, in which the enzyme activity determined in intact erythrocytes was of diagnostic utility. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The Formation and Biological Significance of N7-Guanine Adducts

    PubMed Central

    Boysen, Gunnar; Pachkowski, Brian F.; Nakamura, Jun; Swenberg, James A


    DNA alkylation or adduct formation occurs at nucleophilic sites in DNA, mainly the N7-position of guanine. Ever since identification of the first N7-guanine adduct, several hundred studies on DNA adducts have been reported. Major issues addressed include the relationships between N7-guanine adducts and exposure, mutagenesis, and other biological endpoints. It became quickly apparent that N7-guanine adducts are frequently formed, but may have minimal biological relevance, since they are chemically unstable and do not participate in Watson Crick base pairing. However, N7-guanine adducts have been shown to be excellent biomarkers for internal exposure to direct acting and metabolically activated carcinogens. Questions arise, however, regarding the biological significance for N7-guanine adducts that are readily formed, do not persist, and are not likely to be mutagenic. Thus, we set out to review the current literature to evaluate their formation and the mechanistic evidence for the involvement of N7-guanine adducts in mutagenesis or other biological processes. It was concluded that there is insufficient evidence that N7-guanine adducts can be used beyond confirmation of exposure to the target tissue and demonstration of the molecular dose. There is little to no evidence that N7-guanine adducts or their depurination product, apurinic sites, are the cause of mutations in cells and tissues, since increases in AP sites have not been shown unless toxicity is extant. However, more research is needed to define the extent of chemical depurination versus removal by DNA repair proteins. Interestingly, N7-guanine adducts are clearly present as endogenous background adducts and the endogenous background amounts appear to increase with age. Furthermore, the N7-guanine adducts have been shown to convert to ring opened lesions (FAPy), which are much more persistent and have higher mutagenic potency. Studies in humans are limited in sample size and differences between controls and

  14. Biologically relevant oxidants cause bound proteins to readily oxidatively cross-link at Guanine.


    Solivio, Morwena J; Nemera, Dessalegn B; Sallans, Larry; Merino, Edward J


    Oxidative DNA-protein cross-links have received less attention than other types of DNA damage and remain as one of the least understood types of oxidative lesion. A model system using ribonuclease A and a 27-nucleotide DNA was used to determine the propensity of oxidative cross-linking to occur in the presence of oxidants. Cross-link formation was examined using four different oxidation systems that generate singlet oxygen, superoxide, and metal-based Fenton reactions. It is shown that oxidative cross-linking occurs in yields ranging from 14% to a maximal yield of 61% in all oxidative systems when equivalent concentrations of DNA and protein are present. Because singlet oxygen is the most efficient oxidation system in generating DNA-protein cross-links, it was chosen for further analyses. Cross-linking occurred with single-stranded DNA binding protein and not with bovine serum albumin. Addition of salt lowered nonspecific binding affinity and lowered cross-link yield by up to 59%. The yield of cross-linking increased with increased ratios of protein compared with DNA. Cross-linking was highly dependent on the number of guanines in a DNA sequence. Loss of guanine content on the 27-nucleotide DNA led to nearly complete loss in cross-linking, while primer extension studies showed cross-links to predominantly occur at guanine base on a 100-nucleotide DNA. The chemical species generated were examined using two peptides derived from the ribonuclease A sequence, N-acetyl-AAAKF and N-acetyl-AYKTT, which were cross-linked to 2'-deoxyguanosine. The cross-link products were spiroiminodihydantoin, guanidinohydantoin, and tyrosyl-based adducts. Formation of tyrosine-based adducts may be competitive with the more well-studied lysine-based cross-links. We conclude that oxidative cross-links may be present at high levels in cells since the propensity to oxidatively cross-link is high and so much of the genomic DNA is coated with protein.

  15. [Triplet expansion cytosine-guanine-guanine: Three cases of OMIM syndrome in the same family].


    González-Pérez, Jesús; Izquierdo-Álvarez, Silvia; Fuertes-Rodrigo, Cristina; Monge-Galindo, Lorena; Peña-Segura, José Luis; López-Pisón, Francisco Javier


    The dynamic increase in the number of triplet repeats of cytosine-guanine-guanine (CGG) in the FMR1 gene mutation is responsible for three OMIM syndromes with a distinct clinical phenotype: Fragile X syndrome (FXS) and two pathologies in adult carriers of the premutation (55-200 CGG repeats): Primary ovarian insufficiency (FXPOI) and tremor-ataxia syndrome (FXTAS) associated with FXS. CGG mutation dynamics of the FMR1 gene were studied in DNA samples from peripheral blood from the index case and other relatives of first, second and third degree by TP-PCR, and the percentage methylation. Diagnosis of FXS was confirmed in three patients (21.4%), eight patients (57.1%) were confirmed in the premutation range transmitters, one male patient with full mutation/permutation mosaicism (7.1%) and two patients (14.3%) with normal study. Of the eight permutated patients, three had FXPOI and one male patient had FXTAS. Our study suggests the importance of making an early diagnosis of SXF in order to carry out a family study and genetic counselling, which allow the identification of new cases or premutated patients with FMR1 gene- associated syndromes (FXTAS, FXPOI). Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  16. Studies on guanine deaminase and its inhibitors in rat tissue

    PubMed Central

    Kumar, S.; Josan, V.; Sanger, K. C. S.; Tewari, K. K.; Krishnan, P. S.


    1. In kidney, but not in rat whole brain and liver, guanine-deaminase activity was localized almost exclusively in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, as in brain and liver, the enzymic activity recovered in the supernatant was higher than that in the whole homogenate. The particulate fractions of kidney, especially the heavy mitochondria, brought about powerful inhibition of the supernatant guanine-deaminase activity. 2. In spleen, as in kidney, guanine-deaminase activity was localized in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, the particulate fractions did not inhibit the activity of the supernatant. 3. Guanine-deaminase activity in rat brain was absent from the cerebellum and present only in the cerebral hemispheres. The inhibitor of guanine deaminase was located exclusively in the cerebellum, where it was associated with the particles sedimenting at 5000g from sucrose homogenates. 4. Homogenates of cerebral hemispheres, the separated cortex or the remaining portion of the hemispheres had significantly higher guanine-deaminase activity than homogenates of whole brain. The enzymic activity of the subcellular particulate fractions was nearly the same. 5. Guanine deaminase was purified from the 15000g supernatant of sucrose homogenates of whole brain. The enzyme separated as two distinct fractions, A and B, on DEAE-cellulose columns. 6. The guanine-deaminase activity of the light-mitochondrial fraction of whole brain was fully exposed and solubilized by treatment with Triton X-100, and partially purified. 7. Tested in the form of crude preparations, the inhibitor from kidney did not act on the brain and liver supernatant enzymes and the inhibitor from cerebellum did not act on kidney enzyme, but the inhibitor from liver acted on both brain and kidney enzyme. 8. The inhibitor of guanine deaminase was purified from the heavy mitochondria of whole brain and liver and the 5000g residue of

  17. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    SciTech Connect

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W. ); Pandey, S. )


    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha} protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.

  18. Regulation of membrane associated protein kinase C activity by guanine nucleotide in rabbit peritoneal neutrophils

    SciTech Connect

    Huang, C.K.; Devanney, J.F.


    Addition of phorbol myristate acetate (PMA) (0.1 or guanosine-5'-0-(3-thiotriphosphate) (GTP..gamma..S) ( to the membrane fraction from rabbit peritoneal neutrophils results in an increase of phosphorylation of several membrane proteins. To test whether membrane associated protein kinase C is involved in the activation, histone is added to the membrane as a substrate for protein kinase C. Phosphorylation of histone is determined by counting the gel pieces containing histone IIIS after separation from other membrane components by SDS-gel electrophoresis. In the presence of CaC12 (20, GTP..gamma..S (10 or PMA (0.1 stimulates the phosphorylation of histone IIIS (40% to 70% increase). To achieve this effect calcium is required for GTP..gamma..S but not for PMA. The effect of GTP..gamma..S but not PMA is inhibited in membranes obtained from cells pretreated with pertussis toxin. Membrane protein kinase C is solubilized with Triton X-100 (1%) and then applied to a DEAE-52 cellulose column chromatography. Two peaks of protein kinase C activity are observed. Peak one is eluted at 40 mM NaCl, peak two is eluted at 140 mM NaCl. The activity of peak one is stimulated with phosphatidylserine (PS) and PMA but not with PS and calcium. The activity of peak two is stimulated with either PS and PMA or PS and calcium. The results suggest that GTP binding protein is involved in the activation of membrane associated protein kinase C and the kinase may exist in two forms, calcium sensitive and calcium insensitive.

  19. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    SciTech Connect

    Di Paolo, T.; Falardeau, P.


    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p < 0.001). Competition for (/sup 3/H)-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-(..beta..-..gamma..-imino)triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables.

  20. Catecholamine-sensitive adenylate cyclase of caudate nucleus and cerebral cortex. Effects of guanine nucleotides.

    PubMed Central

    Sulakhe, P V; Leung, N L; Arbus, A T; Sulakhe, S J; Jan, S H; Narayanan, N


    1. GTP and GMP-P(NH)P (guanyl-5'-yl imidodiphosphate) were observed to increase the stimulation of neural adenylate cyclase by dopamine (3,4-dihydroxyphenethylamine) and noradrenaline. 2. GMP-P(NH)P had a biphasic effect on the enzyme activity. 3. Preincubation of membranes with GMP-P(NH)P activated the enzyme by a process dependent on time and temperature. Catecholamines increased the speed and the extent of this activation. 4. Membrane fractions contained high- and low-affinity sites for GMP-P(NH)P binding: this binding was due to protein(s) of the membrane preparations. 5. Low-affinity-site binding of GMP-P(NH)P appeared to be related to the stimulatory effect on the adenylate cyclase activity. PMID:18147

  1. Juvenile Hormone Regulation of Drosophila Epac - A Guanine Nucleotide Exchange Factor for Rap1 Small GTPase

    USDA-ARS?s Scientific Manuscript database

    Previously, we utilized a microchip array encompassing probes for 14,010 genes of Drosophila melanogaster to analyze the effect of (10R) juvenile hormone III (JH) on genome-wide gene expression in Drosophila S2 cells. Treatment with JH yielded a collection of 32 gene transcripts that demonstrated a ...

  2. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    SciTech Connect

    Lindeberg, M.; Jacobs, M. )


    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio) triphosphate (GTP-{gamma}-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the {sigma} subunit of platelet G{sub s} protein. GTP-{gamma}-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al{sup +3} and F{sup {minus}} agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF{sup {minus}}{sub 4} strongly inhibited {sup 3}H-indoleacetic acid nor accumulation; GTP-{gamma}-S effects on this system will be discussed.

  3. Functional reconstitution of prostaglandin E receptor from bovine adrenal medulla with guanine nucleotide binding proteins

    SciTech Connect

    Negishi, M.; Ito, S.; Yokohama, H.; Hayashi, H.; Katada, T.; Ui, M.; Hayaishi, O.


    Prostaglandin E/sub 2/ (PEG/sub 2/) was found to bind specifically to a 100,000 x g pellet prepared from bovine adrenal medulla. The PGE receptor was associated with a GTP-binding protein (G-protein) and could be covalently cross-linked with this G-protein by dithiobis(succinimidyl propionate) in the 100,000 x g pellet. In order to characterize the G-protein associated with the PGE receptor and reconstitute these proteins in phospholipid vesicles, the authors purified the G-protein to apparent homogeneity from the 100,000 x g pellet. The G-protein served as a substrate of pertussis toxin but differed in its ..cap alpha.. subunit from two known pertussis toxin substrate G-proteins (G/sub i/ and G/sub 0/) purified from bovine brain. The molecular weight of the ..cap alpha.. subunit was 40,000, which is between those of G/sub i/ and G/sub 0/. The purified protein was also distinguished immunologically from G/sub i/ and G/sub 0/ and was referred to as G/sub am/. Reconstitution of the PGE receptor with pure C/sub am/, G/sub i/, or G/sub 0/ in phospholipid vesicles resulted in a remarkable restoration of (/sup 3/H)PGE/sub 2/ binding activity in a GTP-dependent manner. The efficiency of these three G-proteins in this capacity was roughly equal. When pertussis toxin- or N-ethylmaleimide-treated G-proteins, instead of the native ones, were reconstituted into vesicles, the restoration of binding activity was no longer observed. These results indicate that the PGE receptor can couple functionally with G/sub am/, G/sub i/, or G/sub 0/ in phospholipid vesicles and suggest that G/sub am/ may be involved in signal transduction of the PGE receptor in bovine adrenal medulla.

  4. Characterization of Oxidative Guanine Damage and Repair in Mammalian Telomeres

    PubMed Central

    Wang, Zhilong; Rhee, David B.; Lu, Jian; Bohr, Christina T.; Zhou, Fang; Vallabhaneni, Haritha; de Souza-Pinto, Nadja C.; Liu, Yie


    8-oxo-7,8-dihydroguanine (8-oxoG) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG) are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1)–initiated DNA base excision repair (BER). Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere–FISH), by chromosome orientation–FISH (CO–FISH), and by indirect immunofluorescence in combination with telomere–FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1−/−) mouse tissues and primary embryonic fibroblasts (MEFs) cultivated in hypoxia condition (3% oxygen), whereas telomere shortening was detected in Ogg1−/− mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen) or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1−/− mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1−/− mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1−/− MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining

  5. Identification of 17 independent mutations responsible for human hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency.

    PubMed Central

    Davidson, B L; Tarlé, S A; Van Antwerp, M; Gibbs, D A; Watts, R W; Kelley, W N; Palella, T D


    Complete hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency causes the Lesch-Nyhan syndrome, an X-linked, purine metabolism disorder manifested by hyperuricemia, hyperuricaciduria, and neurologic dysfunction. Partial HPRT deficiency causes hyperuricemia and gout. One requirement for understanding the molecular basis of HPRT deficiency is the determination of which amino acids in this salvage enzyme are necessary for structural or catalytic competence. In this study we have used the PCR coupled with direct sequencing to determine the nucleotide and subsequent amino acid changes in 22 subjects representing 17 unrelated kindreds from the United Kingdom. These mutations were confirmed by using either RNase mapping or Southern analyses. In addition, experiments were done to determine enzyme activity and electrophoretic mobility, and predictive paradigms were used to study the impact of these amino acid substitutions on secondary structure. Images Figure 2 Figure 3 Figure 4 PMID:2018042

  6. Generation of Guanine – Thymidine Cross-links in DNA by Peroxynitrite/Carbon Dioxide

    PubMed Central

    Yun, Byeong Hwa; Geacintov, Nicholas E.; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO3•− and •NO2 radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2′-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and thymine N3 (T*) atoms (Crean et al., Nucleic Acids Res., 2008, 36, 742–755). In this work we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5–7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitroG), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxoG) and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level, and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled 15N,13C-labeled 2′-deoxy oligoribonucleotides 5′-dGpT and 5′-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and tri-oligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction-monitoring mode. The Nim and 8nitroG are the major products formed (~ 0.05% each), and lesser amounts of 8-oxoG (~ 0.02%), and d(G*pT*) and d(G*-T*) enzymatic digestion products (~ 0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both

  7. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.


    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  8. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.


    Weisman-Shomer, P; Fry, M


    The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

  9. A 2-iminohydantoin from the oxidation of guanine.


    Ye, Wenjie; Sangaiah, R; Degen, Diana E; Gold, Avram; Jayaraj, K; Koshlap, Karl M; Boysen, Gunnar; Williams, Jason; Tomer, Kenneth B; Ball, Louise M


    The nucleobase guanine was oxidized with dimethyldioxirane (DMDO) to explore the role of epoxidizing agents in oxidative DNA damage. Treatment of guanine with 10% molar excess DMDO in aqueous solution at 0 degrees C and pH 7.5 followed by workup under mild conditions gave 5-carboxamido-5-formamido-2-iminohydantoin (1) as the sole isolable product in 71% yield. The structure of 1 was established on the basis of mass spectrometry and NMR studies on 1 and its isotopomers generated by the oxidation of [4-(13)C] and [7-(15)N]guanine, which yield [5-(13)C]1 and [7-(15)N]1. The distribution of 13C and 15N labels in the isotopomeric products supports initial epoxidation of the C4-C5 bond of guanine followed by a 1,2-acyl migration of guanine C6. Compound 1 is suggested as a possible primary DNA lesion from putative epoxidizing agents, including hydroperoxides present during biological processes such as lipid peroxidation.

  10. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.


    Lech, Christopher Jacques; Phan, Anh Tuân


    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Updating Our View of Organelle Genome Nucleotide Landscape

    PubMed Central

    Smith, David Roy


    Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

  12. Dictyostelium Ric8 is a nonreceptor guanine exchange factor for heterotrimeric G proteins and is important for development and chemotaxis

    PubMed Central

    Kataria, Rama; Xu, Xuehua; Fusetti, Fabrizia; Keizer-Gunnink, Ineke; Jin, Tian; van Haastert, Peter J. M.; Kortholt, Arjan


    Heterotrimeric G proteins couple external signals to the activation of intracellular signal transduction pathways. Agonist-stimulated guanine nucleotide exchange activity of G-protein-coupled receptors results in the exchange of G-protein-bound GDP to GTP and the dissociation and activation of the complex into Gα-GTP and a Gβγ dimer. In Dictyostelium, a basal chemotaxis pathway consisting of heterotrimeric and monomeric G proteins is sufficient for chemotaxis. Symmetry breaking and amplification of chemoattractant sensing occurs between heterotrimeric G protein signaling and Ras activation. In a pull-down screen coupled to mass spectrometry, with Gα proteins as bait, we have identified resistant to inhibitors of cholinesterase 8 (Ric8) as a nonreceptor guanine nucleotide exchange factor for Gα-protein. Ric8 is not essential for the initial activation of heterotrimeric G proteins or Ras by uniform chemoattractant; however, it amplifies Gα signaling, which is essential for Ras-mediated symmetry breaking during chemotaxis and development. PMID:23576747

  13. Purine metabolite and energy charge analysis of Trypanosoma brucei cells in different growth phases using an optimized ion-pair RP-HPLC/UV for the quantification of adenine and guanine pools.


    Graven, Patricia; Tambalo, Margherita; Scapozza, Leonardo; Perozzo, Remo


    Human African Trypanosomiasis (HAT) is caused by the protozoan parasite Trypanosoma brucei. Although trypanosomes are well-studied model organisms, only little is known about their adenine and guanine nucleotide pools. Besides being building blocks of RNA and DNA, these nucleotides are also important modulators of diverse biochemical cellular processes. Adenine nucleotides also play an important role in the regulation of metabolic energy. The energetic state of cells is evaluated by the energy charge which gives information about how much energy is available in form of high energy phosphate bonds of adenine nucleotides. A sensitive and reproducible ion-pair RP-HPLC/UV method was developed and optimized, allowing the quantification of guanine and adenine nucleosides/nucleotides in T. brucei. With this method, the purine levels and their respective ratios were investigated in trypanosomes during logarithmic, stationary and senescent growth phases. Results of this study showed that all adenine and guanine purines under investigation were in the low mM range. The energy charge was found to decrease from logarithmic to static and to senescent phase whereas AMP/ATP, ADP/ATP and GDP/GTP ratios increased in the same order. In addition, the AMP/ATP ratio varied as the square of the ADP/ATP ratio, indicating AMP to be the key energy sensor molecule in trypanosomes.

  14. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine-guanine phosphoribosyltransferase.


    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T; Guddat, Luke W


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed.

  15. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine–guanine phosphoribosyltransferase

    PubMed Central

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T.; Guddat, Luke W.


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed. PMID:27786284

  16. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin


    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  17. Camptothecins guanine interactions: mechanism of charge transfer reaction upon photoactivation

    NASA Astrophysics Data System (ADS)

    Steenkeste, K.; Guiot, E.; Tfibel, F.; Pernot, P.; Mérola, F.; Georges, P.; Fontaine-Aupart, M. P.


    The potent activity exhibited by the antitumoral camptothecin (CPT) and its analog irinotecan (CPT-11) is known to be related to a close contact between the drug and the nucleic acid base guanine. This specificity of interaction between these two chromophores was examined by following changes in the photophysical properties of the drug using steady-state as well as time-resolved absorption and fluorescence methods. The observed effects on absorption, fluorescence emission and singlet excited state lifetimes give evidence for the occurrence of a stacking complex formation restricted to the quinoline part of CPT or CPT-11 and the guanine base but also with the adenine base. The triplet excited state properties of the drugs have been also characterized in absence and in presence of guanosine monophosphate and reveal the occurrence of an electron transfer from the guanine base to the drug. Support for this conclusion was obtained from the studies of a set of biological targets of various oxido-reduction potentials, adenosine monophosphate, cytidine, cytosine, tryptophan, tyrosine and phenylalanine. This finding gives an interpretation of the CPT-induced guanine photolesions previously reported in the literature. These data taken together are discussed in connection with the drug activity. The stacking complex CPT/guanine is necessary but not sufficient to explain the role of the chirality and of the lactone structure in the function of the drug. A stereospecific interaction with the enzyme topoisomerase I seems necessary to stabilize the stacking complex. The first experiments using time-resolved fluorescence by two-photon excitation confirms that CPT does not bind to the isolated enzyme.

  18. Formation of Two Novel Estrogen Guanine Adducts and HPLC/MS Detection of 4-Hydroxyestradiol-N7-Guanine in Human Urine

    PubMed Central

    Bransfield, Leslie A.; Rennie, Alissa; Visvanathan, Kala; Odwin, Shelly-Ann; Kensler, Thomas W.; Yager, James D.; Friesen, Marlin D.; Groopman, John D.


