Sample records for 1balpha guanine nucleotides

  1. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.


    Lane, B Josh; Mutchler, Charla; Al Khodor, Souhaila; Grieshaber, Scott S; Carabeo, Rey A


    Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein). TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs), Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K), appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  2. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    SciTech Connect

    Boulias, C.; Moscarello, M.A. )


    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides.

  3. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E


    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  4. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  5. Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.


    Chardin, P; Camonis, J H; Gale, N W; van Aelst, L; Schlessinger, J; Wigler, M H; Bar-Sagi, D


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1.

  6. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    SciTech Connect

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.


    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated with 1 pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.

  7. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  8. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    PubMed Central

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5′-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches. PMID:26558346

  9. Thiol-modifying phenylarsine oxide inhibits guanine nucleotide binding of Rho but not of Rac GTPases.


    Gerhard, Ralf; John, Harald; Aktories, Klaus; Just, Ingo


    Phenylarsine oxide (PAO) is a phosphotyrosine phosphatase inhibitor that cross-links vicinal thiol groups, thereby inactivating phosphatases possessing XCysXXCysX motifs. The RhoA-GTPase, but not the Rac1-GTPase, also possesses vicinal cysteines within the guanine nucleotide-binding region (aa 13-20) and the phosphohydrolase activity site. Treatment of Caco-2 cells with PAO showed a dose-dependent reorganization of the actin cytoskeleton, indicating involvement of Rho GTPases. As tested by pull-down experiments, RhoA, but not Rac1, from cell lysates was inactivated by PAO in a concentration-dependent manner. Modification of RhoA by PAO resulted in altered mobility on SDS-polyacrylamide gel electrophoresis, and PAO-modified RhoA was no longer substrate for C3-catalyzed ADP-ribosylation. Furthermore, RhoA treated with PAO, but not Rac1 treated with PAO, lost its property to bind to guanine nucleotides. Matrix-assisted laser desorption ionization-mass analysis of PAO-modified RhoA showed a mass shift according to an adduction of a single PAO molecule per molecule RhoA. Further analysis of Glu-C-generated RhoA peptides confirmed binding of PAO to a peptide harboring the guanine nucleotide binding region. Thus, PAO does not exclusively inhibit phosphotyrosine phosphatases but also inactivates RhoA by alteration of nucleotide binding.

  10. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    SciTech Connect

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.


    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity (/sup 3/H)fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity (/sup 3/H)fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils.

  11. Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic intellectual disability

    PubMed Central

    Shoubridge, Cheryl; Tarpey, Patrick S; Abidi, Fatima; Ramsden, Sarah L; Rujirabanjerd, Sinitdhorn; Murphy, Jessica A; Boyle, Jackie; Shaw, Marie; Gardner, Alison; Proos, Anne; Puusepp, Helen; Raymond, F Lucy; Schwartz, Charles E; Stevenson, Roger E; Turner, Gill; Field, Michael; Walikonis, Randall S; Harvey, Robert J; Hackett, Anna; Futreal, P Andrew; Stratton, Michael R; Gécz, Jozef


    The first family identified as having a nonsyndromic intellectual disability was mapped in 1988. Here we show that a mutation of IQSEC2, encoding a guanine nucleotide exchange factor for the ADP-ribosylation factor family of small GTPases, caused this disorder. In addition to MRX1, IQSEC2 mutations were identified in three other families with X-linked intellectual disability. This discovery was made possible by systematic and unbiased X chromosome exome resequencing. PMID:20473311

  12. Guanine nucleotide-induced polymerization of actin in electropermeabilized human neutrophils

    PubMed Central


    The effects of exogenous guanine nucleotides on the polymerization of actin in human neutrophils were tested in an electropermeabilized cell preparation. Close to 40% permeabilization was achieved with a single electric discharge as measured by nucleic acid staining with ethidium bromide or propidium iodide with minimal (less than 2%) release of the cytoplasmic marker lactate dehydrogenase. In addition, electropermeabilized neutrophils retained their capacity to produce superoxide anions and to sustain a polymerization of actin in response to surface-receptor dependent stimuli such as chemotactic factors. Electropermeabilization produced a rapid and transient permeabilization that allowed the entry of guanine nucleotides into the cells. GTP and, to a larger extent, its nonhydrolyzable analog guanosine 5'-O-2- thiotriphosphate (GTP[S]), induced a time- and concentration-dependent polymerization of actin, as determined by increased staining with 7- nitrobenz-2-oxa-1,3-diazolylphallacidin. The effects of the aforementioned guanine nucleotides were antagonized by GDP[S], but were insensitive to pertussis toxin. Cholera toxin potentiated to a small degree the amount of actin polymerization induced by GTP[S]. These results provided direct evidence for the involvement of GTP-binding proteins in the regulation of the organization of the cytoskeleton of neutrophils, an event that is of crucial importance to the performance of the defense-oriented functions of these cells. PMID:2768336

  13. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.


    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  14. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    SciTech Connect

    Edenbrandt, C.M.; Murphy, S. )


    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation.

  15. Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

    PubMed Central

    Murray, D W; Didier, S; Chan, A; Paulino, V; Van Aelst, L; Ruggieri, R; Tran, N L; Byrne, A T; Symons, M


    Background: Glioblastoma multiforme (GBM), a highly invasive primary brain tumour, remains an incurable disease. Rho GTPases and their activators, guanine nucleotide exchange factors (GEFs), have central roles in GBM invasion. Anti-angiogenic therapies may stimulate GBM invasion via HGF/c-Met signalling. We aim to identify mediators of HGF-induced GBM invasion that may represent targets in a combination anti-angiogenic/anti-invasion therapeutic paradigm. Methods: Guanine nucleotide exchange factor expression was measured by microarray analysis and western blotting. Specific depletion of proteins was accomplished using siRNA. Cell invasion was determined using matrigel and brain slice assays. Cell proliferation and survival were monitored using sulforhodamine B and colony formation assays. Guanine nucleotide exchange factor and GTPase activities were determined using specific affinity precipitation assays. Results: We found that expression of Dock7, a GEF, is elevated in human GBM tissue in comparison with non-neoplastic brain. We showed that Dock7 mediates serum- and HGF-induced glioblastoma cell invasion. We also showed that Dock7 co-immunoprecipitates with c-Met and that this interaction is enhanced upon HGF stimulation in a manner that is dependent on the adaptor protein Gab1. Dock7 and Gab1 also co-immunoprecipitate in an HGF-dependent manner. Furthermore, Gab1 is required for HGF-induced Dock7 and Rac1 activation and glioblastoma cell invasion. Conclusions: Dock7 mediates HGF-induced GBM invasion. Targeting Dock7 in GBM may inhibit c-MET-mediated invasion in tumours treated with anti-angiogenic regimens. PMID:24518591

  16. Interactions of. beta. -adrenergic receptors with guanine nucleotide-binding proteins

    SciTech Connect

    Abramson, S.N.


    The properties of ..beta..-adrenergic receptors were investigated with radioligand binding assays using the agonists (/sup 3/H)hydroxybenzyl-isoproterenol (/sup 3/H-HBI) and (/sup 3/H)epinephrine (/sup 3/H-EPI), and the antagonist (/sup 125/I)iodopindolol (/sup 125/I-IPIN). Membranes prepared from L6 myoblasts bound (/sup 3/H)HBI, (/sup 3/H)EPI, and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 222 +/- 23, 111 +/- 7, and 325 +/- 37 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI and (/sup 3/H)EPI was inhibited allosterically by guanine nucleotides. Membranes prepared from wild-type S49 lymphoma cells bound (/sup 3/H)HBI and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 48.9 +/- 7.1 and 196 +/- 29 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI was inhibited allosterically by GTP. Similar results were obtained with membranes prepared from the adenylate cyclase deficient variant of S49 lymphoma cells (cyc-), which does not contain a functional stimulatory guanine nucleotide-binding protein (N/sub s/), but does contain a functional inhibitory guanine nucleotide-binding protein (N/sub i/). Binding of (/sup 3/H)HBI to membranes prepared from cyc- S49 cells was inhibited by pretreatment of cells with pertussis toxin. These results suggest that ..beta..-adrenergic receptors on membranes prepared from cyc- S49 cells interact with N/sub i/ to form a ternary complex composed of agonist, receptor, and N/sub i/.

  17. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad


    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  18. Human Rho Guanine Nucleotide Exchange Factor 11 (ARHGEF11) Regulates Dendritic Morphogenesis

    PubMed Central

    Mizuki, Yutaka; Takaki, Manabu; Sakamoto, Shinji; Okamoto, Sojiro; Kishimoto, Makiko; Okahisa, Yuko; Itoh, Masahiko; Yamada, Norihito


    Disturbances of synaptic connectivity during perinatal and adolescent periods have been hypothesized to be related to the pathophysiology of schizophrenia. Rho guanine nucleotide exchange factor 11 (ARHGEF11) is a specific guanine nucleotide exchange factors (GEF) for RhoA, which is a critical regulator of actin cytoskeleton dynamics and organization of dendritic spines and inhibitor of spine maintenance. ARHGEF11 variants are reported to be associated with a higher risk for the onset of schizophrenia in a Japanese population; however, how ARHGEF11 contributes to the pathogenesis of schizophrenia in dendritic spines is unknown. Therefore, we first studied the distribution, binding, and function of ARHGEF11 in the dendritic spines of the rat cerebral cortex. After subcellular fractionation of the rat cerebral cortex, ARHGEF11 was detected with synaptophysin and post-synaptic density protein 95 (PSD-95) in the P2 fractions including synaptosomal fractions containing presynaptic and postsynaptic density proteins. Endogenous ARHGEF11 was coimmunoprecipitated with synaptophysin or PSD-95. In cortical primary neurons at 28 days in vitro, immunostaining revealed that ARHGEF11 located in the dendrites and dendritic spines and colocalized with PSD-95 and synaptophysin. Overexpression of exogenous ARHGEF11 significantly decreased the number of spines (p = 0.008). These results indicate that ARHGEF11 is likely to be associated with synaptic membranes and regulation of spine. PMID:28036092

  19. Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy?


    Lazer, Galit; Katzav, Shulamit


    Rho guanosine triphosphatases (GTPases) are a family of small proteins which function as molecular switches in a variety of signaling pathways following stimulation of cell surface receptors. RhoGTPases regulate numerous cellular processes including cytoskeleton organization, gene transcription, cell proliferation, migration, growth and cell survival. Because of their central role in regulating processes that are dysregulated in cancer, it seems reasonable that defects in the RhoGTPase pathway may be involved in the development of cancer. RhoGTPase activity is regulated by a number of protein families: guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs) and guanine nucleotide-dissociation inhibitors (GDIs). This review discusses the participation of RhoGTPases and their regulators, especially GEFs in human cancers. In particular, we focus on the involvement of the RhoGTPase GEF, Vav1, a hematopoietic specific signal transducer which is involved in human neuroblastoma, pancreatic ductal carcinoma and lung cancer. Finally, we summarize recent advances in the design and application of a number of molecules that specifically target individual RhoGTPases or their regulators or effectors, and discuss their potential for cancer therapy.

  20. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.


    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  1. Cytosolic Na+ controls and epithelial Na+ channel via the Go guanine nucleotide-binding regulatory protein.

    PubMed Central

    Komwatana, P; Dinudom, A; Young, J A; Cook, D I


    In tight Na+-absorbing epithelial cells, the fate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-beta-S, pertussis toxin, and antibodies against the alpha-subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-. Images Fig. 4 PMID:8755611

  2. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    SciTech Connect

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. )


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  3. Recognition and activation of Rho GTPases by Vav1 and Vav2 guanine nucleotide exchange factors.


    Heo, Jongyun; Thapar, Roopa; Campbell, Sharon L


    Vav proteins are Rho GTPase-specific guanine nucleotide exchange factors (GEFs) that are distinguished by the tandem arrangement of Dbl homology (DH), Pleckstrin homology (PH), and cysteine rich domains (CRD). Whereas the tandem DH-PH arrangement is conserved among Rho GEFs, the presence of the CRD is unique to Vav family members and is required for efficient nucleotide exchange. We provide evidence that Vav2-mediated nucleotide exchange of Rho GTPases follows the Theorell-Chance mechanism in which the Vav2.Rho GTPase complex is the major species during the exchange process and the Vav2.GDP-Mg(2+).Rho GTPase ternary complex is present only transiently. The GTPase specificity for the DH-PH-CRD Vav2 in vitro follows this order: Rac1 > Cdc42 > RhoA. Results obtained from fluorescence anisotropy and NMR chemical shift mapping experiments indicate that the isolated Vav1 CRD is capable of directly associating with Rac1, and residues K116 and S83 that are in the proximity of the P-loop and the guanine base either are part of this binding interface or undergo a conformational change in response to CRD binding. The NMR studies are supported by kinetic measurements on Rac1 mutants S83A, K116A, and K116Q and Vav2 CRD mutant K533A in that these mutants affect both the initial binding event of Vav2 with Rac1 (k(on)) and the rate-limiting dissociation of Vav2 from the Vav2.Rac1 binary complex (thereby influencing the enzyme turnover number, k(cat)). The results suggest that the CRD domain in Vav proteins plays an active role, affecting both the k(on) and the k(cat) for Vav-mediated nucleotide exchange on Rho GTPases.

  4. Base and Nucleotide Excision Repair of Oxidatively Generated Guanine Lesions in DNA.


    Shafirovich, Vladimir; Kropachev, Konstantin; Anderson, Thomas; Liu, Zhi; Kolbanovskiy, Marina; Martin, Brooke D; Sugden, Kent; Shim, Yoonjung; Chen, Xuejing; Min, Jung-Hyun; Geacintov, Nicholas E


    The well known biomarker of oxidative stress, 8-oxo-7,8-dihydroguanine, is more susceptible to further oxidation than the parent guanine base and can be oxidatively transformed to the genotoxic spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) lesions. Incubation of 135-mer duplexes with single Sp or Gh lesions in human cell extracts yields a characteristic nucleotide excision repair (NER)-induced ladder of short dual incision oligonucleotide fragments in addition to base excision repair (BER) incision products. The ladders were not observed when NER was inhibited either by mouse monoclonal antibody (5F12) to human XPA or in XPC(-/-) fibroblast cell extracts. However, normal NER activity appeared when the XPC(-/-) cell extracts were complemented with XPC-RAD23B proteins. The Sp and Gh lesions are excellent substrates of both BER and NER. In contrast, 5-guanidino-4-nitroimidazole, a product of the oxidation of guanine in DNA by peroxynitrite, is an excellent substrate of BER only. In the case of mouse embryonic fibroblasts, BER of the Sp lesion is strongly reduced in NEIL1(-/-) relative to NEIL1(+/+) extracts. In summary, in human cell extracts, BER and NER activities co-exist and excise Gh and Sp DNA lesions, suggesting that the relative NER/BER product ratios may depend on competitive BER and NER protein binding to these lesions.

  5. Synaptic functions of the IQSEC family of ADP-ribosylation factor guanine nucleotide exchange factors.


    Um, Ji Won


    Postsynaptic scaffolding proteins interact with numerous synaptic proteins to ensure the organization and specialization of functional excitatory and inhibitory synapses. IQSECs (IQ motif and SEC7 domain-containing proteins) are a class of ADP ribosylation factor-guanine nucleotide exchange factors (ARF-GEFs), whose functions are beginning to be understood as both scaffolding and signaling proteins. Specifically, IQSEC1 binds to PSD-95, and IQSEC2 functions as a regulator of AMPA receptor trafficking at excitatory synapses, whereas IQSEC3 interacts with gephyrin to promote inhibitory synapse development. Here, I review the currently known findings on IQSECs and discuss the possible relations between dysfunctions of IQSECs and the pathophysiology of brain disorders.

  6. Guanine nucleotide binding properties of the mammalian RalA protein produced in Escherichia coli.


    Frech, M; Schlichting, I; Wittinghofer, A; Chardin, P


    The simian ralA cDNA was inserted in a ptac expression vector, and high amounts of soluble ral protein were expressed in Escherichia coli. The purified p24ral contains 1 mol of bound nucleotide/mol of protein that can be exchanged against external nucleotide. The ral protein exchanges GDP with a t 1/2 of 90 min at 37 degrees C in the presence of Mg2+, and has a low GTPase activity (0.07 min-1 at 37 degrees C). We have also studied its affinity for various guanine nucleotides and analogs. NMR measurements show that the three-dimensional environment around the nucleotide is similar in p21ras and p24ral. In addition to these studies on the wild-type ral protein, we used in vitro mutagenesis to introduce substitutions corresponding to the Val12, Val12 + Thr59, and Leu61 substitutions of p21ras. These mutant ral proteins display altered nucleotide exchange kinetics and GTPase activities, however, the effects of the substitutions are less pronounced than in the ras proteins. p24ralVal12 + Thr59 autophosphorylates on the substituted Thr, as a side reaction of the GTP hydrolysis, but the rate is much lower than those of the Thr59 mutants of p21ras. These results show that ras and ral proteins have similar structures and biochemical properties. Significant differences are found, however, in the contribution of the Mg2+ ion to GDP binding, in the rate of the GTPase reaction and in the sensitivity of these two proteins to substitutions around the phosphate-binding site, suggesting that the various "small G-proteins" of the ras family perform different functions.

  7. Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

    SciTech Connect

    Senogles, S.E.; Caron, M.G.


    The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 NPA. /sup 35/S-GTP..gamma..S binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.

  8. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.


    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  9. Guanine nucleotide regulation of receptor binding of thyrotropin-releasing hormone (TRH) in rat brain regions, retina and pituitary.


    Sharif, N A; Burt, D R


    Guanine nucleotides inhibited the specific binding of [3H](3-Me-His2)thyrotropin-releasing hormone ([3H]MeTRH) to receptors for TRH in washed homogenates of rat anterior pituitary gland in a dose-related manner. The order of potency (at 100 and 500 microM final) was Gpp(NH)p (a stable analog of GTP) greater than GTP much greater than GDP much greater than cGMP (with the adenine nucleotides being inactive) in the pituitary and various brain regions. Gpp(NH)p at 1 mM caused 17-35% inhibition of [3H]MeTRH binding to different tissues including the pituitary, hypothalamus, retina and nucleus accumbens. A statistically significant nucleotide effect was not observed, however, in the olfactory bulb and medulla/pons membranes. Gpp(NH)p (1 mM) increased the dissociation constants for [3H]MeTRH binding by 1.9- to 2.4-fold in the pituitary, n. accumbens and retinal preparations without altering the apparent binding capacity. These data suggest that TRH receptor binding can be allosterically regulated by guanine nucleotides and provide further evidence for the existence of guanine nucleotide binding protein(s) coupled to the TRH receptor.

  10. Molecular mechanism of the effects of guanine nucleotide and sulfhydryl reagent on muscarinic receptors in smooth muscles studied by radiation inactivation

    SciTech Connect

    Uchida, S.; Matsumoto, K.; Takeyasu, K.; Higuchi, H.; Yoshida, H.


    The molecular sizes of the units concerned in 3-quinuclidinyl benzilate (QNB) binding and in the effects of guanine nucleotide and sulfhydryl reagent on the inhibition of QNB binding by carbachol in smooth muscle of guinea pig ileum were determined to be 76,000, 179,000 and 107,000, respectively by the radiation inactivation method. One or more subunits (GTP subunit) other than the receptor subunit in a muscarinic receptor appeared to be involved in the effect of guanine nucleotide. When guanine nucleotide was present, the receptor subunit seemed to be dissociated from the GTP subunit.

  11. Influence of gamma subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes.

    PubMed Central

    Muntz, K H; Sternweis, P C; Gilman, A G; Mumby, S M


    Two approaches were taken to address the possible role of gamma-subunit prenylation in dictating the cellular distribution of guanine nucleotide-binding regulatory proteins. Prenylation of gamma subunits was prevented by site-directed mutagenesis or by inhibiting the synthesis of mevalonate, the precursor of cellular isoprenoids. When beta or gamma subunits were transiently expressed in COS-M6 simian kidney cells (COS) cells, the proteins were found in the membrane fraction by immunoblotting. Immunofluorescence experiments indicated that the proteins were distributed to intracellular structures in addition to plasma membranes. Replacement of Cys68 of gamma with Ser prevented prenylation of the mutant protein and association of the protein with the membrane fraction of COS cells. Immunoblotting results demonstrated that some of the beta subunits were found in the cytoplasm when coexpressed with the nonprenylated mutant gamma subunit. When Neuro 2A cells were treated with compactin to inhibit protein prenylation, a fraction of endogenous beta and gamma was distributed in the cytoplasm. It is concluded that prenylation facilitates association of gamma subunits with membranes, that the cellular location of gamma influences the distribution of beta, and that prenylation is not an absolute requirement for interaction of beta and gamma. Images PMID:1550955

  12. Guanine and inosine nucleotides, nucleosides and oxypurines in snail muscles as potential biomarkers of fluoride toxicity.


    Rać, Monika E; Safranow, Krzysztof; Dołegowska, Barbara; Machoy, Zygmunt


    The aim of the present study was to determine the toxicity of fluorides on energy metabolism in muscles of the Helix aspersa maxima snail. Qualitative and quantitative analysis of purine compounds was performed in slices of foot from mature snails with high-performance liquid chromatography. Fluoride concentrations were measured using an ion-selective electrode and gas chromatography. The results show that exposure to fluoride pollution was accompanied by a statistically significant increase in fluoride concentrations in soft tissues. This effect was already noticeable with the smallest fluoride dose. Accumulation was greatest in the shell. There is a significant and positive correlation between fluoride concentrations in foot muscles and guanine and inosine nucleotides or uridine content. The content of low-energy guanylate, inosylate and oxypurine in foot muscles significantly increased with rising dose of fluoride. The difference as compared with controls was significant only for the highest dose of fluoride. Interestingly, uric acid, the final product of purine catabolism, dominated quantitatively in the foot muscles of snails. In conclusion, increased low-energy guanylate and inosylate as well as decreased xanthine concentrations in snail muscle can be indicators of the toxic influence of fluoride on the organism. The measuring of fluoride accumulation in the shell is the most suitable bioindicator of fluoride pollution in the environment.

  13. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.


    Côté, Jean-François; Vuori, Kristiina


    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  14. How not to do kinetics: examples involving GTPases and guanine nucleotide exchange factors.


    Goody, Roger S


    Guanine nucleotide exchange factors (GEFs) are crucial regulators of the action of GTPases in signal transduction and cellular regulation. Although their basic mechanism of action has been apparent for almost 20 years, there are still misconceptions concerning their properties, and these are confounded by superficial or incorrect interpretation of experimental results in individual cases. Here, an example is described in which an incorrect mechanism was derived because of an inadequate analysis of kinetic results. In a second example, a case is discussed where certain GTP analogs were erroneously described as being able to function as low molecular mass GEFs. In both cases, a lack of distinction between rates, rate constants, and apparent rate constants, together with a disregard of relative signal amplitudes, led to the misinterpretations. In a final example, it is shown how the lack of an appropriate kinetic investigation led to the false conclusion that a secreted protein from Legionella pneumophila can act not only as a GEF towards eukaryotic Rab1 but also as a factor that is able to actively dissociate the stable complex between Rab1 and GDP dissociation inhibitor.

  15. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy


    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  16. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.


    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen


    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  17. The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis

    PubMed Central

    Kroon, Jeffrey; Welch, Christopher; Bakker, Erik N.; Matlung, Hanke L.; van den Berg, Timo K.; Sharek, Lisa; Doerschuk, Claire; Hahn, Klaus; Burridge, Keith


    The passage of leukocytes across the endothelium and into arterial walls is a critical step in the development of atherosclerosis. Previously, we showed in vitro that the RhoG guanine nucleotide exchange factor SGEF (Arhgef26) contributes to the formation of ICAM-1-induced endothelial docking structures that facilitate leukocyte transendothelial migration. To further explore the in vivo role of this protein during inflammation, we generated SGEF-deficient mice. When crossed with ApoE null mice and fed a Western diet, mice lacking SGEF showed a significant decrease in the formation of atherosclerosis in multiple aortic areas. A fluorescent biosensor revealed local activation of RhoG around bead-clustered ICAM-1 in mouse aortic endothelial cells. Notably, this activation was decreased in cells from SGEF-deficient aortas compared to wild type. In addition, scanning electron microscopy of intimal surfaces of SGEF−/− mouse aortas revealed reduced docking structures around beads that were coated with ICAM-1 antibody. Similarly, under conditions of flow, these beads adhered less stably to the luminal surface of carotid arteries from SGEF−/− mice. Taken together, these results show for the first time that a Rho-GEF, namely SGEF, contributes to the formation of atherosclerosis by promoting endothelial docking structures and thereby retention of leukocytes at athero-prone sites of inflammation experiencing high shear flow. SGEF may therefore provide a novel therapeutic target for inhibiting the development of atherosclerosis. PMID:23372835

  18. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma

    PubMed Central

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai


    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery. PMID:27462139

  19. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.


    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo


    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  20. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )


    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  1. Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.


    Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R


    Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented.

  2. Genetic interactions in yeast between Ypt GTPases and Arf guanine nucleotide exchangers.

    PubMed Central

    Jones, S; Jedd, G; Kahn, R A; Franzusoff, A; Bartolini, F; Segev, N


    Two families of GTPases, Arfs and Ypt/rabs, are key regulators of vesicular transport. While Arf proteins are implicated in vesicle budding from the donor compartment, Ypt/rab proteins are involved in the targeting of vesicles to the acceptor compartment. Recently, we have shown a role for Ypt31/32p in exit from the yeast trans-Golgi, suggesting a possible function for Ypt/rab proteins in vesicle budding as well. Here we report the identification of a new member of the Sec7-domain family, SYT1, as a high-copy suppressor of a ypt31/32 mutation. Several proteins that belong to the Sec7-domain family, including the yeast Gea1p, have recently been shown to stimulate nucleotide exchange by Arf GTPases. Nucleotide exchange by Arf GTPases, the switch from the GDP- to the GTP-bound form, is thought to be crucial for their function. Sec7p itself has an important role in the yeast secretory pathway. However, its mechanism of action is not yet understood. We show that all members of the Sec7-domain family exhibit distinct genetic interactions with the YPT genes. Biochemical assays demonstrate that, although the homology between the members of the Sec7-domain family is relatively low (20-35%) and limited to a small domain, they all can act as guanine nucleotide exchange factors (GEFs) for Arf proteins, but not for Ypt GTPases. The Sec7-domain of Sec7p is sufficient for this activity. Interestingly, the Sec7 domain activity is inhibited by brefeldin A (BFA), a fungal metabolite that inhibits some of the Arf-GEFs, indicating that this domain is a target for BFA. These results demonstrate that the ability to act as Arf-GEFs is a general property of all Sec7-domain proteins in yeast. The genetic interactions observed between Arf GEFs and Ypt GTPases suggest the existence of a Ypt-Arf GTPase cascade in the secretory pathway. PMID:10430582

  3. A Minimal Rac Activation Domain in the Unconventional Guanine Nucleotide Exchange Factor Dock180†

    PubMed Central

    Wu, Xin; Ramachandran, Sekar; Cerione, Richard A.; Erickson, Jon W.


    Guanine nucleotide exchange factors (GEFs) activate Rho GTPases by catalyzing the exchange of bound GDP for GTP, thereby resulting in downstream effector recognition. Two metazoan families of GEFs have been described: Dbl-GEF family members that share conserved Dbl homology (DH) and Pleckstrin homology (PH) domains and the more recently described Dock180 family members that share little sequence homology with the Dbl family and are characterized by conserved Dock homology regions 1 and 2 (DHR-1 and -2). While extensive characterization of the Dbl family has been performed, less is known about how Dock180 family members act as GEFs, with only a single x-ray structure having recently been reported for the Dock9-Cdc42 complex. In order to learn more about the mechanisms used by the founding member of the family, Dock180, to act as a Rac-specific GEF, we set out to identify and characterize its limit functional GEF domain. A C-terminal portion of the DHR-2 domain, composed of approximately 300 residues (designated as Dock180DHR-2c), is shown to be necessary and sufficient for robust Rac-specific GEF activity both in vitro and in vivo. We further show that Dock180DHR-2c binds to Rac in a manner distinct from Rac-GEFs of the Dbl family. Specifically, Ala27 and Trp56 of Rac appear to provide a bipartite binding site for the specific recognition of Dock180DHR-2c, whereas, for Dbl family Rac-GEFs, Trp56 of Rac is the sole primary determinant of GEF specificity. Based on our findings, we are able to define the core of Dock180 responsible for its Rac-GEF activity as well as highlight key recognition sites that distinguish different Dock180 family members and determine their corresponding GTPase specificities. PMID:21033699

  4. Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein.

    PubMed Central

    Gulbins, E; Coggeshall, K M; Langlet, C; Baier, G; Bonnefoy-Berard, N; Burn, P; Wittinghofer, A; Katzav, S; Altman, A


    We recently identified Vav, the product of the vav proto-oncogene, as a guanine nucleotide exchange factor (GEF) for Ras. Vav is enzymatically activated by lymphocyte antigen receptor-coupled protein tyrosine kinases or independently by diglycerides. To further evaluate the physiological role of Vav, we assessed its GDP-GTP exchange activity against several Ras-related proteins in vitro and determined whether Vav activation in transfected NIH 3T3 fibroblasts correlates with the activity status of Ras and mitogen-activated protein (MAP) kinases. In vitro translated purified Vav activated by phorbol myristate acetate (PMA) or phosphorylation with recombinant p56lck displayed GEF activity against Ras but not against recombinant RacI, RacII, Ral, or RhoA proteins. Expression of vav or proto-vav in stably transfected NIH 3T3 cells led to a approximately 10-fold increase in basal or PMA-stimulated Ras exchange activity, respectively, in total-cell lysates and Vav immunoprecipitates. Elevated GEF activity was paralleled in each case by a significant increase in the proportion of active, GTP-bound Ras. PMA had a minimal effect on the low Ras. GTP level in untransfected control fibroblasts but increased it from 20 to 37% in proto-vav-transfected cells. vav-transfected cells displayed a constitutively elevated Ras. GTP level (35%), which was not increased further by PMA treatment. MAP kinases, known downstream intermediates in Ras-dependent signaling pathways, similarly exhibited increased basal or PMA-stimulated activity in Vav-expressing cells by comparison with normal NIH 3T3 cells. These results demonstrate a physiologic interaction between Vav and its target, Ras, leading to MAP kinase activation. Images PMID:8289830

  5. The atypical Guanine-nucleotide exchange factor, dock7, negatively regulates schwann cell differentiation and myelination.


    Yamauchi, Junji; Miyamoto, Yuki; Hamasaki, Hajime; Sanbe, Atsushi; Kusakawa, Shinji; Nakamura, Akane; Tsumura, Hideki; Maeda, Masahiro; Nemoto, Noriko; Kawahara, Katsumasa; Torii, Tomohiro; Tanoue, Akito


    In development of the peripheral nervous system, Schwann cells proliferate, migrate, and ultimately differentiate to form myelin sheath. In all of the myelination stages, Schwann cells continuously undergo morphological changes; however, little is known about their underlying molecular mechanisms. We previously cloned the dock7 gene encoding the atypical Rho family guanine-nucleotide exchange factor (GEF) and reported the positive role of Dock7, the target Rho GTPases Rac/Cdc42, and the downstream c-Jun N-terminal kinase in Schwann cell migration (Yamauchi et al., 2008). We investigated the role of Dock7 in Schwann cell differentiation and myelination. Knockdown of Dock7 by the specific small interfering (si)RNA in primary Schwann cells promotes dibutyryl cAMP-induced morphological differentiation, indicating the negative role of Dock7 in Schwann cell differentiation. It also results in a shorter duration of activation of Rac/Cdc42 and JNK, which is the negative regulator of myelination, and the earlier activation of Rho and Rho-kinase, which is the positive regulator of myelination. To obtain the in vivo evidence, we generated Dock7 short hairpin (sh)RNA transgenic mice. They exhibited a decreased expression of Dock7 in the sciatic nerves and enhanced myelin thickness, consistent with in vitro observation. The effects of the in vivo knockdown on the signals to Rho GTPases are similar to those of the in vitro knockdown. Collectively, the signaling through Dock7 negatively regulates Schwann cell differentiation and the onset of myelination, demonstrating the unexpected role of Dock7 in the interplay between Schwann cell migration and myelination.

  6. Guanine nucleotide induced conformational change of Cdc42 revealed by hydrogen/deuterium exchange mass spectrometry.


    Yang, Sheng-Wei; Ting, Hsiu-Chi; Lo, Yi-Ting; Wu, Ting-Yuan; Huang, Hung-Wei; Yang, Chia-Jung; Chan, Jui-Fen Riva; Chuang, Min-Chieh; Hsu, Yuan-Hao Howard


    Cdc42 regulates pathways related to cell division. Dysregulation of Cdc42 can lead to cancer, cardiovascular diseases and neurodegenerative diseases. GTP induced activation mechanism plays an important role in the activity and biological functions of Cdc42. P-loop, Switch I and Switch II are critical regions modulating the enzymatic activity of Cdc42. We applied amide hydrogen/deuterium exchange coupled with liquid chromatography mass spectrometry (HDXMS) to investigate the dynamic changes of apo-Cdc42 after GDP, GTP and GMP-PCP binding. The natural substrate GTP induced significant decreases of deuteration in P-loop and Switch II, moderate changes of deuteration in Switch I and significant changes of deuteration in the α7 helix, a region far away from the active site. GTP binding induced similar effects on H/D exchange to its non-hydrolysable analog, GMP-PCP. HDXMS results indicate that GTP binding blocked the solvent accessibility in the active site leading to the decrease of H/D exchange rate surrounding the active site, and further triggered a conformational change resulting in the drastic decrease of H/D exchange rate at the remote α7 helix. Comparing the deuteration levels in three activation states of apo-Cdc42, Cdc42-GDP and Cdc42-GMP-PCP, the apo-Cdc42 has the most flexible structure, which can be stabilized by guanine nucleotide binding. The rates of H/D exchange of Cdc42-GDP are between the GMP-PCP-bound and the apo form, but more closely to the GMP-PCP-bound form. Our results show that the activation of Cdc42 is a process of conformational changes involved with P-loop, Switch II and α7 helix for structural stabilization.

  7. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    SciTech Connect

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M. )


    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increased the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.

  8. Solution structures of oligonucleotides containing either a guanine or a cytosine in front of a gap of one nucleotide

    NASA Astrophysics Data System (ADS)

    Boulard, Y.; Faibis, V.; Fazakerley, G. V.


    We report NMR and molecular modelling studies on two DNA duplexes containing a gap of one nucleotides. The difference between the two oligonucleotides lies in the central base face to the gap, a guanine or a cytosine. For the gapG, we observed in solution a B-form conformation where the guanine stacks in the helix. For the gapC, we reveal the existence of two species, one majority where the cytosine is inside the helix and a second for which the cytosine is extrahelical. Nous présentons une étude par RMN et modélisation moléculaire sur deux duplexes d'ADN contenant une lacune de un nucléotide. La différence entre les deux oligonucléotides réside dans la base centrale en face de la lacune, une guanine ou une cytosine. Pour le duplex appelé gapG, nous observons en solution une hélice de type B dans laquelle la guanine est empilée à l'intérieur de l'hélice. Dans le cas du duplex gapC, nous montrons l'existence de deux formes, l'une où la cytosine est à l'intérieur de l'hélice; la seconde où la cytosine est extra hélicale.

  9. The Rho guanine nucleotide exchange factor ARHGEF5 promotes tumor malignancy via epithelial–mesenchymal transition

    PubMed Central

    Komiya, Y; Onodera, Y; Kuroiwa, M; Nomimura, S; Kubo, Y; Nam, J-M; Kajiwara, K; Nada, S; Oneyama, C; Sabe, H; Okada, M


    Epithelial tumor cells often acquire malignant properties, such as invasion/metastasis and uncontrolled cell growth, by undergoing epithelial–mesenchymal transition (EMT). However, the mechanisms by which EMT contributes to malignant progression remain elusive. Here we show that the Rho guanine nucleotide exchange factor (GEF) ARHGEF5 promotes tumor malignancy in a manner dependent on EMT status. We previously identified ARHGEF5, a member of the Dbl family of GEFs, as a multifunctional mediator of Src-induced cell invasion and tumor growth. In the present study, ARHGEF5 was upregulated during tumor growth factor-β-induced EMT in human epithelial MCF10A cells, and promoted cell migration by activating the Rho-ROCK pathway. ARHGEF5 was necessary for the invasive and in vivo metastatic activity of human colorectal cancer HCT116 cells. These findings underscore the crucial role of ARHGEF5 in cell migration and invasion/metastasis. An in vivo tumorigenesis assay revealed that ARHGEF5 had the potential to promote tumor growth via the phosphatidylinositol 3-kinase (PI3K) pathway. However, ARHGEF5 was not required for tumor growth in epithelial-like human colorectal cancer HCT116 and HT29 cells, whereas the growth of mesenchymal-like SW480 and SW620 cells depended on ARHGEF5. Induction of EMT by tumor necrosis factor-α or Slug in HCT116 cells resulted in the dependence of tumor growth on ARHGEF5. In these mesenchymal-like cells, Akt was activated via ARHGEF5 and its activity was required for tumor growth. Analysis of a transcriptome data set revealed that the combination of ARHGEF5 upregulation and E-cadherin downregulation or Snail upregulation was significantly correlated with poor prognosis in patients with colorectal cancers. Taken together, our findings suggest that EMT-induced ARHGEF5 activation contributes to the progression of tumor malignancy. ARHGEF5 may serve as a potential therapeutic target in a subset of malignant tumors that have undergone EMT. PMID

  10. A Rab1 mutant affecting guanine nucleotide exchange promotes disassembly of the Golgi apparatus

    PubMed Central


    The Golgi apparatus is a dynamic organelle whose structure is sensitive to vesicular traffic and to cell cycle control. We have examined the potential role for rab1a, a GTPase previously associated with ER to Golgi and intra-Golgi transport, in the formation and maintenance of Golgi structure. Bacterially expressed, recombinant rab1a protein was microinjected into rat embryonic fibroblasts, followed by analysis of Golgi morphology by fluorescence and electron microscopy. Three recombinant proteins were tested: wild-type rab, mutant rab1a(S25N), a constitutively GDP-bound form (Nuoffer, C., H. W. Davidson, J. Matteson, J. Meinkoth, and W. E. Balch, 1994. J. Cell Biol. 125: 225- 237), and mutant rab1a(N124I) defective in guanine nucleotide binding. Microinjection of wild-type rab1a protein or a variety of negative controls (injection buffer alone or activated ras protein) did not affect the appearance of the Golgi, as visualized by immunofluorescence of alpha-mannosidase II (Man II), used as a Golgi marker. In contrast, microinjection of the mutant forms promoted the disassembly of the Golgi stacks into dispersed vesicular structures visualized by immunofluorescence. When S25N-injected cells were analyzed by EM after immunoperoxidase labeling, Man II was found in isolated ministacks and large vesicular elements that were often surrounded by numerous smaller unlabeled vesicles resembling carrier vesicles. Golgi disassembly caused by rab1a mutants differs from BFA-induced disruption, since beta- COP remains membrane associated, and Man II does not redistribute to the ER. BFA can still cause these residual Golgi elements to fuse and disperse, albeit at a slower rate. Moreover, BFA recovery is incomplete in the presence of rab1 mutants or GTP gamma S. We conclude that GTP exchange and hydrolysis by GTPases, specifically rab1a, are required to form and maintain normal Golgi stacks. The similarity of Golgi disassembly seen with rab1a mutants to that occurring during

  11. ERK1/2 phosphorylate GEF-H1 to enhance its guanine nucleotide exchange activity toward RhoA

    SciTech Connect

    Fujishiro, Shuh-hei; Tanimura, Susumu; Mure, Shogo; Kashimoto, Yuji; Watanabe, Kazushi; Kohno, Michiaki


    Rho GTPases play an essential role in the regulation of many cellular processes. Although various guanine nucleotide exchange factors (GEFs) are involved in the activation of Rho GTPases, the precise mechanism regulating such activity remains unclear. We have examined whether ERK1/2 are involved in the phosphorylation of GEF-H1, a GEF toward RhoA, to modulate its activity. Expression of GEF-H1 in HT1080 cells with constitutive ERK1/2 activation induced its phosphorylation at Thr{sup 678}, which was totally abolished by treating the cells with PD184352, an ERK pathway inhibitor. Stimulation of HeLa S3 cells with 12-O-tetradecanoyl-phorbol-13-acetate induced the phosphorylation of GEF-H1 in an ERK-dependent manner. ERK1/2-mediated Thr{sup 678}-phosphorylation enhanced the guanine nucleotide exchange activity of GEF-H1 toward RhoA. These results suggest that the ERK pathway, by enhancing the GEF-H1 activity, contributes to the activation of RhoA to regulate the actin assembly, a necessary event for the induction of cellular responses including proliferation and motility.

  12. Role of guanine nucleotide binding protein(s) in vasopressin-induced responses of a vascular smooth muscle cell line

    SciTech Connect

    Nambi, P.; Aiyar, N.; Whitman, M.; Stassen, F.L.; Crooke, S.T.


    Rat aortic smooth muscle cells (A-10) carry vascular V1 vasopressin receptors. In these cells, vasopressin inhibits isoproterenol-induced cAMP accumulation and stimulates phosphatidylinositol turnover and Ca/sup 2 +/ mobilization. Pretreatment of the cells with phorbol esters resulted in inhibition of the vasopressin-induced responses. The inactive phorbol ester aPDD was ineffective. These data suggested that phorbol ester might cause phosphorylation of the vasopressin receptor and/or coupling protein(s). Here, they studied the role of guanine nucleotide binding proteins by employing the novel radiolabeled vasopressin antagonist (/sup 3/H)-SKF 101926. In competition experiments with cell membranes, Gpp(NH)p shifted the vasopressin curve to the right indicating decreased agonist affinity. Phorbol ester pretreatment abolished the Gpp(NH)p effect. Pretreatment of the cells with N-ethylmaleimide (NEM) resulted in inhibition of vasopressin-induced phosphatidyinositol turnover. NEM also abolished the decrease in agonist affinity caused by Gpp(NH)p. These data showed that NEM and phorbol ester pretreatment of smooth muscle cells functionally uncoupled the vasopressin receptors and suggested that vasopressin V1 receptor responses are mediated through guanine nucleotide binding protein(s).

  13. The guanine nucleotide exchange factor Vav3 regulates differentiation of progenitor cells in the developing mouse retina.


    Luft, Veronika; Reinhard, Jacqueline; Shibuya, Masabumi; Fischer, Klaus D; Faissner, Andreas


    The seven main cell types in the mammalian retina arise from multipotent retinal progenitor cells, a process that is tightly regulated by intrinsic and extrinsic signals. However, the molecular mechanisms that control proliferation, differentiation and cell-fate decisions of retinal progenitor cells are not fully understood yet. Here, we report that the guanine nucleotide exchange factor Vav3, a regulator of Rho-GTPases, is involved in retinal development. We demonstrate that Vav3 is expressed in the mouse retina during the embryonic period. In order to study the role of Vav3 in the developing retina, we generate Vav3-deficient mice. The loss of Vav3 results in an accelerated differentiation of retinal ganglion cells and cone photoreceptors during early and late embryonic development. We provide evidence that more retinal progenitor cells express the late progenitor marker Sox9 in Vav3-deficient mice than in wild-types. This premature differentiation is compensated during the postnatal period and late-born cell types such as bipolar cells and Müller glia display normal numbers. Taken together, our data imply that Vav3 is a regulator of retinal progenitor cell differentiation, thus highlighting a novel role for guanine nucleotide exchange factors in retinogenesis.

  14. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    SciTech Connect

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.

  15. ARHGEF7 (BETA-PIX) Acts as Guanine Nucleotide Exchange Factor for Leucine-Rich Repeat Kinase 2

    PubMed Central

    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Background Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Methodology/Principal Findings Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Conclusions/Significance Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis. PMID:21048939

  16. From the ganglioside GQ1balpha to glycomimetic antagonists of the myelin-associated glycoprotein (MAG).


    Ernst, Beat; Schwardt, Oliver; Mesch, Stefanie; Wittwer, Matthias; Rossato, Gianluca; Vedani, Angelo


    The tetrasaccharide 4, a substructure of ganglioside GQ1balpha, shows a remarkable affinity for the myelin-associated glycoprotein (MAG) and was therefore selected as starting point for a lead optimization program. In our search for structurally simplified and pharmacokinetically improved mimics of 4, antagonists with modifications of the core disaccharide Galbeta(1-3)GalNAc, as well as the terminal alpha(2-3)- and the internal alpha(2-6)-linked neuraminic acid were synthesized and tested in target-based binding assays. Compared to the reference tetrasaccharide 4, the most potent antagonist 17 exhibits a 360-fold improved affinity. Furthermore, pharmacokinetic parameters such as stability in the cerebrospinal fluid, logD and permeation through the BBB indicate the drug-like properties of antagonist 17.

  17. Activation of ras p21 transforming properties associated with an increase in the release rate of bound guanine nucleotide.

    PubMed Central

    Lacal, J C; Aaronson, S A


    An Ala-to-Thr substitution at position 59 activates the transforming properties of the p21ras protein without impairment of GTPase activity, a biochemical alteration associated with other activating mutations. To investigate the basis for the transforming properties of the Thr-59 mutant, we characterized guanine nucleotide release. This reaction exhibited a slow rate and stringent temperature requirements. To further dissect the release reaction, we used monoclonal antibodies directed against different epitopes of the p21 molecule. One monoclonal specifically interfered with nucleotide release, while others which recognized different regions of the molecule blocked nucleotide binding. Mutants with the Thr-59 substitution exhibited a three- to ninefold-higher rate of GDP and GTP release than normal p21 or mutants with other activating lesions. This alteration in the Thr-59 mutant would have the effect of increasing its rate of nucleotide exchange. In an intracellular environment with a high GTP/GDP ratio, this would favor the association of GTP with the Thr-59 mutant. Consistent with knowledge of known G-regulatory proteins, these findings support a model in which the p21-GTP complex is the biologically active form of the p21 protein. PMID:3540608

  18. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    PubMed Central

    Zavialov, Andrey V; Hauryliuk, Vasili V; Ehrenberg, Måns


    Background During the translation of mRNA into polypeptide, elongation factor G (EF-G) catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF). Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3. PMID:15985150

  19. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    PubMed Central

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki


    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  20. Superoxide Inhibits Guanine Nucleotide Exchange Factor (GEF) Action on Ras, but not on Rho, through Desensitization of Ras to GEF

    PubMed Central


    Ras and Rho GTPases are molecular switches for various vital cellular signaling pathways. Overactivation of these GTPases often causes development of cancer. Guanine nucleotide exchange factors (GEFs) and oxidants function to upregulate these GTPases through facilitation of guanine nucleotide exchange (GNE) of these GTPases. However, the effect of oxidants on GEF functions, or vice versa, has not been known. We show that, via targeting Ras Cys51, an oxidant inhibits the catalytic action of Cdc25—the catalytic domain of RasGEFs—on Ras. However, the enhancement of Ras GNE by an oxidant continues regardless of the presence of Cdc25. Limiting RasGEF action by an oxidant may function to prevent the pathophysiological overactivation of Ras in the presence of both RasGEFs and oxidants. The continuous exposure of Ras to nitric oxide and its derivatives can form S-nitrosated Ras (Ras-SNO). This study also shows that an oxidant not only inhibits the catalytic action of Cdc25 on Ras-SNO but also fails to enhance Ras-SNO GNE. This lack of enhancement then populates the biologically inactive Ras-SNO in cells, which may function to prevent the continued redox signaling of the Ras pathophysiological response. Finally, this study also demonstrates that, unlike the case with RasGEFs, an oxidant does not inhibit the catalytic action of RhoGEF—Vav or Dbs—on Rho GTPases such as Rac1, RhoA, RhoC, and Cdc42. This result explains the results of the previous study in which, despite the presence of an oxidant, the catalytic action of Dbs in cells continued to enhance RhoC GNE. PMID:24422478

  1. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    PubMed Central

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José


    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  2. A novel oncogene, ost, encodes a guanine nucleotide exchange factor that potentially links Rho and Rac signaling pathways.

    PubMed Central

    Horii, Y; Beeler, J F; Sakaguchi, K; Tachibana, M; Miki, T


    Transfection of NIH3T3 cells with an osteosarcoma expression cDNA library led to the appearance of foci of morphologically transformed cells which were found to harbor a novel oncogene, ost. The ost product was activated by truncation of the N-terminal domain of the ost proto-oncogene and was highly tumorigenic in nude mouse assays. The proto-ost cDNA, isolated subsequently, encodes a predicted protein of 100 kDa containing DH (Db1 homology) and PH (pleckstrin homology) domains. Ost is mainly phosphorylated on serine and localized in the cytoplasm. Purified Ost protein catalyzed guanine nucleotide exchange on RhoA and Cdc42 among the Rho and Ras family members tested, indicating that Ost can activate these small GTP-binding proteins. Ost did not detectably associate with RhoA or Cdc42, but interacted specifically with the GTP-bound form of Rac1, suggesting that Ost can function as an effector of Rac1. These results suggest that Ost is a critical regulatory component which links pathways that signal through Rac1, RhoA and Cdc42. Of the tissues examined, expression of ost was the highest in brain and could be localized to neurons and alpha-tanycytes, suggesting that Ost may participate in axonal transport in these specialized cells. Images PMID:7957046

  3. Guanine Nucleotide Exchange Factor OSG-1 Confers Functional Aging via Dysregulated Rho Signaling in Caenorhabditis elegans Neurons

    PubMed Central

    Duan, Zhibing; Sesti, Federico


    Rho signaling regulates a variety of biological processes, but whether it is implicated in aging remains an open question. Here we show that a guanine nucleotide exchange factor of the Dbl family, OSG-1, confers functional aging by dysregulating Rho GTPases activities in C. elegans. Thus, gene reporter analysis revealed widespread OSG-1 expression in muscle and neurons. Loss of OSG-1 gene function was not associated with developmental defects. In contrast, suppression of OSG-1 lessened loss of function (chemotaxis) in ASE sensory neurons subjected to conditions of oxidative stress generated during natural aging, by oxidative challenges, or by genetic mutations. RNAi analysis showed that OSG-1 was specific toward activation of RHO-1 GTPase signaling. RNAi further implicated actin-binding proteins ARX-3 and ARX-5, thus the actin cytoskeleton, as one of the targets of OSG-1/RHO-1 signaling. Taken together these data suggest that OSG-1 is recruited under conditions of oxidative stress, a hallmark of aging, and contributes to promote loss of neuronal function by affecting the actin cytoskeleton via altered RHO-1 activity. PMID:25527286

  4. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.


    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G


    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs.

  5. RIC8 is a guanine-nucleotide exchange factor for Galpha subunits that regulates growth and development in Neurospora crassa.


    Wright, Sara J; Inchausti, Regina; Eaton, Carla J; Krystofova, Svetlana; Borkovich, Katherine A


    Heterotrimeric (αβγ) G proteins are crucial components of eukaryotic signal transduction pathways. G-protein-coupled receptors (GPCRs) act as guanine nucleotide exchange factors (GEFs) for Gα subunits. Recently, facilitated GDP/GTP exchange by non-GPCR GEFs, such as RIC8, has emerged as an important mechanism for Gα regulation in animals. RIC8 is present in animals and filamentous fungi, such as the model eukaryote Neurospora crassa, but is absent from the genomes of baker's yeast and plants. In Neurospora, deletion of ric8 leads to profound defects in growth and asexual and sexual development, similar to those observed for a mutant lacking the Gα genes gna-1 and gna-3. In addition, constitutively activated alleles of gna-1 and gna-3 rescue many defects of Δric8 mutants. Similar to reports in Drosophila, Neurospora Δric8 strains have greatly reduced levels of G-protein subunits. Effects on cAMP signaling are suggested by low levels of adenylyl cyclase protein in Δric8 mutants and suppression of Δric8 by a mutation in the protein kinase A regulatory subunit. RIC8 acts as a GEF for GNA-1 and GNA-3 in vitro, with the strongest effect on GNA-3. Our results support a role for RIC8 in regulating GNA-1 and GNA-3 in Neurospora.

  6. The Guanine Nucleotide Exchange Factor Brx: A Link between Osmotic Stress, Inflammation and Organ Physiology and Pathophysiology

    PubMed Central

    Kino, Tomoshige; Segars, James H.; Chrousos, George P.


    SUMMARY Dehydration, and consequent intracellular hyperosmolarity, is a major challenge to land organisms, as it is associated with extraction of water from cells and disturbance of global cellular function. Organisms have thus developed a highly conserved regulatory mechanism that transduces the hyperosmolarity signal from the cell surface to the cell nucleus and adjusts the expression of cellular osmolarity-regulating genes. We recently found that the Rho-type guanine nucleotide exchange factor Brx, or AKAP13, is essential for osmotic stress-stimulated expression of nuclear factor of activated T-cells 5 (NFAT5), a key transcription factor of intracellular osmolarity. It accomplishes this by first attracting cJun kinase (JNK)-interacting protein (JIP) 4 and then coupling activated Rho-type small G-proteins to cascade components of the p38 MAPK signaling pathway, ultimately activating NFAT5. We describe the potential implications of osmotic stress and Brx activation in organ physiology and pathophysiology and connect activation of this system to key human homeostatic states. PMID:21037977

  7. Assay of Rab17 and its guanine nucleotide exchange factor Rabex-5 in the dendrites of hippocampal neurons.


    Mori, Yasunori; Fukuda, Mitsunori


    Neurons are functionally and morphologically compartmentalized into axons and dendrites, and the localization of specific proteins within these compartments is critical to the proper formation of neuronal networks, which includes neurite morphogenesis and synapse formation. The small GTPase Rab17 is specifically localized in dendrites and is not found in axons, and it regulates the dendrite morphogenesis and postsynaptic development of mouse hippocampal neurons. However, the spatiotemporal regulation of Rab17 is poorly understood. We recently identified Rabex-5, originally described as a Rab5-guanine nucleotide exchange factor (GEF), as a physiological Rab17-GEF that promotes translocation of Rab17 from the cell body to the dendrites of developing hippocampal neurons. Knockdown of Rab17 in mouse hippocampal neurons resulted in reductions in dendrite growth, branch numbers, filopodium density, and active synapse numbers. Knockdown of Rab17-GEF Rabex-5 in hippocampal neurons resulted in decreased targeting of Rab17 to the dendrites, which led to a reduction in dendrite growth. In this chapter we describe the assay procedures for analyzing Rab17 and Rabex-5 in cultured mouse hippocampal neurons, and we particularly focus on the measurement of total dendrite (or axon) length and total dendrite (or axon) branch numbers, filopodium density, number of active synapses, and dendritic Rab17 signals.

  8. Functional characterization of the guanine nucleotide exchange factor (GEF) motif of GIV protein reveals a threshold effect in signaling.


    Garcia-Marcos, Mikel; Kietrsunthorn, Patrick S; Pavlova, Yelena; Adia, Michelle A; Ghosh, Pradipta; Farquhar, Marilyn G


    Heterotrimeric G proteins are critical signal-transducing molecules controlled by a complex network of regulators. GIV (a.k.a. Girdin) is a unique component of this network and a nonreceptor guanine nucleotide exchange factor (GEF) that functions via a signature motif. GIV's GEF motif is involved in the regulation of critical biological processes such as phosphoinositide 3 kinase (PI3K)-Akt signaling, actin cytoskeleton remodeling, cell migration, and cancer metastasis. Here we investigated how the GEF function of GIV affects the wiring of its signaling pathway to shape different biological responses. Using a structure-guided approach, we designed a battery of GIV mutants with different Gαi-binding and -activating properties and used it to dissect the specific impact of changes in GIV's GEF activity on several cellular responses. In vivo signaling assays revealed a threshold effect of GEF activity for the activation of Akt by GIV in different cell lines and by different stimuli. Akt signaling is minimal at low GEF activity and is sharply increased to reach a maximum above a threshold of GEF activity, suggesting that GIV is a critical signal amplifier and that activation of Akt is ultrasensitive to changes in GIV's GEF activity. A similar threshold dependence was observed for other biological functions promoted by GIV such as remodeling of the actin cytoskeleton and cell migration. This functional characterization of GIV's GEF motif provides insights into the molecular interactions between nonreceptor GEFs and G proteins and the mechanisms that govern this signal transduction pathway.

  9. The Rho-guanine nucleotide exchange factor Trio controls leukocyte transendothelial migration by promoting docking structure formation.


    van Rijssel, Jos; Kroon, Jeffrey; Hoogenboezem, Mark; van Alphen, Floris P J; de Jong, Renske J; Kostadinova, Elena; Geerts, Dirk; Hordijk, Peter L; van Buul, Jaap D


    Leukocyte transendothelial migration involves the active participation of the endothelium through the formation of apical membrane protrusions that embrace adherent leukocytes, termed docking structures. Using live-cell imaging, we find that prior to transmigration, endothelial docking structures form around 80% of all neutrophils. Previously we showed that endothelial RhoG and SGEF control leukocyte transmigration. In this study, our data reveal that both full-length Trio and the first DH-PH (TrioD1) domain of Trio, which can activate Rac1 and RhoG, interact with ICAM-1 and are recruited to leukocyte adhesion sites. Moreover, upon clustering of ICAM-1, the Rho-guanine nucleotide exchange factor Trio activates Rac1, prior to activating RhoG, in a filamin-dependent manner. We further show that docking structure formation is initiated by ICAM-1 clustering into ring-like structures, which is followed by apical membrane protrusion. Interestingly, we find that Rac1 is required for ICAM-1 clustering, whereas RhoG controls membrane protrusion formation. Finally, silencing endothelial Trio expression or reducing TrioD1 activity without affecting SGEF impairs both docking structure formation and leukocyte transmigration. We conclude that Trio promotes leukocyte transendothelial migration by inducing endothelial docking structure formation in a filamin-dependent manner through the activation of Rac1 and RhoG.

