Science.gov

Sample records for 2-acrylamido-2-methyl-1-propanesulfonic acid amps

  1. The use of poly(2-acrylamido-2-methyl-1-propanesulfonic acid) polymers as spacers for isotachophoresis in sieving gel matrices.

    PubMed

    Bellini, M P; Manchester, K L

    1999-03-01

    The electric field strength gradients generated in isotachophoresis (ITP) may be used for the separation of biomolecules. Poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (polyAMPS) polymers of a uniform distribution of molecular mass were synthesized and used as novel spacers in ITP. Since these polymeric spacers are strongly acidic species, their ionic charges remain constant over a wide pH range, so that their ionic mobilities are governed solely by their molecular masses and not by the pH of the milieu. A modification of ITP known as telescope electrophoresis was used to separate a number of acidic dyes of varying ionic mobility, using polyAMPS polymers as spacers. The resolution obtained was superior to that obtained by polyacrylamide gel electrophoresis (PAGE), due to the focusing effect of the electric field strength gradient. Since these novel polymeric spacers are designed to operate within sieving medium, it was decided to test their suitability for the separation of DNA molecules. DNA molecules up to 1000 bp long were successfully resolved, with a similar resolution to that obtained with conventional PAGE. PMID:10036157

  2. SYNTHESIS AND IN VITRO CHARACTERIZATION OF HYDROXYPROPYL METHYLCELLULOSE-GRAFT-POLY (ACRYLIC ACID/2-ACRYLAMIDO-2-METHYL-1-PROPANESULFONIC ACID) POLYMERIC NETWORK FOR CONTROLLED RELEASE OF CAPTOPRIL.

    PubMed

    Furqan Muhammad, Iqbal; Mahmood, Ahmad; Aysha, Rashid

    2016-01-01

    A super-absorbent hydrogel was developed by crosslinking of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and acrylic acid with hydroxypropyl methylcellulose (HPMC) for controlled release drug delivery of captopril, a well known antihypertensive drug. Acrylic acid and AMPS were polymerized and crosslinked with HPMC by free radical polymerization, a widely used chemical crosslinking method. N,N'-methylenebisacrylamide (MBA) and potassium persulfate (KPS) were added as cross-linker and initiator, respectively. The hydrogel formulation was loaded with captopril (as model drug). The concentration of captopril was monitored at 205 nm using UV spectrophotometer. Equilibrium swelling ratio was determined at pH 2, 4.5 and 7.4 to evaluate the pH responsiveness of the formed hydrogel. The super-absorbent hydrogels were evaluated by FTIR, SEM, XRD, and thermal analysis (DSC and TGA). The formation of new copolymeric network was determined by FTIR, XRD, TGA and DSC analysis. The hydrogel formulations with acrylic acid and AMPS ratio of 4: 1 and lower amounts of crosslinker had shown maximum swelling. Moreover, higher release rate of captopril was observed at pH 7.4 than at pH 2, because of more swelling capacity of copolymer with increasing pH of the aqueous medium. The present research work confirms the development of a stable hydrogel comprising of HPMC with acrylic acid and AMPS. The prepared hydrogels exhibited pH sensitive behav-ior. This superabsorbent composite prepared could be a successful drug carrier for treating hypertension. PMID:27008813

  3. 2-Acrylamido-2-methyl-1-propanesulfonic Acid Grafted Poly(vinylidene fluoride-co-hexafluoropropylene)-Based Acid-/Oxidative-Resistant Cation Exchange for Membrane Electrolysis.

    PubMed

    Pandey, Ravi P; Das, Arindam K; Shahi, Vinod K

    2015-12-30

    For developing acid-/oxidative-resistant aliphatic-polymer-based cation-exchange membrane (CEM), macromolecular modification of poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-co-HFP) was carried out by controlled chemical grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS). To introduce the unsaturation suitable for chemical grafting, dehydrofluorination of commercially available PVDF-co-HFP was achieved under alkaline medium. Sulfonated copolymer (SCP) was prepared by the free radical copolymerization of dehydofluorinated PVDF-co-HFP (DHPVDF-co-HFP) and AMPS in the presence of free radical initiator. Prepared SCP-based CEMs were analyzed for their morphological characteristics, ion-exchange capacity (IEC), water uptake, conductivity, and stabilities (mechanical, chemical, and thermal) in comparison with state-of-art Nafion117 membrane. High bound water content avoids the membrane dehydration, and most optimal (SCP-1.33) membrane exhibited about ∼2.5-fold high bound water content in comparison with that of Nafion117 membrane. Bunsen reaction of iodine-sulfur (I-S) was successfully performed by direct-contact-mode membrane electrolysis in a two-compartment electrolytic cell using different SCP membranes. High current efficiency (83-99%) confirmed absence of any side reaction and 328.05 kJ mol-H2(-1) energy was required for to produce 1 mol of H2 by electrolytic cell with SCP-1.33 membrane. In spite of low conductivity for reported SCP membrane in comparison with that of Nafion117 membrane, SCP-1.33 membrane was assessed as suitable candidate for electrolysis because of its low-cost nature and excellent stabilities in highly acidic environment may be due to partial fluorinated segments in the membrane structure. PMID:26642107

  4. Structural organization of films based on polyaniline/polysulfonic acid complexes depending on the synthesis method

    SciTech Connect

    Simagina, L. V. Gaynutdinov, R. V.; Stepina, N. D.; Sorokina, K. L.; Morozova, O. V.; Shumakovich, G. P.; Yaropolov, A. I.; Tolstikhina, A. L.

    2010-07-15

    The optical properties and morphology of complexes based on polyaniline (PANI) and poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPS), depending on their synthesis conditions, have been characterized by UV-visible spectroscopy and atomic force microscopy. The dependence of the electron absorption spectra of PANI/PAMPS complexes and the surface topography of their films on the initiation way of PANI formation (chemical and enzymatic) and the use of promoters of aniline polymerization has been investigated. The aniline polymerization kinetics with and without polymerization promoters has been studied. All PANI/PAMPS complexes are found to have a nanocomposite time-stable structure.

  5. Poly(NIPAm-AMPS) nanoparticles for targeted delivery of anti-inflammatory cell penetrating peptides

    NASA Astrophysics Data System (ADS)

    Bartlett, Rush Lloyd, II

    Inflammatory diseases such as osteoarthritis and rheumatoid arthritis cause $127.8 billion in US healthcare expenditures each year and are the cause of disability for 27% of disabled persons in the United States. Current treatment options rarely halt disease progression and often result in significant unwanted and debilitating side effects. Our laboratory has previously developed a family of cell penetrating peptides (CPPs) which inhibit the activity of mitogen activated protein kinase activate protein kinase 2 (MK2). MK2 mediates the inflammatory response by activating Tristetraprline (TTP). Once activated, TTP rapidly stabilizes AU rich regions of pro-inflammatory cytokine mRNA which allows translation of pro-inflammatory cytokines to occur. Blocking MK2 with our labs CPPs yields a decrease in inflammatory activity but CPPs by are highly non specific and prone to rapid enzymatic degradation in vivo.. In order to increase the potency of MK2 inhibiting CPPs we have developed a novel nanoparticle drug carrier composed of poly(N-isopropylacrylamide-co-2-acrylamido-2-methyl-1-propanesulfonic acid). This drug carrier has been shown to have preliminary efficacy in vitro and ex vivo for suppressing pro-inflammatory cytokine production when releasing CPPs. This thesis will present progress made on three aims: Specific Aim 1) Create and validate a NIPAm based drug delivery system that mimics the binding and release previously observed between cell penetrating peptides and glycosaminoglycans. Specific Aim 2) Engineer degradability into poly(NIPAm-AMPS) nanoparticles to enable more drug to be released and qualify that system in vitro. Specific Aim 3) Validate poly(NIPAm-AMPS) nanoparticles for targeted drug delivery in an ex vivo inflammatory model. Overall we have developed a novel anionic nanoparticle system that is biocompatible and efficient at loading and releasing cell penetrating peptides to inflamed tissue. Once loaded with a CPP the nanoparticle drug complex is

  6. Preparation and evaluation of rigid porous polyacrylamide-based strong cation-exchange monolithic columns for capillary electrochromatography.

    PubMed

    Dong, Jing; Ou, Junjie; Dong, Xiaoli; Wu, Renan; Ye, Mingliang; Zou, Hanfa

    2007-11-01

    A CEC monolithic column with strong cation-exchange (SCX) stationary phase based on hydrophilic monomers was prepared by in situ polymerization of acrylamide, methylenebisacrylamide, and 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) in a complete organic binary porogenic solvent consisting of DMSO and dodecanol. The sulfonic groups provided by the monomer AMPS on the surface of the stationary phase generate an EOF from anode to cathode, and serve as an SCX stationary phase at the same time. The monolithic stationary phase exhibited normal-phase chromatographic behavior for neutral analytes. For charged analytes, electrostatic interaction/repulsion with the monolith was observed. The strong SCX monolithic column has been successfully employed in the electrochromatographic separation of basic drugs, peptides, and alkaloids extracted from natural products. PMID:17924588

  7. Superabsorbent nanocomposite (alginate-g-PAMPS/MMT): synthesis, characterization and swelling behavior.

    PubMed

    Yadav, Mithilesh; Rhee, Kyong Yop

    2012-09-01

    A superabsorbent composite (alginate-g-PAMPS/MMT) was prepared by graft copolymerization from alginate, 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and Na+ montmorillonite (MMT) in an inert atmosphere. Effects of polymerization variables on water absorbency, including the content of Na+ montmorillonite, sodium alginate, N,N'-methylenebisacrylamide and AMPS, were studied. The introduced montmorillonite formed a loose and porous surface and improved the water absorbency of the alginate-g-PAMPS/MMT superabsorbent composite. Swelling behaviors of the superabsorbent composites in various cationic salt solutions (NaCl, CaCl2 and FeCl3) and anionic salt solutions (NaCl and Na2SO4) were also systematically investigated. The superabsorbent composite was further characterized using Fourier transform infrared spectroscopy (FTIR), rheology, thermogravimetric analysis (TGA), X-ray diffraction (XRD) and scanning electron microscopy (SEM) taking alginate-g-PAMPS as a reference. PMID:24751026

  8. Preparation and characterization of polymer electrolyte membranes based on silicon-containing core-shell structured nanocomposite latex particles

    NASA Astrophysics Data System (ADS)

    Zhong, Shuangling; Sun, Chenggang; Gao, Yushan; Cui, Xuejun

    2015-09-01

    A series of silicon-containing core-shell structured polyacrylate/2-acrylamido-2-methyl-1-propanesulfonic acid (SiO2-CS-PA/A) nanocomposite latex particles are prepared by the emulsifier-free emulsion polymerization of acrylate monomers and various amount of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) with colloidal nanosilica particles as seed. The chemical and morphological structures of latex particles with high monomer conversion are determined using Fourier transform infrared (FTIR), dynamic light scattering (DLS) and transmission electron microscopy (TEM). The SiO2-CS-PA/A nanocomposite membranes are fabricated through pouring the latex onto a clean surface of glass and drying at 60 °C for 10 h and 120 °C for 2 h. The nanocomposite membranes possess good thermal and dimensional stability. In addition, in comparison to Nafion® 117, the nanocomposite membranes exhibit moderate proton conductivity, significantly better methanol barrier and selectivity. The methanol diffusion coefficient is in the range of 1.03 × 10-8 to 5.26 × 10-8 cm2 s-1 which is about two orders of magnitude lower than that of Nafion® 117 (2.36 × 10-6 cm2 s-1). The SiO2-CS-PA/A 5 membrane shows the highest selectivity value (2.34 × 105 S cm-3) which is approximately 11.0 times of that (2.13 × 104 S cm-3) of Nafion® 117. These results indicate that the nanocomposite membranes are promising candidates to be used as polymer electrolyte membranes in direct methanol fuel cells.

  9. A Doped Polyaniline Modified Electrode Amperometric Biosensor for Gluconic Acid Determination in Grapes

    PubMed Central

    Albanese, Donatella; Malvano, Francesca; Sannini, Adriana; Pilloton, Roberto; Di Matteo, Marisa

    2014-01-01

    In winemaking gluconic acid is an important marker for quantitative evaluation of grape infection by Botrytis cinerea. A screen-printed amperometric bienzymatic sensor for the determination of gluconic acid based on gluconate kinase (GK) and 6-phospho-D-gluconate dehydrogenase (6PGDH) coimmobilized onto polyaniline/poly (2-acrylamido-2-methyl-1-propanesulfonic acid; PANI-PAAMPSA) is reported in this study. The conductive polymer electrodeposed on the working electrode surface allowed the detection of NADH at low potential (0.1 V) with a linear range from 4 × 10−3 to 1 mM (R2 = 0.99) and a sensitivity of 419.44 nA·mM−1. The bienzymatic sensor has been optimized with regard to GK/6PGDH enzymatic unit ratio and ATP/NADP+ molar ratio which resulted equal to 0.33 and 1.2, respectively. Under these conditions a sensitivity of 255.2 nA·mM−1, a limit of detection of 5 μM and a Relative Standard Deviation (RSD) of 4.2% (n = 5) have been observed. Finally, the biosensor has been applied for gluconic acid measurements in must grape samples and the matrix effect has been taken into consideration. The results have been compared with those obtained on the same samples with a commercial kit based on a spectrophotometric enzyme assay and were in good agreement, showing the capability of the bienzymatic PANI-PAAMPSA biosensor for gluconic acid measurements and thus for the evaluation of Botrytis cinerea infection in grapes. PMID:24960084

  10. Comparison of positively and negatively charged achiral co-monomers added to cyclodextrin monolith: improved chiral separations in capillary electrochromatography.

    PubMed

    Lu, Yang; Shamsi, Shahab A

    2014-10-01

    Cyclodextrins (CDs) and their derivatives have been one of the most popular and successful chiral additives used in electrokinetic chromatography because of the presence of multiple chiral centers, which leads to multiple chiral interactions. However, there has been relatively less published work on the use of CDs as monolithic media for capillary electrochromatography (CEC). The goal of this study was to show how the addition of achiral co-monomer to a polymerizable CD such as glycidyl methacrylate β-cyclodextrin (GMA/β-CD) can affect the enantioselective separations in monolithic CEC. To achieve this goal, polymeric monoliths columns were prepared by co-polymerizing GMA/β-CD with cationic or anionic achiral co-monomers [(2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and vinyl benzyltrimethyl-ammonium (VBTA)] in the presence of conventional crosslinker (ethylene dimethacrylate) and ternary porogen system including butanediol, propanol and water. A total of 34 negatively charged compounds, 30 positively charged compounds and 33 neutral compounds were screened to compare the enantioresolution capability on the GMA/β-CD, GMA/β-CD-VBTA and GMA/β-CD-AMPS monolithic columns. PMID:24108813

  11. Immobilization of Stimuli-Responsive Nanogels onto Honeycomb Porous Surfaces and Controlled Release of Proteins.

    PubMed

    De León, A S; Molina, M; Wedepohl, S; Muñoz-Bonilla, A; Rodríguez-Hernández, J; Calderón, M

    2016-02-23

    In this article, we describe the formation of functional honeycomb-like porous surfaces fabricated by the breath figures technique using blends of either amino-terminated poly(styrene) or a poly(styrene)-b-poly(acrylic acid) block copolymer with homopoly(styrene). Thus, the porous interfaces exhibited either amino or acid groups selectively located inside of the holes, which were subsequently employed to anchor stimuli-responsive nanogels by electrostatic interactions. These nanogels were prepared from poly(N-isopropylacrylamide) (PNIPAM) cross-linked with dendritic polyglycerol (dPG) and semi-interpenetrated with either 2-(dimethylamino)ethyl methacrylate (DMAEMA) or 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) to produce positively and negatively charged nanogel surfaces, respectively. The immobilization of these semi-interpenetrated networks onto the surfaces allowed us to have unique stimuli-responsive surfaces with both controlled topography and composition. More interestingly, the surfaces exhibited stimuli-responsive behavior by variations on the pH or temperature. Finally, the surfaces were evaluated regarding their capacity to induce a thermally triggered protein release at temperatures above the cloud point temperature (T(cp)) of the nanogels. PMID:26818564

  12. A new synthesis, characterization and application chelating resin for determination of some trace metals in honey samples by FAAS.