    Estrogen-DNA adducts are potential biomarkers for assessing the risk of developing of a number of hormonally-modified cancers, including breast cancer. Formation of the 4-hydroxyestradiol-N7-guanine (4-OHE2-N7-guanine) adduct from reaction of estradiol-3,4-quinone with DNA and its detection in vivo has been established. With the ultimate goal of exploring estrogen-DNA adducts as biomarkers in experimental and human investigations, the 4-OHE2-N7-guanine was synthesized and preliminary studies demonstrated that this adduct was detectable in all ten female human urine samples examined. Therefore, more extensive investigations were conducted to study this compound’s chemical-physical properties and to examine the stability of 4-OHE2-N7-guanine under a range of pH conditions that might influence biomarker measurement. Under neutral to alkaline conditions 4-OHE2-N7-guanine could completely oxidize to an 8-oxo-guanine derivative. This derivative was isolated by HPLC and mass spectrometry confirmed the oxidized compound by demonstrating the formation of an m/z 168 fragment, generated by oxygen addition to guanine. Further, investigation of the 4-OHE2-N7-2’-deoxyguanosine nucleoside adduct showed that under alkaline conditions a formamidopyrimidine analogue was produced. The formamidopyrimidine derivative forms from ring opening of the guanine imidazole ring following C-8 oxidation in the N7,N9 disubstituted guanine Formation of both of these oxidized estrogen-guanine DNA adducts has precedent with other chemical agents that covalently bind to the N7 position in guanine. Therefore, the development and application of methods to measure estrogen-guanine adducts will need to also consider these new adducts and the biological implications of these compounds will need to be explored to determine their contribution to estrogen toxicology. PMID:18582124

  19. Guanine is a growth factor for Legionella species.

    PubMed Central

    Pine, L; Franzus, M J; Malcolm, G B


    Evaluation of previously described chemically defined media for the growth of Legionella pneumophila showed that these media supported poor growth of several strains of L. pneumophila and did not support growth of certain of the Legionella species described later. Growth was stimulated by the dialysate from yeast extract but not by the nondialyzable fraction. Further investigations indicated that the active factors from the yeast extract dialysate were purine or pyrimidine derivatives, and certain known purines and pyrimidines were found to stimulate growth. Of these, guanine universally stimulated growth of all Legionella strains and was a growth requirement for several of the species tested. A balanced, N-(2-acetamido)-2-aminoethanesulfonic acid-buffered, chemically defined medium having guanine or a purine-pyrimidine mix is presented for the general growth of Legionella species. PMID:3700600

  20. Impedimetric investigation of gold nanoparticles - guanine modified electrode

    SciTech Connect

    Vulcu, A.; Pruneanu, S.; Berghian-Grosan, C.; Olenic, L.; Muresan, L. M.; Barbu-Tudoran, L.


    In this paper we report the preparation of a modified electrode with gold nanoparticles and guanine. The colloidal suspension of gold nanoparticles was obtained by Turkevich method and was next analyzed by UV-Vis spectroscopy and Transmission Electron Microscopy (TEM). The gold electrode was modified by self-assembling the gold nanoparticles with guanine, the organic molecule playing also the role of linker. The electrochemical characteristics of the bare and modified electrode were investigated by Electrochemical Impedance Spectroscopy (EIS). A theoretical model was developed based on an electrical equivalent circuit which contain solution resistance (R{sub s}), charge transfer resistance (R{sub ct}), Warburg impedance (Z{sub W}) and double layer capacitance (C{sub dl})

  1. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  2. High-Throughput Screening for Small Molecule Inhibitors of LARG-Stimulated RhoA Nucleotide Binding via a Novel Fluorescence Polarization Assay

    PubMed Central

    Evelyn, Chris R.; Ferng, Timothy; Rojas, Rafael J.; Larsen, Martha J.; Sondek, John; Neubig, Richard R.


    Guanine nucleotide-exchange factors (GEFs) stimulate guanine nucleotide exchange and the subsequent activation of Rho-family proteins in response to extracellular stimuli acting upon cytokine, tyrosine kinase, adhesion, integrin, and G-protein coupled receptors (GPCRs). Upon Rho activation, several downstream events occur, such as morphological and cytokskeletal changes, motility, growth, survival, and gene transcription. The RhoGEF Leukemia-Associated RhoGEF (LARG) is a member of the Regulators of G-protein Signaling Homology Domain (RH) family of GEFs originally identified as a result of chromosomal translocation in acute myeloid leukemia. Using a novel fluorescence polarization guanine nucleotide binding assay utilizing BODIPY-Texas Red-GTPγS (BODIPY-TR-GTPγS), we performed a ten-thousand compound high-throughput screen for inhibitors of LARG-stimulated RhoA nucleotide binding. Five compounds identified from the high-throughput screen were confirmed in a non-fluorescent radioactive guanine nucleotide binding assay measuring LARG-stimulated [35S] GTPγS binding to RhoA, thus ruling out non-specific fluorescent effects. All five compounds selectively inhibited LARG-stimulated RhoA [35S] GTPγS binding, but had little to no effect upon RhoA or Gαo [35S] GTPγS binding. Therefore, these five compounds should serve as promising starting points for the development of small molecule inhibitors of LARG-mediated nucleotide exchange as both pharmacological tools and therapeutics. In addition, the fluorescence polarization guanine nucleotide binding assay described here should serve as a useful approach for both high-throughput screening and general biological applications. PMID:19196702

  3. `Guanigma': the revised structure of biogenic anhydrous guanine

    NASA Astrophysics Data System (ADS)

    Hirsch, Anna; Gur, Dvir; Polishchuk, Iryna; Levy, Davide; Pokroy, Boaz; Cruz-Cabeza, Aurora J.; Addadi, Lia; Kronik, Leeor; Leiserowitz, Leslie

    Living organisms display a spectrum of colors, produced by pigmentation, structural coloration, or both. A relatively well-studied system, which produces colors via an array of alternating anhydrous guanine crystals and cytoplasm, is responsible for the metallic luster of many fish. The structure of biogenic anhydrous guanine was believed to be the same as that of the synthetic one - a monoclinic polymorph. Here we re-examine the structure of biogenic guanine, using experimental X-ray and electron diffraction (ED) data exposing troublesome inconsistencies - namely, a 'guanigma'. To address this, we sought alternative candidate polymorphs using symmetry and packing considerations, then used first principles calculations to determine whether the selected candidates could be energetically stable. We identified theoretically a different monoclinic polymorph, were able to synthesize it, and to confirm using X-ray diffraction that it is this polymorph that occurs in biogenic samples. However, the ED data were still not consistent with this polymorph, but rather with a theoretically generated orthorhombic polymorph. This apparent inconsistency was resolved by showing how the ED pattern could be affected by crystal structural faults composed of offset molecular layers.

  4. Fragmentation mechanisms of cytosine, adenine and guanine ionized bases.


    Sadr-Arani, Leila; Mignon, Pierre; Chermette, Henry; Abdoul-Carime, Hassan; Farizon, Bernadette; Farizon, Michel


    The different fragmentation channels of cytosine, adenine and guanine have been studied through DFT calculations. The electronic structure of bases, their cations, and the fragments obtained by breaking bonds provides a good understanding of the fragmentation process that can complete the experimental approach. The calculations allow assigning various fragments to the given peaks. The comparison between the energy required for the formation of fragments and the peak intensity in the mass spectrum is used. For cytosine and guanine the elimination of the HNCO molecule is a major route of dissociation, while for adenine multiple loss of HCN or HNC can be followed up to small fragments. For cytosine, this corresponds to the initial bond cleavage of N3-C4/N1-C2, which represents the main dissociation route. For guanine the release of HNCO is obtained through the N1-C2/C5-C6 bond cleavage (reverse order also possible) leading to the largest peak of the spectrum. The corresponding energies of 3.5 and 3.9 eV are typically in the range available in the experiments. The loss of NH3 or HCN is also possible but requires more energy. For adenine, fragmentation consists of multiple loss of the HCN molecule and the main route corresponding to HC8N9 loss is followed by the release of HC2N1.

  5. A three-state model for the photophysics of guanine.


    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos


    The nonadiabatic photochemistry of the guanine molecule (2-amino-6-oxopurine) and some of its tautomers has been studied by means of the high-level theoretical ab initio quantum chemistry methods CASSCF and CASPT2. Accurate computations, based by the first time on minimum energy reaction paths, states minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of the molecules lead to interpret the photochemistry of guanine and derivatives within a three-state model. As in the other purine DNA nucleobase, adenine, the ultrafast subpicosecond fluorescence decay measured in guanine is attributed to the barrierless character of the path leading from the initially populated 1(pi pi* L(a)) spectroscopic state of the molecule toward the low-lying methanamine-like conical intersection (gs/pi pi* L(a))CI. On the contrary, other tautomers are shown to have a reaction energy barrier along the main relaxation profile. A second, slower decay is attributed to a path involving switches toward two other states, 1(pi pi* L(b)) and, in particular, 1(n(O) pi*), ultimately leading to conical intersections with the ground state. A common framework for the ultrafast relaxation of the natural nucleobases is obtained in which the predominant role of a pi pi*-type state is confirmed.

  6. B3LYP, BLYP and PBE DFT band structures of the nucleotide base stacks

    NASA Astrophysics Data System (ADS)

    Szekeres, Zs; Bogár, F.; Ladik, J.

    DFT crystal orbital (band structure) calculations have been performed for the nucleotide base stacks of cytosine, thymine, adenine, and guanine arranged in DNA B geometry. The band structures obtained with PBE, BLYP, and B3LYP functionals are presented and compared to other related experimental and theoretical results. The influence of the quality of the basis set on the fundamental gap values was also investigated using Clementi's double ζ, 6-31G and 6-31G* basis sets.

  7. Nucleotide correlations and electronic transport of DNA sequences

    NASA Astrophysics Data System (ADS)

    Albuquerque, E. L.; Vasconcelos, M. S.; Lyra, M. L.; de Moura, F. A. B. F.


    We use a tight-binding formulation to investigate the transmissivity and wave-packet dynamics of sequences of single-strand DNA molecules made up from the nucleotides guanine G , adenine A , cytosine C , and thymine T . In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of two artificial sequences: (i) the Rudin-Shapiro one, which has long-range correlations; (ii) a random sequence, which is a kind of prototype of a short-range correlated system, presented here with the same first-neighbor pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the persistence of resonances of finite segments. On the other hand, the wave-packet dynamics seems to be mostly influenced by the short-range correlations.

  8. Pressure response of (31)P chemical shifts of adenine nucleotides.


    Karl, Matthias; Spoerner, Michael; Pham, Thuy-Vy; Narayanan, Sunilkumar Puthenpurackal; Kremer, Werner; Kalbitzer, Hans Robert


    High pressure NMR spectroscopy is a powerful method for identifying rare conformational states of proteins from the pressure response of their chemical shifts. Many proteins have bound adenine nucleotides at their active centers, in most cases in a complex with Mg(2+)-ions. The (31)P NMR signals of phosphate groups of the nucleotides can be used as probes for conformational transitions in the proteins themselves. For distinguishing protein specific pressure effects from trivial pressure responses not due to the protein interaction, data of the pressure response of the free nucleotides must be available. Therefore, the pressure response of (31)P chemical shifts of the adenine nucleotides AMP, ADP, and ATP and their Mg(2+)-complexes has been determined at pH values several units distant from the respective pK-values. It is clearly non-linear for most of the resonances. A negative first order pressure coefficient B1 was determined for all (31)P resonances except Mg(2+)·AMP indicating an upfield shift of the resonances with pressure. The smallest and largest negative values are obtained for the α-phosphate group of ADP and β-phosphate group of Mg(2+)·ATP with -0.32 and -4.59ppm/GPa, respectively. With exception of the α-phosphate group of Mg(2+)·AMP the second order pressure coefficients are positive leading to a saturation like behaviour. The pressure response of the adenine nucleotides is similar but not identical to that observed earlier for guanine nucleotides. The obtained data show that the chemical shift pressure response of the different phosphate groups is rather different dependent on the position of phosphate group in the nucleotide and the nucleotide used. Copyright © 2016. Published by Elsevier B.V.

  9. Nature of guanine oxidation in RNA via the flash-quench technique versus direct oxidation by a metal oxo complex

    PubMed Central

    Holcomb, Dana R.; Ropp, Patricia A.; Theil, Elizabeth C.; Thorp, H. Holden


    Oxidation of RNA can be effected by two different techniques: a photochemical, electron-transfer method termed “flash-quench” and direct oxidation by metal oxo complexes. The flash-quench method produces selective oxidation using a metal photosensitizer, tris(bipyridyl)ruthenium(III) trichloride (Ru(bpy)33+), and quencher, pentaamminechlorocobalt(III) chloride (Co(NH3)5Cl2+). We have optimized the flash-quench technique for the following RNAs: tRNAPhe, human ferritin iron-responsive element (IRE), and a mutated human ferritin IRE. We have also employed a chemical footprinting technique involving the oxoruthenium(IV) complex (Ru(tpy)(bpy)O2+ (tpy = 2,2′,2″-terpyridine; bpy = 2,2′-bipyridine)) to oxidize guanine. Comparison of the two methods shows that the flash-quench technique provides a visualization of nucleotide accessibility for a static conformation of RNA while the Ru(tpy)(bpy)O2+ complex selectively oxidizes labile guanines and gives a visualization of a composite of multiple conformations of the RNA structure. PMID:20038124

  10. Towards metal-mediated g-quartet analogues: 1,2,4-triazole nucleotides.


    Withers, Jamie M; Telfer, Shane G; Filichev, Vyacheslav V


    We proposed that metal-coordinating nucleotides could be used to control the assembly of G-quadruplexes through the formation of an artificial metal-centered quartet. Several guanine-rich DNA sequences containing 1,2,4-triazole-functionalized nucleotides were investigated. These oligonucleotides were designed to form quartets mediated by metal-triazole bonding both on the surface of and within the G-quadruplex core. In contrast to duplex studies in which 1,2,4-triazole nucleosides serve as a mimic of Watson-Crick base-pairs, our results show that these nucleosides are not suitable components of an artificial metal-centered quartet.

  11. Plant Cyclic Nucleotide Signalling

    PubMed Central

    Martinez-Atienza, Juliana; Van Ingelgem, Carl; Roef, Luc


    The presence of the cyclic nucleotides 3′,5′-cyclic adenyl monophosphate (cAMP) and 3′,5′-cyclic guanyl monophosphate (cGMP) in plants is now generally accepted. In addition, cAMP and cGMP have been implicated in the regulation of important plant processes such as stomatal functioning, monovalent and divalent cation fluxes, chloroplast development, gibberellic acid signalling, pathogen response and gene transcription. However, very little is known regarding the components of cyclic nucleotide signalling in plants. In this addendum, the evidence for specific mechanisms of plant cyclic nucleotide signalling is evaluated and discussed. PMID:19704553

  12. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.


    Seclaman, E; Kurunczi, L; Simon, Z


    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  13. Rho guanine exchange factors in blood vessels: fine-tuners of angiogenesis and vascular function.


    Kather, Jakob Nikolas; Kroll, Jens


    The angiogenic cascade is a multi-step process essential for embryogenesis and other physiological and pathological processes. Rho family GTPases are binary molecular switches and serve as master regulators of various basic cellular processes. Rho GTPases are known to exert important functions in angiogenesis and vascular physiology. These functions demand a tight and context-specific control of cellular processes requiring superordinate control by a multitude of guanine nucleotide exchange factors (GEFs). GEFs display various features enabling them to fine-tune the actions of Rho GTPases in the vasculature: (1) GEFs regulate specific steps of the angiogenic cascade; (2) GEFs show a spatio-temporally specific expression pattern; (3) GEFs differentially regulate endothelial function depending on their subcellular location; (4) GEFs mediate crosstalk between complex signaling cascades and (5) GEFs themselves are regulated by another layer of interacting proteins. The aim of this review is to provide an overview about the role of GEFs in regulating angiogenesis and vascular function and to point out current limitations as well as clinical perspectives. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.


    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way.

  15. Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin

    SciTech Connect

    Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie


    The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

  16. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    PubMed Central

    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  17. Toward electrochemical resolution of two genes on one electrode: using 7-deaza analogues of guanine and adenine to prepare PCR products with differential redox activity.


    Yang, Ivana V; Ropp, Patricia A; Thorp, H Holden


    The 7-deaza analogues of guanine and adenine were incorporated into polymerase chain reaction (PCR) products by substitution of the appropriate nucleotide triphosphates into the reaction. These PCR products can be immobilized on ITO electrodes and detected by catalytic cyclic voltammetry with ruthenium polypyridyl complexes. Immobilization on indium tin oxide (ITO) electrodes of 330- and 1200-base pair (bp) PCR amplicons from the E. coli dacA gene containing one or both of the 7-deazapurines was effected by precipitation from a 9:1 DMF/acetate solution. Amplicons containing the 7-deazaguanine base were detected by observing current enhancement in the cyclic voltammogram of Ru(dmb)3(3)+/2+ (dmb = 4,4'-dimethyl-2,2'-bipyridine) due to the selective oxidation of the modified base by this mediator. Oxidation of incorporated 7-deazaadenine bases in addition to native guanines gives rise to a higher current enhancement in the cyclic voltammogram of Ru(bpy)3(3)+/2+ (bpy = 2,2'-bipyridine) compared to the enhancement observed in the presence of guanine only. This strategy was employed to simultaneously detect the 330-bp sequence containing 7-deazaadenine and the 1200-bp sequence containing 7-deazaguanine on the same ITO electrode. Such a strategy may provide a means for detecting multiple genes on a single microlocation and may thereby lead to more highly multiplexed gene assays.

  18. Guanine oxidation by electron transfer: one- versus two-electron oxidation mechanism.


    Kupan, Adam; Saulière, Aude; Broussy, Sylvain; Seguy, Christel; Pratviel, Geneviève; Meunier, Bernard


    The degeneracy of the guanine radical cation, which is formed in DNA by oxidation of guanine by electron transfer, was studied by a detailed analysis of the oxidation products of guanine on oligonucleotide duplexes and by labeling experiments. It was shown that imidazolone, the major product of guanine oxidation, is formed through a one-electron oxidation process and incorporates one oxygen atom from O2. The formation of 8-oxo-7,8-dihydroguanine by a two-electron oxidation process was a minor pathway. The two-electron oxidation mechanism was also evidenced by the formation of a tris(hydroxymethyl)aminomethane adduct.

  19. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.


    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  20. Structure-Based Design of Trna-Guanine Transglycosylase Inhibitors

    NASA Astrophysics Data System (ADS)

    Klebe, Gerhard

    Taking the development of inhibitors for the tRNA-modifying enzyme tRNA-guanine transglycosylase (TGT) as an example, the scope of a structure-based drug development project will be demonstrated, performed via several cycles of iterative design. The described example is based on studies, performed at ETH-Zurich and University of Marburg in joint collaboration. As these studies have been executed in an academic environment, different tools of structure-based design have been applied and several issues of more fundamental interest to the methodological background of the project could be addressed.

  1. Production of guanine from NH(4)CN polymerizations

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Oro, J.


    The synthesis of adenine from the polymerization of concentrated ammonium cyanide solutions is well known. We show here that guanine is also produced by this reaction but at yields ranging from 10 to 40 times less than that of adenine. This synthesis is effective at both +80 and -20 degrees C. Since high concentrations of NH(4)CN are obtainable only by freezing, this prebiotic synthesis would be applicable to frozen regions of the primitive Earth, the Jovian satellite Europa and other icy satellites, and the parent body of the Murchison meteorite.

  2. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    NASA Astrophysics Data System (ADS)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  3. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide


    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less

  4. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    SciTech Connect

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  5. A nucleotide-controlled conformational switch modulates the activity of eukaryotic IMP dehydrogenases.


    Buey, Rubén M; Fernández-Justel, David; Marcos-Alcalde, Íñigo; Winter, Graeme; Gómez-Puertas, Paulino; de Pereda, José María; Luis Revuelta, José


    Inosine-5'-monophosphate dehydrogenase (IMPDH) is an essential enzyme for nucleotide metabolism and cell proliferation. Despite IMPDH is the target of drugs with antiviral, immunosuppressive and antitumor activities, its physiological mechanisms of regulation remain largely unknown. Using the enzyme from the industrial fungus Ashbya gossypii, we demonstrate that the binding of adenine and guanine nucleotides to the canonical nucleotide binding sites of the regulatory Bateman domain induces different enzyme conformations with significantly distinct catalytic activities. Thereby, the comparison of their high-resolution structures defines the mechanistic and structural details of a nucleotide-controlled conformational switch that allosterically modulates the catalytic activity of eukaryotic IMPDHs. Remarkably, retinopathy-associated mutations lie within the mechanical hinges of the conformational change, highlighting its physiological relevance. Our results expand the mechanistic repertoire of Bateman domains and pave the road to new approaches targeting IMPDHs.