  10. Myosin II directly binds and inhibits Dbl family guanine nucleotide exchange factors: a possible link to Rho family GTPases

    PubMed Central

    Lee, Chan-Soo; Choi, Chang-Ki; Schwartz, Martin Alexander


    Cell migration requires the coordinated spatiotemporal regulation of actomyosin contraction and cell protrusion/adhesion. Nonmuscle myosin II (MII) controls Rac1 and Cdc42 activation, and cell protrusion and focal complex formation in migrating cells. However, these mechanisms are poorly understood. Here, we show that MII interacts specifically with multiple Dbl family guanine nucleotide exchange factors (GEFs). Binding is mediated by the conserved tandem Dbl homology–pleckstrin homology module, the catalytic site of these GEFs, with dissociation constants of ∼0.3 µM. Binding to the GEFs required assembly of the MII into filaments and actin-stimulated ATPase activity. Binding of MII suppressed GEF activity. Accordingly, inhibition of MII ATPase activity caused release of GEFs and activation of Rho GTPases. Depletion of βPIX GEF in migrating NIH3T3 fibroblasts suppressed lamellipodial protrusions and focal complex formation induced by MII inhibition. The results elucidate a functional link between MII and Rac1/Cdc42 GTPases, which may regulate protrusion/adhesion dynamics in migrating cells. PMID:20713598

  11. Critical function of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in mouse spermatogenesis.


    Okada, Keisuke; Miyake, Hideaki; Yamaguchi, Kohei; Chiba, Koji; Maeta, Kazuhiro; Bilasy, Shymaa E; Edamatsu, Hironori; Kataoka, Tohru; Fujisawa, Masato


    Small GTPase Rap1 has been implicated in the proper differentiation of testicular germ cells. In the present study, we investigated the functional significance of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in testicular differentiation using mice lacking RA-GEF-2. RA-GEF-2 was expressed predominantly on the luminal side of the seminiferous tubules in wild-type mice. No significant differences were observed in the body weights or hormonal parameters of RA-GEF-2(-)(/)(-) and wild-type mice. However, the testes of RA-GEF-2(-)(/)(-) male mice were significantly smaller than those of wild-type mice and were markedly atrophied as well as hypospermatogenic. The concentration and motility of epididymal sperm were also markedly reduced and frequently had an abnormal shape. The pregnancy rate and number of fetuses were markedly lower in wild-type females after they mated with RA-GEF-2(-)(/)(-) males than with wild-type males, which demonstrated the male infertility phenotype of RA-GEF-2(-)(/)(-) mice. Furthermore, a significant reduction and alteration were observed in the expression level and cell junctional localization of N-cadherin, respectively, in RA-GEF-2(-)(/)(-) testes, which may, at least in part, account for the defects in testicular differentiation and spermatogenesis in these mice.

  12. Biochemical, Biophysical and Cellular Techniques to Study the Guanine Nucleotide Exchange Factor, GIV/Girdin.


    Ghosh, Pradipta; Aznar, Nicolas; Swanson, Lee; Lo, I-Chung; Lopez-Sanchez, Inmaculada; Ear, Jason; Rohena, Cristina; Kalogriopoulos, Nicholas; Joosen, Linda; Dunkel, Ying; Sun, Nina; Nguyen, Peter; Bhandari, Deepali


    Canonical signal transduction via heterotrimeric G proteins is spatiotemporally restricted, i.e., triggered exclusively at the plasma membrane, only by agonist activation of G protein-coupled receptors via a finite process that is terminated within a few hundred milliseconds. Recently, a rapidly emerging paradigm has revealed a noncanonical pathway for activation of heterotrimeric G proteins via the nonreceptor guanidine-nucleotide exchange factor, GIV/Girdin. Biochemical, biophysical, and functional studies evaluating this pathway have unraveled its unique properties and distinctive spatiotemporal features. As in the case of any new pathway/paradigm, these studies first required an in-depth optimization of tools/techniques and protocols, governed by rationale and fundamentals unique to the pathway, and more specifically to the large multimodular GIV protein. Here we provide the most up-to-date overview of protocols that have generated most of what we know today about noncanonical G protein activation by GIV and its relevance in health and disease. © 2016 by John Wiley & Sons, Inc.

  13. Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no guanine nucleotide exchange activity toward Arl1 GTPase

    NASA Astrophysics Data System (ADS)

    Mahajan, Divyanshu; Boh, Boon Kim; Zhou, Yan; Chen, Li; Cornvik, Tobias Carl; Hong, Wanjin; Lu, Lei


    Arl1 is a member of Arf family small GTPases that is essential for the organization and function of Golgi complex. Mon2/Ysl2, which shares significant homology with Sec7 family Arf guanine nucleotide exchange factors, was poorly characterized in mammalian cells. Here, we report the first in depth characterization of mammalian Mon2. We found that Mon2 localized to trans-Golgi network which was dependent on both its N and C termini. The depletion of Mon2 did not affect the Golgi localized or cellular active form of Arl1. Furthermore, our in vitro assay demonstrated that recombinant Mon2 did not promote guanine nucleotide exchange of Arl1. Therefore, our results suggest that Mon2 could be neither necessary nor sufficient for the guanine nucleotide exchange of Arl1. We demonstrated that Mon2 was involved in endosome-to-Golgi trafficking as its depletion accelerated the delivery of furin and CI-M6PR to Golgi after endocytosis.

  14. Role of protein-phospholipid interactions in the activation of ARF1 by the guanine nucleotide exchange factor Arno.


    Paris, S; Béraud-Dufour, S; Robineau, S; Bigay, J; Antonny, B; Chabre, M; Chardin, P


    Arno is a 47-kDa human protein recently identified as a guanine nucleotide exchange factor for ADP ribosylation factor 1 (ARF1) with a central Sec7 domain responsible for the exchange activity and a carboxyl-terminal pleckstrin homology (PH) domain (Chardin, P., Paris, S., Antonny, B., Robineau, S., Béraud-Dufour, S., Jackson, C. L., and Chabre, M. (1996) Nature 384, 481-484). Binding of the PH domain to phosphatidylinositol 4,5-bisphosphate (PIP2) greatly enhances Arno-mediated activation of myristoylated ARF1. We show here that in the absence of phospholipids, Arno promotes nucleotide exchange on [Delta17]ARF1, a soluble mutant of ARF1 lacking the first 17 amino acids. This reaction is unaffected by PIP2, which suggests that the PIP2-PH domain interaction does not directly regulate the catalytic activity of Arno but rather serves to recruit Arno to membranes. Arno catalyzes the release of GDP more efficiently than that of GTP from [Delta17]ARF1, and a stable complex between Arno Sec7 domain and nucleotide-free [Delta17]ARF1 can be isolated. In contrast to [Delta17]ARF1, full-length unmyristoylated ARF1 is not readily activated by Arno in solution. Its activation requires the presence of phospholipids and a reduction of ionic strength and Mg2+ concentration. PIP2 is strongly stimulatory, indicating that binding of Arno to phospholipids is involved, but in addition, electrostatic interactions between phospholipids and the amino-terminal portion of unmyristoylated ARF1GDP seem to be important. We conclude that efficient activation of full-length ARF1 by Arno requires a membrane surface and two distinct protein-phospholipid interactions: one between the PH domain of Arno and PIP2, and the other between amino-terminal cationic residues of ARF1 and anionic phospholipids. The latter interaction is normally induced by insertion of the amino-terminal myristate into the bilayer but can also be artificially facilitated by decreasing Mg2+ and salt concentrations.

  15. Calcium channel currents and their inhibition by (-)-baclofen in rat sensory neurones: modulation by guanine nucleotides.

    PubMed Central

    Dolphin, A C; Scott, R H


    significantly increased by GTP-gamma-S and reduced by GDP-beta-S. 6. The ability of baclofen to inhibit calcium-channel currents was not affected by 1 microM-forskolin or 50 microM-intracellular cyclic AMP. 7. It is concluded that calcium channels in d.r.g.s are associated with a nucleotide binding protein, and that this mediates the effect of baclofen and 2-CA on calcium-channel currents. The ability of GTP-gamma-S to inhibit the transient component of calcium-channel currents in the absence of agonist may represent a means of differentially regulating calcium-channel activity. PMID:2445960

  16. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.


    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng


    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (P<0.05) than that in normal controls (5/36, 13.89%). Moreover, the overexpression rate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  17. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling.


    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders.

  18. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

    PubMed Central

    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders. PMID:25485589

  19. The ect2 rho Guanine nucleotide exchange factor is essential for early mouse development and normal cell cytokinesis and migration.


    Cook, Danielle R; Solski, Patricia A; Bultman, Scott J; Kauselmann, Gunther; Schoor, Michael; Kuehn, Ralf; Friedman, Lori S; Cowley, Dale O; Van Dyke, Terry; Yeh, Jen Jen; Johnson, Leisa; Der, Channing J


    Ect2 is a member of the human Dbl family of guanine nucleotide exchange factors (RhoGEFs) that serve as activators of Rho family small GTPases. Although Ect2 is one of at least 25 RhoGEFs that can activate the RhoA small GTPase, cell culture studies using established cell lines determined that Ect2 is essential for mammalian cell cytokinesis and proliferation. To address the function of Ect2 in normal mammalian development, we performed gene targeting to generate Ect2 knockout mice. The heterozygous Ect2(+/-) mice showed normal development and life span, indicating that Ect2 haplodeficiency was not deleterious for development or growth. In contrast, Ect2(-/-) embryos were not found at birth or postimplantation stages. Ect2(-/-) blastocysts were recovered at embryonic day 3.5 but did not give rise to viable outgrowths in culture, indicating that Ect2 is required for peri-implantation development. To further assess the importance of Ect2 in normal cell physiology, we isolated primary fibroblasts from Ect2(fl/fl) embryos (MEFs) and ablated Ect2 using adenoviral delivery of Cre recombinase. We observed a significant increase in multinucleated cells and accumulation of cells in G2/M phase, consistent with a role for Ect2 in cytokinesis. Ect2 deficiency also caused enlargement of the cytoplasm and impaired cell migration. Finally, although Ect2-dependent activation of RhoA has been implicated in cytokinesis, Ect2 can also activate Rac1 and Cdc42 to cause growth transformation. Surprisingly, ectopic expression of constitutively activated RhoA, Rac1, or Cdc42, known substrates of Ect2, failed to phenocopy Ect2 and did not rescue the defect in cytokinesis caused by loss of Ect2. In summary, our results establish the unique role of Ect2 in development and normal cell proliferation.

  20. Association of genetic variants in the Rho guanine nucleotide exchange factor AKAP13 with familial breast cancer.


    Wirtenberger, Michael; Tchatchou, Sandrine; Hemminki, Kari; Klaes, Rüdiger; Schmutzler, Rita K; Bermejo, Justo L; Chen, Bowang; Wappenschmidt, Barbara; Meindl, Alfons; Bartram, Claus R; Burwinkel, Barbara


    The A-kinase anchor protein 13 (AKAP13, alias BRX and lbc) tethers cAMP-dependent protein kinase to its subcellular environment and catalyses Rho GTPases activity as a guanine nucleotide exchange factor. The crucial role of members of the Rho family of GTPases in carcinogenesis is well established and targeting Rho proteins with antineoplastic compounds has become a major effort in the fight against cancer. Thus, genetic alterations within the candidate cancer susceptibility gene AKAP13 would be expected to provoke a constitutive Rho signalling, thereby facilitating the development of cancer. Here, we analysed the potential impact of four polymorphic non-conservative amino acid exchanges (Arg494Trp, Lys526Gln, Asn1086Asp and Gly2461Ser) in AKAP13 on familial breast cancer. We performed a case-control study using genomic DNA of BRCA1/2 mutation-negative German female index patients from 601 unrelated families, among a subset of 356 high-risk families, and 1053 German female unrelated controls. The newfound Lys526Gln polymorphism revealed a significant association with familial breast cancer (OR = 1.58, 95% CI = 1.07-2.35) and an even stronger association with high-risk familial breast cancer (OR = 1.85, 95% CI = 1.19-2.88). Haplotype analyses were in line with genotype results displaying a similar significance as analyses of individual polymorphisms. Due to the pivotal role of AKAP13 in the Rho GTPases signalling network, this variant might affect the susceptibility to other cancers as well.

  1. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.


    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli


    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  2. Calcium- and guanine-nucleotide-dependent exocytosis in permeabilized rat mast cells. Modulation by protein kinase C.

    PubMed Central

    Koopmann, W R; Jackson, R C


    We have used a digitonin-permeabilized cell system to study the signal transduction pathways responsible for stimulus-secretion coupling in the rat peritoneal mast cell. Conditions were established for permeabilizing the mast cell plasma membrane without disrupting secretory vesicles. Exocytotic release of histamine from digitonin-permeabilized cells required a combination of micromolar concentrations of Ca2+ and the stable guanine nucleotide analogue guanosine 5'-[gamma-thio]triphosphate (GTP[S]), but was independent of exogenous ATP. In the presence of 40 microM-GTP[S], exocytosis was half-maximal at 1.3 microM-Ca2+ and maximal at 10 microM-Ca2+; GTP[S] alone (100 microM) had no effect on histamine release in the absence of added Ca2+. In the presence of 10 microM free Ca2+, 5 microM-GTP[S] was required for half-maximal exocytosis. To examine the possible role of protein kinase C (PKC) in exocytosis, we utilized 12-O-tetradecanoylphorbol 13-acetate (TPA) to activate PKC and studied its effect on histamine release from permeabilized mast cells. Cells that had been incubated with TPA (25 nM for 5 min) exhibited increased sensitivity to both GTP[S] and Ca2+. The PKC inhibitor staurosporine blocked the effect of TPA without inhibiting normal exocytosis in response to the combination of GTP[S] and Ca2+. In addition, down-regulation of mast-cell PKC by long-term TPA treatment (25 nM for 20 h) blocked the ability of the cells to respond to TPA and inhibited exocytosis in response to Ca2+ and GTP[S] by 40-50%. These results suggest that the sensitivity of the exocytotic machinery of the mast cell can be altered by PKC-catalysed phosphorylation events, but that activation of PKC is not required for exocytosis to occur. Images Fig. 7. PMID:1689146

  3. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria


    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  4. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    SciTech Connect

    Feltner, D.E.; Marasco, W.A.


    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of (3H)FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM (3H)FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. (3H)FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of (3H)FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM (3H)FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state.

  5. Phospholipase C-gamma1 is a guanine nucleotide exchange factor for dynamin-1 and enhances dynamin-1-dependent epidermal growth factor receptor endocytosis.


    Choi, Jang Hyun; Park, Jong Bae; Bae, Sun Sik; Yun, Sanguk; Kim, Hyeon Soo; Hong, Won-Pyo; Kim, Il-Shin; Kim, Jae Ho; Han, Mi Young; Ryu, Sung Ho; Patterson, Randen L; Snyder, Solomon H; Suh, Pann-Ghill


    Phospholipase C-gamma1 (PLC-gamma1), which interacts with a variety of signaling molecules through its two Src homology (SH) 2 domains and a single SH3 domain has been implicated in the regulation of many cellular functions. We demonstrate that PLC-gamma1 acts as a guanine nucleotide exchange factor (GEF) of dynamin-1, a 100 kDa GTPase protein, which is involved in clathrin-mediated endocytosis of epidermal growth factor (EGF) receptor. Overexpression of PLC-gamma1 increases endocytosis of the EGF receptor by increasing guanine nucleotide exchange activity of dynamin-1. The GEF activity of PLC-gamma1 is mediated by the direct interaction of its SH3 domain with dynamin-1. EGF-dependent activation of ERK and serum response element (SRE) are both up-regulated in PC12 cells stably overexpressing PLC-gamma1, but knockdown of PLC-gamma1 by siRNA significantly reduces ERK activation. These results establish a new role for PLC-gamma1 in the regulation of endocytosis and suggest that endocytosis of activated EGF receptors may mediate PLC-gamma1-dependent proliferation.

  6. Isolation of a gene encoding a developmentally regulated T cell-specific protein with a guanine nucleotide triphosphate-binding motif

    SciTech Connect

    Carlow, D.A.; Teh, H.S.; Marth, J.


    In this study, we describe a novel full length cDNA clone designated Tgtp that encodes a predicted 415-amino acid a T cell-specific guanine nucleotide triphosphate-binding protein (TGTP) bearing the characteristic motifs of a guanine nucleotide triphosphate (GTP) binding protein. Tgtp is expressed preferentially, if not exclusively, in T cells, and is up-regulated in both unfractionated and in purified CD4{sup +}8{sup +} thymocytes upon TCR cross-linking. In contrast, expression of Tgtp in peripheral T cells is maintained at relatively high levels and is not grossly affected by TCR cross-linking. Antiserum generated against synthetic peptides from the predicted TGTP amino acid sequence recognized a single protein with a molecular mass of {approx}50 kDa, corresponding well with the computed molecular mass of 47 kDa. The only known relative of Tgtp is MUSGTP, which is reportedly expressed in B cells and bears a GTP binding motif. Thus, the discovery of Tgtp resolves a subfamily of molecules with GTP binding motifs and apparent lymphoid lineage-restricted expression. Given the restricted expression pattern in T cells, the up-regulated expression observed in response to TCR signaling in immature thymocytes, and the presence of the motifs characteristic of GTP binding proteins, we suggest that TGTP may have an important function in T cell development and/or T cell activation. 51 refs., 6 figs.

  7. Arf6 Guanine Nucleotide Exchange Factor Cytohesin-2 Binds to CCDC120 and Is Transported Along Neurites to Mediate Neurite Growth*

    PubMed Central

    Torii, Tomohiro; Miyamoto, Yuki; Tago, Kenji; Sango, Kazunori; Nakamura, Kazuaki; Sanbe, Atsushi; Tanoue, Akito; Yamauchi, Junji


    The mechanism of neurite growth is complicated, involving continuous cytoskeletal rearrangement and vesicular trafficking. Cytohesin-2 is a guanine nucleotide exchange factor for Arf6, an Arf family molecular switch protein, controlling cell morphological changes such as neuritogenesis. Here, we show that cytohesin-2 binds to a protein with a previously unknown function, CCDC120, which contains three coiled-coil domains, and is transported along neurites in differentiating N1E-115 cells. Transfection of the small interfering RNA (siRNA) specific for CCDC120 into cells inhibits neurite growth and Arf6 activation. When neurites start to extend, vesicles containing CCDC120 and cytohesin-2 are transported in an anterograde manner rather than a retrograde one. As neurites continue extension, anterograde vesicle transport decreases. CCDC120 knockdown inhibits cytohesin-2 localization into vesicles containing CCDC120 and diffuses cytohesin-2 in cytoplasmic regions, illustrating that CCDC120 determines cytohesin-2 localization in growing neurites. Reintroduction of the wild type CCDC120 construct into cells transfected with CCDC120 siRNA reverses blunted neurite growth and Arf6 activity, whereas the cytohesin-2-binding CC1 region-deficient CCDC120 construct does not. Thus, cytohesin-2 is transported along neurites by vesicles containing CCDC120, and it mediates neurite growth. These results suggest a mechanism by which guanine nucleotide exchange factor for Arf6 is transported to mediate neurite growth. PMID:25326380

  8. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    SciTech Connect

    Hepler, J.R.; Harden, T.K.


    Formation of the inositol phosphates (InsP), InsP/sub 3/, InsP/sub 2/, and InsP/sub 1/ was increased in a concentration dependent manner (K/sub 0.5/ approx. 5 by GTP..sigma..S in washed membranes prepared from /sup 3/H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTP..gamma..S and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 GTP..gamma..S, carbachol stimulated (K/sub 0.5/ approx. 10 M) the formation of InsP above the level achieved with GTP..gamma..S alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 carbachol was GTP..gamma..S > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTP..gamma..S or GTP..gamma..S plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTP..gamma..S in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells.

  9. The effects of acute exposure to ethanol on neurotensin and guanine nucleotide-stimulation of phospholipase C activity in intact NIE-115 neuroblastoma cells

    SciTech Connect

    Smith, T.L. )


    Both ethanol and neurotensin produce sedation and hypothermia. When administered in combination the behavioral effects of these two substances are potentiated. In order to better understand the biochemical nature of this interaction, the direct effects of ethanol on neurotensin receptors and an associated signal transduction process were determined in NIE-115 neuroblastoma cells. Ethanol in physiologically relevant concentrations significantly reduced neurotensin stimulated ({sup 3}H)inositol phosphate production while having no effect on the specific binding of ({sup 3}H)neurotensin. In addition, ethanol up to 200 mM had no effect on GTPYS mediated ({sup 3}H)inositol phosphate production. The results indicate that acute exposure ethanol partially disrupts the normal coupling of activated neurotensin receptors to the guanine nucleotide binding protein associated with phospholipase C.

  10. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    SciTech Connect

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. )


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  11. Architecture and mechanism of the late endosomal Rab7-like Ypt7 guanine nucleotide exchange factor complex Mon1–Ccz1

    PubMed Central

    Kiontke, Stephan; Langemeyer, Lars; Kuhlee, Anne; Schuback, Saskia; Raunser, Stefan; Ungermann, Christian; Kümmel, Daniel


    The Mon1–Ccz1 complex (MC1) is the guanine nucleotide exchange factor (GEF) for the Rab GTPase Ypt7/Rab7 and is required for endosomal maturation and fusion at the vacuole/lysosome. Here we present the overall architecture of MC1 from Chaetomium thermophilum, and in combining biochemical studies and mutational analysis in yeast, we identify the domains required for catalytic activity, complex assembly and localization of MC1. The crystal structure of a catalytic MC1 core complex bound to Ypt7 provides mechanistic insight into its function. We pinpoint the determinants that allow for a discrimination of the Rab7-like Ypt7 over the Rab5-like Vps21, which are both located on the same membrane. MC1 shares structural similarities with the TRAPP complex, but employs a novel mechanism to promote nucleotide exchange that utilizes a conserved lysine residue of Ypt7, which is inserted upon MC1 binding into the nucleotide-binding pocket of Ypt7 and contributes to specificity. PMID:28051187

  12. Refinement of DNA structures through near-edge X-ray absorption fine structure analysis: applications on guanine and cytosine nucleobases, nucleosides, and nucleotides.


    Hua, Weijie; Gao, Bin; Li, Shuhua; Agren, Hans; Luo, Yi


    In this work we highlight the potential of NEXAFS—near-edge X-ray absorption fine structure—analysis to perform refinements of hydrogen-bond structure in DNA. For this purpose we have carried out first-principle calculations of the N1s NEXAFS spectra of the guanine and cytosine nucleobases and their tautomers, nucleosides, and nucleotides in the gas phase, as well as for five crystal structures of guanine, cytosine, or guanosine. The spectra all clearly show imine (π1*) and amine (π2*) nitrogen absorption bands with a characteristic energy difference (Δ). Among all of the intramolecule covalent connections, the tautomerism of hydrogens makes the largest influence, around ±0.4−0.5 eV change of Δ, to the spectra due to a switch of single−double bonds. Deoxyribose and ribose sugars can cause at most 0.2 eV narrowing of Δ, while the phosphate groups have nearly negligible effects on the spectra. Two kinds of intermolecule interactions are analyzed, the hydrogen bonds and the stacking effect, by comparing “compressed” and “expanded” models or by comparing models including or excluding the nearest stacking molecules. The shortening of hydrogen-bond length by 0.2−0.3 Å can result in the reduction of Δ by 0.2−0.8 eV. This is because the hydrogen bonds make the electrons more delocalized, and the amine and imine nitrogens become less distinguishable. Moreover, the hydrogen bond has a different ability to influence the spectra of different crystals, with guanine crystals as the largest (change by 0.8 eV) and the guanosine crystal as the smallest (change by 0.2 eV). The stacking has negligible effects on the spectra in all studied systems. A comparison of guanosine to guanine crystals shows that the sugars in the crystal could create “blocks” in the π-and hydrogen bonds network of bases and thus makes the imine and amine nitrogens more distinguishable with a larger Δ. Our theoretical calculations offer a good match with experimental findings

  13. The auto-inhibitory state of Rho guanine nucleotide exchange factor ARHGEF5/TIM can be relieved by targeting its SH3 domain with rationally designed peptide aptamers.


    He, Ping; Tan, De-Li; Liu, Hong-Xiang; Lv, Feng-Lin; Wu, Wei


    The short isoform of Rho guanine nucleotide exchange factor ARHGEF5 is known as TIM, which plays diverse roles in, for example, tumorigenesis, neuronal development and Src-induced podosome formation through the activation of its substrates, the Rho family of GTPases. The activation is auto-inhibited by a putative helix N-terminal to the DH domain of TIM, which is stabilized by the intramolecular interaction of C-terminal SH3 domain with a poly-proline sequence between the putative helix and the DH domain. In this study, we systematically investigated the structural basis, energetic landscape and biological implication underlying TIM auto-inhibition by using atomistic molecular dynamics simulations and binding free energy analysis. The computational study revealed that the binding of SH3 domain to poly-proline sequence is the prerequisite for the stabilization of TIM auto-inhibition. Thus, it is suggested that targeting SH3 domain with competitors of the poly-proline sequence would be a promising strategy to relieve the auto-inhibitory state of TIM. In this consideration, we rationally designed a number of peptide aptamers for competitively inhibiting the SH3 domain based on modeled TIM structure and computationally generated data. Peptide binding test and guanine nucleotide exchange analysis solidified that these designed peptides can both bind to the SH3 domain potently and activate TIM-catalyzed RhoA exchange reaction effectively. Interestingly, a positive correlation between the peptide affinity and induced exchange activity was observed. In addition, separate mutation of three conserved residues Pro49, Pro52 and Lys54 - they are required for peptide recognition by SH3 domain -- in a designed peptide to Ala would completely abolish the capability of this peptide activating TIM. All these come together to suggest an intrinsic relationship between peptide binding to SH3 domain and the activation of TIM.

  14. A glutamic finger in the guanine nucleotide exchange factor ARNO displaces Mg2+ and the beta-phosphate to destabilize GDP on ARF1.

    PubMed Central

    Béraud-Dufour, S; Robineau, S; Chardin, P; Paris, S; Chabre, M; Cherfils, J; Antonny, B


    The Sec7 domain of the guanine nucleotide exchange factor ARNO (ARNO-Sec7) is responsible for the exchange activity on the small GTP-binding protein ARF1. ARNO-Sec7 forms a stable complex with the nucleotide-free form of [Delta17]ARF1, a soluble truncated form of ARF1. The crystal structure of ARNO-Sec7 has been solved recently, and a site-directed mutagenesis approach identified a hydrophobic groove and an adjacent hydrophilic loop as the ARF1-binding site. We show that Glu156 in the hydrophilic loop of ARNO-Sec7 is involved in the destabilization of Mg2+ and GDP from ARF1. The conservative mutation E156D and the charge reversal mutation E156K reduce the exchange activity of ARNO-Sec7 by several orders of magnitude. Moreover, [E156K]ARNO-Sec7 forms a complex with the Mg2+-free form of [Delta17]ARF1-GDP without inducing the release of GDP. Other mutations in ARNO-Sec7 and in [Delta17]ARF1 suggest that prominent hydrophobic residues of the switch I region of ARF1 insert into the groove of the Sec7 domain, and that Lys73 of the switch II region of ARF1 forms an ion pair with Asp183 of ARNO-Sec7. PMID:9649435

  15. Flow cytometry for real-time measurement of guanine nucleotide binding and exchange by Ras-like GTPases.


    Schwartz, Samantha L; Tessema, Mathewos; Buranda, Tione; Pylypenko, Olena; Rak, Alexey; Simons, Peter C; Surviladze, Zurab; Sklar, Larry A; Wandinger-Ness, Angela


    Ras-like small GTPases cycle between GTP-bound active and GDP-bound inactive conformational states to regulate diverse cellular processes. Despite their importance, detailed kinetic or comparative studies of family members are rarely undertaken due to the lack of real-time assays measuring nucleotide binding or exchange. Here we report a bead-based flow cytometric assay that quantitatively measures the nucleotide binding properties of glutathione-S-transferase (GST) chimeras for prototypical Ras family members Rab7 and Rho. Measurements are possible in the presence or absence of Mg(2+), with magnesium cations principally increasing affinity and slowing nucleotide dissociation rates 8- to 10-fold. GST-Rab7 exhibited a 3-fold higher affinity for guanosine diphosphate (GDP) relative to guanosine triphosphate (GTP) that is consistent with a 3-fold slower dissociation rate of GDP. Strikingly, GST-Rab7 had a marked preference for GTP with ribose ring-conjugated BODIPY FL. The more commonly used gamma-NH-conjugated BODIPY FL GTP analogue failed to bind to GST-Rab7. In contrast, both BODIPY analogues bound equally well to GST-RhoA and GST-RhoC. Comparisons of the GST-Rab7 and GST-RhoA GTP binding pockets provide a structural basis for the observed binding differences. In sum, the flow cytometric assay can be used to measure nucleotide binding properties of GTPases in real time and to quantitatively assess differences between GTPases.

  16. Escherichia coli UMP-kinase, a member of the aspartokinase family, is a hexamer regulated by guanine nucleotides and UTP.


    Serina, L; Blondin, C; Krin, E; Sismeiro, O; Danchin, A; Sakamoto, H; Gilles, A M; Bârzu, O


    The pyrH gene, encoding UMP-kinase from Escherichia coli, was cloned using as a genetic probe the property of the carAB operon to be controlled for its expression by the concentration of cytoplasmic UTP. The open reading frame of the pyrH gene of 723 bp was found to be identical to that of the smbA gene [Yamanaka, K., et al. (1992) J. Bacteriol. 174, 7517-7526], previously described as being involved in chromosome partitioning in E. coli. The bacterial UMP-kinase did not display significant sequence similarity to known nucleoside monophosphate kinases. On the contrary, it exhibited similarity with three families of enzymes including aspartokinases, glutamate kinases, and Pseudomonas aeruginosa carbamate kinase. UMP-kinase overproduced in E. coli was purified to homogeneity and analyzed for its structural and catalytic properties. The protein consists of six identical subunits, each of 240 amino acid residues (the N-terminal methionine residue is missing in the expressed protein). Upon excitation at 295 nm, the bacterial enzyme exhibits a fluorescence emission spectrum with maximum at 332 nm which indicates that the single tryptophan residue of the protein (Trp119) is located in a hydrophobic environment. Like other enzymes involved in the de novo synthesis of pyrimidine nucleotides, UMP-kinase of E. coli is subject to regulation by nucleotides: GTP is an allosteric activator, whereas UTP serves as an allosteric inhibitor. UTP and UDP, but none of the other nucleotides tested such as GTP, ATP, and UMP, enhanced the fluorescence of the protein. The sigmoidal shape of the dose-response curve indicated cooperativity in binding of UTP and UDP.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. New ribose-modified fluorescent analogs of adenine and guanine nucleotides available as substrates for various enzymes.


    Hiratsuka, T


    The synthesis of fluorescent derivatives of nucleosides and nucleotides, by reaction with isatoic anhydride in aqueous solution at mild pH and temperature, yielding their 3'-O-anthraniloyl derivatives, is here described. The N-methylanthraniloyl derivatives were also synthesized by reaction with N-methylisatoic anhydride. Upon excitation at 330-350 nm these derivatives exhibited maximum fluorescence emission at 430-445 nm in aqueous solution with quantum yields of 0.12-0.24. Their fluorescence was sensitive to the polarity of the solvent; in N,N-dimethylformamide the quantum yields were 0.83-0.93. The major differences between the two fluorophores were the longer wavelength of the emission maximum of the N-methylanthraniloyl group and its greater quantum yield in water. All anthraniloyl derivatives, as well as the N-methylanthraniloyl ones, had virtually identical fluorescent properties, regardless of their base structures. The ATP derivatives showed considerable substrate activity as a replacement of ATP with adenylate kinase, guanylate kinase, glutamine synthetase, myosin ATPase and sodium-potassium transport ATPase. The ADP derivatives were good substrates for creatine kinase and glutamine synthetase (gamma-glutamyl transfer activity). The GMP and adenosine derivatives were substrates for guanylate kinase and adenosine deaminase, respectively. All derivatives had only slightly altered Km values for these enzymes. While more fluorescent in water, the N-methylanthraniloyl derivatives were found to show relatively low substrate activities against some of these enzymes. The results indicate that these ribose-modified nucleosides and nucleotides can be versatile fluorescent substrate analogs for various enzymes.

  18. Guanine nucleotide dissociation inhibitor is essential for Rab1 function in budding from the endoplasmic reticulum and transport through the Golgi stack

    PubMed Central


    The small GTPase Rab1 is required for vesicular traffic from the ER to the cis-Golgi compartment, and for transport between the cis and medial compartments of the Golgi stack. In the present study, we examine the role of guanine nucleotide dissociation inhibitor (GDI) in regulating the function of Rab1 in the transport of vesicular stomatitis virus glycoprotein (VSV-G) in vitro. Incubation in the presence of excess GDI rapidly (t1/2 < 30 s) extracted Rab1 from membranes, inhibiting vesicle budding from the ER and sequential transport between the cis-, medial-, and trans-Golgi cisternae. These results demonstrate a direct role for GDI in the recycling of Rab proteins. Analysis of rat liver cytosol by gel filtration revealed that a major pool of Rab1 fractionates with a molecular mass of approximately 80 kD in the form of a GDI-Rab1 complex. When the GDI-Rab1 complex was depleted from cytosol by use of a Rab1-specific antibody, VSV-G failed to exit the ER. However, supplementation of depleted cytosol with a GDI-Rab1 complex prepared in vitro from recombinant forms of Rab1 and GDI efficiently restored export from the ER, and transport through the Golgi stack. These results provide evidence that a cytosolic GDI-Rab1 complex is required for the formation of non-clathrin-coated vesicles mediating transport through the secretory pathway. PMID:8089173

  19. Assessment of roles for the Rho-specific guanine nucleotide dissociation inhibitor (RhoGDI) Ly-GDI in platelet function: a spatial systems approach.


    Ngo, Anh T P; Thierheimer, Marisa L D; Babur, Özgün; Rocheleau, Anne D; Huang, Tao; Pang, Jiaqing; Rigg, Rachel A; Mitrugno, Annachiara; Theodorescu, Dan; Burchard, Julja; Nan, Xiaolin; Demir, Emek; McCarty, Owen J T; Aslan, Joseph E


    Upon activation at sites of vascular injury, platelets undergo morphological alterations essential to hemostasis via cytoskeletal reorganizations driven by the Rho GTPases Rac1, Cdc42 and RhoA. Here we investigate roles for Rho-specific guanine nucleotide dissociation inhibitor proteins (RhoGDIs) in platelet function. We find that platelets express two RhoGDI family members, RhoGDI and Ly-GDI. While RhoGDI localizes throughout platelets in a granule-like manner, Ly-GDI shows an asymmetric, polarized localization that largely overlaps with Rac1 and Cdc42 as well as microtubules and protein kinase C (PKC) in platelets adherent to fibrinogen. Antibody interference and platelet spreading experiments suggest a specific role for Ly-GDI in platelet function. Intracellular signaling studies based on interactome and pathways analyses also support a regulatory role for Ly-GDI, which is phosphorylated at PKC substrate motifs in a PKC-dependent manner in response to the platelet collagen receptor glycoprotein (GP)VI-specific agonist collagen-related peptide. Additionally, PKC inhibition diffuses the polarized organization of Ly-GDI in spread platelets relative to its colocalization with Rac1 and Cdc42. Together our results suggest a role for Ly-GDI in the localized regulation of Rho GTPases in platelets and hypothesize a link between the PKC and Rho GTPase signaling systems in platelet function.

  20. Role of the guanine nucleotide exchange factor in Akt2-mediated plasma membrane translocation of GLUT4 in insulin-stimulated skeletal muscle.


    Takenaka, Nobuyuki; Yasuda, Naoto; Nihata, Yuma; Hosooka, Tetsuya; Noguchi, Tetsuya; Aiba, Atsu; Satoh, Takaya


    The small GTPase Rac1 plays a key role in insulin-promoted glucose uptake mediated by the GLUT4 glucose transporter in skeletal muscle. Our recent studies have demonstrated that the serine/threonine protein kinase Akt2 is critically involved in insulin-dependent Rac1 activation. The purpose of this study is to clarify the role of the guanine nucleotide exchange factor FLJ00068 in Akt2-mediated Rac1 activation and GLUT4 translocation in mouse skeletal muscle and cultured myocytes. Constitutively activated FLJ00068 induced GLUT4 translocation in a Rac1-dependent and Akt2-independent manner in L6 myocytes. On the other hand, knockdown of FLJ00068 significantly reduced constitutively activated Akt2-triggered GLUT4 translocation. Furthermore, Rac1 activation and GLUT4 translocation induced by constitutively activated phosphoinositide 3-kinase were inhibited by knockdown of FLJ00068. In mouse gastrocnemius muscle, constitutively activated FLJ00068 actually induced GLUT4 translocation to the sarcolemma. GLUT4 translocation by constitutively activated FLJ00068 was totally abolished in rac1 knockout mouse gastrocnemius muscle. Additionally, we were successful in detecting the activation of Rac1 following the expression of constitutively activated FLJ00068 in gastrocnemius muscle by immunofluorescence microscopy using an activation-specific probe. Collectively, these results strongly support the notion that FLJ00068 regulates Rac1 downstream of Akt2, leading to the stimulation of glucose uptake in skeletal muscle.

  1. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge

    PubMed Central

    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R.


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock–ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis. PMID:25908317

  2. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1

    PubMed Central


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P2 to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P2 breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P3 concentrations, rather than the closely related lipid, PtdIns(3,4)P2. Finally, the data demonstrate that PtdIns(4,5)P2 and PtdIns(3,4,5)P3 bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo. PMID:15242348

  3. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1.


    Fleming, Ian N; Batty, Ian H; Prescott, Alan R; Gray, Alex; Kular, Gursant S; Stewart, Hazel; Downes, C Peter


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P(2) to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P(2) breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P(3) concentrations, rather than the closely related lipid, PtdIns(3,4)P(2). Finally, the data demonstrate that PtdIns(4,5)P(2) and PtdIns(3,4,5)P(3) bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo.

  4. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge.


    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock-ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis.

  5. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila.


    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it's functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila.

  6. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange factor, is required for GABA-gated Cl⁻ influx through regulation of GABAA receptor trafficking.


    Li, Cuixian; Chen, Shaorui; Yu, Yang; Zhou, Chun; Wang, Ying; Le, Kang; Li, Dong; Shao, Weiwei; Lu, Liang; You, Yan; Peng, Jin; Huang, Heqing; Liu, Peiqing; Shen, Xiaoyan


    GABAA receptors (GABAARs) mediate the majority of fast synaptic inhibition. Trafficking regulation and protein-protein interactions that maintain the appropriate number of GABAARs at the cell surface are considered to be important mechanisms for controlling the strength of synaptic inhibition. Here, we report that BIG1, a brefeldin A (BFA)-inhibited guanine nucleotide-exchange factor (GEF) which has a known role in vesicle trafficking, is a new binding partner of GABAARs. Treatment of neurons with BFA, an uncompetitive inhibitor of BIG1 GEF activity, or depletion of BIG1 by small RNA interference (siRNA) significantly decreased GABAARs at the neuronal surface and suppressed GABA-gated influx of chloride ions. Over-expression of HA-tagged BIG1-E793K, a dominant-negative mutant, also significantly decreased GABAARs at the neuronal surface, but had no effect on the total amount of GABAARs. Inhibition of GABAAR endocytosis by muscimol increased both GABAARs and BIG1 at the neuronal surface in a time-dependent fashion, and this increase could be abolished by bicuculline. Finally, depletion of BIG1 by siRNA inhibited the muscimol-stimulated increase of GABAARs. Those data suggest an important function of BIG1 in trafficking of GABAARs to the cell surface through its GEF activity. Thus, we identify an important role of BIG1 in modulating GABA-gated Cl(-) influx through the regulation of cell surface expression of GABAARs.

  7. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila

    PubMed Central

    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it’s functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila. PMID:27015411

  8. Intersectin 1L Guanine Nucleotide Exchange Activity Is Regulated by Adjacent src Homology 3 Domains That Are Also Involved in Endocytosis

    PubMed Central

    Zamanian, Jennifer L.; Kelly, Regis B.


    Intersectin 1L is a scaffolding protein involved in endocytosis that also has guanine nucleotide exchange activity for Cdc42. In the context of the full-length protein, the catalytic exchange activity of the DH domain is repressed. Here we use biochemical methods to dissect the mechanism for this inhibition. We demonstrate that the intersectin 1L SH3 domains, which bind endocytic proteins, directly inhibit the activity of the DH domain in assays for both binding and exchange of Cdc42. This inhibitory mechanism seems to act through steric hindrance of Cdc42 binding by an intramolecular interaction between the intersectin 1L SH3 domain region and the adjacent DH domain. Surprisingly, the mode of SH3 domain binding is other than through the proline peptide binding pocket. The dual role of the SH3 domains in endocytosis and repression of exchange activity suggests that the intersectin 1L exchange activity is regulated by endocytosis. We show that the endocytic protein, dynamin, competes for binding to the SH3 domains with the neural Wiskott-Aldrich Syndrome protein, an actin filament nucleation protein that is a substrate for activated Cdc42. Swapping of SH3 domain binding partners might act as a switch controlling the actin nucleation activity of intersectin 1L. PMID:12686614

  9. The RhoA guanine nucleotide exchange factor, LARG, mediates ICAM-1-dependent mechanotransduction in endothelial cells to stimulate transendothelial migration.


    Lessey-Morillon, Elizabeth C; Osborne, Lukas D; Monaghan-Benson, Elizabeth; Guilluy, Christophe; O'Brien, E Timothy; Superfine, Richard; Burridge, Keith


    RhoA-mediated cytoskeletal rearrangements in endothelial cells (ECs) play an active role in leukocyte transendothelial cell migration (TEM), a normal physiological process in which leukocytes cross the endothelium to enter the underlying tissue. Although much has been learned about RhoA signaling pathways downstream from ICAM-1 in ECs, little is known about the consequences of the tractional forces that leukocytes generate on ECs as they migrate over the surface before TEM. We have found that after applying mechanical forces to ICAM-1 clusters, there is an increase in cellular stiffening and enhanced RhoA signaling compared with ICAM-1 clustering alone. We have identified that leukemia-associated Rho guanine nucleotide exchange factor (LARG), also known as Rho GEF 12 (ARHGEF12) acts downstream of clustered ICAM-1 to increase RhoA activity, and that this pathway is further enhanced by mechanical force on ICAM-1. Depletion of LARG decreases leukocyte crawling and inhibits TEM. To our knowledge, this is the first report of endothelial LARG regulating leukocyte behavior and EC stiffening in response to tractional forces generated by leukocytes.

  10. In vivo expression of the Arf6 Guanine-nucleotide exchange factor cytohesin-1 in mice exhibits enhanced myelin thickness in nerves.


    Torii, Tomohiro; Miyamoto, Yuki; Onami, Naoko; Tsumura, Hideki; Nemoto, Noriko; Kawahara, Katsumasa; Kato, Minoru; Kotera, Jun; Nakamura, Kazuaki; Tanoue, Akito; Yamauchi, Junji


    The myelin sheath consists of a unique multiple layer structure that acts as an insulator between neuronal axons to enhance the propagation of the action potential. In neuropathies such as demyelinating or dismyelinating diseases, chronic demyelination and defective remyelination occur repeatedly, leading to more severe neuropathy. As yet, little is known about the possibility of drug target-specific medicine for such diseases. In the developing peripheral nervous system (PNS), myelin sheaths form as Schwann cells wrap individual axons. It is thought that the development of a drug promoting myelination by Schwann cells would provide effective therapy against peripheral nerve disorders: to test such treatment, genetically modified mice overexpressing the drug target molecules are needed. We previously identified an Arf6 activator, the guanine-nucleotide exchange factor cytohesin-1, as the signaling molecule controlling myelination of peripheral axons by Schwann cells; yet, the important issue of whether cytohesin-1 itself promotes myelin thickness in vivo has remained unclear. Herein, we show that, in mouse PNS nerves, Schwann cell-specific expression of wild-type cytohesin-1 exhibits enhanced myelin thickness. Downstream activation of Arf6 is also seen in these transgenic mice, revealing the involvement of the cytohesin-1 and Arf6 signaling unit in promoting myelination. These results suggest that cytohesin-1 may be a candidate for the basis of a therapy for peripheral neuropathies through its enhancement of myelin thickness.

  11. Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions.

    PubMed Central

    Nakafuku, M; Obara, T; Kaibuchi, K; Miyajima, I; Miyajima, A; Itoh, H; Nakamura, S; Arai, K; Matsumoto, K; Kaziro, Y


    In a previous paper, we demonstrated that a gene coding for a protein homologous to the alpha subunit of mammalian guanine nucleotide-binding regulatory (G) proteins occurs in Saccharomyces cerevisiae. The gene, designated GPA1, encodes a protein (GP1 alpha) of 472 amino acids with a calculated Mr of 54,075. Here we report the isolation of another G-protein-homologous gene, GPA2, which encodes an amino acid sequence of 449 amino acid residues with a Mr of 50,516. The predicted primary structure of the GPA2-encoded protein (GP2 alpha) is homologous to mammalian G proteins [inhibitory and stimulatory G proteins (Gi and Gs, respectively), a G protein of unknown function (Go), and transducins (Gt)] as well as yeast GP1 alpha. When aligned with the alpha subunit of Gi (Gi alpha) to obtain maximal homology, GP2 alpha was found to contain a stretch of 83 additional amino acid residues near the NH2 terminus. The gene was mapped in chromosome V, close to the centromere. Haploid cells carrying a disrupted GPA2 gene are viable. Cells carrying a high copy number of plasmid GPA2 (YEpGPA2) had markedly elevated levels of cAMP and could suppress a temperature-sensitive mutation of RAS2. These results suggest that GPA2 may be involved in the regulation of cAMP levels in S. cerevisiae. Images PMID:2830616

  12. Essential role for vav Guanine nucleotide exchange factors in brain-derived neurotrophic factor-induced dendritic spine growth and synapse plasticity.


    Hale, Carly F; Dietz, Karen C; Varela, Juan A; Wood, Cody B; Zirlin, Benjamin C; Leverich, Leah S; Greene, Robert W; Cowan, Christopher W


    Brain-derived neurotrophic factor (BDNF) and its cognate receptor, TrkB, regulate a wide range of cellular processes, including dendritic spine formation and functional synapse plasticity. However, the signaling mechanisms that link BDNF-activated TrkB to F-actin remodeling enzymes and dendritic spine morphological plasticity remain poorly understood. We report here that BDNF/TrkB signaling in neurons activates the Vav family of Rac/RhoA guanine nucleotide exchange factors through a novel TrkB-dependent mechanism. We find that Vav is required for BDNF-stimulated Rac-GTP production in cortical and hippocampal neurons. Vav is partially enriched at excitatory synapses in the postnatal hippocampus but does not appear to be required for normal dendritic spine density. Rather, we observe significant reductions in both BDNF-induced, rapid, dendritic spine head growth and in CA3-CA1 theta burst-stimulated long-term potentiation in Vav-deficient mouse hippocampal slices, suggesting that Vav-dependent regulation of dendritic spine morphological plasticity facilitates normal functional synapse plasticity.

  13. Cloning and characterization of mouse UBPy, a deubiquitinating enzyme that interacts with the ras guanine nucleotide exchange factor CDC25(Mm)/Ras-GRF1.


    Gnesutta, N; Ceriani, M; Innocenti, M; Mauri, I; Zippel, R; Sturani, E; Borgonovo, B; Berruti, G; Martegani, E


    We used yeast "two-hybrid" screening to isolate cDNA-encoding proteins interacting with the N-terminal domain of the Ras nucleotide exchange factor CDC25(Mm). Three independent overlapping clones were isolated from a mouse embryo cDNA library. The full-length cDNA was cloned by RACE-polymerase chain reaction. It encodes a large protein (1080 amino acids) highly homologous to the human deubiquitinating enzyme hUBPy and contains a well conserved domain typical of ubiquitin isopeptidases. Therefore we called this new protein mouse UBPy (mUBPy). Northern blot analysis revealed a 4-kilobase mRNA present in several mouse tissues and highly expressed in testis; a good level of expression was also found in brain, where CDC25(Mm) is exclusively expressed. Using a glutathione S-transferase fusion protein, we demonstrated an "in vitro" interaction between mUBPy and the N-terminal half (amino acids 1-625) of CDC25(Mm). In addition "in vivo" interaction was demonstrated after cotransfection in mammalian cells. We also showed that CDC25(Mm), expressed in HEK293 cells, is ubiquitinated and that the coexpression of mUBPy decreases its ubiquitination. In addition the half-life of CDC25Mm protein was considerably increased in the presence of mUBPy. The specific function of the human homolog hUBPy is not defined, although its expression was correlated with cell proliferation. Our results suggest that mUBPy may play a role in controlling degradation of CDC25(Mm), thus regulating the level of this Ras-guanine nucleotide exchange factor.

  14. Insights into the Molecular Activation Mechanism of the RhoA-specific Guanine Nucleotide Exchange Factor, PDZRhoGEF

    SciTech Connect

    Bielnicki, Jakub A.; Shkumatov, Alexander V.; Derewenda, Urszula; Somlyo, Avril V.; Svergun, Dmitri I.; Derewenda, Zygmunt S.


    PDZRhoGEF (PRG) belongs to a small family of RhoA-specific nucleotide exchange factors that mediates signaling through select G-protein-coupled receptors via G{alpha}{sub 12/13} and activates RhoA by catalyzing the exchange of GDP to GTP. PRG is a multidomain protein composed of PDZ, regulators of G-protein signaling-like (RGSL), Dbl-homology (DH), and pleckstrin-homology (PH) domains. It is autoinhibited in cytosol and is believed to undergo a conformational rearrangement and translocation to the membrane for full activation, although the molecular details of the regulation mechanism are not clear. It has been shown recently that the main autoregulatory elements of PDZRhoGEF, the autoinhibitory 'activation box' and the 'GEF switch,' which is required for full activation, are located directly upstream of the catalytic DH domain and its RhoA binding surface, emphasizing the functional role of the RGSL-DH linker. Here, using a combination of biophysical and biochemical methods, we show that the mechanism of PRG regulation is yet more complex and may involve an additional autoinhibitory element in the form of a molten globule region within the linker between RGSL and DH domains. We propose a novel, two-tier model of autoinhibition where the activation box and the molten globule region act synergistically to impair the ability of RhoA to bind to the catalytic DH-PH tandem. The molten globule region and the activation box become less ordered in the PRG-RhoA complex and dissociate from the RhoA-binding site, which may constitute a critical step leading to PRG activation.

  15. Role of a guanine nucleotide-binding protein in. cap alpha. /sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells

    SciTech Connect

    Cornett, L.E.; Norris, J.S.


    In this study the mechanisms involved in ..cap alpha../sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization at the level of the plasma membrane were investigated. Stimulation of /sup 45/Ca/sup 2 +/ efflux from saponin-permeabilized DDT/sub 1/ MF-2 cells was observed with the addition of either the ..cap alpha../sub 1/-adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of (/sup 32/P) NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT/sub 1/, MF-2 cells, possibly the ..cap alpha..-subunit of N/sub i/. However, stimulation of unidirectional /sup 45/Ca/sup 2 +/ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the ..cap alpha../sub 1/-adrenergic receptor to Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family.

  16. Regulated Localization Is Sufficient for Hormonal Control of Regulator of G Protein Signaling Homology Rho Guanine Nucleotide Exchange Factors (RH-RhoGEFs)*

    PubMed Central

    Carter, Angela M.; Gutowski, Stephen; Sternweis, Paul C.


    The regulator of G protein signaling homology (RH) Rho guanine nucleotide exchange factors (RhoGEFs) (p115RhoGEF, leukemia-associated RhoGEF, and PDZ-RhoGEF) contain an RH domain and are specific GEFs for the monomeric GTPase RhoA. The RH domains interact specifically with the α subunits of G12 heterotrimeric GTPases. Activated Gα13 modestly stimulates the exchange activity of both p115RhoGEF and leukemia-associated RhoGEF but not PDZ-RhoGEF. Because all three RH-RhoGEFs can localize to the plasma membrane upon expression of activated Gα13, cellular localization of these RhoGEFs has been proposed as a mechanism for controlling their activity. We use a small molecule-regulated heterodimerization system to rapidly control the localization of RH-RhoGEFs. Acute localization of the proteins to the plasma membrane activates RhoA within minutes and to levels that are comparable with activation of RhoA by hormonal stimulation of G protein-coupled receptors. The catalytic activity of membrane-localized RhoGEFs is not dependent on activated Gα13. We further show that the conserved RH domains can rewire two different RacGEFs to activate Rac1 in response to a traditional activator of RhoA. Thus, RH domains act as independent detectors for activated Gα13 and are sufficient to modulate the activity of RhoGEFs by hormones via mediating their localization to substrate, membrane-associated RhoA. PMID:24855647

  17. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin

    PubMed Central

    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M.; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na+-H+ exchanger activity which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a Guanine-nucleotide Dissociation Inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organellar rearrangements that occur during oogenesis and embryonic development. PMID:21492154

  18. The product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein.

    PubMed Central

    Maier, T; Jacobi, A; Sauter, M; Böck, A


    The products of the hyp operon genes are essential for the formation of catalytically active hydrogenases in Escherichia coli. At least one of these auxiliary proteins, HYPB, appears to be involved in nickel liganding to the hydrogenase apoprotein, since mutations in hypB can be phenotypically suppressed by high nickel concentrations in the medium (R. Waugh and D. H. Boxer, Biochimie 68:157-166, 1986). To approach the identification of the specific function of HYPB, we overexpressed the hypB gene and purified and characterized the gene product. HYPB is a homodimer of 31.6-kDa subunits, and it binds guanine nucleotides, with a Kd for GDP of 1.2 microM. The protein displays a low level of GTPase activity, with a kcat of 0.17 min-1. The apparent Km for GTP, as measured in the GTP hydrolysis reaction, was determined to be 4 microM. A chromatography system was established to measure nickel insertion into hydrogenase 3 from E. coli and to determine the effects of lesions in hypB. Nickel appears to be associated only with the processed large subunit of hydrogenase 3 in the wild type, and hypB mutants accumulate the precursor form of this subunit, which is devoid of nickel. The results are discussed in terms of a model in which HYPB is involved in nickel donation to the hydrogenase apoprotein and in which GTP hydrolysis is thought to reverse the interaction between either HYPB or another nickel-binding protein and the hydrogenase apoprotein after the nickel has been released. Images PMID:8423137

  19. Serotonin-induced muscle contraction in rat stomach fundus is mediated by a G alpha z-like guanine nucleotide binding protein.


    Wang, H Y; Eberle-Wang, K; Simansky, K J; Friedman, E


    Serotonin (5-HT) potently contracts the fundus of the rat stomach; however, the associated transduction pathway has not been described fully. Experiments were performed in an attempt to gain insight into the coupling mechanism associated with this fundal 5-HT receptor. 5-HT-stimulated [35S]GTP gamma S binding to a protein which was recognized by anti-G alpha Z antiserum in a Mg(++)-dependent fashion. 5-HT increased [35S]GTP gamma S binding in the fundus, but not in the corpus of the rat stomach. 5-HT also enhanced the binding of [alpha-32P]GTP to the fundal protein and increased the hydrolysis of GTP to GDP in fundal membranes. The fundal protein which binds GTP is 25 to 29 kDa in size whereas the brain G alpha Z protein which is recognized by the anti-G alpha Z antibody is a 41 kDa protein. Mixing experiments revealed that the fundal guanine nucleotide binding protein does not appear to be a proteolytic product of the 41 kDa G alpha Z protein. Activating protein kinase C with phorbol-12-myristate, 13-acetate induced a concentration-dependent, noncompetitive inhibition of [35S]GTP gamma S binding to the fundal protein, and of 5-HT-induced contraction of fundal strips. Phorbol-12-myristate, 13-acetate did not alter carbachol- or KCl-mediated fundus contraction. Furthermore, the activation of [35S]GTP gamma S binding by serotonergic agonists and its inhibition by pharmacological antagonists corresponded to the known actions of these agents on contraction of fundal muscle. The results provide evidence that the 5-HT receptor in the rat stomach fundus is coupled directly or indirectly to a G alpha z-like protein which may mediate 5-HT-induced contraction in this tissue.

  20. Measurement of thyroid stimulating immunoglobulins using a novel thyroid stimulating hormone receptor-guanine nucleotide-binding protein, (GNAS) fusion bioassay.