    PubMed

    Daşbaşı, Teslima; Saçmacı, Şerife; Çankaya, Nevin; Soykan, Cengiz

    2016-07-15

    In this study, we developed a simple and rapid solid phase extraction (SPE) method for the separation/preconcentration and determination of some trace metals by flame atomic absorption spectrometry (FAAS). A new chelating resin, poly [2-(4-methoxyphenylamino)-2-oxoethyl methacrylate-co-divinylbenzene-co-2-acrylamido-2-methyl-1-propanesulfonic acid] (MPAEMA-co-DVB-co-AMPS), was synthesized and characterized. This chelating resin was used as a new adsorbent material for determination of Cd(II), Co(II), Cr(III), Cu(II), Fe(III), Mn(II), Pb(II), and Zn(II) ions. The parameters influential on the determination of this trace metals were examined. Under the optimum conditions, the detection limits (DL) of the method for trace metals were found to be (3s) in the range of 0.9-2.2 μg L(-1) (n=21), the preconcentration factor was calculated as 200 and the relative standard deviation was obtained achieved as ⩽2% for n=11. The method was performed for the determination of trace metals in some honey samples and standard reference materials. PMID:26948616

  13. Rapid determination of endogenous cytokinins in plant samples by combination of magnetic solid phase extraction with hydrophilic interaction chromatography-tandem mass spectrometry.

    PubMed

    Liu, Zhao; Cai, Bao-Dong; Feng, Yu-Qi

    2012-04-01

    A 2-acrylamido-2-methyl-1-propanesulfonic acid-co-ethylene glycol dimethacrylate (Fe₃O₄/SiO₂/P(AMPS-co-EGDMA)) copolymer was prepared and used as a magnetic solid phase extraction (MSPE) medium for recovery of endogenous cytokinins (CKs) from plant extracts. This magnetic porous polymer was characterized by electron microscopy, nitrogen sorption experiments, elemental analysis and Fourier-transformed infrared spectroscopy. It was demonstrated to have high extraction capacity toward CKs in plants due to its specificity, surface area and porous structure. Coupled with hydrophilic interaction chromatography-tandem mass spectrometry (HILIC-MS/MS), a rapid, simple, and effective MSPE-HILIC-MS/MS analytical method for the quantitative analysis of endogenous CKs in Oryza sativa (O. sativa) roots was successfully established. Good linearities were obtained for all CKs investigated with correlation coefficients (R²>0.9975. The results showed that LODs (S/N=3) were ranged from 0.18 to 3.65 pg mL⁻¹. Reproducibility of the method was obtained with intra-day and inter-day relative standard deviations (RSDs) less than 16.1% and the recoveries in plant samples ranged from 72.8% to 115.5%. Finally, the MSPE-HILIC-MS/MS method was applied to several plant samples, and the amounts of endogenous CKs in O. sativa roots, leaves and Arabidopsis thaliana (A. thaliana) were successfully determined. PMID:22401906

  14. Synthesis, characterization and application of a new chelating resin for solid phase extraction, preconcentration and determination of trace metals in some dairy samples by flame atomic absorption spectrometry.

    PubMed

    Daşbaşı, Teslima; Saçmacı, Şerife; Çankaya, Nevin; Soykan, Cengiz

    2016-11-15

    In this study, a simple and rapid solid phase extraction/preconcentration procedure was developed for determination of Cd(II), Co(II), Cr(III), Cu(II), Fe(III), Mn(II), Pb(II), and Zn(II) trace metals by flame atomic absorption spectrometry (FAAS). A new chelating resin, poly(N-cyclohexylacrylamide-co-divinylbenzene-co-2-acrylamido-2-methyl-1-propanesulfonic acid) (NCA-co-DVB-co-AMPS) (hereafter CDAP) was synthesized and characterized. The influences of the analytical parameters such as pH of the sample solution, type and concentration of eluent, flow rates of the sample and eluent, volume of the sample and eluent, amount of chelating resin, and interference of ions were examined. The limit of detection (LOD) of analytes were found (3s) to be in the range of 0.65-1.90μgL(-1). Preconcentration factor (PF) of 200 and the relative standard deviation (RSD) of ⩽2% were achieved (n=11). The developed method was applied for determination of analytes in some dairy samples and certified reference materials. PMID:27283608

  15. Oligoaniline-containing supramolecular block copolymer nanodielectric materials.

    PubMed

    Hardy, Christopher G; Islam, Md Sayful; Gonzalez-Delozier, Dioni; Ploehn, Harry J; Tang, Chuanbing

    2012-05-14

    We report a new generation of nanodielectric energy storage materials based on supramolecular block copolymers. In our approach, highly polarizable, conducting nanodomains are embedded within an insulating matrix through block copolymer microphase separation. An applied electric field leads to electronic polarization of the conducting domains. The high interfacial area of microphase-separated domains amplifies the polarization, leading to high dielectric permittivity. Specifically, reversible addition fragmentation transfer (RAFT) polymerization was used to prepare block copolymers with poly(methyl acrylate) (PMA) as the insulating segment and a strongly acidic dopant moiety, poly-(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA), as the basis for the conducting segment. The PAMPSA block was complexed with an oligoaniline trimer to form a dopant-conjugated moiety complex that is electronically conductive after oxidation. For the undoped neat block copolymers, the increase of the PMA block length leads to a transition in dielectric properties from ionic conductor to dielectric capacitor with polarization resulting from migration of protons within the isolated PAMPSA domains. The oligoaniline-doped copolymers show remarkably different dielectric properties. At frequencies above 200 kHz, they exhibit characteristics of dielectric capacitors with much higher permittivity and lower dielectric loss than the corresponding undoped copolymers. PMID:22331602

  16. Exploiting the Different Polarity in Piezoresistive Characteristics of Conducting Polymers for Strain Gauge Applications

    NASA Astrophysics Data System (ADS)

    Sezen, Melda; Register, Jeffrey T.; Yao, Yao; Glisic, Branko; Loo, Yueh-Lin

    2015-03-01

    Piezoresistivity defines the change in resistance of a material in response to mechanical stress. We exploited the effects of structural modifications on the piezoresistive properties of conducting polymers, poly(2-acrylamido-2-methyl-1-propanesulfonic acid) doped polyaniline, PANI-PAAMPSA, and poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate), PEDOT:PSS, for strain gauge applications. Under tensile deformation, the resistances of as-cast PANI-PAAMPSA and PEDOT:PSS increase due to increased separation between the electrostatically stabilized conducting polymer particles. Upon solvent annealing in dichloroacetic acid, DCA, PANI-PAAMPSA's resistance decreases whereas PEDOT:PSS's resistance still increases with tension. While DCA treatment reduces the electrostatic interactions between PANI and PAAMPSA, it only removes the PSS overlayer in PEDOT:PSS. The change in the polarity of PANI-PAAMPSA's piezoresistivity is attributed to the unlocking of the globular structure of the as-synthesized conducting polymer complex with DCA-treatment, which then enables strain-induced crystallization on deformation. By tuning the piezoresistive characteristics of the polymers through structural modification, we can design strain gauge circuits for monitoring the conditions of civil structures.

  17. Synthesis of magnetic composite nanoparticles enveloped in copolymers specified for scale inhibition application

    NASA Astrophysics Data System (ADS)

    Do, Bao Phuong Huu; Dung Nguyen, Ba; Duy Nguyen, Hoang; Nguyen, Phuong Tung

    2013-12-01

    We report the synthesis of magnetic iron oxide nanoparticles encapsulated in maleic acid-2-acrylamido-2-methyl-1-propanesulfonate based polymer. This composite nanoparticle is specified for the high-pressure/high-temperature (HPHT) oilfield scale inhibition application. The process includes a facile-ultrasound-supported addition reaction to obtain iron oxide nanoparticles with surface coated by oleic acid. Then via inverse microemulsion polymerization with selected monomers, the specifically designed copolymers have been formatted in nanoscale. The structure and morphology of obtained materials were characterized by transmission electron microscopy (TEM), x-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and the thermal stability. The effectiveness of synthesized compounds as a carbonate scale inhibitor was investigated by testing method NACE standard TM 03-074-95 at aging temperature of 70, 90 and 120 °C. The magnetic nanocomposite particles can be easily collected and detected demonstrating their superior monitoring ability, which is absent in the case of conventional copolymer-based scale inhibitor.

  18. Blood coagulation and platelet adhesion on polyaniline films.

    PubMed

    Humpolíček, Petr; Kuceková, Zdenka; Kašpárková, Věra; Pelková, Jana; Modic, Martina; Junkar, Ita; Trchová, Miroslava; Bober, Patrycja; Stejskal, Jaroslav; Lehocký, Marián

    2015-09-01

    Polyaniline is a promising conducting polymer with still increasing application potential in biomedicine. Its surface modification can be an efficient way how to introduce desired functional groups and to control its properties while keeping the bulk characteristics of the material unchanged. The purpose of the study was to synthetize thin films of pristine conducting polyaniline hydrochloride, non-conducting polyaniline base and polyaniline modified with poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA) and investigate chosen parameters of their hemocompatibility. The modification was performed either by introduction of PAMPSA during the synthesis or by reprotonation of polyaniline base. The polyaniline hydrochloride and polyaniline base had no impact on blood coagulation and platelet adhesion. By contrast, the polyaniline reprotonated with PAMPSA completely hindered coagulation thanks to its interaction with coagulation factors Xa, Va and IIa. The significantly lower platelets adhesion was also found on this surface. Moreover, this film maintains its conductivity at pH of 6, which is an improvement in comparison with standard polyaniline hydrochloride losing most of its conductivity at pH of 4. Polyaniline film with PAMPSA introduced during synthesis had an impact on platelet adhesion but not on coagulation. The combined conductivity, anticoagulation activity, low platelet adhesion and improved conductivity at pH closer to physiological, open up new possibilities for application of polyaniline reprotonated by PAMPSA in blood-contacting devices, such as catheters or blood vessel grafts. PMID:26119372

  19. Synthesis of Polymer-Coated Magnetic Nanoparticles from Red Mud Waste for Enhanced Oil Recovery in Offshore Reservoirs

    NASA Astrophysics Data System (ADS)

    Nguyen, T. P.; Le, U. T. P.; Ngo, K. T.; Pham, K. D.; Dinh, L. X.

    2016-04-01

    Buried red mud waste from groundwater refineries can cause pollution. The aim of this paper is to utilize this mud for the synthesis of Fe3O4 magnetic nanoparticles (MNPs). Then, MNPs are encapsulated by a copolymer of methyl methacrylate and 2-acrylamido-2-methyl-1-propanesulfonate via oleic acid linker. MNPs are prepared by a controlled co-precipitation method in the presence of a dispersant and surface-modified agents to achieve a high hydrophobic or hydrophilic surface. Mini-emulsion polymerization was conducted to construct a core-shell structure with MNPs as core and the copolymer as shell. The core-shell structure of the obtained particles enables them to disperse well in brine and to stabilize at high-temperature environments. The chemical structures and morphology of this nanocomposite were investigated by Fourier transform infrared spectroscopy, transmission electron microscopy, and field emission scanning electron microscopy. The thermal stability of the nanocomposite was evaluated via a thermogravimetric analysis method for the solid state and an annealing experiment for the liquid state. The nanocomposite is about 14 nm, disperses well in brine and is thermally stable in the solid state. The blends of synthesized nanocomposite and carboxylate surfactant effectively reduced the interfacial tension between crude oil and brine, and remained thermally stable after 31 days annealed at 100°C. Therefore, a nanofluid of copolymer/magnetic nanocomposite can be applied as an enhanced oil recovery agent for harsh environments in offshore reservoirs.

  20. Facile fabrication of hierarchical ZnO microstructures assisted with PAMPSA and enhancement of green emission

    NASA Astrophysics Data System (ADS)

    Huang, Qiang; Cun, Tangxiang; Zuo, Wenbin; Liu, Jianping

    2015-03-01

    We report the fabrication of hierarchically microstructured flower-like ZnO by a facile and single-step procedure involving poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA) assisted aqueous chemical method. The shapes and sizes can be controlled just by varying the concentrations of the water-soluble polymer. When a suitable PAMPAS concentration was utilized, uniform well-defined and mono-dispersed chrysanthemum-like ZnO microstructures based on nanorod building blocks were obtained. The formation mechanism of the hierarchical structure was presented. The structured studies using XRD, HRTEM and SAED reveal these ZnO nanorods are composed of a single phase nature with wurtzite structure and grow along with the c-axis. FTIR spectrum indicated the incorporation of a trace of PAMPSA into ZnO crystals. HRTEM, Raman and XPS analyses showed that the hierarchical ZnO microstructures contain high concentration of oxygen vacancies which enable them exhibiting a significant intense deep-level emission centered at green luminescence in its photoluminescence spectra. They also show enhanced photocatalytic efficiency in degradation of methylene blue. It is hoped that the present work may provide a simple method to fabricate ZnO hierarchical microstructures and a positive relationship among polar plane, oxygen vacancy and green emission.

  1. In-situ graft-polymerization preparation of cation-exchange supermacroporous cryogel with sulfo groups in glass columns.

    PubMed

    Yao, Kejian; Yun, Junxian; Shen, Shaochuan; Chen, Fang

    2007-07-20

    Graft polymerization of monomer chains with expected functional groups onto the matrix pore surfaces by initiator is an effective approach for introducing ion-exchange groups to cryogel matrix to get anion- or cation-exchange supermacroporous cryogels. In this work, a novel cation-exchange cryogel with sulfo binding groups was prepared by grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) onto polyacrylamide-based cryogels in glass columns. The grafting polymerization was achieved in an in-situ manner which was performed by pumping the initiator and the reactive solution of graft monomer with sulfo binding groups directly through a cryogel bed pre-produced in a glass column under frozen condition. The axial liquid dispersion characteristics within the monolithic cryogel beds before and after the in-situ polymerization were compared by measuring residence time distributions (RTDs) at various liquid flow rates using tracer pulse-response method. Microstructure morphology of pores within cryogels was analyzed by scanning electron microscopy (SEM). Chromatography of lysozyme was carried out to reveal the protein breakthrough and elution characteristics in the obtained cryogel beds. PMID:17517417

  2. Dynamics in Multicomponent Polyelectrolyte Solutions

    NASA Astrophysics Data System (ADS)

    Nagao, Michihiro

    2010-03-01

    Double-network hydrogels (DN-gel) prepared from the combination of a moderately cross-linked anionic polyelectrolyte (poly(2-acrylamido-2-methyl-1-propanesulfonic acid), PAMPS) and an un-cross-linked linear polymer (polyacrylamide, PAAm) solution show strong mechanical properties far superior to that of their individual constituents [1]. To determine the origin of the superior properties of DN-gels, we investigated the structure and the chain dynamics of model PAMPS/PAAm solution blends using small-angle neutron scattering and neutron spin-echo measurements [2]. Akcasu's dynamic scattering theory for a multicomponent system [3] is modified to include polyelectrolytes, and the resulting equation describes well the neutron spin-echo results over the entire wavevector range covered in our experiments. Parameters such as effective solvent viscosity were deduced from the measured data using the modified Akcasu equation. Both the relaxation time at large length scales (10-100 nm) and the segmental diffusion coefficient at short length scales (0.1-1 nm) or the effective solvent viscosity show good accordance with the macroscopic rheological behavior of the solution blends. [4pt] [1] J.P. Gong et al., Adv. Mater. 15, 1155 (2003). [0pt] [2] S. Lee et al., Macromolecules 42, 1293 (2009). [0pt] [2] A.Z. Akcasu, in Dynamic Liht Scattering, The Method and Some Applications; W. Brown Ed. (Oxford University Press, London 1992).