  6. Detection of C8-(1-hydroxyethyl)guanine in liver RNA and DNA from control and ethanol-treated rats.


    Nakao, Lia S; Fonseca, Elaine; Augusto, Ohara


    Alcohol consumption is associated with an increased risk of cancer by mechanisms that remain unknown but have been suggested to involve radical metabolites. We have previously shown that the 1-hydroxyethyl radical produced from ethanol oxidation in vitro is able to alkylate nucleic acids to produce C8-(1-hydroxyethyl)guanine [C8-(1-HE)gua] among other products. To assess if this adduct is produced in vivo, we developed a sensitive HPLC-MS/MS method for its detection and analyzed hydrolysates of liver RNA and DNA from control and ethanol-treated rats. Unexpectedly, C8-(1-HE)gua was found to be present in both RNA and DNA from the liver of control Sprague-Dawley rats, and its levels increased slightly, but not significantly, after an acute ethanol dose (5 g/kg). In rat liver, C8-(1-HE)gua endogenous levels were about 10 times higher in RNA (35 +/- 5/10(7) guanine) than DNA (3.7 +/- 1.1/10(7) guanine). These levels were also found in commercial RNA (calf liver and yeast) and DNA (calf thymus), further indicating the endogenous source of the adduct. DNA basal levels of C8-(1-HE)gua were similar to those reported for other 2C guanine adducts such as N7-(2-hydroxyethyl)guanine and N2-ethyl-2'-deoxyguanosine. We speculate that all of these adducts may be generated from DNA attack by products of basal lipid peroxidation. The higher RNA levels of C8-(1-HE)gua are in agreement with the higher accessibility of RNA and nucleotides to reactive intermediates because they are not as protected or as localized as DNA. Chemical modification of RNA has been receiving increasingly attention as an important event in genotoxic mechanisms. Comparison of RNA basal levels of C8-(1-HE)gua, N7-(2-hydroxyethyl)guanine, and N2-ethyl-2'-deoxyguanosine may provide clues about their endogenous sources and biological significance. Yet, the marginal increase of DNA C8-(1-HE)gua upon ethanol administration argues against this adduct playing a major role in the carcinogenic effects of ethanol.

  7. DNA sequence context as a determinant of the quantity and chemistry of guanine oxidation produced by hydroxyl radicals and one-electron oxidants.


    Margolin, Yelena; Shafirovich, Vladimir; Geacintov, Nicholas E; DeMott, Michael S; Dedon, Peter C


    DNA sequence context has emerged as a critical determinant of the location and quantity of nucleobase damage caused by many oxidizing agents. However, the complexity of nucleobase and 2-deoxyribose damage caused by strong oxidants such as ionizing radiation and the Fenton chemistry of Fe2+-EDTA/H2O2 poses a challenge to defining the location of nucleobase damage and the effects of sequence context on damage chemistry in DNA. To address this problem, we developed a gel-based method that allows quantification of nucleobase damage in oxidized DNA by exploiting Escherichia coli exonuclease III to remove fragments containing direct strand breaks and abasic sites. The rigor of the method was verified in studies of guanine oxidation by photooxidized riboflavin and nitrosoperoxycarbonate, for which different effects of sequence context have been demonstrated by other approaches (Margolin, Y., Cloutier, J. F., Shafirovich, V., Geacintov, N. E., and Dedon, P. C. (2006) Nat. Chem. Biol. 2, 365-366). Using duplex oligodeoxynucleotides containing all possible three-nucleotide sequence contexts for guanine, the method was used to assess the role of DNA sequence context in hydroxyl radical-induced guanine oxidation associated with gamma-radiation and Fe2+-EDTA/H2O2. The results revealed both differences and similarities for G oxidation by hydroxyl radicals and by one-electron oxidation by riboflavin-mediated photooxidation, which is consistent with the predominance of oxidation pathways for hydroxyl radicals other than one-electron oxidation to form guanine radical cations. Although the relative quantities of G oxidation produced by hydroxyl radicals were more weakly correlated with sequence-specific ionization potential than G oxidation produced by riboflavin, damage produced by both hydroxyl radical generators and riboflavin within two- and three-base runs of G showed biases in location that are consistent with a role for electron transfer in defining the location of the damage

  8. Guanine binding to gold nanoparticles through nonbonding interactions.


    Zhang, Xi; Sun, Chang Q; Hirao, Hajime


    Gold nanoparticles have been widely used as nanocarriers in gene delivery. However, the binding mechanism between gold nanoparticles and DNA bases remains a puzzle. We performed density functional theory calculations with and without dispersion correction on Au(N)( (N = 13, 55, or 147) nanoparticles in high-symmetry cuboctahedral structures to understand the mechanism of their binding with guanine at the under-coordinated sites. Our study verified that: (i) negative charges transfer from the inner area to the surface of a nanoparticle as a result of the surface quantum trapping effect; and (ii) the valence states shift up toward the Fermi level, and thereby participate more actively in the binding to guanine. These effects are more prominent in a smaller nanoparticle, which has a larger surface-to-volume ratio. Additional fragment orbital analysis revealed that: (i) electron donation from the lone-pair orbital of N to the unoccupied orbital of the Au cluster occurs in all complexes; (ii) π back-donation occurs from the polarized Au d(yz) orbital to the N p(y)-π* orbital when there is no Au···H-N hydrogen bond, and, (iii) depending on the configuration, Au···H-N hydrogen bonding can also exist, to which the Au occupied orbital and the H-N unoccupied orbital contribute.

  9. Prokaryotic Nucleotide Excision Repair

    PubMed Central

    Kisker, Caroline; Kuper, Jochen; Van Houten, Bennett


    Nucleotide excision repair (NER) has allowed bacteria to flourish in many different niches around the globe that inflict harsh environmental damage to their genetic material. NER is remarkable because of its diverse substrate repertoire, which differs greatly in chemical composition and structure. Recent advances in structural biology and single-molecule studies have given great insight into the structure and function of NER components. This ensemble of proteins orchestrates faithful removal of toxic DNA lesions through a multistep process. The damaged nucleotide is recognized by dynamic probing of the DNA structure that is then verified and marked for dual incisions followed by excision of the damage and surrounding nucleotides. The opposite DNA strand serves as a template for repair, which is completed after resynthesis and ligation. PMID:23457260

  10. Prokaryotic nucleotide excision repair.


    Kisker, Caroline; Kuper, Jochen; Van Houten, Bennett


    Nucleotide excision repair (NER) has allowed bacteria to flourish in many different niches around the globe that inflict harsh environmental damage to their genetic material. NER is remarkable because of its diverse substrate repertoire, which differs greatly in chemical composition and structure. Recent advances in structural biology and single-molecule studies have given great insight into the structure and function of NER components. This ensemble of proteins orchestrates faithful removal of toxic DNA lesions through a multistep process. The damaged nucleotide is recognized by dynamic probing of the DNA structure that is then verified and marked for dual incisions followed by excision of the damage and surrounding nucleotides. The opposite DNA strand serves as a template for repair, which is completed after resynthesis and ligation.

  11. Determination of the base composition of deoxyribonucleic acid by measurement of the adenine/guanine ratio

    PubMed Central

    Kirk, J. T. O.


    A method is described for determination of the base composition (as guanine+cytosine or adenine+thymine content) of DNA by accurate measurement of the adenine/guanine ratio. The DNA is hydrolysed with 0·03n-hydrochloric acid for 40min. to release the purines. The hydrolysate is subjected to ion-exchange chromatography on Zeo-Karb 225. Apurinic acids are eluted with 0·03n-hydrochloric acid and then guanine and adenine are eluted separately with 2n-hydrochloric acid. Guanine and adenine are each collected as a single fraction, and the amount of base in each case is determined by measuring the volume and the extinction at suitable wavelengths. For use in the calculations, millimolar extinction coefficients in 2n-hydrochloric acid of 12·09 for adenine at 262mμ, and 10·77 for guanine at 248mμ, were determined with authentic samples of bases. The method gives extremely reproducible results: from 12 determinations with calf thymus DNA the adenine/guanine molar ratio had a standard deviation of 0·011; this corresponds to a standard deviation in guanine+cytosine content of 0·2% guanine+cytosine. PMID:5626094

  12. Translesion synthesis by human DNA polymerase eta across oxidative products of guanine.


    Kino, Katuhito; Ito, Nobutoshi; Sugasawa, Kaoru; Sugiyama, Hiroshi; Hanaoka, Fumio


    Guanine is the most oxidizable base among natural bases. 8-Oxoguanine (8-oxoG) is the typical oxidative product, but the amount of 8-oxoG does not directly reflect the strength of oxidative stress. Imidazolone, oxazolone and guanidinohydantoin are oxidative products of guanine and 8-oxoG. Here, we investigated enzymatic reactions with human DNA polymerase eta on these lesions.

  13. Mobility enhancement of organic field-effect transistor based on guanine trap-neutralizing layer

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Yu, Junsheng; Taylor, André D.; Katz, Howard E.


    We introduced a nucleic acid component guanine as a trap-neutralizing layer between silicon dioxide gate dielectric and a pentacene semiconducting layer to obtain increased field-effect mobility in organic field-effect transistors (OFETs). A tripling of the field-effect mobility, from 0.13 to 0.42 cm2/V s, was achieved by introducing a 2 nm guanine layer. By characterizing the surface morphology of pentacene films grown on guanine, we found that the effect of guanine layer on the topography of pentacene film was not responsible for the mobility enhancement of the OFETs. The increased field-effect mobility was mainly attributed to the hydrogen bonding capacity of otherwise unassociated guanine molecules, which enabled them to neutralize trapping sites on the silicon dioxide surface.

  14. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways

    NASA Astrophysics Data System (ADS)

    Becerra, Arturo; Lazcano, Antonio


    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  15. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  16. The synergism of nucleoside antibiotics combined with guanine 7-N-oxide against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV).


    Hasobe, M; Saneyoshi, M; Isono, K


    Guanine 7-N-oxide was shown to have synergistic activity in combination with neplanocin A against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV), as reported previously. We examined further the antiviral activity of guanine 7-N-oxide in combination with other nucleoside antibiotics against IHNV. Synergism was seen between guanine 7-N-oxide and D-eritadenine or cordycepin. It is considered that compounds inhibiting RNA methylation show synergism with guanine 7-N-oxide.

  17. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.


    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao


    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  18. Unusual energy transfer and structures in guanine oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Davis, Steven Paul; Truss, Tiffany; Nordlund, Thomas M.


    2-Aminopurine (2AP), a fluorescent analog of adenine, was alternately substituted into each of the five positions in guanine (G) pentadeoxynucleotides. Temperature dependent absorption and fluorescence excitation spectra of these and of samples plus complements showed that 2AP placed in the terminal 3' position exhibited higher energy transfer from G to 2AP than samples with 2AP in other positions: 102-3thymine-containing, but four times less than in adenine oligomers. The unusual position dependence in G oligomers may arise from intrastrand H bonding between 2AP-NH2 and G-O6. Additionally, the temperature dependence of the 2AP excitation band in G oligomers is unique. In GGGG[2AP] the spectral change is a shift to the red with increasing temperature; in the other G oligomers, the spectral shape changes and shifts to the blue. Spectral changes for oligomers of other bases are generally shifts to the blue.

  19. Unusual energy transfer and structures in guanine oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Davis, Steven Paul; Truss, Tiffany; Nordlund, Thomas M.


    2-Aminopurine (2AP), a fluorescent analog of adenine, was alternately substituted into each of the five positions in guanine (G) pentadeoxynucleotides. Temperature dependent absorption and fluorescence excitation spectra of these and of samples plus complements showed that 2AP placed in the terminal 3' position exhibited higher energy transfer from G to 2AP than samples with 2AP in other positions: 102-3thymine-containing, but four times less than in adenine oligomers. The unusual position dependence in G oligomers may arise from intrastrand H bonding between 2AP-NH2 and G-O6. Additionally, the temperature dependence of the 2AP excitation band in G oligomers is unique. In GGGG[2AP] the spectral change is a shift to the red with increasing temperature; in the other G oligomers, the spectral shape changes and shifts to the blue. Spectral changes for oligomers of other bases are generally shifts to the blue.

  20. In vivo methylation of guanine by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Adam, Y; Hegazi, B


    The in vivo methylating capability of the organophosphorus insecticide tetrachlorvinphos, assayed by the formation of 7-methyl-guanine in mouse liver, was investigated. Following intraperitoneal injection of male mice with different doses of the 14C-insecticide, labelled at the OCH3 groups, the total and specific radioactivity of nucleic acids and protein were determined. The 14C-labelling in the isolated macromolecules reached its maximum 24 hours following administration of the insecticide. Analysis of the acid hydrolysate of DNA and of RNA on Dowex-50 WX-12 revealed the presence of (7-14C) methylguanine. At maximum 14C-labelling, the amount of radioactive 7-MeGu, calculated as fraction of total dose, was around 9 X 10(-5) and 39 X 10(-5) for DNA and RNA, respectively.

  1. Mechanistic Aspects of Hydration of Guanine Radical Cations in DNA

    PubMed Central


    The mechanistic aspects of hydration of guanine radical cations, G•+ in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G•+ radical one-electron oxidation products were generated by SO4•– radical anions derived from the photolysis of S2O82– anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4•– radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)• with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)• radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)• decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)• radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)• radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G•+:C] base pair. This [G(-H)•:H+C ⇆ G•+:C] equilibrium allows for the hydration of G•+ followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G•+ and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally. PMID:24689701

  2. Lifetimes and reaction pathways of guanine radical cations and neutral guanine radicals in an oligonucleotide in aqueous solutions.


    Rokhlenko, Yekaterina; Geacintov, Nicholas E; Shafirovich, Vladimir


    The exposure of guanine in the oligonucleotide 5'-d(TCGCT) to one-electron oxidants leads initially to the formation of the guanine radical cation G(•+), its deptotonation product G(-H)(•), and, ultimately, various two- and four-electron oxidation products via pathways that depend on the oxidants and reaction conditions. We utilized single or successive multiple laser pulses (308 nm, 1 Hz rate) to generate the oxidants CO(3)(•-) and SO(4)(•-) (via the photolysis of S(2)O(8)(2-) in aqueous solutions in the presence and absence of bicarbonate, respectively) at concentrations/pulse that were ∼20-fold lower than the concentration of 5'-d(TCGCT). Time-resolved absorption spectroscopy measurements following single-pulse excitation show that the G(•+) radical (pK(a) = 3.9) can be observed only at low pH and is hydrated within 3 ms at pH 2.5, thus forming the two-electron oxidation product 8-oxo-7,8-dihydroguanosine (8-oxoG). At neutral pH, and single pulse excitation, the principal reactive intermediate is G(-H)(•), which, at best, reacts only slowly with H(2)O and lives for ∼70 ms in the absence of oxidants/other radicals to form base sequence-dependent intrastrand cross-links via the nucleophilic addition of N3-thymidine to C8-guanine (5'-G*CT* and 5'-T*CG*). Alternatively, G(-H)(•) can be oxidized further by reaction with CO(3)(•-), generating the two-electron oxidation products 8-oxoG (C8 addition) and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih, by C5 addition). The four-electron oxidation products, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), appear only after a second (or more) laser pulse. The levels of all products, except 8-oxoG, which remains at a low constant value, increase with the number of laser pulses.

  3. A non-catalytic N-terminal domain negatively influences the nucleotide exchange activity of translation elongation factor 1Bα.


    Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V


    Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect.

  4. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    SciTech Connect

    Caroline Kisker


    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  5. Base sequence context effects on nucleotide excision repair.


    Cai, Yuqin; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E


    Nucleotide excision repair (NER) plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P), 10S (+)-trans-anti-B[a]P-N(2)-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  6. Guanine and 7,8-dihydro-8-oxo-guanine-specific oxidation in DNA by chromium(V).


    Sugden, Kent D; Martin, Brooke D


    The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, although the mechanism of cancer induction is currently unknown. Intracellular reduction of Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA damage by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a metal-binding pathway, have been proposed to account for the lesions observed in cell systems. We have used a model Cr(V) complex, N,N-ethylenebis(salicylidene-animato)oxochromium(V) [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides produced guanine-specific lesions that were not 8-oxo-2'-deoxyguanosine, based on the inability of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of product for identification by electrospray ionization mass spectrometry. The guanine-based lesions observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodihydantoin. The effects of these Cr(V)-Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay. These lesions produced G --> T transversion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data suggest a model by which chromate can cause DNA damage leading to mutations and cancer.

  7. Theoretical study of hydrated copper(II) interactions with guanine: a computational density functional theory study.


    Pavelka, Matej; Shukla, Manoj K; Leszczynski, Jerzy; Burda, Jaroslav V


    Optimization of the hydrated Cu(II)(N7-guanine) structures revealed a number of minima on the potential energy surface. For selected structures, energy decompositions together with the determination of electronic properties (partial charges and electron spin densities) were performed. In the complexes of guanine with the bare copper cation and that with the monoaqua ligated cation, an electron transfer from guanine to Cu(II) was observed, resulting in a Cu(I)-guanine(+) type of complex. Conformers with two aqua ligands are borderline systems characterized by a Cu partial charge of +0.7e and a similar value of the spin density (0.6e) localized on guanine. When tetracoordination of copper was achieved, only then the prevailing electron spin density is unambiguously localized on copper. The energetic preference of diaqua-Cu-(N7,O6-guanine) over triaqua-Cu-(N7-guanine) was found for the four-coordinate structures. However, the energy difference between these two conformations decreases with the number of water molecules present in the systems, and in complexes with five water molecules this preference is preserved only at DeltaG level where thermal and entropy terms are included.

  8. In vivo formation of N7-guanine DNA adduct by safrole 2',3'-oxide in mice.


    Shen, Li-Ching; Chiang, Su-Yin; Lin, Ming-Huan; Chung, Wen-Sheng; Wu, Kuen-Yuh


    Safrole, a naturally occurring product derived from spices and herbs, has been shown to be associated with the development of hepatocellular carcinoma in rodents. Safrole 2',3'-oxide (SFO), an electrophilic metabolite of safrole, was shown to react with DNA bases to form detectable DNA adducts in vitro, but not detected in vivo. Therefore, the objective of this study was to investigate the formation of N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine (N7γ-SFO-Gua) resulting from the reaction of SFO with the most nucleophilic site of guanine in vitro and in vivo with a newly developed isotope-dilution high performance liquid chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS) method. N7γ-SFO-Gua and [(15)N(5)]-N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine ([(15)N(5)]-N7γ-SFO-Gua) were first synthesized, purified, and characterized. The HPLC-ESI-MS/MS method was developed to measure N7γ-SFO-Gua in calf thymus DNA treated with 60 μmol of SFO for 72 h and in urine samples of mice treated with a single dose of SFO (30 mg/kg body weight, intraperitoneally). In calf thymus DNA, the level of N7γ-SFO-Gua was 2670 adducts per 10(6)nucleotides. In urine of SFO-treated mice, the levels of N7γ-SFO-Gua were 1.02±0.14 ng/mg creatinine (n=4) on day 1, 0.73±0.68 ng/mg creatinine (n=4) on day 2, and below the limit of quantitation on day 3. These results suggest that SFO can cause in vivo formation of N7γ-SFO-Gua, which may then be rapidly depurinated from the DNA backbone and excreted through urine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. Nucleotide signalling during inflammation

    PubMed Central

    Idzko, Marco; Ferrari, Davide; Eltzschig, Holger K.


    Inflammatory conditions are associated with the extracellular release of nucleotides, particularly ATP. In the extracellular compartment, ATP predominantly functions as a signalling molecule through the activation of purinergic P2 receptors. Metabotropic P2Y receptors are G-protein-coupled, whereas ionotropic P2X receptors are ATP-gated ion channels. Here we discuss how signalling events through P2 receptors alter the outcomes of inflammatory or infectious diseases. Recent studies implicate a role for P2X/P2Ysignalling in mounting appropriate inflammatory responses critical for host defence against invading pathogens or tumours. Conversely, P2X/P2Y signalling can promote chronic inflammation during ischaemia and reperfusion injury, inflammatory bowel disease or acute and chronic diseases of the lungs. Although nucleotide signalling has been used clinically in patients before, research indicates an expanding field of opportunities for specifically targeting individual P2 receptors for the treatment of inflammatory or infectious diseases. PMID:24828189

  10. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.


    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V


    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  11. Prostaglandin modulation of Ca2+ channels in rat sympathetic neurones is mediated by guanine nucleotide binding proteins.

    PubMed Central

    Ikeda, S R


    1. The effects of prostaglandins on whole-cell Ca2+ currents of acutely isolated and short-term cultured adult rat superior cervical ganglion neurones were investigated using the patch-clamp technique. 2. Prostaglandin E2 (PGE2) produced a rapid, reversible and concentration-dependent reduction of the sympathetic neurone Ca2+ current. The effects of PGE2 were both voltage and time dependent. The relationship between Ca2+ current inhibition and test potential was 'bell' shaped with maximal inhibition occurring near the potential where the Ca2+ current amplitude was maximal (ca + 10 mV). In the presence of PGE2, the Ca2+ current rising phase was slower and biphasic at potentials between 0 and +40 mV. 3. Prolonged (> 2 min) application of 1 microM PGE2 resulted in a desensitization of the response. Similarly, repeated short (ca 1 min) applications of 1 microM PGE2 resulted in a progressive tachyphylaxis of the response. 4. A concentration-response curve for PGE2 was well described by a single-site binding isotherm. The concentration producing half-maximal block (IC50) and the maximal attainable reduction of the Ca2+ current were 7.8 nM and 48%, respectively. 5. When compared at a concentration of 1 microM, PGF2 alpha was less potent (33% inhibition) than PGE2 but otherwise produced similar effects. In contrast, 1 microM PGD2 had negligible effects. 6. Activation curves, as derived from tail current amplitudes, were described by the sum of two Boltzmann functions in both the presence and absence of PGE2. In the presence of PGE2, the activation curve was shifted toward more depolarized potentials. Most of the shift could be accounted for by a decrease in the fractional amplitude of the current component activated at hyperpolarized potentials along with a concomitant increase in the component activated at depolarized potentials. The deactivation time constant (0.33 ms), measured at -40 mV, was not altered by PGE2. 7. The majority of the Ca2+ current inhibition produced by PGE2 was relieved by depolarizing conditioning pre-pulses to +80 mV for 50 ms. 8. Dialysis of sympathetic neurones with a pipette solution containing 2.0 mM guanosine 5'-O-(2-thiodiphosphate) (GDP-beta-S) abolished the effects of PGE2 on the Ca2+ current. Pretreatment of the neurones overnight with pertussis toxin significantly, but incompletely, decreased the Ca2+ current inhibition produced by PGE2. 9. The prolonged Ca2+ tail current component induced by the dihydropyridine Ca2+ channel 'agonist' (+)202-791 (2 microM) was unaffected by 1 microM PGE2. 10. PGE2 partially inhibited the Ca2+ current component remaining after pretreatment of the neurones with 10 microM omega-conotoxin.(ABSTRACT TRUNCATED AT 400 WORDS) Images Fig. 9 Fig. 10 PMID:1338790

  12. Juvenile Hormone Regulates the Expression of Drosophila Epac– a Guanine Nucleotide Exchange Factor for Rap1 Small GTPase

    USDA-ARS?s Scientific Manuscript database

    The juvenile hormones (JH) are a key group of insect hormones involved in regulating larval development and adult reproductive processes. Although well-studied from the physiological standpoint, the molecular actions of JH remain unclear. Using cDNA microchip array technology, we previously identifi...