    Pierce, M; Sandrock, R; Gillespie, G; Meikle, A W


    Hyperthyroidism, defined by overproduction of thyroid hormones, has a 2-3% prevalence in the population. The most common form of hyperthyroidism is Graves' disease. A diagnostic biomarker for Graves' disease is the presence of immunoglobulins which bind to, and stimulate, the thyroid stimulating hormone receptor (TSHR), a G-protein coupled receptor (GPCR). We hypothesized that the ectopically expressed TSHR gene in a thyroid stimulating immunoglobulin (TSI) assay could be engineered to increase the accumulation of the GPCR pathway second messenger, cyclic AMP (cAMP), the molecule measured in the assay as a marker for pathway activation. An ectopically expressing TSHR-mutant guanine nucleotide-binding protein, (GNAS) Chinese hamster ovary (CHO) cell clone was constructed using standard molecular biology techniques. After incubation of the new clone with sera containing various levels of TSI, GPCR pathway activation was then quantified by measuring cAMP accumulation in the clone. The clone, together with a NaCl-free cell assay buffer containing 5% polyethylene glycol (PEG)6000, was tested against 56 Graves' patients, 27 toxic thyroid nodule patients and 119 normal patients. Using receiver operating characteristic analysis, when comparing normal with Graves' sera, the assay yielded a sensitivity of 93%, a specificity of 99% and an efficiency of 98%. Total complex precision (within-run, across runs and across days), presented as a percentage coefficient of variation, was found to be 7·8, 8·7 and 7·6% for low, medium and high TSI responding serum, respectively. We conclude that the performance of the new TSI assay provides sensitive detection of TSI, allowing for accurate, early detection of Graves' disease.

  1. Architecture of the eIF2B regulatory subcomplex and its implications for the regulation of guanine nucleotide exchange on eIF2

    PubMed Central

    Kuhle, Bernhard; Eulig, Nora K.; Ficner, Ralf


    Eukaryal translation initiation factor 2B (eIF2B) acts as guanine nucleotide exchange factor (GEF) for eIF2 and forms a central target for pathways regulating global protein synthesis. eIF2B consists of five non-identical subunits (α–ϵ), which assemble into a catalytic subcomplex (γ, ϵ) responsible for the GEF activity, and a regulatory subcomplex (α, β, δ) which regulates the GEF activity under stress conditions. Here, we provide new structural and functional insight into the regulatory subcomplex of eIF2B (eIF2BRSC). We report the crystal structures of eIF2Bβ and eIF2Bδ from Chaetomium thermophilum as well as the crystal structure of their tetrameric eIF2B(βδ)2 complex. Combined with mutational and biochemical data, we show that eIF2BRSC exists as a hexamer in solution, consisting of two eIF2Bβδ heterodimers and one eIF2Bα2 homodimer, which is homologous to homohexameric ribose 1,5-bisphosphate isomerases. This homology is further substantiated by the finding that eIF2Bα specifically binds AMP and GMP as ligands. Based on our data, we propose a model for eIF2BRSC and its interactions with eIF2 that is consistent with previous biochemical and genetic data and provides a framework to better understand eIF2B function, the molecular basis for Gcn−, Gcd− and VWM/CACH mutations and the evolutionary history of the eIF2B complex. PMID:26384431

  2. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    SciTech Connect

    Tsukamoto, Yuta; Kagiwada, Satoshi; Shimazu, Sayuri; Takegawa, Kaoru; Noguchi, Tetsuko; Miyamoto, Masaaki


    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  3. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin.


    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na(+) -H(+) exchanger activity, which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a guanine-nucleotide dissociation inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organelle rearrangements that occur during oogenesis and embryonic development.

  4. (3H)WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    SciTech Connect

    Norman, A.B.; Battaglia, G.; Creese, I.


    In the presence of a 30 nM prazosin mask, (/sup 3/H)-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ((/sup 3/H)WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for (/sup 3/H) WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at (/sup 3/H)WB4101-binding sites in the presence of 30 nM prazosin and (/sup 3/H) lysergic acid diethylamide ((/sup 3/H)LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of (/sup 3/H)WB4101 is significantly lower than the Bmax of (/sup 3/H)LSD in various brain regions. WB4101 competition for (/sup 3/H) LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of (/sup 3/H)WB4101 binding derived from saturation experiments. This suggests that (/sup 3/H)WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by (/sup 3/H)LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for (/sup 3/H)WB4101 but compete for multiple (/sup 3/H)LSD 5-HT1 binding sites. These data indicate that (/sup 3/H)WB4101 selectively labels the 5-HT1A serotonin receptor, whereas (/sup 3/H) LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of (/sup 3/H)WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of (/sup 3/H)WB4101 binding.

  5. Regulation of follitropin-sensitive adenylate cyclase by stimulatory and inhibitory forms of the guanine nucleotide regulatory protein in immature rat Sertoli cells

    SciTech Connect

    Johnson, G.P.


    Studies have been designed to examine the role of guanine nucleotides in mediating FSH-sensitive adenylate cyclase activity in Sertoli cell plasma membranes. Analysis of ({sup 3}H)GDP binding to plasma membranes suggested a single high affinity site with a K{sub d} = 0.24 uM. Competition studies indicated that GTP{sub {gamma}}S was 7-fold more potent than GDP{sub {beta}}S. Bound GDP could be released by FSH in the presence of GTP{sub {gamma}}S, but not by FSH alone. Adenylate cyclase activity was enhanced 5-fold by FSH in the presence of GTP. Addition of GDP{sub {beta}}S to the activated enzyme (FSH plus GTP) resulted in a time-dependent decay to basal activity within 20 sec. GDP{sub {beta}}S competitively inhibited GTP{sub {gamma}}S-stimulated adenylate cyclase activity with a K{sub i} = 0.18 uM. Adenylate cyclase activity was also demonstrated to be sensitive to the nucleotide bound state. In the presence of FSH, only the GTP{sub {gamma}}S-bound form persisted even if GDP{sub {beta}}S previously occupied all available binding sites. Two membrane proteins, M{sub r} = 43,000 and 48,000, were ADP{centered dot}ribosylated using cholera toxin and labeling was enhanced 2 to 4-fold by GTP{sub {gamma}}S but not by GDP{sub {beta}}S. The M{sub r} = 43,000 and 48,000 proteins represented variant forms of G{sub S}. A single protein of M{sub r} = 40,000 (G{sub i}) was ADP-ribosylated by pertussis toxin in vitro. GTP inhibited forskolin-stimulated adenylate cyclase activity with an IC{sub 50} = 0.1 uM. The adenosine analog, N{sup 6}{centered dot}phenylisopropyl adenosine enhanced GTP inhibition of forskolin-stimulated adenylate cyclase activity by an additional 15%. GTP-dependent inhibition of forskolin-sensitive adenylate cyclase activity was abolished in membranes prepared from Sertoli cells treated in culture with pertussis toxin.

  6. Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the. alpha. subunit of the stimulatory guanine nucleotide-binding regulatory protein

    SciTech Connect

    Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G. )


    ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the {alpha} subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost, a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5{prime}-({alpha}-{sup 32}P)triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an {alpha} subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera.

  7. Guanine nucleotide exchange factor 2 for Rab5 proteins coordinated with GLUP6/GEF regulates the intracellular transport of the proglutelin from the Golgi apparatus to the protein storage vacuole in rice endosperm.


    Wen, Liuying; Fukuda, Masako; Sunada, Mariko; Ishino, Sonoko; Ishino, Yoshizumi; Okita, Thomas W; Ogawa, Masahiro; Ueda, Takashi; Kumamaru, Toshihiro


    Rice glutelin polypeptides are initially synthesized on the endoplasmic reticulum (ER) membrane as a proglutelin, which are then transported to the protein storage vacuole (PSV) via the Golgi apparatus. Rab5 and its cognate activator guanine nucleotide exchange factor (GEF) are essential for the intracellular transport of proglutelin from the Golgi apparatus to the PSV. Results from previous studies showed that the double recessive type of glup4/rab5a and glup6/gef mutant accumulated much higher amounts of proglutelin than either parent line. The present study demonstrates that the double recessive type of glup4/rab5a and glup6/gef mutant showed not only elevated proglutelin levels and much larger paramural bodies but also reduced the number and size of PSVs, indicating a synergistic mutation effect. These observations led us to the hypothesis that other isoforms of Rab5 and GEF also participate in the intracellular transport of rice glutelin. A database search identified a novel guanine nucleotide exchange factor, Rab5-GEF2. Like GLUP6/GEF, Rab5-GEF2 was capable of activating Rab5a and two other Rab5 isoforms in in vitro GTP/GDP exchange assays. GEF proteins consist of the helical bundle (HB) domain at the N-terminus, Vps9 domain, and a C-terminal region. By the deletion analysis of GEFs, the HB domain was found essential for the activation of Rab5 proteins.

  8. Small-GTPase-Associated Signaling by the Guanine Nucleotide Exchange Factors CpDock180 and CpCdc24, the GTPase Effector CpSte20, and the Scaffold Protein CpBem1 in Claviceps purpurea

    PubMed Central

    Herrmann, Andrea; Tillmann, Britta A. M.; Schürmann, Janine; Bölker, Michael


    Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea. PMID:24489041

  9. Specific and nonspecific metal ion-nucleotide interactions at aqueous/solid interfaces functionalized with adenine, thymine, guanine, and cytosine oligomers.


    Holland, Joseph G; Malin, Jessica N; Jordan, David S; Morales, Esmeralda; Geiger, Franz M


    This article reports nonlinear optical measurements that quantify, for the first time directly and without labels, how many Mg(2+) cations are bound to DNA 21-mers covalently linked to fused silica/water interfaces maintained at pH 7 and 10 mM NaCl, and what the thermodynamics are of these interactions. The overall interaction of Mg(2+) with adenine, thymine, guanine, and cytosine is found to involve -10.0 ± 0.3, -11.2 ± 0.3, -14.0 ± 0.4, and -14.9 ± 0.4 kJ/mol, and nonspecific interactions with the phosphate and sugar backbone are found to contribute -21.0 ± 0.6 kJ/mol for each Mg(2+) ion bound. The specific and nonspecific contributions to the interaction energy of Mg(2+) with oligonucleotide single strands is found to be additive, which suggests that within the uncertainty of these surface-specific experiments, the Mg(2+) ions are evenly distributed over the oligomers and not isolated to the most strongly binding nucleobase. The nucleobases adenine and thymine are found to bind only three Mg(2+) ions per 21-mer oligonucleotide, while the bases cytosine and guanine are found to bind eleven Mg(2+) ions per 21-mer oligonucleotide.

  10. Regulation of neutrophil NADPH oxidase activation in a cell-free system by guanine nucleotides and fluoride. Evidence for participation of a pertussis and cholera toxin-insensitive G protein.


    Gabig, T G; English, D; Akard, L P; Schell, M J


    Guanine nucleotide-binding regulatory proteins (G proteins) transduce a remarkably diverse group of extracellular signals to a relatively limited number of intracellular target enzymes. In the neutrophil, transduction of the signal following fMet-Leu-Phe receptor-ligand interaction is mediated by a pertussis toxin substrate (Gi) that activates inositol-specific phospholipase C. We have utilized a plasma membrane-containing fraction from unstimulated human neutrophils as the target enzyme to explore the role of G proteins in arachidonate and cytosolic cofactor-dependent activation of the NADPH-dependent O-2-generating oxidase. When certain guanine nucleotides or their nonhydrolyzable analogues were present during arachidonate and cytosolic cofactor-dependent activation, they exerted substantial dose-dependent effects. The GTP analogue, GTP gamma S, caused a 2-fold increase in NADPH oxidase activation (half-maximal stimulation, 1.1 microM). Either GDP or its nonhydrolyzable analogue, GDP beta S, inhibited up to 80% of the basal NADPH oxidase activation (Ki GDP = 0.12 mM, GDP beta S = 0.23 mM). GTP caused only slight and variable stimulation, whereas F-, an agent known to promote the active conformation of G proteins, caused a 1.6-fold stimulation of NADPH oxidase activation. NADPH oxidase activation in the cell-free system was absolutely and specifically dependent on Mg2+. Although O2- production in response to fMet-Leu-Phe was inhibited greater than 90% in neutrophils pretreated with pertussis toxin, cytosolic cofactor and target oxidase membranes from neutrophils treated with pertussis toxin showed no change in basal- or GTP gamma S-stimulated NADPH oxidase activation. Cholera toxin treatment of neutrophils also had no effect on the cell-free activation system. Our results suggest a role for a G protein that is distinct from Gs or Gi in the arachidonate and cytosolic cofactor-dependent NADPH oxidase cell-free activation system.

  11. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function.


    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Jia, Lei; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E


    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue-DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision

  12. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.


    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide

  13. Leucine Zipper Down-regulated in Cancer-1 (LDOC1) interacts with Guanine nucleotide binding protein-like 3-like (GNL3L) to modulate Nuclear Factor-kappa B (NF-κB) signaling during cell proliferation.


    Thoompumkal, Indu Jose; Rehna, Krishnan; Anbarasu, Kumaraswamy; Mahalingam, Sundarasamy


    Guanine nucleotide binding protein-like 3-like (GNL3L) is an evolutionarily conserved putative nucleolar GTPase belonging to the HSR1-MMR1 family. In the present study, using protein-protein interaction assays, we show that Leucine Zipper Down-regulated in Cancer-1 (LDOC1) is a novel interacting partner of GNL3L. Furthermore, our results reveal that ectopic expression of LDOC1 destabilizes endogenous GNL3L levels and down modulates GNL3L-induced cell proliferation, in contrast, the knockdown of LDOC1 potentiates cell proliferation upon GNL3L expression. Interestingly, GNL3L upregulates NF-κB dependent transcriptional activity by modulating the expression of NF-κB subunit p65, which is reversed upon co-expression of LDOC1 with GNL3L. GNL3L also potentiates TNF-α mediated NF-κB activity. In addition, anti-apoptotic function of GNL3L is impaired upon p65 knockdown, suggesting its critical role in GNL3L mediated cell proliferation/survival. An inverse correlation of GNL3L and LDOC1 expression profiles in various tumor tissues from BioXpress database indicate their critical role in cancer. Collectively, our data provides evidence that GNL3L-LDOC1 interplay regulates cell proliferation through the modulation of NF-κB pathway during tumorigenesis.

  14. PKR and GCN2 kinases and guanine nucleotide exchange factor eukaryotic translation initiation factor 2B (eIF2B) recognize overlapping surfaces on eIF2alpha.


    Dey, Madhusudan; Trieselmann, Bruce; Locke, Emily G; Lu, Jingfang; Cao, Chune; Dar, Arvin C; Krishnamoorthy, Thanuja; Dong, Jinsheng; Sicheri, Frank; Dever, Thomas E


    Four stress-responsive protein kinases, including GCN2 and PKR, phosphorylate eukaryotic translation initiation factor 2alpha (eIF2alpha) on Ser51 to regulate general and gene-specific protein synthesis. Phosphorylated eIF2 is an inhibitor of its guanine nucleotide exchange factor, eIF2B. Mutations that block translational regulation were isolated throughout the N-terminal OB-fold domain in Saccharomyces cerevisiae eIF2alpha, including those at residues flanking Ser51 and around 20 A away in the conserved motif K79GYID83. Any mutation at Glu49 or Asp83 blocked translational regulation; however, only a subset of these mutations impaired Ser51 phosphorylation. Substitution of Ala for Asp83 eliminated phosphorylation by GCN2 and PKR both in vivo and in vitro, establishing the critical contributions of remote residues to kinase-substrate recognition. In contrast, mutations that blocked translational regulation but not Ser51 phosphorylation impaired the binding of eIF2B to phosphorylated eIF2alpha. Thus, two structurally distinct effectors of eIF2 function, eIF2alpha kinases and eIF2B, have evolved to recognize the same surface and overlapping determinants on eIF2alpha.

  15. Brefeldin A-Inhibited Guanine Nucleotide-Exchange Factor 1 (BIG1) Governs the Recruitment of Tumor Necrosis Factor Receptor-Associated Factor 2 (TRAF2) to Tumor Necrosis Factor Receptor 1 (TNFR1) Signaling Complexes

    PubMed Central

    Noguchi, Takuya; Tsuchida, Mei; Kogue, Yosuke; Spadini, Christian; Hirata, Yusuke; Matsuzawa, Atsushi


    Tumor necrosis factor receptor-associated factor 2 (TRAF2) is a critical mediator of tumor necrosis factor-α (TNF-α) signaling. However, the regulatory mechanisms of TRAF2 are not fully understood. Here we show evidence that TRAF2 requires brefeldin A-inhibited guanine nucleotide-exchange factor 1 (BIG1) to be recruited into TNF receptor 1 (TNFR1) signaling complexes. In BIG1 knockdown cells, TNF-α-induced c-Jun N-terminal kinase (JNK) activation was attenuated and the sensitivity to TNF-α-induced apoptosis was increased. Since these trends correlated well with those of TRAF2 deficient cells as previously demonstrated, we tested whether BIG1 functions as an upstream regulator of TRAF2 in TNFR1 signaling. As expected, we found that knockdown of BIG1 suppressed TNF-α-dependent ubiquitination of TRAF2 that is required for JNK activation, and impaired the recruitment of TRAF2 to the TNFR1 signaling complex (complex I). Moreover, we found that the recruitment of TRAF2 to the death-inducing signaling complex termed complex II was also impaired in BIG1 knockdown cells. These results suggest that BIG1 is a key component of the machinery that drives TRAF2 to the signaling complexes formed after TNFR1 activation. Thus, our data demonstrate a novel and unexpected function of BIG1 that regulates TNFR1 signaling by targeting TRAF2. PMID:27834853

  16. Nucleotide excision repair of 2-acetylaminofluorene- and 2-aminofluorene-(C8)-guanine adducts: molecular dynamics simulations elucidate how lesion structure and base sequence context impact repair efficiencies.


    Mu, Hong; Kropachev, Konstantin; Wang, Lihua; Zhang, Lu; Kolbanovskiy, Alexander; Kolbanovskiy, Marina; Geacintov, Nicholas E; Broyde, Suse


    Nucleotide excision repair (NER) efficiencies of DNA lesions can vary by orders of magnitude, for reasons that remain unclear. An example is the pair of N-(2'-deoxyguanosin-8-yl)-2-aminofluorene (dG-C8-AF) and N-(2'-deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-C8-AAF) adducts that differ by a single acetyl group. The NER efficiencies in human HeLa cell extracts of these lesions are significantly different when placed at G(1), G(2) or G(3) in the duplex sequence (5'-CTCG(1)G(2)CG(3)CCATC-3') containing the NarI mutational hot spot. Furthermore, the dG-C8-AAF adduct is a better substrate of NER than dG-C8-AF in all three NarI sequence contexts. The conformations of each of these adducts were investigated by Molecular dynamics (MD) simulation methods. In the base-displaced conformational family, the greater repair susceptibility of dG-C8-AAF in all sequences stems from steric hindrance effects of the acetyl group which significantly diminish the adduct-base stabilizing van der Waals stacking interactions relative to the dG-C8-AF case. Base sequence context effects for each adduct are caused by differences in helix untwisting and minor groove opening that are derived from the differences in stacking patterns. Overall, the greater NER efficiencies are correlated with greater extents of base sequence-dependent local untwisting and minor groove opening together with weaker stacking interactions.

  17. Evidence from photoaffinity labelling studies for coupling of the alpha/sub 1/-adrenergic receptor to a guanine-nucleotide (G) binding protein

    SciTech Connect

    Graham, R.M.; Sena, L.; Schwarz, K.R.; Homcy, C.J.


    In contrast to ..beta..- and ..cap alpha../sub 2/-adrenergic receptors the role of a G-protein in signal transduction at ..cap alpha..-adrenergic receptors has been difficult to define. Using rat hepatic membranes prepared to avoid retention of endogenous nucleotides and activation of Ca/sup 2 +/-sensitive proteases, a Gpp(NH)p shift in agonist ((-)epinephrine) affinity from an IC/sub 50/ 10/sup -6/ to 5 x 10/sup -5/ M was readily demonstrable in competition studies with the ..cap alpha../sub 1/-specific radioligand (/sup 3/H)prazosin, but was not observed in membranes prepared without protease inhibitors (PIs). Labelling of these membranes with the photolabile prazosin analog, (/sup 125/I)CP65,526, followed by SDS-PAGE/autoradiography revealed a predominant, specifically labelled protein of M/sub r/ = 80,000, whereas a M/sub r/ = 59,000 peptide was evident with membranes prepared in the absence of PIs. The IC/sub 50/ for inhibition of labelling of the M/sub r/ = 80,000 peptide by (-)epinephrine, as determined by radiochromatogram scanning of autoradiographs of the photolabelled receptor, shifted from 10/sup -7/ to 10/sup -6/ in the presence of Gpp(NH)p. However, no shift in agonist affinity at the M/sub r/ = 59,000 peptide was evident in membranes prepared without PIs. This approach provides visual evidence for a G-protein-mediated shift in agonist affinity at the ..cap alpha../sub 1/-adrenergic receptor and allows a correlation between subunit size analysis and ligand binding.

  18. Voltage-gated ion channel Kv4.3 is associated with Rap guanine nucleotide exchange factors and regulates angiotensin receptor type 1 signaling to small G-protein Rap.


    Potapova, Irina A; Cohen, Ira S; Doronin, Sergey V


    The voltage-gated potassium channel Kv4.3 was coexpressed with its beta-subunit Kv channel-interacting protein 2 and the angiotensin type 1 receptor in HEK-293 cells. Proteomic analysis of proteins coimmunoprecipitated with Kv4.3 revealed that Kv4.3 is associated with Rap guanine nucleotide exchange factors MR-GEF and EPAC-1. Previously, we demonstrated that Kv4.3 interacts with the angiotensin type 1 receptor in HE293 cells and cardiac myocytes. On the basis of this, we investigated the angiotensin type 1 receptor signaling to small G-proteins Ras and Rap-1 in the presence and absence of the Kv4.3-Kv channel-interacting protein 2 macromolecular complex. Ras activation was not significantly affected by coexpression of Kv4.3 and Kv channel-interacting protein 2. Ras exhibited a rapid activation-inactivation pattern with maximum activity at 2.5 min after addition of angiotensin II. In contrast, activation of Rap-1 was affected dramatically by coexpression of Kv4.3 and Kv channel-interacting protein 2 with the angiotensin type 1 receptor. In the absence of Kv4.3 and Kv channel-interacting protein 2, stimulation of the angiotensin type 1 receptor resulted in steady activation of Rap-1 that reached a plateau 25 min after addition of angiotensin II. In the presence of Kv4.3 and Kv channel-interacting protein 2, Rap-1 reaches a maximum activity 2.5 min after addition of angiotensin II and then deactivates rapidly, demonstrating a pattern of activation similar to that of Ras. Our findings show that Kv4.3 regulates angiotensin type 1 receptor signaling to the small G-protein Rap-1.

  19. Crucial Role of Rapgef2 and Rapgef6, a Family of Guanine Nucleotide Exchange Factors for Rap1 Small GTPase, in Formation of Apical Surface Adherens Junctions and Neural Progenitor Development in the Mouse Cerebral Cortex123

    PubMed Central

    Maeta, Kazuhiro; Edamatsu, Hironori; Nishihara, Kaori; Ikutomo, Junji; Bilasy, Shymaa E.


    Abstract Cerebral neocortex development in mammals requires highly orchestrated events involving proliferation, differentiation, and migration of neural progenitors and neurons. Rapgef2 and Rapgef6 constitute a unique family of guanine nucleotide exchange factors for Rap1 small GTPase, which is known to play crucial roles in migration of postmitotic neurons. We previously reported that conditional knockout of Rapgef2 in dorsal telencephalon (Rapgef2-cKO) resulted in the formation of an ectopic cortical mass (ECM) resembling that of subcortical band heterotopia. Here we show that double knockout of Rapgef6 in Rapgef2-cKO mice (Rapgef2/6-dKO) results in marked enlargement of the ECM. While Rapgef2-cKO affects late-born neurons only, Rapgef2/6-dKO affects both early-born and late-born neurons. The Rapgef2-cKO cortex at embryonic day (E) 15.5, and the Rapgef2/6-dKO cortex at E13.5 and E15.5 show disruption of the adherens junctions (AJs) on the apical surface, detachment of radial glial cells (RGCs) from the apical surface and disorganization of the radial glial fiber system, which are accompanied by aberrant distribution of RGCs and intermediate progenitors, normally located in the ventricular zone and the subventricular zone, respectively, over the entire cerebral cortex. Moreover, intrauterine transduction of Cre recombinase into the Rapgef2flox/flox brains also results in the apical surface AJ disruption and the RGC detachment from the apical surface, both of which are effectively suppressed by cotransduction of the constitutively active Rap1 mutant Rap1G12V. These results demonstrate a cell-autonomous role of the Rapgef2/6-Rap1 pathway in maintaining the apical surface AJ structures, which is necessary for the proper development of neural progenitor cells. PMID:27390776

  20. The Tumor-suppressive Small GTPase DiRas1 Binds the Noncanonical Guanine Nucleotide Exchange Factor SmgGDS and Antagonizes SmgGDS Interactions with Oncogenic Small GTPases.


    Bergom, Carmen; Hauser, Andrew D; Rymaszewski, Amy; Gonyo, Patrick; Prokop, Jeremy W; Jennings, Benjamin C; Lawton, Alexis J; Frei, Anne; Lorimer, Ellen L; Aguilera-Barrantes, Irene; Mackinnon, Alexander C; Noon, Kathleen; Fierke, Carol A; Williams, Carol L


    The small GTPase DiRas1 has tumor-suppressive activities, unlike the oncogenic properties more common to small GTPases such as K-Ras and RhoA. Although DiRas1 has been found to be a tumor suppressor in gliomas and esophageal squamous cell carcinomas, the mechanisms by which it inhibits malignant phenotypes have not been fully determined. In this study, we demonstrate that DiRas1 binds to SmgGDS, a protein that promotes the activation of several oncogenic GTPases. In silico docking studies predict that DiRas1 binds to SmgGDS in a manner similar to other small GTPases. SmgGDS is a guanine nucleotide exchange factor for RhoA, but we report here that SmgGDS does not mediate GDP/GTP exchange on DiRas1. Intriguingly, DiRas1 acts similarly to a dominant-negative small GTPase, binding to SmgGDS and inhibiting SmgGDS binding to other small GTPases, including K-Ras4B, RhoA, and Rap1A. DiRas1 is expressed in normal breast tissue, but its expression is decreased in most breast cancers, similar to its family member DiRas3 (ARHI). DiRas1 inhibits RhoA- and SmgGDS-mediated NF-κB transcriptional activity in HEK293T cells. We also report that DiRas1 suppresses basal NF-κB activation in breast cancer and glioblastoma cell lines. Taken together, our data support a model in which DiRas1 expression inhibits malignant features of cancers in part by nonproductively binding to SmgGDS and inhibiting the binding of other small GTPases to SmgGDS.

  1. Ginseng (Panax quinquefolius) attenuates leptin-induced cardiac hypertrophy through inhibition of p115Rho guanine nucleotide exchange factor-RhoA/Rho-associated, coiled-coil containing protein kinase-dependent mitogen-activated protein kinase pathway activation.


    Moey, Melissa; Rajapurohitam, Venkatesh; Zeidan, Asad; Karmazyn, Morris


    Leptin is a 16-kDa peptide primarily derived from white adipocytes and is typically elevated in plasma of obese individuals. Although leptin plays a critical role in appetite regulation, leptin receptors have been identified in numerous tissues including the heart and have been shown to directly mediate cardiac hypertrophy through RhoA/ROCK (Ras homolog gene family, member A/Rho-associated, coiled-coil containing protein kinase)-dependent p38 mitogen-activated protein kinase (MAPK) activation; however, the basis for RhoA stimulation is unknown. Rho guanine nucleotide exchange factors (GEFs) catalyze the exchange of GDP for GTP resulting in Rho activation and may be the potential upstream factors mediating leptin-induced RhoA activation and therefore a potential target for inhibition. We investigated the effects of North American ginseng (Panax quinquefolius), reported to reduce cardiac hypertrophy, on RhoA/ROCK and MAPK activation in ventricular cardiomyocytes exposed to leptin (50 ng/ml) and the possible role of p115RhoGEF and p63RhoGEF in these responses. Leptin produced a robust hypertrophic response that was associated with RhoA/ROCK activation resulting in a significant increase in cofilin-2 phosphorylation and actin polymerization, the latter evidenced by a reduction in the G/F actin ratio. These effects were prevented by ginseng (10 μg/ml). The stimulation of RhoA/ROCK by leptin was associated with significantly increased p115RhoGEF gene and protein expression and exchange activity, all of which were completely prevented by ginseng. The ability of ginseng to prevent leptin-induced activation of RhoA/ROCK was further associated with diminished p38 MAPK activation and nuclear translocation. These results demonstrate a potent inhibitory effect of ginseng against leptin-induced cardiac hypertrophy, an effect associated with prevention of p115RhoGEF-RhoA/ROCK-dependent p38 MAPK activation.

  2. On the use of the transmembrane domain of bacteriorhodopsin as a template for modeling the three-dimensional structure of guanine nucleotide-binding regulatory protein-coupled receptors.

    PubMed Central

    Pardo, L; Ballesteros, J A; Osman, R; Weinstein, H


    The molecular architecture of bacteriorhodopsin (BR) is commonly regarded as a structural template for the three-dimensional structure of membrane receptors that are functionally coupled to guanine nucleotide-binding regulatory proteins (GPCR). More recently, specific molecular models of such GPCR were constructed on the basis of the functional and structural relation of rhodopsin to BR as well as the sequence homology between rhodopsin and the GPCR. Such models of GPCR leave unresolved the difficulty caused by the apparent lack of any significant degree of sequence homology between the seven transmembrane helices (TMH) of BR and the portions in the sequence of the various GPCR that are considered to constitute their transmembrane domains. Evolutionary arguments offered in favor of the structural relation between BR and the opsins, and hence the GPCR, prompted our investigation of the possibility that the sequence homology, including any similarity in the distribution of kink-inducing proline residues among the helices, might have been obscured by the assumption that the TMH maintained their sequential order from BR in the evolution of the mammalian proteins. With a definition of the TMH in the neurotransmitter GPCR guided by hydropathicity predictions, and additional criteria used to define the span of each helix, optimal alignment of each pair of sequences was determined with no gaps allowed in the matching. The resulting alignment proposed here reveals considerable homology between the TMH in BR and those in GPCR, if the sequential order of the helices is ignored. These findings suggest the possibility that exon shuffling could have occurred in the proposed evolution of the GPCR gene from BR and point to a modification of the BR template to account for the correct packing of the helices in the tertiary structures of GPCR. These findings could guide the construction of three-dimensional models of the neurotransmitter GPCR on the basis of specific interhelical

  3. The Chromobacterium violaceum type III effector CopE, a guanine nucleotide exchange factor for Rac1 and Cdc42, is involved in bacterial invasion of epithelial cells and pathogenesis.


    Miki, Tsuyoshi; Akiba, Kinari; Iguchi, Mirei; Danbara, Hirofumi; Okada, Nobuhiko


    The type III secretion system (T3SS) encoded by Chromobacterium pathogenicity islands 1 and 1a (Cpi-1/-1a) is critical for Chromobacterium violaceum pathogenesis. T3SS-dependent virulence is commonly characterized by type III effector virulence function, but the full repertoire of the effector proteins of Cpi-1/-1a T3SS is unknown. In this study, we showed that expression of Cpi-1/-1a T3SS is controlled by the master regulator CilA. We used transcriptional profiling with DNA microarrays to define CilA regulon and identified genes encoding T3SS effectors whose translocation into host cells was dependent on Cpi-1/-1a T3SS. From these effectors, we found that CopE (CV0296) has similarities to a guanine nucleotide exchange factor (GEF) for Rho GTPases in its C-terminal portion. The N-terminal portions (1-81 amino acids) of CopE and a CivB as a putative chaperone were required for its translocation. CopE specifically activates Rac1 and Cdc42 followed by the induction of actin cytoskeletal rearrangement. Interestingly, C. violaceum invades human epithelial HeLa cells in a Cpi-1/-1a-encoded T3SS- and CopE-dependent manner. Finally, C. violaceum strains lacking copE and expressing a CopE-G168V deficient in GEF activity were attenuated for virulence in mice, suggesting that CopE contributes to the virulence of this pathogen.

  4. Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    SciTech Connect

    Grasso, P.; Reichert, L.E. Jr. )


    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel.

  5. 1,25-Dihydroxyvitamin D3 attenuates adenylyl cyclase activity in rat thyroid cells: reduction of thyrotropin receptor number and increase in guanine nucleotide-binding protein Gi-2 alpha.


    Berg, J P; Sandvik, J A; Ree, A H; Sørnes, G; Bjøro, T; Torjesen, P A; Gordeladze, J O; Haug, E


    1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] is the most potent of the naturally occurring vitamin D metabolites. In rat thyroid FRTL-5 cells, 1,25-(OH)2D3 attenuated the increase in TSH-stimulated adenylyl cyclase activity obtained by removing TSH from the culture medium. When cells were incubated with 1,25-(OH)2D3 (10 nmol/liter; 4 days), the binding capacity for specific [125I]TSH binding decreased from 20.1 +/- 1.8 to 8.8 +/- 1.6 fmol/10(6) cells (mean +/- SEM; n = 4; P < 0.01) compared to that in control cells. The Kd did not change (mean +/- SEM, 0.46 +/- 0.09 vs. 0.25 +/- 0.07 nmol/liter; n = 4; P = NS). Western blotting revealed no change in the membrane content of the adenylyl cyclase (AC) stimulatory guanine nucleotide-binding protein (G-protein) alpha-subunit (Gs alpha) during 1,25-(OH)2D3 treatment. Similarly, levels of the AC inhibitory G-protein Gi-3 alpha- and G-protein beta-subunits were not altered by 1,25-(OH)2D3. However, Western blotting with antibodies recognizing both Gi-1 alpha and Gi-2 alpha was augmented 4-fold, presumably representing an increase in Gi-2 alpha only, as Gi-1 alpha messenger RNA (mRNA) was not detected in FRTL-5 cells. 1,25-(OH)2D3 (10 nmol/liter; 4 days) reduced cholera toxin (10 nmol/liter)-stimulated AC activity to 85% of the control value (P < 0.05), whereas forskolin (100 mumol/liter)-stimulated direct activation of AC was inhibited by 39%. The TSH receptor mRNA level correlated to the beta-actin mRNA was 2-fold higher in control cells compared to that in 1,25-(OH)2D3-treated cells 12 h after TSH removal. Only minor alterations in the Gs alpha mRNA/beta-actin mRNA and Gi-3 alpha mRNA/beta-actin mRNA ratios were observed during 1,25-(OH)2D3 treatment, whereas Gi-2 alpha mRNA increased 3-fold compared to that in control cells. No change in the resting intracellular Ca2+ concentration could be detected after 4 days of 1,25-(OH)2D3 treatment. Our studies show that 1,25-(OH)2D3 attenuates AC activity by reducing the TSH receptor

  6. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.


    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides.

  7. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed Central

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides. PMID:7177848

  8. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 1 2013-04-01 2013-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  9. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 1 2014-04-01 2014-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  10. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 1 2012-04-01 2012-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  11. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  12. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i)...

  13. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents...

  14. Bacterial Ammeline Metabolism via Guanine Deaminase ▿

    PubMed Central

    Seffernick, Jennifer L.; Dodge, Anthony G.; Sadowsky, Michael J.; Bumpus, John A.; Wackett, Lawrence P.


    Melamine toxicity in mammals has been attributed to the blockage of kidney tubules by insoluble complexes of melamine with cyanuric acid or uric acid. Bacteria metabolize melamine via three consecutive deamination reactions to generate cyanuric acid. The second deamination reaction, in which ammeline is the substrate, is common to many bacteria, but the genes and enzymes responsible have not been previously identified. Here, we combined bioinformatics and experimental data to identify guanine deaminase as the enzyme responsible for this biotransformation. The ammeline degradation phenotype was demonstrated in wild-type Escherichia coli and Pseudomonas strains, including E. coli K12 and Pseudomonas putida KT2440. Bioinformatics analysis of these and other genomes led to the hypothesis that the ammeline deaminating enzyme was guanine deaminase. An E. coli guanine deaminase deletion mutant was deficient in ammeline deaminase activity, supporting the role of guanine deaminase in this reaction. Two guanine deaminases from disparate sources (Bradyrhizobium japonicum USDA 110 and Homo sapiens) that had available X-ray structures were purified to homogeneity and shown to catalyze ammeline deamination at rates sufficient to support bacterial growth on ammeline as a sole nitrogen source. In silico models of guanine deaminase active sites showed that ammeline could bind to guanine deaminase in a similar orientation to guanine, with a favorable docking score. Other members of the amidohydrolase superfamily that are not guanine deaminases were assayed in vitro, and none had substantial ammeline deaminase activity. The present study indicated that widespread guanine deaminases have a promiscuous activity allowing them to catalyze a key reaction in the bacterial transformation of melamine to cyanuric acid and potentially contribute to the toxicity of melamine. PMID:20023034

  15. Nucleotide capacitance calculation for DNA sequencing

    SciTech Connect

    Lu, Jun-Qiang; Zhang, Xiaoguang


    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nano-gap electrodes may not sufficient to be used as a stand alone method for rapid DNA sequencing, the capacitance of the nucleotides should be taken into consideration in any GHz-frequency electric measurements and may also serve as an additional criterion for identifying the DNA sequence.

  16. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.


    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  17. Identification of N2-(1-carboxyethyl)guanine (CEG) as a guanine advanced glycosylation end product.


    Papoulis, A; al-Abed, Y; Bucala, R


    Reducing sugars such as glucose react nonenzymatically with protein amino groups to initiate a posttranslational modification process known as advanced glycosylation. Nucleotide bases also participate in advanced glycosylation reactions, producing DNA-linked advanced glycosylation endproducts (AGEs) that cause mutations and DNA transposition. Although several protein-derived AGEs have been isolated and structurally characterized, AGE-modified nucleotides have not yet been reported. We systematically examined the reactivities of the model nucleotide bases 9-methylguanine (9-mG), 9-methyladenine (9-mA), and 1-methylcytosine (1-mC) toward glucose and several glucose-derived reactants. In "fast" reactions performed at refluxing temperature and physiological pH, 1 equiv of nucleotide base was reacted with 10 equiv of D-glucose, D-glucose 6-phosphate (G-6-P), D-glucose 6-phosphate/lysine (G-6-P/Lys), the Schiff base 1-n-propylamino-N-D-glucoside (SB), or the Amadori product 1-n-propylamino-N-D-fructose (AP). In every reaction involving 9-mG, N2-(1-carboxyethyl)-9-methylguanine (CEmG) was a major product which was produced. N2-(1-carboxyethyl)-9-methylguanine also formed from 9-mG and AP in long-term incubations performed at 37 degrees C. Direct treatment of 9-mG with methylglyoxal (MG), a Maillard reaction propagator that forms from the decomposition of AP, also produced CEmG in high yield. N2-(1-Carboxyethyl)-9-methylguanine appears to result from the nucleophilic addition of the primary amino group of guanine to the ketone group of MG followed by an intramolecular rearrangement. Methylglyoxal is a known prokaryotic mutagen and was shown additionally to be mutagenic in a eukaryotic shuttle vector assay system.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  19. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  20. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  1. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  2. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    SciTech Connect

    Yeh, Hsin-chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S


    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  3. Guanyl nucleotides modulate binding to steroid receptors in neuronal membranes.

    PubMed Central

    Orchinik, M; Murray, T F; Franklin, P H; Moore, F L


    The recently characterized corticosteroid receptor on amphibian neuronal membranes appears to mediate rapid, stress-induced changes in male reproductive behaviors. Because the transduction mechanisms associated with this receptor are unknown, we performed radioligand binding studies to determine whether this steroid receptor is negatively modulated by guanyl nucleotides. The binding of [3H]corticosterone to neuronal membranes was inhibited by nonhydrolyzable guanyl nucleotides in both equilibrium saturation binding and titration studies. The addition of guanyl nucleotide plus unlabeled corticosterone induced a rapid phase of [3H]corticosterone dissociation from membranes that was not induced by addition of unlabeled ligand alone. Furthermore, the equilibrium binding of [3H]corticosterone and the sensitivity of the receptor to modulation by guanyl nucleotides were both enhanced by Mg2+. These results are consistent with the formation of a ternary complex of steroid, receptor, and guanine nucleotide-binding protein that is subject to regulation by guanyl nucleotides. Therefore, rapid signal transduction through corticosteroid receptors on neuronal membranes appears to be mediated by guanine nucleotide-binding proteins. PMID:1570300

  4. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.


    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi


    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.


    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  6. Cap analog substrates reveal three clades of cap guanine-N2 methyltransferases with distinct methyl acceptor specificities.


    Benarroch, Delphine; Jankowska-Anyszka, Marzena; Stepinski, Janusz; Darzynkiewicz, Edward; Shuman, Stewart


    The Tgs proteins are structurally homologous AdoMet-dependent eukaryal enzymes that methylate the N2 atom of 7-methyl guanosine nucleotides. They have an imputed role in the synthesis of the 2,2,7-trimethylguanosine (TMG) RNA cap. Here we exploit a collection of cap-like substrates to probe the repertoire of three exemplary Tgs enzymes, from mammalian, protozoan, and viral sources, respectively. We find that human Tgs (hTgs1) is a bona fide TMG synthase adept at two separable transmethylation steps: (1) conversion of m(7)G to m(2,7)G, and (2) conversion of m(2,7)G to m(2,2,7)G. hTgs1 is unable to methylate G or m(2)G, signifying that both steps require an m(7)G cap. hTgs1 utilizes a broad range of m(7)G nucleotides, including mono-, di-, tri-, and tetraphosphate derivatives as well as cap dinucleotides with triphosphate or tetraphosphate bridges. In contrast, Giardia lamblia Tgs (GlaTgs2) exemplifies a different clade of guanine-N2 methyltransferase that synthesizes only a dimethylguanosine (DMG) cap structure and cannot per se convert DMG to TMG under any conditions tested. Methylation of benzyl(7)G and ethyl(7)G nucleotides by hTgs1 and GlaTgs2 underscored the importance of guanine N7 alkylation in providing a key pi-cation interaction in the methyl acceptor site. Mimivirus Tgs (MimiTgs) shares with the Giardia homolog the ability to catalyze only a single round of methyl addition at guanine-N2, but is distinguished by its capacity for guanine-N2 methylation in the absence of prior N7 methylation. The relaxed cap specificity of MimiTgs is revealed at alkaline pH. Our findings highlight both stark and subtle differences in acceptor specificity and reaction outcomes among Tgs family members.

  7. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    SciTech Connect

    Hazelton, Keith Z.; Ho, Meng-Chaio; Cassera, Maria B.; Clinch, Keith; Crump, Douglas R.; Rosario Jr., Irving; Merino, Emilio F.; Almo, Steve C.; Tyler, Peter C.; Schramm, Vern L.


    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  8. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B


    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  9. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals

    NASA Astrophysics Data System (ADS)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi


    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  10. Identification, expression, and characterization of Escherichia coli guanine deaminase.


    Maynes, J T; Yuan, R G; Snyder, F F


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a K(m) of 15 microM with guanine and a k(cat) of 3.2 s(-1). The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3' from an open reading frame which shows homology to a bacterial purine base permease.

  11. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

    PubMed Central

    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of 15 μM with guanine and a kcat of 3.2 s−1. The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3′ from an open reading frame which shows homology to a bacterial purine base permease. PMID:10913105

  12. Experimental observation of guanine tautomers with VUV photoionization.


    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single-photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to that with laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest-lying tautomers of guanine suggest that the experimental observations arise from different tautomers being populated in the two different experimental methods.

  13. Guanine oxidation: one- and two-electron reactions.


    Pratviel, Geneviève; Meunier, Bernard


    Guanine bases in DNA are the most sensitive to oxidation. A lot of effort has been devoted to the understanding of the chemical modifications of guanine under different oxidizing conditions, the final goal being to know which lesions in DNA can be expected in vivo and their biological consequences. This article analyses the mechanisms underlying guanine oxidation by the comparison between one- and two-electron transfer processes. The different oxidants used in vitro give complementary answers. This overview presents a choice of some key intermediates and the predictive description of G-oxidation products that can be generated from these intermediates depending on the reaction conditions.

  14. Experimental observation of guanine tautomers with VUV photoionization

    SciTech Connect

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  15. Adenine and guanine 8CH exchange in nucleic acids: resolution and measurement by Raman optical multichannel analysis.


    Lamba, O P; Becka, R; Thomas, G J

    Deuterium exchange of 8C protons of adenine and guanine in nucleic acids is conveniently monitored by laser Raman spectrophotometry, and the average exchange rate so determined [kA + kG] can be exploited as a dynamic probe of the secondary structure of DNA or RNA [J. M. Benevides and G. J. Thomas, Jr. (1985) Biopolymers 24, 667-682]. The present work describes a rapid Raman procedure, based upon optical multichannel analysis, which permits discrimination of the different 8CH exchange rates, kA of adenine and kG of guanine, in a single experimental protocol. For this procedure, simultaneous measurements are made of the intensity decay or frequency shift in separately resolved Raman bands of adenine and guanine, each of which is sensitive only to 8C deuteration of its respective purine. Resolution of the rates kA and kG is demonstrated for the mononucleotide mixtures, 5'-rAMP + 5'-rGMP and 5'-dAMP + 5'-dGMP, for the polynucleotides poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC), for calf thymus DNA, and for the 17 base-pair operator OR3. We show that the different exchange rates of adenine and guanine, in nucleotide mixtures and in DNA, may also be calculated independently from intensity decay of the composite 1481-cm-1 band, comprising overlapped adenine and guanine components, over a time domain that encompasses two distinct regimes: (1) a relatively more rapid exchange of guanine, and (2) a concurrent slower exchange of adenine. Both methods developed here yield consistent results. We find, first, that exchange of guanine is approximately twofold more rapid than that of adenine when both purines are present in the same structure and solvent environment, presumably a consequence of the greater basicity of the 7N site of guanine. Second, we find that adenine suffers greater retardation of exchange than guanine when both purines are incorporated into a "classical" B-DNA secondary structure, such as that of calf thymus DNA. This finding suggests different

  16. De Novo Guanine Biosynthesis but Not the Riboswitch-Regulated Purine Salvage Pathway Is Required for Staphylococcus aureus Infection In Vivo

    PubMed Central

    Yan, Donghong; Katakam, Anand K.; Reichelt, Mike; Lin, Baiwei; Kim, Janice; Park, Summer; Date, Shailesh V.; Monk, Ian R.; Xu, Min; Austin, Cary D.; Maurer, Till


    ABSTRACT De novo guanine biosynthesis is an evolutionarily conserved pathway that creates sufficient nucleotides to support DNA replication, transcription, and translation. Bacteria can also salvage nutrients from the environment to supplement the de novo pathway, but the relative importance of either pathway during Staphylococcus aureus infection is not known. In S. aureus, genes important for both de novo and salvage pathways are regulated by a guanine riboswitch. Bacterial riboswitches have attracted attention as a novel class of antibacterial drug targets because they have high affinity for small molecules, are absent in humans, and regulate the expression of multiple genes, including those essential for cell viability. Genetic and biophysical methods confirm the existence of a bona fide guanine riboswitch upstream of an operon encoding xanthine phosphoribosyltransferase (xpt), xanthine permease (pbuX), inosine-5′-monophosphate dehydrogenase (guaB), and GMP synthetase (guaA) that represses the expression of these genes in response to guanine. We found that S. aureus guaB and guaA are also transcribed independently of riboswitch control by alternative promoter elements. Deletion of xpt-pbuX-guaB-guaA genes resulted in guanine auxotrophy, failure to grow in human serum, profound abnormalities in cell morphology, and avirulence in mouse infection models, whereas deletion of the purine salvage genes xpt-pbuX had none of these effects. Disruption of guaB or guaA recapitulates the xpt-pbuX-guaB-guaA deletion in vivo. In total, the data demonstrate that targeting the guanine riboswitch alone is insufficient to treat S. aureus infections but that inhibition of guaA or guaB could have therapeutic utility. IMPORTANCE De novo guanine biosynthesis and purine salvage genes were reported to be regulated by a guanine riboswitch in Staphylococcus aureus. We demonstrate here that this is not true, because alternative promoter elements that uncouple the de novo pathway from

  17. 32P-post-labelling of 7-(3-chloro-2-hydroxypropyl)guanine in white blood cells of workers occupationally exposed to epichlorohydrin.


    Plna, K; Osterman-Golkar, S; Nogradi, E; Segerbäck, D


    Epichlorohydrin (ECH) is a simple 3-carbon epoxide of industrial importance. It has been shown to be genotoxic in several systems and carcinogenic in experimental animals. The aim of the present investigation was to study DNA adducts of ECH as a biomarker of occupational exposure to this chemical. 7-(3-Chloro-2-hydroxypropyl)guanine (7-CHP-guanine) was analysed in DNA from white blood cells using an anion exchange-based adduct enrichment protocol of the (32)P-post-labelling/HPLC-based assay. Blood samples were collected from seven workers handling ECH (exposed), nine workers not handling ECH but normally present in the premises where this chemical is used (potentially exposed) and 13 office and factory workers from locations in the plant where ECH is not handled (controls). 7-CHP-guanine was detected in five of the seven workers exposed to ECH (1.6-7.1 mol/10(9) mol nucleotides) and in two of the nine workers potentially exposed to ECH (0.8-1.5 mol/10(9) mol nucleotides). This adduct was not detected in any of the 13 controls. The difference in adduct levels between exposed workers and controls was statistically significant (Mann-Whitney test, P < 0.001), as was the difference between exposed workers and potentially exposed workers (P = 0.017). The recovery of 7-CHP-guanine in the (32)P-post-labelling assay was on average 48 +/- 7%, which is considerably higher than previously reported for other 7-alkylguanines. The method used had a limit of detection of approximately 0.4 mol adduct/10(9) mol nucleotides using 20 microg DNA. This study shows for the first time ECH-induced DNA adducts in humans and suggests that 7-CHP-guanine may be used as a biomarker of occupational exposure to ECH.

  18. Guanine- Formation During the Thermal Polymerization of Amino Acids

    NASA Technical Reports Server (NTRS)

    Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.


    The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

  19. Biologically relevant oxidants cause bound proteins to readily oxidatively cross-link at Guanine.


    Solivio, Morwena J; Nemera, Dessalegn B; Sallans, Larry; Merino, Edward J


    Oxidative DNA-protein cross-links have received less attention than other types of DNA damage and remain as one of the least understood types of oxidative lesion. A model system using ribonuclease A and a 27-nucleotide DNA was used to determine the propensity of oxidative cross-linking to occur in the presence of oxidants. Cross-link formation was examined using four different oxidation systems that generate singlet oxygen, superoxide, and metal-based Fenton reactions. It is shown that oxidative cross-linking occurs in yields ranging from 14% to a maximal yield of 61% in all oxidative systems when equivalent concentrations of DNA and protein are present. Because singlet oxygen is the most efficient oxidation system in generating DNA-protein cross-links, it was chosen for further analyses. Cross-linking occurred with single-stranded DNA binding protein and not with bovine serum albumin. Addition of salt lowered nonspecific binding affinity and lowered cross-link yield by up to 59%. The yield of cross-linking increased with increased ratios of protein compared with DNA. Cross-linking was highly dependent on the number of guanines in a DNA sequence. Loss of guanine content on the 27-nucleotide DNA led to nearly complete loss in cross-linking, while primer extension studies showed cross-links to predominantly occur at guanine base on a 100-nucleotide DNA. The chemical species generated were examined using two peptides derived from the ribonuclease A sequence, N-acetyl-AAAKF and N-acetyl-AYKTT, which were cross-linked to 2'-deoxyguanosine. The cross-link products were spiroiminodihydantoin, guanidinohydantoin, and tyrosyl-based adducts. Formation of tyrosine-based adducts may be competitive with the more well-studied lysine-based cross-links. We conclude that oxidative cross-links may be present at high levels in cells since the propensity to oxidatively cross-link is high and so much of the genomic DNA is coated with protein.

  20. Studies on guanine deaminase and its inhibitors in rat tissue

    PubMed Central

    Kumar, S.; Josan, V.; Sanger, K. C. S.; Tewari, K. K.; Krishnan, P. S.


    1. In kidney, but not in rat whole brain and liver, guanine-deaminase activity was localized almost exclusively in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, as in brain and liver, the enzymic activity recovered in the supernatant was higher than that in the whole homogenate. The particulate fractions of kidney, especially the heavy mitochondria, brought about powerful inhibition of the supernatant guanine-deaminase activity. 2. In spleen, as in kidney, guanine-deaminase activity was localized in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, the particulate fractions did not inhibit the activity of the supernatant. 3. Guanine-deaminase activity in rat brain was absent from the cerebellum and present only in the cerebral hemispheres. The inhibitor of guanine deaminase was located exclusively in the cerebellum, where it was associated with the particles sedimenting at 5000g from sucrose homogenates. 4. Homogenates of cerebral hemispheres, the separated cortex or the remaining portion of the hemispheres had significantly higher guanine-deaminase activity than homogenates of whole brain. The enzymic activity of the subcellular particulate fractions was nearly the same. 5. Guanine deaminase was purified from the 15000g supernatant of sucrose homogenates of whole brain. The enzyme separated as two distinct fractions, A and B, on DEAE-cellulose columns. 6. The guanine-deaminase activity of the light-mitochondrial fraction of whole brain was fully exposed and solubilized by treatment with Triton X-100, and partially purified. 7. Tested in the form of crude preparations, the inhibitor from kidney did not act on the brain and liver supernatant enzymes and the inhibitor from cerebellum did not act on kidney enzyme, but the inhibitor from liver acted on both brain and kidney enzyme. 8. The inhibitor of guanine deaminase was purified from the heavy mitochondria of whole brain and liver and the 5000g residue of

  1. Identification of 17 independent mutations responsible for human hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency.

    PubMed Central

    Davidson, B L; Tarlé, S A; Van Antwerp, M; Gibbs, D A; Watts, R W; Kelley, W N; Palella, T D


    Complete hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency causes the Lesch-Nyhan syndrome, an X-linked, purine metabolism disorder manifested by hyperuricemia, hyperuricaciduria, and neurologic dysfunction. Partial HPRT deficiency causes hyperuricemia and gout. One requirement for understanding the molecular basis of HPRT deficiency is the determination of which amino acids in this salvage enzyme are necessary for structural or catalytic competence. In this study we have used the PCR coupled with direct sequencing to determine the nucleotide and subsequent amino acid changes in 22 subjects representing 17 unrelated kindreds from the United Kingdom. These mutations were confirmed by using either RNase mapping or Southern analyses. In addition, experiments were done to determine enzyme activity and electrophoretic mobility, and predictive paradigms were used to study the impact of these amino acid substitutions on secondary structure. Images Figure 2 Figure 3 Figure 4 PMID:2018042

  2. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    SciTech Connect

    Lindeberg, M.; Jacobs, M. )


    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio) triphosphate (GTP-{gamma}-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the {sigma} subunit of platelet G{sub s} protein. GTP-{gamma}-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al{sup +3} and F{sup {minus}} agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF{sup {minus}}{sub 4} strongly inhibited {sup 3}H-indoleacetic acid nor accumulation; GTP-{gamma}-S effects on this system will be discussed.

  3. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    SciTech Connect

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W. ); Pandey, S. )


    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha} protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.

  4. Juvenile Hormone Regulation of Drosophila Epac - A Guanine Nucleotide Exchange Factor for Rap1 Small GTPase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previously, we utilized a microchip array encompassing probes for 14,010 genes of Drosophila melanogaster to analyze the effect of (10R) juvenile hormone III (JH) on genome-wide gene expression in Drosophila S2 cells. Treatment with JH yielded a collection of 32 gene transcripts that demonstrated a ...

  5. Regulation of membrane associated protein kinase C activity by guanine nucleotide in rabbit peritoneal neutrophils

    SciTech Connect

    Huang, C.K.; Devanney, J.F.


    Addition of phorbol myristate acetate (PMA) (0.1 or guanosine-5'-0-(3-thiotriphosphate) (GTP..gamma..S) ( to the membrane fraction from rabbit peritoneal neutrophils results in an increase of phosphorylation of several membrane proteins. To test whether membrane associated protein kinase C is involved in the activation, histone is added to the membrane as a substrate for protein kinase C. Phosphorylation of histone is determined by counting the gel pieces containing histone IIIS after separation from other membrane components by SDS-gel electrophoresis. In the presence of CaC12 (20, GTP..gamma..S (10 or PMA (0.1 stimulates the phosphorylation of histone IIIS (40% to 70% increase). To achieve this effect calcium is required for GTP..gamma..S but not for PMA. The effect of GTP..gamma..S but not PMA is inhibited in membranes obtained from cells pretreated with pertussis toxin. Membrane protein kinase C is solubilized with Triton X-100 (1%) and then applied to a DEAE-52 cellulose column chromatography. Two peaks of protein kinase C activity are observed. Peak one is eluted at 40 mM NaCl, peak two is eluted at 140 mM NaCl. The activity of peak one is stimulated with phosphatidylserine (PS) and PMA but not with PS and calcium. The activity of peak two is stimulated with either PS and PMA or PS and calcium. The results suggest that GTP binding protein is involved in the activation of membrane associated protein kinase C and the kinase may exist in two forms, calcium sensitive and calcium insensitive.

  6. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    SciTech Connect

    Di Paolo, T.; Falardeau, P.


    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p < 0.001). Competition for (/sup 3/H)-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-(..beta..-..gamma..-imino)triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables.

  7. Functional reconstitution of prostaglandin E receptor from bovine adrenal medulla with guanine nucleotide binding proteins

    SciTech Connect

    Negishi, M.; Ito, S.; Yokohama, H.; Hayashi, H.; Katada, T.; Ui, M.; Hayaishi, O.