  3. Synthesis of Polymer-Coated Magnetic Nanoparticles from Red Mud Waste for Enhanced Oil Recovery in Offshore Reservoirs

    NASA Astrophysics Data System (ADS)

    Nguyen, T. P.; Le, U. T. P.; Ngo, K. T.; Pham, K. D.; Dinh, L. X.

    2016-07-01

    Buried red mud waste from groundwater refineries can cause pollution. The aim of this paper is to utilize this mud for the synthesis of Fe3O4 magnetic nanoparticles (MNPs). Then, MNPs are encapsulated by a copolymer of methyl methacrylate and 2-acrylamido-2-methyl-1-propanesulfonate via oleic acid linker. MNPs are prepared by a controlled co-precipitation method in the presence of a dispersant and surface-modified agents to achieve a high hydrophobic or hydrophilic surface. Mini-emulsion polymerization was conducted to construct a core-shell structure with MNPs as core and the copolymer as shell. The core-shell structure of the obtained particles enables them to disperse well in brine and to stabilize at high-temperature environments. The chemical structures and morphology of this nanocomposite were investigated by Fourier transform infrared spectroscopy, transmission electron microscopy, and field emission scanning electron microscopy. The thermal stability of the nanocomposite was evaluated via a thermogravimetric analysis method for the solid state and an annealing experiment for the liquid state. The nanocomposite is about 14 nm, disperses well in brine and is thermally stable in the solid state. The blends of synthesized nanocomposite and carboxylate surfactant effectively reduced the interfacial tension between crude oil and brine, and remained thermally stable after 31 days annealed at 100°C. Therefore, a nanofluid of copolymer/magnetic nanocomposite can be applied as an enhanced oil recovery agent for harsh environments in offshore reservoirs.

  4. Drilling fluids containing amps, acrylic acid, itaconic acid polymer

    SciTech Connect

    Bardoliwalla, D.F.

    1987-10-13

    This patent describes an aqueous drilling fluid having present in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component, there being from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has a weight average molecular weight of between about 50,000 to about 1,000,000 being in its free acid or partially or completely neutralized form and being at least water dispersible. A method is described of drilling a well into a subterranean formation in which an aqueous drilling fluid is circulated into the well. The step of circulating the drilling fluid contains in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component. There is from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has weight average molecular weight of between about 50,000 to about 1,000,000 in its free acid or partially or completely neutralized form and is at least water dispersible.

  5. Conductive Polymeric Binder for Lithium-Ion Battery Anode

    NASA Astrophysics Data System (ADS)

    Gao, Tianxiang

    Tin (Sn) has a high-specific capacity (993 mAhg-1) as an anode material for Li-ion batteries. To overcome the poor cycling performance issue caused by its large volume expansion and pulverization during the charging and discharging process, many researchers put efforts into it. Most of the strategies are through nanostructured material design and introducing conductive polymer binders that serve as matrix of the active material in anode. This thesis aims for developing a novel method for preparing the anode to improve the capacity retention rate. This would require the anode to have high electrical conductivity, high ionic conductivity, and good mechanical properties, especially elasticity. Here the incorporation of a conducting polymer and a conductive hydrogel in Sn-based anodes using a one-step electrochemical deposition via a 3-electrode cell method is reported: the Sn particles and conductive component can be electrochemically synthesized and simultaneously deposited into a hybrid thin film onto the working electrode directly forming the anode. A well-defined three dimensional network structure consisting of Sn nanoparticles coated by conducting polymers is achieved. Such a conductive polymer-hydrogel network has multiple advantageous features: meshporous polymeric structure can offer the pathway for lithium ion transfer between the anode and electrolyte; the continuous electrically conductive polypyrrole network, with the electrostatic interaction with elastic, porous hydrogel, poly (2-acrylamido-2-methyl-1-propanesulfonic acid-co-acrylonitrile) (PAMPS) as both the crosslinker and doping anion for polypyrrole (PPy) can decrease the volume expansion by creating porous scaffold and softening the system itself. Furthermore, by increasing the amount of PAMPS and creating an interval can improve the cycling performance, resulting in improved capacity retention about 80% after 20 cycles, compared with only 54% of that of the control sample without PAMPS. The cycle

  6. Post-polymerization photografting on methacrylate-based monoliths for separation of intact proteins and protein digests with comprehensive two-dimensional liquid chromatography hyphenated with high-resolution mass spectrometry.

    PubMed

    Vonk, Rudy J; Wouters, Sam; Barcaru, Andrei; Vivó-Truyols, Gabriel; Eeltink, Sebastiaan; de Koning, Leo J; Schoenmakers, Peter J

    2015-05-01

    Post-polymerization photografting is a versatile tool to alter the surface chemistry of organic-based monoliths so as to obtain desired stationary phase properties. In this study, 2-acrylamido-2-methyl-1-propanesulfonic acid was grafted to a hydrophobic poly(butyl methacrylate-co-ethylene glycol dimethacrylate) monolith to create a strong cation exchange stationary phase. Both single-step and two-step photografting were addressed, and the effects of grafting conditions were assessed. An experimental design has been applied in an attempt to optimize three of the key parameters of the two-step photografting chemistry, i.e. the grafting time of the initiator, the monomer concentration and the monomer irradiation time. The photografted columns were implemented in a comprehensive two-dimensional column liquid chromatography ( (t) LC ×  (t) LC) workflow and applied for the separation of intact proteins and peptides. A baseline separation of 11 intact proteins was obtained within 20 min by implementing a gradient across a limited RP composition window in the second dimension. (t) LC ×  (t) LC with UV detection was used for the separation of cytochrome c digest, bovine serum insulin digest and a digest of a complex protein mixture. A semi-quantitative estimation of the occupation of separation space, the orthogonality, of the (t) LC ×  (t) LC system yielded 75%. The (t) LC ×  (t) LC setup was hyphenated to a high-resolution Fourier transform ion cyclotron resonance mass spectrometer instrument to identify the bovine serum insulin tryptic peptides and to demonstrate the compatibility with MS analysis. PMID:25801383

  7. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  8. Lithocholic acid attenuates cAMP-dependent Cl- secretion in human colonic epithelial T84 cells.

    PubMed

    Ao, Mei; Domingue, Jada C; Khan, Nabihah; Javed, Fatima; Osmani, Kashif; Sarathy, Jayashree; Rao, Mrinalini C

    2016-06-01

    Bile acids (BAs) play a complex role in colonic fluid secretion. We showed that dihydroxy BAs, but not the monohydroxy BA lithocholic acid (LCA), stimulate Cl(-) secretion in human colonic T84 cells (Ao M, Sarathy J, Domingue J, Alrefai WA, Rao MC. Am J Physiol Cell Physiol 305: C447-C456, 2013). In this study, we explored the effect of LCA on the action of other secretagogues in T84 cells. While LCA (50 μM, 15 min) drastically (>90%) inhibited FSK-stimulated short-circuit current (Isc), it did not alter carbachol-stimulated Isc LCA did not alter basal Isc, transepithelial resistance, cell viability, or cytotoxicity. LCA's inhibitory effect was dose dependent, acted faster from the apical membrane, rapid, and not immediately reversible. LCA also prevented the Isc stimulated by the cAMP-dependent secretagogues 8-bromo-cAMP, lubiprostone, or chenodeoxycholic acid (CDCA). The LCA inhibitory effect was BA specific, since CDCA, cholic acid, or taurodeoxycholic acid did not alter FSK or carbachol action. While LCA alone had no effect on intracellular cAMP concentration ([cAMP]i), it decreased FSK-stimulated [cAMP]i by 90%. Although LCA caused a small increase in intracellular Ca(2+) concentration ([Ca(2+)]i), chelation by BAPTA-AM did not reverse LCA's effect on Isc LCA action does not appear to involve known BA receptors, farnesoid X receptor, vitamin D receptor, muscarinic acetylcholine receptor M3, or bile acid-specific transmembrane G protein-coupled receptor 5. LCA significantly increased ERK1/2 phosphorylation, which was completely abolished by the MEK inhibitor PD-98059. Surprisingly PD-98059 did not reverse LCA's effect on Isc Finally, although LCA had no effect on basal Isc, nystatin permeabilization studies showed that LCA both stimulates an apical cystic fibrosis transmembrane conductance regulator Cl(-) current and inhibits a basolateral K(+) current. In summary, 50 μM LCA greatly inhibits cAMP-stimulated Cl(-) secretion, making low doses of LCA of

  9. Cyclic AMP-dependent Protein Lysine Acylation in Mycobacteria Regulates Fatty Acid and Propionate Metabolism*

    PubMed Central

    Nambi, Subhalaxmi; Gupta, Kallol; Bhattacharyya, Moitrayee; Ramakrishnan, Parvathy; Ravikumar, Vaishnavi; Siddiqui, Nida; Thomas, Ann Terene; Visweswariah, Sandhya S.

    2013-01-01

    Acetylation of lysine residues is a posttranslational modification that is used by both eukaryotes and prokaryotes to regulate a variety of biological processes. Here we identify multiple substrates for the cAMP-dependent protein lysine acetyltransferase from Mycobacterium tuberculosis (KATmt). We demonstrate that a catalytically important lysine residue in a number of FadD (fatty acyl CoA synthetase) enzymes is acetylated by KATmt in a cAMP-dependent manner and that acetylation inhibits the activity of FadD enzymes. A sirtuin-like enzyme can deacetylate multiple FadDs, thus completing the regulatory cycle. Using a strain deleted for the KATmt ortholog in Mycobacterium bovis Bacillus Calmette-Guérin (BCG), we show for the first time that acetylation is dependent on intracellular cAMP levels. KATmt can utilize propionyl CoA as a substrate and, therefore, plays a critical role in alleviating propionyl CoA toxicity in mycobacteria by inactivating acyl CoA synthetase (ACS). The precision by which mycobacteria can regulate the metabolism of fatty acids in a cAMP-dependent manner appears to be unparalleled in other biological organisms and is ideally suited to adapt to the complex environment that pathogenic mycobacteria experience in the host. PMID:23553634

  10. Eosinophil viability is increased by acidic pH in a cAMP- and GPR65-dependent manner.

    PubMed

    Kottyan, Leah C; Collier, Ann R; Cao, Khanh H; Niese, Kathryn A; Hedgebeth, Megan; Radu, Caius G; Witte, Owen N; Khurana Hershey, Gurjit K; Rothenberg, Marc E; Zimmermann, Nives

    2009-09-24

    The microenvironment of the lung in asthma is acidic, yet the effect of acidity on inflammatory cells has not been well established. We now demonstrate that acidity inhibits eosinophil apoptosis and increases cellular viability in a dose-dependent manner between pH 7.5 and 6.0. Notably, acidity induced eosinophil cyclic adenosine 5'-monophosphate (cAMP) production and enhanced cellular viability in an adenylate cyclase-dependent manner. Furthermore, we identify G protein-coupled receptor 65 (GPR65) as the chief acid-sensing receptor expressed by eosinophils, as GPR65-deficient eosinophils were resistant to acid-induced eosinophil cAMP production and enhanced viability. Notably, GPR65(-/-) mice had attenuated airway eosinophilia and increased apoptosis in 2 distinct models of allergic airway disease. We conclude that eosinophil viability is increased in acidic microenvironments in a cAMP- and GPR65-dependent manner. PMID:19641187

  11. Eosinophil viability is increased by acidic pH in a cAMP- and GPR65-dependent manner

    PubMed Central

    Kottyan, Leah C.; Collier, Ann R.; Cao, Khanh H.; Niese, Kathryn A.; Hedgebeth, Megan; Radu, Caius G.; Witte, Owen N.; Khurana Hershey, Gurjit K.; Rothenberg, Marc E.

    2009-01-01

    The microenvironment of the lung in asthma is acidic, yet the effect of acidity on inflammatory cells has not been well established. We now demonstrate that acidity inhibits eosinophil apoptosis and increases cellular viability in a dose-dependent manner between pH 7.5 and 6.0. Notably, acidity induced eosinophil cyclic adenosine 5′-monophosphate (cAMP) production and enhanced cellular viability in an adenylate cyclase–dependent manner. Furthermore, we identify G protein-coupled receptor 65 (GPR65) as the chief acid-sensing receptor expressed by eosinophils, as GPR65-deficient eosinophils were resistant to acid-induced eosinophil cAMP production and enhanced viability. Notably, GPR65−/− mice had attenuated airway eosinophilia and increased apoptosis in 2 distinct models of allergic airway disease. We conclude that eosinophil viability is increased in acidic microenvironments in a cAMP- and GPR65-dependent manner. PMID:19641187

  12. Synthesis, structural characterization and effect on human granulocyte intracellular cAMP levels of abscisic acid analogs.

    PubMed

    Bellotti, Marta; Salis, Annalisa; Grozio, Alessia; Damonte, Gianluca; Vigliarolo, Tiziana; Galatini, Andrea; Zocchi, Elena; Benatti, Umberto; Millo, Enrico

    2015-01-01

    The phytohormone abscisic acid (ABA), in addition to regulating physiological functions in plants, is also produced and released by several mammalian cell types, including human granulocytes, where it stimulates innate immune functions via an increase of the intracellular cAMP concentration ([cAMP]i). We synthesized several ABA analogs and evaluated the structure-activity relationship, by the systematical modification of selected regions of these analogs. The resulting molecules were tested for their ability to inhibit the ABA-induced increase of [cAMP]i in human granulocytes. The analogs with modified configurations at C-2' and C-3' abrogated the ABA-induced increase of the [cAMP]i and also inhibited several pro-inflammatory effects induced by exogenous ABA on granulocytes and monocytes. Accordingly, these analogs could be suitable as novel putative anti-inflammatory compounds. PMID:25496807

  13. Lipoic acid stimulates cAMP production via G protein-coupled receptor-dependent and -independent mechanisms.

    PubMed

    Salinthone, Sonemany; Schillace, Robynn V; Tsang, Catherine; Regan, John W; Bourdette, Dennis N; Carr, Daniel W

    2011-07-01

    Lipoic acid (LA) is a naturally occurring fatty acid that exhibits anti-oxidant and anti-inflammatory properties and is being pursued as a therapeutic for many diseases including multiple sclerosis, diabetic polyneuropathy and Alzheimer's disease. We previously reported on the novel finding that racemic LA (50:50 mixture of R-LA and S-LA) stimulates cAMP production, activates prostanoid EP2 and EP4 receptors and adenylyl cyclases (AC), and suppresses activation and cytotoxicity in NK cells. In this study, we present evidence that furthers our understanding of the mechanisms of action of LA. Using various LA derivatives, such as dihydrolipoic acid (DHLA), S,S-dimethyl lipoic acid (DMLA) and lipoamide (LPM), we discovered that only LA is capable of stimulating cAMP production in NK cells. Furthermore, there is no difference in cAMP production after stimulation with either R-LA, S-LA or racemic LA. Competition and synergistic studies indicate that LA may also activate AC independent of the EP2 and EP4 receptors. Pretreatment of PBMCs with KH7 (a specific peptide inhibitor of soluble AC) and the calcium inhibitor (Bapta) prior to LA treatment resulted in reduced cAMP levels, suggesting that soluble AC and calcium signaling mediate LA stimulation of cAMP production. In addition, pharmacological inhibitor studies demonstrate that LA also activates other G protein-coupled receptors, including histamine and adenosine but not the β-adrenergic receptors. These novel findings provide information to better understand the mechanisms of action of LA, which can help facilitate the use of LA as a therapeutic for various diseases. PMID:21036588

  14. A link of Ca2+ to cAMP oscillations in Dictyostelium: the calmodulin antagonist W-7 potentiates cAMP relay and transiently inhibits the acidic Ca2+-store