  13. ITAM Signaling by Vav Family Rho Guanine Nucleotide Exchange Factors Regulates Interstitial Transit Rates of Neutrophils In Vivo

    PubMed Central

    Mascarenhas, Francesca; Delgado, Ryan; Miller, Mark J.; Swat, Wojciech


    Background In response to infection, neutrophils are quickly recruited from the blood into inflamed tissues. The interstitial migration of neutrophils is crucial for the efficient capture and control of rapidly proliferating microbes before microbial growth can overwhelm the host's defenses. However, the molecular mechanisms that regulate interstitial migration are incompletely understood. Methodology/Principal Findings Here, we use two-photon microscopy (2PM) to study discrete steps of neutrophil responses during subcutaneous infection with bacteria. Our study demonstrates that signals emanating from ITAM-containing receptors mediated by Vav family Rho GEFs control the velocity, but not the directionality, of neutrophil migration towards sites of bacterial infection. Conclusions/Significance Here we show that during neutrophil migration towards sites of bacterial infection, signals emanating from ITAM-containing receptors specifically control interstitial neutrophil velocity. PMID:19247495

  14. A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana

    USDA-ARS?s Scientific Manuscript database

    Rop/Rac small GTPases are central to diverse developmental and cellular activities in plants, playing an especially important Role in polar growth of pollen tubes. Although it is established that a class of plant-specific RopGEFs promotes the activity of Rop/Rac through the catalytic PRONE (Plant-sp...

  15. A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana

    USDA-ARS?s Scientific Manuscript database

    Rop/Rac small GTPases are central to diverse developmental and cellular activities in plants, playing an especially important role in polar growth of pollen tubes. Although it is established that a class of plant-specific RopGEFs promotes the activity of Rop/Rac through the catalytic PRONE (Plant sp...

  16. Magnetic bead isolation of neutrophil plasma membranes and quantification of membrane-associated guanine nucleotide binding proteins.


    Chang, Peter S; Absood, Afaf; Linderman, Jennifer J; Omann, Geneva M


    A protocol for isolation of neutrophil plasma membranes utilizing a plasma membrane marker antibody, anti-CD15, attached to superparamagnetic beads was developed. Cells were initially disrupted by nitrogen cavitation and then incubated with anti-CD15 antibody-conjugated superparamagnetic beads. The beads were then washed to remove unbound cellular debris and cytosol. Recovered plasma membranes were quantified by immunodetection of G(beta2) in Western blots. This membrane marker-based separation yielded highly pure plasma membranes. This protocol has advantages over standard density sedimentation protocols for isolating plasma membrane in that it is faster and easily accommodates cell numbers as low as 10(6). These methods were coupled with immunodetection methods and an adenosine 5(')-diphosphate-ribosylation assay to measure the amount of membrane-associated G(ialpha) proteins available for receptor coupling in neutrophils either stimulated with N-formyl peptides or treated to differing degrees with pertussis toxin. As expected, pertussis toxin treatment decreased the amount of membrane G protein available for signaling although total membrane G protein was not affected. In addition, activation of neutrophils with N-formyl peptides resulted in an approximately 50% decrease in G protein associated with the plasma membrane.

  17. The Putative Guanine Nucleotide Exchange Factor RicA Mediates Upstream Signaling for Growth and Development in Aspergillus

    PubMed Central

    Kwon, Nak-Jung; Park, Hee-Soo; Jung, Seunho; Kim, Sun Chang


    Heterotrimeric G proteins (G proteins) govern growth, development, and secondary metabolism in various fungi. Here, we characterized ricA, which encodes a putative GDP/GTP exchange factor for G proteins in the model fungus Aspergillus nidulans and the opportunistic human pathogen Aspergillus fumigatus. In both species, ricA mRNA accumulates during vegetative growth and early developmental phases, but it is not present in spores. The deletion of ricA results in severely impaired colony growth and the total (for A. nidulans) or near (for A. fumigatus) absence of asexual sporulation (conidiation). The overexpression (OE) of the A. fumigatus ricA gene (AfricA) restores growth and conidiation in the ΔAnricA mutant to some extent, indicating partial conservation of RicA function in Aspergillus. A series of double mutant analyses revealed that the removal of RgsA (an RGS protein of the GanB Gα subunit), but not sfgA, flbA, rgsB, or rgsC, restored vegetative growth and conidiation in ΔAnricA. Furthermore, we found that RicA can physically interact with GanB in yeast and in vitro. Moreover, the presence of two copies or OE of pkaA suppresses the profound defects caused by ΔAnricA, indicating that RicA-mediated growth and developmental signaling is primarily through GanB and PkaA in A. nidulans. Despite the lack of conidiation, brlA and vosA mRNAs accumulated to normal levels in the ΔricA mutant. In addition, mutants overexpressing fluG or brlA (OEfluG or OEbrlA) failed to restore development in the ΔAnricA mutant. These findings suggest that the commencement of asexual development requires unknown RicA-mediated signaling input in A. nidulans. PMID:23002107

  18. The putative guanine nucleotide exchange factor RicA mediates upstream signaling for growth and development in Aspergillus.


    Kwon, Nak-Jung; Park, Hee-Soo; Jung, Seunho; Kim, Sun Chang; Yu, Jae-Hyuk


    Heterotrimeric G proteins (G proteins) govern growth, development, and secondary metabolism in various fungi. Here, we characterized ricA, which encodes a putative GDP/GTP exchange factor for G proteins in the model fungus Aspergillus nidulans and the opportunistic human pathogen Aspergillus fumigatus. In both species, ricA mRNA accumulates during vegetative growth and early developmental phases, but it is not present in spores. The deletion of ricA results in severely impaired colony growth and the total (for A. nidulans) or near (for A. fumigatus) absence of asexual sporulation (conidiation). The overexpression (OE) of the A. fumigatus ricA gene (AfricA) restores growth and conidiation in the ΔAnricA mutant to some extent, indicating partial conservation of RicA function in Aspergillus. A series of double mutant analyses revealed that the removal of RgsA (an RGS protein of the GanB Gα subunit), but not sfgA, flbA, rgsB, or rgsC, restored vegetative growth and conidiation in ΔAnricA. Furthermore, we found that RicA can physically interact with GanB in yeast and in vitro. Moreover, the presence of two copies or OE of pkaA suppresses the profound defects caused by ΔAnricA, indicating that RicA-mediated growth and developmental signaling is primarily through GanB and PkaA in A. nidulans. Despite the lack of conidiation, brlA and vosA mRNAs accumulated to normal levels in the ΔricA mutant. In addition, mutants overexpressing fluG or brlA (OEfluG or OEbrlA) failed to restore development in the ΔAnricA mutant. These findings suggest that the commencement of asexual development requires unknown RicA-mediated signaling input in A. nidulans.

  19. Ontogenetic development of the striatal [3H]spiperone binding: regulation by sodium and guanine nucleotide in rats.


    Nomura, Y; Oki, K; Segawa, T


    Ontogenetic development of specific [3H]spiperone binding to crude synaptic membranes and its regulation by Na+ and GTP was investigated in the rat striatum. (d)-Butaclamol more effectively inhibited [3H]spiperone binding than (l)-butaclamol. The ratio of inhibitory activity of (d)- and (l)-butaclamol for [3H]spiperone binding was not different between 1-, 7-, and 70-day-old animals but eight- to ninefold lower at 18 days of gestation than during the postnatal period. A Scatchard plot of specific binding indicated the presence of two types of binding: low-affinity (KD = 1.51 nM) and high-affinity (KD = 0.09 nM) binding on day 70. Only one component (KD = 0.075 nM) was observed on days 1 and 7 and both types of binding were found on day 15. Bmax gradually increased with age and reached a peak on day 30, followed by a decline on days 70 and 360. Na+, 100 mM, significantly increased specific binding on days 1, 7, 15, and 70. GTP, 50 microM, completely reversed the Na+-induced decrease in IC50 of apomorphine on both days 15 and 70, but not on day 7. It is suggested that receptors could recognize ligand stereospecificity on day 1. The density in dopamine receptors in the striatum reaches a peak on day 30, followed by a decrease on days 70 and 360. In addition, regulation by Na+ and GTP in agonist binding to dopamine receptors seems to become functional between 1 and 2 weeks after birth.

  20. Guanine Oxidation in Double-stranded DNA by MnTMPyP/KHSO(5): At Least Three Independent Reaction Pathways.


    Lapi, A; Pratviel, G; Meunier, B


    In order to better define the mechanism and the products of guanine oxidation within DNA, we investigated the details of the mechanism of guanine oxidation by a metalloporphyrin, Mn-TMPyP, associated to KHSO(5) on oligonucleotides. We found that the three major products of guanine oxidation are formed by independent reaction routes. The oxidized guanidinohydantoin (1) and the proposed spiro compound 3 derivatives are not precursors of imidazolone lesion (Iz). These guanine lesions as well as their degradation products, may account for non-detected guanine oxidation products on oxidatively damaged DNA.

  1. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.


    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  2. Nucleotide cleaving agents and method


    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.


    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  3. Mechanistic aspects of hydration of guanine radical cations in DNA.


    Rokhlenko, Yekaterina; Cadet, Jean; Geacintov, Nicholas E; Shafirovich, Vladimir


    The mechanistic aspects of hydration of guanine radical cations, G(•+) in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G(•+) radical one-electron oxidation products were generated by SO4(•-) radical anions derived from the photolysis of S2O8(2-) anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4(•-) radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)(•) with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)(•) radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)(•) decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)(•) radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)(•) radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G(•+):C] base pair. This [G(-H)(•):H(+)C ⇆ G(•+):C] equilibrium allows for the hydration of G(•+) followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G(•+) and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally.

  4. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie


    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  5. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.


    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  6. Structural Basis of Cyclic Nucleotide Selectivity in cGMP-dependent Protein Kinase II


    Campbell, James C.; Kim, Jeong Joo; Li, Kevin Y.; ...


    Membrane-bound cGMP-dependent protein kinase (PKG) II is an important regulator of bone growth, renin secretion, and memory formation. Despite its crucial physiological roles, little is known about its cyclic nucleotide selectivity mechanism due to a lack of structural information. Here, we find that the C-terminal cyclic nucleotide binding (CNB-B) domain of PKGII binds cGMP with higher affinity and selectivity when compared with its N-terminal CNB (CNB-A) domain. To understand the structural basis of cGMP selectivity, we solved co-crystal structures of the CNB domains with cyclic nucleotides. Our structures combined with mutagenesis demonstrate that the guanine-specific contacts at Asp-412 and Arg-415more » of the αC-helix of CNB-B are crucial for cGMP selectivity and activation of PKG II. Structural comparison with the cGMP selective CNB domains of human PKG I and Plasmodium falciparum PKG (PfPKG) shows different contacts with the guanine moiety, revealing a unique cGMP selectivity mechanism for PKG II.« less

  7. Structural Basis of Cyclic Nucleotide Selectivity in cGMP-dependent Protein Kinase II

    SciTech Connect

    Campbell, James C.; Kim, Jeong Joo; Li, Kevin Y.; Huang, Gilbert Y.; Reger, Albert S.; Matsuda, Shinya; Sankaran, Banumathi; Link, Todd M.; Yuasa, Keizo; Ladbury, John E.; Casteel, Darren E.; Kim, Choel


    Membrane-bound cGMP-dependent protein kinase (PKG) II is an important regulator of bone growth, renin secretion, and memory formation. Despite its crucial physiological roles, little is known about its cyclic nucleotide selectivity mechanism due to a lack of structural information. Here, we find that the C-terminal cyclic nucleotide binding (CNB-B) domain of PKGII binds cGMP with higher affinity and selectivity when compared with its N-terminal CNB (CNB-A) domain. To understand the structural basis of cGMP selectivity, we solved co-crystal structures of the CNB domains with cyclic nucleotides. Our structures combined with mutagenesis demonstrate that the guanine-specific contacts at Asp-412 and Arg-415 of the αC-helix of CNB-B are crucial for cGMP selectivity and activation of PKG II. Structural comparison with the cGMP selective CNB domains of human PKG I and Plasmodium falciparum PKG (PfPKG) shows different contacts with the guanine moiety, revealing a unique cGMP selectivity mechanism for PKG II.

  8. Structural Basis of Cyclic Nucleotide Selectivity in cGMP-dependent Protein Kinase II*

    PubMed Central

    Campbell, James C.; Kim, Jeong Joo; Li, Kevin Y.; Huang, Gilbert Y.; Reger, Albert S.; Matsuda, Shinya; Sankaran, Banumathi; Link, Todd M.; Yuasa, Keizo; Ladbury, John E.; Casteel, Darren E.; Kim, Choel


    Membrane-bound cGMP-dependent protein kinase (PKG) II is a key regulator of bone growth, renin secretion, and memory formation. Despite its crucial physiological roles, little is known about its cyclic nucleotide selectivity mechanism due to a lack of structural information. Here, we find that the C-terminal cyclic nucleotide binding (CNB-B) domain of PKG II binds cGMP with higher affinity and selectivity when compared with its N-terminal CNB (CNB-A) domain. To understand the structural basis of cGMP selectivity, we solved co-crystal structures of the CNB domains with cyclic nucleotides. Our structures combined with mutagenesis demonstrate that the guanine-specific contacts at Asp-412 and Arg-415 of the αC-helix of CNB-B are crucial for cGMP selectivity and activation of PKG II. Structural comparison with the cGMP selective CNB domains of human PKG I and Plasmodium falciparum PKG (PfPKG) shows different contacts with the guanine moiety, revealing a unique cGMP selectivity mechanism for PKG II. PMID:26769964

  9. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto


    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  10. The intrinsic stabilities and structures of alkali metal cationized guanine quadruplexes.


    Azargun, M; Jami-Alahmadi, Y; Fridgen, T D


    The structures and stabilities of self-assembled guanine quadruplexes, M(9eG)8(+) (M = Na, K, Rb, Cs; 9eG = 9-ethylguanine), have been studied in the gas phase by blackbody infrared radiative dissociation to determine the difference in the stabilizing effect of the alkali metal cations. The order of stabilities to decomposition was determined to be K(+) > Rb(+) > Cs(+) ≫ Na(+), which is consistent with the observation of K(+) being the ion of choice in guanine quadruplexes in nucleic acids. In the gas phase, the sodiated quadruplex was found to lose one 9eG at a time, whereas the quadruplexes of the heavier cations lost a neutral guanine tetrad. Vibrational spectroscopy on the gas-phase quadruplex ions was consistent with the structures in which the metal cations were sandwiched between two guanine tetrads. Electronic structure calculations are also used to compare with the observed stabilities and vibrational spectra.

  11. Guanine-06 methylation reduces the reactivity of d(GpG) towards platinum complexes.


    Struik, A F; Zuiderwijk, C T; van Boom, J H; Elding, L I; Reedijk, J


    6-methylated guanine dinucleotides were used to study the influence of hydrogen bonding on the specific binding of the antitumor drug cDDP, cis-PtCl2(NH3)2, to DNA. In this interaction, the guanine-06 site appears to be important in explaining the preference for a pGpG-N7(1),N7(2) chelate, which results from H-bridge formation with the ammine ligand of cDDP. Guanine-06 methylated dinucleotides and the nonmodified dinucleotides were reacted with [Pt(dien)Cl]+, cis-PtCl2(NH3)2, and cis-[Pt(NH3)2(H2O)2]2+ and the reaction products were characterized by 1H NMR using pH titrations. Methylation at guanine-06 clearly reduces the preference for the guanine. In competition experiments monitored by NMR and experiments using UV spectrophotometry a decreasing reactivity towards [Pt(dien)(H2O)]2+ and cis-[Pt(NH3)2(H2O)2]2+ was found, in the order of d(GpG) greater than d(GomepG) greater than d(GpGome) greater than d(GomepGome). The difference in reactivity between 5' guanine methylation and 3' guanine methylation is ascribed to differences in the H-bond formation with the backbone phosphate. The resulting reduced stacking of the bases in both modified dinucleotides, compared to the bases in d(GpG), results in a preference for the 3' guanine over 5'.

  12. Photoirradiation products of flavin derivatives, and the effects of photooxidation on guanine.


    Kino, Katsuhito; Kobayashi, Teruhiko; Arima, Eiji; Komori, Rie; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Photoirradiation in the presence of riboflavin led to guanine oxidation and the formation of imidazolone. Meanwhile, riboflavin itself was degraded by ultraviolet light A (UV-A) and visible light (VIS) radiation, and the end product was lumichrome. VIS radiation in the presence of riboflavin oxidized guanine similarly to UV-A radiation. Although UV-A radiation with lumichrome oxidized guanine, VIS radiation with lumichrome did not. Thus, UV-A radiation with riboflavin can oxidize guanine even if riboflavin is degraded to lumichrome. In contrast, following VIS radiation degradation of riboflavin to lumichrome, VIS radiation with riboflavin is hardly capable of oxidizing guanine. The consequences of riboflavin degradation and guanine photooxidation can be extended to flavin mononucleotide and flavin adenine dinucleotide. In addition, we report advanced synthesis; carboxymethylflavin was obtained by oxidation of formylmethylflavin with chlorite and hydrogen peroxide; lumichrome was obtained by heating of formylmethylflavin in 50% AcOH; lumiflavin was obtained by incubation of formylmethylflavin in 2 M NaOH, followed by isolation by step-by-step concentration.

  13. Mechanisms involved in the antinociception induced by spinal administration of inosine or guanine in mice.


    de Oliveira, Enderson D; Schallenberger, Cristhine; Böhmer, Ana Elisa; Hansel, Gisele; Fagundes, Aécio C; Milman, Michael; Silva, Marcos D P; Oses, Jean P; Porciúncula, Lisiane O; Portela, Luís V; Elisabetsky, Elaine; Souza, Diogo O; Schmidt, André P


    It is well known that adenine-based purines exert multiple effects on pain transmission. Recently, we have demonstrated that guanine-based purines may produce some antinociceptive effects against chemical and thermal pain in mice. The present study was designed to investigate the antinociceptive effects of intrathecal (i.t.) administration of inosine or guanine in mice. Additionally, investigation into the mechanisms of action of these purines, their general toxicity and measurements of CSF purine levels were performed. Animals received an i.t. injection of vehicle (30mN NaOH), inosine or guanine (up to 600nmol) and submitted to several pain models and behavioural paradigms. Guanine and inosine produced dose-dependent antinociceptive effects in the tail-flick, hot-plate, intraplantar ( glutamate, capsaicin and acetic acid pain models. Additionally, i.t. inosine inhibited the biting behaviour induced by spinal injection of capsaicin and i.t. guanine reduced the biting behaviour induced by spinal injection of glutamate or AMPA. Intrathecal administration of inosine (200nmol) induced an approximately 115-fold increase on CSF inosine levels. This study provides new evidence on the mechanism of action of extracellular guanine and inosine presenting antinociceptive effects following spinal administration. These effects seem to be related, at least partially, to the modulation of A1 adenosine receptors.

  14. Oxidatively Generated Guanine(C8)-Thymine(N3) Intrastrand Cross-links in Double-stranded DNA Are Repaired by Base Excision Repair Pathways.


    Talhaoui, Ibtissam; Shafirovich, Vladimir; Liu, Zhi; Saint-Pierre, Christine; Akishev, Zhiger; Matkarimov, Bakhyt T; Gasparutto, Didier; Geacintov, Nicholas E; Saparbaev, Murat


    Oxidatively generated guanine radical cations in DNA can undergo various nucleophilic reactions including the formation of C8-guanine cross-links with adjacent or nearby N3-thymines in DNA in the presence of O2. The G*[C8-N3]T* lesions have been identified in the DNA of human cells exposed to oxidative stress, and are most likely genotoxic if not removed by cellular defense mechanisms. It has been shown that the G*[C8-N3]T* lesions are substrates of nucleotide excision repair in human cell extracts. Cleavage at the sites of the lesions was also observed but not further investigated (Ding et al. (2012) Nucleic Acids Res. 40, 2506-2517). Using a panel of eukaryotic and prokaryotic bifunctional DNA glycosylases/lyases (NEIL1, Nei, Fpg, Nth, and NTH1) and apurinic/apyrimidinic (AP) endonucleases (Apn1, APE1, and Nfo), the analysis of cleavage fragments by PAGE and MALDI-TOF/MS show that the G*[C8-N3]T* lesions in 17-mer duplexes are incised on either side of G*, that none of the recovered cleavage fragments contain G*, and that T* is converted to a normal T in the 3'-fragment cleavage products. The abilities of the DNA glycosylases to incise the DNA strand adjacent to G*, while this base is initially cross-linked with T*, is a surprising observation and an indication of the versatility of these base excision repair proteins.