    Prostaglandin E/sub 2/ (PEG/sub 2/) was found to bind specifically to a 100,000 x g pellet prepared from bovine adrenal medulla. The PGE receptor was associated with a GTP-binding protein (G-protein) and could be covalently cross-linked with this G-protein by dithiobis(succinimidyl propionate) in the 100,000 x g pellet. In order to characterize the G-protein associated with the PGE receptor and reconstitute these proteins in phospholipid vesicles, the authors purified the G-protein to apparent homogeneity from the 100,000 x g pellet. The G-protein served as a substrate of pertussis toxin but differed in its ..cap alpha.. subunit from two known pertussis toxin substrate G-proteins (G/sub i/ and G/sub 0/) purified from bovine brain. The molecular weight of the ..cap alpha.. subunit was 40,000, which is between those of G/sub i/ and G/sub 0/. The purified protein was also distinguished immunologically from G/sub i/ and G/sub 0/ and was referred to as G/sub am/. Reconstitution of the PGE receptor with pure C/sub am/, G/sub i/, or G/sub 0/ in phospholipid vesicles resulted in a remarkable restoration of (/sup 3/H)PGE/sub 2/ binding activity in a GTP-dependent manner. The efficiency of these three G-proteins in this capacity was roughly equal. When pertussis toxin- or N-ethylmaleimide-treated G-proteins, instead of the native ones, were reconstituted into vesicles, the restoration of binding activity was no longer observed. These results indicate that the PGE receptor can couple functionally with G/sub am/, G/sub i/, or G/sub 0/ in phospholipid vesicles and suggest that G/sub am/ may be involved in signal transduction of the PGE receptor in bovine adrenal medulla.

  8. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.


    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  9. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.


    Weisman-Shomer, P; Fry, M


    The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

  10. A 2-iminohydantoin from the oxidation of guanine.


    Ye, Wenjie; Sangaiah, R; Degen, Diana E; Gold, Avram; Jayaraj, K; Koshlap, Karl M; Boysen, Gunnar; Williams, Jason; Tomer, Kenneth B; Ball, Louise M


    The nucleobase guanine was oxidized with dimethyldioxirane (DMDO) to explore the role of epoxidizing agents in oxidative DNA damage. Treatment of guanine with 10% molar excess DMDO in aqueous solution at 0 degrees C and pH 7.5 followed by workup under mild conditions gave 5-carboxamido-5-formamido-2-iminohydantoin (1) as the sole isolable product in 71% yield. The structure of 1 was established on the basis of mass spectrometry and NMR studies on 1 and its isotopomers generated by the oxidation of [4-(13)C] and [7-(15)N]guanine, which yield [5-(13)C]1 and [7-(15)N]1. The distribution of 13C and 15N labels in the isotopomeric products supports initial epoxidation of the C4-C5 bond of guanine followed by a 1,2-acyl migration of guanine C6. Compound 1 is suggested as a possible primary DNA lesion from putative epoxidizing agents, including hydroperoxides present during biological processes such as lipid peroxidation.

  11. Updating Our View of Organelle Genome Nucleotide Landscape

    PubMed Central

    Smith, David Roy


    Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

  12. Purine metabolite and energy charge analysis of Trypanosoma brucei cells in different growth phases using an optimized ion-pair RP-HPLC/UV for the quantification of adenine and guanine pools.


    Graven, Patricia; Tambalo, Margherita; Scapozza, Leonardo; Perozzo, Remo


    Human African Trypanosomiasis (HAT) is caused by the protozoan parasite Trypanosoma brucei. Although trypanosomes are well-studied model organisms, only little is known about their adenine and guanine nucleotide pools. Besides being building blocks of RNA and DNA, these nucleotides are also important modulators of diverse biochemical cellular processes. Adenine nucleotides also play an important role in the regulation of metabolic energy. The energetic state of cells is evaluated by the energy charge which gives information about how much energy is available in form of high energy phosphate bonds of adenine nucleotides. A sensitive and reproducible ion-pair RP-HPLC/UV method was developed and optimized, allowing the quantification of guanine and adenine nucleosides/nucleotides in T. brucei. With this method, the purine levels and their respective ratios were investigated in trypanosomes during logarithmic, stationary and senescent growth phases. Results of this study showed that all adenine and guanine purines under investigation were in the low mM range. The energy charge was found to decrease from logarithmic to static and to senescent phase whereas AMP/ATP, ADP/ATP and GDP/GTP ratios increased in the same order. In addition, the AMP/ATP ratio varied as the square of the ADP/ATP ratio, indicating AMP to be the key energy sensor molecule in trypanosomes.

  13. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine-guanine phosphoribosyltransferase.


    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T; Guddat, Luke W


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed.

  14. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine–guanine phosphoribosyltransferase

    PubMed Central

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T.; Guddat, Luke W.


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed. PMID:27786284

  15. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin


    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  16. Camptothecins guanine interactions: mechanism of charge transfer reaction upon photoactivation

    NASA Astrophysics Data System (ADS)

    Steenkeste, K.; Guiot, E.; Tfibel, F.; Pernot, P.; Mérola, F.; Georges, P.; Fontaine-Aupart, M. P.


    The potent activity exhibited by the antitumoral camptothecin (CPT) and its analog irinotecan (CPT-11) is known to be related to a close contact between the drug and the nucleic acid base guanine. This specificity of interaction between these two chromophores was examined by following changes in the photophysical properties of the drug using steady-state as well as time-resolved absorption and fluorescence methods. The observed effects on absorption, fluorescence emission and singlet excited state lifetimes give evidence for the occurrence of a stacking complex formation restricted to the quinoline part of CPT or CPT-11 and the guanine base but also with the adenine base. The triplet excited state properties of the drugs have been also characterized in absence and in presence of guanosine monophosphate and reveal the occurrence of an electron transfer from the guanine base to the drug. Support for this conclusion was obtained from the studies of a set of biological targets of various oxido-reduction potentials, adenosine monophosphate, cytidine, cytosine, tryptophan, tyrosine and phenylalanine. This finding gives an interpretation of the CPT-induced guanine photolesions previously reported in the literature. These data taken together are discussed in connection with the drug activity. The stacking complex CPT/guanine is necessary but not sufficient to explain the role of the chirality and of the lactone structure in the function of the drug. A stereospecific interaction with the enzyme topoisomerase I seems necessary to stabilize the stacking complex. The first experiments using time-resolved fluorescence by two-photon excitation confirms that CPT does not bind to the isolated enzyme.

  17. Impedimetric investigation of gold nanoparticles - guanine modified electrode

    SciTech Connect

    Vulcu, A.; Pruneanu, S.; Berghian-Grosan, C.; Olenic, L.; Muresan, L. M.; Barbu-Tudoran, L.


    In this paper we report the preparation of a modified electrode with gold nanoparticles and guanine. The colloidal suspension of gold nanoparticles was obtained by Turkevich method and was next analyzed by UV-Vis spectroscopy and Transmission Electron Microscopy (TEM). The gold electrode was modified by self-assembling the gold nanoparticles with guanine, the organic molecule playing also the role of linker. The electrochemical characteristics of the bare and modified electrode were investigated by Electrochemical Impedance Spectroscopy (EIS). A theoretical model was developed based on an electrical equivalent circuit which contain solution resistance (R{sub s}), charge transfer resistance (R{sub ct}), Warburg impedance (Z{sub W}) and double layer capacitance (C{sub dl})

  18. Guanine is a growth factor for Legionella species.

    PubMed Central

    Pine, L; Franzus, M J; Malcolm, G B


    Evaluation of previously described chemically defined media for the growth of Legionella pneumophila showed that these media supported poor growth of several strains of L. pneumophila and did not support growth of certain of the Legionella species described later. Growth was stimulated by the dialysate from yeast extract but not by the nondialyzable fraction. Further investigations indicated that the active factors from the yeast extract dialysate were purine or pyrimidine derivatives, and certain known purines and pyrimidines were found to stimulate growth. Of these, guanine universally stimulated growth of all Legionella strains and was a growth requirement for several of the species tested. A balanced, N-(2-acetamido)-2-aminoethanesulfonic acid-buffered, chemically defined medium having guanine or a purine-pyrimidine mix is presented for the general growth of Legionella species. PMID:3700600

  19. B3LYP, BLYP and PBE DFT band structures of the nucleotide base stacks

    NASA Astrophysics Data System (ADS)

    Szekeres, Zs; Bogár, F.; Ladik, J.

    DFT crystal orbital (band structure) calculations have been performed for the nucleotide base stacks of cytosine, thymine, adenine, and guanine arranged in DNA B geometry. The band structures obtained with PBE, BLYP, and B3LYP functionals are presented and compared to other related experimental and theoretical results. The influence of the quality of the basis set on the fundamental gap values was also investigated using Clementi's double ζ, 6-31G and 6-31G* basis sets.

  20. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  1. Fragmentation mechanisms of cytosine, adenine and guanine ionized bases.


    Sadr-Arani, Leila; Mignon, Pierre; Chermette, Henry; Abdoul-Carime, Hassan; Farizon, Bernadette; Farizon, Michel


    The different fragmentation channels of cytosine, adenine and guanine have been studied through DFT calculations. The electronic structure of bases, their cations, and the fragments obtained by breaking bonds provides a good understanding of the fragmentation process that can complete the experimental approach. The calculations allow assigning various fragments to the given peaks. The comparison between the energy required for the formation of fragments and the peak intensity in the mass spectrum is used. For cytosine and guanine the elimination of the HNCO molecule is a major route of dissociation, while for adenine multiple loss of HCN or HNC can be followed up to small fragments. For cytosine, this corresponds to the initial bond cleavage of N3-C4/N1-C2, which represents the main dissociation route. For guanine the release of HNCO is obtained through the N1-C2/C5-C6 bond cleavage (reverse order also possible) leading to the largest peak of the spectrum. The corresponding energies of 3.5 and 3.9 eV are typically in the range available in the experiments. The loss of NH3 or HCN is also possible but requires more energy. For adenine, fragmentation consists of multiple loss of the HCN molecule and the main route corresponding to HC8N9 loss is followed by the release of HC2N1.

  2. `Guanigma': the revised structure of biogenic anhydrous guanine

    NASA Astrophysics Data System (ADS)

    Hirsch, Anna; Gur, Dvir; Polishchuk, Iryna; Levy, Davide; Pokroy, Boaz; Cruz-Cabeza, Aurora J.; Addadi, Lia; Kronik, Leeor; Leiserowitz, Leslie

    Living organisms display a spectrum of colors, produced by pigmentation, structural coloration, or both. A relatively well-studied system, which produces colors via an array of alternating anhydrous guanine crystals and cytoplasm, is responsible for the metallic luster of many fish. The structure of biogenic anhydrous guanine was believed to be the same as that of the synthetic one - a monoclinic polymorph. Here we re-examine the structure of biogenic guanine, using experimental X-ray and electron diffraction (ED) data exposing troublesome inconsistencies - namely, a 'guanigma'. To address this, we sought alternative candidate polymorphs using symmetry and packing considerations, then used first principles calculations to determine whether the selected candidates could be energetically stable. We identified theoretically a different monoclinic polymorph, were able to synthesize it, and to confirm using X-ray diffraction that it is this polymorph that occurs in biogenic samples. However, the ED data were still not consistent with this polymorph, but rather with a theoretically generated orthorhombic polymorph. This apparent inconsistency was resolved by showing how the ED pattern could be affected by crystal structural faults composed of offset molecular layers.

  3. A three-state model for the photophysics of guanine.


    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos


    The nonadiabatic photochemistry of the guanine molecule (2-amino-6-oxopurine) and some of its tautomers has been studied by means of the high-level theoretical ab initio quantum chemistry methods CASSCF and CASPT2. Accurate computations, based by the first time on minimum energy reaction paths, states minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of the molecules lead to interpret the photochemistry of guanine and derivatives within a three-state model. As in the other purine DNA nucleobase, adenine, the ultrafast subpicosecond fluorescence decay measured in guanine is attributed to the barrierless character of the path leading from the initially populated 1(pi pi* L(a)) spectroscopic state of the molecule toward the low-lying methanamine-like conical intersection (gs/pi pi* L(a))CI. On the contrary, other tautomers are shown to have a reaction energy barrier along the main relaxation profile. A second, slower decay is attributed to a path involving switches toward two other states, 1(pi pi* L(b)) and, in particular, 1(n(O) pi*), ultimately leading to conical intersections with the ground state. A common framework for the ultrafast relaxation of the natural nucleobases is obtained in which the predominant role of a pi pi*-type state is confirmed.

  4. Nucleotide correlations and electronic transport of DNA sequences

    NASA Astrophysics Data System (ADS)

    Albuquerque, E. L.; Vasconcelos, M. S.; Lyra, M. L.; de Moura, F. A. B. F.


    We use a tight-binding formulation to investigate the transmissivity and wave-packet dynamics of sequences of single-strand DNA molecules made up from the nucleotides guanine G , adenine A , cytosine C , and thymine T . In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of two artificial sequences: (i) the Rudin-Shapiro one, which has long-range correlations; (ii) a random sequence, which is a kind of prototype of a short-range correlated system, presented here with the same first-neighbor pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the persistence of resonances of finite segments. On the other hand, the wave-packet dynamics seems to be mostly influenced by the short-range correlations.

  5. Nature of guanine oxidation in RNA via the flash-quench technique versus direct oxidation by a metal oxo complex

    PubMed Central

    Holcomb, Dana R.; Ropp, Patricia A.; Theil, Elizabeth C.; Thorp, H. Holden


    Oxidation of RNA can be effected by two different techniques: a photochemical, electron-transfer method termed “flash-quench” and direct oxidation by metal oxo complexes. The flash-quench method produces selective oxidation using a metal photosensitizer, tris(bipyridyl)ruthenium(III) trichloride (Ru(bpy)33+), and quencher, pentaamminechlorocobalt(III) chloride (Co(NH3)5Cl2+). We have optimized the flash-quench technique for the following RNAs: tRNAPhe, human ferritin iron-responsive element (IRE), and a mutated human ferritin IRE. We have also employed a chemical footprinting technique involving the oxoruthenium(IV) complex (Ru(tpy)(bpy)O2+ (tpy = 2,2′,2″-terpyridine; bpy = 2,2′-bipyridine)) to oxidize guanine. Comparison of the two methods shows that the flash-quench technique provides a visualization of nucleotide accessibility for a static conformation of RNA while the Ru(tpy)(bpy)O2+ complex selectively oxidizes labile guanines and gives a visualization of a composite of multiple conformations of the RNA structure. PMID:20038124

  6. Towards metal-mediated g-quartet analogues: 1,2,4-triazole nucleotides.


    Withers, Jamie M; Telfer, Shane G; Filichev, Vyacheslav V


    We proposed that metal-coordinating nucleotides could be used to control the assembly of G-quadruplexes through the formation of an artificial metal-centered quartet. Several guanine-rich DNA sequences containing 1,2,4-triazole-functionalized nucleotides were investigated. These oligonucleotides were designed to form quartets mediated by metal-triazole bonding both on the surface of and within the G-quadruplex core. In contrast to duplex studies in which 1,2,4-triazole nucleosides serve as a mimic of Watson-Crick base-pairs, our results show that these nucleosides are not suitable components of an artificial metal-centered quartet.

  7. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.


    Seclaman, E; Kurunczi, L; Simon, Z


    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  8. Plant Cyclic Nucleotide Signalling

    PubMed Central

    Martinez-Atienza, Juliana; Van Ingelgem, Carl; Roef, Luc


    The presence of the cyclic nucleotides 3′,5′-cyclic adenyl monophosphate (cAMP) and 3′,5′-cyclic guanyl monophosphate (cGMP) in plants is now generally accepted. In addition, cAMP and cGMP have been implicated in the regulation of important plant processes such as stomatal functioning, monovalent and divalent cation fluxes, chloroplast development, gibberellic acid signalling, pathogen response and gene transcription. However, very little is known regarding the components of cyclic nucleotide signalling in plants. In this addendum, the evidence for specific mechanisms of plant cyclic nucleotide signalling is evaluated and discussed. PMID:19704553

  9. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.


    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way.

  10. Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin

    SciTech Connect

    Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie


    The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

  11. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    PubMed Central

    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  12. Toward electrochemical resolution of two genes on one electrode: using 7-deaza analogues of guanine and adenine to prepare PCR products with differential redox activity.


    Yang, Ivana V; Ropp, Patricia A; Thorp, H Holden


    The 7-deaza analogues of guanine and adenine were incorporated into polymerase chain reaction (PCR) products by substitution of the appropriate nucleotide triphosphates into the reaction. These PCR products can be immobilized on ITO electrodes and detected by catalytic cyclic voltammetry with ruthenium polypyridyl complexes. Immobilization on indium tin oxide (ITO) electrodes of 330- and 1200-base pair (bp) PCR amplicons from the E. coli dacA gene containing one or both of the 7-deazapurines was effected by precipitation from a 9:1 DMF/acetate solution. Amplicons containing the 7-deazaguanine base were detected by observing current enhancement in the cyclic voltammogram of Ru(dmb)3(3)+/2+ (dmb = 4,4'-dimethyl-2,2'-bipyridine) due to the selective oxidation of the modified base by this mediator. Oxidation of incorporated 7-deazaadenine bases in addition to native guanines gives rise to a higher current enhancement in the cyclic voltammogram of Ru(bpy)3(3)+/2+ (bpy = 2,2'-bipyridine) compared to the enhancement observed in the presence of guanine only. This strategy was employed to simultaneously detect the 330-bp sequence containing 7-deazaadenine and the 1200-bp sequence containing 7-deazaguanine on the same ITO electrode. Such a strategy may provide a means for detecting multiple genes on a single microlocation and may thereby lead to more highly multiplexed gene assays.

  13. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    NASA Astrophysics Data System (ADS)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  14. Guanine oxidation by electron transfer: one- versus two-electron oxidation mechanism.


    Kupan, Adam; Saulière, Aude; Broussy, Sylvain; Seguy, Christel; Pratviel, Geneviève; Meunier, Bernard


    The degeneracy of the guanine radical cation, which is formed in DNA by oxidation of guanine by electron transfer, was studied by a detailed analysis of the oxidation products of guanine on oligonucleotide duplexes and by labeling experiments. It was shown that imidazolone, the major product of guanine oxidation, is formed through a one-electron oxidation process and incorporates one oxygen atom from O2. The formation of 8-oxo-7,8-dihydroguanine by a two-electron oxidation process was a minor pathway. The two-electron oxidation mechanism was also evidenced by the formation of a tris(hydroxymethyl)aminomethane adduct.

  15. Detection of C8-(1-hydroxyethyl)guanine in liver RNA and DNA from control and ethanol-treated rats.


    Nakao, Lia S; Fonseca, Elaine; Augusto, Ohara


    Alcohol consumption is associated with an increased risk of cancer by mechanisms that remain unknown but have been suggested to involve radical metabolites. We have previously shown that the 1-hydroxyethyl radical produced from ethanol oxidation in vitro is able to alkylate nucleic acids to produce C8-(1-hydroxyethyl)guanine [C8-(1-HE)gua] among other products. To assess if this adduct is produced in vivo, we developed a sensitive HPLC-MS/MS method for its detection and analyzed hydrolysates of liver RNA and DNA from control and ethanol-treated rats. Unexpectedly, C8-(1-HE)gua was found to be present in both RNA and DNA from the liver of control Sprague-Dawley rats, and its levels increased slightly, but not significantly, after an acute ethanol dose (5 g/kg). In rat liver, C8-(1-HE)gua endogenous levels were about 10 times higher in RNA (35 +/- 5/10(7) guanine) than DNA (3.7 +/- 1.1/10(7) guanine). These levels were also found in commercial RNA (calf liver and yeast) and DNA (calf thymus), further indicating the endogenous source of the adduct. DNA basal levels of C8-(1-HE)gua were similar to those reported for other 2C guanine adducts such as N7-(2-hydroxyethyl)guanine and N2-ethyl-2'-deoxyguanosine. We speculate that all of these adducts may be generated from DNA attack by products of basal lipid peroxidation. The higher RNA levels of C8-(1-HE)gua are in agreement with the higher accessibility of RNA and nucleotides to reactive intermediates because they are not as protected or as localized as DNA. Chemical modification of RNA has been receiving increasingly attention as an important event in genotoxic mechanisms. Comparison of RNA basal levels of C8-(1-HE)gua, N7-(2-hydroxyethyl)guanine, and N2-ethyl-2'-deoxyguanosine may provide clues about their endogenous sources and biological significance. Yet, the marginal increase of DNA C8-(1-HE)gua upon ethanol administration argues against this adduct playing a major role in the carcinogenic effects of ethanol.

  16. DNA sequence context as a determinant of the quantity and chemistry of guanine oxidation produced by hydroxyl radicals and one-electron oxidants.


    Margolin, Yelena; Shafirovich, Vladimir; Geacintov, Nicholas E; DeMott, Michael S; Dedon, Peter C


    DNA sequence context has emerged as a critical determinant of the location and quantity of nucleobase damage caused by many oxidizing agents. However, the complexity of nucleobase and 2-deoxyribose damage caused by strong oxidants such as ionizing radiation and the Fenton chemistry of Fe2+-EDTA/H2O2 poses a challenge to defining the location of nucleobase damage and the effects of sequence context on damage chemistry in DNA. To address this problem, we developed a gel-based method that allows quantification of nucleobase damage in oxidized DNA by exploiting Escherichia coli exonuclease III to remove fragments containing direct strand breaks and abasic sites. The rigor of the method was verified in studies of guanine oxidation by photooxidized riboflavin and nitrosoperoxycarbonate, for which different effects of sequence context have been demonstrated by other approaches (Margolin, Y., Cloutier, J. F., Shafirovich, V., Geacintov, N. E., and Dedon, P. C. (2006) Nat. Chem. Biol. 2, 365-366). Using duplex oligodeoxynucleotides containing all possible three-nucleotide sequence contexts for guanine, the method was used to assess the role of DNA sequence context in hydroxyl radical-induced guanine oxidation associated with gamma-radiation and Fe2+-EDTA/H2O2. The results revealed both differences and similarities for G oxidation by hydroxyl radicals and by one-electron oxidation by riboflavin-mediated photooxidation, which is consistent with the predominance of oxidation pathways for hydroxyl radicals other than one-electron oxidation to form guanine radical cations. Although the relative quantities of G oxidation produced by hydroxyl radicals were more weakly correlated with sequence-specific ionization potential than G oxidation produced by riboflavin, damage produced by both hydroxyl radical generators and riboflavin within two- and three-base runs of G showed biases in location that are consistent with a role for electron transfer in defining the location of the damage

  17. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.


    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  18. Structure-Based Design of Trna-Guanine Transglycosylase Inhibitors

    NASA Astrophysics Data System (ADS)

    Klebe, Gerhard

    Taking the development of inhibitors for the tRNA-modifying enzyme tRNA-guanine transglycosylase (TGT) as an example, the scope of a structure-based drug development project will be demonstrated, performed via several cycles of iterative design. The described example is based on studies, performed at ETH-Zurich and University of Marburg in joint collaboration. As these studies have been executed in an academic environment, different tools of structure-based design have been applied and several issues of more fundamental interest to the methodological background of the project could be addressed.

  19. Production of guanine from NH(4)CN polymerizations

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Oro, J.


    The synthesis of adenine from the polymerization of concentrated ammonium cyanide solutions is well known. We show here that guanine is also produced by this reaction but at yields ranging from 10 to 40 times less than that of adenine. This synthesis is effective at both +80 and -20 degrees C. Since high concentrations of NH(4)CN are obtainable only by freezing, this prebiotic synthesis would be applicable to frozen regions of the primitive Earth, the Jovian satellite Europa and other icy satellites, and the parent body of the Murchison meteorite.

  20. Guanine binding to gold nanoparticles through nonbonding interactions.


    Zhang, Xi; Sun, Chang Q; Hirao, Hajime


    Gold nanoparticles have been widely used as nanocarriers in gene delivery. However, the binding mechanism between gold nanoparticles and DNA bases remains a puzzle. We performed density functional theory calculations with and without dispersion correction on Au(N)( (N = 13, 55, or 147) nanoparticles in high-symmetry cuboctahedral structures to understand the mechanism of their binding with guanine at the under-coordinated sites. Our study verified that: (i) negative charges transfer from the inner area to the surface of a nanoparticle as a result of the surface quantum trapping effect; and (ii) the valence states shift up toward the Fermi level, and thereby participate more actively in the binding to guanine. These effects are more prominent in a smaller nanoparticle, which has a larger surface-to-volume ratio. Additional fragment orbital analysis revealed that: (i) electron donation from the lone-pair orbital of N to the unoccupied orbital of the Au cluster occurs in all complexes; (ii) π back-donation occurs from the polarized Au d(yz) orbital to the N p(y)-π* orbital when there is no Au···H-N hydrogen bond, and, (iii) depending on the configuration, Au···H-N hydrogen bonding can also exist, to which the Au occupied orbital and the H-N unoccupied orbital contribute.

  1. Translesion synthesis by human DNA polymerase eta across oxidative products of guanine.


    Kino, Katuhito; Ito, Nobutoshi; Sugasawa, Kaoru; Sugiyama, Hiroshi; Hanaoka, Fumio


    Guanine is the most oxidizable base among natural bases. 8-Oxoguanine (8-oxoG) is the typical oxidative product, but the amount of 8-oxoG does not directly reflect the strength of oxidative stress. Imidazolone, oxazolone and guanidinohydantoin are oxidative products of guanine and 8-oxoG. Here, we investigated enzymatic reactions with human DNA polymerase eta on these lesions.

  2. Mobility enhancement of organic field-effect transistor based on guanine trap-neutralizing layer

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Yu, Junsheng; Taylor, André D.; Katz, Howard E.


    We introduced a nucleic acid component guanine as a trap-neutralizing layer between silicon dioxide gate dielectric and a pentacene semiconducting layer to obtain increased field-effect mobility in organic field-effect transistors (OFETs). A tripling of the field-effect mobility, from 0.13 to 0.42 cm2/V s, was achieved by introducing a 2 nm guanine layer. By characterizing the surface morphology of pentacene films grown on guanine, we found that the effect of guanine layer on the topography of pentacene film was not responsible for the mobility enhancement of the OFETs. The increased field-effect mobility was mainly attributed to the hydrogen bonding capacity of otherwise unassociated guanine molecules, which enabled them to neutralize trapping sites on the silicon dioxide surface.

  3. The synergism of nucleoside antibiotics combined with guanine 7-N-oxide against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV).


    Hasobe, M; Saneyoshi, M; Isono, K


    Guanine 7-N-oxide was shown to have synergistic activity in combination with neplanocin A against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV), as reported previously. We examined further the antiviral activity of guanine 7-N-oxide in combination with other nucleoside antibiotics against IHNV. Synergism was seen between guanine 7-N-oxide and D-eritadenine or cordycepin. It is considered that compounds inhibiting RNA methylation show synergism with guanine 7-N-oxide.

  4. A non-catalytic N-terminal domain negatively influences the nucleotide exchange activity of translation elongation factor 1Bα.


    Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V


    Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect.

  5. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    SciTech Connect

    Caroline Kisker


    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  6. Base sequence context effects on nucleotide excision repair.


    Cai, Yuqin; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E


    Nucleotide excision repair (NER) plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P), 10S (+)-trans-anti-B[a]P-N(2)-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  7. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.


    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao


    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  8. In vivo methylation of guanine by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Adam, Y; Hegazi, B


    The in vivo methylating capability of the organophosphorus insecticide tetrachlorvinphos, assayed by the formation of 7-methyl-guanine in mouse liver, was investigated. Following intraperitoneal injection of male mice with different doses of the 14C-insecticide, labelled at the OCH3 groups, the total and specific radioactivity of nucleic acids and protein were determined. The 14C-labelling in the isolated macromolecules reached its maximum 24 hours following administration of the insecticide. Analysis of the acid hydrolysate of DNA and of RNA on Dowex-50 WX-12 revealed the presence of (7-14C) methylguanine. At maximum 14C-labelling, the amount of radioactive 7-MeGu, calculated as fraction of total dose, was around 9 X 10(-5) and 39 X 10(-5) for DNA and RNA, respectively.

  9. Lifetimes and reaction pathways of guanine radical cations and neutral guanine radicals in an oligonucleotide in aqueous solutions.


    Rokhlenko, Yekaterina; Geacintov, Nicholas E; Shafirovich, Vladimir


    The exposure of guanine in the oligonucleotide 5'-d(TCGCT) to one-electron oxidants leads initially to the formation of the guanine radical cation G(•+), its deptotonation product G(-H)(•), and, ultimately, various two- and four-electron oxidation products via pathways that depend on the oxidants and reaction conditions. We utilized single or successive multiple laser pulses (308 nm, 1 Hz rate) to generate the oxidants CO(3)(•-) and SO(4)(•-) (via the photolysis of S(2)O(8)(2-) in aqueous solutions in the presence and absence of bicarbonate, respectively) at concentrations/pulse that were ∼20-fold lower than the concentration of 5'-d(TCGCT). Time-resolved absorption spectroscopy measurements following single-pulse excitation show that the G(•+) radical (pK(a) = 3.9) can be observed only at low pH and is hydrated within 3 ms at pH 2.5, thus forming the two-electron oxidation product 8-oxo-7,8-dihydroguanosine (8-oxoG). At neutral pH, and single pulse excitation, the principal reactive intermediate is G(-H)(•), which, at best, reacts only slowly with H(2)O and lives for ∼70 ms in the absence of oxidants/other radicals to form base sequence-dependent intrastrand cross-links via the nucleophilic addition of N3-thymidine to C8-guanine (5'-G*CT* and 5'-T*CG*). Alternatively, G(-H)(•) can be oxidized further by reaction with CO(3)(•-), generating the two-electron oxidation products 8-oxoG (C8 addition) and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih, by C5 addition). The four-electron oxidation products, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), appear only after a second (or more) laser pulse. The levels of all products, except 8-oxoG, which remains at a low constant value, increase with the number of laser pulses.

  10. Guanine and 7,8-dihydro-8-oxo-guanine-specific oxidation in DNA by chromium(V).


    Sugden, Kent D; Martin, Brooke D


    The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, although the mechanism of cancer induction is currently unknown. Intracellular reduction of Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA damage by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a metal-binding pathway, have been proposed to account for the lesions observed in cell systems. We have used a model Cr(V) complex, N,N-ethylenebis(salicylidene-animato)oxochromium(V) [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides produced guanine-specific lesions that were not 8-oxo-2'-deoxyguanosine, based on the inability of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of product for identification by electrospray ionization mass spectrometry. The guanine-based lesions observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodihydantoin. The effects of these Cr(V)-Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay. These lesions produced G --> T transversion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data suggest a model by which chromate can cause DNA damage leading to mutations and cancer.

  11. Guanine Oxidation in Double-stranded DNA by MnTMPyP/KHSO(5): At Least Three Independent Reaction Pathways.


    Lapi, A; Pratviel, G; Meunier, B


    In order to better define the mechanism and the products of guanine oxidation within DNA, we investigated the details of the mechanism of guanine oxidation by a metalloporphyrin, Mn-TMPyP, associated to KHSO(5) on oligonucleotides. We found that the three major products of guanine oxidation are formed by independent reaction routes. The oxidized guanidinohydantoin (1) and the proposed spiro compound 3 derivatives are not precursors of imidazolone lesion (Iz). These guanine lesions as well as their degradation products, may account for non-detected guanine oxidation products on oxidatively damaged DNA.

  12. Nucleotide signalling during inflammation

    PubMed Central

    Idzko, Marco; Ferrari, Davide; Eltzschig, Holger K.


    Inflammatory conditions are associated with the extracellular release of nucleotides, particularly ATP. In the extracellular compartment, ATP predominantly functions as a signalling molecule through the activation of purinergic P2 receptors. Metabotropic P2Y receptors are G-protein-coupled, whereas ionotropic P2X receptors are ATP-gated ion channels. Here we discuss how signalling events through P2 receptors alter the outcomes of inflammatory or infectious diseases. Recent studies implicate a role for P2X/P2Ysignalling in mounting appropriate inflammatory responses critical for host defence against invading pathogens or tumours. Conversely, P2X/P2Y signalling can promote chronic inflammation during ischaemia and reperfusion injury, inflammatory bowel disease or acute and chronic diseases of the lungs. Although nucleotide signalling has been used clinically in patients before, research indicates an expanding field of opportunities for specifically targeting individual P2 receptors for the treatment of inflammatory or infectious diseases. PMID:24828189

  13. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.


    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  14. Theoretical Study of Oxidation of Guanine by Singlet Oxygen (¹Δg) and Formation of Guanine:Lysine Cross-Links.


    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard


    Oxidation of guanine in the presence of lysine can lead to guanine-lysine cross-links. The ratio of the C-4, C-5 and C-8 crosslinks depends on the manner of oxidation. Type II photosensitizers such as Rose Bengal and methylene blue can generate singlet oxygen, which leads to a different ratio of products than oxidation by type I photosensitizers or by one electron oxidants. Modeling reactions of singlet oxygen can be quite challenging. Reactions have been explored using CASSCF, NEVPT2, DFT, CCSD(T), BD(T) calculations with SMD implicit solvation. The spin contaminations in open-shell calculations were corrected by Yamaguchi's approximate spin projection method. The addition of singlet oxygen to guanine to form guanine endoperoxide proceeds step-wise via a zwitterionic peroxyl intermediate. The subsequent barrier for ring closure is smaller than the initial barrier for singlet oxygen addition. Ring opening of the endoperoxide by protonation at C4-O is followed by loss of a proton from C-8 and dehydration to produce 8-oxoGox. The addition of lysine (modelled by methylamine) or water across the C5-N7 double bond of 8-oxoGox is followed by acyl migration to form the final spiro products. The barrier for methylamine addition is significantly lower than for water addition and should be the dominant reaction channel. These results are in good agreement with the experimental results for the formation of guanine-lysine cross-links via oxidation by type II photosensitizers.

  15. Prostaglandin modulation of Ca2+ channels in rat sympathetic neurones is mediated by guanine nucleotide binding proteins.

    PubMed Central

    Ikeda, S R


    1. The effects of prostaglandins on whole-cell Ca2+ currents of acutely isolated and short-term cultured adult rat superior cervical ganglion neurones were investigated using the patch-clamp technique. 2. Prostaglandin E2 (PGE2) produced a rapid, reversible and concentration-dependent reduction of the sympathetic neurone Ca2+ current. The effects of PGE2 were both voltage and time dependent. The relationship between Ca2+ current inhibition and test potential was 'bell' shaped with maximal inhibition occurring near the potential where the Ca2+ current amplitude was maximal (ca + 10 mV). In the presence of PGE2, the Ca2+ current rising phase was slower and biphasic at potentials between 0 and +40 mV. 3. Prolonged (> 2 min) application of 1 microM PGE2 resulted in a desensitization of the response. Similarly, repeated short (ca 1 min) applications of 1 microM PGE2 resulted in a progressive tachyphylaxis of the response. 4. A concentration-response curve for PGE2 was well described by a single-site binding isotherm. The concentration producing half-maximal block (IC50) and the maximal attainable reduction of the Ca2+ current were 7.8 nM and 48%, respectively. 5. When compared at a concentration of 1 microM, PGF2 alpha was less potent (33% inhibition) than PGE2 but otherwise produced similar effects. In contrast, 1 microM PGD2 had negligible effects. 6. Activation curves, as derived from tail current amplitudes, were described by the sum of two Boltzmann functions in both the presence and absence of PGE2. In the presence of PGE2, the activation curve was shifted toward more depolarized potentials. Most of the shift could be accounted for by a decrease in the fractional amplitude of the current component activated at hyperpolarized potentials along with a concomitant increase in the component activated at depolarized potentials. The deactivation time constant (0.33 ms), measured at -40 mV, was not altered by PGE2. 7. The majority of the Ca2+ current inhibition produced by PGE2 was relieved by depolarizing conditioning pre-pulses to +80 mV for 50 ms. 8. Dialysis of sympathetic neurones with a pipette solution containing 2.0 mM guanosine 5'-O-(2-thiodiphosphate) (GDP-beta-S) abolished the effects of PGE2 on the Ca2+ current. Pretreatment of the neurones overnight with pertussis toxin significantly, but incompletely, decreased the Ca2+ current inhibition produced by PGE2. 9. The prolonged Ca2+ tail current component induced by the dihydropyridine Ca2+ channel 'agonist' (+)202-791 (2 microM) was unaffected by 1 microM PGE2. 10. PGE2 partially inhibited the Ca2+ current component remaining after pretreatment of the neurones with 10 microM omega-conotoxin.(ABSTRACT TRUNCATED AT 400 WORDS) Images Fig. 9 Fig. 10 PMID:1338790

  16. Magnetic bead isolation of neutrophil plasma membranes and quantification of membrane-associated guanine nucleotide binding proteins.


    Chang, Peter S; Absood, Afaf; Linderman, Jennifer J; Omann, Geneva M


    A protocol for isolation of neutrophil plasma membranes utilizing a plasma membrane marker antibody, anti-CD15, attached to superparamagnetic beads was developed. Cells were initially disrupted by nitrogen cavitation and then incubated with anti-CD15 antibody-conjugated superparamagnetic beads. The beads were then washed to remove unbound cellular debris and cytosol. Recovered plasma membranes were quantified by immunodetection of G(beta2) in Western blots. This membrane marker-based separation yielded highly pure plasma membranes. This protocol has advantages over standard density sedimentation protocols for isolating plasma membrane in that it is faster and easily accommodates cell numbers as low as 10(6). These methods were coupled with immunodetection methods and an adenosine 5(')-diphosphate-ribosylation assay to measure the amount of membrane-associated G(ialpha) proteins available for receptor coupling in neutrophils either stimulated with N-formyl peptides or treated to differing degrees with pertussis toxin. As expected, pertussis toxin treatment decreased the amount of membrane G protein available for signaling although total membrane G protein was not affected. In addition, activation of neutrophils with N-formyl peptides resulted in an approximately 50% decrease in G protein associated with the plasma membrane.

  17. A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rop/Rac small GTPases are central to diverse developmental and cellular activities in plants, playing an especially important Role in polar growth of pollen tubes. Although it is established that a class of plant-specific RopGEFs promotes the activity of Rop/Rac through the catalytic PRONE (Plant-sp...

  18. A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rop/Rac small GTPases are central to diverse developmental and cellular activities in plants, playing an especially important role in polar growth of pollen tubes. Although it is established that a class of plant-specific RopGEFs promotes the activity of Rop/Rac through the catalytic PRONE (Plant sp...

  19. ITAM Signaling by Vav Family Rho Guanine Nucleotide Exchange Factors Regulates Interstitial Transit Rates of Neutrophils In Vivo

    PubMed Central

    Mascarenhas, Francesca; Delgado, Ryan; Miller, Mark J.; Swat, Wojciech


    Background In response to infection, neutrophils are quickly recruited from the blood into inflamed tissues. The interstitial migration of neutrophils is crucial for the efficient capture and control of rapidly proliferating microbes before microbial growth can overwhelm the host's defenses. However, the molecular mechanisms that regulate interstitial migration are incompletely understood. Methodology/Principal Findings Here, we use two-photon microscopy (2PM) to study discrete steps of neutrophil responses during subcutaneous infection with bacteria. Our study demonstrates that signals emanating from ITAM-containing receptors mediated by Vav family Rho GEFs control the velocity, but not the directionality, of neutrophil migration towards sites of bacterial infection. Conclusions/Significance Here we show that during neutrophil migration towards sites of bacterial infection, signals emanating from ITAM-containing receptors specifically control interstitial neutrophil velocity. PMID:19247495

  20. The putative guanine nucleotide exchange factor RicA mediates upstream signaling for growth and development in Aspergillus.


    Kwon, Nak-Jung; Park, Hee-Soo; Jung, Seunho; Kim, Sun Chang; Yu, Jae-Hyuk


    Heterotrimeric G proteins (G proteins) govern growth, development, and secondary metabolism in various fungi. Here, we characterized ricA, which encodes a putative GDP/GTP exchange factor for G proteins in the model fungus Aspergillus nidulans and the opportunistic human pathogen Aspergillus fumigatus. In both species, ricA mRNA accumulates during vegetative growth and early developmental phases, but it is not present in spores. The deletion of ricA results in severely impaired colony growth and the total (for A. nidulans) or near (for A. fumigatus) absence of asexual sporulation (conidiation). The overexpression (OE) of the A. fumigatus ricA gene (AfricA) restores growth and conidiation in the ΔAnricA mutant to some extent, indicating partial conservation of RicA function in Aspergillus. A series of double mutant analyses revealed that the removal of RgsA (an RGS protein of the GanB Gα subunit), but not sfgA, flbA, rgsB, or rgsC, restored vegetative growth and conidiation in ΔAnricA. Furthermore, we found that RicA can physically interact with GanB in yeast and in vitro. Moreover, the presence of two copies or OE of pkaA suppresses the profound defects caused by ΔAnricA, indicating that RicA-mediated growth and developmental signaling is primarily through GanB and PkaA in A. nidulans. Despite the lack of conidiation, brlA and vosA mRNAs accumulated to normal levels in the ΔricA mutant. In addition, mutants overexpressing fluG or brlA (OEfluG or OEbrlA) failed to restore development in the ΔAnricA mutant. These findings suggest that the commencement of asexual development requires unknown RicA-mediated signaling input in A. nidulans.

  1. Ontogenetic development of the striatal [3H]spiperone binding: regulation by sodium and guanine nucleotide in rats.


    Nomura, Y; Oki, K; Segawa, T


    Ontogenetic development of specific [3H]spiperone binding to crude synaptic membranes and its regulation by Na+ and GTP was investigated in the rat striatum. (d)-Butaclamol more effectively inhibited [3H]spiperone binding than (l)-butaclamol. The ratio of inhibitory activity of (d)- and (l)-butaclamol for [3H]spiperone binding was not different between 1-, 7-, and 70-day-old animals but eight- to ninefold lower at 18 days of gestation than during the postnatal period. A Scatchard plot of specific binding indicated the presence of two types of binding: low-affinity (KD = 1.51 nM) and high-affinity (KD = 0.09 nM) binding on day 70. Only one component (KD = 0.075 nM) was observed on days 1 and 7 and both types of binding were found on day 15. Bmax gradually increased with age and reached a peak on day 30, followed by a decline on days 70 and 360. Na+, 100 mM, significantly increased specific binding on days 1, 7, 15, and 70. GTP, 50 microM, completely reversed the Na+-induced decrease in IC50 of apomorphine on both days 15 and 70, but not on day 7. It is suggested that receptors could recognize ligand stereospecificity on day 1. The density in dopamine receptors in the striatum reaches a peak on day 30, followed by a decrease on days 70 and 360. In addition, regulation by Na+ and GTP in agonist binding to dopamine receptors seems to become functional between 1 and 2 weeks after birth.

  2. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie


    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  3. Nucleotide cleaving agents and method


    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.


    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  4. Mechanistic aspects of hydration of guanine radical cations in DNA.


    Rokhlenko, Yekaterina; Cadet, Jean; Geacintov, Nicholas E; Shafirovich, Vladimir


    The mechanistic aspects of hydration of guanine radical cations, G(•+) in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G(•+) radical one-electron oxidation products were generated by SO4(•-) radical anions derived from the photolysis of S2O8(2-) anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4(•-) radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)(•) with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)(•) radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)(•) decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)(•) radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)(•) radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G(•+):C] base pair. This [G(-H)(•):H(+)C ⇆ G(•+):C] equilibrium allows for the hydration of G(•+) followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G(•+) and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally.

  5. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto


    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  6. The intrinsic stabilities and structures of alkali metal cationized guanine quadruplexes.


    Azargun, M; Jami-Alahmadi, Y; Fridgen, T D


    The structures and stabilities of self-assembled guanine quadruplexes, M(9eG)8(+) (M = Na, K, Rb, Cs; 9eG = 9-ethylguanine), have been studied in the gas phase by blackbody infrared radiative dissociation to determine the difference in the stabilizing effect of the alkali metal cations. The order of stabilities to decomposition was determined to be K(+) > Rb(+) > Cs(+) ≫ Na(+), which is consistent with the observation of K(+) being the ion of choice in guanine quadruplexes in nucleic acids. In the gas phase, the sodiated quadruplex was found to lose one 9eG at a time, whereas the quadruplexes of the heavier cations lost a neutral guanine tetrad. Vibrational spectroscopy on the gas-phase quadruplex ions was consistent with the structures in which the metal cations were sandwiched between two guanine tetrads. Electronic structure calculations are also used to compare with the observed stabilities and vibrational spectra.

  7. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.


    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  8. Mechanisms involved in the antinociception induced by spinal administration of inosine or guanine in mice.


    de Oliveira, Enderson D; Schallenberger, Cristhine; Böhmer, Ana Elisa; Hansel, Gisele; Fagundes, Aécio C; Milman, Michael; Silva, Marcos D P; Oses, Jean P; Porciúncula, Lisiane O; Portela, Luís V; Elisabetsky, Elaine; Souza, Diogo O; Schmidt, André P


    It is well known that adenine-based purines exert multiple effects on pain transmission. Recently, we have demonstrated that guanine-based purines may produce some antinociceptive effects against chemical and thermal pain in mice. The present study was designed to investigate the antinociceptive effects of intrathecal (i.t.) administration of inosine or guanine in mice. Additionally, investigation into the mechanisms of action of these purines, their general toxicity and measurements of CSF purine levels were performed. Animals received an i.t. injection of vehicle (30mN NaOH), inosine or guanine (up to 600nmol) and submitted to several pain models and behavioural paradigms. Guanine and inosine produced dose-dependent antinociceptive effects in the tail-flick, hot-plate, intraplantar ( glutamate, capsaicin and acetic acid pain models. Additionally, i.t. inosine inhibited the biting behaviour induced by spinal injection of capsaicin and i.t. guanine reduced the biting behaviour induced by spinal injection of glutamate or AMPA. Intrathecal administration of inosine (200nmol) induced an approximately 115-fold increase on CSF inosine levels. This study provides new evidence on the mechanism of action of extracellular guanine and inosine presenting antinociceptive effects following spinal administration. These effects seem to be related, at least partially, to the modulation of A1 adenosine receptors.

  9. Photoirradiation products of flavin derivatives, and the effects of photooxidation on guanine.


    Kino, Katsuhito; Kobayashi, Teruhiko; Arima, Eiji; Komori, Rie; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Photoirradiation in the presence of riboflavin led to guanine oxidation and the formation of imidazolone. Meanwhile, riboflavin itself was degraded by ultraviolet light A (UV-A) and visible light (VIS) radiation, and the end product was lumichrome. VIS radiation in the presence of riboflavin oxidized guanine similarly to UV-A radiation. Although UV-A radiation with lumichrome oxidized guanine, VIS radiation with lumichrome did not. Thus, UV-A radiation with riboflavin can oxidize guanine even if riboflavin is degraded to lumichrome. In contrast, following VIS radiation degradation of riboflavin to lumichrome, VIS radiation with riboflavin is hardly capable of oxidizing guanine. The consequences of riboflavin degradation and guanine photooxidation can be extended to flavin mononucleotide and flavin adenine dinucleotide. In addition, we report advanced synthesis; carboxymethylflavin was obtained by oxidation of formylmethylflavin with chlorite and hydrogen peroxide; lumichrome was obtained by heating of formylmethylflavin in 50% AcOH; lumiflavin was obtained by incubation of formylmethylflavin in 2 M NaOH, followed by isolation by step-by-step concentration.

  10. Oxidatively Generated Guanine(C8)-Thymine(N3) Intrastrand Cross-links in Double-stranded DNA Are Repaired by Base Excision Repair Pathways.


    Talhaoui, Ibtissam; Shafirovich, Vladimir; Liu, Zhi; Saint-Pierre, Christine; Akishev, Zhiger; Matkarimov, Bakhyt T; Gasparutto, Didier; Geacintov, Nicholas E; Saparbaev, Murat


    Oxidatively generated guanine radical cations in DNA can undergo various nucleophilic reactions including the formation of C8-guanine cross-links with adjacent or nearby N3-thymines in DNA in the presence of O2. The G*[C8-N3]T* lesions have been identified in the DNA of human cells exposed to oxidative stress, and are most likely genotoxic if not removed by cellular defense mechanisms. It has been shown that the G*[C8-N3]T* lesions are substrates of nucleotide excision repair in human cell extracts. Cleavage at the sites of the lesions was also observed but not further investigated (Ding et al. (2012) Nucleic Acids Res. 40, 2506-2517). Using a panel of eukaryotic and prokaryotic bifunctional DNA glycosylases/lyases (NEIL1, Nei, Fpg, Nth, and NTH1) and apurinic/apyrimidinic (AP) endonucleases (Apn1, APE1, and Nfo), the analysis of cleavage fragments by PAGE and MALDI-TOF/MS show that the G*[C8-N3]T* lesions in 17-mer duplexes are incised on either side of G*, that none of the recovered cleavage fragments contain G*, and that T* is converted to a normal T in the 3'-fragment cleavage products. The abilities of the DNA glycosylases to incise the DNA strand adjacent to G*, while this base is initially cross-linked with T*, is a surprising observation and an indication of the versatility of these base excision repair proteins.

  11. Guanine oxidation product 5-carboxamido-5-formamido-2-iminohydantoin induces mutations when bypassed by DNA polymerases and is a substrate for base excision repair.


    Alshykhly, Omar R; Fleming, Aaron M; Burrows, Cynthia J


    Guanine (G) is a target for oxidation by reactive oxygen species in DNA, RNA, and the nucleotide pool. Damage to DNA yields products with alternative properties toward DNA processing enzymes compared to those of the parent nucleotide. A new lesion, 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), bearing a stereocenter in the base was recently identified from the oxidation of G. DNA polymerase and base excision repair processing of this new lesion has now been evaluated. Single nucleotide insertion opposite (S)-2Ih and (R)-2Ih in the template strand catalyzed by the DNA polymerases Klenow fragment exo(-), DPO4, and Hemo KlenTaq demonstrates these lesions to cause point mutations. Specifically, they promote 3-fold more G·C → C·G transversion mutations than G·C → T·A, and (S)-2Ih was 2-fold more blocking for polymerase bypass than (R)-2Ih. Both diastereomer lesions were found to be substrates for the DNA glycosylases NEIL1 and Fpg, and poorly excised by endonuclease III (Nth). The activity was independent of the base pair partner. Thermal melting, CD spectroscopy, and density functional theory geometric optimization calculations were conducted to provide insight into these polymerase and DNA glycosylase studies. These results identify that formation of the 2Ih lesions in a cell would be mutagenic in the event that they were not properly repaired.

  12. Template polymerization of nucleotide analogues

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.


    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  13. A new rapid amplification of cDNA ends method for extremely guanine plus cytosine-rich genes.


    Shi, Xianzong; Jarvis, Donald L


    Rapid amplification of cDNA ends (RACE) is widely used to determine the 5'- and 3'-terminal nucleotide sequences of genes. Many different RACE methods have been developed to meet various requirements, but none addresses the difficult problems that arise when trying to isolate the ends of extremely guanine plus cytosine (GC)-rich genes. In this study, we found that we were unable to isolate the correct 5' or 3' end of an insect gene, which appeared to include extremely GC-rich sequences, using current RACE methods. Thus, we developed a new RACE method that can be used for this purpose. This new method entails first-strand cDNA synthesis at 70 degrees C with Thermo-X reverse transcriptase in the presence of homoectoine, followed by a polymerase chain reaction with 98 degrees C denaturation steps and Phusion DNA polymerase in the presence of 1M betaine and 5% dimethyl sulfoxide (DMSO). The use of these conditions yielded 5'- and 3'-RACE products that were approximately 80% GC over 213 and 162bp, respectively, and included shorter internal regions of 82 to 89% GC.

  14. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines

    PubMed Central

    López-Cruz, Roberto I.; Crocker, Daniel E.; Gaxiola-Robles, Ramón; Bernal, Jaime A.; Real-Valle, Roberto A.; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements. PMID:27375492

  15. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand.


    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (Eu(III)-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the Eu(III)-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the Eu(III)-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the Eu(III)-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using Eu(III)-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of Eu(III)-dtpa-bis(guanine) at 570nm as a function of adenine (Ad) concentration in the range of 0.00-5.00×10(-5)molL(-1) was observed. The detection limit is about 4.70×10(-7)molL(-1).

  16. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine.


    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne


    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA.

  17. Control of self-assembled 2D nanostructures by methylation of guanine.


    Bald, Ilko; Wang, Yao-guang; Dong, Mingdong; Rosen, Christian B; Ravnsbaek, Jens B; Zhuang, Gui-lin; Gothelf, Kurt V; Wang, Jian-guo; Besenbacher, Flemming


    Methylation of DNA nucleobases is an important control mechanism in biology applied, for example, in the regulation of gene expression. The effect of methylation on the intermolecular interactions between guanine molecules is studied through an interplay between scanning tunneling microscopy (STM) and density functional theory with empirical dispersion correction (DFT-D). The present STM and DFT-D results show that methylation of guanine can have subtle effects on the hydrogen-bond strength with a strong dependence on the position of methylation. It is demonstrated that the methylation of DNA nucleobases is a precise means to tune intermolecular interactions and consequently enables very specific recognition of DNA methylation by enzymes. This scheme is used to generate four different types of artificial 2D nanostructures from methylated guanine. For instance, a 2D guanine windmill motif that is stabilized by cooperative hydrogen bonding is revealed. It forms by self-assembly on a graphite surface under ambient conditions at the liquid-solid interface when the hydrogen-bonding donor at the N1 site of guanine is blocked by a methyl group.

  18. Guanine-based structural coloration as an indicator of oxidative stress in a cichlid fish.


    Cahn, Matthew D; Brown, Alexandria C; Clotfelter, Ethan D


    Vertebrate pigmentation is known to be influenced by oxidative stress, but few studies have tested the hypothesis that structural coloration can be similarly affected. We tested whether fish iridophores, which produce structural color using guanine stacks, might be affected by the prooxidant-antioxidant balance of the animal. Specifically, we hypothesized that convict cichlids (Amatitlania nigrofasciata) metabolize guanine present in iridophores to uric acid, an antioxidant, in response to oxidative damage. We used Hunter's contrast gloss and high performance liquid chromatography to determine whether dietary guanine supplementation allows fish to maintain their structural coloration despite oxidative stress induced via ultraviolet-B (UV-B) radiation. We found that dietary guanine was associated with greater skin gloss, and that exposure to UV-B light reduced glossiness. UV-B exposure did not increase oxidative damage (acrolein) or total antioxidant capacity in the skin or liver. Our experiment did not detect effects of dietary guanine or UV-B light on uric acid, but uric acid was positively related to antioxidant capacity. Our results support the hypothesis that structural color in fish may be altered by environmental stressors such as exposure to UV light, and highlight the need for future studies to consider the role of iridophores in condition-dependent visual signaling.

  19. Label-free detection of telomerase activity using guanine electrochemical oxidation signal.


    Eskiocak, Ugur; Ozkan-Ariksoysal, Dilsat; Ozsoz, Mehmet; Oktem, Huseyin Avni


    Telomerase is an important biomarker for cancer cells and its activation in 85% of all cancer types confers a clinical diagnostic value. A label-free electrochemical assay based on guanine oxidation signal to measure telomerase activity is described. This developed technology combined with a disposable sensor, carbon graphite electrode (CGE), and differential pulse voltammetry (DPV) was performed by using PCR amplicons with/without telomeric repeats as the guanine oxidation signal observed at +1.0 V measured after the immobilization of PCR products. Guanine oxidation signal was chosen as a measure of telomerase activity because a substantial increase in the number of guanines was introduced by the action of telomerase which adds hexameric repeats (TTAGGG)n that contain 50% guanine. The developed assay was shown to specifically measure telomerase activity from cell extracts, and elongation rates increased linearly in a concentration dependent manner. Telomerase activity could be detected in cell extracts containing as low as 100 ng/microL of protein. All of the electrochemical measurements were also confirmed with the conventional TRAP-silver staining assay. Rapidity, simplicity, and the label-free nature of the developed assay make it suitable for practical use in quantitative determination of telomerase activity from clinical samples for diagnosis of cancer.

  20. Reduction of electron deficient guanine radical species in plasmid DNA by tyrosine derivatives.


    Tsoi, Mandi; Do, Trinh T; Tang, Vicky J; Aguilera, Joseph A; Milligan, Jamie R


    Guanine bases are the most easily oxidized sites in DNA and therefore electron deficient guanine radical species are major intermediates in the direct effect of ionizing radiation (ionization of the DNA itself) on DNA as a consequence of hole migration to guanine. As a model for this process we have used gamma-irradiation in the presence of thiocyanate ions to generate single electron oxidized guanine radicals in a plasmid target in aqueous solution. The stable species formed from these radicals can be detected and quantified by the formation of strand breaks in the plasmid after a post-irradiation incubation using a suitable enzyme. If a tyrosine derivative is also present during irradiation, the production of guanine oxidation products is decreased by electron transfer from tyrosine to the intermediate guanyl radical species. By using cationic tyrosine containing ligands we are able to observe this process when the tyrosine is electrostatically bound to the plasmid. The driving force dependence of this reaction was determined by comparing the reactivity of tyrosine with its 3-nitro analog. The results imply that the electron transfer reaction is coupled to a proton transfer. The experimental conditions used in this model system provide a reasonable approximation to those involved in the radioprotection of DNA by tightly bound proteins in chromatin.

  1. Electrochemical studies on the oxidation of guanine and adenine at cyclodextrin modified electrodes.


    Abbaspour, Abdolkarim; Noori, Abolhassan


    An electrochemical sensor for guanine and adenine using cyclodextrin-modified poly(N-acetylaniline) (PNAANI) on a carbon paste electrode has been developed. The oxidation mechanism of guanine and adenine on the surface of the electrode was investigated by cyclic voltammetry. It was found that the electrode processes are irreversible, pH dependent, and involve several reaction products. The electron transfer process occurs in consecutive steps with the formation of a strongly adsorbed intermediate on the electrode surface. Also, a new method for estimating the apparent formation constants of guanine and adenine with the immobilized cyclodextrins, through the change of surface coverage of studied analytes has been reported. Both guanine and adenine showed linear concentrations in the range of 0.1-10 microM by using differential pulse voltammetry, with an experimental limit of detection down to 0.05 microM. Linear concentration ranges of 2-150 microM for guanine and 6-104 microM for adenine have been found when cyclic voltammetry was used for determination of both analytes.