    PubMed Central

    Malchow, Dieter; Lusche, Daniel F; Schlatterer, Christina

    2004-01-01

    Background During early differentiation of Dictyostelium the attractant cAMP is released periodically to induce aggregation of the cells. Here we pursue the question whether pulsatile cAMP signaling is coupled to a basic Ca2+-oscillation. Results We found that the calmodulin antagonist W-7 transiently enhanced cAMP spikes. We show that W-7 acts on an acidic Ca2+-store: it abolished ATP-dependent vesicular acidification, inhibited V-type H+ATPase activity more potently than the weaker antagonist W-5 and caused vesicular Ca2+-leakage. Concanamycin A, an inhibitor of the V-type H+-pump, blocked the Ca2+-leakage elicited by W-7 as well as cAMP-oscillations in the presence of W-7. Concanamycin A caused an increase of the cytosolic Ca2+-concentration whereas W-7 did not. In case of the latter, Ca2+ was secreted by the cells. In accord with our hypothesis that the link from Ca2+ to cAMP synthesis is mediated by a Ca2+-dependent phospholipase C we found that W-7 was not active in the phospholipase C knockout mutant. Conclusion We conclude that the potentiation of cAMP relay by W-7 is due to a transient inhibition of the acidic Ca2+-store. The inhibition of the proton pump by W-7 causes a leakage of Ca2+ that indirectly stimulates adenylyl cyclase activity via phospholipase C. PMID:15147588

  15. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  16. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells

    PubMed Central

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  17. Comparative Analysis of Dibutyric cAMP and Butyric Acid on the Differentiation of Human Eosinophilic Leukemia EoL-1 Cells

    PubMed Central

    2015-01-01

    Purification of enough numbers of circulating eosinophils is difficult because eosinophils account for less than 5% peripheral blood leukocytes. Human eosinophilic leukemia EoL-1 cells have been considered an in vitro source of eosinophils as they can differentiate into mature eosinophil-like cells when incubated with dibutyryl cAMP (dbcAMP) or butyric acid. In this study, the viability and phenotypic maturation of EoL-1 cells stimulated by either dbcAMP or butyric acid were comparatively analyzed. After treatment with 100 µM dbcAMP or 0.5 µM butyric acid, EoL-1 cells showed morphological signs of differentiation, although the number of nonviable EoL-1 cells was significantly increased following butyric acid treatment. Stimulation of EoL-1 cells with 0.5 µM butyric acid more effectively induced the expression of mature eosinophil markers than stimulation with dbcAMP. These results suggest that treatment of EoL-1 cells with 0.5 µM butyric acid for limited duration could be an effective strategy for inducing their differentiation. Considering that expression of CCR3 was not sufficient in EoL-1 cells stimulated with 0.5 µM butyric acid, treatment of the chemically stimulated EoL-1 cells with cytokines, which primarily support eosinophil maturation, would help to obtain differentiated EoL-1 cells with greater functional maturity. PMID:26770185

  18. [Effect of aluminium and cAMP on acid phosphatase from the apoplast of barley and maize root cells].

    PubMed

    Fedorovskaia, M D; Tikhaia, N I

    2003-01-01

    Acid phosphatase activity inhibited by 1 mM sodium molybdate was detected at the surface of barley seedling roots and in the cell wall fraction isolated from barley and maize seedling roots. This enzyme hydrolyzed NPP, GP, and PPi at low pH (4.0 and below). NPP hydrolysis was stimulated by magnesium (but not calcium or manganese) ions, while PPi hydrolysis was independent of the presence of bivalent ions. The activity of phosphatase localized in the cell walls of the both crops increased in the presence of 100 microM AlCl3 or CuCl2. Stimulation of NPP hydrolysis by micromolar concentrations of aluminium and copper as well as by millimolar concentrations of magnesium decreased in the presence of 25 microM cAMP. This agrees with the previous data on the enzyme localized at the outer side of the properly oriented vesicles in the microscomal fraction of plasmalemma. The role of the root extracellular acid phosphatase loosely associated with various apoplast structures in plant adaptation to toxic effect of aluminium in the acidic soils as well as possible control of this process by cAMP secretion to the apoplast are discussed. PMID:12712579

  19. Preferential hydrophobic interactions are responsible for a preference of D-amino acids in the aminoacylation of 5'-AMP with hydrophobic amino acids

    NASA Technical Reports Server (NTRS)

    Lacey, J. C. Jr; Wickramasinghe, N. S.; Sabatini, R. S.

    1992-01-01

    We have studied the chemistry of aminoacyl AMP to model reactions at the 3' terminus of aminoacyl tRNA for the purpose of understanding the origin of protein synthesis. The present studies relate to the D, L preference in the esterification of 5'-AMP. All N-acetyl amino acids we studied showed faster reaction of the D-isomer, with a generally decreasing preference for D-isomer as the hydrophobicity of the amino acid decreased. The beta-branched amino acids, Ile and Val, showed an extreme preference for D-isomer. Ac-Leu, the gamma-branched amino acid, showed a slightly low D/L ratio relative to its hydrophobicity. The molecular basis for these preferences for D-isomer is understandable in the light of our previous studies and seems to be due to preferential hydrophobic interaction of the D-isomer with adenine. The preference for hydrophobic D-amino acids can be decreased by addition of an organic solvent to the reaction medium. Conversely, peptidylation with Ac-PhePhe shows a preference for the LL isomer over the DD isomer.

  20. Cyclic AMP infusion and blood sugar, serum insulin and serum nonesterified fatty acid responses to glucose in recent experimental hyperthyroid dogs.

    PubMed

    Renauld, A; Garrido, D

    1992-01-01

    Recent experimental hyperthyroid (REH) dogs exhibit poor "in vivo" insulin responses to glucose probably due to a failure somewhere in cAMP-adenylate cyclase system. The actions of exogenous cAMP on these responses and on the regulation of blood sugar (BS) and serum nonesterified fatty acids (NEFA) during glucose infusion tests (GIT) in REH and normal dogs were studied here. Hyperthyroidism was induced by 1-thyroxine administration (100 micrograms/kg body wt./die, 10 days). GIT consisted of i.v. glucose-priming followed by glucose i.v. continuous infusion (60 min). cAMP (0, 33 or 66 mg/kg body wt./min) was infused alone (30 min) and then overlapped to gluco-se infusion (60 min). Peripheral veins were used for infusions and blood sample withdrawal. BS, serum inmunoreactive insulin (IRI) and serum NEFA concentrations, basally and throughout the test, were measured. Basally, there was neither action nor interaction of hyperthyroidism and exogenous cAMP on these variables. During the GIT, the BS levels remained unaffected by hyperthyroidism; cAMP increased them, but failed to interact with hyperthyroidism. cAMP noninfused normal dogs responded to hyperglycemia with hyperinsulinemia, whereas REH dogs noninfused the nucleotide did not. cAMP administration at a high dose promoted their response in normal and REH dogs, particularly in the former; in the latter, the response was still lower than in cAMP noninfused normal controls. Although recent hyperthyroidism increased serum NEFA basal level, it exerted neither action nor interaction with the infused cAMP on serum NEFA during GIT. Results are discussed on the basis that the abolished insulin secretion "in vivo" characterizing the REH dogs, related to beta-adrenergic deficiency, can be for the most part restored by exogenous cAMP administration, despite which some glucose and triglyceride metabolism impairments are developed. PMID:1343982

  1. Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression

    PubMed Central

    Osawa, Yosuke; Seki, Ekihiro; Kodama, Yuzo; Suetsugu, Atsushi; Miura, Kouichi; Adachi, Masayuki; Ito, Hiroyasu; Shiratori, Yoshimune; Banno, Yoshiko; Olefsky, Jerrold M.; Nagaki, Masahito; Moriwaki, Hisataka; Brenner, David A.; Seishima, Mitsuru

    2011-01-01

    Acid sphingomyelinase (ASM) regulates the homeostasis of sphingolipids, including ceramides and sphingosine-1-phosphate (S1P). Because sphingolipids regulate AKT activation, we investigated the role of ASM in hepatic glucose and lipid metabolism. Initially, we overexpressed ASM in the livers of wild-type and diabetic db/db mice by adenovirus vector (Ad5ASM). In these mice, glucose tolerance was improved, and glycogen and lipid accumulation in the liver were increased. Using primary cultured hepatocytes, we confirmed that ASM increased glucose uptake, glycogen deposition, and lipid accumulation through activation of AKT and glycogen synthase kinase-3β. In addition, ASM induced up-regulation of glucose transporter 2 accompanied by suppression of AMP-activated protein kinase (AMPK) phosphorylation. Loss of sphingosine kinase-1 (SphK1) diminished ASM-mediated AKT phosphorylation, but exogenous S1P induced AKT activation in hepatocytes. In contrast, SphK1 deficiency did not affect AMPK activation. These results suggest that the SphK/S1P pathway is required for ASM-mediated AKT activation but not for AMPK inactivation. Finally, we found that treatment with high-dose glucose increased glycogen deposition and lipid accumulation in wild-type hepatocytes but not in ASM−/− cells. This result is consistent with glucose intolerance in ASM−/− mice. In conclusion, ASM modulates AKT activation and AMPK inactivation, thus regulating glucose and lipid metabolism in the liver.—Osawa, Y., Seki, E., Kodama, Y., Suetsugu, A., Miura, K., Adachi, M., Ito, H., Shiratori, Y., Banno, Y., Olefsky, J. M., Nagaki, M., Moriwaki, H., Brenner, D. A., Seishima, M. Acid sphingomyelinase regulates glucose and lipid metabolism in hepatocytes through AKT activation and AMP-activated protein kinase suppression. PMID:21163859

  2. Highly efficient peptide formation from N-acetylaminoacyl-AMP anhydride and free amino acid

    NASA Technical Reports Server (NTRS)

    Mullins, D. W., Jr.; Lacey, J. C., Jr.

    1983-01-01

    The kinetics of formation of the N-blocked dipeptide, N-acetylglycylglycine, from N-acetylglycyl adenylate anhydride and glycine in aqueous solution at 25 C, and at various PH's are reported. The reaction is of interest in that over a physiologically relevant pH range (6-8), peptide synthesis proceeds more rapidly than hydrolysis, even at those pH's at which this compound becomes increasingly susceptible to base-catalyzed hydrolysis. Under similar conditions, the corresponding unblocked aminoacyl adenylate anhydrides are considerably more unstable, and undergo appreciable hydrlysis in the presence of free amino acid. Because N-blocked aminoacyl adenylate anhydrides serve as model compounds of peptidyl adenylate anhydrides, these results suggest that primitive amino acid polymerization systems may have operated by cyclic reactivation of the peptidyl carboxyl group, rather than that of the incoming amino acid.

  3. Activation of AMP-activated protein kinase by retinoic acid sensitizes hepatocellular carcinoma cells to apoptosis induced by sorafenib

    PubMed Central

    Ishijima, Naoki; Kanki, Keita; Shimizu, Hiroki; Shiota, Goshi

    2015-01-01

    To improve the outcome of cancer chemotherapy, strategies to enhance the efficacy of anticancer drugs are required. Sorafenib is the only drug to prolong overall survival of the patients with hepatocellular carcinoma (HCC), however, the outcome is still not satisfactory. Retinoids, vitamin A derivatives, have been known to exhibit inhibitory effects on various cancers including HCC. In this study, we investigated the effects of combined treatment using sorafenib and retinoids including all-trans retinoic acid (ATRA), NIK-333, and Am80 on HCC cells. Cell viability assays in six HCC cell lines, HepG2, PLC/PRF/5, HuH6, HLE, HLF, and Hep3B, revealed that 5 and 10 μM ATRA, concentrations that do not exert cytotoxic effects, enhanced the cytotoxicity of sorafenib, being much more effective than NIK-333 and Am80. We found that ATRA induced AMP-activated protein kinase activation, which was followed by reduced intracellular ATP level. Gene expression analysis revealed that ATRA decreased the expression of glycolytic genes such as GLUT-1 and LDHA. In the combination treatment using ATRA and sorafenib, increased apoptosis, followed by the activation of p38 MAPK and JNK, the upregulation and translocation of Bax to mitochondria, and the activation of caspase-3, was observed. Suppression of AMP-activated protein kinase by siRNA restored the viability of the cells treated with ATRA and sorafenib. Our results thus indicate that ATRA is useful for enhancing the cytotoxicity of sorafenib against HCC cells by regulating the energy metabolism of HCC cells. PMID:25683251

  4. Activation of AMP-activated protein kinase by retinoic acid sensitizes hepatocellular carcinoma cells to apoptosis induced by sorafenib.

    PubMed

    Ishijima, Naoki; Kanki, Keita; Shimizu, Hiroki; Shiota, Goshi

    2015-05-01

    To improve the outcome of cancer chemotherapy, strategies to enhance the efficacy of anticancer drugs are required. Sorafenib is the only drug to prolong overall survival of the patients with hepatocellular carcinoma (HCC), however, the outcome is still not satisfactory. Retinoids, vitamin A derivatives, have been known to exhibit inhibitory effects on various cancers including HCC. In this study, we investigated the effects of combined treatment using sorafenib and retinoids including all-trans retinoic acid (ATRA), NIK-333, and Am80 on HCC cells. Cell viability assays in six HCC cell lines, HepG2, PLC/PRF/5, HuH6, HLE, HLF, and Hep3B, revealed that 5 and 10 μM ATRA, concentrations that do not exert cytotoxic effects, enhanced the cytotoxicity of sorafenib, being much more effective than NIK-333 and Am80. We found that ATRA induced AMP-activated protein kinase activation, which was followed by reduced intracellular ATP level. Gene expression analysis revealed that ATRA decreased the expression of glycolytic genes such as GLUT-1 and LDHA. In the combination treatment using ATRA and sorafenib, increased apoptosis, followed by the activation of p38 MAPK and JNK, the upregulation and translocation of Bax to mitochondria, and the activation of caspase-3, was observed. Suppression of AMP-activated protein kinase by siRNA restored the viability of the cells treated with ATRA and sorafenib. Our results thus indicate that ATRA is useful for enhancing the cytotoxicity of sorafenib against HCC cells by regulating the energy metabolism of HCC cells. PMID:25683251

  5. AMP kinase activation with AICAR further increases fatty acid oxidation and blunts triacylglycerol hydrolysis in contracting rat soleus muscle

    PubMed Central

    Smith, Angela C; Bruce, Clinton R; Dyck, David J

    2005-01-01

    Muscle contraction increases glucose uptake and fatty acid (FA) metabolism in isolated rat skeletal muscle, due at least in part to an increase in AMP-activated kinase activity (AMPK). However, the extent to which AMPK plays a role in the regulation of substrate utilization during contraction is not fully understood. We examined the acute effects of 5-aminoimidazole-4-carboxamide riboside (AICAR; 2 mm), a pharmacological activator of AMPK, on FA metabolism and glucose oxidation during high intensity tetanic contraction in isolated rat soleus muscle strips. Muscle strips were exposed to two different FA concentrations (low fatty acid, LFA, 0.2 mm; high fatty acid, HFA, 1 mm) to examine the role that FA availability may play in both exogenous and endogenous FA metabolism with contraction and AICAR. Synergistic increases in AMPK α2 activity (+45%; P < 0.05) were observed after 30 min of contraction with AICAR, which further increased exogenous FA oxidation (LFA: +71%, P < 0.05; HFA: +46%, P < 0.05) regardless of FA availability. While there were no changes in triacylglycerol (TAG) esterification, AICAR did increase the ratio of FA partitioned to oxidation relative to TAG esterification (LFA: +65%, P < 0.05). AICAR significantly blunted endogenous TAG hydrolysis (LFA: −294%, P < 0.001; HFA: −117%, P < 0.05), but had no effect on endogenous oxidation rates, suggesting a better matching between TAG hydrolysis and subsequent oxidative needs of the muscle. There was no effect of AICAR on the already elevated rates of glucose oxidation during contraction. These results suggest that FA metabolism is very sensitive to AMPK α2 stimulation during contraction. PMID:15774529

  6. Glucose Regulates Hypothalamic Long-chain Fatty Acid Metabolism via AMP-activated Kinase (AMPK) in Neurons and Astrocytes*

    PubMed Central

    Taïb, Bouchra; Bouyakdan, Khalil; Hryhorczuk, Cécile; Rodaros, Demetra; Fulton, Stephanie; Alquier, Thierry

    2013-01-01

    Hypothalamic controls of energy balance rely on the detection of circulating nutrients such as glucose and long-chain fatty acids (LCFA) by the mediobasal hypothalamus (MBH). LCFA metabolism in the MBH plays a key role in the control of food intake and glucose homeostasis, yet it is not known if glucose regulates LCFA oxidation and esterification in the MBH and, if so, which hypothalamic cell type(s) and intracellular signaling mechanisms are involved. The aim of this study was to determine the impact of glucose on LCFA metabolism, assess the role of AMP-activated Kinase (AMPK), and to establish if changes in LCFA metabolism and its regulation by glucose vary as a function of the kind of LCFA, cell type, and brain region. We show that glucose inhibits palmitate oxidation via AMPK in hypothalamic neuronal cell lines, primary hypothalamic astrocyte cultures, and MBH slices ex vivo but not in cortical astrocytes and slice preparations. In contrast, oleate oxidation was not affected by glucose or AMPK inhibition in MBH slices. In addition, our results show that glucose increases palmitate, but not oleate, esterification into neutral lipids in neurons and MBH slices but not in hypothalamic astrocytes. These findings reveal for the first time the metabolic fate of different LCFA in the MBH, demonstrate AMPK-dependent glucose regulation of LCFA oxidation in both astrocytes and neurons, and establish metabolic coupling of glucose and LCFA as a distinguishing feature of hypothalamic nuclei critical for the control of energy balance. PMID:24240094

  7. Effects of cAMP modulators on long-chain fatty-acid uptake and utilization by electrically stimulated rat cardiac myocytes.