  15. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.


    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  16. Computational Study of Oxidation of Guanine by Singlet Oxygen ((1) Δg ) and Formation of Guanine:Lysine Cross-Links.


    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard


    Oxidation of guanine in the presence of lysine can lead to guanine-lysine cross-links. The ratio of the C4, C5 and C8 crosslinks depends on the manner of oxidation. Type II photosensitizers such as Rose Bengal and methylene blue can generate singlet oxygen, which leads to a different ratio of products than oxidation by type I photosensitizers or by one electron oxidants. Modeling reactions of singlet oxygen can be quite challenging. Reactions have been explored using CASSCF, NEVPT2, DFT, CCSD(T), and BD(T) calculations with SMD implicit solvation. The spin contamination in open-shell calculations were corrected by Yamaguchi's approximate spin projection method. The addition of singlet oxygen to guanine to form guanine endo- peroxide proceeds step-wise via a zwitterionic peroxyl intermediate. The subsequent barrier for ring closure is smaller than the initial barrier for singlet oxygen addition. Ring opening of the endoperoxide by protonation at C4-O is followed by loss of a proton from C8 and dehydration to produce 8-oxoG(ox) . The addition of lysine (modelled by methylamine) or water across the C5=N7 double bond of 8-oxoG(ox) is followed by acyl migration to form the final spiro products. The barrier for methylamine addition is significantly lower than for water addition and should be the dominant reaction channel. These results are in good agreement with the experimental results for the formation of guanine-lysine cross-links by oxidation by type II photosensitizers.

  17. Template polymerization of nucleotide analogues

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.


    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  18. Guanine oxidation product 5-carboxamido-5-formamido-2-iminohydantoin induces mutations when bypassed by DNA polymerases and is a substrate for base excision repair.


    Alshykhly, Omar R; Fleming, Aaron M; Burrows, Cynthia J


    Guanine (G) is a target for oxidation by reactive oxygen species in DNA, RNA, and the nucleotide pool. Damage to DNA yields products with alternative properties toward DNA processing enzymes compared to those of the parent nucleotide. A new lesion, 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), bearing a stereocenter in the base was recently identified from the oxidation of G. DNA polymerase and base excision repair processing of this new lesion has now been evaluated. Single nucleotide insertion opposite (S)-2Ih and (R)-2Ih in the template strand catalyzed by the DNA polymerases Klenow fragment exo(-), DPO4, and Hemo KlenTaq demonstrates these lesions to cause point mutations. Specifically, they promote 3-fold more G·C → C·G transversion mutations than G·C → T·A, and (S)-2Ih was 2-fold more blocking for polymerase bypass than (R)-2Ih. Both diastereomer lesions were found to be substrates for the DNA glycosylases NEIL1 and Fpg, and poorly excised by endonuclease III (Nth). The activity was independent of the base pair partner. Thermal melting, CD spectroscopy, and density functional theory geometric optimization calculations were conducted to provide insight into these polymerase and DNA glycosylase studies. These results identify that formation of the 2Ih lesions in a cell would be mutagenic in the event that they were not properly repaired.

  19. A new rapid amplification of cDNA ends method for extremely guanine plus cytosine-rich genes.


    Shi, Xianzong; Jarvis, Donald L


    Rapid amplification of cDNA ends (RACE) is widely used to determine the 5'- and 3'-terminal nucleotide sequences of genes. Many different RACE methods have been developed to meet various requirements, but none addresses the difficult problems that arise when trying to isolate the ends of extremely guanine plus cytosine (GC)-rich genes. In this study, we found that we were unable to isolate the correct 5' or 3' end of an insect gene, which appeared to include extremely GC-rich sequences, using current RACE methods. Thus, we developed a new RACE method that can be used for this purpose. This new method entails first-strand cDNA synthesis at 70 degrees C with Thermo-X reverse transcriptase in the presence of homoectoine, followed by a polymerase chain reaction with 98 degrees C denaturation steps and Phusion DNA polymerase in the presence of 1M betaine and 5% dimethyl sulfoxide (DMSO). The use of these conditions yielded 5'- and 3'-RACE products that were approximately 80% GC over 213 and 162bp, respectively, and included shorter internal regions of 82 to 89% GC.

  20. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines.


    López-Cruz, Roberto I; Crocker, Daniel E; Gaxiola-Robles, Ramón; Bernal, Jaime A; Real-Valle, Roberto A; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements.

  1. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines

    PubMed Central

    López-Cruz, Roberto I.; Crocker, Daniel E.; Gaxiola-Robles, Ramón; Bernal, Jaime A.; Real-Valle, Roberto A.; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements. PMID:27375492

  2. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand

    NASA Astrophysics Data System (ADS)

    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (EuIII-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the EuIII-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the EuIII-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the EuIII-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using EuIII-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of EuIII-dtpa-bis(guanine) at 570 nm as a function of adenine (Ad) concentration in the range of 0.00-5.00 × 10- 5 mol L- 1 was observed. The detection limit is about 4.70 × 10- 7 mol L- 1.

  3. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand.


    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (Eu(III)-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the Eu(III)-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the Eu(III)-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the Eu(III)-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using Eu(III)-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of Eu(III)-dtpa-bis(guanine) at 570nm as a function of adenine (Ad) concentration in the range of 0.00-5.00×10(-5)molL(-1) was observed. The detection limit is about 4.70×10(-7)molL(-1).

  4. Hypoxanthine-guanine phosophoribosyltransferase (HPRT) deficiency: Lesch-Nyhan syndrome

    PubMed Central

    Torres, Rosa J; Puig, Juan G


    Deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity is an inborn error of purine metabolism associated with uric acid overproduction and a continuum spectrum of neurological manifestations depending on the degree of the enzymatic deficiency. The prevalence is estimated at 1/380,000 live births in Canada, and 1/235,000 live births in Spain. Uric acid overproduction is present inall HPRT-deficient patients and is associated with lithiasis and gout. Neurological manifestations include severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit, and self-injurious behaviour. The most severe forms are known as Lesch-Nyhan syndrome (patients are normal at birth and diagnosis can be accomplished when psychomotor delay becomes apparent). Partial HPRT-deficient patients present these symptoms with a different intensity, and in the least severe forms symptoms may be unapparent. Megaloblastic anaemia is also associated with the disease. Inheritance of HPRT deficiency is X-linked recessive, thus males are generally affected and heterozygous female are carriers (usually asymptomatic). Human HPRT is encoded by a single structural gene on the long arm of the X chromosome at Xq26. To date, more than 300 disease-associated mutations in the HPRT1 gene have been identified. The diagnosis is based on clinical and biochemical findings (hyperuricemia and hyperuricosuria associated with psychomotor delay), and enzymatic (HPRT activity determination in haemolysate, intact erythrocytes or fibroblasts) and molecular tests. Molecular diagnosis allows faster and more accurate carrier and prenatal diagnosis. Prenatal diagnosis can be performed with amniotic cells obtained by amniocentesis at about 15–18 weeks' gestation, or chorionic villus cells obtained at about 10–12 weeks' gestation. Uric acid overproduction can be managed by allopurinol treatment. Doses must be carefully adjusted to avoid xanthine lithiasis. The lack of precise

  5. Hypoxanthine-guanine phosophoribosyltransferase (HPRT) deficiency: Lesch-Nyhan syndrome.


    Torres, Rosa J; Puig, Juan G


    Deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity is an inborn error of purine metabolism associated with uric acid overproduction and a continuum spectrum of neurological manifestations depending on the degree of the enzymatic deficiency. The prevalence is estimated at 1/380,000 live births in Canada, and 1/235,000 live births in Spain. Uric acid overproduction is present inall HPRT-deficient patients and is associated with lithiasis and gout. Neurological manifestations include severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit, and self-injurious behaviour. The most severe forms are known as Lesch-Nyhan syndrome (patients are normal at birth and diagnosis can be accomplished when psychomotor delay becomes apparent). Partial HPRT-deficient patients present these symptoms with a different intensity, and in the least severe forms symptoms may be unapparent. Megaloblastic anaemia is also associated with the disease. Inheritance of HPRT deficiency is X-linked recessive, thus males are generally affected and heterozygous female are carriers (usually asymptomatic). Human HPRT is encoded by a single structural gene on the long arm of the X chromosome at Xq26. To date, more than 300 disease-associated mutations in the HPRT1 gene have been identified. The diagnosis is based on clinical and biochemical findings (hyperuricemia and hyperuricosuria associated with psychomotor delay), and enzymatic (HPRT activity determination in haemolysate, intact erythrocytes or fibroblasts) and molecular tests. Molecular diagnosis allows faster and more accurate carrier and prenatal diagnosis. Prenatal diagnosis can be performed with amniotic cells obtained by amniocentesis at about 15-18 weeks' gestation, or chorionic villus cells obtained at about 10-12 weeks' gestation. Uric acid overproduction can be managed by allopurinol treatment. Doses must be carefully adjusted to avoid xanthine lithiasis. The lack of precise

  6. Guanine-based structural coloration as an indicator of oxidative stress in a cichlid fish.


    Cahn, Matthew D; Brown, Alexandria C; Clotfelter, Ethan D


    Vertebrate pigmentation is known to be influenced by oxidative stress, but few studies have tested the hypothesis that structural coloration can be similarly affected. We tested whether fish iridophores, which produce structural color using guanine stacks, might be affected by the prooxidant-antioxidant balance of the animal. Specifically, we hypothesized that convict cichlids (Amatitlania nigrofasciata) metabolize guanine present in iridophores to uric acid, an antioxidant, in response to oxidative damage. We used Hunter's contrast gloss and high performance liquid chromatography to determine whether dietary guanine supplementation allows fish to maintain their structural coloration despite oxidative stress induced via ultraviolet-B (UV-B) radiation. We found that dietary guanine was associated with greater skin gloss, and that exposure to UV-B light reduced glossiness. UV-B exposure did not increase oxidative damage (acrolein) or total antioxidant capacity in the skin or liver. Our experiment did not detect effects of dietary guanine or UV-B light on uric acid, but uric acid was positively related to antioxidant capacity. Our results support the hypothesis that structural color in fish may be altered by environmental stressors such as exposure to UV light, and highlight the need for future studies to consider the role of iridophores in condition-dependent visual signaling.

  7. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine.


    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne


    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA.

  8. Control of self-assembled 2D nanostructures by methylation of guanine.


    Bald, Ilko; Wang, Yao-guang; Dong, Mingdong; Rosen, Christian B; Ravnsbaek, Jens B; Zhuang, Gui-lin; Gothelf, Kurt V; Wang, Jian-guo; Besenbacher, Flemming


    Methylation of DNA nucleobases is an important control mechanism in biology applied, for example, in the regulation of gene expression. The effect of methylation on the intermolecular interactions between guanine molecules is studied through an interplay between scanning tunneling microscopy (STM) and density functional theory with empirical dispersion correction (DFT-D). The present STM and DFT-D results show that methylation of guanine can have subtle effects on the hydrogen-bond strength with a strong dependence on the position of methylation. It is demonstrated that the methylation of DNA nucleobases is a precise means to tune intermolecular interactions and consequently enables very specific recognition of DNA methylation by enzymes. This scheme is used to generate four different types of artificial 2D nanostructures from methylated guanine. For instance, a 2D guanine windmill motif that is stabilized by cooperative hydrogen bonding is revealed. It forms by self-assembly on a graphite surface under ambient conditions at the liquid-solid interface when the hydrogen-bonding donor at the N1 site of guanine is blocked by a methyl group.

  9. Do clinical features of Lesch-Nyhan disease correlate more closely with hypoxanthine or guanine recycling?


    Schretlen, David J; Callon, Wynne; Ward, Rebecca E; Fu, Rong; Ho, Tiffany; Gordon, Barry; Harris, James C; Jinnah, H A


    Lesch-Nyhan disease (LND) is a rare, X-linked recessive neurodevelopmental disorder caused by deficiency of hypoxanthine-guanine phosphoribosyltransferase (HGprt), an enzyme in the purine salvage pathway. HGprt has two functions; it recycles hypoxanthine and guanine. Which of these two functions is more relevant for pathogenesis is unclear because some evidence points to hypoxanthine recycling, but other evidence points to guanine recycling. In this study, we selectively assayed hypoxanthine (Hprt) and guanine (Gprt) recycling in skin fibroblasts from 17 persons with LND, 11 with an attenuated variant of the disease (LNV), and 19 age-, sex-, and race-matched healthy controls (HC). Activity levels of both enzymes differed across groups (p < 0.0001), but only Gprt distinguished patients with LND from those with LNV (p < 0.05). Gprt also showed slightly stronger correlations than Hprt with 13 of 14 measures of the clinical phenotype, including the severity of dystonia, cognitive impairment, and behavioral abnormalities. These findings suggest that loss of guanine recycling might be more closely linked to the LND/LNV phenotype than loss of hypoxanthine recycling.

  10. Electrochemical studies on the oxidation of guanine and adenine at cyclodextrin modified electrodes.


    Abbaspour, Abdolkarim; Noori, Abolhassan


    An electrochemical sensor for guanine and adenine using cyclodextrin-modified poly(N-acetylaniline) (PNAANI) on a carbon paste electrode has been developed. The oxidation mechanism of guanine and adenine on the surface of the electrode was investigated by cyclic voltammetry. It was found that the electrode processes are irreversible, pH dependent, and involve several reaction products. The electron transfer process occurs in consecutive steps with the formation of a strongly adsorbed intermediate on the electrode surface. Also, a new method for estimating the apparent formation constants of guanine and adenine with the immobilized cyclodextrins, through the change of surface coverage of studied analytes has been reported. Both guanine and adenine showed linear concentrations in the range of 0.1-10 microM by using differential pulse voltammetry, with an experimental limit of detection down to 0.05 microM. Linear concentration ranges of 2-150 microM for guanine and 6-104 microM for adenine have been found when cyclic voltammetry was used for determination of both analytes.

  11. Label-free detection of telomerase activity using guanine electrochemical oxidation signal.


    Eskiocak, Ugur; Ozkan-Ariksoysal, Dilsat; Ozsoz, Mehmet; Oktem, Huseyin Avni


    Telomerase is an important biomarker for cancer cells and its activation in 85% of all cancer types confers a clinical diagnostic value. A label-free electrochemical assay based on guanine oxidation signal to measure telomerase activity is described. This developed technology combined with a disposable sensor, carbon graphite electrode (CGE), and differential pulse voltammetry (DPV) was performed by using PCR amplicons with/without telomeric repeats as the guanine oxidation signal observed at +1.0 V measured after the immobilization of PCR products. Guanine oxidation signal was chosen as a measure of telomerase activity because a substantial increase in the number of guanines was introduced by the action of telomerase which adds hexameric repeats (TTAGGG)n that contain 50% guanine. The developed assay was shown to specifically measure telomerase activity from cell extracts, and elongation rates increased linearly in a concentration dependent manner. Telomerase activity could be detected in cell extracts containing as low as 100 ng/microL of protein. All of the electrochemical measurements were also confirmed with the conventional TRAP-silver staining assay. Rapidity, simplicity, and the label-free nature of the developed assay make it suitable for practical use in quantitative determination of telomerase activity from clinical samples for diagnosis of cancer.

  12. Reduction of electron deficient guanine radical species in plasmid DNA by tyrosine derivatives.


    Tsoi, Mandi; Do, Trinh T; Tang, Vicky J; Aguilera, Joseph A; Milligan, Jamie R


    Guanine bases are the most easily oxidized sites in DNA and therefore electron deficient guanine radical species are major intermediates in the direct effect of ionizing radiation (ionization of the DNA itself) on DNA as a consequence of hole migration to guanine. As a model for this process we have used gamma-irradiation in the presence of thiocyanate ions to generate single electron oxidized guanine radicals in a plasmid target in aqueous solution. The stable species formed from these radicals can be detected and quantified by the formation of strand breaks in the plasmid after a post-irradiation incubation using a suitable enzyme. If a tyrosine derivative is also present during irradiation, the production of guanine oxidation products is decreased by electron transfer from tyrosine to the intermediate guanyl radical species. By using cationic tyrosine containing ligands we are able to observe this process when the tyrosine is electrostatically bound to the plasmid. The driving force dependence of this reaction was determined by comparing the reactivity of tyrosine with its 3-nitro analog. The results imply that the electron transfer reaction is coupled to a proton transfer. The experimental conditions used in this model system provide a reasonable approximation to those involved in the radioprotection of DNA by tightly bound proteins in chromatin.

  13. Guanine derivatives modulate L-glutamate uptake into rat brain synaptic vesicles.


    Tasca, Carla I; Santos, Tiago G; Tavares, Rejane G; Battastini, Ana M O; Rocha, João B T; Souza, Diogo O


    Glutamate uptake into synaptic vesicles is driven by a proton electrochemical gradient generated by a vacuolar H(+)-ATPase and stimulated by physiological concentrations of chloride. This uptake plays an important role in glutamatergic transmission. We show here that vesicular glutamate uptake is selectively inhibited by guanine derivatives, in a time- and concentration-dependent manner. Guanosine, GMP, GDP, guanosine-5'-O-2-thiodiphosphate, GTP, or 5'-guanylylimidodiphosphate (GppNHp) inhibited glutamate uptake in 1.5 and 3 min incubations, however, when incubating for 10 min, only GTP or GppNHp displayed such inhibition. By increasing ATP concentrations, the inhibitory effect of GTP was no longer observed, but GppNHp still inhibited glutamate uptake. In the absence of ATP, vesicular ATPase can hydrolyze GTP in order to drive glutamate uptake. However, 5mM GppNHp inhibited ATP hydrolysis by synaptic vesicle preparations. GTP or GppNHp decreased the proton electrochemical gradient, whereas the other guanine derivatives did not. Glutamate saturation curves were assayed in order to evaluate the specificity of inhibition of the vesicular glutamate carrier by the guanine derivatives. The maximum velocity of the initial rate of glutamate uptake was decreased by all guanine derivatives. These results indicate that, although GppNHp can inhibit ATPase activity, guanine derivatives are more likely to be acting through interaction with vesicular glutamate carrier.

  14. Oxidative guanine base damage regulates human telomerase activity

    PubMed Central

    Fouquerel, Elise; Lormand, Justin; Bose, Arindam; Lee, Hui-Ting; Kim, Grace S.; Li, Jianfeng; Sobol, Robert W.; Freudenthal, Bret D.; Myong, Sua; Opresko, Patricia L.


    Changes in telomere length are associated with degenerative diseases and cancer. Oxidative stress and DNA damage have been linked to both positive and negative alterations in telomere length and integrity. Here we examined how the common oxidative lesion 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG) regulates telomere elongation by telomerase. When present in the deoxynucleoside triphosphate pool as 8-oxodGTP, telomerase utilization of the oxidized nucleotide during telomere extension is mutagenic and terminates further elongation. Depletion of the enzyme that removes oxidized dNTPs, MTH1, increases telomere dysfunction and cell death in telomerase positive cancer cells harboring shortened telomeres. In contrast, a pre-existing 8-oxoG within the telomeric DNA sequence promotes telomerase activity by destabilizing G-quadruplex structure in the DNA. We show that the mechanism by which 8-oxoG arises in the telomere, either by insertion of oxidized nucleotides or by direct reaction with free radicals, dictates whether telomerase is inhibited or stimulated and thereby, mediates the biological outcome. PMID:27820808

  15. RNA Secondary Structures Having a Compatible Sequence of Certain Nucleotide Ratios.


    Barrett, Christopher L; Li, Thomas J X; Reidys, Christian M


    Given a random RNA secondary structure, S, we study RNA sequences having fixed ratios of nucleotides that are compatible with S. We perform this analysis for RNA secondary structures subject to various base-pairing rules and minimum arc- and stack-length restrictions. Our main result reads as follows: in the simplex of nucleotide ratios, there exists a convex region, in which, in the limit of long sequences, a random structure asymptotically almost surely (a.a.s.) has compatible sequence with these ratios and outside of which a.a.s. a random structure has no such compatible sequence. We localize this region for RNA secondary structures subject to various base-pairing rules and minimum arc- and stack-length restrictions. In particular, for GC-sequences (GC denoting the nucleotides guanine and cytosine, respectively) having a ratio of G nucleotides smaller than 1/3, a random RNA secondary structure without any minimum arc- and stack-length restrictions has a.a.s. no such compatible sequence. For sequences having a ratio of G nucleotides larger than 1/3, a random RNA secondary structure has a.a.s. such compatible sequences. We discuss our results in the context of various families of RNA structures.

  16. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.


    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth


    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.

  17. Formation of the carboxamidine precursor of cyanuric acid from guanine oxidative lesion dehydro-guanidinohydantoin.


    Irvoas, Joris; Trzcionka, Jérôme; Pratviel, Geneviève


    DNA damage under oxidative stress leads to oxidation of guanine base. The identification of the resulting guanine lesions in cellular DNA is difficult due to the sensitivity of the primary oxidation products to hydrolysis and/or further oxidation. We isolated dehydroguanidino-hydantoin (DGh) (or oxidized guanidinohydantoin), a secondary oxidation product of guanine, and showed that this lesion reacts readily with nucleophiles such as asymmetric peroxides and transforms to 2,4,6-trioxo-1,3,5-triazinane-1-carboxamidine residue. Further hydrolysis of this intermediate leads to cyanuric acid and finally to urea residue. This work demonstrates a new possible pathway for the formation of the well-known carboxamidine precursor of cyanuric acid lesion.

  18. Effect of intense magnetic fields on the convection of biogenic guanine crystals in aqueous solution

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Mizukawa, Y.