  2. Guanine derivatives modulate L-glutamate uptake into rat brain synaptic vesicles.


    Tasca, Carla I; Santos, Tiago G; Tavares, Rejane G; Battastini, Ana M O; Rocha, João B T; Souza, Diogo O


    Glutamate uptake into synaptic vesicles is driven by a proton electrochemical gradient generated by a vacuolar H(+)-ATPase and stimulated by physiological concentrations of chloride. This uptake plays an important role in glutamatergic transmission. We show here that vesicular glutamate uptake is selectively inhibited by guanine derivatives, in a time- and concentration-dependent manner. Guanosine, GMP, GDP, guanosine-5'-O-2-thiodiphosphate, GTP, or 5'-guanylylimidodiphosphate (GppNHp) inhibited glutamate uptake in 1.5 and 3 min incubations, however, when incubating for 10 min, only GTP or GppNHp displayed such inhibition. By increasing ATP concentrations, the inhibitory effect of GTP was no longer observed, but GppNHp still inhibited glutamate uptake. In the absence of ATP, vesicular ATPase can hydrolyze GTP in order to drive glutamate uptake. However, 5mM GppNHp inhibited ATP hydrolysis by synaptic vesicle preparations. GTP or GppNHp decreased the proton electrochemical gradient, whereas the other guanine derivatives did not. Glutamate saturation curves were assayed in order to evaluate the specificity of inhibition of the vesicular glutamate carrier by the guanine derivatives. The maximum velocity of the initial rate of glutamate uptake was decreased by all guanine derivatives. These results indicate that, although GppNHp can inhibit ATPase activity, guanine derivatives are more likely to be acting through interaction with vesicular glutamate carrier.

  3. RNA Secondary Structures Having a Compatible Sequence of Certain Nucleotide Ratios.


    Barrett, Christopher L; Li, Thomas J X; Reidys, Christian M


    Given a random RNA secondary structure, S, we study RNA sequences having fixed ratios of nucleotides that are compatible with S. We perform this analysis for RNA secondary structures subject to various base-pairing rules and minimum arc- and stack-length restrictions. Our main result reads as follows: in the simplex of nucleotide ratios, there exists a convex region, in which, in the limit of long sequences, a random structure asymptotically almost surely (a.a.s.) has compatible sequence with these ratios and outside of which a.a.s. a random structure has no such compatible sequence. We localize this region for RNA secondary structures subject to various base-pairing rules and minimum arc- and stack-length restrictions. In particular, for GC-sequences (GC denoting the nucleotides guanine and cytosine, respectively) having a ratio of G nucleotides smaller than 1/3, a random RNA secondary structure without any minimum arc- and stack-length restrictions has a.a.s. no such compatible sequence. For sequences having a ratio of G nucleotides larger than 1/3, a random RNA secondary structure has a.a.s. such compatible sequences. We discuss our results in the context of various families of RNA structures.

  4. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.


    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth


    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.

  5. Fast nucleotide identification through fingerprinting using gold nanoparticle-based surface-assisted laser desorption/ionisation.


    Larguinho, Miguel; Capelo, José L; Baptista, Pedro V


    We report a method centred on gold nanoparticle-based surface-assisted laser desorption/ionisation for analysis of deoxynucleotides and alkylated nucleobases. Gold nanoparticles allow for enhanced analysis capability by eliminating undesired signature peaks; thus more elegant mass spectra can be attained that allow identification by nucleotide mass fingerprint. The resulting fingerprinting patterns on the spectra are compared and associated with the presence of different nucleotides in the sample. This method can be easily extended to modified nucleotides implicated in genome lesions due to exposure to environment chemicals, such as DNA adducts (e.g. guanine adducts). The use of gold nanoparticles for surface-assisted laser desorption/ionisation can be an useful tool to resolve common issues of background noise when analysing nucleic acids samples.

  6. Effect of intense magnetic fields on the convection of biogenic guanine crystals in aqueous solution

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Mizukawa, Y.


    In this study, the basic magneto-optic properties of biogenic microcrystals in aqueous media were investigated. Microcrystals, mica plates, silica, and microcrystals from a diatom cell and biogenic guanine crystals from goldfish showed light scattering inhibition when the crystals were observed in water under a 5 T magnetic field and dark-field illumination. In particular, in 50% ethanol/water medium, convection of the biogenic guanine particle aggregates was reversibly inhibited when the microcrystal suspension was exposed to a 5 T magnetic field. Microscopic observation comparing the biogenic guanine crystals in water with 95% ethanol or 99% acetone revealed that light flickering on the surface of the crystals was affected by the surface interaction of the crystal with the surrounding medium. By considering both the magnetic orientation of the microcrystals and the possible interactions of crystals with the surrounding medium, a magnetically controllable fluidic tracer was suggested.

  7. Formation of the carboxamidine precursor of cyanuric acid from guanine oxidative lesion dehydro-guanidinohydantoin.


    Irvoas, Joris; Trzcionka, Jérôme; Pratviel, Geneviève


    DNA damage under oxidative stress leads to oxidation of guanine base. The identification of the resulting guanine lesions in cellular DNA is difficult due to the sensitivity of the primary oxidation products to hydrolysis and/or further oxidation. We isolated dehydroguanidino-hydantoin (DGh) (or oxidized guanidinohydantoin), a secondary oxidation product of guanine, and showed that this lesion reacts readily with nucleophiles such as asymmetric peroxides and transforms to 2,4,6-trioxo-1,3,5-triazinane-1-carboxamidine residue. Further hydrolysis of this intermediate leads to cyanuric acid and finally to urea residue. This work demonstrates a new possible pathway for the formation of the well-known carboxamidine precursor of cyanuric acid lesion.

  8. Rapid and simple G-quadruplex DNA aptasensor with guanine chemiluminescence detection.


    Cho, Sandy; Park, Lucienne; Chong, Richard; Kim, Young Teck; Lee, Ji Hoon


    Cost-effective and sensitive aptasensor with guanine chemiluminescence detection capable of simply quantifying thrombin in human serum was developed using thrombin aptamer (TBA), one of the G-quadruplex DNA aptamers, without expensive nanoparticles and complicated procedures. Guanines of G-quadruplex TBA-conjugated carboxyfluorescein (6-FAM) bound with thrombin do not react with 3,4,5-trimethoxylphenylglyoxal (TMPG) in the presence of tetra-n-propylammonium hydroxide (TPA), whereas guanines of free TBA- and TBA-conjugated 6-FAM immobilized on the surface of graphene oxide rapidly react with TMPG to emit light. Thus, guanine chemiluminescence in 5% human serum with thrombin was lower than that without thrombin when TBA-conjugated 6-FAM was added in two samples and incubated for 20 min. In other words, the brightness of guanine chemiluminescence was quenched due to the formation of G-quadruplex TBA-conjugated 6-FAM bound with thrombin in a sample. High-energy intermediate, capable of emitting dim light by itself, formed from the reaction between guanines of TBA and TMPG in the presence of TPA, transfers energy to 6-FAM to emit bright light based on the principle of chemiluminescence energy transfer (CRET). G-quadruplex TBA aptasensor devised using the rapid interaction between TBA-conjugated 6-FAM and thrombin quantified trace levels of thrombin without complicated procedures. The limit of detection (LOD = background + 3 × standard deviation) of G-quadruplex TBA aptasensor with good linear calibration curve, accuracy, precision, and recovery was as low as 12.3 nM in 5% human serum. Using the technology reported in this research, we expect that various types of G-quadruplex DNA aptasensors capable of specifically sensing a target molecule such as ATP, HIV, ochratoxin, potassium ions, and thrombin can be developed.

  9. Mechanisms of oxidation of guanine in DNA by carbonate radical anion, a decomposition product of nitrosoperoxycarbonate.


    Lee, Young Ae; Yun, Byeong Hwa; Kim, Seog K; Margolin, Yelena; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

  10. Alkylation of urinary guanine in mice by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Hegazi, B


    The methylating capability of tetrachlorvinphos on urinary guanine in mice has been investigated using an insecticide labeled at both O-CH3 groups. Following intraperitoneal administration of the 14C-labeled insecticide to mice, about 0.57% of the radioactivity in the O- to 24-hr samples was associated with the purine fraction. The amount of [7-14C]methylguanine in 0- to 48-hr urine samples, estimated as fraction of applied dose, was 26-31 X 10(-5). The results obtained indicate possible chemical alkylation of urinary guanine. On the other hand, a considerable portion of radioactivity is probably incorporated via the C-1 pool.

  11. Labeled nucleotide phosphate (NP) probes


    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu


    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  12. Ric-8A, a G protein chaperone with nucleotide exchange activity induces long-range secondary structure changes in Gα

    PubMed Central

    Kant, Ravi; Zeng, Baisen; Thomas, Celestine J; Bothner, Brian; Sprang, Stephen R


    Cytosolic Ric-8A has guanine nucleotide exchange factor (GEF) activity and is a chaperone for several classes of heterotrimeric G protein α subunits in vertebrates. Using Hydrogen-Deuterium Exchange-Mass Spectrometry (HDX-MS) we show that Ric-8A disrupts the secondary structure of the Gα Ras-like domain that girds the guanine nucleotide-binding site, and destabilizes the interface between the Gαi1 Ras and helical domains, allowing domain separation and nucleotide release. These changes are largely reversed upon binding GTP and dissociation of Ric-8A. HDX-MS identifies a potential Gα interaction site in Ric-8A. Alanine scanning reveals residues crucial for GEF activity within that sequence. HDX confirms that, like G protein-coupled receptors (GPCRs), Ric-8A binds the C-terminus of Gα. In contrast to GPCRs, Ric-8A interacts with Switches I and II of Gα and possibly at the Gα domain interface. These extensive interactions provide both allosteric and direct catalysis of GDP unbinding and release and GTP binding. DOI: PMID:28008853

  13. Ric-8A, a G protein chaperone with nucleotide exchange activity induces long-range secondary structure changes in Gα.


    Kant, Ravi; Zeng, Baisen; Thomas, Celestine J; Bothner, Brian; Sprang, Stephen R


    Cytosolic Ric-8A has guanine nucleotide exchange factor (GEF) activity and is a chaperone for several classes of heterotrimeric G protein α subunits in vertebrates. Using Hydrogen-Deuterium Exchange-Mass Spectrometry (HDX-MS) we show that Ric-8A disrupts the secondary structure of the Gα Ras-like domain that girds the guanine nucleotide-binding site, and destabilizes the interface between the Gαi1 Ras and helical domains, allowing domain separation and nucleotide release. These changes are largely reversed upon binding GTP and dissociation of Ric-8A. HDX-MS identifies a potential Gα interaction site in Ric-8A. Alanine scanning reveals residues crucial for GEF activity within that sequence. HDX confirms that, like G protein-coupled receptors (GPCRs), Ric-8A binds the C-terminus of Gα. In contrast to GPCRs, Ric-8A interacts with Switches I and II of Gα and possibly at the Gα domain interface. These extensive interactions provide both allosteric and direct catalysis of GDP unbinding and release and GTP binding.

  14. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation.


    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M


    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity.

  15. Vibrational investigations of guanine, thioguanine and their singly charged cations and anions

    NASA Astrophysics Data System (ADS)

    Singh, R.; Yadav, R. A.


    The complete vibrational studies have been done with help of quantum mechanics for the neutral Guanine (Gua) and Thioguanine (TGua) molecules and their singly charged cations and anions employing the B3LYP/6-311++G** method. Neutral Thioguanine and cations of Guanine and Thioguanine show planar structures and belong to Cs point group symmetry while the neutral Guanine and anions of Guanine and Thioguanine possess non-planar structure with C1 point group symmetry. Vibrational studies of ionic radicals of Gua and its thio- derivative are not available in literatures. Such extensive studies have been attempted for the first time. The normal modes of all the species have been assigned on the basis using potential energy distributions (PEDs) using GAR2PED software. The PEDs have also been calculated to make a conspicuous assignment as animation available in GaussView is not a guarantee for correct normal mode assignment. Charge transfer occurs in the molecule have been shown by the calculated highest occupied molecular orbital—lowest unoccupied molecular orbital (HOMO-LUMO) energies. The mapping of electron density iso-surface with electrostatic potential, has been carried out to get the information about the size, shape, charge density distribution and site of chemical reactivity of the molecule. The electronic properties HOMO and LUMO energies have been measured. The energy gap from HOMO to LUMO of the Gua is 5.0547 eV and TGua 4.0743 eV.

  16. Theoretical and Experimental Study of Valence-Shell Ionization Spectra of Guanine

    NASA Astrophysics Data System (ADS)

    Zaytseva, Irina L.; Trofimov, Alexander B.; Schirmer, Jochen; Plekan, Oksana; Feyer, Vitaliy; Richter, Robert; Coreno, Marcello; Prince, Kevin C.


    The full valence-shell ionization spectra of the four most stable guanine tautomers were studied theoretically. The third-order algebraic-diagrammatic construction (ADC(3)) method for the one-particle Green's function was used to calculate the energies and relative intensities of the vertical ionization transitions. For low-lying transitions, the influence of planar and nonplanar guanine configurations on the ionization energies, as well as the convergence of the results with respect to basis set was studied at the level of the outer-valence Green's function (OVGF) approximation scheme. The results of the calculations were used to interpret recent synchrotron radiation valence-shell photoionization spectra of guanine in the gas phase under thermal equilibrium conditions. The photoelectron spectrum was modeled by summing individual tautomer spectra weighted by Boltzmann population ratios (BPR) of tautomers from our previous high-level ab initio thermochemical calculations. The theoretical spectra are in good agreement with the experimental results, providing assignments of most observed structures and offering insight into tautomerism of guanine in the gas phase. The first six molecular orbitals give rise to single-hole states with a binding energy of about 7-12 eV. At higher binding energy the spectral features are mainly due to satellite states.

  17. Extracellular conversion of guanine-based purines to guanosine specifically enhances astrocyte glutamate uptake.


    Frizzo, Marcos Emílio dos Santos; Antunes Soares, Félix Alexandre; Dall'Onder, Leonara Patrícia; Lara, Diogo Rizzato; Swanson, Raymond A; Souza, Diogo Onofre


    Guanosine (GUO) has been shown to stimulate glutamate uptake in primary astrocyte cultures. The purpose of this study was to determine the effect and specificity of guanine- or adenine-based purines on glutamate and GABA uptake in cultured astrocytes. Stimulatory effect on glutamate uptake was observed with GUO, GMP or GTP. Simultaneous exposure with these guanine-based purines did not show an additive effect. We also investigated a possible interconversion of guanine-based purines during incubation time. Action by GTP was excluded since the hydrolysis resistant GTP analog, GMP-PNP did not stimulate glutamate uptake. Addition of an ecto-5'-nucleotidase inhibitor abolished GMP-stimulatory effect on glutamate uptake, without affecting GUO action. Taken together, these results suggest that GUO is the guanine-based purines responsible for glutamate uptake activation. In addition, the stimulatory effect on glutamate uptake was not observed with adenine-based purines. Moreover, GABA uptake was not activated by GUO. These results point to specificity in the interaction between GUO and the astrocyte glutamate uptake system.

  18. Successive attachment of electrons to protonated Guanine: (G+H)* radicals and (G+H)- anions.


    Zhang, Jun D; Xie, Yaoming; Schaefer, Henry F


    The structures, energetics, and vibrational frequencies of nine hydrogenated 9H-keto-guanine radicals (G+H)(*) and closed-shell anions (G+H)(-) are predicted using the carefully calibrated (Chem. Rev. 2002, 102, 231) B3LYP density functional method in conjunction with a DZP++ basis set. These radical and anionic species come from consecutive electron attachment to the corresponding protonated (G+H)(+) cations in low pH environments. The (G+H)(+) cations are studied using the same level of theory. The proton affinity (PA) of guanine computed in this research (228.1 kcal/mol) is within 0.7 kcal/mol of the latest experiment value. The radicals range over 41 kcal/mol in relative energy, with radical r1, in which H is attached at the C8 site of guanine, having the lowest energy. The lowest energy anion is a2, derived by hydride ion attachment at the C2 site of guanine. No stable N2-site hydride should exist in the gas phase. Structure a9 was predicted to be dissociative in this research. The theoretical adiabatic electron affinities (AEA), vertical electron affinities, and vertical detachment energies were computed, with AEAs ranging from 0.07 to 3.12 eV for the nine radicals.

  19. Nucleotide binding affects intrinsic dynamics and structural communication in Ras GTPases.


    Fanelli, Francesca; Raimondi, Francesco


    The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins) that are essential to intracellular signal transduction. These proteins act biologically as molecular switches, which, cycling between OFF and ON states, play fundamental role in cell biology. This review article summarizes the inferences from the widest computational analyses done so far on Ras GTPases aimed at providing a comprehensive structural/dynamic view of the trans-family and family-specific functioning mechanisms. These variegated comparative analyses could infer the evolutionary and intrinsic flexibilities as well as the structural communication features in the most representative G protein families in different functional states. In spite of the low sequence similarities, the members of the Ras superfamily share the topology of the Ras-like domain, including the nucleotide binding site. GDP and GTP make very similar interactions in all GTPases and differences in their binding modes are localized around the γ-phosphate of GTP. Remarkably, such subtle local differences result in significant differences in the functional dynamics and structural communication features of the protein. In Ras GTPases, the nucleotide plays a central and active role in dictating functional dynamics, establishing the major structure network, and mediating the communication paths instrumental in function retention and specialization. Collectively, the results of these studies support the speculation that an "extended conformational selection model" that embraces a repertoire of selection and adjustment processes is likely more suitable to describe the nucleotide behavior in these important molecular switches.

  20. Rab27a Targeting to Melanosomes Requires Nucleotide Exchange but Not Effector Binding

    PubMed Central

    Tarafder, Abul K; Wasmeier, Christina; Figueiredo, Ana C; Booth, Antonia E G; Orihara, Asumi; Ramalho, Jose S; Hume, Alistair N; Seabra, Miguel C


    Rab GTPases are important determinants of organelle identity and regulators of vesicular transport pathways. Consequently, each Rab occupies a highly specific subcellular localization. However, the precise mechanisms governing Rab targeting remain unclear. Guanine nucleotide exchange factors (GEFs), putative membrane-resident targeting factors and effector binding have all been implicated as critical regulators of Rab targeting. Here, we address these issues using Rab27a targeting to melanosomes as a model system. Rab27a regulates motility of lysosome-related organelles and secretory granules. Its effectors have been characterized extensively, and we have identified Rab3GEP as the non-redundant Rab27a GEF in melanocytes (Figueiredo AC et al. Rab3GEP is the non-redundant guanine nucleotide exchange factor for Rab27a in melanocytes. J Biol Chem 2008;283:23209–23216). Using Rab27a mutants that show impaired binding to representatives of all four Rab27a effector subgroups, we present evidence that effector binding is not essential for targeting of Rab27a to melanosomes. In contrast, we observed that knockdown of Rab3GEP resulted in mis-targeting of Rab27a, suggesting that Rab3GEP activity is required for correct targeting of Rab27a. However, the identification of Rab27a mutants that undergo efficient GDP/GTP exchange in the presence of Rab3GEP in vitro but are mis-targeted in a cellular context indicates that nucleotide loading is not the sole determinant of subcellular targeting of Rab27a. Our data support a model in which exchange activity, but not effector binding, represents one essential factor that contributes to membrane targeting of Rab proteins. PMID:21554507

  1. Metalated nucleotide chemisorption on hydroxyapatite.


    Benedetti, Michele; Antonucci, Daniela; De Castro, Federica; Girelli, Chiara R; Lelli, Marco; Roveri, Norberto; Fanizzi, Francesco P


    The experiments here reported evidence on the importance of the residual charge of a nucleotide derivative, for the adsorption on nHAP (hydroxyapatite nanocrystals), in water solution. We found that the simple presence of phosphates on the nucleotide derivative does not guarantee adsorption on nHAP. On the other hand, we demonstrated that a cationic or neutral charge on a nucleotide derivative produces a strongly reduced chemical adsorption (chemisorption) whereas, in the presence of a net negative charge, relevant adsorption on nHAP is observed. The number of phosphates can only modulate the adsorption efficiency of a molecule provided that this latter bears an overall negative charge. The neutral zwitterionic nucleotide Pt(II) complexes, bearing negatively charged phosphates, are unable to give stable chemisorption. Previous considerations are important to model the binding ability of phosphate bearing nucleotide derivatives or molecules on hydroxyapatite. The findings reported in the present paper could be relevant in bone tissue targeting or nHAP mediated drug delivery.

  2. Insertion of oxidized nucleotide triggers rapid DNA polymerase opening

    PubMed Central

    Kim, Taejin; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.; Schlick, Tamar


    A novel mechanism is unveiled to explain why a pro-mutagenic nucleotide lesion (oxidized guanine, 8-oxoG) causes the mammalian DNA repair polymerase-β (pol-β) to rapidly transition to an inactive open conformation. The mechanism involves unexpected features revealed recently in time-lapse crystallography. Specifically, a delicate water network associated with a lesion-stabilizing auxilliary product ion Mg(p) triggers a cascade of events that leads to poor active site geometry and the rupture of crucial molecular interactions between key residues in both the anti(8-oxoG:C) and syn(8-oxoG:A) systems. Once the base pairs in these lesioned systems are broken, dislocation of both Asp192 (a metal coordinating ligand) and the oxoG phosphate group (PO4) interfere with the hydrogen bonding between Asp192 and Arg258, whose rotation toward Asp192 is crucial to the closed-to-open enzyme transition. Energetically, the lesioned open states are similar in energy to those of the corresponding closed complexes after chemistry, in marked contrast to the unlesioned pol-β anti(G:C) system, whose open state is energetically higher than the closed state. The delicate surveillance system offers a fundamental protective mechanism in the cell that triggers DNA repair events which help deter insertion of oxidized lesions. PMID:27034465

  3. Different Characteristics and Nucleotide Binding Properties of Inosine Monophosphate Dehydrogenase (IMPDH) Isoforms

    PubMed Central

    Thomas, Elaine C.; Gunter, Jennifer H.; Webster, Julie A.; Schieber, Nicole L.; Oorschot, Viola; Parton, Robert G.; Whitehead, Jonathan P.


    We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH), a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP) would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i) the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii) communication occurs between the Bateman and catalytic domains and (iii) the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease. PMID:23236438

  4. The use of modified and non-natural nucleotides provide unique insights into pro-mutagenic replication catalyzed by polymerase eta

    PubMed Central

    Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J.; Berdis, Anthony J.


    This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. PMID:26717984

  5. Finding Adiabatically Bound Anions of Guanine through a Combinatorial Computational Approach

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.


    In summary, guanine supports many adiabatically bound valence anions, which result from enamine-imine transformations of the most stable neutral tautomers. These stable anionic tautomers have been found using combinatorial-computational prescreening at the B3LYP level of theory followed by CCSD(T)/aug-cc-pVDZ calculations. The new anionic tautomers contradict a common opinion that guanine has the lowest electron affinity among nucleobases. The new anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom. They might affect the structure and properties of DNA and RNA exposed to low-energy electrons. Chemical transformations of DNA triggered by the new anionic tautomers will be explored in our future studies.

  6. Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.


    Musumeci, Domenica; Irace, Carlo; Santamaria, Rita; Milano, Domenico; Tecilla, Paolo; Montesarchio, Daniela


    Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2.

  7. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.


    Usha, S; Selvaraj, S


    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  8. The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts

    PubMed Central

    Wyss, Laura A.; Nilforoushan, Arman; Williams, David M.; Marx, Andreas; Sturla, Shana J.


    Enzymatic approaches for locating alkylation adducts at single-base resolution in DNA could enable new technologies for understanding carcinogenesis and supporting personalized chemotherapy. Artificial nucleotides that specifically pair with alkylated bases offer a possible strategy for recognition and amplification of adducted DNA, and adduct-templated incorporation of an artificial nucleotide has been demonstrated for a model DNA adduct O6-benzylguanine by a DNA polymerase. In this study, DNA adducts of biological relevance, O6-methylguanine (O6-MeG) and O6-carboxymethylguanine (O6-CMG), were characterized to be effective templates for the incorporation of benzimidazole-derived 2′-deoxynucleoside-5′-O-triphosphates (BenziTP and BIMTP) by an engineered KlenTaq DNA polymerase. The enzyme catalyzed specific incorporation of the artificial nucleotide Benzi opposite adducts, with up to 150-fold higher catalytic efficiency for O6-MeG over guanine in the template. Furthermore, addition of artificial nucleotide Benzi was required for full-length DNA synthesis during bypass of O6-CMG. Selective incorporation of the artificial nucleotide opposite an O6-alkylguanine DNA adduct was verified using a novel 2′,3′-dideoxy derivative of BenziTP. The strategy was used to recognize adducts in the presence of excess unmodified DNA. The specific processing of BenziTP opposite biologically relevant O6-alkylguanine adducts is characterized herein as a basis for potential future DNA adduct sequencing technologies. PMID:27378785

  9. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.


    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  10. Non-covalent functionalization of hexagonal boron nitride nanosheets with guanine.


    Anota, E Chigo; Tlapale, Y; Villanueva, M Salazar; Márquez, J A Rivera


    Density functional theory (DFT) calculations were performed to analyze changes in the structural and electronic properties generated by the interaction of a single nucleobase group (guanine) with the surface of boron nitride nanosheets with hexagonal symmetry (hBNNs). Nanosheets in two contexts were tested: pristine sheets and with point defects (doped with carbon atoms). The criterion of energy minimum was used to find the ground state of the nine possible isomers generated by the hBNNs-guanine interaction. The phenomenon of physisorption is known to occur at values less than 1.0 eV; the adsorption energy results revealed that the preferential geometry was a parallel arrangement between the two partners, with van der Waals-type bonds generated for the hBNNs doped with two carbon atoms. This was the only energetically stable configuration, thus revealing a vibrational mode rather than imaginaries. Furthermore, the hBNNs/C-guanine system has a low value for work function, and therefore could be used in health applications such drug transport and delivery. The increased polarity values suggest that these nanosheets could be solubilized in common solvents used in experimental processes.

  11. Geometrical Characterization of Adenine And Guanine on Cu(110) By NEXAFS, XPS, And DFT Calculation

    SciTech Connect

    Furukawa, M.; Yamada, T.; Katano, S.; Kawai, M.; Ogasawara, H.; Nilsson, A.; /SLAC, SSRL /Stockholm U.


    Adsorption of purine DNA bases (guanine and adenine) on Cu(1 1 0) was studied by X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine-structure spectroscopy (NEXAFS), and density-functional theory (DFT) calculation. At coverages near 0.2 monolayers, Angular-resolved NEXAFS analysis revealed that adenine adsorbates lie almost flat and that guanine adsorbates are tilted up on the surface with the purine ring parallel to the atom rows of Cu(1 1 0). Referring to the previous studies on pyrimidine DNA bases [M. Furukawa, H. Fujisawa, S. Katano, H. Ogasawara, Y. Kim, T. Komeda, A. Nilsson, M. Kawai, Surf. Sci. 532-535 (2003) 261], the isomerization of DNA bases on Cu(1 1 0) was found to play an important role in the adsorption geometry. Guanine, thymine and cytosine adsorption have an amine-type nitrogen next to a carbonyl group, which is dehydrogenated into imine nitrogen on Cu(1 1 0). These bases are bonded by the inherent portion of - NH-CO - altered by conversion into enolic form and dehydrogenation. Adenine contains no CO group and is bonded to Cu(1 1 0) by participation of the inherent amine parts, resulting in nearly flatly-lying position.

  12. Oxidative modification of guanine bases initiated by oxyl radicals derived from photolysis of azo compounds.


    Shao, Jie; Geacintov, Nicholas E; Shafirovich, Vladimir


    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO(*)), 2-amidinoprop-2-oxyl (RO(*)), and superoxide (O(2)(*-)) radicals. These oxyl radicals with negligible absorption in a near UV-visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO(*) radicals induce fast one-electron oxidation of 2'-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)(*). In contrast, ROO(*) radicals do not react at observable rates with dG. The O(2)(*-) radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end-products of guanine oxidation is the combination of the G(-H)(*) and O(2)(*-) radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end-products produced by oxidation of two substrates: (1) the guanosine derivative 2',3',5'-tri-O-acetylguanosine (tri-O-Ac-G) and (2) the 5'-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5'-d(CCATC[Iz]CTACC products.

  13. DNA polymerase V allows bypass of toxic guanine oxidation products in vivo.


    Neeley, William L; Delaney, Sarah; Alekseyev, Yuriy O; Jarosz, Daniel F; Delaney, James C; Walker, Graham C; Essigmann, John M


    Reactive oxygen and nitrogen radicals produced during metabolic processes, such as respiration and inflammation, combine with DNA to form many lesions primarily at guanine sites. Understanding the roles of the polymerases responsible for the processing of these products to mutations could illuminate molecular mechanisms that correlate oxidative stress with cancer. Using M13 viral genomes engineered to contain single DNA lesions and Escherichia coli strains with specific polymerase (pol) knockouts, we show that pol V is required for efficient bypass of structurally diverse, highly mutagenic guanine oxidation products in vivo. We also find that pol IV participates in the bypass of two spiroiminodihydantoin lesions. Furthermore, we report that one lesion, 5-guanidino-4-nitroimidazole, is a substrate for multiple SOS polymerases, whereby pol II is necessary for error-free replication and pol V for error-prone replication past this lesion. The results spotlight a major role for pol V and minor roles for pol II and pol IV in the mechanism of guanine oxidation mutagenesis.

  14. Formation of ring-opened and rearranged products of guanine: mechanisms and biological significance.


    Jena, N R; Mishra, P C


    DNA damage by endogenous and exogenous agents is a serious concern, as the damaged products can affect genome integrity severely. Damage to DNA may arise from various factors such as DNA base modifications, strand break, inter- and intrastrand crosslinks, and DNA-protein crosslinks. Among these factors, DNA base modification is a common and important form of DNA damage that has been implicated in mutagenesis, carcinogenesis, and many other pathological conditions. Among the four DNA bases, guanine (G) has the smallest oxidation potential, because of which it is frequently modified by reactive species, giving rise to a plethora of lethal lesions. Similarly, 8-oxo-7,8-dihydroguanine (8-oxoG), an oxidatively damaged guanine lesion, also undergoes various degradation reactions giving rise to several mutagenic species. The various products formed from reactions of G or 8-oxoG with different reactive species are mainly 2,6-diamino-4-oxo-5-formamidopyrimidine, 2,5-diamino-4H-imidazolone, 2,2,4-triamino-5-(2H)-oxazolone, 5-guanidino-4-nitroimidazole, guanidinohydantoin, spiroiminodihydantoin, cyanuric acid, parabanic acid, oxaluric acid, and urea, among others. These products are formed from either ring opening or ring opening and subsequent rearrangement. The main aim of this review is to provide a comprehensive overview of various possible reactions and the mechanisms involved, after which these ring-opened and rearranged products of guanine would be formed in DNA. The biological significance of oxidatively damaged products of G is also discussed.

  15. Magnetic Control of the Light Reflection Anisotropy in a Biogenic Guanine Microcrystal Platelet.


    Iwasaka, Masakazu; Mizukawa, Yuri; Roberts, Nicholas W


    Bioinspired but static optical devices such as lenses, retarders, and reflectors have had a significant impact on the designs of many man-made optical technologies. However, while numerous adaptive and flexible optical mechanisms are found throughout the animal kingdom, highly desirable biomimetic copies of these remarkable smart systems remain, in many cases, a distant dream. Many aquatic animals have evolved highly efficient reflectors based on multilayer stacks of the crystallized nucleic acid base guanine. With exceptional levels of spectral and intensity control, these reflectors represent an interesting design pathway towards controllable micromirror structures. Here we show that individual guanine crystals, with dimensions of 5 μm × 20 μm × 70 nm, can be magnetically controlled to act as individual micromirrors. By applying magnetic fields of 500 mT, the reflectivity of these crystals can be switched off and on for the change in reflectivity. Overall, the use of guanine represents a novel design scheme for a highly efficient and controllable synthetic organic micromirror array.

  16. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    NASA Astrophysics Data System (ADS)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  17. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    PubMed Central

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10−7 to 10−3 Ω−1 cm−1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries. PMID:27091631

  18. ESI-MS Characterization of a Novel Pyrrole-Inosine Nucleoside that Interacts with Guanine Bases

    PubMed Central

    Pierce, Sarah E.; Sherman, Courtney L.; Jayawickramarajah, Janarthanan; Lawrence, Candace M.; Sessler, Jonathan L.; Brodbelt, Jennifer S.


    Based on binding studies undertaken by electrospray ionization-mass spectrometry, a synthetic pyrrole-inosine nucleoside, 1, capable of forming an extended three-point Hoogsteen-type hydrogen-bonding interaction with guanine, is shown to form specific complexes with two different quadruplex DNA structures [dTG4T]4 and d(T2G4)4 as well as guanine rich duplex DNA. The binding interactions of two other analogs were evaluated in order to unravel the structural features that contribute to specific DNA recognition. The importance of the Hoogsteen interactions was confirmed through the absence of specific binding when the pyrrole NH hydrogen-bonding site was blocked or removed. While 2, with a large blocking group, was not found to interact with virtually any form of DNA, 3, with the pyrrole functionality missing, was found to interact non-specifically with several types of DNA. The specific binding of 1 to guanine rich DNA emphasizes the necessity of careful ligand design for specific sequence recognition. PMID:18790136

  19. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution.


    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi; Fujii, Kentaro; Yokoya, Akinari; Fukuda, Yoshihiro; Saitoh, Yuji


    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5'-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5'-monophosphate, and adenosine 5'-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  20. A New Apparatus for Studies of Low Energy Electron Collisions with Nucleotide Molecules

    NASA Astrophysics Data System (ADS)

    Duron, Jessica; Hargreaves, Leigh

    Low-energy electrons, the most copiously produced by-product of radiation cancer therapy, have been shown to be a strong driver of DNA damage in living cells [1]. Quantitative data describing these collisions are presently rare due to technological challenges in performing electron scattering measurements from the nucleobases, e.g. uracil, thymine, guanine, etc. These challenges include the low-vapor pressure of commercial samples (which are powders at room temperature), and the difficulty in making accurate flow measurements from heated gas sources, required to establish the absolute scale of the measured data. Based on techniques pioneered in positron collision physics [2], a new apparatus is presently undergoing commissioning at the California State University Fullerton, which aims to address these issues. We will make the first cross-section measurements for slow (E0 < 30eV) electron collisions with nucleotides. We will report design parameters and ongoing progress in the commissioning of this new experiment.

  1. Bromination of deoxycytidine by eosinophil peroxidase: A mechanism for mutagenesis by oxidative damage of nucleotide precursors

    PubMed Central

    Henderson, Jeffrey P.; Byun, Jaeman; Williams, Michelle V.; McCormick, Michael L.; Parks, William C.; Ridnour, Lisa A.; Heinecke, Jay W.


    Oxidants generated by eosinophils during chronic inflammation may lead to mutagenesis in adjacent epithelial cells. Eosinophil peroxidase, a heme enzyme released by eosinophils, generates hypobromous acid that damages tissue in inflammatory conditions. We show that human eosinophils use eosinophil peroxidase to produce 5-bromodeoxycytidine. Flow cytometric, immunohistochemical, and mass spectrometric analyses all demonstrated that 5-bromodeoxycytidine generated by eosinophil peroxidase was taken up by cultured cells and incorporated into genomic DNA as 5-bromodeoxyuridine. Although previous studies have focused on oxidation of chromosomal DNA, our observations suggest another mechanism for oxidative damage of DNA. In this scenario, peroxidase-catalyzed halogenation of nucleotide precursors yields products that subsequently can be incorporated into DNA. Because the thymine analog 5-BrUra mispairs with guanine in DNA, generation of brominated pyrimidines by eosinophils might constitute a mechanism for cytotoxicity and mutagenesis at sites of inflammation. PMID:11172002

  2. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition

    PubMed Central

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  3. Nucleotide sequence and analysis of the mgl operon of Escherichia coli K12.


    Hogg, R W; Voelker, C; Von Carlowitz, I


    The nucleotide sequence of the Escherichia coli K12 beta-methylgalactoside transport operon, mgl, was determined. Primer extension analysis indicated that the synthesis of mRNA initiates at guanine residue 145 of the determined sequence. The operon contains three open reading frames (ORF). The operator proximal ORF, mglB, encodes the galactose binding protein, a periplasmic protein of 332 amino acids including the 23 residue amino-terminal signal peptide. Following a 62 nucleotide spacer, the second ORF, mglA, is capable of encoding a protein of 506 amino acids. The amino-terminal and carboxyl-terminal halves of this protein are homologous to each other and each half contains a putative nucleotide binding site. The third ORF, mglC, is capable of encoding a hydrophobic protein of 336 amino acids which is thought to generate the transmembrane pore. The overall organization of the mglBAC operon and its potential to encode three proteins is similar to that of the ara FGH high affinity transport operon, located approximately 1 min away on the E. coli K12 chromosome.

  4. Lead(II)-catalyzed oxidation of guanine in solution studied with electrospray ionization mass spectrometry.


    Banu, Laura; Blagojevic, Voislav; Bohme, Diethard K


    The oxidation of guanine was investigated in water/methanol solution both in the absence and in the presence of Pb(II) with a variable temperature reactor coupled to a tandem mass spectrometer that allowed signature ions of solution reagents and products to be monitored by electrospray ionization (ESI). Two different oxidizing agents were employed, one strong (peroxymonosulfuric acid) and one weaker (hydrogen peroxide). Peroxymonosulfuric acid was observed to oxidize guanine rapidly at room temperature, k(app) > 10(-2) s(-1), whether in the absence or in the presence of Pb(II), to produce spiroiminohydantoin. Guanine did not show measurable oxidation by hydrogen peroxide in the absence of Pb(II) at concentrations of H(2)O(2) up to 1 M at temperatures up to 333 K (k(app) < 3 × 10(-8) s(-1) at 298 K), but in the presence of Pb(II), it was observed to produce both 5-carboxamido-5-formamido-2-iminohydantoin (2-Ih) and imidazolone (Iz) in a ratio of 2.3 ± 0.1 with a total rate enhancement of more than 4 × 10(3). The activation energy was measured to be 82 ± 11 kJ mol(-1) and is more than 120 kJ mol(-1) lower than that for the uncatalyzed oxidation with hydrogen peroxide measured to be at least 208 ± 26 kJ mol(-1). An activation energy of 113 ± 9 kJ mol(-1) has been reported by Bruskov et al. (Nucleic Acids Res.2002, 30, 1354) for the heat-induced oxidation by hydrogen peroxide of guanine embedded as guanosine in DNA which leads to the production of 8-oxo-7,8-dihydro-guanine (8-oxo-Gua). The atomic lead dication lowers the activation energy by activating the hydrogen peroxide oxidant, possibly by O-O bond activation, and by directing the oxidation, possibly through coordination to the functional groups adjacent to the carbon C5: the C6 carbonyl group and the N7 nitrogen. The coupling of tandem mass spectrometry (MS(2)) with a simple variable temperature reactor by ESI proved to be very effective for measuring reaction kinetics and activation energies in solution

  5. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael


    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  6. Applications of adenine nucleotide measurements in oceanography

    NASA Technical Reports Server (NTRS)

    Holm-Hansen, O.; Hodson, R.; Azam, F.


    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  7. Drosophila RhoGEF4 encodes a novel RhoA-specific guanine exchange factor that is highly expressed in the embryonic central nervous system.


    Nahm, Minyeop; Lee, Mihye; Baek, Seung-Hak; Yoon, Jin-Ho; Kim, Hong-Hee; Lee, Zang Hee; Lee, Seungbok


    Rho family small GTPases act as molecular switches that regulate neuronal morphogenesis, including axon growth and guidance, dendritic spine formation, and synapse formation. These proteins are positively regulated by guanine nucleotide exchange factors (GEFs) of the Dbl family. This study describes the identification and characterization of Drosophila RhoGEF4 (DRhoGEF4), a novel Dbl family protein that is specifically expressed in the central nervous system during Drosophila embryogenesis. The predicted amino acid sequence of DRhoGEF4 contains a Dbl homology (DH) domain and an adjacent C-terminal pleckstrin homology (PH) domain, which are most closely related to those of mammalian frabins. In this study, the DH-PH motif is shown to enhance the dissociation of GDP from either RhoA or Rac1 but not from Cdc42 in vitro. In addition, p21-binding domain pull-down assays demonstrate that DRhoGEF4 activates RhoA, but neither Rac1 nor Cdc42 in HEK293 cells. Finally, overexpression of DRhoGEF4 is able to induce assembly of stress fibers in cultured NIH3T3 cells. Taken together, these findings suggest that DRhoGEF4 may participate in cytoskeleton-related cellular events by specifically activating RhoA in neuronal morphogenesis.

  8. RhoA Phosphorylation Induces Rac1 Release from Guanine Dissociation Inhibitor α and Stimulation of Vascular Smooth Muscle Cell Migration▿

    PubMed Central

    Rolli-Derkinderen, Malvyne; Toumaniantz, Gilles; Pacaud, Pierre; Loirand, Gervaise


    Although overactivation of RhoA is recognized as a common component of vascular disorders, the molecular mechanisms regulating RhoA activity in vascular smooth muscle cells (VSMC) are still unclear. We have previously shown that in VSMC, RhoA is phosphorylated on Ser188 by nitric oxide (NO)-stimulated cGMP-dependent kinase (PKG), which leads to RhoA-Rho kinase pathway inhibition. In this study, we showed that expression of phosphoresistant RhoA mutants prevented the stimulation of VSMC migration and adhesion induced by NO-PKG pathway activation. In contrast, under basal conditions, phosphomimetic RhoA mutants stimulated VSMC adhesion and migration through a signaling pathway requiring Rac1 and the Rho exchange factor Vav3. RhoA phosphorylation or phosphomimetic RhoA mutants induced Rac1 activation but did not activate Vav3. Indeed, phosphorylated RhoA or phosphomimetic mutants trapped guanine dissociation inhibitor α (GDIα), leading to the release of Rac1 and its translocation to the membrane, where it was then activated by the basal Vav3 nucleotide exchange activity. In vivo, RhoA phosphorylation induced by PKG activation in the aortas of rats treated with sildenafil induced dissociation of Rac1 from GDIα and activation of the Rac1 signaling pathway. These results suggest that the phosphorylation of RhoA represents a novel potent and physiological GDIα displacement factor that leads to Rac1 activation and regulation of Rac1-dependent VSMC functions. PMID:20696841

  9. European Nucleotide Archive in 2016

    PubMed Central

    Toribio, Ana Luisa; Alako, Blaise; Amid, Clara; Cerdeño-Tarrága, Ana; Clarke, Laura; Cleland, Iain; Fairley, Susan; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Martínez-Villacorta, Josué; Pakseresht, Nima; Rajan, Jeena; Reddy, Kethi; Rosello, Marc; Silvester, Nicole; Smirnov, Dmitriy; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy


    The European Nucleotide Archive (ENA; offers a rich platform for data sharing, publishing and archiving and a globally comprehensive data set for onward use by the scientific community. With a broad scope spanning raw sequencing reads, genome assemblies and functional annotation, the resource provides extensive data submission, search and download facilities across web and programmatic interfaces. Here, we outline ENA content and major access modalities, highlight major developments in 2016 and outline a number of examples of data reuse from ENA. PMID:27899630

  10. New nucleotide analogues with enhanced signal properties.


    Cherkasov, Dmitry; Biet, Thorsten; Bäuml, Englbert; Traut, Walther; Lohoff, Michael


    We describe synthesis and testing of a novel type of dye-modified nucleotides which we call macromolecular nucleotides (m-Nucs). Macromolecular nucleotides comprise a nucleotide moiety, a macromolecular linear linker, and a large macromolecular ligand carrying multiple fluorescent dyes. With incorporation of the nucleotide moiety into the growing nucleic acid strand during enzymatic synthesis, the macromolecular ligand together with the coupled dyes is bound to the nucleic acid. By the use of this new class of modified nucleotides, signals from multiple dye molecules can be obtained after a single enzymatic incorporation event. The modified nucleotides are considered especially useful in the fields of nanobiotechnology, where signal stability and intensity is a limiting factor.

  11. Fragmentation of the adenine and guanine molecules induced by electron collisions

    SciTech Connect

    Minaev, B. F. E-mail:; Shafranyosh, M. I.; Svida, Yu. Yu; Sukhoviya, M. I.; Shafranyosh, I. I.; Baryshnikov, G. V.; Minaeva, V. A.


    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10{sup −15} and 3.2 × 10{sup −15} cm{sup 2}, respectively. The total cross section for formation of the negative ions is 6.1 × 10{sup −18} and 7.6 × 10{sup −18} cm{sup 2} at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments.

  12. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.


    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin


    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes.

  13. Effect of hydration on the lowest singlet PiPi* excited-state geometry of guanine: a theoretical study.


    Shukla, M K; Leszczynski, Jerzy


    An ab-initio computational study was performed to investigate the effect of explicit hydration on the ground and lowest singlet PiPi* excited-state geometry and on the selected stretching vibrational frequencies corresponding to the different NH sites of the guanine acting as hydrogen-bond donors. The studied systems consisted of guanine interacting with one, three, five, six, and seven water molecules. Ground-state geometries were optimized at the HF level, while excited-state geometries were optimized at the CIS level. The 6-311G(d,p) basis set was used in all calculations. The nature of potential energy surfaces was ascertained via the harmonic vibrational frequency analysis; all structures were found minima at the respective potential energy surfaces. The changes in the geometry and the stretching vibrational frequencies of hydrogen-bond-donating sites of the guanine in the ground and excited state consequent to the hydration are discussed. It was found that the first solvation shell of the guanine can accommodate up to six water molecules. The addition of the another water molecule distorts the hydrogen-bonding network by displacing other neighboring water molecules away from the guanine plane.

  14. Simultaneous Determination of Adenine and Guanine Using Cadmium Selenide Quantum Dots-Graphene Oxide Nanocomposite Modified Electrode.


    Kalaivani, Arumugam; Narayanan, Sangilimuthu Sriman


    A novel electrochemical sensor was fabricated by immobilizing Cadmium Selenide Quantum Dots (CdSe QDs)-Graphene Oxide (GO) nanocomposite on a paraffin wax impregnated graphite electrode (PIGE) and was used for the simultaneous determination of adenine and guanine. The CdSe QDs-GO nanocomposite was prepared by ultrasonication and was characterized with spectroscopic and microscopic techniques. The nanocomposite modified electrode was characterized by cyclic voltammetry (CV). The modified electrode showed excellent electrocatalytic activity towards the oxidative determination of adenine and guanine with a good peak separation of 0.31 V. This may be due to the high surface area and fast electron transfer kinetics of the nanocomposite. The modified electrode exhibited wide linear ranges from 0.167 μM to 245 μM for Guanine and 0.083 μM to 291 μM for Adenine with detection limits of 0.055 μM Guanine and 0.028 μM of Adenine (S/N = 3) respectively. Further, the modified electrode was used for the quantitative determination of adenine and guanine in herring sperm DNA with satisfactory results. The modified electrode showed acceptable selectivity, reproducibility and stability under optimal conditions.

  15. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  16. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.


    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  17. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  18. Acyclic phosph(on)ate inhibitors of Plasmodium falciparum hypoxanthine-guanine-xanthine phosphoribosyltransferase

    PubMed Central

    Clinch, Keith; Crump, Douglas R.; Evans, Gary B.; Hazleton, Keith Z.; Mason, Jennifer M.; Schramm, Vern L.


    The pathogenic protozoa responsible for malaria lack enzymes for the de novo synthesis of purines and rely on purine salvage from the host. In Plasmodium falciparum (Pf), hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) converts hypoxanthine to inosine monophosphate and is essential for purine salvage making the enzyme an anti-malarial drug target. We have synthesized a number of simple acyclic aza-C- nucleosides and shown that some are potent inhibitors of Pf HGXPRT while showing excellent selectivity for the Pf versus the human enzyme. PMID:23810424

  19. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.


    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min


    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16,000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses.

  20. Electron and hole transfer from DNA base radicals to oxidized products of guanine in DNA.


    Cai, Zhongli; Sevilla, Michael D


    An investigation of electron and hole transfer to oxidized guanine bases in DNA is reported. Guanine in DNA was preferentially oxidized by Br(2)(*-) at 298 K to 8-oxo-7,8-dihydro-guanine (8-oxo-G) and higher oxidation products. HPLC-EC analysis of irradiated DNA shows that the formation of 8-oxo-G could not be increased above the ratio of one 8-oxo-G to 127 +/- 6 bp regardless of dose. 8-oxo-G can be produced only at low levels because it is further oxidized to other species. These oxidation products of guanine have been extensively investigated and identified by others. Our electron spin resonance studies suggest that at 77 K 8-oxo-G is a trap for radiation-produced holes, but certain further oxidation products of 8-oxo-G (G(ox)) are found to be efficient electron traps. Gamma irradiation of oxidized DNA samples in frozen (D(2)O) aqueous ices and glassy 7 M LiBr solutions resulted in radicals formed by electron attachment to the G(ox) sites that were monitored by electron spin resonance spectroscopy (ESR) at 77 K. These ESR spectra suggest that those oxidation products of 8-oxo-G containing alpha-diketo groups account for the electron traps (G(ox)) in oxidized DNA with oxaluric acid a likely major trap. Electron transfer from DNA anion radicals to G(ox) was followed by monitoring of their ESR signals with time at 77 K. Using typical values for the tunneling constant beta estimates of the relative amount of G(ox) to base pairs were obtained. Radicals formed by UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions were also investigated. The 8-oxo-G cation accounts for less than 10% of all the radicals observed after either gamma irradiation of oxidized DNA in frozen (D(2)O) aqueous solution or UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions. We estimate hole transfer distances of about 7 +/- 1 bp at 1 min from G(*+) to 8-oxo-G.

  1. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    PubMed Central

    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  2. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Bende, A.; Muntean, C. M.


    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  3. Experimental treatment of Staphylococcus aureus bovine intramammary infection using a guanine riboswitch ligand analog.


    Ster, C; Allard, M; Boulanger, S; Lamontagne Boulet, M; Mulhbacher, J; Lafontaine, D A; Marsault, E; Lacasse, P; Malouin, F


    Staphylococcus aureus is a leading cause of intramammary infections (IMI). We recently demonstrated that Staph. aureus strains express the gene guaA during bovine IMI. This gene codes for a guanosine monophosphate synthetase and its expression is regulated by a guanine riboswitch. The guanine analog 2,5,6-triaminopyrimidine-4-one (PC1) is a ligand of the guanine riboswitch. Interactions between PC1 and its target result in inhibition of guanosine monophosphate synthesis and subsequent death of the bacterium. The present study describes the investigational use of PC1 for therapy of Staph. aureus IMI in lactating cows. The in vitro minimal inhibitory concentration of PC1 ranged from 0.5 to 4 μg/mL for a variety of Staph. aureus and Staphylococcus epidermidis strains and required a reducing agent for stability and full potency. A safety assessment study was performed, whereby the healthy quarters of 4 cows were infused with increasing doses of PC1 (0, 150, 250, and 500 mg). Over the 44 h following infusions, no obvious adverse effect was observed. Ten Holstein multiparous cows in mid lactation were then experimentally infused into 3 of the quarters with approximately 50 cfu of Staph. aureus strain SHY97-3906 and infection was allowed to progress for 2 wk before starting PC1 treatment. Bacterial counts reached then about 10(3) to 10(4) cfu/mL of milk. Infected quarters were treated with 1 of 3 doses of PC1 (0, 250, or 500 mg) after each morning and evening milking for 7d (i.e., 14 intramammary infusions of PC1). During the treatment period, milk from PC1-treated quarters showed a significant reduction in bacterial concentrations. However, this reduction of Staph. aureus count in milk was not maintained during the 4 wk following the end of the treatment and only 15% of the PC1-treated quarters underwent bacteriological cure. The somatic cell count and the quarter milk production were not affected by treatments. Although bacterial clearance was not achieved following

  4. Design of electrochemical biosensor systems for the detection of specific DNA sequences in PCR-amplified nucleic acids related to the catechol-O-methyltransferase Val108/158Met polymorphism based on intrinsic guanine signal.


    Ozkan-Ariksoysal, Dilsat; Tezcanli, Burcin; Kosova, Buket; Ozsoz, Mehmet


    Psychiatric disorders are common and complex diseases that show polygenic and multifactorial heredity. A single nucleotide polymorphism (Val108/158Met) in the catechol-O-methyl transferase (COMT) gene is related to many psychiatric disorders such as schizophrenia, alcoholism, bipolar disorder, and obsessive-compulsive disorder. Schizophrenia is a complex disorder and a single nucleotide polymorphism (Val108/158Met) at the COMT gene is related to schizophrenia susceptibility. A novel hybridization-based disposable electrochemical DNA biosensor for the detection of a common functional polymorphism in the COMT gene from polymerase chain reaction (PCR) amplicons has been described without using an external label. This developed technology combined with a disposable carbon graphite electrode and differential pulse voltammetry was performed by using short synthetic oligonucleotides and PCR amplicons in length 203 bp to measure the change of guanine oxidation signal obtained at approximately +1.0 V after DNA hybridization between probe and target (synthetic target or denatured PCR samples). COMT-specific oligonucleotides were immobilized onto the carbon surface with a simple adsorption method in two different modes: (a) Guanine-containing targets were attached or (b) inosine-substituted probes were attached onto an electrode. By controlling the surface coverage of the target DNA, the hybridization event between the probes and their synthetic targets or specific PCR products was optimized. The wild-type or polymorphic allele-specific probes/targets were also interacted with an equal amount of noncomplementary and one-base mismatch-containing DNAs in order to measure the sensor selectivity. The decrease or appearance in the intrinsic guanine signal simplified the detection procedure and shortened the assay time because protocol eliminates the label-binding step. The nonspecific binding effects were minimized by using sodium dodecyl sulfate with different washing methods

  5. Nucleotide Metabolism and DNA Replication.


    Warner, Digby F; Evans, Joanna C; Mizrahi, Valerie


    The development and application of a highly versatile suite of tools for mycobacterial genetics, coupled with widespread use of "omics" approaches to elucidate the structure, function, and regulation of mycobacterial proteins, has led to spectacular advances in our understanding of the metabolism and physiology of mycobacteria. In this article, we provide an update on nucleotide metabolism and DNA replication in mycobacteria, highlighting key findings from the past 10 to 15 years. In the first section, we focus on nucleotide metabolism, ranging from the biosynthesis, salvage, and interconversion of purine and pyrimidine ribonucleotides to the formation of deoxyribonucleotides. The second part of the article is devoted to DNA replication, with a focus on replication initiation and elongation, as well as DNA unwinding. We provide an overview of replication fidelity and mutation rates in mycobacteria and summarize evidence suggesting that DNA replication occurs during states of low metabolic activity, and conclude by suggesting directions for future research to address key outstanding questions. Although this article focuses primarily on observations from Mycobacterium tuberculosis, it is interspersed, where appropriate, with insights from, and comparisons with, other mycobacterial species as well as better characterized bacterial models such as Escherichia coli. Finally, a common theme underlying almost all studies of mycobacterial metabolism is the potential to identify and validate functions or pathways that can be exploited for tuberculosis drug discovery. In this context, we have specifically highlighted those processes in mycobacterial DNA replication that might satisfy this critical requirement.

  6. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures

    PubMed Central

    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.


    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na+-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na+-coordinated antiparallel quadruplexes but not K+-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. PMID:25813041

  7. New investigations of the guanine trichloro cuprate(II) complex crystal

    NASA Astrophysics Data System (ADS)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir


    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  8. Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Hall, James P.; Poynton, Fergus E.; Keane, Páraic M.; Gurung, Sarah P.; Brazier, John A.; Cardin, David J.; Winter, Graeme; Gunnlaugsson, Thorfinnur; Sazanovich, Igor V.; Towrie, Michael; Cardin, Christine J.; Kelly, John M.; Quinn, Susan J.


    To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

  9. Mosaic organization of DNA nucleotides

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.


    Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

  10. Nucleotide excision repair in humans.


    Spivak, Graciela


    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process.

  11. Nucleotide excision repair in humans

    PubMed Central

    Spivak, Graciela


    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  12. Total chemical synthesis of a 77-nucleotide-long RNA sequence having methionine-acceptance activity.