    PubMed Central

    Luiken, J J F P; Willems, J; Coort, S L M; Coumans, W A; Bonen, A; Van Der Vusse, G J; Glatz, J F C

    2002-01-01

    Recently, we established that cellular contractions increase long-chain fatty-acid (FA) uptake by cardiac myocytes. This increase is dependent on the transport function of an 88 kDa membrane FA transporter, FA translocase (FAT/CD36), and, in analogy to skeletal muscle, is likely to involve its translocation from an intracellular pool to the sarcolemma. In the present study, we investigated whether cAMP-dependent signalling is involved in this translocation process. Isoproterenol, dibutyryl-cAMP and the phosphodiesterase (PDE) inhibitor, amrinone, which markedly raised the intracellular cAMP level, did not affect cellular FA uptake, but influenced the fate of intracellular FAs by directing these to mitochondrial oxidation in electrostimulated cardiac myocytes. The PDE inhibitors 3-isobutyl-1-methylxanthine, milrinone and dipyridamole each significantly stimulated FA uptake as well as intracellular cAMP levels, but these effects were quantitatively unrelated. The stimulatory effects of these PDE inhibitors were antagonized by sulpho- N -succinimidylpalmitate, indicating the involvement of FAT/CD36, albeit that the different PDE inhibitors use different molecular mechanisms to stimulate FAT/CD36-mediated FA uptake. Notably, 3-isobutyl-1-methylxanthine and milrinone increased the intrinsic activity of FAT/CD36, possibly through its covalent modification, and dipyridamole induces translocation of FAT/CD36 to the sarcolemma. Elevation of intracellular cGMP, but not of cAMP, by the PDE inhibitor zaprinast did not have any effect on FA uptake and metabolism by cardiac myocytes. The stimulatory effects of PDE inhibitors on cardiac FA uptake should be considered when applying these agents in clinical medicine. PMID:12093365

  8. The synthesis and characterization of environmentally-responsive water-swellable and water-soluble polymers for wastewater remediation

    NASA Astrophysics Data System (ADS)

    Armentrout, Rodney Scott

    The primary research goal is the development of new polymeric materials that demonstrate the environmentally-responsive sequestration of common water foulants, including surfactants and oils. Water-swellable and water-soluble polymers have been synthesized, structurally characterized, and their physical properties have been determined. In addition, the ability of the materials to sequester model water foulants has been evaluated. Anionic crosslinked polymer networks of 2-acrylamido-2-methyl-1-propanesulfonic acid, acrylamide, and methylene bisacrylamide have been synthesized and characterized by determining the equilibrium water contents as a function of ionic content of the polymer network. The molar ratio of bound surfactant to ionic group was determined to be less than one for all hydrogels studied, indicating an ion-exchange binding mechanism with minimal hydrophobic interactions between bound and unbound surfactant molecules is responsible for surfactant binding. Cationic crosslinked cyclopolymer networks of N,N-diallyl- N-methyl amine (DAMA) and N,N,N,N-tetraallyl ammonium chloride (TAAC) have been synthesized and characterized by determining the equilibrium water content as a function of pH. A maximum in the equilibrium water content is observed for pH-6 when the polymer is fully ionized. The solubilization of a model water foulant, p-cresol, by the polymeric surfactant, Pluronic F127, has been studied via equilibrium dialysis, dynamic light scattering and ultrafiltration experiments. It has been shown that at 25°C p-cresol is readily solubilized by F127 since the polymeric surfactant exists in a multimer conformation. Ultrafiltration experiments have demonstrated that the polymer-foulant binding interactions are largely unaffected by shear in a hollow fiber membrane. Copolymers of the zwitterionic monomer, 3-(N,N-diallyl- N-methyl ammonio) propane sulfonate (DAMAPS) and N,N-diallyl- N,N-dimethylammonium chloride (DADMAC) (the DADS series) or the p

  9. Effects of membrane polyunsaturated fatty acids on opiate peptide inhibition of basal and prostaglandin E1-stimulated cyclic AMP formation in intact N1E-115 neuroblastoma cells.

    PubMed

    Murphy, M G; Moak, C M; Rao, B G

    1987-12-01

    The effects of membrane polyunsaturated fatty acids (PUFA) on opiate peptide-mediated inhibition of basal and prostaglandin E1-stimulated cyclic AMP formation were examined in intact N1E-115 neuroblastoma cells. Addition of opiate peptides such as methionine 5-enkephalin (metEnk) to control cultures and to cultures that had been supplemented for 48 hr with 50 microM linoleic acid resulted in dose-dependent decreases in cAMP formation; these decreases were blocked by naloxone. Maximum inhibition of basal cyclase activity was 50-55% in both control and PUFA-enriched cells; however, half-maximal inhibition required ten times more metEnk in supplemented cultures than in controls. This is consistent with our observation that the affinity of binding of [tyrosyl-3',5'-3H(N)](2-D-alanine-5-D-leucine)enkephalin ([3H]DADLE) to intact PUFA-enriched cells was lower than that to control cells. Receptor density was not modified as a result of supplementation. Addition of prostaglandin E1 (PGE1) to the cells produced rapid dose-dependent increases in cAMP formation. Maximum responses were higher in PUFA-enriched than in control cells (1924 and 972 pmol cAMP formed/mg protein respectively). Also, the apparent value for EC50 for PGE1 was consistently lower in supplemented cultures. MetEnk reduced PGE1-stimulated cAMP formation by 45-55% in both control and supplemented cells, and values for IC50 were similar (approximately 30 nM) in both. In the presence of the opiate peptide, values for EC50 for PGE1 were similar in control and PUFA-enriched cultures (0.07 and 0.09 microM respectively). The data from these studies suggest that membrane PUFA increase the efficiency of coupling of receptors that stimulate cAMP formation and decrease the efficiency of those that mediate inhibition. PMID:2825714

  10. The β-Lactamase Gene Regulator AmpR Is a Tetramer That Recognizes and Binds the d-Ala-d-Ala Motif of Its Repressor UDP-N-acetylmuramic Acid (MurNAc)-pentapeptide*

    PubMed Central

    Vadlamani, Grishma; Thomas, Misty D.; Patel, Trushar R.; Donald, Lynda J.; Reeve, Thomas M.; Stetefeld, Jörg; Standing, Kenneth G.; Vocadlo, David J.; Mark, Brian L.

    2015-01-01

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal d-Ala-d-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the d-Ala-d-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  11. The β-lactamase gene regulator AmpR is a tetramer that recognizes and binds the D-Ala-D-Ala motif of its repressor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide.

    PubMed

    Vadlamani, Grishma; Thomas, Misty D; Patel, Trushar R; Donald, Lynda J; Reeve, Thomas M; Stetefeld, Jörg; Standing, Kenneth G; Vocadlo, David J; Mark, Brian L

    2015-01-30

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal D-Ala-D-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the D-Ala-D-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  12. Arachidonic acid release from rat Leydig cells: the involvement of G protein, phospholipase A2 and regulation of cAMP production.

    PubMed

    Ronco, A M; Moraga, P F; Llanos, M N

    2002-01-01

    We have previously demonstrated that the release of arachidonic acid (AA) from human chorionic gonadotropin (hCG)-stimulated Leydig cells occurs in a dose- and time-dependent manner. In addition, the amount of AA released was dependent on the hormone-receptor interaction and the concentration of LH-hCG binding sites on the cell surface. The present study was conducted to evaluate the involvement of phospholipase A(2) (PLA(2)) and G proteins in AA release from hormonally stimulated rat Leydig cells, and the possible role of this fatty acid in cAMP production. Cells were first prelabelled with [(14)C]AA to incorporate the fatty acid into cell phospholipids, and then treated in different ways to evaluate AA release. hCG (25 mIU) increased the release of AA to 180+/-12% when compared with AA released from control cells, arbitrarily set as 100%. Mepacrine and parabromophenacyl bromide (pBpB), two PLA(2) inhibitors, decreased the hormone-stimulated AA release to 85+/-9 and 70+/-24% respectively. Conversely, melittin, a PLA(2) stimulator, increased the release of AA up to 200% over control. The inhibitory effect of mepacrine on the release of AA was evident in hCG-treated Leydig cells, but not in the melittin-treated cells. To determine if the release of AA was also mediated through a G protein, cells were first permeabilized and subsequently treated with pertussis toxin or GTPgammaS, a non-hydrolyzable analog of GTP. Results demonstrate that GTPgammaS was able to induce a similar level of the release of AA as hCG. In addition, pertussis toxin completely abolished the stimulatory effect of hCG on the release of AA, indicating that a member of the G(i) family was involved in the hCG-dependent release of AA. Cells treated with PLA(2) inhibitors did not modify cAMP production, but exogenously added AA significantly reduced cAMP production from hCG-treated Leydig cells, in a manner dependent on the concentration of AA and hCG. Results presented here suggest an involvement of

  13. c-AMP dependent protein kinase A inhibitory activity of six algal extracts from southeastern Australia and their fatty acid composition.

    PubMed

    Zivanovic, Ana; Skropeta, Danielle

    2012-07-01

    c-AMP dependent protein kinase (protein kinase A, PKA) is an important enzyme involved in the regulation of an increasing number of physiological processes including immune function, cardiovascular disease, memory disorders and cancer. The objective of this study was to evaluate the PKA inhibitory activity of a range of algal extracts, along with their fatty acid composition. Six algal species were investigated including two Chlorophyta (Codium dimorphum and Ulva lactuca), two Phaeophyta (Phyllospora comosa and Sargassum sp.) and two Rhodophyta (Prionitis linearis and Corallina vancouveriensis), with the order of PKA inhibitory activity of their extracts identified as follows: brown seaweeds > red seaweeds > green seaweeds with the brown alga Sargassum sp. exhibiting the highest PKA inhibitory activity (84% at 100 microg/mL). GC/MS analysis identified a total of 18 fatty acids in the six algal extracts accounting for 72-87% of each extract, with hexadecanoic acid and 9,12-octadecadienoic acid as the dominant components. The most active extract (Sargassum sp.) also contained the highest percentage of the saturated C14:0 fatty acid (12.8% of the total extract), which is a known to inhibit PKA. These results provide the first description of the PKA inhibitory activity of marine algae along with the first description of the fatty acid composition of these six algal species from South Eastern Australian waters. Importantly, this study reveals that abundant and readily available marine algae are a new and relatively unexplored source of PKA inhibitory compounds. PMID:22908583

  14. Chenodeoxycholic acid stimulates Cl− secretion via cAMP signaling and increases cystic fibrosis transmembrane conductance regulator phosphorylation in T84 cells

    PubMed Central

    Ao, Mei; Sarathy, Jayashree; Domingue, Jada; Alrefai, Waddah A.

    2013-01-01

    High levels of chenodeoxycholic acid (CDCA) and deoxycholic acid stimulate Cl− secretion in mammalian colonic epithelia. While different second messengers have been implicated in this action, the specific signaling pathway has not been fully delineated. Using human colon carcinoma T84 cells, we elucidated this cascade assessing Cl− transport by measuring I− efflux and short-circuit current (Isc). CDCA (500 μM) rapidly increases I− efflux, and we confirmed by Isc that it elicits a larger response when added to the basolateral vs. apical surface. However, preincubation with cytokines increases the monolayer responsiveness to apical addition by 55%. Nystatin permeabilization studies demonstrate that CDCA stimulates an eletrogenic apical Cl− but not a basolateral K+ current. Furthermore, CDCA-induced Isc was inhibited (≥67%) by bumetanide, BaCl2, and the cystic fibrosis transmembrane conductance regulator (CFTR) inhibitor CFTRinh-172. CDCA-stimulated Isc was decreased 43% by the adenylate cyclase inhibitor MDL12330A and CDCA increases intracellular cAMP concentration. The protein kinase A inhibitor H89 and the microtubule disrupting agent nocodazole, respectively, cause 94 and 47% reductions in CDCA-stimulated Isc. Immunoprecipitation with CFTR antibodies, followed by sequential immunoblotting with Pan-phospho and CFTR antibodies, shows that CDCA increases CFTR phosphorylation by approximately twofold. The rapidity and side specificity of the response to CDCA imply a membrane-mediated process. While CDCA effects are not blocked by the muscarinic receptor antagonist atropine, T84 cells possess transcript and protein for the bile acid G protein-coupled receptor TGR5. These results demonstrate for the first time that CDCA activates CFTR via a cAMP-PKA pathway involving microtubules and imply that this occurs via a basolateral membrane receptor. PMID:23761628

  15. Modulatory effects of steroid hormones, oxytocin, arachidonic acid, forskolin and cyclic AMP on the expression of aquaporin 1 and aquaporin 5 in the porcine uterus during placentation.

    PubMed

    Skowronska, A; Mlotkowska, P; Okrasa, S; Nielsen, S; Skowronski, M T

    2016-04-01

    Aquaporins (AQPs) are proteins forming trans-membrane channels responsible for water transport. AQP1 and AQP5 are present in structures of the female reproductive system. In the uterus, these AQPs are involved in water movement between the intraluminal, interstitial and capillary compartments and their uterine expression is essential throughout the pregnancy, including its early stages. Thus, the study aimed to assess the influence of P4 (progesterone), E2 (estradiol), OT (oxytocin), AA (arachidonic acid), cAMP and FSK (forskolin) on the AQP1 and AQP5 mRNA and protein expression in the uterine tissue of gilts on Days 30 - 32 of gestation (the placentation period), following short (3 h) and long (24 h) incubations. Steroid hormones influenced the expression of AQP1 and AQP5; E2 up-regulated, but P4 down-regulated mRNAs of these AQPs, whereas the protein level of studied AQPs was increased by both steroids. OT treatment decreased AQP1 (after 24 h), but increased AQP5 (after 3 h) mRNA expression. Treatment with AA significantly reduced the AQP1 expression at the mRNA level, but stimulated at the protein level. The expression of AQP5 mRNA and protein was stimulated by AA. FSK markedly decreased AQP1 mRNA, but increased of AQP5 after 3-h incubation. In turn, cAMP stimulated and inhibited transcription of AQP5 after 3- and 24-h incubations, respectively. Immunohistochemical analysis confirmed the uterine localization of AQP1 in the apical and basal membranes of endothelial cells and AQP5 in the apical membranes of epithelial cells under control condition. Treatments with P4, E2, AA, cAMP or FSK have caused additional appearance of AQP5 labeling in the basolateral membranes of epithelial cells. These results suggest a participation of steroid hormones (P4 and E2), AA derivatives and cAMP in controlling the expression of AQP1 and AQP5 as well as the distribution of AQP5 in the uterine tissue of pregnant gilts during placentation (Days 30 - 32 of gestation). PMID:27226190

  16. Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements

    PubMed Central

    Yuan, Jinxiang; Li, Ming; Torres, Yasaira Rodriguez; Galle, Courtney S.