    In this study, the basic magneto-optic properties of biogenic microcrystals in aqueous media were investigated. Microcrystals, mica plates, silica, and microcrystals from a diatom cell and biogenic guanine crystals from goldfish showed light scattering inhibition when the crystals were observed in water under a 5 T magnetic field and dark-field illumination. In particular, in 50% ethanol/water medium, convection of the biogenic guanine particle aggregates was reversibly inhibited when the microcrystal suspension was exposed to a 5 T magnetic field. Microscopic observation comparing the biogenic guanine crystals in water with 95% ethanol or 99% acetone revealed that light flickering on the surface of the crystals was affected by the surface interaction of the crystal with the surrounding medium. By considering both the magnetic orientation of the microcrystals and the possible interactions of crystals with the surrounding medium, a magnetically controllable fluidic tracer was suggested.

  19. A DFT investigation on interactions between asymmetric derivatives of cisplatin and nucleobase guanine

    NASA Astrophysics Data System (ADS)

    Tai, Truong Ba; Nhat, Pham Vu


    The interactions of hydrolysis products of cisplatin and its asymmetric derivatives cis- and trans-[PtCl2(iPram)(Mepz)] with guanine were studied using DFT methods. These interactions are dominated by electrostatic effects, namely hydrogen bond contributions and there exists a charge flow from H-atoms of ligands to the O-atoms of guanine. The replacement of NH3 moieties by larger functional groups accompanies with a moderate reaction between PtII and guanine molecule, diminishing the cytotoxicity of the drug. The asymmetric and symmetric NH2 stretching modes of complexes having strong hydrogen bond interactions are red shifted importantly as compared to complexes without presence of hydrogen bond interactions.

  20. Fast nucleotide identification through fingerprinting using gold nanoparticle-based surface-assisted laser desorption/ionisation.


    Larguinho, Miguel; Capelo, José L; Baptista, Pedro V


    We report a method centred on gold nanoparticle-based surface-assisted laser desorption/ionisation for analysis of deoxynucleotides and alkylated nucleobases. Gold nanoparticles allow for enhanced analysis capability by eliminating undesired signature peaks; thus more elegant mass spectra can be attained that allow identification by nucleotide mass fingerprint. The resulting fingerprinting patterns on the spectra are compared and associated with the presence of different nucleotides in the sample. This method can be easily extended to modified nucleotides implicated in genome lesions due to exposure to environment chemicals, such as DNA adducts (e.g. guanine adducts). The use of gold nanoparticles for surface-assisted laser desorption/ionisation can be an useful tool to resolve common issues of background noise when analysing nucleic acids samples.

  1. Rapid and simple G-quadruplex DNA aptasensor with guanine chemiluminescence detection.


    Cho, Sandy; Park, Lucienne; Chong, Richard; Kim, Young Teck; Lee, Ji Hoon


    Cost-effective and sensitive aptasensor with guanine chemiluminescence detection capable of simply quantifying thrombin in human serum was developed using thrombin aptamer (TBA), one of the G-quadruplex DNA aptamers, without expensive nanoparticles and complicated procedures. Guanines of G-quadruplex TBA-conjugated carboxyfluorescein (6-FAM) bound with thrombin do not react with 3,4,5-trimethoxylphenylglyoxal (TMPG) in the presence of tetra-n-propylammonium hydroxide (TPA), whereas guanines of free TBA- and TBA-conjugated 6-FAM immobilized on the surface of graphene oxide rapidly react with TMPG to emit light. Thus, guanine chemiluminescence in 5% human serum with thrombin was lower than that without thrombin when TBA-conjugated 6-FAM was added in two samples and incubated for 20 min. In other words, the brightness of guanine chemiluminescence was quenched due to the formation of G-quadruplex TBA-conjugated 6-FAM bound with thrombin in a sample. High-energy intermediate, capable of emitting dim light by itself, formed from the reaction between guanines of TBA and TMPG in the presence of TPA, transfers energy to 6-FAM to emit bright light based on the principle of chemiluminescence energy transfer (CRET). G-quadruplex TBA aptasensor devised using the rapid interaction between TBA-conjugated 6-FAM and thrombin quantified trace levels of thrombin without complicated procedures. The limit of detection (LOD = background + 3 × standard deviation) of G-quadruplex TBA aptasensor with good linear calibration curve, accuracy, precision, and recovery was as low as 12.3 nM in 5% human serum. Using the technology reported in this research, we expect that various types of G-quadruplex DNA aptasensors capable of specifically sensing a target molecule such as ATP, HIV, ochratoxin, potassium ions, and thrombin can be developed.

  2. Mechanisms of oxidation of guanine in DNA by carbonate radical anion, a decomposition product of nitrosoperoxycarbonate.


    Lee, Young Ae; Yun, Byeong Hwa; Kim, Seog K; Margolin, Yelena; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

  3. Alkylation of urinary guanine in mice by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Hegazi, B


    The methylating capability of tetrachlorvinphos on urinary guanine in mice has been investigated using an insecticide labeled at both O-CH3 groups. Following intraperitoneal administration of the 14C-labeled insecticide to mice, about 0.57% of the radioactivity in the O- to 24-hr samples was associated with the purine fraction. The amount of [7-14C]methylguanine in 0- to 48-hr urine samples, estimated as fraction of applied dose, was 26-31 X 10(-5). The results obtained indicate possible chemical alkylation of urinary guanine. On the other hand, a considerable portion of radioactivity is probably incorporated via the C-1 pool.

  4. Labeled nucleotide phosphate (NP) probes


    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY


    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. [Nucleotide receptors and renal function].


    Jankowski, Maciej


    Kidney plays a key role in homeostasis of human body. It has heterogenic structure and is characterized by complicated vascular beds and numbers of sympathetic nerves endings. Nucleotides receptors are involved in the regulation of blood flow, a fundamental process for renal function. Plasma is filtrated in renal glomerulus and activity of nucleotides receptors located on cells of glomerular filter modifies the physi- cochemical properties of filter and affects the filtration process. Electrolytes, water and low molecular weight molecules are reabsorbed from tubular fluid or secreted into fluid in proximal and distal tubules. Glomerular filtration rate and activity of tubular processes are regulated via nucleotides receptors by glomerulotubularbalance and tubuloglomerular feedback. Nucleotides receptors are involved in systemic regulation of blood pressure and carbohydrate metabolism.

  6. Ric-8A, a G protein chaperone with nucleotide exchange activity induces long-range secondary structure changes in Gα

    PubMed Central

    Kant, Ravi; Zeng, Baisen; Thomas, Celestine J; Bothner, Brian; Sprang, Stephen R


    Cytosolic Ric-8A has guanine nucleotide exchange factor (GEF) activity and is a chaperone for several classes of heterotrimeric G protein α subunits in vertebrates. Using Hydrogen-Deuterium Exchange-Mass Spectrometry (HDX-MS) we show that Ric-8A disrupts the secondary structure of the Gα Ras-like domain that girds the guanine nucleotide-binding site, and destabilizes the interface between the Gαi1 Ras and helical domains, allowing domain separation and nucleotide release. These changes are largely reversed upon binding GTP and dissociation of Ric-8A. HDX-MS identifies a potential Gα interaction site in Ric-8A. Alanine scanning reveals residues crucial for GEF activity within that sequence. HDX confirms that, like G protein-coupled receptors (GPCRs), Ric-8A binds the C-terminus of Gα. In contrast to GPCRs, Ric-8A interacts with Switches I and II of Gα and possibly at the Gα domain interface. These extensive interactions provide both allosteric and direct catalysis of GDP unbinding and release and GTP binding. DOI: PMID:28008853

  7. Ric-8A, a G protein chaperone with nucleotide exchange activity induces long-range secondary structure changes in Gα.


    Kant, Ravi; Zeng, Baisen; Thomas, Celestine J; Bothner, Brian; Sprang, Stephen R


    Cytosolic Ric-8A has guanine nucleotide exchange factor (GEF) activity and is a chaperone for several classes of heterotrimeric G protein α subunits in vertebrates. Using Hydrogen-Deuterium Exchange-Mass Spectrometry (HDX-MS) we show that Ric-8A disrupts the secondary structure of the Gα Ras-like domain that girds the guanine nucleotide-binding site, and destabilizes the interface between the Gαi1 Ras and helical domains, allowing domain separation and nucleotide release. These changes are largely reversed upon binding GTP and dissociation of Ric-8A. HDX-MS identifies a potential Gα interaction site in Ric-8A. Alanine scanning reveals residues crucial for GEF activity within that sequence. HDX confirms that, like G protein-coupled receptors (GPCRs), Ric-8A binds the C-terminus of Gα. In contrast to GPCRs, Ric-8A interacts with Switches I and II of Gα and possibly at the Gα domain interface. These extensive interactions provide both allosteric and direct catalysis of GDP unbinding and release and GTP binding.

  8. Vibrational investigations of guanine, thioguanine and their singly charged cations and anions

    NASA Astrophysics Data System (ADS)

    Singh, R.; Yadav, R. A.


    The complete vibrational studies have been done with help of quantum mechanics for the neutral Guanine (Gua) and Thioguanine (TGua) molecules and their singly charged cations and anions employing the B3LYP/6-311++G** method. Neutral Thioguanine and cations of Guanine and Thioguanine show planar structures and belong to Cs point group symmetry while the neutral Guanine and anions of Guanine and Thioguanine possess non-planar structure with C1 point group symmetry. Vibrational studies of ionic radicals of Gua and its thio- derivative are not available in literatures. Such extensive studies have been attempted for the first time. The normal modes of all the species have been assigned on the basis using potential energy distributions (PEDs) using GAR2PED software. The PEDs have also been calculated to make a conspicuous assignment as animation available in GaussView is not a guarantee for correct normal mode assignment. Charge transfer occurs in the molecule have been shown by the calculated highest occupied molecular orbital—lowest unoccupied molecular orbital (HOMO-LUMO) energies. The mapping of electron density iso-surface with electrostatic potential, has been carried out to get the information about the size, shape, charge density distribution and site of chemical reactivity of the molecule. The electronic properties HOMO and LUMO energies have been measured. The energy gap from HOMO to LUMO of the Gua is 5.0547 eV and TGua 4.0743 eV.

  9. Extracellular conversion of guanine-based purines to guanosine specifically enhances astrocyte glutamate uptake.


    Frizzo, Marcos Emílio dos Santos; Antunes Soares, Félix Alexandre; Dall'Onder, Leonara Patrícia; Lara, Diogo Rizzato; Swanson, Raymond A; Souza, Diogo Onofre


    Guanosine (GUO) has been shown to stimulate glutamate uptake in primary astrocyte cultures. The purpose of this study was to determine the effect and specificity of guanine- or adenine-based purines on glutamate and GABA uptake in cultured astrocytes. Stimulatory effect on glutamate uptake was observed with GUO, GMP or GTP. Simultaneous exposure with these guanine-based purines did not show an additive effect. We also investigated a possible interconversion of guanine-based purines during incubation time. Action by GTP was excluded since the hydrolysis resistant GTP analog, GMP-PNP did not stimulate glutamate uptake. Addition of an ecto-5'-nucleotidase inhibitor abolished GMP-stimulatory effect on glutamate uptake, without affecting GUO action. Taken together, these results suggest that GUO is the guanine-based purines responsible for glutamate uptake activation. In addition, the stimulatory effect on glutamate uptake was not observed with adenine-based purines. Moreover, GABA uptake was not activated by GUO. These results point to specificity in the interaction between GUO and the astrocyte glutamate uptake system.

  10. Successive attachment of electrons to protonated Guanine: (G+H)* radicals and (G+H)- anions.


    Zhang, Jun D; Xie, Yaoming; Schaefer, Henry F


    The structures, energetics, and vibrational frequencies of nine hydrogenated 9H-keto-guanine radicals (G+H)(*) and closed-shell anions (G+H)(-) are predicted using the carefully calibrated (Chem. Rev. 2002, 102, 231) B3LYP density functional method in conjunction with a DZP++ basis set. These radical and anionic species come from consecutive electron attachment to the corresponding protonated (G+H)(+) cations in low pH environments. The (G+H)(+) cations are studied using the same level of theory. The proton affinity (PA) of guanine computed in this research (228.1 kcal/mol) is within 0.7 kcal/mol of the latest experiment value. The radicals range over 41 kcal/mol in relative energy, with radical r1, in which H is attached at the C8 site of guanine, having the lowest energy. The lowest energy anion is a2, derived by hydride ion attachment at the C2 site of guanine. No stable N2-site hydride should exist in the gas phase. Structure a9 was predicted to be dissociative in this research. The theoretical adiabatic electron affinities (AEA), vertical electron affinities, and vertical detachment energies were computed, with AEAs ranging from 0.07 to 3.12 eV for the nine radicals.

  11. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation.


    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M


    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity.

  12. Magnetic control of the inclination of biogenic guanine crystals fixed on a substrate

    NASA Astrophysics Data System (ADS)

    Mizukawa, Yuri; Iwasaka, Masakazu


    In the present study, we describe the fabrication and manipulation of a micro-mirror system similar to the iridophores of neon tetra that allow microstructural light control. Biogenic guanine crystals as micro-mirrors were adhered to a glass substrate with flexible DNA joints under a vertical magnetic field of 480 mT. We then observed the movement of the micro-mirrors under sub-Tesla horizontal magnetic fields. Under ambient fields, the orientation of the guanine micro-mirrors did not change. Appling a horizontal magnetic field of approximately 400 mT generated by an electromagnet induced motion and width changes of the guanine micro-mirrors, which were observed by an optical microscope. However, the inclination of the micro-mirrors recovered upon removal of the magnetic field. The developed guanine micro-mirrors on a glass substrate demonstrate the remote control of microstructural diamagnetic materials, and may show promise for use as an underwater microactuator for microfluidic systems.

  13. Preparation of DNA and RNA Fragments Containing Guanine N2-Thioalkyl Tethers

    PubMed Central

    Hou, Xiaorong; Wang, Gang; Gaffney, Barbara L.; Jones, Roger A.


    This unit describes procedures for preparation of deoxyguanosine and guanosine derivatives in which the guanine N2 contains a thiopropyl tether, protected as a tert-butyl disulfide. After incorporation into a DNA or RNA fragment, this tether allows site-specific crosslinking to a thiol of a protein or another nucleic acid. PMID:20517990

  14. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik


    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  15. An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition.

    PubMed Central

    Kiga, D; Futamura, Y; Sakamoto, K; Yokoyama, S


    RNAs that bind to xanthine (2,6-dioxypurine) were isolated from a population of 10(12) random sequences by in vitro selection. These xanthine-binding RNAs were found to have a 10 nt consensus sequence at an internal loop in the most probable secondary structure. By trimming one of the xanthine-binding RNAs, a representative xanthine-binding RNA (designated as XBA) of 32 nt residues was prepared. The dissociation constant of this RNA for xanthine was determined to be 3.3 microM by equilibrium filtration experiments. The XBA RNA can bind to guanine as well, whereas it hardly accommodates adenine, cytosine or uracil. The K d values for various xanthine/guanine analogues were determined, and revealed that the N1H, N7 and O6 moieties of the ligand are involved in the binding with the XBA RNA. The ribonuclease sensitivities of some internal-loop residues changed upon the addition of xanthine, suggesting that the internal loop of the XBA RNA is involved in the ligand binding. Interestingly, the consensus sequence of the xanthine/guanine-binding RNAs is the same as a sequence in one of the internal loops of the hairpin ribozyme, except for a substitution that is neutral with respect to xanthine/guanine binding. PMID:9512549

  16. Nucleotide binding affects intrinsic dynamics and structural communication in Ras GTPases.


    Fanelli, Francesca; Raimondi, Francesco


    The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins) that are essential to intracellular signal transduction. These proteins act biologically as molecular switches, which, cycling between OFF and ON states, play fundamental role in cell biology. This review article summarizes the inferences from the widest computational analyses done so far on Ras GTPases aimed at providing a comprehensive structural/dynamic view of the trans-family and family-specific functioning mechanisms. These variegated comparative analyses could infer the evolutionary and intrinsic flexibilities as well as the structural communication features in the most representative G protein families in different functional states. In spite of the low sequence similarities, the members of the Ras superfamily share the topology of the Ras-like domain, including the nucleotide binding site. GDP and GTP make very similar interactions in all GTPases and differences in their binding modes are localized around the γ-phosphate of GTP. Remarkably, such subtle local differences result in significant differences in the functional dynamics and structural communication features of the protein. In Ras GTPases, the nucleotide plays a central and active role in dictating functional dynamics, establishing the major structure network, and mediating the communication paths instrumental in function retention and specialization. Collectively, the results of these studies support the speculation that an "extended conformational selection model" that embraces a repertoire of selection and adjustment processes is likely more suitable to describe the nucleotide behavior in these important molecular switches.

  17. Rab27a Targeting to Melanosomes Requires Nucleotide Exchange but Not Effector Binding

    PubMed Central

    Tarafder, Abul K; Wasmeier, Christina; Figueiredo, Ana C; Booth, Antonia E G; Orihara, Asumi; Ramalho, Jose S; Hume, Alistair N; Seabra, Miguel C


    Rab GTPases are important determinants of organelle identity and regulators of vesicular transport pathways. Consequently, each Rab occupies a highly specific subcellular localization. However, the precise mechanisms governing Rab targeting remain unclear. Guanine nucleotide exchange factors (GEFs), putative membrane-resident targeting factors and effector binding have all been implicated as critical regulators of Rab targeting. Here, we address these issues using Rab27a targeting to melanosomes as a model system. Rab27a regulates motility of lysosome-related organelles and secretory granules. Its effectors have been characterized extensively, and we have identified Rab3GEP as the non-redundant Rab27a GEF in melanocytes (Figueiredo AC et al. Rab3GEP is the non-redundant guanine nucleotide exchange factor for Rab27a in melanocytes. J Biol Chem 2008;283:23209–23216). Using Rab27a mutants that show impaired binding to representatives of all four Rab27a effector subgroups, we present evidence that effector binding is not essential for targeting of Rab27a to melanosomes. In contrast, we observed that knockdown of Rab3GEP resulted in mis-targeting of Rab27a, suggesting that Rab3GEP activity is required for correct targeting of Rab27a. However, the identification of Rab27a mutants that undergo efficient GDP/GTP exchange in the presence of Rab3GEP in vitro but are mis-targeted in a cellular context indicates that nucleotide loading is not the sole determinant of subcellular targeting of Rab27a. Our data support a model in which exchange activity, but not effector binding, represents one essential factor that contributes to membrane targeting of Rab proteins. PMID:21554507

  18. Determination of endogenous and exogenously derived N7-(2-hydroxyethyl)guanine adducts in ethylene oxide-treated rats.


    Marsden, Debbie A; Jones, Donald J L; Lamb, John H; Tompkins, Elaine M; Farmer, Peter B; Brown, Karen


    Ethylene oxide (EO) is one of the most widely used intermediates in the chemical industry. It is also formed endogenously as a result of cytochrome P450-mediated metabolism of ethylene, which is ubiquitous in the environment. Additionally, ethylene is generated in vivo during normal physiological processes such as methionine oxidation and lipid peroxidation; therefore, humans are continually exposed to EO. EO is classed by the IARC as carcinogenic to humans and reacts with DNA, primarily forming N7-(2-hydroxyethyl)guanine adducts (N7-HEG), which can be used as biomarkers of exposure and potential cancer risk. To assess the risks to humans associated with occupational exposure to low EO concentrations, it is necessary to establish the relative contribution of DNA damage arising from endogenous and exogenously derived EO. Using a newly developed highly sensitive LC-MS/MS assay with selected reaction monitoring that offers a limit of detection of 0.1 fmol of N7-HEG on column, we have established background levels of N7-HEG (1.1-3.5 adducts/10(8) nucleotides) in tissues of rats. Following intraperitoneal administration of a single dose or three daily doses of EO (0.01-1.0 mg/kg), N7-HEG adducts generally increased with dose, except at the lowest concentration where total N7-HEG levels were no different to that detected in control animals, indicating that any increase was negligible as compared to the endogenous damage already present. In the 3 day study, the kinetics of adduct removal were also investigated and in comparing N7-HEG formation in the two studies, DNA damage did not appear to accumulate with repeated administration.

  19. Metalated nucleotide chemisorption on hydroxyapatite.


    Benedetti, Michele; Antonucci, Daniela; De Castro, Federica; Girelli, Chiara R; Lelli, Marco; Roveri, Norberto; Fanizzi, Francesco P


    The experiments here reported evidence on the importance of the residual charge of a nucleotide derivative, for the adsorption on nHAP (hydroxyapatite nanocrystals), in water solution. We found that the simple presence of phosphates on the nucleotide derivative does not guarantee adsorption on nHAP. On the other hand, we demonstrated that a cationic or neutral charge on a nucleotide derivative produces a strongly reduced chemical adsorption (chemisorption) whereas, in the presence of a net negative charge, relevant adsorption on nHAP is observed. The number of phosphates can only modulate the adsorption efficiency of a molecule provided that this latter bears an overall negative charge. The neutral zwitterionic nucleotide Pt(II) complexes, bearing negatively charged phosphates, are unable to give stable chemisorption. Previous considerations are important to model the binding ability of phosphate bearing nucleotide derivatives or molecules on hydroxyapatite. The findings reported in the present paper could be relevant in bone tissue targeting or nHAP mediated drug delivery.

  20. Arxula adeninivorans recombinant guanine deaminase and its application in the production of food with low purine content.