    PubMed Central

    Ogilvie, K K; Usman, N; Nicoghosian, K; Cedergren, R J


    Chemical synthesis is described of a 77-nucleotide-long RNA molecule that has the sequence of an Escherichia coli Ado-47-containing tRNA(fMet) species in which the modified nucleosides have been substituted by their unmodified parent nucleosides. The sequence was assembled on a solid-phase, controlled-pore glass support in a stepwise manner with an automated DNA synthesizer. The ribonucleotide building blocks used were fully protected 5'-monomethoxytrityl-2'-silyl-3'-N,N-diisopropylaminophosphoram idites. p-Nitro-phenylethyl groups were used to protect the O6 of guanine residues. The fully deprotected tRNA analogue was characterized by polyacrylamide gel electrophoresis (sizing), terminal nucleotide analysis, sequencing, and total enzyme degradation, all of which indicated that the sequence was correct and contained only 3-5 linkages. The 77-mer was then assayed for amino acid acceptor activity by using E. coli methionyl-tRNA synthetase. The results indicated that the synthetic product, lacking modified bases, is a substrate for the enzyme and has an amino acid acceptance 11% of that of the major native species, tRNA(fMet) containing 7-methylguanosine at position 47. Images PMID:3413059

  13. Comparative Genomic Analysis Reveals a Critical Role of De Novo Nucleotide Biosynthesis for Saccharomyces cerevisiae Virulence

    PubMed Central

    Pérez-Torrado, Roberto; Llopis, Silvia; Perrone, Benedetta; Gómez-Pastor, Rocío; Hube, Bernhard; Querol, Amparo


    In recent years, the number of human infection cases produced by the food related species Saccharomyces cerevisiae has increased. Whereas many strains of this species are considered safe, other ‘opportunistic’ strains show a high degree of potential virulence attributes and can cause infections in immunocompromised patients. Here we studied the genetic characteristics of selected opportunistic strains isolated from dietary supplements and also from patients by array comparative genomic hybridization. Our results show increased copy numbers of IMD genes in opportunistic strains, which are implicated in the de novo biosynthesis of the purine nucleotides pathway. The importance of this pathway for virulence of S. cerevisiae was confirmed by infections in immunodeficient murine models using a GUA1 mutant, a key gene of this pathway. We show that exogenous guanine, an end product of this pathway in its triphosphorylated form, increases the survival of yeast strains in ex vivo blood infections. Finally, we show the importance of the DNA damage response that activates dNTP biosynthesis in yeast cells during ex vivo blood infections. We conclude that opportunistic yeasts may use an enhanced de novo biosynthesis of the purine nucleotides pathway to increase survival and favor infections in the host. PMID:25816288

  14. Plastid sequence evolution: a new pattern of nucleotide substitutions in the Cucurbitaceae.


    Decker-Walters, Deena S; Chung, Sang-Min; Staub, Jack E


    Nucleotide substitutions (i.e., point mutations) are the primary driving force in generating DNA variation upon which selection can act. Substitutions called transitions, which entail exchanges between purines (A = adenine, G = guanine) or pyrimidines (C = cytosine, T = thymine), typically outnumber transversions (e.g., exchanges between a purine and a pyrimidine) in a DNA strand. With an increasing number of plant studies revealing a transversion rather than transition bias, we chose to perform a detailed substitution analysis for the plant family Cucurbitaceae using data from several short plastid DNA sequences. We generated a phylogenetic tree for 19 taxa of the tribe Benincaseae and related genera and then scored conservative substitution changes (e.g., those not exhibiting homoplasy or reversals) from the unambiguous branches of the tree. Neither the transition nor (A+T)/(G+C) biases found in previous studies were supported by our overall data. More importantly, we found a novel and symmetrical substitution bias in which Gs had been preferentially replaced by A, As by C, Cs by T, and Ts by G, resulting in the G-->A-->C-->T-->G substitution series. Understanding this pattern will lead to new hypotheses concerning plastid evolution, which in turn will affect the choices of substitution models and other tree-building algorithms for phylogenetic analyses based on nucleotide data.

  15. Inhibitory effects promoted by 5'-nucleotides on the ecto-3'-nucleotidase activity of Leishmania amazonensis.


    Freitas-Mesquita, Anita Leocadio; Gomes, Marta T; Vieira, Danielle P; Paes-Vieira, Lisvane; Nascimento, Michelle T C; Lopes, Angela H C S; Meyer-Fernandes, José Roberto


    The protozoan parasite Leishmania amazonensis is the etiological agent of cutaneous leishmaniasis. During its life cycle, the flagellated metacyclic promastigote forms are transmitted to vertebrate hosts by sandfly bites, and they develop into amastigotes inside macrophages, where they multiply. L. amazonensis possesses a bifunctional enzyme, called 3'-nucleotidase/nuclease (3'NT/NU), which is able to hydrolyze extracellular 3'-monophosphorylated nucleosides and nucleic acids. 3'NT/NU plays an important role in the generation of extracellular adenosine and has been described as a key enzyme in the acquisition of purines by trypanosomatids. Furthermore, it has been observed that 3'NT/NU also plays a valuable role in the establishment of parasitic infection. In this context, this study aimed to investigate the modulation of the 3'-nucleotidase (3'NT) activity of L. amazonensis by several nucleotides. It was observed that 3'NT activity is inhibited by micromolar concentrations of guanosine and guanine nucleotides. The inhibition promoted by 5'-GMP on the 3'NT activity of L. amazonensis is reversible and uncompetitive because the addition of the inhibitor decreased the kinetic parameters Km and Vmax. Finally, we found that the addition of 5'-GMP is able to reverse the stimulation promoted by 3'-AMP in a macrophage-parasite interaction assay. The determination of compounds that can inhibit the 3'NT activity of Leishmania is very important because this enzyme does not occur in mammals, making it a potential therapeutic target.

  16. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, David B.; Lao, Guifang


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  17. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, D.B.; Lao, G.


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  18. Genetic Analysis of Yeast Yip1p Function Reveals a Requirement for Golgi-Localized Rab Proteins and Rab-Guanine Nucleotide Dissociation Inhibitor

    PubMed Central

    Chen, Catherine Z.; Calero, Monica; DeRegis, Carol J.; Heidtman, Matthew; Barlowe, Charles; Collins, Ruth N.


    Yip1p is the first identified Rab-interacting membrane protein and the founder member of the YIP1 family, with both orthologs and paralogs found in all eukaryotic genomes. The exact role of Yip1p is unclear; YIP1 is an essential gene and defective alleles severely disrupt membrane transport and inhibit ER vesicle budding. Yip1p has the ability to physically interact with Rab proteins and the nature of this interaction has led to suggestions that Yip1p may function in the process by which Rab proteins translocate between cytosol and membranes. In this study we have investigated the physiological requirements for Yip1p action. Yip1p function requires Rab-GDI and Rab proteins, and several mutations that abrogate Yip1p function lack Rab-interacting capability. We have previously shown that Yip1p in detergent extracts has the capability to physically interact with Rab proteins in a promiscuous manner; however, a genetic analysis that covers every yeast Rab reveals that the Rab requirement in vivo is exclusively confined to a subset of Rab proteins that are localized to the Golgi apparatus. PMID:15611160

  19. Genetic analysis of yeast Yip1p function reveals a requirement for Golgi-localized rab proteins and rab-Guanine nucleotide dissociation inhibitor.


    Chen, Catherine Z; Calero, Monica; DeRegis, Carol J; Heidtman, Matthew; Barlowe, Charles; Collins, Ruth N


    Yip1p is the first identified Rab-interacting membrane protein and the founder member of the YIP1 family, with both orthologs and paralogs found in all eukaryotic genomes. The exact role of Yip1p is unclear; YIP1 is an essential gene and defective alleles severely disrupt membrane transport and inhibit ER vesicle budding. Yip1p has the ability to physically interact with Rab proteins and the nature of this interaction has led to suggestions that Yip1p may function in the process by which Rab proteins translocate between cytosol and membranes. In this study we have investigated the physiological requirements for Yip1p action. Yip1p function requires Rab-GDI and Rab proteins, and several mutations that abrogate Yip1p function lack Rab-interacting capability. We have previously shown that Yip1p in detergent extracts has the capability to physically interact with Rab proteins in a promiscuous manner; however, a genetic analysis that covers every yeast Rab reveals that the Rab requirement in vivo is exclusively confined to a subset of Rab proteins that are localized to the Golgi apparatus.

  20. Aberrant Overexpression of the Rgl2 Ral Small GTPase-specific Guanine Nucleotide Exchange Factor Promotes Pancreatic Cancer Growth through Ral-dependent and Ral-independent Mechanisms*

    PubMed Central

    Vigil, Dominico; Martin, Timothy D.; Williams, Falina; Yeh, Jen Jen; Campbell, Sharon L.; Der, Channing J.


    Our recent studies established essential and distinct roles for RalA and RalB small GTPase activation in K-Ras mutant pancreatic ductal adenocarcinoma (PDAC) cell line tumorigencity, invasion, and metastasis. However, the mechanism of Ral GTPase activation in PDAC has not been determined. There are four highly related mammalian RalGEFs (RalGDS, Rgl1, Rgl2, and Rgl3) that can serve as Ras effectors. Whether or not they share distinct or overlapping functions in K-Ras-mediated growth transformation has not been explored. We found that plasma membrane targeting to mimic persistent Ras activation enhanced the growth-transforming activities of RalGEFs. Unexpectedly, transforming activity did not correlate directly with total cell steady-state levels of Ral activation. Next, we observed elevated Rgl2 expression in PDAC tumor tissue and cell lines. Expression of dominant negative Ral, which blocks RalGEF function, as well as interfering RNA suppression of Rgl2, reduced PDAC cell line steady-state Ral activity, growth in soft agar, and Matrigel invasion. Surprisingly, the effect of Rgl2 on anchorage-independent growth could not be rescued by constitutively activated RalA, suggesting a novel Ral-independent function for Rgl2 in transformation. Finally, we determined that Rgl2 and RalB both localized to the leading edge, and this localization of RalB was dependent on endogenous Rgl2 expression. In summary, our observations support nonredundant roles for RalGEFs in Ras-mediated oncogenesis and a key role for Rgl2 in Ral activation and Ral-independent PDAC growth. PMID:20801877

  1. Developmental changes in the role of a pertussis toxin sensitive guanine nucleotide binding protein in the rat cardiac alpha sub 1 -adrenergic system

    SciTech Connect

    Han, H.M.


    During development, the cardiac alpha{sub 1}-adrenergic chronotropic response changes from positive in the neonate to negative in the adult. This thesis examined the possibility of a developmental change in coupling of a PT-sensitive G-protein to the alpha{sub 1}-adrenergic receptor. Radioligand binding experiments performed with the iodinated alpha{sub 1}-selective radioligand ({sup 125}I)-I-2-({beta}-(4-hydroxphenyl)ethylaminomethyl)tetralone (({sup 125}I)-IBE 2254) demonstrated that the alpha{sub 1}-adrenergic receptor is coupled to a G-protein in both neonatal and adult rat hearts. However, in the neonate the alpha{sub 1}-adrenergic receptor is coupled to a PT-insensitive G-protein, whereas in the adult the alpha{sub 1}-adrenergic receptor is coupled to both a PT-insensitive and a PT-sensitive G-protein. Consistent with the results from binding experiments, PT did not have any effect on the alpha{sub 1}-mediated positive chronotropic response in the neonate, whereas in the adult the alpha{sub 1}-mediated negative chronotropic response was completely converted to a positive one after PT-treatment. This thesis also examined the possibility of an alteration in coupling of the alpha{sub 1}-adrenergic receptor to its effector under certain circumstances such as high potassium (K{sup +}) depolarization in nerve-muscle (NM) co-cultures, a system which has been previously shown to be a convenient in vitro model to study the mature inhibitory alpha{sub 1}-response.

  2. Human Gpn1 purified from bacteria binds guanine nucleotides and hydrolyzes GTP as a protein dimer stabilized by its C-terminal tail.


    González-González, Rogelio; Guerra-Moreno, José A; Cristóbal-Mondragón, Gema R; Romero, Violeta; Peña-Gómez, Sonia G; Montero-Morán, Gabriela M; Lara-González, Samuel; Hernández-Arana, Andrés; Fernández-Velasco, Daniel A; Calera, Mónica R; Sánchez-Olea, Roberto


    The essential GTPase Gpn1 mediates RNA polymerase II nuclear targeting and controls microtubule dynamics in yeast and human cells by molecular mechanisms still under investigation. Here, we purified human HisGpn1 expressed as a recombinant protein in bacteria E. coli BL-21 (DE3). Affinity purified HisGpn1 eluted from a size exclusion column as a protein dimer, a state conserved after removing the hexa-histidine tail and confirmed by separating HisGpn1 in native gels, and in dynamic light scattering experiments. Human HisGpn1 purity was higher than 95%, molecularly monodisperse and could be concentrated to more than 10 mg/mL without aggregating. Circular dichroism spectra showed that human HisGpn1 was properly folded and displayed a secondary structure rich in alpha helices. HisGpn1 effectively bound GDP and the non-hydrolyzable GTP analogue GMPPCP, and hydrolyzed GTP. We next tested the importance of the C-terminal tail, present in eukaryotic Gpn1 but not in the ancestral archaeal Gpn protein, on HisGpn1 dimer formation. C-terminal deleted human HisGpn1 (HisGpn1ΔC) was also purified as a protein dimer, indicating that the N-terminal GTPase domain contains the interaction surface needed for dimer formation. In contrast to HisGpn1, however, HisGpn1ΔC dimer spontaneously dissociated into monomers. In conclusion, we have developed a method to purify properly folded and functionally active human HisGpn1 from bacteria, and showed that the C-terminal tail, universally conserved in all eukaryotic Gpn1 orthologues, stabilizes the GTPase domain-mediated Gpn1 protein dimer. The availability of recombinant human Gpn1 will open new research avenues to unveil the molecular and pharmacological properties of this essential GTPase.

  3. The adaptor protein 3BP2 associates with VAV guanine nucleotide exchange factors to regulate NFAT activation by the B-cell antigen receptor.


    Foucault, Isabelle; Le Bras, Séverine; Charvet, Céline; Moon, Chéol; Altman, Amnon; Deckert, Marcel


    Engagement of the B-cell antigen receptor (BCR) activates kinases of the Src and Syk families and signaling complexes assembled by adaptor proteins, which dictate B-cell fate and function. The adaptor 3BP2/SH3BP2, an Abl Src homology domain 3 (SH3)-binding and Syk-kinases interacting protein, exhibits positive regulatory roles in T, natural killer (NK), and basophilic cells. However, its involvement in BCR signaling is completely unknown. Here we show that 3BP2 is tyrosine phosphorylated following BCR aggregation on B lymphoma cells, and that 3BP2 is a substrate for Syk and Fyn, but not Btk. To further explore the function of 3BP2 in B cells, we screened a yeast 2-hybrid B-lymphocyte library and found 3BP2 as a binding partner of Vav proteins. The interaction between 3BP2 and Vav proteins involved both constitutive and inducible mechanisms. 3BP2 also interacted with other components of the BCR signaling pathway, including Syk and phospholipase C gamma (PLC-gamma). Furthermore, overexpression and RNAi blocking experiments showed that 3BP2 regulated BCR-mediated activation of nuclear factor of activated T cells (NFATs). Finally, evidence was provided that 3BP2 functionally cooperates with Vav proteins and Rho GTPases to activate NFATs. Our results show that 3BP2 may regulate BCR-mediated gene activation through Vav proteins.

  4. Selective amplification of an mRNA and related pseudogene for a human ADP-ribosylation factor, a guanine nucleotide-dependent protein activator of cholera toxin

    SciTech Connect

    Monaco, L.; Murtagh, J.J.; Newman, K.B.; Tsai, Su-Chen; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and used to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.

  5. The rho-guanine nucleotide exchange factor domain of obscurin regulates assembly of titin at the Z-disk through interactions with Ran binding protein 9.


    Bowman, Amber L; Catino, Dawn H; Strong, John C; Randall, William R; Kontrogianni-Konstantopoulos, Aikaterini; Bloch, Robert J


    Obscurin is an approximately 800-kDa protein composed of structural and signaling domains that organizes contractile structures in striated muscle. We have studied the Rho-GEF domain of obscurin to understand its roles in morphogenesis and signaling. We used adenoviral overexpression of this domain, together with ultrastructural and immunofluorescence methods, to examine its effect on maturing myofibrils. We report that overexpression of the Rho-GEF domain specifically inhibits the incorporation of titin into developing Z-disks and disrupts the structure of the Z-disk and Z/I junction, and alters features of the A/I junction. The organization of other sarcomeric markers, including alpha-actinin, was not affected. We identified Ran binding protein 9 (RanBP9) as a novel ligand of the Rho-GEF domain and showed that binding is specific, with an apparent binding affinity of 1.9 microM. Overexpression of the binding region of RanBP9 also disrupted the incorporation of titin into developing Z-disks. Immunofluorescence localization during myofibrillogenesis indicated that the Rho-GEF domain assembles into sarcomeres before RanBP9, which first occurs in myonuclei and later in development translocates to the myoplasm, where it colocalizes with obscurin. Both the Rho-GEF domain and its binding region on RanBP9 bind directly to the N-terminal Ig domains of titin, which flank the Z-disk. Our results suggest that the Rho-GEF domain interacts with RanBP9 and that both can interact with the N-terminal region of titin to influence the formation of the Z-disk and A/I junction.

  6. Essential role of vesicular nucleotide transporter in vesicular storage and release of nucleotides in platelets

    PubMed Central

    Hiasa, Miki; Togawa, Natsuko; Miyaji, Takaaki; Omote, Hiroshi; Yamamoto, Akitsugu; Moriyama, Yoshinori


    Abstract Nucleotides are stored in the dense granules of platelets. The release of nucleotides triggers one of the first steps in a series of cascades responsible for blood coagulation. However, the mechanism of how the nucleotides are accumulated in the granules is still far less understood. The transporter protein responsible for storage of nucleotides in the neuroendocrine cells has been identified and characterized. We hypothesized that the vesicular nucleotide transporter (VNUT) is also involved in the vesicular storage of nucleotides in platelets. In this article, we present three lines of evidence that VNUT is responsible for the vesicular storage of nucleotides in platelets and that vesicular ATP transport is crucial for platelet function, detection and characterization of VNUT activity in platelets isolated from healthy humans and MEG‐01 cells, RNA interference experiments on MEG‐01 cells, and studies on nucleotide transport and release with a selective inhibitor. PMID:24907298

  7. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.


    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B


    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  8. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.


    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  9. Molecular basis for nucleotide-binding specificity: role of the exocyclic amino group "N2" in recognition by a guanylyl-ribonuclease.


    Schrift, Greta L; Waldron, Travis T; Timmons, Mitchell A; Ramaswamy, S; Kearney, William R; Murphy, Kenneth P


    Proteins interact with nucleotides to perform a multitude of functions within cells. These interactions are highly specific; however, the molecular basis for this specificity is not well understood. To identify factors critical for protein-guanine nucleotide recognition the binding of two closely related ligands, guanosine 3'-monophosphate (3'GMP) and inosine 3'-monophosphate (3'IMP), to Ribonuclease Sa (RNase Sa), a small, guanylyl-endoribonuclease from Streptomyces aureofaciens, was compared using isothermal titration calorimetry, NMR, X-ray crystallography and molecular dynamics simulations. This comparison has allowed for the determination of the contribution of the exocyclic amino group "N2" of the guanine base to nucleotide binding specificity. Calorimetric measurements indicate that RNase Sa has a higher affinity for 3'GMP (K=(1.5+/-0.2)x10(5)) over 3'IMP (K=(3.1+/-0.2)x10(4)) emphasizing the importance of N2 as a key determinant of RNase Sa guanine binding specificity. This result was unexpected as the published structural data for RNase Sa in complex with 3'GMP showed only a potential long-range interaction (>3.3A) between N2 and the side-chain of Glu41 of RNase Sa. The observed difference in affinity is largely due to a reduction in the favorable enthalpy change by 10 kJ/mol for 3'IMP binding as compared to 3'GMP that is accompanied by a significant difference in the heat capacity changes observed for binding the two ligands. To aid interpretation of the calorimetric data, the first crystal structure of a small, guanylyl ribonuclease bound to 3'IMP was determined to 2.0 A resolution. This structure has revealed small yet unexpected changes in the ligand conformation and differences in the conformations of the side-chains contacting the sugar and phosphate moieties as compared to the 3'GMP complex. The structural data suggest the less favorable enthalpy change is due to an overall lengthening of the contacts between RNase Sa and 3'IMP as compared to 3'GMP

  10. Hydroxyl Radical (OH•) Reaction with Guanine in an Aqueous Environment: A DFT Study

    PubMed Central

    Kumar, Anil; Pottiboyina, Venkata; Sevilla, Michael D.


    The reaction of hydroxyl radical (OH•) with DNA accounts for about half of radiation-induced DNA damage in living systems. Previous literature reports point out that the reaction of OH• with DNA proceeds mainly through the addition of OH• to the C=C bond of the DNA bases. However, recently it has been reported that the principal reaction of OH• with dGuo (deoxyguanosine) is the direct hydrogen atom abstraction from its exocyclic amine group rather than addition of OH• to the C=C bond. In the present work, these two reaction pathways of OH• attack on guanine (G) in the presence of water molecules (aqueous environment) are investigated using the density functional theory (DFT) B3LYP method with 6-31G* and 6-31++G** basis sets. The calculations show that the initial addition of the OH• at C4=C5 double bond of guanine is barrier free and the adduct radical (G-OH•) has only a small activation barrier of ca. 1 – 6 kcal/mol leading to the formation of a metastable ion-pair intermediate (G•+---OH−). The formation of ion-pair is a result of the highly oxidizing nature of the OH• in aqueous media. The resulting ion-pair (G•+---OH−) deprotonates to form H2O and neutral G radicals favoring G(N1-H)• with an activation barrier of ca. 5 kcal/mol. The overall process from the G(C4)-OH• (adduct) to G(N1-H)• and water is found to be exothermic in nature by more than 13 kcal/mol. (G-OH•), (G•+---OH−), and G(N1-H)• were further characterized by the CAM-B3LYP calculations of their UV-visible spectra and good agreement between theory and experiment is achieved. Our calculations for the direct hydrogen abstraction pathway from N1 and N2 sites of guanine by the OH• show that this is also a competitive route to produce G(N2-H)•, G(N1-H)• and H2O. PMID:22050033

  11. Pathways of arachidonic acid peroxyl radical reactions and product formation with guanine radicals.


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxyl radicals were derived from the one-electron oxidation of polyunsaturated fatty acids by sulfate radicals that were generated by the photodissociation of peroxodisulfate anions in air-equilibrated aqueous solutions. Reactions of these peroxyl and neutral guanine radicals, also generated by oxidation with sulfate radicals, were investigated by laser kinetic spectroscopy, and the guanine oxidation products were identified by HPLC and mass spectrometry methods. Sulfate radicals rapidly oxidize arachidonic (ArAc), linoleic (LnAc), and palmitoleic (PmAc) acids with similar rate constants, (2-4) x 10 (9) M (-1) s (-1). The C-centered radicals derived from the oxidation of ArAc and LnAc include nonconjugated Rn(.) ( approximately 80%) and conjugated bis-allylic Rba(.) ( approximately 20%) radicals. The latter were detectable in the absence of oxygen by their prominent, narrow absorption band at 280 nm. The Rn(.) radicals of ArAc (containing three bis-allylic sites) transform to the Rba(.) radicals via an intramolecular H-atom abstraction [rate constant (7.5 +/- 0.7) x 10 (4) s (-1)]. In contrast, the Rn(.) radicals of LnAc that contain only one bis-allylic site do not transform intramolecularly to the Rba(.) radicals. In the case of PmAc, which contains only one double bond, the Rba(.) radicals are not observed. The Rn(.) radicals of PmAc rapidly combine with oxygen with a rate constant of (3.8 +/- 0.4) x 10(9) M(-1) s(-1). The Rba(.) radicals of ArAc are less reactive and react with oxygen with a rate constant of (2.2 +/- 0.2) x 10 (8) M (-1) s (-1). The ArAc peroxyl radicals formed spontaneously eliminate superoxide radical anions [rate constant = (3.4 +/- 0.3) x 10 (4) M (-1) s (-1)]. The stable oxidative lesions derived from the 2',3',5'-tri- O-acetylguanosine or 2',3',5'-tri- O-acetyl-8-oxo-7,8-dihydroguanosine radicals and their subsequent reactions with ArAc peroxyl radicals were also investigated. The major products found were the 2,5-diamino-4 H

  12. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui


    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  13. Nucleotide Selectivity of Antibiotic Kinases▿

    PubMed Central

    Shakya, Tushar; Wright, Gerard D.


    Antibiotic kinases, which include aminoglycoside and macrolide phosphotransferases (APHs and MPHs), pose a serious threat to currently used antimicrobial therapies. These enzymes show structural and functional homology with Ser/Thr/Tyr kinases, which is suggestive of a common ancestor. Surprisingly, recent in vitro studies using purified antibiotic kinase enzymes have revealed that a number are able to utilize GTP as the antibiotic phospho donor, either preferentially or exclusively compared to ATP, the canonical phosphate donor in most biochemical reactions. To further explore this phenomenon, we examined three enzymes, APH(3′)-IIIa, APH(2″)-Ib, and MPH(2′)-I, using a competitive assay that mimics in vivo nucleotide triphosphate (NTP) concentrations and usage by each enzyme. Downstream analysis of reaction products by high-performance liquid chromatography enabled the determination of partitioning of phosphate flux from NTP donors to antibiotics. Using this ratio along with support from kinetic analysis and inhibitor studies, we find that under physiologic concentrations of NTPs, APH(3′)-IIIa exclusively uses ATP, MPH(2′)-I exclusively uses GTP, and APH(2″)-Ib is able to use both species with a preference for GTP. These differences reveal likely different pathways in antibiotic resistance enzyme evolution and can be exploited in selective inhibitor design to counteract resistance. PMID:20231391

  14. Nucleotide selectivity of antibiotic kinases.


    Shakya, Tushar; Wright, Gerard D


    Antibiotic kinases, which include aminoglycoside and macrolide phosphotransferases (APHs and MPHs), pose a serious threat to currently used antimicrobial therapies. These enzymes show structural and functional homology with Ser/Thr/Tyr kinases, which is suggestive of a common ancestor. Surprisingly, recent in vitro studies using purified antibiotic kinase enzymes have revealed that a number are able to utilize GTP as the antibiotic phospho donor, either preferentially or exclusively compared to ATP, the canonical phosphate donor in most biochemical reactions. To further explore this phenomenon, we examined three enzymes, APH(3')-IIIa, APH(2'')-Ib, and MPH(2')-I, using a competitive assay that mimics in vivo nucleotide triphosphate (NTP) concentrations and usage by each enzyme. Downstream analysis of reaction products by high-performance liquid chromatography enabled the determination of partitioning of phosphate flux from NTP donors to antibiotics. Using this ratio along with support from kinetic analysis and inhibitor studies, we find that under physiologic concentrations of NTPs, APH(3')-IIIa exclusively uses ATP, MPH(2')-I exclusively uses GTP, and APH(2'')-Ib is able to use both species with a preference for GTP. These differences reveal likely different pathways in antibiotic resistance enzyme evolution and can be exploited in selective inhibitor design to counteract resistance.

  15. UVA-visible photo-excitation of guanine radical cations produces sugar radicals in DNA and model structures

    PubMed Central

    Adhikary, Amitava; Malkhasian, Aramice Y. S.; Collins, Sean; Koppen, Jessica; Becker, David; Sevilla, Michael D.


    This work presents evidence that photo-excitation of guanine radical cations results in high yields of deoxyribose sugar radicals in DNA, guanine deoxyribonucleosides and deoxyribonucleotides. In dsDNA at low temperatures, formation of C1′• is observed from photo-excitation of G•+ in the 310–480 nm range with no C1′• formation observed ≥520 nm. Illumination of guanine radical cations in 2′dG, 3′-dGMP and 5′-dGMP in aqueous LiCl glasses at 143 K is found to result in remarkably high yields (∼85–95%) of sugar radicals, namely C1′•, C3′• and C5′•. The amount of each of the sugar radicals formed varies dramatically with compound structure and temperature of illumination. Radical assignments were confirmed using selective deuteration at C5′ or C3′ in 2′-dG and at C8 in all the guanine nucleosides/tides. Studies of the effect of temperature, pH, and wavelength of excitation provide important information about the mechanism of formation of these sugar radicals. Time-dependent density functional theory calculations verify that specific excited states in G•+ show considerable hole delocalization into the sugar structure, in accord with our proposed mechanism of action, namely deprotonation from the sugar moiety of the excited molecular radical cation. PMID:16204456

  16. Highly sensitive and synergistic detection of guanine and adenine based on poly(xanthurenic acid)-reduced graphene oxide interface.


    Yang, Tao; Kong, Qianqian; Li, Qianhe; Wang, Xinxing; Chen, Lihua; Jiao, Kui


    In order to achieve the large direct electrochemical signals of guanine and adenine, an urgent request to explore novel electrode materials and interfaces has been put forward. In this paper, a poly(xanthurenic acid, Xa)-reduced graphene oxide (PXa-ERGNO) interface, which has rich negatively charged active sites and accelerated electron transfer ability, was fabricated for monitoring the positively charged guanine and adenine. Scanning electron microscopy, Fourier transform infrared spectroscopy, Raman spectra, X-ray photoelectron spectroscopy, cyclic voltammetry, electrochemical impedance spectroscopy, and differential pulse voltammetry were adopted to characterize the morphology and prove the electrochemical properties of the prepared interface. The PXa-ERGNO interface with rich negative charge and large electrode surface area was an excellent sensing platform to prompt the adsorption of the positively charged guanine and adenine via strong π-π* interaction or electrostatic adsorption. The PXa-ERGNO interface exhibited prominent synergistic effect and good electrocatalytic activity for sensitive determination of guanine and adenine compared with sole PXa or ERGNO modified electrode. The sensing platform we built could be further applied in the adsorption and detection of other positively charged biomolecules or aromatic molecules.

  17. Analysis of nucleotide insertion opposite 2,2,4-triamino-5(2H)-oxazolone by eukaryotic B- and Y-family DNA polymerases.


    Suzuki, Masayo; Kino, Katsuhito; Kawada, Taishu; Morikawa, Masayuki; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Mutations induced by oxidative DNA damage can cause diseases such as cancer. In particular, G:C-T:A and G:C-C:G transversions are caused by oxidized guanine and have been observed in the p53 and K-ras genes. We focused on an oxidized form of guanine, 2,2,4-triamino-5(2H)-oxazolone (Oz), as a cause of G:C-C:G transversions based on our earlier elucidation that DNA polymerases (Pols) α, β, γ, ε, η, I, and IV incorporate dGTP opposite Oz. The nucleotide insertion and extension of Pols δ, ζ, ι, κ, and REV1, belonging to the B- and Y-families of DNA polymerases, were analyzed for the first time. Pol δ incorporated dGTP, in common with other replicative DNA polymerases. Pol ζ incorporated dGTP and dATP, and the efficiency of elongation up to full-length beyond Oz was almost the same as that beyond G. Although nucleotide incorporation by Pols ι or κ was also error-prone, they did not extend the primer. On the other hand, the polymerase REV1 predominantly incorporated dCTP opposite Oz more efficiently than opposite 8-oxo-7,8-dihydroguanine, guanidinohydantoin, or tetrahydrofuran. Here, we demonstrate that Pol ζ can efficiently replicate DNA containing Oz and that REV1 can prevent G:C-C:G transversions caused by Oz.

  18. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.


    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  19. Long-range correlations in nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.


    DNA SEQUENCES have been analysed using models, such as an it-step Markov chain, that incorporate the possibility of short-range nucleotide correlations1. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  20. Targeting of Polycomb Repressive Complex 2 to RNA by Short Repeats of Consecutive Guanines.


    Wang, Xueyin; Goodrich, Karen J; Gooding, Anne R; Naeem, Haroon; Archer, Stuart; Paucek, Richard D; Youmans, Daniel T; Cech, Thomas R; Davidovich, Chen


    Polycomb repressive complex 2 (PRC2) is a histone methyltransferase that trimethylates H3K27, a mark of repressed chromatin. Mammalian PRC2 binds RNA promiscuously, with thousands of target transcripts in vivo. But what does PRC2 recognize in these RNAs? Here we show that purified human PRC2 recognizes G > C,U ≫ A in single-stranded RNA and has a high affinity for folded guanine quadruplex (G4) structures but little binding to duplex RNAs. Importantly, G-tract motifs are significantly enriched among PRC2-binding transcripts in vivo. DNA sequences coding for PRC2-binding RNA motifs are enriched at PRC2-binding sites on chromatin and H3K27me3-modified nucleosomes. Collectively, the abundance of PRC2-binding RNA motifs rationalizes the promiscuous RNA binding of PRC2, and their enrichment at Polycomb target genes provides a means for RNA-mediated regulation.

  1. Particular behavior of the adenine and guanine ring-breathing modes upon the DNA conformational transitions.


    Ghomi, M; Letellier, R; Taillandier, E


    Harmonic dynamics calculations performed on the deoxyguanosine (dG) and deoxyadenosine (dA) residues, based on a reliable force field, show that the breathing motions of both guanine and adenine residues are involved in two different vibration modes (750-500 cm-1 spectral region). The calculated results reveal a strong coupling of these modes with the sugar pucker motions. This effect has been verified for the dG residue by the Raman spectra of polyd(G-C). As far as the dA residue is concerned, the particular behavior of the adenine residue breathing mode predicted by these calculations, has been confirmed by Raman spectra of polyd(A-T) undergoing a B----Z conformational transition.

  2. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T


    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  3. Simultaneous determination of adenine and guanine in ruminant bacterial pellets by ion-pair HPLC.


    García del Moral, Pilar; Arín, María Jesús; Resines, José Antonio; Díez, María Teresa


    An ion-pair reversed-phase high-performance liquid chromatography with gradient elution and UV detection was used to measure adenine (A) and guanine (G) in lyophilized bacterial pellets from ruminants using allopurinol as internal standard. The separation was performed on a Symmetry C18 column and the detection was monitored at 280 nm. Calibration curves were found to be linear in the concentration range from 5 to 50 mg/l with correlation coefficients (r2)>0.999. Mean recoveries of A and G standards added to bacterial samples were 102.2 and 98.2, respectively. The method proposed yielded sharp, well-resolved peaks within 25 min and was successfully applied for the determination of A and G in bacterial pellets.

  4. A direct-dynamics study of proton transfer through water bridges in guanine and 7-azaindole

    NASA Astrophysics Data System (ADS)

    Smedarchina, Zorka; Siebrand, Willem; Fernández-Ramos, Antonio; Gorb, Leonid; Leszczynski, Jerzy


    To evaluate the efficiency of bridges of water molecules as proton conduits, multidimensional ab initio proton transfer rate constants are reported for complexes of guanine and 7-azaindole with one and two water molecules. These water molecules form hydrogen-bonded bridges between functional groups involved in tautomerization via proton transfer and catalyze this transfer. Structures and energies of the relevant stationary configurations are optimized at the second-order Møller-Plesset level and vibrational force fields are evaluated at the Hartree-Fock level. The proton transfer rate constants, calculated with the instanton method, show the effect of the structure and strength of the hydrogen bonds, reflected in couplings between the tunneling mode and the other vibrations of the complexes. The results indicate that strongly hydrogen-bonded, strain-free water bridges can serve as very efficient proton conduits.

  5. Surface-Enhanced Hyper-Raman Spectra of Adenine, Guanine, Cytosine, Thymine, and Uracil

    PubMed Central


    Using picosecond excitation at 1064 nm, surface-enhanced hyper-Raman scattering (SEHRS) spectra of the nucleobases adenine, guanine, cytosine, thymine, and uracil with two different types of silver nanoparticles were obtained. Comparing the SEHRS spectra with SERS data from the identical samples excited at 532 nm and with known infrared spectra, the major bands in the spectra are assigned. Due to the different selection rules for the one- and two-photon excited Raman scattering, we observe strong variation in relative signal strengths of many molecular vibrations obtained in SEHRS and SERS spectra. The two-photon excited spectra of the nucleobases are found to be very sensitive with respect to molecule–nanoparticle interactions. Using both the SEHRS and SERS data, a comprehensive vibrational characterization of the interaction of nucleobases with silver nanostructures can be achieved. PMID:28077982

  6. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.


    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S


    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  7. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells

    SciTech Connect

    Palella, T.D.; Silverman, L.J.; Schroll, C.T.; Homa, F.L.; Levine, M.; Kelley, W.N.


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.

  8. Nucleotide exchange factor GEF-H1 mediates cross-talk between microtubules and the actin cytoskeleton.


    Krendel, Mira; Zenke, Frank T; Bokoch, Gary M


    Regulation of the actin cytoskeleton by microtubules is mediated by the Rho family GTPases. However, the molecular mechanisms that link microtubule dynamics to Rho GTPases have not, as yet, been identified. Here we show that the Rho guanine nucleotide exchange factor (GEF)-H1 is regulated by an interaction with microtubules. GEF-H1 mutants that are deficient in microtubule binding have higher activity levels than microtubule-bound forms. These mutants also induce Rho-dependent changes in cell morphology and actin organization. Furthermore, drug-induced microtubule depolymerization induces changes in cell morphology and gene expression that are similar to the changes induced by the expression of active forms of GEF-H1. Furthermore, these effects are inhibited by dominant-negative versions of GEF-H1. Thus, GEF-H1 links changes in microtubule integrity to Rho-dependent regulation of the actin cytoskeleton.

  9. Mutagenicity associated with O6-methylguanine-DNA damage and mechanism of nucleotide flipping by AGT during repair

    NASA Astrophysics Data System (ADS)

    Jena, N. R.; Bansal, Manju


    Methylated guanine damage at O6 position (i.e. O6MG) is dangerous due to its mutagenic and carcinogenic character that often gives rise to G:C-A:T mutation. However, the reason for this mutagenicity is not known precisely and has been a matter of controversy. Further, although it is known that O6-alkylguanine-DNA alkyltransferase (AGT) repairs O6MG paired with cytosine in DNA, the complete mechanism of target recognition and repair is not known completely. All these aspects of DNA damage and repair have been addressed here by employing high level density functional theory in gas phase and aqueous medium. It is found that the actual cause of O6MG mediated mutation may arise due to the fact that DNA polymerases incorporate thymine opposite to O6MG, misreading the resulting O6MG:T complex as an A:T base pair due to their analogous binding energies and structural alignments. It is further revealed that AGT mediated nucleotide flipping occurs in two successive steps. The intercalation of the finger residue Arg128 into the DNA double helix and its interaction with the O6MG:C base pair followed by rotation of the O6MG nucleotide are found to be crucial for the damage recognition and nucleotide flipping.

  10. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.


    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi


    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine.

  11. Electrochemical oxidation of guanine: electrode reaction mechanism and tailoring carbon electrode surfaces to switch between adsorptive and diffusional responses.


    Li, Qian; Batchelor-McAuley, Christopher; Compton, Richard G


    The electrochemical oxidation of guanine is studied in aqueous media at various carbon electrodes. Specifically edge plane pyrolytic graphite (EPPG), basal plane pyrolytic graphite (BPPG), and highly ordered pyrolytic graphite (HOPG) were used, and the voltammetry was found to vary significantly. In all cases, signals characteristic of adsorbed guanine were seen and the total charge passed varied from surface to surface in the order roughened BPPG > EPPG > BPPG > HOPG. It is of note that the peak height for the EPPG electrode is less than that found for roughened BPPG; furthermore, across the series of electrodes, there is a significant decrease in peak potential with increasing density of edge plane sites present at the electrode surface. This leads us to conclude that there are two dominating and controlling factors present: (i) the density of basal plane sites on which guanine can adsorb and (ii) the density of edge plane sites necessary for the electro-oxidation of the analyte. This conclusion is corroborated through further experiments with multi- and single-walled carbon nanotubes. Adsorption was seen to be enhanced by modification of the EPPG surface with alumina particles, and as such, increased peak signals were observed in their presence. It is further reported that via the pre-adsorption of acetone onto the graphite surface that the adsorption of guanine may be blocked, resulting in a diffusional voltammetric signal. This diffusional response has been successfully modeled and gives insight into the complex -4e(-), -4H(+) oxidation mechanism; specifically, it enables explanation of the observed change in rate-determining step with scan rate. The oxidation of guanine first proceeds via a two-electron oxidation followed by a chemical step to form 8-oxoguanine, then 8-oxoguanine is then further oxidized to form nonelectroactive products. The change is mechanism is attributed to the variation in potential of the first and second electron transfer with scan

  12. Identification of residues in the human guanylate-binding protein 1 critical for nucleotide binding and cooperative GTP hydrolysis.


    Praefcke, Gerrit J K; Kloep, Stephan; Benscheid, Utz; Lilie, Hauke; Prakash, Balaji; Herrmann, Christian


    The guanylate-binding proteins (GBPs) form a group of interferon-gamma inducible GTP-binding proteins which belong to the family of dynamin-related proteins. Like other members of this family, human guanylate-binding protein 1 (hGBP1) shows nucleotide-dependent oligomerisation that stimulates the GTPase activity of the protein. A unique feature of the GBPs is their ability to hydrolyse GTP to GDP and GMP. In order to elucidate the relationship between these findings, we designed point mutants in the phosphate-binding loop (P-loop) as well as in the switch I and switch II regions of the protein based on the crystal structure of hGBP1. These mutant proteins were analysed for their interaction with guanine nucleotides labeled with a fluorescence dye and for their ability to hydrolyse GTP in a cooperative manner. We identified mutations of amino acid residues that decrease GTPase activity by orders of magnitude a part of which are conserved in GTP-binding proteins. In addition, mutants in the P-loop were characterized that strongly impair binding of nucleotide. In consequence, together with altered GTPase activity and given cellular nucleotide concentrations this results in hGBP1 mutants prevailingly resting in the nucleotide-free (K51A and S52N) or the GTP bound form (R48A), respectively. Using size-exclusion chromatography and analytical ultracentrifugation we addressed the impact on protein oligomerisation. In summary, mutants of hGBP1 were identified and biochemically characterized providing hGBP1 locked in defined states in order to investigate their functional role in future cell biology studies.

  13. Replication Past the γ-Radiation-Induced Guanine-Thymine Cross-Link G[8,5-Me]T by Human and Yeast DNA Polymerase η

    PubMed Central

    Raychaudhury, Paromita; Basu, Ashis K.


    γ-Radiation-induced intrastrand guanine-thymine cross-link, G[8,5-Me]T, hinders replication in vitro and is mutagenic in mammalian cells. Herein we report in vitro translesion synthesis of G[8,5-Me]T by human and yeast DNA polymerase η (hPol η and yPol η). dAMP misincorporation opposite the cross-linked G by yPol η was preferred over correct incorporation of dCMP, but further extension was 100-fold less efficient for G∗:A compared to G∗:C. For hPol η, both incorporation and extension were more efficient with the correct nucleotides. To evaluate translesion synthesis in the presence of all four dNTPs, we have developed a plasmid-based DNA sequencing assay, which showed that yPol η was more error-prone. Mutational frequencies of yPol η and hPol η were 36% and 14%, respectively. Targeted G → T was the dominant mutation by both DNA polymerases. But yPol η induced targeted G → T in 23% frequency relative to 4% by hPol η. For yPol η, targeted G → T and G → C constituted 83% of the mutations. By contrast, with hPol η, semi-targeted mutations (7.2%), that is, mutations at bases near the lesion, occurred at equal frequency as the targeted mutations (6.9%). The kind of mutations detected with hPol η showed significant similarities with the mutational spectrum of G[8,5-Me]T in human embryonic kidney cells. PMID:20936176

  14. Deficiency of the purine metabolic gene HPRT dysregulates microRNA-17 family cluster and guanine-based cellular functions: a role for EPAC in Lesch-Nyhan syndrome

    PubMed Central

    Guibinga, Ghiabe-Henri; Murray, Fiona; Barron, Nikki; Pandori, William; Hrustanovic, Gorjan


    Lesch-Nyhan syndrome (LNS) is a neurodevelopmental disorder caused by mutations in the gene encoding the purine metabolic enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT). A series of motor, cognitive and neurobehavioral anomalies characterize this disease phenotype, which is still poorly understood. The clinical manifestations of this syndrome are believed to be the consequences of deficiencies in neurodevelopmental pathways that lead to disordered brain function. We have used microRNA array and gene ontology analysis to evaluate the gene expression of differentiating HPRT-deficient human neuron-like cell lines. We set out to identify dysregulated genes implicated in purine-based cellular functions. Our approach was based on the premise that HPRT deficiency affects preeminently the expression and the function of purine-based molecular complexes, such as guanine nucleotide exchange factors (GEFs) and small GTPases. We found that several microRNAs from the miR-17 family cluster and genes encoding GEF are dysregulated in HPRT deficiency. Most notably, our data show that the expression of the exchange protein activated by cAMP (EPAC) is blunted in HPRT-deficient human neuron-like cell lines and fibroblast cells from LNS patients, and is altered in the cortex, striatum and midbrain of HPRT knockout mouse. We also show a marked impairment in the activation of small GTPase RAP1 in the HPRT-deficient cells, as well as differences in cytoskeleton dynamics that lead to increased motility for HPRT-deficient neuron-like cell lines relative to control. We propose that the alterations in EPAC/RAP1 signaling and cell migration in HPRT deficiency are crucial for neuro-developmental events that may contribute to the neurological dysfunctions in LNS. PMID:23804752

  15. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.


    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E


    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  16. Plant cyclic nucleotide signalling: facts and fiction.


    Martinez-Atienza, Juliana; Van Ingelgem, Carl; Roef, Luc; Maathuis, Frans Jm


    The presence of the cyclic nucleotides 3',5'-cyclic adenyl monophosphate (cAMP) and 3',5'-cyclic guanyl monophosphate (cGMP) in plants is now generally accepted. In addition, cAMP and cGMP have been implicated in the regulation of important plant processes such as stomatal functioning, monovalent and divalent cation fluxes, chloroplast development, gibberellic acid signalling, pathogen response and gene transcription. However, very little is known regarding the components of cyclic nucleotide signalling in plants. In this addendum, the evidence for specific mechanisms of plant cyclic nucleotide signalling is evaluated and discussed.

  17. Single Nucleotide Polymorphisms and Osteoarthritis

    PubMed Central

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping


    Abstract Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy–Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13–1.46; AA versus GG: OR = 1.60, 95% CI 1.25–2.05; GA versus GG: OR = 1.31, 95% CI 1.18–1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12–1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19–1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased

  18. Advances in targeting cyclic nucleotide phosphodiesterases

    PubMed Central

    Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.


    Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066

  19. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.


    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir


    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  20. Site-specific excision repair of 1-nitrosopyrene-induced DNA adducts at the nucleotide level in the HPRT gene of human fibroblasts: effect of adduct conformation on the pattern of site-specific repair.

    PubMed Central

    Wei, D; Maher, V M; McCormick, J J


    Studies showing that different types of DNA adducts are repaired in human cells at different rates suggest that DNA adduct conformation is the major determinant of the rate of nucleotide excision repair. However, recent studies of repair of cyclobutane pyrimidine dimers or benzo[a]pyrene diol epoxide (BPDE)-induced adducts at the nucleotide level in DNA of normal human fibroblasts indicate that the rate of repair of the same adduct at different nucleotide positions can vary up to 10-fold, suggesting an important role for local DNA conformation. To see if site-specific DNA repair is a common phenomenon for bulky DNA adducts, we determined the rate of repair of 1-nitrosopyrene (1-NOP)-induced adducts in exon 3 of the hypoxanthine phosphoribosyltransferase gene at the nucleotide level using ligation-mediated PCR. To distinguish between the contributions of adduct conformation and local DNA conformation to the rate of repair, we compared the results obtained with 1-NOP with those we obtained previously using BPDE. The principal DNA adduct formed by either agent involves guanine. We found that rates of repair of 1-NOP-induced adducts also varied significantly at the nucleotide level, but the pattern of site-specific repair differed from that of BPDE-induced adducts at the same guanine positions in the same region of DNA. The average rate of excision repair of 1-NOP adducts in exon 3 was two to three times faster than that of BPDE adducts, but at particular nucleotides the rate was slower or faster than that of BPDE adducts or, in some cases, equal to that of BPDE adducts. These results indicate that the contribution of the local DNA conformation to the rate of repair at a particular nucleotide position depends upon the specific DNA adduct involved. However, the data also indicate that the conformation of the DNA adduct is not the only factor contributing to the rate of repair at different nucleotide positions. Instead, the rate of repair at a particular nucleotide

  1. A type of nucleotide motif that distinguishes tobamovirus species more efficiently than nucleotide signatures.


    Gibbs, A J; Armstrong, J S; Gibbs, M J


    The complete genomic sequences of forty-eight tobamoviruses were classified and found to form at least twelve species clusters. Individual species were not conveniently defined by 'nucleotide signatures' (i.e. strings of one or more nucleotides unique to a taxon) as these were scattered sparsely throughout the genomes and were mostly single nucleotides. By contrast all the species were concisely and uniquely distinguished by short nucleotide motifs consisting of conserved genus-specific sites intercalated with variable sites that provided species-specific combinations of nucleotides (nucleotide combination motifs; NC-motifs). We describe the procedure for finding NC-motifs in a convenient and phylogenetically conserved region of the tobamovirus RNA polymerase gene, the '4404-50 motif'. NC-motifs have been found in other sets of homologous sequences, and are convenient for use in published taxonomic descriptions.

  2. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    PubMed Central

    Jayamohan, Harikrishnan; Gale, Bruce K.; Minson, Bj; Lambert, Christopher J.; Gordon, Neil; Sant, Himanshu J.


    In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic) beads for capture and polyguanine (polyG) oligonucleotide functionalized secondary (polystyrene) beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli/ secondary bead). While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 108 guanine tags per secondary bead (7.5 × 106 biotin-FITC per secondary bead, 20 guanines per oligonucleotide) bound to the target (E. coli). A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV) was used to quantify the amount of polyG involved in the hybridization event with tris(2,2′-bipyridine)ruthenium(II) ( Ru(bpy)32+) as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3. We also demonstrate the use of the

  3. Oxidation of guanine by carbonate radicals derived from photolysis of carbonatotetramminecobalt(III) complexes and the pH dependence of intrastrand DNA cross-links mediated by guanine radical reactions.


    Crean, Conor; Lee, Young Ae; Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    The carbonate radical anion CO(3)(*-) is a decomposition product of nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, an important biological byproduct of the inflammatory response. The selective oxidation of guanine in DNA by CO(3)(*-) radicals is known to yield spiroiminodihydantoin (Sp) and guanidinohydantoin (Gh) products, and also a novel intrastrand cross-linked product: 5'-d(CCATCG*CT*ACC), featuring a linkage between guanine C8 (G*) and thymine N3 (T*) atoms in the oligonucleotide (Crean et al., Nucleic Acids Res. 2008, 36, 742-755). Involvement of the T-N3 (pK(a) of N3-H is 9.67) suggests that the formation of 5'-d(CCATCG*CT*ACC) might be pH-dependent. This hypothesis was tested by generating CO(3)(*-) radicals through the photodissociation of carbonatotetramminecobalt(III) complexes by steady-state UV irradiation, which allowed for studies of product yields in the pH 5.0-10.0 range. The yield of 5'-d(CCATCG*CT*ACC) at pH 10.0 is approximately 45 times greater than at pH 5.0; this is consistent with the proposed mechanism, which requires N3(H) thymine proton dissociation followed by nucleophilic addition to the C8 guanine radical.

  4. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.


    Grimme, Stefan; Bauer, Christopher Alexander


    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  5. Ruthenation of Non‐stacked Guanines in DNA G‐Quadruplex Structures: Enhancement of c‐MYC Expression

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; Couceiro, José R.


    Abstract Guanine quadruplexes (GQs) are compact four‐stranded DNA structures that play a key role in the control of a variety of biological processes, including gene transcription. Bulky ruthenium complexes featuring a bipyridine, a terpyridine, and one exchangeable ligand ([Ru(terpy)(bpy)X]n+) are able to metalate exposed guanines present in the GQ of the c‐MYC promoter region that are not involved in quadruplex base pairing. qRT‐PCR and western‐blot experiments indicated that the complexes promote a remarkable increase in the expression of this oncogene. We also show that exchangeable thioether ligands (X=RSR′, Met) allow regulation of the metalating activity of the complex with visible light. PMID:27860057

  6. Synthesis of adenine, guanine, cytosine, and other nitrogen organic compounds by a Fischer-Tropsch-like process.

    NASA Technical Reports Server (NTRS)

    Yang, C. C.; Oro, J.


    Study of the formation of purines, pyrimidines, and other bases from CO, H2, and NH3 under conditions similar to those used in the Fischer-Tropsch process. It is found that industrial nickel/iron alloy catalyzes the synthesis of adenine, guanine, cytosine, and other nitrogenous compounds from mixtures of CO, H2, and NH3 at temperatures of about 600 C. Sufficient sample was accumulated to isolate as solid products adenine, guanine, and cytosine, which were identified by infrared spectrophotometry. In the absence of nickel/iron catalyst, at 650 C, or in the presence of this catalyst, at 450 C, no purines or pyrimidines were synthesized. These results confirm and extend some of the work reported by Kayatsu et al. (1968).

  7. A Cu(II) complex of an imidazolium-based ionic liquid: synthesis, X-ray structure and application in the selective electrochemical sensing of guanine.


    Singh, Amanpreet; Singh, Ajnesh; Singh, Narinder


    An imidazolium-based ionic liquid containing a carboxylic acid group was synthesized and complexed with Cu(II). The resulting complex R1 was fully characterized using various techniques, including IR spectroscopy and X-ray crystallography. Binding studies of the complex R1 were performed with anions and biomolecules using cyclic voltammetry, which showed no change in its voltammogram upon the addition of various anions and most biomolecules. However, a shift in the reduction peak from +0.20 to -0.15 was observed upon the addition of guanine. This selective determination of guanine by R1 was extended by using R1 as an electrochemical sensor for guanine in various voltammetric techniques, including cyclic voltammetry, LSV and DPV. The proposed sensor showed excellent reproducibility and high selectivity and sensitivity towards guanine, with a linear range of 0-20 μM and a detection limit of 45 nM.

  8. Guanine Deaminase Functions as Dihydropterin Deaminase in the Biosynthesis of Aurodrosopterin, a Minor Red Eye Pigment of Drosophila*

    PubMed Central

    Kim, Jaekwang; Park, Sang Ick; Ahn, Chiyoung; Kim, Heuijong; Yim, Jeongbin


    Dihydropterin deaminase, which catalyzes the conversion of 7,8-dihydropterin to 7,8-dihydrolumazine, was purified 5850-fold to apparent homogeneity from Drosophila melanogaster. Its molecular mass was estimated to be 48 kDa by gel filtration and SDS-PAGE, indicating that it is a monomer under native conditions. The pI value, temperature, and optimal pH of the enzyme were 5.5, 40 °C, and 7.5, respectively. Interestingly the enzyme had much higher activity for guanine than for 7,8-dihydropterin. The specificity constant (kcat/Km) for guanine (8.6 × 106 m−1·s−1) was 860-fold higher than that for 7,8-dihydropterin (1.0 × 104 m−1·s−1). The structural gene of the enzyme was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis as CG18143, located at region 82A1 on chromosome 3R. The cloned and expressed CG18143 exhibited both 7,8-dihydropterin and guanine deaminase activities. Flies with mutations in CG18143, SUPor-P/Df(3R)A321R1 transheterozygotes, had severely decreased activities in both deaminases compared with the wild type. Among several red eye pigments, the level of aurodrosopterin was specifically decreased in the mutant, and the amount of xanthine and uric acid also decreased considerably to 76 and 59% of the amounts in the wild type, respectively. In conclusion, dihydropterin deaminase encoded by CG18143 plays a role in the biosynthesis of aurodrosopterin by providing one of its precursors, 7,8-dihydrolumazine, from 7,8-dihydropterin. Dihydropterin deaminase also functions as guanine deaminase, an important enzyme for purine metabolism. PMID:19567870

  9. Quantum-chemical study of interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-nucleobases.


    Mikulski, Damian; Szeląg, Małgorzata; Molski, Marcin


    Trans-resveratrol, a natural phytoalexin present in red wine and grapes, has gained considerable attention because of its antiproliferative, chemopreventive and proapoptotic activity against human cancer cells. The accurate quantum-chemical computations based on the density functional theory (DFT) and ab initio second-order Møller-Plesset perturbation method (MP2) have been performed for the first time to study interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-derived nitrogenous bases: adenine, guanine, cytosine and thymine in vacuum and water medium. This compound is found to show high affinity to nitrogenous bases and guanine-thymine dinucleotide. The electrostatic interactions from intermolecular hydrogen bonding increase the stability of complexes studied. In particular, significantly strong hydrogen bonds between 4'-H atom of trans-resveratrol and imidazole nitrogen as well as carbonyl oxygen atoms of nucleobases studied stabilize these systems. The stabilization energies computed reveal that the negatively charged trans-resveratrol-dinucleotide complex is more energetically stable in water medium than in vacuum. MP2 method gives more reliable and significantly high values of stabilization energy of trans-resveratrol-dinucleotide, trans-resveratrol-guanine and trans-resveratrol-thymine complexes than B3LYP exchange-correlation functional because it takes into account London dispersion energy. According to the results, in the presence of trans-resveratrol the 3'-5' phosphodiester bond in dinucleotide can be cleaved and the proton from 4'-OH group of trans-resveratrol migrates to the 3'-O atom of dinucleotide. It is concluded that trans-resveratrol is able to break the DNA strand. Hence, the findings obtained help understand antiproliferative and anticancer properties of this polyphenol.

  10. Structure of radicals from X-irradiated guanine derivatives: an experimental and computational study of sodium guanosine dihydrate single crystals.


    Jayatilaka, Nayana; Nelson, William H


    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. Electron paramagnetic resonance (EPR) and electron-nuclear double resonance (ENDOR) studies of crystals X-irradiated at 10 K detected evidence for three radical forms. Radical R1, characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen alpha-couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling, was identified as the primary electron-loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1' of the ribose moiety. The identification of radicals R1-R3 was supported by density functional theory (DFT) calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of one-electron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty.

  11. Computational prediction of one-electron reduction potentials and acid dissociation constants for guanine oxidation intermediates and products.