    2015-01-01

    ABSTRACT Triggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation. IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of

  17. Fermented Rhus verniciflua Stokes Extract Exerts an Antihepatic Lipogenic Effect in Oleic-Acid-Induced HepG2 Cells via Upregulation of AMP-Activated Protein Kinase.

    PubMed

    Lee, Myoung-Sun; Kim, Joo-Seok; Cho, Sun-Mi; Lee, Seon Ok; Kim, Sung-Hoon; Lee, Hyo-Jeong

    2015-08-19

    Rhus verniciflua Stokes has been used as a traditional medicine and food supplement in Korea. In the present study, fermented R. verniciflua Stokes extract (FRVE), an allergen-free extract of R. verniciflua Stokes fermented with the yeast Saccharomyces carlsbergensis, was assessed for its lipid-lowering potential in an in vitro non-alcoholic fatty liver disease model. FRVE markedly suppressed lipid accumulation and intracellular triglycerides (TGs) in the presence of oleic acid (OA). Additionally, FRVE decreased both mRNA and protein levels of lipid-synthesis- and cholesterol-metabolism-related factors, such as sterol regulatory element-binding protein-1 (SREBP-1), fatty acid synthase (FAS), glycerol-3-phosphate acyltransferase (GPAT), and 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), in OA-induced HepG2 cells. Moreover, FRVE activated low-density lipoprotein receptor (LDLR), AMP-activated protein kinase (AMPK), and fatty acid oxidation-related factors peroxisome proliferator activated receptor α (PPARα) and carnitine palmitoyltransferase 1 (CPT-1). Further, the AMPK inhibitor compound C suppressed the increased expression of AMPK phosphorylation induced by FRVE. Phenolics and cosanols in FRVE increased the phosphorylation of AMPK and decreased that of SREBP-1. Taken together, our findings suggest that FRVE has antilipogenic potential in non-alcoholic fatty livers via AMPK upregulation. PMID:26176317

  18. AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages.

    PubMed

    Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

    2015-01-01

    AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload. PMID:26098914

  19. AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages

    PubMed Central

    Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

    2015-01-01

    AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload. PMID:26098914

  20. The Effects of cAMP-elevating Agents and Alpha Lipoic Acid on In Vitro Maturation of Mouse Germinal Vesicle Oocytes

    PubMed Central

    Rahnama, Ali; Zavareh, Saeed; Ghorbanian, Mohammad Taghi; Karimi, Isaac

    2013-01-01

    Background In spite of extensive efforts to improve in vitro oocyte maturation, the obtained results are not very efficient. This study was conducted to assess impacts of cAMP elevating agents and alpha lipoic acid (ALA) on in vitro oocyte maturation and fertilization. Methods Mouse germinal vesicle (GV) oocytes were categorized into cumulus denuded oocytes (DOs; n=896) and cumulus oocyte complexes (COCs; n=1077) groups. GV oocytes were matured in vitro with or without ALA; (I) without the meiotic inhibitors; (II) supplemented with cilostamide; (III) supplemented with forskolin and (IV) supplemented with Forskolin plus cilostamide. The obtained metaphase II (MII) oocytes were subjected to in vitro fertilization. Independent-samples t-testand ANOVA were used for data analysis. A p-value less than 0.05 was considered to be statistically significant. Results The COCs maturation, fertilization and two cell embryo rates were higher than those of DOs in the control group, while no significant difference was observed between relevant COCs and DOs when they were cultured with cilostamide meiotic inhibitors in two step manner. Combined treatment of cilostamide and forskolin significantly elevated the developmental rates in both COCs and DOs as compared to other groups. The developmental rates of COCs and DOs in the presence of ALA were similar to their respective groups without ALA. Conclusion cAMP elevating agents were more effective on DOs than COCs with regard to rates of maturation and fertilization. However, ALA did not affect the developmental rates of both COCs and DOs in in vitro maturation in one or two step manner. PMID:24551571

  1. Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase.

    PubMed

    Deng, Xiong; Dong, Qingming; Bridges, Dave; Raghow, Rajendra; Park, Edwards A; Elam, Marshall B

    2015-12-01

    In hyperinsulinemic states including obesity and T2DM, overproduction of fatty acid and triglyceride contributes to steatosis of the liver, hyperlipidemia and hepatic insulin resistance. This effect is mediated in part by the transcriptional regulator sterol responsive element binding protein-1c (SREBP-1c), which stimulates the expression of genes involved in hepatic fatty acid and triglyceride synthesis. SREBP-1c is up regulated by insulin both via increased transcription of nascent full-length SREBP-1c and by enhanced proteolytic processing of the endoplasmic reticulum (ER)-bound precursor to yield the transcriptionally active n-terminal form, nSREBP-1c. Polyunsaturated fatty acids of marine origin (n-3 PUFA) prevent induction of SREBP-1c by insulin thereby reducing plasma and hepatic triglycerides. Despite widespread use of n-3 PUFA supplements to reduce triglycerides in clinical practice, the exact mechanisms underlying their hypotriglyceridemic effect remain elusive. Here we demonstrate that the n-3 PUFA docosahexaenoic acid (DHA; 22:5 n-3) reduces nSREBP-1c by inhibiting regulated intramembrane proteolysis (RIP) of the nascent SREBP-1c. We further show that this effect of DHA is mediated both via activation of AMP-activated protein kinase (AMPK) and by inhibition of mechanistic target of rapamycin complex 1 (mTORC1). The inhibitory effect of AMPK on SREBP-1c processing is linked to phosphorylation of serine 365 of SREBP-1c in the rat. We have defined a novel regulatory mechanism by which n-3 PUFA inhibit induction of SREBP-1c by insulin. These findings identify AMPK as an important negative regulator of hepatic lipid synthesis and as a potential therapeutic target for hyperlipidemia in obesity and T2DM. PMID:26327595

  2. Nordihydroguaiaretic acid protects against high-fat diet-induced fatty liver by activating AMP-activated protein kinase in obese mice

    SciTech Connect

    Lee, Myoung-Su; Kim, Daeyoung; Jo, Keunae; Hwang, Jae-Kwan

    2010-10-08

    Research highlights: {yields} NDGA decreases high-fat diet-induced body weight gain and adiposity. {yields} NDGA reduces high-fat diet-induced triglyceride accumulation in liver. {yields} NDGA improves lipid storage in vitro through altering lipid regulatory proteins. {yields} Inhibition of lipid storage in vivo and in vitro is mediated by AMPK activation. -- Abstract: Nonalcoholic fatty liver disease, one of the most common causes of chronic liver disease, is strongly associated with metabolic syndrome. Nordihydroguaiaretic acid (NDGA) has been reported to inhibit lipoprotein lipase; however, the effect of NDGA on hepatic lipid metabolism remains unclear. We evaluated body weight, adiposity, liver histology, and hepatic triglyceride content in high-fat diet (HFD)-fed C57BL/6J mice treated with NDGA. In addition, we characterized the underlying mechanism of NDGA's effects in HepG2 hepatocytes by Western blot and RT-PCR analysis. NDGA (100 or 200 mg/kg/day) reduced weight gain, fat pad mass, and hepatic triglyceride accumulation, and improved serum lipid parameters in mice fed a HFD for 8 weeks. NDGA significantly increased AMP-activated protein kinase (AMPK) phosphorylation in the liver and in HepG2 hepatocytes. NDGA downregulated the level of mature SREBP-1 and its target genes (acetyl-CoA carboxylase and fatty acid synthase), but, it upregulated expression of genes involved in fatty acid oxidation, such as peroxisome proliferator-activated receptor (PPAR){alpha}, PPAR{gamma} coactivator-1, carnitine palmitoyl transferase-1, and uncoupling protein-2. The specific AMPK inhibitor compound C attenuated the effects of NDGA on expression of lipid metabolism-related proteins in HepG2 hepatocytes. The beneficial effects of NDGA on HFD-induced hepatic triglyceride accumulation are mediated through AMPK signaling pathways, suggesting a potential target for preventing NAFLD.

  3. Coffee polyphenol caffeic acid but not chlorogenic acid increases 5'AMP-activated protein kinase and insulin-independent glucose transport in rat skeletal muscle.

    PubMed

    Tsuda, Satoshi; Egawa, Tatsuro; Ma, Xiao; Oshima, Rieko; Kurogi, Eriko; Hayashi, Tatsuya

    2012-11-01

    Chlorogenic acid is an ester of caffeic and quinic acids, and is one of the most widely consumed polyphenols because it is abundant in foods, especially coffee. We explored whether chlorogenic acid and its metabolite, caffeic acid, act directly on skeletal muscle to stimulate 5'-adenosine monophosphate-activated protein kinase (AMPK). Incubation of rat epitrochlearis muscles with Krebs buffer containing caffeic acid (≥0.1 mM, ≥30 min) but not chlorogenic acid increased the phosphorylation of AMPKα Thr(172), an essential step for kinase activation, and acetyl CoA carboxylase Ser(79), a downstream target of AMPK, in a dose- and time-dependent manner. Analysis of isoform-specific AMPK activity revealed that AMPKα2 activity increased significantly, whereas AMPKα1 activity did not change. This enzyme activation was associated with a reduction in phosphocreatine content and an increased rate of 3-O-methyl-d-glucose transport activity in the absence of insulin. These results suggest that caffeic acid but not chlorogenic acid acutely stimulates skeletal muscle AMPK activity and insulin-independent glucose transport with a reduction of the intracellular energy status. PMID:22227267

  4. Endogenous Ligand for GPR120, Docosahexaenoic Acid, Exerts Benign Metabolic Effects on the Skeletal Muscles via AMP-activated Protein Kinase Pathway*

    PubMed Central

    Kim, Nami; Lee, Jung Ok; Lee, Hye Jeong; Kim, Hyung Ip; Kim, Joong Kwan; Lee, Yong Woo; Lee, Soo Kyung; Kim, Su Jin; Park, Sun Hwa; Kim, Hyeon Soo

    2015-01-01

    Docosahexaenoic acid (DHA) is an endogenous ligand of G protein-coupled receptor 120 (GPR120). However, the mechanisms underlying DHA action are poorly understood. In this study, DHA stimulated glucose uptake in the skeletal muscles in an AMP-activated protein kinase (AMPK)-dependent manner. GPR120-mediated increase in intracellular Ca2+ was critical for DHA-mediated AMPK phosphorylation and glucose uptake. In addition, DHA stimulated GLUT4 translocation AMPK-dependently. Inhibition of AMPK and Ca2+/calmodulin-dependent protein kinase kinase blocked DHA-induced glucose uptake. DHA and GW9508, a GPR120 agonist, increased GPR120 expression. DHA-mediated glucose uptake was not observed in GPR120 knockdown conditions. DHA increased AMPK phosphorylation, glucose uptake, and intracellular Ca2+ concentration in primary cultured myoblasts. Taken together, these results indicated that the beneficial metabolic role of DHA was attributed to its ability to regulate glucose via the GPR120-mediated AMPK pathway in the skeletal muscles. PMID:26134561

  5. Non-esterified fatty acids activate the AMP-activated protein kinase signaling pathway to regulate lipid metabolism in bovine hepatocytes.

    PubMed

    Li, Xinwei; Li, Xiaobing; Chen, Hui; Lei, Liancheng; Liu, Juxiong; Guan, Yuan; Liu, Zhaoxi; Zhang, Liang; Yang, Wentao; Zhao, Chenxu; Fu, Shixin; Li, Peng; Liu, Guowen; Wang, Zhe

    2013-01-01

    Non-esterified fatty acids (NEFAs) act as signaling molecules involved in regulating genes expression to modulate lipid metabolism. However, the regulation mechanism of NEFAs on lipid metabolism in dairy cows is unclear. The AMP-activated protein kinase (AMPK) signaling pathway plays a key role in regulating hepatic lipid metabolism. In vitro, bovine hepatocytes were cultured and treated with different concentrations of NEFAs and AMPKα inhibitors (BML-275). NEFAs increased AMPKα phosphorylation through up-regulating the protein levels of liver kinase B1. Activated AMPKα increased the expression and transcriptional activity of peroxisome proliferator-activated receptor α (PPARα). NEFAs also directly activate the PPARα independent of AMPKα. Activated PPARα increased the lipolytic genes expression to increase lipid oxidation. Furthermore, activated AMPKα inhibited the expression and transcriptional activity of the sterol regulatory element-binding protein 1c and carbohydrate responsive element-binding protein, which reduced the expression of lipogenic genes, thereby decreasing lipid synthesis. Activated AMPKα phosphorylated and inhibited acetyl-CoA carboxylase and increased carnitine palmitoyltransferase-1 activity, which increased lipid oxidation. Consequently, the triglyceride content in the NEFAs-treated hepatocytes was significantly decreased. These results indicate that NEFAs activate the AMPKα signaling pathway to increase lipid oxidation and decrease lipid synthesis in hepatocytes, which in turn, generates more ATP to relieve the negative energy balance in transition dairy cows. PMID:23690240

  6. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases. PMID:14982755

  7. Resistance to Cefepime and Cefpirome Due to a 4-Amino-Acid Deletion in the Chromosome-Encoded AmpC β-Lactamase of a Serratia marcescens Clinical Isolate

    PubMed Central

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-01-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The blaAmpC gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the blaAmpC gene from S. marcescens HD had a 12-nucleotide deletion compared to the blaAmpC gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the β-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type β-lactamases. PMID:14982755

  8. Phosphorylation of CREB, a cyclic AMP responsive element binding protein, contributes partially to lysophosphatidic acid-induced fibroblast cell proliferation

    SciTech Connect

    Kwon, Yong-Jun; Sun, Yuanjie; Kim, Nam-Ho; Huh, Sung-Oh

    2009-03-13

    Lysophospholipids regulate a wide array of biological processes including cell survival and proliferation. In our previous studies, we found that in addition to SRE, CRE is required for maximal c-fos promoter activation triggered by lysophosphatidic acid (LPA). c-fos is an early indicator of various cells into the cell cycle after mitogenic stimulation. However, role of CREB activation in LPA-stimulated proliferation has not been elucidated yet. Here, we investigate how LPA induces proliferation in Rat-2 fibroblast cell via CREB activation. We found that total cell number and BrdU-positive cells were increased by LPA. Moreover, levels of c-fos mRNA and cyclin D1 protein were increased via LPA-induced CREB phosphorylation. Furthermore, LPA-induced Rat-2 cell proliferation was decreased markedly by ERK inhibitor (U0126) and partially by MSK inhibitor (H89). Taken together, these results suggest that CREB activation could partially up-regulate accumulation of cyclin D1 protein level and proliferation of LPA-stimulated Rat-2 fibroblast cells.