    Trautwein-Schult, Anke; Jankowska, Dagmara; Cordes, Arno; Hoferichter, Petra; Klein, Christina; Matros, Andrea; Mock, Hans-Peter; Baronian, Keith; Bode, Rüdiger; Kunze, Gotthard


    Purines of exogenous and endogenous sources are degraded to uric acid in human beings. Concentrations >6.8 mg uric acid/dl serum cause hyperuricemia and its symptoms. Pharmaceuticals and the reduction of the intake of purine-rich food are used to control uric acid levels. A novel approach to the latter proposition is the enzymatic reduction of the purine content of food by purine-degrading enzymes. Here we describe the production of recombinant guanine deaminase by the yeast Arxula adeninivorans LS3 and its application in food. In media supplemented with nitrogen sources hypoxanthine or adenine, guanine deaminase (AGDA) gene expression is induced and intracellular accumulation of guanine deaminase (Agdap) protein occurs. The characteristics of the guanine deaminase isolated from wild-type strain LS3 and a transgenic strain expressing the AGDA gene under control of the strong constitutive TEF1 promoter were determined and compared. Both enzymes were dimeric and had temperature optima of 55°C with high substrate specificity for guanine and localisation in both the cytoplasm and vacuole of yeast. The enzyme was demonstrated to reduce levels of guanine in food. A mixture of guanine deaminase and other purine degradation enzymes will allow the reduction of purines in purine-rich foods. © 2014 S. Karger AG, Basel.

  1. Hypoxanthine-guanine phosphoribosyltransferase: characteristics of the mutant enzyme in erythrocytes from patients with the Lesch-Nyhan syndrome.


    Arnold, W J; Meade, J C; Kelley, W N


    The Lesch-Nyhan syndrome is characterized clinically by choreoathetosis, spasticity, selfmutilation, and mental and growth retardation. Biochemically, there is a striking reduction of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) activity in affected individuals. We have examined erythrocytes from 14 patients with the Lesch-Nyhan syndrome for the presence of hypoxanthine-guanine phosphoribosyltransferase activity and enzyme protein. In contrast to the usual finding of no detectable hypoxanthine-guanine phosphoribosyltransferase activity, we have found low levels (0.002-0.79 nmoles/mg protein per hr) of hypoxanthine-guanine phosphoribosyltransferase activity in erythrocyte lysates from five of these patients. In three of the five patients, hypoxanthine-guanine phosphoribosyltransferase activity appeared to be substantially more labile in vivo than normal using erythrocytes which had been separated according to their density (age). Immunochemical studies using a monospecific antiserum prepared from a homogeneous preparation of normal human erythrocyte hypoxanthine-guanine phosphoribosyltransferase revealed immunoreactive protein (CRM) in hemolysate from all 14 patients with the Lesch-Nyhan syndrome. The immunoreactive protein from each patient gave a reaction of complete identity with normal erythrocyte hypoxanthine-guanine phosphoribosyltransferase and was present in quantities equal to those observed in normal erythrocytes. In addition, a constant amount of CRM was found in erythrocytes of increasing density (age) from patients with the Lesch-Nyhan syndrome despite the decreasing hypoxanthine-guanine phosphoribosyltransferase activity. These studies confirm previous data which indicate that the mutations leading to the Lesch-Nyhan syndrome are usually, if not always on the structural gene coding for hypoxanthine-guanine phosphoribosyltransferase. In addition, although the mutant proteins appear to be present in normal amounts, they are often very labile in

  2. Insertion of oxidized nucleotide triggers rapid DNA polymerase opening

    PubMed Central

    Kim, Taejin; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.; Schlick, Tamar


    A novel mechanism is unveiled to explain why a pro-mutagenic nucleotide lesion (oxidized guanine, 8-oxoG) causes the mammalian DNA repair polymerase-β (pol-β) to rapidly transition to an inactive open conformation. The mechanism involves unexpected features revealed recently in time-lapse crystallography. Specifically, a delicate water network associated with a lesion-stabilizing auxilliary product ion Mg(p) triggers a cascade of events that leads to poor active site geometry and the rupture of crucial molecular interactions between key residues in both the anti(8-oxoG:C) and syn(8-oxoG:A) systems. Once the base pairs in these lesioned systems are broken, dislocation of both Asp192 (a metal coordinating ligand) and the oxoG phosphate group (PO4) interfere with the hydrogen bonding between Asp192 and Arg258, whose rotation toward Asp192 is crucial to the closed-to-open enzyme transition. Energetically, the lesioned open states are similar in energy to those of the corresponding closed complexes after chemistry, in marked contrast to the unlesioned pol-β anti(G:C) system, whose open state is energetically higher than the closed state. The delicate surveillance system offers a fundamental protective mechanism in the cell that triggers DNA repair events which help deter insertion of oxidized lesions. PMID:27034465

  3. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    PubMed Central

    Vergnano, Marta; Wan, Chris


    ABSTRACT We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. PMID:28743817

  4. Different Characteristics and Nucleotide Binding Properties of Inosine Monophosphate Dehydrogenase (IMPDH) Isoforms

    PubMed Central

    Thomas, Elaine C.; Gunter, Jennifer H.; Webster, Julie A.; Schieber, Nicole L.; Oorschot, Viola; Parton, Robert G.; Whitehead, Jonathan P.


    We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH), a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP) would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i) the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii) communication occurs between the Bateman and catalytic domains and (iii) the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease. PMID:23236438

  5. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.


    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G


    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected cells

  6. Guanine α-carboxy nucleoside phosphonate (G-α-CNP) shows a different inhibitory kinetic profile against the DNA polymerases of human immunodeficiency virus (HIV) and herpes viruses.


    Balzarini, Jan; Menni, Michael; Das, Kalyan; van Berckelaer, Lizette; Ford, Alan; Maguire, Nuala M; Liekens, Sandra; Boehmer, Paul E; Arnold, Eddy; Götte, Matthias; Maguire, Anita R


    α-Carboxy nucleoside phosphonates (α-CNPs) are modified nucleotides that represent a novel class of nucleotide-competing reverse transcriptase (RT) inhibitors (NcRTIs). They were designed to act directly against HIV-1 RT without the need for prior activation (phosphorylation). In this respect, they differ from the nucleoside or nucleotide RTIs [N(t)RTIs] that require conversion to their triphosphate forms before being inhibitory to HIV-1 RT. The guanine derivative (G-α-CNP) has now been synthesized and investigated for the first time. The (L)-(+)-enantiomer of G-α-CNP directly and competitively inhibits HIV-1 RT by interacting with the substrate active site of the enzyme. The (D)-(-)-enantiomer proved inactive against HIV-1 RT. In contrast, the (+)- and (-)-enantiomers of G-α-CNP inhibited herpes (i.e. HSV-1, HCMV) DNA polymerases in a non- or uncompetitive manner, strongly indicating interaction of the (L)-(+)- and the (D)-(-)-G-α-CNPs at a location different from the polymerase substrate active site of the herpes enzymes. Such entirely different inhibition profile of viral polymerases is unprecedented for a single antiviral drug molecule. Moreover, within the class of α-CNPs, subtle differences in their sensitivity to mutant HIV-1 RT enzymes were observed depending on the nature of the nucleobase in the α-CNP molecules. The unique properties of the α-CNPs make this class of compounds, including G-α-CNP, direct acting inhibitors of multiple viral DNA polymerases. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. The use of modified and non-natural nucleotides provide unique insights into pro-mutagenic replication catalyzed by polymerase eta

    PubMed Central

    Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J.; Berdis, Anthony J.


    This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. PMID:26717984

  8. The EMBL Nucleotide Sequence Database.


    Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Leinonen, Rasko; Lin, Quan; Lombard, Vincent; Lopez, Rodrigo; Redaschi, Nicole; Stoehr, Peter; Tuli, Mary Ann; Tzouvara, Katerina; Vaughan, Robert


    The EMBL Nucleotide Sequence Database (aka EMBL-Bank; incorporates, organises and distributes nucleotide sequences from all available public sources. EMBL-Bank is located and maintained at the European Bioinformatics Institute (EBI) near Cambridge, UK. In an international collaboration with DDBJ (Japan) and GenBank (USA), data are exchanged amongst the collaborating databases on a daily basis. Major contributors to the EMBL database are individual scientists and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via FTP, email and World Wide Web interfaces. EBI's Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many other specialized databases. For sequence similarity searching, a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. All resources can be accessed via the EBI home page at

  9. Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.


    Musumeci, Domenica; Irace, Carlo; Santamaria, Rita; Milano, Domenico; Tecilla, Paolo; Montesarchio, Daniela


    Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Absence of hypoxanthine:guanine phosphoribosyltransferase activity in murine Dunn osteosarcoma

    SciTech Connect

    Abelson, H.T.; Gorka, C.


    The transplantable murine Dunn osteosarcoma has no detectable hypoxanthine:guanine phosphoribosyltransferase (EC activity. This was established from the tumors directly and from tissue culture cell lines derived from the tumor using a variety of assays: e.g., no (3H)hypoxanthine uptake into tumor or tissue culture cells, no conversion of (3H)hypoxanthine to (3H)IMP by cell extracts from tumors or tissue culture cells, no growth of tissue culture cells in hypoxanthine:aminopterin:thymidine medium, and normal growth of these cells in 10 microM 6-mercaptopurine. Ten human osteosarcomas have been assayed, and two have no apparent hypoxanthine:guanine phosphoribosyltransferase enzyme activity. After high-dose methotrexate treatment in vivo, murine tumors could be selectively killed and normal tissues could be spared by using a rescue regimen of hypoxanthine-thymidine-allopurinol.

  11. Finding Adiabatically Bound Anions of Guanine through a Combinatorial Computational Approach

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.


    In summary, guanine supports many adiabatically bound valence anions, which result from enamine-imine transformations of the most stable neutral tautomers. These stable anionic tautomers have been found using combinatorial-computational prescreening at the B3LYP level of theory followed by CCSD(T)/aug-cc-pVDZ calculations. The new anionic tautomers contradict a common opinion that guanine has the lowest electron affinity among nucleobases. The new anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom. They might affect the structure and properties of DNA and RNA exposed to low-energy electrons. Chemical transformations of DNA triggered by the new anionic tautomers will be explored in our future studies.

  12. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.


    Usha, S; Selvaraj, S


    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  13. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.


    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  14. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    PubMed Central

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10−7 to 10−3 Ω−1 cm−1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries. PMID:27091631

  15. Oxidative modification of guanine bases initiated by oxyl radicals derived from photolysis of azo compounds.


    Shao, Jie; Geacintov, Nicholas E; Shafirovich, Vladimir


    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO(*)), 2-amidinoprop-2-oxyl (RO(*)), and superoxide (O(2)(*-)) radicals. These oxyl radicals with negligible absorption in a near UV-visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO(*) radicals induce fast one-electron oxidation of 2'-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)(*). In contrast, ROO(*) radicals do not react at observable rates with dG. The O(2)(*-) radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end-products of guanine oxidation is the combination of the G(-H)(*) and O(2)(*-) radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end-products produced by oxidation of two substrates: (1) the guanosine derivative 2',3',5'-tri-O-acetylguanosine (tri-O-Ac-G) and (2) the 5'-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5'-d(CCATC[Iz]CTACC products.

  16. Guanine-aspartic acid interactions probed with IR-UV resonance spectroscopy.


    Crews, Bridgit O; Abo-Riziq, Ali; Pluhácková, Kristýna; Thompson, Patrina; Hill, Glake; Hobza, Pavel; de Vries, Mattanjah S


    Double resonance spectroscopy of clusters of guanine with aspartic acid reveals geometries similar to patterns exhibited in DNA base pairs. In the spectral region of 32,800 cm(-1) to 35,500 cm(-1) we observe five isomers of guanine-aspartic acid clusters and assign their structures based on IR-UV hole-burning spectra and wave function theory calculations at the MP2/cc-pVDZ and MP2/cc-pVTZ levels. The calculations employed both harmonic and one-dimensional scan anharmonic approximations. Three of the isomers are similar, assigned to structures containing three hydrogen bonds and 9-enolguanine. We assign the fourth isomer to a structure containing a 9-keto tautomer of guanine and forming a triply bonded structure similar to a base pairing interaction. The fifth isomer dissociates with proton transfer upon excitation or ionization. This is the first set of experiments and high-level ab initio calculations of the isolated, microscopic interactions of an amino acid and a nucleobase, the building blocks of nucleic acids and proteins.

  17. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    NASA Astrophysics Data System (ADS)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  18. Magnetic Control of the Light Reflection Anisotropy in a Biogenic Guanine Microcrystal Platelet.


    Iwasaka, Masakazu; Mizukawa, Yuri; Roberts, Nicholas W


    Bioinspired but static optical devices such as lenses, retarders, and reflectors have had a significant impact on the designs of many man-made optical technologies. However, while numerous adaptive and flexible optical mechanisms are found throughout the animal kingdom, highly desirable biomimetic copies of these remarkable smart systems remain, in many cases, a distant dream. Many aquatic animals have evolved highly efficient reflectors based on multilayer stacks of the crystallized nucleic acid base guanine. With exceptional levels of spectral and intensity control, these reflectors represent an interesting design pathway towards controllable micromirror structures. Here we show that individual guanine crystals, with dimensions of 5 μm × 20 μm × 70 nm, can be magnetically controlled to act as individual micromirrors. By applying magnetic fields of 500 mT, the reflectivity of these crystals can be switched off and on for the change in reflectivity. Overall, the use of guanine represents a novel design scheme for a highly efficient and controllable synthetic organic micromirror array.

  19. Non-covalent functionalization of hexagonal boron nitride nanosheets with guanine.


    Anota, E Chigo; Tlapale, Y; Villanueva, M Salazar; Márquez, J A Rivera


    Density functional theory (DFT) calculations were performed to analyze changes in the structural and electronic properties generated by the interaction of a single nucleobase group (guanine) with the surface of boron nitride nanosheets with hexagonal symmetry (hBNNs). Nanosheets in two contexts were tested: pristine sheets and with point defects (doped with carbon atoms). The criterion of energy minimum was used to find the ground state of the nine possible isomers generated by the hBNNs-guanine interaction. The phenomenon of physisorption is known to occur at values less than 1.0 eV; the adsorption energy results revealed that the preferential geometry was a parallel arrangement between the two partners, with van der Waals-type bonds generated for the hBNNs doped with two carbon atoms. This was the only energetically stable configuration, thus revealing a vibrational mode rather than imaginaries. Furthermore, the hBNNs/C-guanine system has a low value for work function, and therefore could be used in health applications such drug transport and delivery. The increased polarity values suggest that these nanosheets could be solubilized in common solvents used in experimental processes.

  20. Singlet Oxygen Attack on Guanine: Reactivity and Structural Signature within the B-DNA Helix.


    Dumont, Elise; Grüber, Raymond; Bignon, Emmanuelle; Morell, Christophe; Aranda, Juan; Ravanat, Jean-Luc; Tuñón, Iñaki


    Oxidatively generated DNA lesions are numerous and versatile, and have been the subject of intensive research since the discovery of 8-oxoguanine in 1984. Even for this prototypical lesion, the precise mechanism of formation remains elusive due to the inherent difficulties in characterizing high-energy intermediates. We have probed the stability of the guanine endoperoxide in B-DNA as a key intermediate and determined a unique activation free energy of around 6 kcal mol(-1) for the formation of the first C-O covalent bond upon the attack of singlet molecular oxygen ((1) O2 ) on the central guanine of a solvated 13 base-pair poly(dG-dC), described by means of quantum mechanics/molecular mechanics (QM/MM) simulations. The B-helix remains stable upon oxidation in spite of the bulky character of the guanine endoperoxide. Our modeling study has revealed the nature of the versatile (1) O2 attack in terms of free energy and shows a sensitivity to electrostatics and solvation as it involves a charge-separated intermediate. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    PubMed Central

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.


    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  2. Formation of ring-opened and rearranged products of guanine: mechanisms and biological significance.


    Jena, N R; Mishra, P C


    DNA damage by endogenous and exogenous agents is a serious concern, as the damaged products can affect genome integrity severely. Damage to DNA may arise from various factors such as DNA base modifications, strand break, inter- and intrastrand crosslinks, and DNA-protein crosslinks. Among these factors, DNA base modification is a common and important form of DNA damage that has been implicated in mutagenesis, carcinogenesis, and many other pathological conditions. Among the four DNA bases, guanine (G) has the smallest oxidation potential, because of which it is frequently modified by reactive species, giving rise to a plethora of lethal lesions. Similarly, 8-oxo-7,8-dihydroguanine (8-oxoG), an oxidatively damaged guanine lesion, also undergoes various degradation reactions giving rise to several mutagenic species. The various products formed from reactions of G or 8-oxoG with different reactive species are mainly 2,6-diamino-4-oxo-5-formamidopyrimidine, 2,5-diamino-4H-imidazolone, 2,2,4-triamino-5-(2H)-oxazolone, 5-guanidino-4-nitroimidazole, guanidinohydantoin, spiroiminodihydantoin, cyanuric acid, parabanic acid, oxaluric acid, and urea, among others. These products are formed from either ring opening or ring opening and subsequent rearrangement. The main aim of this review is to provide a comprehensive overview of various possible reactions and the mechanisms involved, after which these ring-opened and rearranged products of guanine would be formed in DNA. The biological significance of oxidatively damaged products of G is also discussed.

  3. DNA polymerase V allows bypass of toxic guanine oxidation products in vivo.


    Neeley, William L; Delaney, Sarah; Alekseyev, Yuriy O; Jarosz, Daniel F; Delaney, James C; Walker, Graham C; Essigmann, John M


    Reactive oxygen and nitrogen radicals produced during metabolic processes, such as respiration and inflammation, combine with DNA to form many lesions primarily at guanine sites. Understanding the roles of the polymerases responsible for the processing of these products to mutations could illuminate molecular mechanisms that correlate oxidative stress with cancer. Using M13 viral genomes engineered to contain single DNA lesions and Escherichia coli strains with specific polymerase (pol) knockouts, we show that pol V is required for efficient bypass of structurally diverse, highly mutagenic guanine oxidation products in vivo. We also find that pol IV participates in the bypass of two spiroiminodihydantoin lesions. Furthermore, we report that one lesion, 5-guanidino-4-nitroimidazole, is a substrate for multiple SOS polymerases, whereby pol II is necessary for error-free replication and pol V for error-prone replication past this lesion. The results spotlight a major role for pol V and minor roles for pol II and pol IV in the mechanism of guanine oxidation mutagenesis.

  4. Geometrical Characterization of Adenine And Guanine on Cu(110) By NEXAFS, XPS, And DFT Calculation

    SciTech Connect

    Furukawa, M.; Yamada, T.; Katano, S.; Kawai, M.; Ogasawara, H.; Nilsson, A.; /SLAC, SSRL /Stockholm U.


    Adsorption of purine DNA bases (guanine and adenine) on Cu(1 1 0) was studied by X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine-structure spectroscopy (NEXAFS), and density-functional theory (DFT) calculation. At coverages near 0.2 monolayers, Angular-resolved NEXAFS analysis revealed that adenine adsorbates lie almost flat and that guanine adsorbates are tilted up on the surface with the purine ring parallel to the atom rows of Cu(1 1 0). Referring to the previous studies on pyrimidine DNA bases [M. Furukawa, H. Fujisawa, S. Katano, H. Ogasawara, Y. Kim, T. Komeda, A. Nilsson, M. Kawai, Surf. Sci. 532-535 (2003) 261], the isomerization of DNA bases on Cu(1 1 0) was found to play an important role in the adsorption geometry. Guanine, thymine and cytosine adsorption have an amine-type nitrogen next to a carbonyl group, which is dehydrogenated into imine nitrogen on Cu(1 1 0). These bases are bonded by the inherent portion of - NH-CO - altered by conversion into enolic form and dehydrogenation. Adenine contains no CO group and is bonded to Cu(1 1 0) by participation of the inherent amine parts, resulting in nearly flatly-lying position.

  5. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte.


    Dutta, Dipak; Nagapradeep, N; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it's in-built supply of Li(+)-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10(-7) to 10(-3) Ω(-1) cm(-1)) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80-100 °C, from a dual Li(+) and H(+) (<100 °C) to a pure Li(+) conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  6. ESI-MS Characterization of a Novel Pyrrole-Inosine Nucleoside that Interacts with Guanine Bases

    PubMed Central

    Pierce, Sarah E.; Sherman, Courtney L.; Jayawickramarajah, Janarthanan; Lawrence, Candace M.; Sessler, Jonathan L.; Brodbelt, Jennifer S.


    Based on binding studies undertaken by electrospray ionization-mass spectrometry, a synthetic pyrrole-inosine nucleoside, 1, capable of forming an extended three-point Hoogsteen-type hydrogen-bonding interaction with guanine, is shown to form specific complexes with two different quadruplex DNA structures [dTG4T]4 and d(T2G4)4 as well as guanine rich duplex DNA. The binding interactions of two other analogs were evaluated in order to unravel the structural features that contribute to specific DNA recognition. The importance of the Hoogsteen interactions was confirmed through the absence of specific binding when the pyrrole NH hydrogen-bonding site was blocked or removed. While 2, with a large blocking group, was not found to interact with virtually any form of DNA, 3, with the pyrrole functionality missing, was found to interact non-specifically with several types of DNA. The specific binding of 1 to guanine rich DNA emphasizes the necessity of careful ligand design for specific sequence recognition. PMID:18790136

  7. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.


    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim


    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  8. Aquifex aeolicus tRNA (N2,N2-guanine)-dimethyltransferase (Trm1) catalyzes transfer of methyl groups not only to guanine 26 but also to guanine 27 in tRNA.