    Psciuk, Brian T; Schlegel, H Bernhard


    Reduction potentials and pK(a) values were calculated for intermediates and products along three major pathways for guanine oxidation using the B3LYP and CBS-QB3 levels of theory with the SMD implicit solvation model. N-methylated nucleobases were used as models for nucleoside species. Ensemble averaged reduction potentials at pH 7 (E7) were obtained by combining calculated standard reduction potentials with calculated pKa values in addition to accounting for tautomerization energies. Calculated pK(a) values are reasonable based on experimental estimates and chemical intuition. Pathway A leads to guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp). The first step is the oxidation of 8-oxoguanine which proceeds by the loss of an electron followed by the loss of two protons and loss of another electron, yielding 8-oxopurine. The calculated E7 values for the remaining intermediates and products are at least 0.3 V higher than that of guanine, indicating that further oxidation of these species is unlikely. Pathway B leads to two formamidopyrimidine isomers (FAPyG and 2,5FAPyG). Species along this pathway have calculated reduction potentials that are much lower than the oxidation potential for guanine and would likely be very short-lived in an oxidatively stressed environment. Pathway C leads to reduced spiroiminodihydantoin and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih). Similar to pathway A, the calculated reduction potentials for species along this pathway are at least 0.4 V higher than that of guanine.

  12. Rational design of hetero-ring-expanded guanine analogs with enhanced properties for modified DNA building blocks.


    Zhang, Jinmei; Cukier, Robert I; Bu, Yuxiang


    The properties and modes of recognition of physiological DNAs associated with the four natural nucleobases might be extended, in principle, by the design of non-natural nucleobase derivatives. The goal is an expansion of the genetic alphabet, with the possible outcome of producing new DNAs with improved physical or biological properties. In this work, a new series of hetero-ring-expanded guanine analogs are proposed, and their relevant structural characteristics and electronic properties are determined by density functional theory. The stabilities of the decamer DNA duplexes (dn.dC)10 (where n represents the corresponding expanded guanine analog designed here) are also examined, using molecular dynamics. The simulations show that the designed motifs can form stable DNA-like structures. We determined the pairing energies for the Watson-Crick (WC) hydrogen-bonded dimers between the expanded G-analogs and the natural C, and found that the pairing energies are close to those of the natural GC pair. The calculated adiabatic ionization potentials (IPs) of the size-expanded guanine analogs and their base pairs, and the corresponding vertical ionization potentials, show that some are distinctly smaller than the corresponding natural versions. The HOMO-LUMO energy gaps for most of the size-expanded guanine analogs and their WC base pairs are considerably lower than those of the corresponding natural base and base pairs. Thus, the expanded G bases may be considered as DNA genetic motifs, and they may serve as building blocks for potential biological applications and the development of molecular electronic devices.

  13. SVOP Is a Nucleotide Binding Protein

    PubMed Central

    Yao, Jia; Bajjalieh, Sandra M.


    Background Synaptic Vesicle Protein 2 (SV2) and SV2-related protein (SVOP) are transporter-like proteins that localize to neurotransmitter-containing vesicles. Both proteins share structural similarity with the major facilitator (MF) family of small molecule transporters. We recently reported that SV2 binds nucleotides, a feature that has also been reported for another MF family member, the human glucose transporter 1 (Glut1). In the case of Glut1, nucleotide binding affects transport activity. In this study, we determined if SVOP also binds nucleotides and assessed its nucleotide binding properties. Methodology/Principal Findings We performed in vitro photoaffinity labeling experiments with the photoreactive ATP analogue, 8-azido-ATP[γ] biotin and purified recombinant SVOP-FLAG fusion protein. We found that SVOP is a nucleotide-binding protein, although both its substrate specificity and binding site differ from that of SV2. Within the nucleotides tested, ATP, GTP and NAD show same level of inhibition on SVOP-FLAG labeling. Dose dependent studies indicated that SVOP demonstrates the highest affinity for NAD, in contrast to SV2, which binds both NAD and ATP with equal affinity. Mapping of the binding site revealed a single region spanning transmembrane domains 9–12, which contrasts to the two binding sites in the large cytoplasmic domains in SV2A. Conclusions/Significance SVOP is the third MF family member to be found to bind nucleotides. Given that the binding sites are unique in SVOP, SV2 and Glut1, this feature appears to have arisen separately. PMID:19390693

  14. beta-NAD is a novel nucleotide released on stimulation of nerve terminals in human urinary bladder detrusor muscle.


    Breen, Leanne T; Smyth, Lisa M; Yamboliev, Ilia A; Mutafova-Yambolieva, Violeta N


    Endogenous nucleotides with extracellular functions may be involved in the complex neural control of human urinary bladder (HUB). Using HPLC techniques with fluorescence detection, we observed that in addition to ATP and its metabolites ADP, AMP and adenosine, electrical field stimulation (EFS; 4-16 Hz, 0.1 ms, 15 V, 60 s) of HUB detrusor smooth muscle coreleases novel nucleotide factors, which produce etheno-1N(6)-ADP-ribose (eADPR) on etheno-derivatization at high temperature. A detailed HPLC fraction analysis determined that nicotinamide adenine dinucleotide (beta-NAD+; 7.0 +/- 0.7 fmol/mg tissue) is the primary nucleotide that contributes to the formation of eADPR. The tissue superfusates collected during EFS also contained the beta-NAD+ metabolite ADPR (0.35 +/- 0.2 fmol/mg tissue) but not cyclic ADPR (cADPR). HUB failed to degrade nicotinamide guanine dinucleotide (NGD+), a specific substrate of ADP ribosyl cyclase, suggesting that the activity of this enzyme in the HUB is negligible. The EFS-evoked release of beta-NAD+ was frequency dependent and is reduced in the presence of tetrodotoxin (TTX; 0.3 micromol/l), omega-conotoxin GVIA (50 nmol/l), and botulinum neurotoxin A (BoNT/A; 100 nmol/l), but remained unchanged in the presence of guanethidine (3 micromol/l), omega-agatoxin IVA (50 nmol/l), or charbachol (1 micromol/l). Capsaicin (10 micromol/l) increased both the resting and EFS-evoked overflow of beta-NAD+. Exogenous beta-NAD+ (1 micromol/l) reduced both the frequency and amplitude of spontaneous contractions. In conclusion, we detected nerve-evoked overflow of beta-NAD+ and ADPR in HUB. The beta-NAD(+)/ADPR system may constitute a novel inhibitory extracellular nucleotide mechanism of neural control of the human bladder.

  15. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM.


    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A; Jansen, Chimed; Fletcher, Dan A; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V; Cowling, Victoria H


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation.

  16. The Guanine-Based Purinergic System: The Tale of An Orphan Neuromodulation

    PubMed Central

    Garozzo, Roberta; Frinchi, Monica; Fernandez-Dueñas, Víctor; Di Iorio, Patrizia; Ciccarelli, Renata; Caciagli, Francesco; Condorelli, Daniele F.; Ciruela, Francisco; Belluardo, Natale


    Guanine-based purines (GBPs) have been recently proposed to be not only metabolic agents but also extracellular signaling molecules that regulate important functions in the central nervous system. In such way, GBPs-mediated neuroprotection, behavioral responses and neuronal plasticity have been broadly described in the literature. However, while a number of these functions (i.e., GBPs neurothophic effects) have been well-established, the molecular mechanisms behind these GBPs-dependent effects are still unknown. Furthermore, no plasma membrane receptors for GBPs have been described so far, thus GBPs are still considered orphan neuromodulators. Interestingly, an intricate and controversial functional interplay between GBPs effects and adenosine receptors activity has been recently described, thus triggering the hypothesis that GBPs mechanism of action might somehow involve adenosine receptors. Here, we review recent data describing the GBPs role in the brain. We focus on the involvement of GBPs regulating neuronal plasticity, and on the new hypothesis based on putative GBPs receptors. Overall, we expect to shed some light on the GBPs world since although these molecules might represent excellent candidates for certain neurological diseases management, the lack of putative GBPs receptors precludes any high throughput screening intent for the search of effective GBPs-based drugs. PMID:27378923

  17. Identification of guanine exchange factor key residues involved in exchange activity and Ras interaction.


    Camus, C; Hermann-Le Denmat, S; Jacquet, M


    We have carried out a functional analysis of the human HGRF55 exchange factor in the yeast Saccharomyces cerevisiae. Twelve residues conserved among most of all known guanine exchange factors (GEFs) have been independently changed to alanine. Taking advantage of the ability of Hgrf55p to replace the yeast Cdc25p exchange factor, and using the two-hybrid system with RAS2ala22 allele, we have identified key residues for the interaction with Ras and/or its activation. Substitution of arginine 392 to alanine leads to a complete loss of interaction with Ras, though the protein remains stable. Substitution of Asp266 or Arg359 to alanine results in inactive proteins at 39 degrees C, still able however to interact with Ras. The other charged-to-alanine substitutions led to no detectable phenotype when present alone but most of them dramatically increased the temperature sensitive phenotype observed with [Asp266Ala] substitution. Surprisingly, the cysteine to alanine substitution in the highly conserved PCVPF/Y motif proved to be without effect, suggesting that the sulfhydryl group is not essential for stability or interaction with Ras.

  18. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?


    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro


    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  19. Electron correlation effects and density analysis of the first-order hyperpolarizability of neutral guanine tautomers.


    Alparone, Andrea


    Dipole moments (μ), charge distributions, and static electronic first-order hyperpolarizabilities (β(μ)) of the two lowest-energy keto tautomers of guanine (7H and 9H) were determined in the gas phase using Hartree-Fock, Møller-Plesset perturbation theory (MP2 and MP4), and DFT (PBE1PBE, B97-1, B3LYP, CAM-B3LYP) methods with Dunning's correlation-consistent aug-cc-pVDZ and d-aug-cc-pVDZ basis sets. The most stable isomer 7H exhibits a μ value smaller than that of the 9H form by a factor of ca. 3.5. The β μ value of the 9H tautomer is strongly dependent on the computational method employed, as it dramatically influences the β(μ) (9H)/β(μ) (7H) ratio, which at the highest correlated MP4/aug-cc-pVDZ level is predicted to be ca. 5. The Coulomb-attenuating hybrid exchange-correlation CAM-B3LYP method is superior to the conventional PBE1PBE, B3LYP, and B97-1 functionals in predicting the β(μ) values. Differences between the largest diagonal hyperpolarizability components were clarified through hyperpolarizability density analyses. Dipole moment and first-order hyperpolarizability are molecular properties that are potentially useful for distinguishing the 7H from the 9H tautomer.

  20. Self-catalyzed site-specific depurination of guanine residues within gene sequences.


    Amosova, Olga; Coulter, Richard; Fresco, Jacques R


    A self-catalyzed, site-specific guanine-depurination activity has been found to occur in short gene sequences with a potential to form a stem-loop structure. The critical features of that catalytic intermediate are a 5'-G-T-G-G-3' loop and an adjacent 5'-T.A-3' base pair of a short duplex stem stable enough to fix the loop structure required for depurination of its 5'-G residue. That residue is uniquely depurinated with a rate some 5 orders of magnitude faster than that of random "spontaneous" depurination. In contrast, all other purine residues in the sequence depurinate at the spontaneous background rate. The reaction requires no divalent cations or other cofactors and occurs under essentially physiological conditions. Such stem-loops can form in duplex DNA under superhelical stress, and their critical sequence features have been found at numerous sites in the human genome. Self-catalyzed stem-loop-mediated depurination leading to flexible apurinic sites may therefore serve some important biological role, e.g., in nucleosome positioning, genetic recombination, or chromosome superfolding.

  1. Theoretical investigation of hydrogen transfer mechanism in the guanine cytosine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni


    We have studied the quantum-dynamics of the hydrogen bonds in the guanine-cytosine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick G-C, the imino-enol G*-C*, the imino-enol-imino-enol G #-C # and some zwitterionic structures. The common idea in the literature is that only the G-C and the G*-C* tautomers are stable with an estimate of G-C → G*-C* transition probability of 10 -6-10 -9 by the help of Boltzmann statistics. Here we show a detailed quantum theoretical study that suggests the following conclusion: G-C is the stablest tautomer, some partially charged systems (due to the movement of only one hydrogen atom) are important and a large amount of the imino-enol G*-C* (and less of the imino-enol-imino-enol G #-C # structure) tautomer is present at any time. The corresponding transition probabilities from different tautomers are not due to thermal passage, but they are a pure quantum phenomenon. These large probabilities definitively disprove the idea of these tautomers as mutation points. The mechanisms of passage from the G-C tautomer to the others have also been investigated.

  2. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM

    PubMed Central

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A.; Jansen, Chimed; Fletcher, Dan A.; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V.; Cowling, Victoria H.


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. PMID:27422871

  3. Overoxidized polypyrrole/graphene nanocomposite with good electrochemical performance as novel electrode material for the detection of adenine and guanine.


    Gao, Yan-Sha; Xu, Jing-Kun; Lu, Li-Min; Wu, Li-Ping; Zhang, Kai-Xin; Nie, Tao; Zhu, Xiao-Fei; Wu, Yao


    Most conducting polymer/graphene composites have excellent electrical conductivity. However, the background currents of these composites modified electrodes are much larger. In order to improve the sensitivities of these methods, it is necessary to decrease the background signal. In this paper, porous structure films of overoxidized polypyrrole/graphene (PPyox/GR) have been electrochemically coated onto glassy carbon electrode (GCE) and successfully utilized as an efficient electrode material for the quantitive detection of adenine and guanine, two of the most important components of DNA and RNA. The permselective polymer coatings with low background current could improve the selectivity and sensitivity of microelectrodes for the electropositive purine bases. The GRs into these polymers would further improve sensitivity by increasing the electroactive surface area. The electrochemical sensor can be applied to the quantification of adenine and guanine with a linear range covering 0.06-100 µM and 0.04-100 µM, and a low detection limit of 0.02 μM and 0.01 μM, respectively. More importantly, the proposed method was applied to quantify adenine and guanine in calf thymus DNA with satisfactory results.

  4. Electrochemical biosensor based on silver nanoparticles-polydopamine-graphene nanocomposite for sensitive determination of adenine and guanine.


    Huang, Ke-Jing; Wang, Lan; Wang, Hai-Bo; Gan, Tian; Wu, Ying-Ying; Li, Jing; Liu, Yan-Ming


    A multifunctional Ag nanoparticles (AgNPs)-polydopamine (Pdop)@graphene (Gr) composite was prepared by a simple and mild procedure. Gr was easily coated with Pdop at room temperature and then AgNPs was deposited by mildly stirring. The nanocomposite was characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). Guanine and adenine as model moleculars were employed to study their electrochemical responses at the Ag-Pdop@Gr composite modified electrode, which showed more favorable electron transfer kinetics than Gr modified glassy carbon and AgNPs modified glassy carbon electrodes. The Ag-Pdop@Gr modified electrode exhibited linear ranges of 0.04-50 μM and 0.02-40 μM with detection limits of 4.0 nM and 2.0 nM for guanine and adenine, respectively. The developed method was applied for simultaneous determination of trace-level adenine and guanine in fish sperm. The results demonstrated that the AgNPs-Pdop@Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for biosensing.

  5. DNA oxidation in anionic reverse micelles: ruthenium-mediated damage at Guanine in single- and double-stranded DNA.


    Evans, Sarah E; Mon, Soe; Singh, Robinder; Ryzhkov, Lev R; Szalai, Veronika A


    One-electron guanine oxidation in DNA has been investigated in anionic reverse micelles (RMs). A photochemical method for generating Ru3+ from the ruthenium polypyridyl complex tris(2-2'-bipyridine)ruthenium(II) chloride ([Ru(bpy)3]Cl2) is combined with high-resolution polyacrylamide gel electrophoresis (PAGE) to quantify piperidine-labile guanine oxidation products. As characterized by emission spectroscopy of Ru(bpy)3(2+), the addition of DNA to RMs containing Ru(bpy)3(2+) does not perturb the environment of Ru(bpy)3(2+). The steady-state quenching efficiency of Ru(bpy)3(2+) with K3[Fe(CN)6] in buffer solution is approximately 2-fold higher than that observed in RMs. Consistent with the difference in quenching efficiency in the two media, a 1.5-fold higher yield of piperidine-labile damage products as monitored by PAGE is observed for duplex oligonucleotide in buffer vs RMs. In contrast, a 13-fold difference in the yield of PAGE-detected G oxidation products is observed when single-stranded DNA is the substrate. Circular dichroism spectra showed that single-stranded DNA undergoes a structural change in anionic RMs. This structural change is potentially due to cation-mediated adsorption of the DNA phosphates on the anionic headgroups of the RMs, leading to protection of the guanine from oxidatively generated damage.

  6. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.


    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia


    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  7. Multisite-specific archaeosine tRNA-guanine transglycosylase (ArcTGT) from Thermoplasma acidophilum, a thermo-acidophilic archaeon

    PubMed Central

    Kawamura, Takuya; Hirata, Akira; Ohno, Satoshi; Nomura, Yuichiro; Nagano, Tomoko; Nameki, Nobukazu; Yokogawa, Takashi; Hori, Hiroyuki


    Archaeosine (G+), which is found only at position 15 in many archaeal tRNA, is formed by two steps, the replacement of the guanine base with preQ0 by archaeosine tRNA-guanine transglycosylase (ArcTGT) and the subsequent modification of preQ0 to G+ by archaeosine synthase. However, tRNALeu from Thermoplasma acidophilum, a thermo-acidophilic archaeon, exceptionally has two G+13 and G+15 modifications. In this study, we focused on the biosynthesis mechanism of G+13 and G+15 modifications in this tRNALeu. Purified ArcTGT from Pyrococcus horikoshii, for which the tRNA recognition mechanism and structure were previously characterized, exchanged only the G15 base in a tRNALeu transcript with 14C-guanine. In contrast, T. acidophilum cell extract exchanged both G13 and G15 bases. Because T. acidophilum ArcTGT could not be expressed as a soluble protein in Escherichia coli, we employed an expression system using another thermophilic archaeon, Thermococcus kodakarensis. The arcTGT gene in T. kodakarensis was disrupted, complemented with the T. acidophilum arcTGT gene, and tRNALeu variants were expressed. Mass spectrometry analysis of purified tRNALeu variants revealed the modifications of G+13 and G+15 in the wild-type tRNALeu. Thus, T. acidophilum ArcTGT has a multisite specificity and is responsible for the formation of both G+13 and G+15 modifications. PMID:26721388

  8. Cyclic nucleotide phosphodiesterases (PDEs): coincidence detectors acting to spatially and temporally integrate cyclic nucleotide and non-cyclic nucleotide signals.


    Maurice, Donald H; Wilson, Lindsay S; Rampersad, Sarah N; Hubert, Fabien; Truong, Tammy; Kaczmarek, Milosz; Brzezinska, Paulina; Freitag, Silja I; Umana, M Bibiana; Wudwud, Alie


    The cyclic nucleotide second messengers cAMP and cGMP each affect virtually all cellular processes. Although these hydrophilic small molecules readily diffuse throughout cells, it is remarkable that their ability to activate their multiple intracellular effectors is spatially and temporally selective. Studies have identified a critical role for compartmentation of the enzymes which hydrolyse and metabolically inactivate these second messengers, the PDEs (cyclic nucleotide phosphodiesterases), in this specificity. In the present article, we describe several examples from our work in which compartmentation of selected cAMP- or cGMP-hydrolysing PDEs co-ordinate selective activation of cyclic nucleotide effectors, and, as a result, selectively affect cellular functions. It is our belief that therapeutic strategies aimed at targeting PDEs within these compartments will allow greater selectivity than those directed at inhibiting these enzymes throughout the cells.

  9. Comparison of the acid-base properties of ribose and 2'-deoxyribose nucleotides.


    Mucha, Ariel; Knobloch, Bernd; Jezowska-Bojczuk, Małgorzata; Kozłowski, Henryk; Sigel, Roland K O


    The extent to which the replacement of a ribose unit by a 2'-deoxyribose unit influences the acid-base properties of nucleotides has not hitherto been determined in detail. In this study, by potentiometric pH titrations in aqueous solution, we have measured the acidity constants of the 5'-di- and 5'-triphosphates of 2'-deoxyguanosine [i.e., of H(2)(dGDP)(-) and H(2)(dGTP)(2-)] as well as of the 5'-mono-, 5'-di-, and 5'-triphosphates of 2'-deoxyadenosine [i.e., of H(2)(dAMP)(+/-), H(2)(dADP)(-), and H(2)(dATP)(2-)]. These 12 acidity constants (of the 56 that are listed) are compared with those of the corresponding ribose derivatives (published data) measured under the same experimental conditions. The results show that all protonation sites in the 2'-deoxynucleotides are more basic than those in their ribose counterparts. The influence of the 2'-OH group is dependent on the number of 5'-phosphate groups as well as on the nature of the purine nucleobase. The basicity of N7 in guanine nucleotides is most significantly enhanced (by about 0.2 pK units), while the effect on the phosphate groups and the N1H or N1H(+) sites is less pronounced but clearly present. In addition, (1)H NMR chemical shift change studies in dependence on pD in D(2)O have been carried out for the dAMP, dADP, and dATP systems, which confirmed the results from the potentiometric pH titrations and showed the nucleotides to be in their anti conformations. Overall, our results are not only of relevance for metal ion binding to nucleotides or nucleic acids, but also constitute an exact basis for the calculation, determination, and understanding of perturbed pK(a) values in DNAzymes and ribozymes, as needed for the delineation of acid-base mechanisms in catalysis.

  10. Proofreading of misincorporated nucleotides in DNA transcription

    NASA Astrophysics Data System (ADS)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B.


    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction.

  11. Proofreading of misincorporated nucleotides in DNA transcription

    NASA Astrophysics Data System (ADS)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B.


    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction.

  12. Quadruplex-single nucleotide polymorphisms (Quad-SNP) influence gene expression difference among individuals.


    Baral, Aradhita; Kumar, Pankaj; Halder, Rashi; Mani, Prithvi; Yadav, Vinod Kumar; Singh, Ankita; Das, Swapan K; Chowdhury, Shantanu


    Non-canonical guanine quadruplex structures are not only predominant but also conserved among bacterial and mammalian promoters. Moreover recent findings directly implicate quadruplex structures in transcription. These argue for an intrinsic role of the structural motif and thereby posit that single nucleotide polymorphisms (SNP) that compromise the quadruplex architecture could influence function. To test this, we analysed SNPs within quadruplex motifs (Quad-SNP) and gene expression in 270 individuals across four populations (HapMap) representing more than 14,500 genotypes. Findings reveal significant association between quadruplex-SNPs and expression of the corresponding gene in individuals (P < 0.0001). Furthermore, analysis of Quad-SNPs obtained from population-scale sequencing of 1000 human genomes showed relative selection bias against alteration of the structural motif. To directly test the quadruplex-SNP-transcription connection, we constructed a reporter system using the RPS3 promoter-remarkable difference in promoter activity in the 'quadruplex-destabilized' versus 'quadruplex-intact' promoter was noticed. As a further test, we incorporated a quadruplex motif or its disrupted counterpart within a synthetic promoter reporter construct. The quadruplex motif, and not the disrupted-motif, enhanced transcription in human cell lines of different origin. Together, these findings build direct support for quadruplex-mediated transcription and suggest quadruplex-SNPs may play significant role in mechanistically understanding variations in gene expression among individuals.

  13. Vesicular nucleotide transporter regulates the nucleotide content in airway epithelial mucin granules

    PubMed Central

    Sesma, Juliana I.; Kreda, Silvia M.; Okada, Seiko F.; van Heusden, Catharina; Moussa, Lama; Jones, Lisa C.; O'Neal, Wanda K.; Togawa, Natsuko; Hiasa, Miki; Moriyama, Yoshinori


    Nucleotides within the airway surface liquid promote fluid secretion via activation of airway epithelial purinergic receptors. ATP is stored within and released from mucin granules as co-cargo with mucins, but the mechanism by which ATP, and potentially other nucleotides, enter the lumen of mucin granules is not known. We assessed the contribution of the recently identified SLC17A9 vesicle nucleotide transporter (VNUT) to the nucleotide availability within isolated mucin granules and further examined the involvement of VNUT in mucin granule secretion-associated nucleotide release. RT-PCR and Western blot analyses indicated that VNUT is abundantly expressed in airway epithelial goblet-like Calu-3 cells, migrating as a duplex with apparent mobility of 55 and 60 kDa. Subcellular fractionation studies indicated that VNUT55 was associated with high-density mucin granules, whereas VNUT60 was associated with low-density organelles. Immunofluorescence studies showed that recombinant VNUT localized to mucin granules and other organelles. Mucin granules isolated from VNUT short hairpin RNA-expressing cells exhibited a marked reduction of ATP, ADP, AMP, and UTP levels within granules. Ca2+-regulated vesicular ATP release was markedly reduced in these cells, but mucin secretion was not affected. These results suggest that VNUT is the relevant nucleotide transporter responsible for the uptake of cytosolic nucleotides into mucin granules. By controlling the entry of nucleotides into mucin granules, VNUT contributes to the release of purinergic signaling molecules necessary for the proper hydration of co-released mucins. PMID:23467297

  14. Vesicular nucleotide transporter regulates the nucleotide content in airway epithelial mucin granules.


    Sesma, Juliana I; Kreda, Silvia M; Okada, Seiko F; van Heusden, Catharina; Moussa, Lama; Jones, Lisa C; O'Neal, Wanda K; Togawa, Natsuko; Hiasa, Miki; Moriyama, Yoshinori; Lazarowski, Eduardo R


    Nucleotides within the airway surface liquid promote fluid secretion via activation of airway epithelial purinergic receptors. ATP is stored within and released from mucin granules as co-cargo with mucins, but the mechanism by which ATP, and potentially other nucleotides, enter the lumen of mucin granules is not known. We assessed the contribution of the recently identified SLC17A9 vesicle nucleotide transporter (VNUT) to the nucleotide availability within isolated mucin granules and further examined the involvement of VNUT in mucin granule secretion-associated nucleotide release. RT-PCR and Western blot analyses indicated that VNUT is abundantly expressed in airway epithelial goblet-like Calu-3 cells, migrating as a duplex with apparent mobility of 55 and 60 kDa. Subcellular fractionation studies indicated that VNUT55 was associated with high-density mucin granules, whereas VNUT60 was associated with low-density organelles. Immunofluorescence studies showed that recombinant VNUT localized to mucin granules and other organelles. Mucin granules isolated from VNUT short hairpin RNA-expressing cells exhibited a marked reduction of ATP, ADP, AMP, and UTP levels within granules. Ca(2+)-regulated vesicular ATP release was markedly reduced in these cells, but mucin secretion was not affected. These results suggest that VNUT is the relevant nucleotide transporter responsible for the uptake of cytosolic nucleotides into mucin granules. By controlling the entry of nucleotides into mucin granules, VNUT contributes to the release of purinergic signaling molecules necessary for the proper hydration of co-released mucins.

  15. In vitro and cellular effects of 4-pyridone-3-carboxamide riboside on enzymes of nucleotide metabolism.


    Slominska, Ewa M; Borkowski, Tomasz; Rybakowska, Iwona; Abramowicz-Glinka, Magdalena; Orlewska, Czesława; Smolenski, Ryszard T


    4-Pyridone-3-carboxamide-1-beta-D-ribonucleoside (4PYR) is an endogenously produced nucleoside that has recently been identified as a substrate for intracellular phosphorylation to form nucleotide derivatives. Low level of 4PYR is normally present in human plasma, but 4PYR massively accumulates in patients with renal failure. This study aimed to evaluate effects of 4PYR and its monophosphate derivative (4PYMP) on several enzymes of nucleotide metabolism in homogenates and intact cells. Activities of adenosine monophosphate deaminase (AMPD), adenosine deaminase, ecto-5'-nucleotidase (e5NT), adenine phosphoribosyltransferase (APRT), hypoxanthine/guanine phosphoribosyltransferase, purine nucleoside phosphorylase, and S-adenosylhomocysteine hydrolase (SAHH) were evaluated in erythrocyte lysates, rat heart homogenates, and in the intact rat cardiomyocytes by high performance liquid chromatography-based assays. 4PYMP caused significant inhibition of AMPD in both erythrocyte lysate and heart homogenate with 50% inhibitory concentration (IC50) of 74 and 55 μM, respectively. Inhibition of e5NT in heart homogenates was also noted with IC50 of 63 μM. 4PYMP slightly inhibited APRT and 4PYR caused moderate activation of SAHH. No effects on other enzymes studied were noted. Inhibition of AMPD by 4PYMP in homogenates was confirmed in the intact cell experiments with isolated cardiomyocytes that were allowed to accumulate 4PYMP by incubation with 4PYR. We conclude that among pathways studied, most important is the effect of 4PYMP on AMPD and that such effect could be one of the consequences of elevated plasma 4PYR concentration.

  16. The International Nucleotide Sequence Database Collaboration

    PubMed Central

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Sequence Database Collaboration, International Nucleotide


    The International Nucleotide Sequence Database Collaboration (INSDC; comprises three global partners committed to capturing, preserving and providing comprehensive public-domain nucleotide sequence information. The INSDC establishes standards, formats and protocols for data and metadata to make it easier for individuals and organisations to submit their nucleotide data reliably to public archives. This work enables the continuous, global exchange of information about living things. Here we present an update of the INSDC in 2015, including data growth and diversification, new standards and requirements by publishers for authors to submit their data to the public archives. The INSDC serves as a model for data sharing in the life sciences. PMID:26657633

  17. Structural insights into the dual nucleotide exchange and GDI displacement activity of SidM/DrrA

    PubMed Central

    Suh, Hye-Young; Lee, Dong-Won; Lee, Kwang-Hoon; Ku, Bonsu; Choi, Sung-Jin; Woo, Jae-Sung; Kim, Yeon-Gil; Oh, Byung-Ha


    GDP-bound prenylated Rabs, sequestered by GDI (GDP dissociation inhibitor) in the cytosol, are delivered to destined sub-cellular compartment and subsequently activated by GEFs (guanine nucleotide exchange factors) catalysing GDP-to-GTP exchange. The dissociation of GDI from Rabs is believed to require a GDF (GDI displacement factor). Only two RabGDFs, human PRA-1 and Legionella pneumophila SidM/DrrA, have been identified so far and the molecular mechanism of GDF is elusive. Here, we present the structure of a SidM/DrrA fragment possessing dual GEF and GDF activity in complex with Rab1. SidM/DrrA reconfigures the Switch regions of the GTPase domain of Rab1, as eukaryotic GEFs do toward cognate Rabs. Structure-based mutational analyses show that the surface of SidM/DrrA, catalysing nucleotide exchange, is involved in GDI1 displacement from prenylated Rab1:GDP. In comparison with an eukaryotic GEF TRAPP I, this bacterial GEF/GDF exhibits high binding affinity for Rab1 with GDP retained at the active site, which appears as the key feature for the GDF activity of the protein. PMID:19942850

  18. The International Nucleotide Sequence Database Collaboration.


    Nakamura, Yasukazu; Cochrane, Guy; Karsch-Mizrachi, Ilene


    The International Nucleotide Sequence Database Collaboration (INSDC;, one of the longest-standing global alliances of biological data archives, captures, preserves and provides comprehensive public domain nucleotide sequence information. Three partners of the INSDC work in cooperation to establish formats for data and metadata and protocols that facilitate reliable data submission to their databases and support continual data exchange around the world. In this article, the INSDC current status and update for the year of 2012 are presented. Among discussed items of international collaboration meeting in 2012, BioSample database and changes in submission are described as topics.

  19. Identification of aflatoxin M1-N7-guanine in liver and urine of tree shrews and rats following administration of aflatoxin B1.


    Egner, Patricia A; Yu, Xiang; Johnson, Jesse K; Nathasingh, Christopher K; Groopman, John D; Kensler, Thomas W; Roebuck, Bill D


    Epidemiological studies have shown that exposure to aflatoxin B(1) (AFB(1)) and concurrent infection with hepatitis B lead to a multiplicative risk of developing liver cancer. This chemical-viral interaction can be recapitulated in the tree shrew (Tupia belangeri chinensis). As an initial characterization of this model, the metabolism of AFB(1) in tree shrews has been examined and compared to a sensitive bioassay species, the rat. Utilizing LC/MS/MS, an unreported product, aflatoxin M(1)-N(7)-guanine (AFM(1)-N(7)-guanine), was detected in urine and hepatic DNA samples 24 h after administration of 400 microg/kg AFB(1). In hepatic DNA isolated from tree shrews, AFM(1)-N(7)-guanine was the predominant adduct, 0.74 +/- 0.14 pmol/mg DNA, as compared to 0.37 +/- 0.07 pmol/mg DNA of AFB(1)-N(7)-guanine. Conversely, in rat liver, 6.56 +/- 2.41 pmol/mg DNA of AFB(1)-N(7)-guanine and 0.42 +/- 0.13 pmol/mg DNA of AFM(1)-N(7)-guanine were detected. Rats excreted 1.00 +/- 0.21 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.29 +/- 0.10 pmol AFM(1)-N(7)-guanine/mg creatinine as compared to 0.60 +/- 0.12 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.69 +/- 0.16 pmol AFM(1)-N(7)-guanine/mg creatinine excreted by the tree shrew. Furthermore, tree shrew urine contained 40 times more of the hydroxylated metabolite, AFM(1), than was excreted by rats. In vitro experiments confirmed this difference in oxidative metabolism. Hepatic microsomes isolated from tree shrews failed to produce aflatoxin Q(1) or aflatoxin P(1) but formed a significantly greater amount of AFM(1) than rat microsomes. Bioassays indicated that the tree shrew was considerably more resistant than the rat to AFB(1) hepatocarcinogenesis, which may reflect the significant differences in metabolic profiles of the two species.

  20. Stability of low concentrations of guanine-based antivirals in sucrose or maltitol solutions.


    Desai, D; Rao, V; Guo, H; Li, D; Bolgar, M


    Three guanine-based antiviral drugs, entecavir, lobucavir, and acyclovir showed degradation in presence of sucrose in ready-to-use solutions held at 50 degrees C, with more degradation at pH 4 than at pH 6 or 7. LC/MS analysis of the solutions showed isomeric adducts of the drugs and reducing sugars. Sucrose, a disaccharide and a non-reducing sugar, was the source of monosaccharides, the reducing sugars. Sucrose showed pH-dependent hydrolysis at 50 degrees C into two monosaccharides, fructose and glucose, with more sucrose hydrolyzing at pH 4 than pH 6 or 7. Additionally, the three drugs showed pH-dependent degradation at 50 degrees C in fructose and glucose solutions with the following rank order: pH 7>pH 6>pH 4. This indicated that the increased degradation of the drugs in sucrose solutions at pH 4 was mainly due to more hydrolysis of sucrose into fructose and glucose compared to pH 6 or 7, and subsequent reactions of the fructose and glucose with the drugs. Based on structures of the major degradants, it is proposed that the main cause of the degradation was nucleophilic addition of the primary amine group of the drugs to the carbonyl group of the fructose and glucose. This reaction was facilitated as the solution pH increased from 4 to 7. All the drugs showed satisfactory stability regardless of the storage temperature or solution pH in maltitol, an alternate sweetener. The free aldehyde or ketone group in maltitol precursors is reduced to a hydroxyl group after the hydrogenation process making maltitol less susceptible to nucleophilic addition.

  1. Giardia lamblia RNA cap guanine-N2 methyltransferase (Tgs2).


    Hausmann, Stéphane; Shuman, Stewart


    Tgs1 is the enzyme responsible for converting 7-methylguanosine RNA caps to the 2,2,7-trimethylguanosine cap structures of small nuclear and small nucleolar RNAs. Whereas budding yeast Saccharomyces cerevisiae and fission yeast Schizosaccharomyces pombe encode a single Tgs1 protein, the primitive eukaryote Giardia lamblia encodes two paralogs, Tgs1 and Tgs2. Here we show that purified Tgs2 is a monomeric enzyme that catalyzes methyl transfer from AdoMet (K(m) of 6 microm) to m(7)GDP (K(m) of 65 microm; k(cat) of 14 min(-1)) to form m(2,7)GDP. Tgs2 also methylates m(7)GTP (K(m) of 30 microm; k(cat) of 13 min(-1)) and m(7)GpppA (K(m) of 7 microm; k(cat)) of 14 min(-1) but is unreactive with GDP, GTP, GpppA, ATP, CTP, or UTP. We find that the conserved residues Asp-68, Glu-91, and Trp-143 are essential for Tgs2 methyltransferase activity in vitro. The m(2,7)GDP product formed by Tgs2 can be converted to m(2,2,7)GDP by S. pombe Tgs1 in the presence of excess AdoMet. However, Giardia Tgs2 itself is apparently unable to add a second methyl group at guanine-N2. This result implies that 2,2,7-trimethylguanosine caps in Giardia are either synthesized by Tgs1 alone or by the sequential action of Tgs2 and Tgs1. The specificity of Tgs2 raises the prospect that some Giardia mRNAs might contain dimethylguanosine caps.

  2. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    SciTech Connect

    Jett, J.


    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  3. Vacuum-Ultraviolet photoionization studies of the microhydrationof DNA bases (Guanine, Cytosine, Adenine and Thymine)

    SciTech Connect

    Belau, L.; Wilson, K.R.; Leone, S.R.; Musahid, Ahmed


    In this work, we report on a photoionization study of the microhydration of the four DNA bases. Gas-phase clusters of water with DNA bases [guanine (G), cytosine (C), adenine (A), and thymine (T)] are generated via thermal vaporization of the bases and expansion of the resultant vapor in a continuous supersonic jet expansion of water seeded in Ar. The resulting clusters are investigated by single-photon ionization with tunable vacuum-ultraviolet synchrotron radiation and mass analyzed using reflectron mass spectrometry. Photoionization efficiency (PIE) curves are recorded for the DNA bases and the following water (W) clusters: G, GW{sub n} (n = 1-3); C, CW{sub n} (n = 1-3); A, AW{sub n} (n = 1,2); and T, TW{sub n} (n = 1-3). Appearance energies (AE) are derived from the onset of these PIE curves (all energies in eV): G (8.1 {+-} 0.1), GW (8.0 {+-} 0.1), GW{sub 2} (8.0 {+-} 0.1), and GW{sub 3} (8.0); C (8.65 {+-} 0.05), CW (8.45 {+-} 0.05), CW{sub 2} (8.4 {+-} 0.1), and CW{sub 3} (8.3 {+-} 0.1); A (8.30 {+-} 0.05), AW (8.20 {+-} 0.05), and AW{sub 2} (8.1 {+-} 0.1); T (8.90 {+-} 0.05); and TW (8.75 {+-} 0.05), TW{sub 2} (8.6 {+-} 0.1), and TW{sub 3} (8.6 {+-} 0.1). The AEs of the DNA bases decrease slightly with the addition of water molecules (up to three) but do not converge to values found for photoinduced electron removal from DNA bases in solution.

  4. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    PubMed Central

    Altavilla, Salvatore F.; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state toward a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population toward the ground state and subsequent relaxation back to the FC region. PMID:25941671

  5. Spiroiminodihydantoin lesions derived from guanine oxidation: structures, energetics, and functional implications.


    Jia, Lei; Shafirovich, Vladimir; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse


    Reactive oxygen species present in the cell generate DNA damage. One of the major oxidation products of guanine in DNA, 8-oxo-7,8-dihydroguanine, formed by loss of two electrons, is among the most extensively studied base lesions. The further removal of two electrons from this product can yield spiroiminodihydantoin (Sp) R and S stereoisomers. Both in vitro and in vivo experiments have shown that the Sp stereoisomers are highly mutagenic, causing G --> T and G --> C transversions. Hence, they are of interest as examples of endogenous DNA damage that may initiate cancer. To interpret the mutagenic properties of the Sp lesions, an understanding of their structural properties is needed. To elucidate these structural effects, we have carried out computational investigations at the level of the Sp-modified base and nucleoside. At the base level, quantum mechanical geometry optimization studies have revealed exact mirror image symmetry of the R and S stereoisomers, with a near-perpendicular geometry of the two rings. At the nucleoside level, an extensive survey of the potential energy surface by molecular mechanics calculations using AMBER has provided three-dimensional potential energy maps. These maps reveal that the range and flexibility of the glycosidic torsion angles are significantly more restricted in both stereoisomeric adducts than in unmodified 2'-deoxyguanosine. The structural and energetic results suggest that the unusual geometric, steric, and hydrogen bonding properties of these lesions underlie their mutagenicity. In addition, stereoisomer-specific differences indicate the possibility that their processing by cellular replication and repair enzymes may be differentially affected by their absolute configuration.

  6. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus


    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  7. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.


    Crenshaw, Ezekiel; Leung, Brian P; Kwok, Chun Kit; Sharoni, Michal; Olson, Kalee; Sebastian, Neeraj P; Ansaloni, Sara; Schweitzer-Stenner, Reinhard; Akins, Michael R; Bevilacqua, Philip C; Saunders, Aleister J


    A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ) peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP). APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes), non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region) at residues 3008-3027 (NM_201414.2). This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  8. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    NASA Astrophysics Data System (ADS)

    Altavilla, Salvatore; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state towards a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population towards the ground state and subsequent relaxation back to the FC region.

  9. Regulation of innate immunity by extracellular nucleotides

    PubMed Central

    Gorini, Stefania; Gatta, Lucia; Pontecorvo, Laura; Vitiello, Laura; la Sala, Andrea


    Extracellular ATP (eATP) is the most abundant among extracellular nucleotides and is commonly considered as a classical danger signal, which stimulates immune responses in the presence of tissue injury. In fact, increased nucleotide concentration in the extracellular space is generally closely associated with tissue stress or damage. However non-lytic nucleotide release may also occur in many cell types under a variety of conditions. Extracellular nucleotides are sensed by a class of plasma membrane receptors called P2 purinergic receptors (P2Rs). P2 receptors are expressed by all immunological cells and their activation elicits different responses. Extracellular ATP can act as an initiator or terminator of immune responses being able to induce different effects on immune cells depending on the pattern of P2 receptors engaged, the duration of the stimulus and its concentration in the extracellular milieu. Millimolar (high) concentrations of extracellular ATP, induce predominantly proinflammatory effects, while micromolar (low) doses exert mainly tolerogenic/immunosuppressive action. Moreover small, but significant differences in the pattern of P2 receptor expression in mice and humans confer diverse capacities of ATP in regulating the immune response. PMID:23358447

  10. Quantification of 8-oxo-guanine and guanine as the nucleobase, nucleoside and deoxynucleoside forms in human urine by high-performance liquid chromatography-electrospray tandem mass spectrometry.


    Weimann, Allan; Belling, Dorthe; Poulsen, Henrik E


    Oxidative DNA damage, linked pathogenically to a variety of diseases such as cancer and ageing, can be investigated by measuring specific DNA repair products in urine. Within the last decade, since it was established that such products were excreted into urine, progress in their analysis in urine has been limited. Guanine is the DNA base most prone to oxidation. We present a method for determination of the urinary 8-hydroxylated species of guanine, based on direct injection of urine onto a high-performance liquid chromatography (HPLC)-tandem mass spectrometry system. The analysis covers the 8-hydroxylated base, ribonucleoside and deoxynucleoside, and the corresponding non-oxidised species. Without pre-treatment of urine the detection limits for the nucleobases are approximately 2 nM (50 fmol injected) and for the nucleosides approximately 0.5 nM (12.5 fmol injected). Previously, liquid chromatography of the nucleobases has been problematic but is made possible by low-temperature reverse-phase C18 chromatography, a method that increases retention on the column. In the case of the nucleosides, retention was almost total and provides a means for on-column concentration of larger urine samples and controlled high peak gradient elution. The total excretion of 8-hydroxylated guanine species was 212 nmol/24 h. The oxidised base accounted for 64%, the ribonucleoside for 23% and the deoxynucleoside for 13%, indicating substantial oxidation of RNA in humans. In rat urine, excretion of the oxidised base was more dominant, the percentages of the oxidised base, ribonucleoside and deoxynucleosides being 89, 8 and 3%. This finding is at odds with previous reports using immunoaffinity pre-purification and HPLC-electrochemical detection analysis. The developed method now makes it possible to measure oxidative nucleic acid stress to both RNA and DNA in epidemiological and intervention settings, and our findings indicate a substantial RNA oxidation in addition to DNA oxidation. The

  11. Induction of unique structural changes in guanine-rich DNA regions by the triazoloacridone C-1305, a topoisomerase II inhibitor with antitumor activities

    PubMed Central

    Lemke, Krzysztof; Wojciechowski, Marcin; Laine, William; Bailly, Christian; Colson, Pierre; Baginski, Maciej; Larsen, Annette K.; Skladanowski, Andrzej


    We recently reported that the antitumor triazoloacridone, compound C-1305, is a topoisomerase II poison with unusual properties. In this study we characterize the DNA interactions of C-1305 in vitro, in comparison with other topoisomerase II inhibitors. Our results show that C-1305 binds to DNA by intercalation and possesses higher affinity for GC- than AT-DNA as revealed by surface plasmon resonance studies. Chemical probing with DEPC indicated that C-1305 induces structural perturbations in DNA regions with three adjacent guanine residues. Importantly, this effect was highly specific for C-1305 since none of the other 22 DNA interacting drugs tested was able to induce similar structural changes in DNA. Compound C-1305 induced stronger structural changes in guanine triplets at higher pH which suggested that protonation/deprotonation of the drug is important for this drug-specific effect. Molecular modeling analysis predicts that the zwitterionic form of C-1305 intercalates within the guanine triplet, resulting in widening of both DNA grooves and aligning of the triazole ring with the N7 atoms of guanines. Our results show that C-1305 binds to DNA and induces very specific and unusual structural changes in guanine triplets which likely plays an important role in the cytotoxic and antitumor activity of this unique compound. PMID:16254080

  12. The role of topoisomerase I in suppressing genome instability associated with a highly transcribed guanine-rich sequence is not restricted to preventing RNA:DNA hybrid accumulation.


    Yadav, Puja; Owiti, Norah; Kim, Nayun


    Highly transcribed guanine-run containing sequences, in Saccharomyces cerevisiae, become unstable when topoisomerase I (Top1) is disrupted. Topological changes, such as the formation of extended RNA:DNA hybrids or R-loops or non-canonical DNA structures including G-quadruplexes has been proposed as the major underlying cause of the transcription-linked genome instability. Here, we report that R-loop accumulation at a guanine-rich sequence, which is capable of assembling into the four-stranded G4 DNA structure, is dependent on the level and the orientation of transcription. In the absence of Top1 or RNase Hs, R-loops accumulated to substantially higher extent when guanine-runs were located on the non-transcribed strand. This coincides with the orientation where higher genome instability was observed. However, we further report that there are significant differences between the disruption of RNase Hs and Top1 in regards to the orientation-specific elevation in genome instability at the guanine-rich sequence. Additionally, genome instability in Top1-deficient yeasts is not completely suppressed by removal of negative supercoils and further aggravated by expression of mutant Top1. Together, our data provide a strong support for a function of Top1 in suppressing genome instability at the guanine-run containing sequence that goes beyond preventing the transcription-associated RNA:DNA hybrid formation.

  13. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    SciTech Connect

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.


    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  14. Effect of x irradiation on the capacity of transfer RNA to act as substrate for guanine-tRNA transferase

    SciTech Connect

    Walden, T.; Farkas, W.R.


    Observation on the guanine-accepting ability of x-irradiated wheat germ tRNA shows 50% inactivation at 57,000 rad with an unusual sawtooth pattern at low doses. The sawtooth has peaks at 1330 and 3300 rad and can be modified by bovine serum albumin. RPC-5 profiles of guanylated irradiated and unirradiated tRNA are identical, indicating that irradiation does not result in abnormal tRNA species, that ordinarily are not substrates for this enzyme, becoming substrates.

  15. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids.


    Zanoni, Maria Valnice Boldrin; Rogers, Emma I; Hardacre, Christopher; Compton, Richard G


    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N(6,2,2,2)][N(Tf)(2)], 1-butyl-3-methylimidazolium hexafluorosphosphate [C(4)mim][PF(6)], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C(4)mpyrr][N(Tf)(2)], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C(4)mim][N(Tf)(2)], N-butyl-N-methyl-pyrrolidinium dicyanamide [C(4)mpyrr][N(NC)(2)] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P(14,6,6,6)][FAP] on a platinum microelectrode. In [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P(14,6,6,6)][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  16. Combined Monte Carlo and quantum mechanics study of the hydration of the guanine-cytosine base pair.


    Coutinho, Kaline; Ludwig, Valdemir; Canuto, Sylvio


    We present a computer simulation study of the hydration of the guanine-cytosine (GC) hydrogen-bonded complex. Using first principles density-functional theory, with gradient-corrected exchange-correlation and Monte Carlo simulation, we include thermal contribution, structural effects, solvent polarization, and the water-water and water-GC hydrogen bond interaction to show that the GC interaction in an aqueous environment is weakened to about 70% of the value obtained for an isolated complex. We also analyze in detail the preferred hydration sites of the GC pair and show that on the average it makes around five hydrogen bonds with water.

  17. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution

    SciTech Connect

    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi; Fujii, Kentaro; Yokoya, Akinari; Fukuda, Yoshihiro; Saitoh, Yuji


    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5{sup ′}-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5{sup ′}-monophosphate, and adenosine 5{sup ′}-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  18. Identification and Localization of the Cyclic Nucleotide Phosphodiesterase 10A in Bovine Testis and Mature Spermatozoa

    PubMed Central

    Goupil, Serge; Maréchal, Loïze; El Hajj, Hassan; Tremblay, Marie-Ève; Richard, François J.


    In mammals, adenosine 3’, 5’-cyclic monophosphate (cAMP) is known to play highly important roles in sperm motility and acrosomal exocytosis. It is known to act through protein phosphorylation via PRKA and through the activation of guanine nucleotide exchange factors like EPAC. Sperm intracellular cAMP levels depend on the activity of adenylyl cyclases, mostly SACY, though transmembrane-containing adenylyl cyclases are also present, and on the activity of cyclic nucleotide phosphodiesterases (PDE) whose role is to degrade cAMP into 5’-AMP. The PDE superfamily is subdivided into 11 families (PDE1 to 11), which act on either cAMP or cGMP, or on both cAMP and cGMP although with different enzymatic properties. PDE10, which is more effective on cAMP than cGMP, has been known for almost 15 years and is mostly studied in the brain where it is associated with neurological disorders. Although a high level of PDE10A gene expression is observed in the testis, information on the identity of the isoforms or on the cell type that express the PDE10 protein is lacking. The objective of this study was to identify the PDE10A isoforms expressed in the testis and germ cells, and to determine the presence and localization of PDE10A in mature spermatozoa. As a sub-objective, since PDE10A transcript variants were reported strictly through analyses of bovine genomic sequence, we also wanted to determine the nucleotide and amino acid sequences by experimental evidence. Using RT-PCR, 5’- and 3’-RACE approaches we clearly show that PDE10A transcript variants X3 and X5 are expressed in bovine testis as well as in primary spermatocytes and spermatids. We also reveal using a combination of immunological techniques and proteomics analytical tools that the PDE10A isoform X4 is present in the area of the developing acrosome of spermatids and of the acrosome of mature spermatozoa. PMID:27548062

  19. Proton transfer in guanine-cytosine radical anion embedded in B-form DNA.


    Chen, Hsing-Yin; Kao, Chai-Lin; Hsu, Sodio C N


    The electron-attachment-induced proton transfer in the guanine-cytosine (G:C) base pair is thought to be relevant to the issues of charge transport and radiation damage in DNA. However, our understanding on the reaction mainly comes from the data of isolated bases and base pairs, and the behavior of the reaction in the DNA duplex is not clear. In the present study, the proton-transfer reaction in reduced G:C stacks is investigated by quantum mechanical calculations with the aim to clarify how each environmental factor affects the proton transfer in G:C(*-). The calculations show that while the proton transfer in isolated G:C(*-) is exothermic with a small energetic barrier, it becomes endothermic with a considerably enhanced energetic barrier in G:C stacks. The substantial effect of G:C stacking is proved to originate from the electrostatic interactions between the dipole moments of outer G:C base pairs and the middle G:C(*-) base-pair radical anion; the extent of charge delocalization is very small and plays little role in affecting the proton transfer in G:C(*-). On the basis of the electrostatic model, the sequence dependence of the proton transfer in the ionized G:C base pair is predicted. In addition, the water molecules in the first hydration shell around G:C(*-) display a pronounced effect that facilitates the proton-transfer reaction; further consideration of bulk hydration only slightly lowers the energetic barrier and reaction energy. We also notice that the water arrangement around an embedded G:C(*-) is different from that around an isolated G:C(*-), which could result in a very different solvent effect on the energetics of the proton transfer. In contrast to the important influences of base stacking and hydration, the effects of sugar-phosphate backbone and counterions are found to be minor. Our calculations also reveal that a G:C base pair embedded in DNA is capable of accommodating two excess electrons only in bulk hydration; the resultant G(N1-H

  20. Benchmark Theoretical and Experimental Study on (15)N NMR Shifts of Oxidatively Damaged Guanine.


    Dračínský, Martin; Šála, Michal; Klepetářová, Blanka; Šebera, Jakub; Fukal, Jiří; Holečková, Veronika; Tanaka, Yoshiyuki; Nencka, Radim; Sychrovský, Vladimír


    The (15)N NMR shifts of 9-ethyl-8-oxoguanine (OG) were calculated and measured in liquid DMSO and in crystal. The OG molecule is a model for oxidatively damaged 2'-deoxyguanosine that occurs owing to oxidative stress in cell. The DNA lesion is repaired with human 8-oxoguanine glycosylase 1 (hOGG1) base-excision repair enzyme, however, the exact mechanism of excision of damaged nucleobase with hOGG1 is currently unknown. This benchmark study on (15)N NMR shifts of OG aims their accurate structural interpretation and calibration of the calculation protocol utilizable in future studies on mechanism of hOGG1 enzyme. The effects of NMR reference, DFT functional, basis set, solvent, structure, and dynamics on calculated (15)N NMR shifts were first evaluated for OG in crystal to calibrate the best performing calculation method. The effect of large-amplitude motions on (15)N NMR shifts of OG in liquid was calculated employing molecular dynamics. The B3LYP method with Iglo-III basis used for B3LYP optimized geometry with 6-311++G(d,p) basis and including effects of solvent and molecular dynamic was the calculation protocol used for calculation of (15)N NMR shifts of OG. The NMR shift of N9 nitrogen of OG was particularly studied because the atom is involved in an N-glycosidic bond that is cleaved with hOGG1. The change of N9 NMR shift owing to oxidation of 9-ethylguanine (G) measured in liquid was -27.1 ppm. The calculated N9 NMR shift of OG deviated from experiment in crystal and in liquid by 0.45 and 0.65 ppm, respectively. The calculated change of N9 NMR shift owing to notable N9-pyramidalization of OG in one previously found polymorph was 20.53 ppm. We therefore assume that the pyramidal geometry of N9 nitrogen that could occur for damaged DNA within hOGG1 catalytic site might be detectable with (15)N NMR spectroscopy. The calculation protocol can be used for accurate structural interpretation of (15)N NMR shifts of oxidatively damaged guanine DNA residue.

  1. Simultaneous protection of organic p- and n-channels in complementary inverter from aging and bias-stress by DNA-base guanine/Al2O3 double layer.


    Lee, Junyeong; Hwang, Hyuncheol; Min, Sung-Wook; Shin, Jae Min; Kim, Jin Sung; Jeon, Pyo Jin; Lee, Hee Sung; Im, Seongil


    Although organic field-effect transistors (OFETs) have various advantages of lightweight, low-cost, mechanical flexibility, and nowadays even higher mobility than amorphous Si-based FET, stability issue under bias and ambient condition critically hinder its practical application. One of the most detrimental effects on organic layer comes from penetrated atmospheric species such as oxygen and water. To solve such degradation problems, several molecular engineering tactics are introduced: forming a kinetic barrier, lowering the level of molecule orbitals, and increasing the band gap. However, direct passivation of organic channels, the most promising strategy, has not been reported as often as other methods. Here, we resolved the ambient stability issues of p-type (heptazole)/or n-type (PTCDI-C13) OFETs and their bias-stability issues at once, using DNA-base small molecule guanine (C5H5N5O)/Al2O3 bilayer. The guanine protects the organic channels as buffer/and H getter layer between the channels and capping Al2O3, whereas the oxide capping resists ambient molecules. As a result, both p-type and n-type OFETs are simultaneously protected from gate-bias stress and 30 days-long ambient aging, finally demonstrating a highly stable, high-gain complementary-type logic inverter.

  2. Nucleotide sequence of papaya mosaic virus RNA.


    Sit, T L; Abouhaidar, M G; Holy, S


    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  3. Radiation and thermal stabilities of adenine nucleotides.


    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I


    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  4. Evolution of functional six-nucleotide DNA.