  9. AMP-activated Protein Kinase α2 Subunit Is Required for the Preservation of Hepatic Insulin Sensitivity by n-3 Polyunsaturated Fatty Acids

    PubMed Central

    Jelenik, Tomas; Rossmeisl, Martin; Kuda, Ondrej; Jilkova, Zuzana Macek; Medrikova, Dasa; Kus, Vladimir; Hensler, Michal; Janovska, Petra; Miksik, Ivan; Baranowski, Marcin; Gorski, Jan; Hébrard, Sophie; Jensen, Thomas E.; Flachs, Pavel; Hawley, Simon; Viollet, Benoit; Kopecky, Jan

    2010-01-01

    OBJECTIVE The induction of obesity, dyslipidemia, and insulin resistance by high-fat diet in rodents can be prevented by n-3 long-chain polyunsaturated fatty acids (LC-PUFAs). We tested a hypothesis whether AMP-activated protein kinase (AMPK) has a role in the beneficial effects of n-3 LC-PUFAs. RESEARCH DESIGN AND METHODS Mice with a whole-body deletion of the α2 catalytic subunit of AMPK (AMPKα2−/−) and their wild-type littermates were fed on either a low-fat chow, or a corn oil-based high-fat diet (cHF), or a cHF diet with 15% lipids replaced by n-3 LC-PUFA concentrate (cHF+F). RESULTS Feeding a cHF diet induced obesity, dyslipidemia, hepatic steatosis, and whole-body insulin resistance in mice of both genotypes. Although cHF+F feeding increased hepatic AMPKα2 activity, the body weight gain, dyslipidemia, and the accumulation of hepatic triglycerides were prevented by the cHF+F diet to a similar degree in both AMPKα2−/− and wild-type mice in ad libitum-fed state. However, preservation of hepatic insulin sensitivity by n-3 LC-PUFAs required functional AMPKα2 and correlated with the induction of adiponectin and reduction in liver diacylglycerol content. Under hyperinsulinemic-euglycemic conditions, AMPKα2 was essential for preserving low levels of both hepatic and plasma triglycerides, as well as plasma free fatty acids, in response to the n-3 LC-PUFA treatment. CONCLUSIONS Our results show that n-3 LC-PUFAs prevent hepatic insulin resistance in an AMPKα2-dependent manner and support the role of adiponectin and hepatic diacylglycerols in the regulation of insulin sensitivity. AMPKα2 is also essential for hypolipidemic and antisteatotic effects of n-3 LC-PUFA under insulin-stimulated conditions. PMID:20693347

  10. Identification and Biochemical Characterization of an Acid Sphingomyelinase-Like Protein from the Bacterial Plant Pathogen Ralstonia solanacearum that Hydrolyzes ATP to AMP but Not Sphingomyelin to Ceramide

    PubMed Central

    Airola, Michael V.; Tumolo, Jessica M.; Snider, Justin; Hannun, Yusuf A.

    2014-01-01

    Acid sphingomyelinase (aSMase) is a human enzyme that catalyzes the hydrolysis of sphingomyelin to generate the bioactive lipid ceramide and phosphocholine. ASMase deficiency is the underlying cause of the genetic diseases Niemann-Pick Type A and B and has been implicated in the onset and progression of a number of other human diseases including cancer, depression, liver, and cardiovascular disease. ASMase is the founding member of the aSMase protein superfamily, which is a subset of the metallophosphatase (MPP) superfamily. To date, MPPs that share sequence homology with aSMase, termed aSMase-like proteins, have been annotated and presumed to function as aSMases. However, none of these aSMase-like proteins have been biochemically characterized to verify this. Here we identify RsASML, previously annotated as RSp1609: acid sphingomyelinase-like phosphodiesterase, as the first bacterial aSMase-like protein from the deadly plant pathogen Ralstonia solanacearum based on sequence homology with the catalytic and C-terminal domains of human aSMase. A biochemical characterization of RsASML does not support a role in sphingomyelin hydrolysis but rather finds RsASML capable of acting as an ATP diphosphohydrolase, catalyzing the hydrolysis of ATP and ADP to AMP. In addition, RsASML displays a neutral, not acidic, pH optimum and prefers Ni2+ or Mn2+, not Zn2+, for catalysis. This alters the expectation that all aSMase-like proteins function as acid SMases and expands the substrate possibilities of this protein superfamily to include nucleotides. Overall, we conclude that sequence homology with human aSMase is not sufficient to predict substrate specificity, pH optimum for catalysis, or metal dependence. This may have implications to the biochemically uncharacterized human aSMase paralogs, aSMase-like 3a (aSML3a) and aSML3b, which have been implicated in cancer and kidney disease, respectively, and assumed to function as aSMases. PMID:25144372

  11. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  12. Pretreatment of cultured preadipocytes with arachidonic acid during the differentiation phase without a cAMP-elevating agent enhances fat storage after the maturation phase.

    PubMed

    Khan, Ferdous; Syeda, Pinky Karim; Nartey, Michael Nii N; Rahman, Mohammad Shahidur; Islam, Mohammad Safiqul; Nishimura, Kohji; Jisaka, Mitsuo; Shono, Fumiaki; Yokota, Kazushige

    2016-03-01

    Arachidonic acid (AA) and the related prostanoids exert complex effects on the adipocyte differentiation depending on the culture conditions and life stages. Here, we investigated the effect of the pretreatment of cultured 3T3-L1 preadipocytes with exogenous AA during the differentiation phase without 3-isobutyl-1-methylxanthine (IBMX), a cAMP-elevating agent, on the storage of fats after the maturation phase. This pretreatment with AA stimulated appreciably adipogenesis after the maturation phase as evident with the up-regulated gene expression of adipogenic markers. The stimulatory effect of the pretreatment with AA was attenuated by the co-incubation with each of cyclooxygenase (COX) inhibitors. Among exogenous prostanoids and related compounds, the pretreatment with MRE-269, a selective agonist of the IP receptor for prostaglandin (PG) I2, strikingly stimulated the storage of fats in adipocytes. The gene expression analysis of arachidonate COX pathway revealed that the transcript levels of inducible COX-2, membrane-bound PGE synthase-1, and PGF synthase declined more greatly in cultured preadipocytes treated with AA. By contrast, the expression levels of COX-1, cytosolic PGE synthase, and PGI synthase remained constitutive. The treatment of cultured preadipocytes with AA resulted in the decreased synthesis of PGE2 and PGF2α serving as anti-adipogenic PGs although the biosynthesis of pro-adipogenic PGI2 was up-regulated during the differentiation phase. Moreover, the gene expression levels of EP4 and FP, the respective prostanoid receptors for PGE2 and PGF2α, were gradually suppressed by the supplementation with AA, whereas that of IP for PGI2 remained relatively constant. Collectively, these results suggest the predominant role of endogenous PGI2 in the stimulatory effect of the pretreatment of cultured preadipoccytes with AA during the differentiation phase without IBMX on adipogenesis after the maturation phase. PMID:26928048

  13. trans-Caffeic acid stearyl ester from Paeonia suffruticosa inhibits melanin synthesis by cAMP-mediating down-regulation of α-melanocyte-stimulating hormone-stimulated melanogenesis signaling pathway in B16 cells.

    PubMed

    Liang, Chia-Hua; Chou, Tzung-Han; Tseng, Ya-Ping; Ding, Hsiou-Yu

    2012-01-01

    trans-Caffeic acid stearyl ester (TCASE) from the root cortex of Paeonia suffruticosa ANDREWS is a traditional medicinal herb that has several beneficial properties. However, the inhibitory effect of TCASE on melanogenesis has not been explored. In the cell viability assay, TCASE did not show a cytotoxic effect at a dose of 65 µM for 48 h in B16, HaCaT and Hs68 cells. TCASE considerably inhibits melanin synthesis, and reduces intracellular cyclic adenosine monophosphate (cAMP) levels, tyrosinase activity and L-3-(3,4-dihydroxyphenyl)-alanine (DOPA) oxidase activity in a concentration-dependent manner in the presence of α-melanocyte-stimulating hormone (α-MSH) in B16 cells, and the inhibition efficiency of TCASE exceeds that of ascorbic acid and arbutin. TCASE reduces melanocortin-1 receptor (MC1R), microphthalmia transcription factor (MITF), tyrosinase, tyrosinase-related protein-2 (TRP-2) and TRP-1 mRNA and protein levels in B16 cells. Based on the findings, TCASE is posited to inhibit melanogenesis signaling while suppressing cAMP levels and, subsequently, MC1R, MITF, tyrosinase, TRP-2 and TRP-1 down-regulation, resulting in the suppression of tyrosinase activity, DOPA oxidase activity and melanin synthesis. PMID:23207771

  14. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2014-04-02

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  15. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  16. The vasorelaxant effect of 8(17),12E,14-labdatrien-18-oic acid involves stimulation of adenylyl cyclase and cAMP/PKA pathway: Evidences by pharmacological and molecular docking studies.

    PubMed

    Ribeiro, Luciano A A; Alencar Filho, Edilson B; Coelho, Maisa C; Silva, Bagnólia A

    2015-10-01

    The relaxant effect of 8(17),12E,14-labdatrien-18-oic acid (LBD) was investigated on isolated aortic rings and compared with forskolin (FSK), a standard and potent activator of adenylyl cyclase (AC) with relaxing effect. The presence of potassium channel blockers, such as glibenclamide (ATP-blocker), apamin (SKCa-blocker), charybdotoxin (BKCa-blocker) did not significantly affect either the LBD or FSK concentration-response curves. However, in the presence of 4-aminopyridine (KV-blocker), the relaxant effect for both diterpenes was significantly attenuated, with reduction of its relative potencies. Moreover, the relaxation induced by 8-Br-cAMP, an analog of cAMP, was also significantly attenuated in the same conditions, i.e., in the presence of 4-aminopyridine. The presence of aminophylline, a nonselective phosphodiesterase inhibitor, caused a significant increasing in the potency for both LBD and FSK. On the other hand, the presence of Rp-cAMPS, a selective PKA-inhibitor, significantly attenuated the relaxant effect of LBD. In this work, in the same experimental conditions, both labdane-type diterpenes presented remarkably similar results; FSK, however, presented a higher potency (100-fold) than LBD. Thus, the hypothesis that LBD could be a novel AC-activator emerged. To assess that hypothesis, computational molecular docking studies were performed. Crystallographic structure of adenylyl cyclase/forskolin complex (1AB8) was obtained from RSCB Protein Data Bank and used to compare the modes of interaction of the native ligand and LBD. The computational data shows many similarities between LBD and FSK concerning the interaction with the regulatory site of AC. Taken together, the results presented here pointed to LBD as a novel AC-activator. PMID:26144373

  17. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  18. Electrochromic and photonic devices utilizing polymer colloidal particles

    NASA Astrophysics Data System (ADS)

    Shim, Goo Hwan

    switched more than 100 times with 5% drop of transmittance contrast ratio and PEDOT-based ECD could be switched more than 1000 times with 7% drop of transmittance contrast ratio at lambdamax. In addition to the single ICP-based ECDs, ECDs having the PANI and PEDOT blended electrochromic layer was fabricated to achieve the tuning of the absorption spectra of the ECD. The blended electrochromic layer was formed through the inkjet printing of the blended PANI-silica and PEDOT-silica inks on an ITO-PET film. Micro pixelated ECDs having 500 mum sized patterns and large area static image ECDs having 5 cm sized patterns are fabricated employing the inkjet printed electrochromic layers. Moreover, dual image display ECDs could be fabricated through the inkjet printing of two different electrochromic materials on the same electrode. In the second part, a reflection-type ECDs employing PS PCCA film both as reflection mirror and polymeric electrolyte is presented. This work realizes the modulation of the rejected light from a PS PCCA structure through the electrochemical switching of the electrochromic material, PANI-poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPS) composites. Film processible conducting polymer PANI-PAMPS was first synthesized then spun cast on an ITO-PET film to form an electrochromic layer. The reflection-type PANI-PAMPS-based ECD, employing PS PCCA both as a mirror and a polymeric electrolyte was fabricated. Resulting reflection-type ECDs exhibited the modulation of reflectance from the stop band of the PCCA with the 3% reflectance contrast ratio at 562 nm. The third part presents the dynamic tuning of a photoluminescent dye through the coupling of a Rhodamine B dye to the PS CCA. Reflectance and photoluminescence spectra of this luminescent dye-coupled ordered structures showed modification of emission in the region of the stop band. An adjustment of the interparticle distance could modify the emission spectra of the dye labeled particles by varying the

  19. Activation of AMP-activated protein kinase by kainic acid mediates brain-derived neurotrophic factor expression through a NF-kappaB dependent mechanism in C6 glioma cells

    SciTech Connect

    Yoon, Hana; Oh, Young Taek; Lee, Jung Yeon; Choi, Ji Hyun; Lee, Ju Hie; Baik, Hyung Hwan; Kim, Sung Soo; Choe, Wonchae; Yoon, Kyung-Sik; Ha, Joohun; Kang, Insug

    2008-07-04

    AMP-activated protein kinase (AMPK) is a key regulator of energy homeostasis. Kainic acid (KA), a prototype excitotoxin is known to induce brain-derived neurotrophic factor (BDNF) in brain. In this study, we examined the role of AMPK in KA-induced BDNF expression in C6 glioma cells. We showed that KA and KA receptor agonist induced activation of AMPK and KA-induced AMPK activation was blocked by inhibition of Ca{sup 2+}/calmodulin-dependent protein kinase kinase (CaMKK) {beta}. We then showed that inhibition of AMPK by compound C, a selective inhibitor of AMPK, or small interfering RNA of AMPK{alpha}1 blocked KA-induced BDNF mRNA and protein expression. Inhibition of AMPK blocked KA-induced phosphorylation of CaMKII and I kappaB kinase (IKK) in C6 cells. Finally, we showed that inhibition of AMPK reduced DNA binding and transcriptional activation of nuclear factor-kappaB (NF-{kappa}B) in KA-treated cells. These results suggest that AMPK mediates KA-induced BDNF expression by regulating NF-{kappa}B activation.

  20. Nesfatin-1 Stimulates Fatty-Acid Oxidation by Activating AMP-Activated Protein Kinase in STZ-Induced Type 2 Diabetic Mice

    PubMed Central

    Xu, Huan; Wang, Peng-fei; Cai, Gui-ju; Song, Hai-feng; Wang, Chang-chen; Dong, Zhao-tong; Ju, Yan-jiao; Jiang, Zheng-yao

    2013-01-01

    Nesfatin-1 is an anorexigenic peptide involved in energy homeostasis. Recently, nesfatin-1 was reported to decrease blood glucose level and improve insulin sensitivity in high-fat diet-fed rats. However, little information is known about the influence of nesfatin-1 on lipid metabolism either in physiological or diabetic condition. This study undertook whether nesfatin-1 was involved in the pathophysiology in Streptozotocin-induced type 2 diabetic mice (T2DM), which was induced by a combination of high-calorie diet and two low-doses Streptozotocin. We observed that plasma nesfatin-1 was significantly increased while expression of nesfatin-1 neurons were decreased in hypothalamus in diabetes group compared to only high-calorie diet control group; intravenous injection of nesfatin-1 decreased 0–1h, 0–2h, 0–3h cumulative food intake in T2DM, but 0–24h total food intake had no difference between groups. Body weight and plasma FFA were normalized after nesfatin-1(10 µg/Kg) administration for 6 days. These results suggested that nesfatin-1 improved lipid disorder in T2DM. It was found that blood glucose and insulin resistance coefficient decreased with treatment of nesfatin-1 (both in 1 µg/Kg and 10 µg/Kg doses) in diabetes mice. For further understanding the role of nesfatin-1 on lipid metabolism, we detected p-AMPK and p-ACC of skeletal muscle in T2DM using western blotting. The expression of p-AMPK and p-ACC increased when nesfatin-1 was given with doses 1 µg/Kg but not in doses 10 µg/Kg. Taken together, nesfatin-1 participated in the development of T2DM and stimulated free fatty acid utilization via AMPK-ACC pathway in skeletal muscle in T2DM. PMID:24391760

  1. Dehydroeburicoic Acid from Antrodia camphorata Prevents the Diabetic and Dyslipidemic State via Modulation of Glucose Transporter 4, Peroxisome Proliferator-Activated Receptor α Expression and AMP-Activated Protein Kinase Phosphorylation in High-Fat-Fed Mice

    PubMed Central

    Kuo, Yueh-Hsiung; Lin, Cheng-Hsiu; Shih, Chun-Ching

    2016-01-01

    This study investigated the potential effects of dehydroeburicoic acid (TT), a triterpenoid compound from Antrodia camphorata, in vitro and examined the effects and mechanisms of TT on glucose and lipid homeostasis in high-fat-diet (HFD)-fed mice. The in vitro study examined the effects of a MeOH crude extract (CruE) of A. camphorata and Antcin K (AnK; the main constituent of fruiting body of this mushroom) on membrane glucose transporter 4 (GLUT4) and phospho-Akt in C2C12 myoblasts cells. The in vitro study demonstrated that treatment with CruE, AnK and TT increased the membrane levels of glucose transporter 4 (GLUT4) and phospho-Akt at different concentrations. The animal experiments were performed for 12 weeks. Diabetic mice were randomly divided into six groups after 8 weeks of HFD-induction and treated with daily oral gavage doses of TT (at three dose levels), fenofibrate (Feno) (at 0.25 g/kg body weight), metformin (Metf) (at 0.3 g/kg body weight) or vehicle for another 4 weeks while on an HFD diet. HFD-fed mice exhibited increased blood glucose levels. TT treatment dramatically lowered blood glucose levels by 34.2%~43.4%, which was comparable to the antidiabetic agent-Metf (36.5%). TT-treated mice reduced the HFD-induced hyperglycemia, hypertriglyceridemia, hyperinsulinemia, hyperleptinemia, and hypercholesterolemia. Membrane levels of GLUT4 were significantly higher in CruE-treated groups in vitro. Skeletal muscle membrane levels of GLUT4 were significantly higher in TT-treated mice. These groups of mice also displayed lower mRNA levels of glucose-6-phosphatase (G6 Pase), an inhibitor of hepatic glucose production. The combination of these agents produced a net hypoglycemic effect in TT-treated mice. TT treatment enhanced the expressions of hepatic and skeletal muscle AMP-activated protein kinase (AMPK) phosphorylation in mice. TT-treated mice exhibited enhanced expression of hepatic fatty acid oxidation enzymes, including peroxisome proliferator

  2. Dehydroeburicoic Acid from Antrodia camphorata Prevents the Diabetic and Dyslipidemic State via Modulation of Glucose Transporter 4, Peroxisome Proliferator-Activated Receptor α Expression and AMP-Activated Protein Kinase Phosphorylation in High-Fat-Fed Mice.