    Awai, Takako; Kimura, Satoshi; Tomikawa, Chie; Ochi, Anna; Ihsanawati; Bessho, Yoshitaka; Yokoyama, Shigeyuki; Ohno, Satoshi; Nishikawa, Kazuya; Yokogawa, Takashi; Suzuki, Tsutomu; Hori, Hiroyuki


    Transfer RNA (N2,N2-guanine)-dimethyltransferase (Trm1) catalyzes N2,N2-dimethylguanine formation at position 26 (m(2)(2)G26) in tRNA. In the reaction, N2-guanine at position 26 (m(2)G26) is generated as an intermediate. The trm1 genes are found only in archaea and eukaryotes, although it has been reported that Aquifex aeolicus, a hyper-thermophilic eubacterium, has a putative trm1 gene. To confirm whether A. aeolicus Trm1 has tRNA methyltransferase activity, we purified recombinant Trm1 protein. In vitro methyl transfer assay revealed that the protein has a strong tRNA methyltransferase activity. We confirmed that this gene product is expressed in living A. aeolicus cells and that the enzymatic activity exists in cell extract. By preparing 22 tRNA transcripts and testing their methyl group acceptance activities, it was demonstrated that this Trm1 protein has a novel tRNA specificity. Mass spectrometry analysis revealed that it catalyzes methyl transfers not only to G26 but also to G27 in substrate tRNA. Furthermore, it was confirmed that native tRNA(Cys) has an m(2)(2)G26m(2)G27 or m(2)(2)G26m(2)(2)G27 sequence, demonstrating that these modifications occur in living cells. Kinetic studies reveal that the m2G26 formation is faster than the m(2)G27 formation and that disruption of the G27-C43 base pair accelerates velocity of the G27 modification. Moreover, we prepared an additional 22 mutant tRNA transcripts and clarified that the recognition sites exist in the T-arm structure. This long distance recognition results in multisite recognition by the enzyme.

  9. Highly efficient incorporation of the fluorescent nucleotide analogs tC and tCO by Klenow fragment

    PubMed Central

    Sandin, Peter; Stengel, Gudrun; Ljungdahl, Thomas; Börjesson, Karl; Macao, Bertil; Wilhelmsson, L. Marcus


    Studies of the mechanisms by which DNA polymerases select the correct nucleotide frequently employ fluorescently labeled DNA to monitor conformational rearrangements of the polymerase–DNA complex in response to incoming nucleotides. For this purpose, fluorescent base analogs play an increasingly important role because they interfere less with the DNA–protein interaction than do tethered fluorophores. Here we report the incorporation of the 5′-triphosphates of two exceptionally bright cytosine analogs, 1,3-diaza-2-oxo-phenothiazine (tC) and its oxo-homolog, 1,3-diaza-2-oxo-phenoxazine (tCO), into DNA by the Klenow fragment. Both nucleotide analogs are polymerized with slightly higher efficiency opposite guanine than cytosine triphosphate and are shown to bind with nanomolar affinity to the DNA polymerase active site, according to fluorescence anisotropy measurements. Using this method, we perform competitive binding experiments and show that they can be used to determine the dissociation constant of any given natural or unnatural nucleotide. The results demonstrate that the active site of the Klenow fragment is flexible enough to tolerate base pairs that are size-expanded in the major groove. In addition, the possibility to enzymatically polymerize a fluorescent nucleotide with high efficiency complements the tool box of biophysical probes available to study DNA replication. PMID:19401439

  10. Highly efficient incorporation of the fluorescent nucleotide analogs tC and tCO by Klenow fragment.


    Sandin, Peter; Stengel, Gudrun; Ljungdahl, Thomas; Börjesson, Karl; Macao, Bertil; Wilhelmsson, L Marcus


    Studies of the mechanisms by which DNA polymerases select the correct nucleotide frequently employ fluorescently labeled DNA to monitor conformational rearrangements of the polymerase-DNA complex in response to incoming nucleotides. For this purpose, fluorescent base analogs play an increasingly important role because they interfere less with the DNA-protein interaction than do tethered fluorophores. Here we report the incorporation of the 5'-triphosphates of two exceptionally bright cytosine analogs, 1,3-diaza-2-oxo-phenothiazine (tC) and its oxo-homolog, 1,3-diaza-2-oxo-phenoxazine (tC(O)), into DNA by the Klenow fragment. Both nucleotide analogs are polymerized with slightly higher efficiency opposite guanine than cytosine triphosphate and are shown to bind with nanomolar affinity to the DNA polymerase active site, according to fluorescence anisotropy measurements. Using this method, we perform competitive binding experiments and show that they can be used to determine the dissociation constant of any given natural or unnatural nucleotide. The results demonstrate that the active site of the Klenow fragment is flexible enough to tolerate base pairs that are size-expanded in the major groove. In addition, the possibility to enzymatically polymerize a fluorescent nucleotide with high efficiency complements the tool box of biophysical probes available to study DNA replication.

  11. The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts

    PubMed Central

    Wyss, Laura A.; Nilforoushan, Arman; Williams, David M.; Marx, Andreas; Sturla, Shana J.


    Enzymatic approaches for locating alkylation adducts at single-base resolution in DNA could enable new technologies for understanding carcinogenesis and supporting personalized chemotherapy. Artificial nucleotides that specifically pair with alkylated bases offer a possible strategy for recognition and amplification of adducted DNA, and adduct-templated incorporation of an artificial nucleotide has been demonstrated for a model DNA adduct O6-benzylguanine by a DNA polymerase. In this study, DNA adducts of biological relevance, O6-methylguanine (O6-MeG) and O6-carboxymethylguanine (O6-CMG), were characterized to be effective templates for the incorporation of benzimidazole-derived 2′-deoxynucleoside-5′-O-triphosphates (BenziTP and BIMTP) by an engineered KlenTaq DNA polymerase. The enzyme catalyzed specific incorporation of the artificial nucleotide Benzi opposite adducts, with up to 150-fold higher catalytic efficiency for O6-MeG over guanine in the template. Furthermore, addition of artificial nucleotide Benzi was required for full-length DNA synthesis during bypass of O6-CMG. Selective incorporation of the artificial nucleotide opposite an O6-alkylguanine DNA adduct was verified using a novel 2′,3′-dideoxy derivative of BenziTP. The strategy was used to recognize adducts in the presence of excess unmodified DNA. The specific processing of BenziTP opposite biologically relevant O6-alkylguanine adducts is characterized herein as a basis for potential future DNA adduct sequencing technologies. PMID:27378785

  12. Crosslinking reactions of 4-amino-6-oxo-2-vinylpyrimidine with guanine derivatives and structural analysis of the adducts

    PubMed Central

    Kusano, Shuhei; Ishiyama, Shogo; Lam, Sik Lok; Mashima, Tsukasa; Katahira, Masato; Miyamoto, Kengo; Aida, Misako; Nagatsugi, Fumi


    DNA interstrand crosslinks (ICLs) are the primary mechanism for the cytotoxic activity of many clinical anticancer drugs, and numerous strategies for forming ICLs have been developed. One such method is using crosslink-forming oligonucleotides (CFOs). In this study, we designed a 4-amino-6-oxo-2-vinylpyrimidine (AOVP) derivative with an acyclic spacer to react selectively with guanine. The AOVP CFO exhibited selective crosslinking reactivity with guanine and thymine in DNA, and with guanine in RNA. These crosslinking reactions with guanine were accelerated in the presence of CoCl2, NiCl2, ZnCl2 and MnCl2. In addition, we demonstrated that the AOVP CFO was reactive toward 8-oxoguanine opposite AOVP in the duplex DNA. The structural analysis of each guanine and 8-oxoguanine adduct in the duplex DNA was investigated by high-resolution NMR. The results suggested that AOVP reacts at the N2 amine in guanine and at the N1 or N2 amines in 8-oxoguanine in the duplex DNA. This study demonstrated the first direct determination of the adduct structure in duplex DNA without enzyme digestion. PMID:26245348

  13. Lead(II)-catalyzed oxidation of guanine in solution studied with electrospray ionization mass spectrometry.


    Banu, Laura; Blagojevic, Voislav; Bohme, Diethard K


    The oxidation of guanine was investigated in water/methanol solution both in the absence and in the presence of Pb(II) with a variable temperature reactor coupled to a tandem mass spectrometer that allowed signature ions of solution reagents and products to be monitored by electrospray ionization (ESI). Two different oxidizing agents were employed, one strong (peroxymonosulfuric acid) and one weaker (hydrogen peroxide). Peroxymonosulfuric acid was observed to oxidize guanine rapidly at room temperature, k(app) > 10(-2) s(-1), whether in the absence or in the presence of Pb(II), to produce spiroiminohydantoin. Guanine did not show measurable oxidation by hydrogen peroxide in the absence of Pb(II) at concentrations of H(2)O(2) up to 1 M at temperatures up to 333 K (k(app) < 3 × 10(-8) s(-1) at 298 K), but in the presence of Pb(II), it was observed to produce both 5-carboxamido-5-formamido-2-iminohydantoin (2-Ih) and imidazolone (Iz) in a ratio of 2.3 ± 0.1 with a total rate enhancement of more than 4 × 10(3). The activation energy was measured to be 82 ± 11 kJ mol(-1) and is more than 120 kJ mol(-1) lower than that for the uncatalyzed oxidation with hydrogen peroxide measured to be at least 208 ± 26 kJ mol(-1). An activation energy of 113 ± 9 kJ mol(-1) has been reported by Bruskov et al. (Nucleic Acids Res.2002, 30, 1354) for the heat-induced oxidation by hydrogen peroxide of guanine embedded as guanosine in DNA which leads to the production of 8-oxo-7,8-dihydro-guanine (8-oxo-Gua). The atomic lead dication lowers the activation energy by activating the hydrogen peroxide oxidant, possibly by O-O bond activation, and by directing the oxidation, possibly through coordination to the functional groups adjacent to the carbon C5: the C6 carbonyl group and the N7 nitrogen. The coupling of tandem mass spectrometry (MS(2)) with a simple variable temperature reactor by ESI proved to be very effective for measuring reaction kinetics and activation energies in solution

  14. Single-nucleotide patch base excision repair of uracil in DNA by mitochondrial protein extracts.


    Stierum, R H; Dianov, G L; Bohr, V A


    Mammalian mitochondria contain several 16.5 kb circular DNAs (mtDNA) encoding electron transport chain proteins. Reactive oxygen species formed as byproducts from oxidative phosphorylation in these organelles can cause oxidative deamination of cytosine and lead to uracil in mtDNA. Upon mtDNA replication, these lesions, if unrepaired, can lead to mutations. Until recently, it was thought that there was no DNA repair in mitochondria, but lately there is evidence that some lesions are efficiently repaired in these organelles. In the study of nuclear DNA repair, the in vitro repair measurements in cell extracts have provided major insights into the mechanisms. The use of whole-cell extract based DNA repair methods has revealed that mammalian nuclear base excision repair (BER) diverges into two pathways: the single-nucleotide replacement and long patch repair mechanisms. Similar in vitro methods have not been available for the study of mitochondrial BER. We have established an in vitro DNA repair system supported by rat liver mitochondrial protein extract and DNA substrates containing a single uracil opposite to a guanine. Using this approach, we examined the repair pathways and the identity of the DNA polymerase involved in mitochondrial BER (mtBER). Employing restriction analysis of in vitro repaired DNA to map the repair patch size, we demonstrate that only one nucleotide is incorporated during the repair process. Thus, in contrast to BER in the nucleus, mtBER of uracil in DNA is solely accomplished by single-nucleotide replacement.

  15. A role for adenine nucleotides in the sensing mechanism to purine starvation in Leishmania donovani.


    Martin, Jessica L; Yates, Phillip A; Boitz, Jan M; Koop, Dennis R; Fulwiler, Audrey L; Cassera, Maria Belen; Ullman, Buddy; Carter, Nicola S


    Purine salvage by Leishmania is an obligatory nutritional process that impacts both cell viability and growth. Previously, we have demonstrated that the removal of purines in culture provokes significant metabolic changes that enable Leishmania to survive prolonged periods of purine starvation. In order to understand how Leishmania sense and respond to changes in their purine environment, we have exploited several purine pathway mutants, some in which adenine and guanine nucleotide metabolism is uncoupled. While wild type parasites grow in any one of a variety of naturally occurring purines, the proliferation of these purine pathway mutants requires specific types or combinations of exogenous purines. By culturing purine pathway mutants in high levels of extracellular purines that are either permissive or non-permissive for growth and monitoring for previously defined markers of the adaptive response to purine starvation, we determined that adaptation arises from a surveillance of intracellular purine nucleotide pools rather than from a direct sensing of the extracellular purine content of the environment. Specifically, our data suggest that perturbation of intracellular adenine-containing nucleotide pools provides a crucial signal for inducing the metabolic changes necessary for the long-term survival of Leishmania in a purine-scarce environment. © 2016 John Wiley & Sons Ltd.

  16. Imbalance of purine nucleotides in alanosine-resistant baby hamster kidney cells.


    Pang, J C; Du, R P; Bingham, H; Juranka, P; Chan, V L


    Human DNA was used to transform adenosine kinase (AK)-deficient BHK cells followed by selection of AK+ cells in medium containing alanosine, adenosine, and uridine (AAU medium). Twenty AAUr isolates were analyzed, and none of them contained AK activity. Several purine salvage enzymes were, however, found to be affected in these cells. The levels of hypoxanthine-guanine phosphoribosyltransferase and adenylosuccinate synthetase activities were elevated, while the adenylosuccinase activity was reduced. AAU-resistance may be explained by elevated activity of adenylosuccinate synthetase to overcome the alanosine block; thus AAUr cells were able to convert exogenous adenosine----inosine----hypoxanthine----IMP----AMPS----AMP. Moreover, these AAUr cells required exogenous purines for growth. HPLC analyses of endogenous nucleotide pools of AAUr cells showed that the levels of adenine nucleotides have diminished to less than 10% of the parental levels. These results suggest that the AAU-resistant mutation, which elicits pleiotropic phenotypes in BHK cells, affects an important component in the regulation of adenine nucleotide synthesis. By including erthyro-9-(2-hydroxy-3-nonyl)adenine in the AAU medium (renamed as AAUE medium) to block deamination of adenosine, AK+ BHK cells were isolated.

  17. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition

    PubMed Central

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  18. Bromination of deoxycytidine by eosinophil peroxidase: A mechanism for mutagenesis by oxidative damage of nucleotide precursors

    PubMed Central

    Henderson, Jeffrey P.; Byun, Jaeman; Williams, Michelle V.; McCormick, Michael L.; Parks, William C.; Ridnour, Lisa A.; Heinecke, Jay W.


    Oxidants generated by eosinophils during chronic inflammation may lead to mutagenesis in adjacent epithelial cells. Eosinophil peroxidase, a heme enzyme released by eosinophils, generates hypobromous acid that damages tissue in inflammatory conditions. We show that human eosinophils use eosinophil peroxidase to produce 5-bromodeoxycytidine. Flow cytometric, immunohistochemical, and mass spectrometric analyses all demonstrated that 5-bromodeoxycytidine generated by eosinophil peroxidase was taken up by cultured cells and incorporated into genomic DNA as 5-bromodeoxyuridine. Although previous studies have focused on oxidation of chromosomal DNA, our observations suggest another mechanism for oxidative damage of DNA. In this scenario, peroxidase-catalyzed halogenation of nucleotide precursors yields products that subsequently can be incorporated into DNA. Because the thymine analog 5-BrUra mispairs with guanine in DNA, generation of brominated pyrimidines by eosinophils might constitute a mechanism for cytotoxicity and mutagenesis at sites of inflammation. PMID:11172002

  19. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution.


    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi; Fujii, Kentaro; Yokoya, Akinari; Fukuda, Yoshihiro; Saitoh, Yuji


    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5'-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5'-monophosphate, and adenosine 5'-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  20. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael


    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  1. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael


    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  2. Applications of adenine nucleotide measurements in oceanography

    NASA Technical Reports Server (NTRS)

    Holm-Hansen, O.; Hodson, R.; Azam, F.


    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  3. Increased mobility and on/off ratio in organic field-effect transistors using low-cost guanine-pentacene multilayers

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Taylor, André D.; Yu, Junsheng; Katz, Howard E.


    Layer-by-layer deposited guanine and pentacene in organic field-effect transistors (OFETs) is introduced. Through adjusting the layer thickness ratio of guanine and pentacene, the tradeoff of two electronic parameters in OFETs, charge carrier mobility and current on/off ratio, was controlled. The charge mobility was enhanced by depositing pentacene over and between guanine layers and by increasing the proportion of pentacene in the layer-by-layer system, while the current on/off ratio was increased via the decreased off current induced by the guanine layers. The tunable device performance was mainly ascribed to the trap and dopant neutralizing properties of the guanine layers, which would decrease the density of free hydroxyl groups in the OFETs. Furthermore, the cost of the devices could be reduced remarkably via the adoption of low-cost guanine.

  4. RhoA Phosphorylation Induces Rac1 Release from Guanine Dissociation Inhibitor α and Stimulation of Vascular Smooth Muscle Cell Migration▿

    PubMed Central

    Rolli-Derkinderen, Malvyne; Toumaniantz, Gilles; Pacaud, Pierre; Loirand, Gervaise


    Although overactivation of RhoA is recognized as a common component of vascular disorders, the molecular mechanisms regulating RhoA activity in vascular smooth muscle cells (VSMC) are still unclear. We have previously shown that in VSMC, RhoA is phosphorylated on Ser188 by nitric oxide (NO)-stimulated cGMP-dependent kinase (PKG), which leads to RhoA-Rho kinase pathway inhibition. In this study, we showed that expression of phosphoresistant RhoA mutants prevented the stimulation of VSMC migration and adhesion induced by NO-PKG pathway activation. In contrast, under basal conditions, phosphomimetic RhoA mutants stimulated VSMC adhesion and migration through a signaling pathway requiring Rac1 and the Rho exchange factor Vav3. RhoA phosphorylation or phosphomimetic RhoA mutants induced Rac1 activation but did not activate Vav3. Indeed, phosphorylated RhoA or phosphomimetic mutants trapped guanine dissociation inhibitor α (GDIα), leading to the release of Rac1 and its translocation to the membrane, where it was then activated by the basal Vav3 nucleotide exchange activity. In vivo, RhoA phosphorylation induced by PKG activation in the aortas of rats treated with sildenafil induced dissociation of Rac1 from GDIα and activation of the Rac1 signaling pathway. These results suggest that the phosphorylation of RhoA represents a novel potent and physiological GDIα displacement factor that leads to Rac1 activation and regulation of Rac1-dependent VSMC functions. PMID:20696841

  5. Drosophila RhoGEF4 encodes a novel RhoA-specific guanine exchange factor that is highly expressed in the embryonic central nervous system.


    Nahm, Minyeop; Lee, Mihye; Baek, Seung-Hak; Yoon, Jin-Ho; Kim, Hong-Hee; Lee, Zang Hee; Lee, Seungbok


    Rho family small GTPases act as molecular switches that regulate neuronal morphogenesis, including axon growth and guidance, dendritic spine formation, and synapse formation. These proteins are positively regulated by guanine nucleotide exchange factors (GEFs) of the Dbl family. This study describes the identification and characterization of Drosophila RhoGEF4 (DRhoGEF4), a novel Dbl family protein that is specifically expressed in the central nervous system during Drosophila embryogenesis. The predicted amino acid sequence of DRhoGEF4 contains a Dbl homology (DH) domain and an adjacent C-terminal pleckstrin homology (PH) domain, which are most closely related to those of mammalian frabins. In this study, the DH-PH motif is shown to enhance the dissociation of GDP from either RhoA or Rac1 but not from Cdc42 in vitro. In addition, p21-binding domain pull-down assays demonstrate that DRhoGEF4 activates RhoA, but neither Rac1 nor Cdc42 in HEK293 cells. Finally, overexpression of DRhoGEF4 is able to induce assembly of stress fibers in cultured NIH3T3 cells. Taken together, these findings suggest that DRhoGEF4 may participate in cytoskeleton-related cellular events by specifically activating RhoA in neuronal morphogenesis.

  6. European Nucleotide Archive in 2016

    PubMed Central

    Toribio, Ana Luisa; Alako, Blaise; Amid, Clara; Cerdeño-Tarrága, Ana; Clarke, Laura; Cleland, Iain; Fairley, Susan; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Martínez-Villacorta, Josué; Pakseresht, Nima; Rajan, Jeena; Reddy, Kethi; Rosello, Marc; Silvester, Nicole; Smirnov, Dmitriy; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy


    The European Nucleotide Archive (ENA; offers a rich platform for data sharing, publishing and archiving and a globally comprehensive data set for onward use by the scientific community. With a broad scope spanning raw sequencing reads, genome assemblies and functional annotation, the resource provides extensive data submission, search and download facilities across web and programmatic interfaces. Here, we outline ENA content and major access modalities, highlight major developments in 2016 and outline a number of examples of data reuse from ENA. PMID:27899630

  7. Effect of 10-T magnetic fields on structural colors in guanine crystals of fish scales

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Miyashita, Y.; Kudo, M.; Kurita, S.; Owada, N.


    This work reports the magnetically modulated structural colors in the chromatophore of goldfish scales under static magnetic fields up to 10 T. A fiber optic system for spectroscopy measurements and a CCD microscope were set in the horizontal bore of a 10-T superconducting magnet. One leaf of a fish scale was set in a glass chamber, exposed to visible light from its side direction, and then static magnetic fields were applied perpendicular to the surface of the scale. In addition, an optical fiber for spectroscopy was directed perpendicular to the surface. During the magnetic field sweep-up, the aggregate of guanine thin plates partially showed a rapid light quenching under 0.26 to 2 T; however, most of the thin plates continued to scatter the side-light and showed changing iridescence, which was displayed individually by each