    Zhang, Liqin; Yang, Zunyi; Sefah, Kwame; Bradley, Kevin M; Hoshika, Shuichi; Kim, Myong-Jung; Kim, Hyo-Joong; Zhu, Guizhi; Jiménez, Elizabeth; Cansiz, Sena; Teng, I-Ting; Champanhac, Carole; McLendon, Christopher; Liu, Chen; Zhang, Wen; Gerloff, Dietlind L; Huang, Zhen; Tan, Weihong; Benner, Steven A


    Axiomatically, the density of information stored in DNA, with just four nucleotides (GACT), is higher than in a binary code, but less than it might be if synthetic biologists succeed in adding independently replicating nucleotides to genetic systems. Such addition could also add functional groups not found in natural DNA, but useful for molecular performance. Here, we consider two new nucleotides (Z and P, 6-amino-5-nitro-3-(1'-β-D-2'-deoxyribo-furanosyl)-2(1H)-pyridone and 2-amino-8-(1'-β-D-2'-deoxyribofuranosyl)-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one). These are designed to pair via complete Watson-Crick geometry. These were added to a library of oligonucleotides used in a laboratory in vitro evolution (LIVE) experiment; the GACTZP library was challenged to deliver molecules that bind selectively to liver cancer cells, but not to untransformed liver cells. Unlike in classical in vitro selection, low levels of mutation allow this system to evolve to create binding molecules not necessarily present in the original library. Over a dozen binding species were recovered. The best had Z and/or P in their sequences. Several had multiple, nearby, and adjacent Zs and Ps. Only the weaker binders contained no Z or P at all. This suggests that this system explored much of the sequence space available to this genetic system and that GACTZP libraries are richer reservoirs of functionality than standard libraries.

  5. Nucleotide excision repair in Escherichia coli.

    PubMed Central

    Van Houten, B


    One of the best-studied DNA repair pathways is nucleotide excision repair, a process consisting of DNA damage recognition, incision, excision, repair resynthesis, and DNA ligation. Escherichia coli has served as a model organism for the study of this process. Recently, many of the proteins that mediate E. coli nucleotide excision have been purified to homogeneity; this had led to a molecular description of this repair pathway. One of the key repair enzymes of this pathway is the UvrABC nuclease complex. The individual subunits of this enzyme cooperate in a complex series of partial reactions to bind to and incise the DNA near a damaged nucleotide. The UvrABC complex displays a remarkable substrate diversity. Defining the structural features of DNA lesions that provide the specificity for damage recognition by the UvrABC complex is of great importance, since it represents a unique form of protein-DNA interaction. Using a number of in vitro assays, researchers have been able to elucidate the action mechanism of the UvrABC nuclease complex. Current research is devoted to understanding how these complex events are mediated within the living cell. PMID:2181258

  6. [Nucleotide receptors in learning and neuronal plasticity].


    Czajkowski, Rafał


    Nucleotide signalling plays an important role in neuronal plasticity and learning. Nucleotides are released at the synaptic terminals and may act pre- and postsynaptically by activating Pland P2 receptors. The A1 receptor, activated tonically by resting concentration of adenosine regulates basal neurotransmission. The A2A receptor is activated by increased adenosine levels and participates in plastic changes. ATP may act as an independent neurotransmitter on the P2X1 receptor, or via P2X3 subtype as a neuromodulator that affects NMDA receptor signalling. The G protein coupled P2Y receptors also evoke neuromodulatory effect on the neuronal plasticity, inhibiting LTD in prefrontal cortex. P2X7 receptor is responsible for communication between astrocytes and for synchronizing their activity. ATP and adenosine released by astrocytes act as neuromodulators both at the release site and heterosynaptically. Taken together, these multiple actions of nucleotides constitute a mechanism regulating homeostatic processes that are necessary for proper brain functioning: synaptic scaling and metaplasticity.

  7. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    SciTech Connect

    Shin, Joong-Won; Bernstein, Elliot R.


    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  8. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.


    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  9. Mutagenic effects induced by the attack of NO2 radical to the guanine-cytosine base pair

    PubMed Central

    Cerón-Carrasco, José P.; Requena, Alberto; Zúñiga, José; Jacquemin, Denis


    We investigate the attack of the nitrogen dioxide radical (NO•2) to the guanine—cytosine (GC) base pair and the subsequent tautomeric reactions able to induce mutations, by means of density functional theory (DFT) calculations. The conducted simulations allow us to identify the most reactive sites of the GC base pair. Indeed, the computed relative energies demonstrate that the addition of the NO•2 radical to the C8 position of the guanine base forms to the most stable adduct. Although the initial adducts might evolve to non-canonical structures via inter-base hydrogen bonds rearrangements, the probability for the proton exchange to occur lies in the same range as that observed for undamaged DNA. As a result, tautomeric errors in NO2-attacked DNA arises at the same rate as in canonical DNA, with no macroscopic impact on the overall stability of DNA. The potential mutagenic effects of the GC–NO•2 radical adducts likely involve side reactions, e.g., the GC deprotonation to the solvent, rather than proton exchange between guanine and cytosine basis. PMID:25798437

  10. Quadruplexes of human telomere dG{sub 3}(TTAG{sub 3}){sub 3} sequences containing guanine abasic sites

    SciTech Connect

    Skolakova, Petra; Bednarova, Klara; Vorlickova, Michaela; Sagi, Janos


    Research highlights: {yields} Loss of a guanine base does not hinder the formation of G-quadruplex of human telomere sequence. {yields} Each depurination strongly destabilizes the quadruplex of dG{sub 3}(TTAG{sub 3}){sub 3} in NaCl and KCl. {yields} Conformational change of the abasic analogs of dG{sub 3}(TTAG{sub 3}){sub 3} is inhibited in KCl. {yields} The effects abasic sites may affect telomere-end structures in vivo. -- Abstract: This study was performed to evaluate how the loss of a guanine base affects the structure and stability of the three-tetrad G-quadruplex of 5'-dG{sub 3}(TTAG{sub 3}){sub 3}, the basic quadruplex-forming unit of the human telomere DNA. None of the 12 possible abasic sites hindered the formation of quadruplexes, but all reduced the thermodynamic stability of the parent quadruplex in both NaCl and KCl. The base loss did not change the Na{sup +}-stabilized intramolecular antiparallel architecture, based on CD spectra, but held up the conformational change induced in dG{sub 3}(TTAG{sub 3}){sub 3} in physiological concentration of KCl. The reduced stability and the inhibited conformational transitions observed here in vitro for the first time may predict that unrepaired abasic sites in G-quadruplexes could lead to changes in the chromosome's terminal protection in vivo.

  11. Constructing a novel 8-hydroxy-2'-deoxyguanosine electrochemical sensor and application in evaluating the oxidative damages of DNA and guanine.


    Guo, Zhipan; Liu, Xiuhui; Liu, Yuelin; Wu, Guofan; Lu, Xiaoquan


    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is commonly identified as a biomarker of oxidative DNA damage. In this work, a novel and facile 8-OHdG sensor was developed based on the multi-walled carbon nanotubes (MWCNTs) modified glassy carbon electrode (GCE). It exhibited good electrochemical responses toward the oxidation of 8-OHdG, and the linear ranges were 5.63×10(-8)-6.08×10(-6)M and 6.08×10(-6)-1.64×10(-5)M, with the detection limit of 1.88×10(-8)M (S/N=3). Moreover, the fabricated sensor was applied for the determination of 8-OHdG generated from damaged DNA and guanine, respectively, and the oxidation currents of 8-OHdG increased along with the damaged DNA and guanine within certain concentrations. These results could be used to evaluate the DNA damage, and provide useful information on diagnosing diseases caused by mutation and deficiency of the immunity system.

  12. The Role of Aspartic Acid 143 in E. coli tRNA-Guanine Transglycosylase: Insights from Mutagenesis Studies and Computational Modeling

    PubMed Central

    Todorov, Katherine Abold; Tan, Xiao-Jian; Nonekowski, Susanne T.; Garcia, George A.; Carlson, Heather A.


    tRNA guanine transglycosylase (TGT) is a tRNA-modifying enzyme which catalyzes the posttranscriptional exchange of guanine in position 34 of tRNAY,H,N,D with the modified base queuine in eukaryotes or its precursor, preQ1 base, in eubacteria. Thus, TGT must recognize the guanine in tRNA and the free base queuine or preQ1 to catalyze this exchange. The crystal structure of Zymomonas mobilis TGT with preQ1 bound suggests that a key aspartate is critically involved in substrate recognition. To explore this, a series of site-directed mutants of D143 in Escherichia coli TGT were made and characterized to investigate heterocyclic substrate recognition. Our data confirm that D143 has significant impact on KM of guanine; however, the trend in the KM data (D143A < D143N < D143S < D143T) is unexpected. Computational studies were used to further elucidate the interactions between guanine and the D143 mutants. A homology model of E. coli TGT was created, and the role of D143 was investigated by molecular dynamic simulations of guanine bound to the wild-type and D143-mutant TGTs. To validate the model systems against our kinetic data, free energies of binding were fit using the linear interaction energy (LIE) method. This is a unique application of the LIE method because the same ligand is bound to several mutant proteins rather than one protein binding several ligands. The atomic detail gained from the simulations provided a better understanding of the binding affinities of guanine with the mutant TGTs, revealing that water molecules enter the active site and hydrogen bond to the ligand and compensate for lost protein-ligand interactions. The trend of binding affinity for wild-type > D143A > D143N > D143S > D143T appears to be directly related to the degree of hydrogen bonding available to guanine in the binding site. PMID:15951383

  13. HPLC purification of RNA aptamers up to 59 nucleotides with single-nucleotide resolution.


    Huang, Zhen; Lin, Chi-Yen; Jaremko, William; Niu, Li


    An RNA sample is usually heterogeneous. RNA heterogeneity refers to difference in length or size (i.e., number of nucleotides [nt]), sequence, or alternative but coexisting conformations. Separation and purification of RNA is generally required for investigating the structure and function of RNA, such as RNA catalysis and RNA structure determination by nuclear magnetic resonance or crystallography. Separation and purification of RNA is also required for using RNAs as functional probes and therapeutics as well as building blocks for RNA nanoparticles. Previously established protocols are limited in separating RNAs longer than 25 nt by single-nucleotide resolution. When the length of RNAs becomes longer, single-nucleotide separation of RNAs becomes more challenging. Here we describe protocols, by the use of ion-pair, reverse-phase high-performance liquid chromatography (HPLC), to extend our ability to separate regular RNAs up to 59 nt with single-nucleotide resolution. For chemically modified RNAs at 2' positions on the ribose, we can resolve RNAs of similar sizes even with a 26 Da difference. This is much less than 320 Da, an average single-nucleotide molecular weight difference.

  14. Escherichia coli MutY protein has a guanine-DNA glycosylase that acts on 7,8-dihydro-8-oxoguanine:guanine mispair to prevent spontaneous G:C-->C:G transversions.


    Zhang, Q M; Ishikawa, N; Nakahara, T; Yonei, S


    Low rates of spontaneous G:C-->C:G transversions would be achieved not only by the correction of base mismatches during DNA replication but also by the prevention and removal of oxidative base damage in DNA. Escherichia coli must have several pathways to repair such mismatches and DNA modifications. In this study, we attempted to identify mutator loci leading to G:C-->C:G transversions in E.coli. The strain CC103 carrying a specific mutation in lacZ was mutagenized by random miniTn 10 insertion mutagenesis. In this strain, only the G:C-->C:G change can revert the glutamic acid at codon 461, which is essential for sufficient beta-galactosidase activity to allow growth on lactose. Mutator strains were detected as colonies with significantly increased rates of papillae formation on glucose minimal plates containing P-Gal and X-Gal. We screened approximately 40 000 colonies and selected several mutator strains. The strain GC39 showed the highest mutation rate to Lac+. The gene responsible for the mutator phenotypes, mut39 , was mapped at around 67 min on the E.coli chromosome. The sequencing of the miniTn 10 -flanking DNA region revealed that the mut39 was identical to the mutY gene of E.coli. The plasmid carrying the mutY + gene reduced spontaneous G:C-->T:A and G:C-->C:G mutations in both mutY and mut39 strains. Purified MutY protein bound to the oligonucleotides containing 7,8-dihydro-8-oxo-guanine (8-oxoG):G and 8-oxoG:A. Furthermore, we found that the MutY protein had a DNA glycosylase activity which removes unmodified guanine from the 8-oxoG:G mispair. These results demonstrate that the MutY protein prevents the generation of G:C-->C:G transversions by removing guanine from the 8-oxoG:G mispair in E.coli.

  15. Nucleotide sequence alignment using sparse coding and belief propagation.


    Roozgard, Aminmohammad; Barzigar, Nafise; Wang, Shuang; Jiang, Xiaoqian; Ohno-Machado, Lucila; Cheng, Samuel


    Advances in DNA information extraction techniques have led to huge sequenced genomes from organisms spanning the tree of life. This increasing amount of genomic information requires tools for comparison of the nucleotide sequences. In this paper, we propose a novel nucleotide sequence alignment method based on sparse coding and belief propagation to compare the similarity of the nucleotide sequences. We used the neighbors of each nucleotide as features, and then we employed sparse coding to find a set of candidate nucleotides. To select optimum matches, belief propagation was subsequently applied to these candidate nucleotides. Experimental results show that the proposed approach is able to robustly align nucleotide sequences and is competitive to SOAPaligner [1] and BWA [2].

  16. In Vitro Selection Using Modified or Unnatural Nucleotides

    PubMed Central

    Stovall, Gwendolyn M.; Bedenbaugh, Robert S.; Singh, Shruti; Meyer, Adam J.; Hatala, Paul J.; Ellington, Andrew D.; Hall, Bradley


    Incorporation of modified nucleotides into in vitro RNA or DNA selections offer many potential advantages, such as the increased stability of selected nucleic acids against nuclease degradation, improved affinities, expanded chemical functionality, and increased library diversity. This unit provides useful information and protocols for in vitro selection using modified nucleotides. It includes a discussion of when to use modified nucleotides; protocols for evaluating and optimizing transcription reactions, as well as confirming the incorporation of the modified nucleotides; protocols for evaluating modified nucleotide transcripts as template in reverse transcription reactions; protocols for the evaluation of the fidelity of modified nucleotides in the replication and the regeneration of the pool; and a protocol to compare modified nucleotide pools and selection conditions. PMID:25606981

  17. Formation of Amino Acids and Nucleotide Bases in a Titan Atmosphere Simulation Experiment

    PubMed Central

    Yelle, R.V.; Buch, A.; Carrasco, N.; Cernogora, G.; Dutuit, O.; Quirico, E.; Sciamma-O'Brien, E.; Smith, M.A.; Somogyi, Á.; Szopa, C.; Thissen, R.; Vuitton, V.


    Abstract The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N2/CH4/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C4H5N3O, C4H4N2O2, C5H6N2O2, C5H5N5, and C6H9N3O2 are produced by chemistry in the simulation chamber. Gas chromatography–mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C4H5N3O), uracil (C5H4N2O2), thymine (C5H6N2O2), guanine (C5H5N5O), glycine (C2H5NO2), and alanine (C3H7NO2). Adenine (C5H5N5) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin. Key Words: Astrochemistry—Planetary atmospheres—Titan—Astrobiology. Astrobiology 12, 809–817. PMID:22917035

  18. Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment.


    Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V


    The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

  19. Guanyl Nucleotide Exchange Factor Sql2 and Ras2 Regulate Filamentous Growth in Ustilago maydis

    PubMed Central

    Müller, Philip; Katzenberger, Jörg D.; Loubradou , Gabriel; Kahmann, Regine


    The cyclic AMP (cAMP)-signaling pathway regulates cell morphology and plays a crucial role during pathogenic development of the plant-pathogenic fungus Ustilago maydis. Strains lacking components of this signaling pathway, such as the Gα-subunit Gpa3 or the adenylyl cyclase Uac1, are nonpathogenic and grow filamentously. On the other hand, strains exhibiting an activated cAMP pathway due to a dominant-active allele of gpa3 display a glossy colony phenotype and are unable to proliferate in plant tumors. Here we present the identification of sql2 as a suppressor of the glossy colony phenotype of a gpa3Q206L strain. sql2 encodes a protein with similarity to CDC25-like guanine nucleotide exchange factors, which are known to act on Ras proteins. Overexpression of sql2 leads to filamentous growth that cannot be suppressed by exogenous cAMP, suggesting that Sql2 does not act upstream of Uac1. To gain more insight in signaling processes regulated by Sql2, we isolated two genes encoding Ras proteins. Expression of dominant active alleles of ras1 and ras2 showed that Ras2 induces filamentous growth while Ras1 does not affect cell morphology but elevates pheromone gene expression. These results indicate that Ras1 and Ras2 fulfill different functions in U. maydis. Moreover, observed similarities between the filaments induced by sql2 and ras2 suggest that Sql2 is an activator of Ras2. Interestingly, sql2 deletion mutants are affected in pathogenic development but not in mating, indicating a specific function of sql2 during pathogenesis. PMID:12796306

  20. Evaluation of the flanking nucleotide sequences of sarcomeric hypertrophic cardiomyopathy substitution mutations.


    Meurs, Kathryn M; Mealey, Katrina L


    Hypertrophic cardiomyopathy (HCM) is a familial myocardial disease with a prevalence of 1 in 500. More than 400 causative mutations have been identified in 13 sarcomeric and myofilament related genes, 350 of these are substitution mutations within eight sarcomeric genes. Within a population, examples of recurring identical disease causing mutations that appear to have arisen independently have been noted as well as those that appear to have been inherited from a common ancestor. The large number of novel HCM mutations could suggest a mechanism of increased mutability within the sarcomeric genes. The objective of this study was to evaluate the most commonly reported HCM genes, beta myosin heavy chain (MYH7), myosin binding protein C, troponin I, troponin T, cardiac regulatory myosin light chain, cardiac essential myosin light chain, alpha tropomyosin and cardiac alpha-actin for sequence patterns surrounding the substitution mutations that may suggest a mechanism of increased mutability. The mutations as well as the 10 flanking nucleotides were evaluated for frequency of di-, tri- and tetranucleotides containing the mutation as well as for the presence of certain tri- and tetranculeotide motifs. The most common substitutions were guanine (G) to adenine (A) and cytosine (C) to thymidine (T). The CG dinucleotide had a significantly higher relative mutability than any other dinucleotide (p<0.05). The relative mutability of each possible trinucleotide and tetranucleotide sequence containing the mutation was calculated; none were at a statistically higher frequency than the others. The large number of G to A and C to T mutations as well as the relative mutability of CG may suggest that deamination of methylated CpG is an important mechanism for mutation development in at least some of these cardiac genes.

  1. Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

    SciTech Connect

    Benasutti, M.; Ejadi, S.; Whitlow, M.D.; Loechler, E.L.


    The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines in some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.

  2. The Shizosaccharomyces pombe homolog (SpMYH) of the Escherichia coli MutY is required for removal of guanine from 8-oxoguanine/guanine mispairs to prevent G:C to C:G transversions.


    Doi, Takashi; Yonekura, Shin-Ichiro; Tano, Keizo; Yasuhira, Shinji; Yonei, Shuji; Zhang, Qiu-Mei


    The frequency of G:C-->C:G transversions significantly increases upon exposure of cells to ionizing radiation or reactive oxygen species. Transversions can be prevented by base excision repair, which removes the causative modified bases from DNA. Our previous studies revealed that MutY is responsible for removing guanine from 7,8-dihydro-8-oxoguanine/guanine mispairs (8-oxoG/G) and prevents the generation of G:C-->C:G transversions in E. coli. SpMYH, a homolog of E. coli MutY, had been identified and characterized in the fission yeast S. pombe. Purified SpMYH has adenine DNA glycosylase activity on A/8-oxoG and A/G mismatch-containing oligonucleotides. In this study, we examined whether SpMYH has a similar activity allowing it to remove G from 8-oxoG/G in DNA. The purified SpMYH tightly bound to duplex oligonucleotides containing 8-oxoG/G and removed the unmodified G from 8-oxoG/G as efficiently as A from 8-oxoG/A. The activity was absent in the cell extract prepared from an SpMYH-knockout strain of S. pombe. The expression of SpMYH markedly reduced the frequency of spontaneous G:C-->C:G transversions in the E. coli mutY mutant. These results demonstrate that SpMYH is involved in the repair of 8-oxoG/G, by which it prevents mutations induced by oxidative stress in S. pombe.

  3. Estimation of evolutionary distances between nucleotide sequences.


    Zharkikh, A


    A formal mathematical analysis of the substitution process in nucleotide sequence evolution was done in terms of the Markov process. By using matrix algebra theory, the theoretical foundation of Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) and Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984) methods was provided. Extensive computer simulation was used to compare the accuracy and effectiveness of various methods for estimating the evolutionary distance between two nucleotide sequences. It was shown that the multiparameter methods of Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984), Gojobori et al.'s (J. Mol. Evol. 18:414-422, 1982), and Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) are preferable to others for the purpose of phylogenetic analysis when the sequences are long. However, when sequences are short and the evolutionary distance is large, Tajima and Nei's (Mol. Biol. Evol. 1:269-285, 1984) method is superior to others.

  4. Cyclic nucleotide imaging and cardiovascular disease.


    Berisha, Filip; Nikolaev, Viacheslav O


    The universal second messengers cyclic nucleotides 3',5'-cyclic adenosine monophosphate (cAMP) and 3',5'-cyclic guanosine monophosphate (cGMP) play central roles in cardiovascular function and disease. They act in discrete, functionally relevant subcellular microdomains which regulate, for example, calcium cycling and excitation-contraction coupling. Such localized cAMP and cGMP signals have been difficult to measure using conventional biochemical techniques. Recent years have witnessed the advent of live cell imaging techniques which allow visualization of these functionally relevant second messengers with unprecedented spatial and temporal resolution at cellular, subcellular and tissue levels. In this review, we discuss these new imaging techniques and give examples how they are used to visualize cAMP and cGMP in physiological and pathological settings to better understand cardiovascular function and disease. Two primary techniques include the use of Förster resonance energy transfer (FRET) based cyclic nucleotide biosensors and nanoscale scanning ion conductance microscopy (SICM). These methods can provide deep mechanistic insights into compartmentalized cAMP and cGMP signaling.

  5. Variance estimation for nucleotide substitution models.


    Chen, Weishan; Wang, Hsiuying


    The current variance estimators for most evolutionary models were derived when a nucleotide substitution number estimator was approximated with a simple first order Taylor expansion. In this study, we derive three variance estimators for the F81, F84, HKY85 and TN93 nucleotide substitution models, respectively. They are obtained using the second order Taylor expansion of the substitution number estimator, the first order Taylor expansion of a squared deviation and the second order Taylor expansion of a squared deviation, respectively. These variance estimators are compared with the existing variance estimator in terms of a simulation study. It shows that the variance estimator, which is derived using the second order Taylor expansion of a squared deviation, is more accurate than the other three estimators. In addition, we also compare these estimators with an estimator derived by the bootstrap method. The simulation shows that the performance of this bootstrap estimator is similar to the estimator derived by the second order Taylor expansion of a squared deviation. Since the latter one has an explicit form, it is more efficient than the bootstrap estimator.

  6. A Transient Interaction between the Phosphate Binding Loop and Switch I Contributes to the Allosteric Network between Receptor and Nucleotide in Gαi1*

    PubMed Central

    Thaker, Tarjani M.; Sarwar, Maruf; Preininger, Anita M.; Hamm, Heidi E.; Iverson, T. M.


    Receptor-mediated activation of the Gα subunit of heterotrimeric G proteins requires allosteric communication between the receptor binding site and the guanine nucleotide binding site, which are separated by >30 Å. Structural changes in the allosteric network connecting these sites are predicted to be transient in the wild-type Gα subunit, making studies of these connections challenging. In the current work, site-directed mutants that alter the energy barriers between the activation states are used as tools to better understand the transient features of allosteric signaling in the Gα subunit. The observed differences in relative receptor affinity for intact Gαi1 subunits versus C-terminal Gαi1 peptides harboring the K345L mutation are consistent with this mutation modulating the allosteric network in the protein subunit. Measurement of nucleotide exchange rates, affinity for metarhodopsin II, and thermostability suggest that the K345L Gαi1 variant has reduced stability in both the GDP-bound and nucleotide-free states as compared with wild type but similar stability in the GTPγS-bound state. High resolution x-ray crystal structures reveal conformational changes accompanying the destabilization of the GDP-bound state. Of these, the conformation for Switch I was stabilized by an ionic interaction with the phosphate binding loop. Further site-directed mutagenesis suggests that this interaction between Switch I and the phosphate binding loop is important for receptor-mediated nucleotide exchange in the wild-type Gαi1 subunit. PMID:24596087

  7. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    PubMed Central

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  8. Molecular dynamics simulations reveal the balance of forces governing the formation of a guanine tetrad—a common structural unit of G-quadruplex DNA

    PubMed Central

    Kogut, Mateusz; Kleist, Cyprian; Czub, Jacek


    G-quadruplexes (G4) are nucleic acid conformations of guanine-rich sequences, in which guanines are arranged in the square-planar G-tetrads, stacked on one another. G4 motifs form in vivo and are implicated in regulation of such processes as gene expression and chromosome maintenance. The structure and stability of various G4 topologies were determined experimentally; however, the driving forces for their formation are not fully understood at the molecular level. Here, we used all-atom molecular dynamics to probe the microscopic origin of the G4 motif stability. By computing the free energy profiles governing the dissociation of the 3′-terminal G-tetrad in the telomeric parallel-stranded G4, we examined the thermodynamic and kinetic stability of a single G-tetrad, as a common structural unit of G4 DNA. Our results indicate that the energetics of guanine association alone does not explain the overall stability of the G-tetrad and that interactions involving sugar–phosphate backbone, in particular, the constrained minimization of the phosphate–phosphate repulsion energy, are crucial in providing the observed enthalpic stabilization. This enthalpic gain is largely compensated by the unfavorable entropy change due to guanine association and optimization of the backbone topology. PMID:26980278

  9. Metal-organic frameworks and β-cyclodextrin-based composite electrode for simultaneous quantification of guanine and adenine in a lab-on-valve manifold.


    Wang, Yang; Chen, Huanhuan; Wu, Yichun; Ge, Huali; Ye, Guiqin; Hu, Xiaoya


    In this work, a novel chemically modified electrode is constructed based on metal-organic frameworks and β-cyclodextrin (Cu3(BTC)2/β-CD, BTC = benzene-1,3,5-tricarboxylate) composite material. The electrode was used for simultaneous determination of guanine and adenine in a sequential injection lab-on-valve format and exhibited sensitive responses to guanine and adenine oxidation due to the π-π stacking interaction of Cu3(BTC)2 and the inclusion behavior of β-CD. The analytical performance was assessed with respect to the supporting electrolyte and its pH, accumulation time and accumulation potential, and the fluid flow rates. Under optimal conditions, linear calibration ranges for both guanine and adenine were from 1.0 × 10(-7) to 1.0 × 10(-5) mol L(-1), and detection limits (S/N = 3) were found to be 5.2 × 10(-8) and 2.8 × 10(-8) mol L(-1), respectively. The proposed sensor showed advantages of high sensitivity, simple sample preparation protocol, enhanced throughput and good reproducibility. Finally, the practical application of the proposed sensor has been performed for the determination of guanine and adenine in real samples with satisfactory results.

  10. Major and minor groove conformations of DNA trimers modified on guanine or adenine by 4-aminobiphenyl: Adenine adducts favor the minor groove

    SciTech Connect

    Shapiro, R.; Ellis, S.; Hingerty, B.E.


    We have studied the conformational effects of 4-aminobiphenyl modification at C-8 of guanine or adenine on double-stranded DNA trimers. We used sequences with the modified purine at the central base pair and all 16 possible neighboring sequences at the outer pairs. Minimized potential energy calculations were carried out using the molecular mechanics program DUPLEX to survey the conformation space of these adducts, using a total of 1280 starting structures both in the modified guanine series and in the modified adenine series. Conformer families in which the bound 4-aminobiphenyl was located in the DNA major groove, and in the minor groove, were located for both adenine and guanine modification. In the modified guanine series, the major and minor groove families were roughly comparable in energy, and the sequence context determined which was more stable in a particular case. In the modified adenine series, however, the minor groove structure was more that 10 kcal/mol more stable than the major groove for all sequences. As a result, minor groove adducts provided most of the global minima in the adenine-modified series. This result may be relevant to a previous mutagenesis study [Lasko et al. (1988) J. Biol. Chem. 263, 15429-15435] in which the hot spot of most frequent occurrence was located at an adenine, in the sequence GAT. 25 refs., 9 figs., 4 tabs.

  11. Stability of guanine adsorbed in a clay mineral under gamma irradiation at temperatures (77 and 298 K): Implications for chemical evolution studies

    NASA Astrophysics Data System (ADS)

    Meléndez-López, A. L.; Ramos-Bernal, S.; Ramírez-Vázquez, M. L.


    Chemical evolution is a physical and chemical preamble prior the appearance of life. In these processes, clay minerals might have played an important role on the early Earth. The relevance of these solids in the emergence of life is due to their ancient origin, wide distribution, and especially, their physico-chemical properties. Clays, therefore, are considered the most likely inorganic materials to promote organic reactions in the primitive Earth. John D. Bernal suggested clays as concentrators of biological precursor molecules, as catalysis and clays might protect these molecules from high-energy radiation. On the other hand, nucleic acid bases and their derivatives are important compounds in biological systems. Their synthesis and stability in environmental conditions are of paramount importance in chemical evolution. The aim of this work is to extend the knowledge of the role of clays in the prebiotic epoch in relation to the behavior of guanine, a nucleic acid base, adsorbed in a clay mineral. To this end, we studied its adsorption in clays, its site of binding, and its survival under a high radiation field and at different temperatures and pH. The results showed guanine adsorption onto clays increased with the decreasing of the pH. This result could be explained by electrostatic forces between guanine positively charged at an acid pH and the negatively charged interlamellar channel of the clay. X-ray diffractograms showed that guanine is adsorbed onto the clay at the interlayer channel. To study the survival of guanine in a high radiation field, the system guanine-clay was irradiated under different irradiation doses, temperatures, and pH. The results showed that more than 90% of the guanine survives, and when the radiolysis is made without clay, the decomposition of this molecule occurs at low irradiation doses. The radiolysis performed at 77 K showed very low decomposition, which is important in cometary chemistry. These results show the protection role of

  12. Guanine-specific oxidation of double-stranded DNA by Cr(VI) and ascorbic acid forms spiroiminodihydantoin and 8-oxo-2'-deoxyguanosine.


    Slade, Peter G; Hailer, M Katie; Martin, Brooke D; Sugden, Kent D


    7,8-dihydro-8-oxoguanine (8-oxoG) is thought to be a major lesion formed in DNA by oxidative attack at the nucleobase guanine. Recent studies have shown that 8-oxoG has a lower reduction potential than the parent guanine and is a hot spot for further oxidation. Spiroiminodihydantoin (Sp) has been identified as one of these further oxidation products. Chromium(VI) is a human carcinogen that, when reduced by a cellular reductant such as ascorbate, can oxidize DNA. In this study, duplex DNA was reacted with Cr(VI) and ascorbate to identify and quantify the base lesions formed. Guanine bases were observed to be preferentially oxidized with 5' guanines within purine repeats showing enhanced oxidation. Trapping of the guanine lesions by the base excision repair enzymes hOGG1 and mNEIL2 showed nearly exclusive trapping by mNEIL2, suggesting that 8-oxoG was not the major lesion but rather a lesion recognized by mNEIL2 such as Sp. Formation of the Sp lesion in the Cr(VI)/Asc oxidation reaction with DNA was confirmed by LC-ESI-MS detection. HPLC-ECD was used to identify and quantify any 8-oxoG arising from Cr(VI)/Asc oxidation of DNA. Concentrations of Cr(VI) (3.1-50 microM) with a corresponding 1:10 ratio of Asc oxidized between 0.3% and 1.5% of all guanines within the duplex DNA strand to Sp. 8-oxoG was also identified but with the highest Cr(VI) concentration converting approximately 0.1% of all guanines to 8-oxoG. These results show that Sp was present in concentrations approximately 20 times greater than that of 8-oxoG in this system. The results indicate that 8-oxoG, while present, was not the major product of Cr(VI)/Asc oxidation of DNA and that Sp predominates under these conditions. These results further imply that Sp may be the lesion that accounts for the carcinogenicity of this metal in cellular systems.

  13. Evidence for a class of very small introns in the gene for hypoxanthine-guanine phosphoribosyltransferase in Schistosoma mansoni.

    PubMed Central

    Craig, S P; Muralidhar, M G; McKerrow, J H; Wang, C C


    The single copy gene for the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of the parasitic trematode, Schistosoma mansoni, contains seven introns, the first four of which are only 31, 33, 42, and 32 bases in length. These are the smallest introns ever discovered in a non-viral nuclear gene coding for protein. These very small introns possess the canonical GT...AG splice site sequences but lack the branching sequence, the secondary structure, and the minimum size of approximately 50 bases believed to be required for the splicing of eucaryotic mRNA precursors. Evidently, a somewhat different splicing mechanism for the transcripts of these very small introns is necessary. Their discovery within the genes of helminths raises theoretical considerations for the evolution of introns in eucaryotes. Images PMID:2701934

  14. Analysis of cDNA encoding the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of Schistosoma mansoni; a putative target for chemotherapy.

    PubMed Central

    Craig, S P; McKerrow, J H; Newport, G R; Wang, C C


    Because of the lack of de novo purine biosynthesis, hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) is a critical enzyme in the purine metabolic pathway of the human parasite, Schistosoma mansoni. Using a cDNA clone encoding mouse HGPRTase and subsequently a synthetic oligonucleotide derived from sequencing a clone of genomic DNA, two clones were isolated from an adult schistosome cDNA library. One clone is 1.374 Kilobases (Kb) long and has an open reading frame of 693 bases. The deduced 231 amino acid sequence has 47.9% identity in a 217 amino acid overlap with human HGPRTase. Northern blot analysis indicates that the full length of mRNA for the S. mansoni HGPRTase is 1.45-1.6 Kb. Analysis of the primary structures of the putative active site for human and parasite enzymes reveal specific differences which may eventually be exploitable in the design of drugs for the treatment of schistosomiasis. Images PMID:3136439

  15. Comparison of Transition Metal-Mediated Oxidation Reactions of Guanine in Nucleoside and Single-Stranded Oligodeoxynucleotide Contexts.


    Ghude, Pranjali; Schallenberger, Mark A; Fleming, Aaron M; Muller, James G; Burrows, Cynthia J


    As the most readily oxidized of DNA's four natural bases, guanine is a prime target for attack by reactive oxygen species (ROS) and transition metal-mediated oxidants. The oxidation products of a modified guanosine nucleoside and of a single-stranded oligodeoxynucleotide, 5'-d(TTTTTTTGTTTTTTT)-3' have been studied using oxidants that include Co(II), Ni(II), and Ir(IV) compounds as well as photochemically generated oxidants such as sulphate radical, electron-transfer agents (riboflavin) and singlet oxygen. The oxidized lesions formed include spiroiminodihydantoin (Sp), guanidinohydantoin (Gh), imidazolone (Iz), oxazolone (Z) and 5-carboxamido-5-formamido-2-iminohydantion (2-Ih) nucleosides with a high degree of dependence on the exact oxidation system employed. Interestingly, a nickel(II) macrocyclic complex in conjunction with KHSO(5) leads to the recently reported 2-Ih heterocycle as the major product in both the nucleoside and oligonucleotide contexts.

  16. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  17. The 4-nitroquinoline 1-oxide mutational spectrum in single stranded DNA is characterized by guanine to pyrimidine transversions.


    Fronza, G; Campomenosi, P; Iannone, R; Abbondandolo, A


    4-Nitroquinoline-1-oxide is a potent mutagen and carcinogen which induces two main guanine adducts at positions C8 and N2. In ds or ss damaged DNA the ratio C8/N2 adducts is 1:2 and 8-10:1, respectively. In bacteria and yeast 4NQO has been shown to be a base substitution mutagen acting at G residues inducing mainly G to A transitions. We determined the mutational spectrum induced by the 4NQO metabolite, acetoxy-4-aminoquinoline 1-oxide, in the M13lacZ'/E. coli lacZ delta M15 alpha complementation assay using ssDNA. Among 68 Ac-4HAQO induced mutants, G to Pyr transversion was the most frequent base substitution observed. By comparison with dsDNA based systems, our data suggest that dGuo-C8-AQO induces G to Pyr transversions. A mechanism to explain how this lesion may induce transversions is proposed.

  18. Biochemical and genetic analysis of RNA cap guanine-N2 methyltransferases from Giardia lamblia and Schizosaccharomyces pombe.


    Hausmann, Stéphane; Ramirez, Alejandro; Schneider, Susanne; Schwer, Beate; Shuman, Stewart


    RNA cap guanine-N2 methyltransferases such as Schizosaccharomyces pombe Tgs1 and Giardia lamblia Tgs2 catalyze methylation of the exocyclic N2 amine of 7-methylguanosine. Here we performed a mutational analysis of Giardia Tgs2, entailing an alanine scan of 17 residues within the minimal active domain. Alanine substitutions at Phe18, Thr40, Asp76, Asn103 and Asp140 reduced methyltransferase specific activity to <3% of wild-type Tgs2, thereby defining these residues as essential. Alanines at Pro142, Tyr148 and Pro185 reduced activity to 7-12% of wild-type. Structure-activity relationships at Phe18, Thr40, Asp76, Asn103, Asp140 and Tyr148, and at three other essential residues defined previously (Asp68, Glu91 and Trp143) were gleaned by testing the effects of 18 conservative substitutions. Our results engender a provisional map of the Tgs2 active site, which we discuss in light of crystal structures of related methyltransferases. A genetic analysis of S. pombe Tgs1 showed that it is nonessential. An S. pombe tgs1Delta strain grows normally, notwithstanding the absence of 2,2,7-trimethylguanosine caps on its U1, U2, U4 and U5 snRNAs. However, we find that S. pombe requires cap guanine-N7 methylation catalyzed by the enzyme Pcm1. Deletion of the pcm1(+) gene was lethal, as were missense mutations in the Pcm1 active site. Thus, whereas m(7)G caps are essential in both S. pombe and S. cerevisiae, m(2,2,7)G caps are not.

  19. Crystal structure of a chimera of human and Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferases provides insights into oligomerization.


    Gayathri, P; Sujay Subbayya, I N; Ashok, Chethan S; Selvi, T Senthamizh; Balaram, Hemalatha; Murthy, M R N


    The crystal structure of a chimera of Plasmodium falciparum (Pf) and human hypoxanthine guanine phosphoribosyltransferases (HGPRT), which consists of the core of the protein from the human enzyme and the hood region from the Pf enzyme, has been determined as a complex with the product guanosine monophosphate (GMP). The chimera can utilize hypoxanthine, guanine, and xanthine as substrates, similar to the Pf enzyme. It exists as a monomer-dimer mixture in solution, but shifts to a tetramer on addition of phosphoribosyl pyrophosphate (PRPP). The structural studies reveal that the asymmetric unit of the crystal consists of two monomers of the chimeric HGPRT. Surprisingly, the dimer interface of the chimera is the less extensive AC interface of the parent HGPRTs. An analysis of the crystal structures of the various human HGPRTs provides an explanation for the oligomeric characteristics of the chimera. Pro93 and Tyr197 form part of crucial interactions holding together the AB interface in the unliganded or GMP-bound forms of HGPRT, while Pro93 and His26 interact at the interface after binding of PRPP. Replacement of Tyr197 of human HGPRT by Ile207 in the chimera disrupts the interaction at the AB interface in the absence of PRPP. In the presence of PRPP, the interaction between Pro93 and His26 could restore the AB interface, shifting the chimeric enzyme to a tetrameric state. The structure provides valuable insights into the differences in the AB interface between Pf and human HGPRTs, which may be useful for designing selective inhibitors against the parasite enzyme.

  20. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine.


    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy


    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found.

  1. Substrate orientation and specificity in xanthine oxidase: crystal structures of the enzyme in complex with indole-3-acetaldehyde and guanine.


    Cao, Hongnan; Hall, James; Hille, Russ


    Xanthine oxidase is a molybdenum-containing hydroxylase that catalyzes the hydroxylation of sp(2)-hybridized carbon centers in a variety of aromatic heterocycles as well as aldehydes. Crystal structures of the oxidase form of the bovine enzyme in complex with a poor substrate indole-3-acetaldehyde and the nonsubstrate guanine have been determined, both at a resolution of 1.6 Å. In each structure, a specific and unambiguous orientation of the substrate in the active site is observed in which the hydroxylatable site is oriented away from the active site molybdenum center. The orientation seen with indole-3-acetaldehyde has the substrate positioned with the indole ring rather than the exocyclic aldehyde nearest the molybdenum center, indicating that the substrate must rotate some 30° in the enzyme active site to permit hydroxylation of the aldehyde group (as observed experimentally), accounting for the reduced reactivity of the enzyme toward this substrate. The principal product of hydroxylation of indole-3-acetaldehyde by the bovine enzyme is confirmed to be indole-3-carboxylic acid based on its characteristic UV-vis spectrum, and the kinetics of enzyme reduction are reported. With guanine, the dominant orientation seen crystallographically has the C-8 position that might be hydroxylated pointed away from the active site molybdenum center, in a configuration resembling that seen previously with hypoxanthine (a substrate that is effectively hydroxylated at position 2). The ∼180° reorientation required to permit reaction is sterically prohibited, indicating that substrate (mis)orientation in the active site is a major factor precluding formation of the highly mutagenic 8-hydroxyguanine.

  2. Fluorescence properties of 8-(2-pyridyl)guanine "2PyG" as compared to 2-aminopurine in DNA.


    Dumas, Anaëlle; Luedtke, Nathan W


    Because of their environment-sensitive fluorescence quantum yields, base analogues such as 2-aminopurine (2AP), 6-methylisoxanthopterin (6-MI), and 3-methylisoxanthopterin (3-MI) are widely used in nucleic-acid folding and catalysis assays. Emissions from these guanine mimics are quenched by base-stacking interactions and collisions with purine residues. Fluorescent base analogues that remain highly emissive in folded nucleic acids can provide sensitive means to differentiate DNA/RNA structures by participating in energy transfer from proximal ensembles of unmodified nucleobases. The development of new, highly emissive guanine mimics capable of proper base stacking and base-pairing interactions is an important prerequisite to this approach. Here we report a comparison of the most commonly used probe, 2-aminopurine (2AP), to 8-(2-pyridyl)-2'-deoxyguanosine (2PyG). The photophysical properties of these purine derivatives are very different. 2PyG exhibits enhanced fluorescence quantum yields upon its incorporation into folded nucleic acids--approximately 50-fold brighter fluorescence intensity than 2AP in the context of duplex DNA. Due to its bright fluorescence and compatibility with proper DNA folding, 2PyG can be used to accurately quantify energy-transfer efficiencies, whereas 2AP is much less sensitive to structure-specific trends in energy transfer. When using nucleoside monomers, Stern-Volmer plots of 2AP fluorescence revealed upward curvature of F(0) /F upon titration of guanosine monophoshate (GMP), whereas 2PyG exhibited unusual downward curvature of F(0) /F that resulted in a recovery of fluorescence at high GMP concentrations. These results are consistent with the trends observed for 2PyG- and 2AP-containing oligonucleotides, and furthermore suggest that solutions containing high concentrations of GMP can, in some ways, mimic the high local nucleobase densities of folded nucleic acids.

  3. New Dihydro OO'Bis(Salicylidene) 2,2' Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA.


    Arjmand, Farukh; Mohani, Bhawana; Parveen, Shamima


    The newly synthesized ligand, dihydro OO'bis(salicylidene) 2,2' aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH(4). Cu(II) (3) and Zn(II) (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the Cu(II) atom, while the Sn(IV) atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable "hyperchromic effect" in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N(7) position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, k(obs), values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential E(pa) and E(pc) values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E(1/2) has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA.

  4. Intrastrand G-U cross-links generated by the oxidation of guanine in 5'-d(GCU) and 5'-r(GCU).


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    It has been suggested that carbonate radical anions are biologically important because they may be produced during the inflammatory response. The carbonate radicals can selectively oxidize guanine in DNA and RNA by one-electron transfer mechanisms and the guanine radicals thus formed decay by diverse competing pathways with other free radicals or nucleophiles. Using a photochemical method to generate CO(3)(-) radicals in vitro, we compare the distributions of products initiated by the one-electron oxidation of guanine in the trinucleotides 5'-r(GpCpU) and 5'-d(GpCpU) in aqueous buffer solutions (pH 7.5). Similar distributions of stable end products identified by LC-MS/MS methods were found in both cases. The guanine oxidation products include the diastereomeric pair of spiroiminodihydantoin (Sp) and 2,5-diamino-4H-imidazolone (Iz). In addition, intrastrand cross-linked products involving covalent bonds between the G and the U bases (GCU) were also found, although with different relative yields in the 2'-deoxy- and the ribotrinucleotides. The positive-ion MS/MS spectra of the 5'-r(GpCpU) and 5'-d(GpCpU) products clearly indicate the presence of covalently linked G-U products that have a mass smaller by 2 Da than the sum of the G and U bases in both types of trinucleotides. The 5'-d(GCU) cross-linked product was further characterized by 1D and 2D NMR methods that confirm its cyclic structure in which the guanine C8 atom is covalently linked to the uracil N3 atom.

  5. Performance characteristics of guanine incorporated PVDF-HFP/PEO polymer blend electrolytes with binary iodide salts for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Senthil, R. A.; Theerthagiri, J.; Madhavan, J.; Arof, A. K.


    In this work, we have investigated the influence of guanine as an organic dopant in dye-sensitized solar cell (DSSC) based on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) polymer blend electrolyte along with binary iodide salts (potassium iodide (KI) and tetrabutylammonium iodide (TBAI)) and iodine (I2). The PVDF-HFP/KI + TBAI/I2, PVDF-HFP/PEO/KI + TBAI/I2 and guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolytes were prepared by solution casting technique using DMF as solvent. The PVDF-HFP/KI + TBAI/I2 electrolyte showed an ionic conductivity value of 9.99 × 10-5 Scm-1, whereas, it was found to be increased to 4.53 × 10-5 Scm-1 when PEO was blended with PVDF-HFP/KI + TBAI/I2 electrolyte. However, a maximum ionic conductivity value of 3.67 × 10-4 Scm-1 was obtained for guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 blend electrolyte. The photovoltaic properties of all these polymer electrolytes in DSSCs were characterized. As a consequence, the power conversion efficiency of the guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC was significantly improved to 4.98% compared with PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC (2.46%). These results revealed that the guanine can be an effective organic dopant to enhance the performance of DSSCs.

  6. A Steric-inhibition model for regulation of nucleotide exchange via the Dock180 family of GEFs.


    Lu, Mingjian; Kinchen, Jason M; Rossman, Kent L; Grimsley, Cynthia; Hall, Matthew; Sondek, John; Hengartner, Michael O; Yajnik, Vijay; Ravichandran, Kodi S


    CDM (CED-5, Dock180, Myoblast city) family members have been recently identified as novel, evolutionarily conserved guanine nucleotide exchange factors (GEFs) for Rho-family GTPases . They regulate multiple processes, including embryonic development, cell migration, apoptotic-cell engulfment, tumor invasion, and HIV-1 infection, in diverse model systems . However, the mechanism(s) of regulation of CDM proteins has not been well understood. Here, our studies on the prototype member Dock180 reveal a steric-inhibition model for regulating the Dock180 family of GEFs. At basal state, the N-terminal SH3 domain of Dock180 binds to the distant catalytic Docker domain and negatively regulates the function of Dock180. Further studies revealed that the SH3:Docker interaction sterically blocks Rac access to the Docker domain. Interestingly, ELMO binding to the SH3 domain of Dock180 disrupted the SH3:Docker interaction, facilitated Rac access to the Docker domain, and contributed to the GEF activity of the Dock180/ELMO complex. Additional genetic rescue studies in C. elegans suggested that the regulation of the Docker-domain-mediated GEF activity by the SH3 domain and its adjoining region is evolutionarily conserved. This steric-inhibition model may be a general mechanism for regulating multiple SH3-domain-containing Dock180 family members and may have implications for a variety of biological processes.

  7. GS-9219/VDC-1101 - a prodrug of the acyclic nucleotide PMEG has antitumor activity inspontaneous canine multiple myeloma

    PubMed Central


    Background Multiple myeloma (MM) is an important human and canine cancer for which novel therapies remain necessary. VDC-1101 (formerly GS-9219), a novel double prodrug of the anti-proliferative nucleotide analog 9-(2-phosphonylmethoxyethyl) guanine (PMEG), possesses potent cytotoxic activity in vitro in human lymphoblasts and leukemia cell lines and in vivo in spontaneous canine lymphoma. Given the similarity in lineage between lymphoma and MM, we hypothesized that VDC-1101 would be active against MM. Results We evaluated the in vitro antiproliferative effects of VDC-1101 against 3 human MM cell lines, and we performed a phase-II clinical trial in 14 dogs with spontaneous MM. Each dog was treated with a maximum of 6 doses of VDC-1101 monotherapy over 10–15 weeks. Dose-dependent antiproliferative activity was observed in all evaluated cell lines. Major antitumor responses (reduction of serum paraprotein and resolution of hypercalcemia, peripheral cytopenias and bone marrow plasmacytosis) were observed in 9 of 11 evaluable dogs for a median of 172 days, including a durable stringent complete response (>1047 days) in a dog with melphalan-refractory disease. 2 dogs were euthanized due to presumed pulmonary fibrosis; there were no other dose-limiting toxicities encountered. Conclusions In conclusion, VDC-1101 has significant anti-tumor activity at well-tolerated doses in spontaneous canine MM. PMID:24460928

  8. DNA lesion can facilitate base ionization: vertical ionization energies of aqueous 8-oxoguanine and its nucleoside and nucleotide.


    Palivec, Vladimír; Pluhařová, Eva; Unger, Isaak; Winter, Bernd; Jungwirth, Pavel


    8-Oxoguanine is one of the key products of indirect radiation damage to DNA by reactive oxygen species. Here, we describe ionization of this damaged nucleobase and the corresponding nucleoside and nucleotide in aqueous phase, modeled by the nonequilibrium polarizable continuum model, establishing their lowest vertical ionization energies of 6.8-7.0 eV. We thus confirm that 8-oxoguanine has even lower ionization energy than the parental guanine, which is the canonical nucleobase with the lowest ionization energy. Therefore, it can act as a trap for the cationic hole formed by ionizing radiation and thus protect DNA from further radiation damage. We also model using time-dependent density functional theory and measure by liquid jet photoelectron spectroscopy the valence photoelectron spectrum of 8-oxoguanine in water. We show that the calculated higher lying ionization states match well the experiment which, however, is not sensitive enough to capture the electron signal corresponding to the lowest ionization process due to the low solubility of 8-oxoguanine in water.

  9. QGRS-H Predictor: a web server for predicting homologous quadruplex forming G-rich sequence motifs in nucleotide sequences

    PubMed Central

    Menendez, Camille; Frees, Scott; Bagga, Paramjeet S.


    Naturally occurring G-quadruplex structural motifs, formed by guanine-rich nucleic acids, have been reported in telomeric, promoter and transcribed regions of mammalian genomes. G-quadruplex structures have received significant attention because of growing evidence for their role in important biological processes, human disease and as therapeutic targets. Lately, there has been much interest in the potential roles of RNA G-quadruplexes as cis-regulatory elements of post-transcriptional gene expression. Large-scale computational genomics studies on G-quadruplexes have difficulty validating their predictions without laborious testing in ‘wet’ labs. We have developed a bioinformatics tool, QGRS-H Predictor that can map and analyze conserved putative Quadruplex forming 'G'-Rich Sequences (QGRS) in mRNAs, ncRNAs and other nucleotide sequences, e.g. promoter, telomeric and gene flanking regions. Identifying conserved regulatory motifs helps validate computations and enhances accuracy of predictions. The QGRS-H Predictor is particularly useful for mapping homologous G-quadruplex forming sequences as cis-regulatory elements in the context of 5′- and 3′-untranslated regions, and CDS sections of aligned mRNA sequences. QGRS-H Predictor features highly interactive graphic representation of the data. It is a unique and user-friendly application that provides many options for defining and studying G-quadruplexes. The QGRS-H Predictor can be freely accessed at: PMID:22576365

  10. IMPDH2 genetic polymorphism: a promoter single-nucleotide polymorphism disrupts a cyclic adenosine monophosphate responsive element.


    Garat, Anne; Cauffiez, Christelle; Hamdan-Khalil, Rima; Glowacki, François; Devos, Aurore; Leclerc, Julie; Lionet, Arnaud; Allorge, Delphine; Lo-Guidice, Jean-Marc; Broly, Franck


    Inosine 5'-monophosphate dehydrogenase (IMPDH), which catalyzes a key step in the de novo biosynthesis of guanine nucleotide, is mediated by two highly conserved isoforms, IMPDH1 and IMPDH2. In this study, IMPDH2 genetic polymorphism was investigated in 96 individuals of Caucasian origin. Four single-nucleotide polymorphisms were identified, comprising one previously described single base-pair substitution in the close vicinity of the consensus donor splice site of intron 7 (IVS7+10T>C), and three novel polymorphisms, one silent substitution in exon 9 (c.915C>G), one single base-pair insertion (g.6971_6972insT) within the 3'-untranslated region of the gene, and one substitution located in the promoter region (c.-95T>G) in a transcription factor binding site CRE(A) (cyclic adenosine monophosphate [cAMP] response element). Considering the nature and location of this latter polymorphism, its functional relevance was examined by transfecting HEK293 and Jurkat cell lines with constructs of the related region of IMPDH2/luciferase reporter gene. The c.-95T>G mutation leads to a significant decrease of luciferase activity (HEK293: 55% decrease, p < 0.05; Jurkat: 65% decrease, p < 0.05) compared with the wild-type promoter sequence and, therefore, is likely to determine interindividual differences in IMPDH2 transcriptional regulation. These results might contribute to a better understanding of the variability in clinical outcome and dose adjustments of certain immunosuppressors that are metabolized through the IMPDH pathway or that are IMPDH inhibitors.

  11. Characterization of the Dominant and Rare Members of a Young Hawaiian Soil Bacterial Community with Small-Subunit Ribosomal DNA Amplified from DNA Fractionated on the Basis of Its Guanine and Cytosine Composition

    PubMed Central

    Nüsslein, Klaus; Tiedje, James M.


    The small-subunit ribosomal DNA (rDNA) diversity was found to be very high in a Hawaiian soil community that might be expected to have lower diversity than the communities in continental soils because the Hawaiian soil is geographically isolated and only 200 years old, is subjected to a constant climate, and harbors low plant diversity. Since an underlying community structure could not be revealed by analyzing the total eubacterial rDNA, we first fractionated the DNA on the basis of guanine-plus-cytosine (G+C) content by using bis-benzimidazole and equilibrium centrifugation and then analyzed the bacterial rDNA amplified from a fraction with a high biomass (63% G+C fraction) and a fraction with a low biomass (35% G+C fraction). The rDNA clone libraries were screened by amplified rDNA restriction analysis to determine phylotype distribution. The dominant biomass reflected by the 63% G+C fraction contained several dominant phylotypes, while the community members that were less successful (35% G+C fraction) did not show dominance but there was a very high diversity of phylotypes. Nucleotide sequence analysis revealed taxa belonging to the groups expected for the G+C contents used. The dominant phylotypes in the 63% G+C fraction were members of the Pseudomonas, Rhizobium-Agrobacterium, and Rhodospirillum assemblages, while all of the clones sequenced from the 35% G+C fraction were affiliated with several Clostridium assemblages. The two-step rDNA analysis used here uncovered more diversity than can be detected by direct rDNA analysis of total community DNA. The G+C separation step is also a way to detect some of the less dominant organisms in a community. PMID:9546163

  12. High-yield production of short GpppA- and 7MeGpppA-capped RNAs and HPLC-monitoring of methyltransfer reactions at the guanine-N7 and adenosine-2′O positions

    PubMed Central

    Peyrane, F.; Selisko, B.; Decroly, E.; Vasseur, J. J.; Benarroch, D.; Canard, B.; Alvarez, K.


    Many eukaryotic and viral mRNAs, in which the first transcribed nucleotide is an adenosine, are decorated with a cap-1 structure, 7MeG5′-ppp5′-A2′OMe. The positive-sense RNA genomes of flaviviruses (Dengue, West Nile virus) for example show strict conservation of the adenosine. We set out to produce GpppA- and 7MeGpppA-capped RNA oligonucleotides for non-radioactive mRNA cap methyltransferase assays and, in perspective, for studies of enzyme specificity in relation to substrate length as well as for co-crystallization studies. This study reports the use of a bacteriophage T7 DNA primase fragment to synthesize GpppACn and 7MeGpppACn (1 ≤ n ≤ 9) in a one-step enzymatic reaction, followed by direct on-line cleaning HPLC purification. Optimization studies show that yields could be modulated by DNA template, enzyme and substrate concentration adjustments and longer reaction times. Large-scale synthesis rendered pure (in average 99%) products (1 ≤ n ≤ 7) in quantities of up to 100 nmol starting from 200 nmol cap analog. The capped RNA oligonucleotides were efficient substrates of Dengue virus (nucleoside-2′-O-)-methyltransferase, and human (guanine-N7)-methyltransferase. Methyltransfer reactions were monitored by a non-radioactive, quantitative HPLC assay. Additionally, the produced capped RNAs may serve in biochemical, inhibition and structural studies involving a variety of eukaryotic and viral methyltransferases and guanylyltransferases. PMID:17259217

  13. Cyclic Nucleotide Signaling in Polycystic Kidney Disease

    PubMed Central

    Wang, Xiaofang; Ward, Christopher J.; Harris, Peter C.; Torres, Vicente E.


    Increased levels of 3’–5’-cyclic adenosine monophosphate (cAMP) stimulate cell proliferation and fluid secretion in polycystic kidney disease (PKD). Since hydrolytic capacity of phosphodiesterases (PDE) far exceeds maximum rate of synthesis by adenylyl cyclases (AC), cellular levels of cAMP are more sensitive to PDE inhibition than to AC activity changes. We have used enzymatic, western blot, immunohistochemistry, PCR and biochemical assays to study activity and expression of PDE families and isoforms and expression of downstream effectors of cAMP signaling in wild