    PubMed

    Kuo, Yueh-Hsiung; Lin, Cheng-Hsiu; Shih, Chun-Ching

    2016-01-01

    This study investigated the potential effects of dehydroeburicoic acid (TT), a triterpenoid compound from Antrodia camphorata, in vitro and examined the effects and mechanisms of TT on glucose and lipid homeostasis in high-fat-diet (HFD)-fed mice. The in vitro study examined the effects of a MeOH crude extract (CruE) of A. camphorata and Antcin K (AnK; the main constituent of fruiting body of this mushroom) on membrane glucose transporter 4 (GLUT4) and phospho-Akt in C2C12 myoblasts cells. The in vitro study demonstrated that treatment with CruE, AnK and TT increased the membrane levels of glucose transporter 4 (GLUT4) and phospho-Akt at different concentrations. The animal experiments were performed for 12 weeks. Diabetic mice were randomly divided into six groups after 8 weeks of HFD-induction and treated with daily oral gavage doses of TT (at three dose levels), fenofibrate (Feno) (at 0.25 g/kg body weight), metformin (Metf) (at 0.3 g/kg body weight) or vehicle for another 4 weeks while on an HFD diet. HFD-fed mice exhibited increased blood glucose levels. TT treatment dramatically lowered blood glucose levels by 34.2%~43.4%, which was comparable to the antidiabetic agent-Metf (36.5%). TT-treated mice reduced the HFD-induced hyperglycemia, hypertriglyceridemia, hyperinsulinemia, hyperleptinemia, and hypercholesterolemia. Membrane levels of GLUT4 were significantly higher in CruE-treated groups in vitro. Skeletal muscle membrane levels of GLUT4 were significantly higher in TT-treated mice. These groups of mice also displayed lower mRNA levels of glucose-6-phosphatase (G6 Pase), an inhibitor of hepatic glucose production. The combination of these agents produced a net hypoglycemic effect in TT-treated mice. TT treatment enhanced the expressions of hepatic and skeletal muscle AMP-activated protein kinase (AMPK) phosphorylation in mice. TT-treated mice exhibited enhanced expression of hepatic fatty acid oxidation enzymes, including peroxisome proliferator

  3. Counteracting Roles of AMP Deaminase and AMP Kinase in the Development of Fatty Liver

    PubMed Central

    Lanaspa, Miguel A.; Cicerchi, Christina; Garcia, Gabriela; Li, Nanxing; Roncal-Jimenez, Carlos A.; Rivard, Christopher J.; Hunter, Brandi; Andrés-Hernando, Ana; Ishimoto, Takuji; Sánchez-Lozada, Laura G.; Thomas, Jeffrey; Hodges, Robert S.; Mant, Colin T.; Johnson, Richard J.

    2012-01-01

    Fatty liver (hepatic steatosis) is associated with nucleotide turnover, loss of ATP and generation of adenosine monophosphate (AMP). It is well known that in fatty liver, activity of the AMP-activated kinase (AMPK) is reduced and that its stimulation can prevent hepatic steatosis by both enhancing fat oxidation and reducing lipogenesis. Here we show that another AMP dependent enzyme, AMPD2, has opposing effects on fatty acid oxidation when compared to AMPK. In human hepatocytres, AMPD2 activation –either by overexpression or by lowering intracellular phosphate levels with fructose- is associated with a significant reduction in AMPK activity. Likewise, silencing of AMPK spontaneously increases AMPD activity, demonstrating that these enzymes counter-regulate each other. Furthermore, we show that a downstream product of AMP metabolism through AMPD2, uric acid, can inhibit AMPK activity in human hepatocytes. Finally, we show that fructose-induced fat accumulation in hepatocytes is due to a dominant stimulation of AMPD2 despite stimulating AMPK. In this regard, AMPD2-deficient hepatocytes demonstrate a further activation of AMPK after fructose exposure in association with increased fatty acid oxidation, and conversely silencing AMPK enhances AMPD-dependent fat accumulation. In vivo, we show that sucrose fed rats also develop fatty liver that is blocked by metformin in association with both a reduction in AMPD activity and an increase in AMPK activity. In summary, AMPD and AMPK are both important in hepatic fat accumulation and counter-regulate each other. We present the novel finding that uric acid inhibits AMPK kinase activity in fructose-fed hepatocytes thus providing new insights into the pathogenesis of fatty liver. PMID:23152807

  4. Allostery and conformational dynamics in cAMP-binding acyltransferases.

    PubMed

    Podobnik, Marjetka; Siddiqui, Nida; Rebolj, Katja; Nambi, Subhalaxmi; Merzel, Franci; Visweswariah, Sandhya S

    2014-06-01

    Mycobacteria harbor unique proteins that regulate protein lysine acylation in a cAMP-regulated manner. These lysine acyltransferases from Mycobacterium smegmatis (KATms) and Mycobacterium tuberculosis (KATmt) show distinctive biochemical properties in terms of cAMP binding affinity to the N-terminal cyclic nucleotide binding domain and allosteric activation of the C-terminal acyltransferase domain. Here we provide evidence for structural features in KATms that account for high affinity cAMP binding and elevated acyltransferase activity in the absence of cAMP. Structure-guided mutational analysis converted KATms from a cAMP-regulated to a cAMP-dependent acyltransferase and identified a unique asparagine residue in the acyltransferase domain of KATms that assists in the enzymatic reaction in the absence of a highly conserved glutamate residue seen in Gcn5-related N-acetyltransferase-like acyltransferases. Thus, we have identified mechanisms by which properties of similar proteins have diverged in two species of mycobacteria by modifications in amino acid sequence, which can dramatically alter the abundance of conformational states adopted by a protein. PMID:24748621

  5. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  6. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  7. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  8. cAMP signaling prevents podocyte apoptosis via activation of protein kinase A and mitochondrial fusion.

    PubMed

    Li, Xiaoying; Tao, Hua; Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  9. Modulators of cyclic AMP systems.

    PubMed

    Hess, S M; Chasin, M; Free, C A; Harris, D N

    1975-01-01

    On the basis of the data reported here, one may conclude that although many agents that act in the central nervous system are modulators of the action of cyclic AMP, it is difficult to establish a direct connection between the pharmacologic activity and the levels of cyclic AMP in the brain. This lack of interrelation applies to the benzodiazepines as well as to the pyrazolopyridines. The data for members of the latter group are somewhat frustrating in this regard, since an excellent correlation has been shown to exist between the potency of inhibition of PDE and activity in the antianxiety test. In measurements of steroidogenesis in the isolated adrenal cell, the correlation between activity in vito and the conflict assay is even better. The data presented here and reported elsewhere (Shimizu et al., 1974; Kelly et al., 1974; Mayer and King, 1974; King and Mayer, 1974) provide evidence that agents that act as inhibitors of PDE in cell-free systems exert their influence on cyclic AMP in tissue slices of the brain of guinea pigs by mechanisms that seem not to be related to an effect on PDE. Papaverine, and possibly chlordiazepoxide, may act by releasing agonists that, in turn, stimulate the accumulation of cyclic AMP. This activity is blocked bo other inhibitors of PDE, such as theophyline. Results obtained by the use of platelets are refreshingly clear. Inhibition of aggregation has been shown to occur when the level of cyclic AMP is raised, and a suggestive exists that the most potent inhibitors of platelet PDE are the best potentiators of the action of PGE1 in blocking aggregation. The study utilizing drugs collected from a large number of therapeutic classes makes clear that it is difficult to attribute the mechanism of action for any of the classes studied to modulation of cyclic AMP. An unexpected finding of this study, however, was the fact that pharmacologic agents include an unusually large number of inhibitors of PDE as compared with agents chosen at

  10. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  11. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  12. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  13. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  14. Structural and functional characterization of Pseudomonas aeruginosa global regulator AmpR.

    PubMed

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen; Mathee, Kalai

    2014-11-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5' rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ(54) and σ(70) consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  15. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  16. Occurrence of cyclic AMP and related enzymes during germination of Pinus pinea seeds.

    PubMed

    Martelli, P; Lusini, P; Bovalini, L; Bartali, R; Franchi, G G; Cinci, G

    1987-01-01

    The occurrence of cAMP, adenylate cyclase and cAMP phosphodiesterase has been tested in Pinus pinea seed during germination. The study has been carried out on dormant and imbibed seeds, seedlings, endospermic residues, roots and cotyledons. cAMP has been detected by the protein binding method and its occurrence has been verified by HPLC detections. cAMP phosphodiesterase shows a very high activity at acidic pH, while being completely inactive at pH 7.4. At this pH value, well detectable levels of adenylate cyclase have been observed. Therefore, the classical pathway of synthesis and breakdown of cAMP, already accepted for animal and bacterial cells, seems to be operating in Pinus pinea plant too. PMID:3038780

  17. Pseudomonas aeruginosa β-lactamase induction requires two permeases, AmpG and AmpP

    PubMed Central

    2010-01-01

    Background In Enterobacteriaceae, β-lactam antibiotic resistance involves murein recycling intermediates. Murein recycling is a complex process with discrete steps taking place in the periplasm and the cytoplasm. The AmpG permease is critical to this process as it transports N-acetylglucosamine anhydrous N-acetylmuramyl peptides across the inner membrane. In Pseudomonadaceae, this intrinsic mechanism remains to be elucidated. Since the mechanism involves two cellular compartments, the characterization of transporters is crucial to establish the link. Results Pseudomonas aeruginosa PAO1 has two ampG paralogs, PA4218 (ampP) and PA4393 (ampG). Topology analysis using β-galactosidase and alkaline phosphatase fusions indicates ampP and ampG encode proteins which possess 10 and 14 transmembrane helices, respectively, that could potentially transport substrates. Both ampP and ampG are required for maximum expression of β-lactamase, but complementation and kinetic experiments suggest they act independently to play different roles. Mutation of ampG affects resistance to a subset of β-lactam antibiotics. Low-levels of β-lactamase induction occur independently of either ampP or ampG. Both ampG and ampP are the second members of two independent two-gene operons. Analysis of the ampG and ampP operon expression using β-galactosidase transcriptional fusions showed that in PAO1, ampG operon expression is β-lactam and ampR-independent, while ampP operon expression is β-lactam and ampR-dependent. β-lactam-dependent expression of the ampP operon and independent expression of the ampG operon is also dependent upon ampP. Conclusions In P. aeruginosa, β-lactamase induction occurs in at least three ways, induction at low β-lactam concentrations by an as yet uncharacterized pathway, at intermediate concentrations by an ampP and ampG dependent pathway, and at high concentrations where although both ampP and ampG play a role, ampG may be of greater importance. Both ampP and amp

  18. Nanocapsules templated on liquid cores stabilized by graft amphiphilic polyelectrolytes

    NASA Astrophysics Data System (ADS)

    Szafraniec, Joanna; Janik, Małgorzata; Odrobińska, Joanna; Zapotoczny, Szczepan

    2015-03-01

    A surfactant-free method of preparation of nanocapsules templated on liquid cores using amphiphilic graft polyelectrolytes was developed. A model photoactive copolymer, poly(sodium 2-acrylamido-2-methyl-1-propanesulfonate) with grafted poly(vinylnaphthalene) chains (PAMPS-graft-PVN) was used to stabilize toluene droplets in an aqueous emulsion. The macromolecules, due to their amphiphilic character and the presence of strong ionic groups, tend to undergo intramolecular aggregation in water but at the water-oil interface less compact conformation is preferred with PVN grafts anchoring in the oil phase and the charged PAMPS main chains residing in the aqueous phase, thus stabilizing the nanoemulsion droplets. Formation of such nanocapsules was confirmed by dynamic light scattering measurements as well as SEM and cryo-TEM imaging. Grafting density and content of the chromophores in the graft copolymers were varied in order to achieve high stability of the coated nanodroplets. It was shown that the capsules are better stabilized by the copolymers with many short hydrophobic grafts than with fewer but longer ones. Use of photoactive polyelectrolytes enabled spectroscopic investigation of the relationship between conformation of the macromolecules and stabilization of the oil-core nanocapsules. Long-term stability of the nanocapsules was achieved and further increased by multilayer shell formation using polyelectrolytes deposited via the layer-by-layer approach. The obtained capsules served as efficient nanocontainers for a hydrophobic fluorescent probe. The proposed strategy of nanocapsule preparation may be easily extended to biologically relevant polymers and applied to fabricate liquid core nanodelivery systems without the need of using low molecular weight additives which may have adverse effects in numerous biomedical applications.A surfactant-free method of preparation of nanocapsules templated on liquid cores using amphiphilic graft polyelectrolytes was developed

  19. Synthesis and Characterization of Water-Soluble Conjugated Oligoelectrolytes for Near-Infrared Fluorescence Biological Imaging.

    PubMed

    Woo, Shin-Jae; Park, Sungmin; Jeong, Ji-Eun; Hong, Yoochan; Ku, Minhee; Kim, Bo Yun; Jang, Il Ho; Heo, Soon Chul; Wang, Taejun; Kim, Ki Hean; Yang, Jaemoon; Kim, Jae Ho; Woo, Han Young

    2016-06-29

    Near-infrared (NIR) fluorophores attract increasing attention as a molecular marker (or probe) for in vivo and in vitro biological fluorescence imaging. Three types of new NIR fluorescent conjugated oligoelectrolytes (COEs: Q-FlTBTTFl, Q-FlBBTFl, and Q-FlTBBTTFl) are synthesized with quaternized ammonium ionic groups in their side-chains for water solubility. The emission wavelength is modulated in the range 600-1300 nm, by adjusting the intramolecular charge transfer in the molecular backbone based on the electron-rich fluorene (and/or thiophene) and electron-deficient benzo[2,1,3]thiadiazole (or benzo[1,2-c:4,5-c']bis[1,2,5]thiadiazole) moieties. The COEs show a remarkably larger Stokes shift (147-276 nm) compared to commercial rhodamine and cyanine dyes in water, avoiding self-quenching and interference from the excitation backscattered light. The photoluminescence (PL) quantum efficiency is improved substantially by up to 27.8% in water by fabricating a vesicular complex, COE/v, with a block ionomer, poly[(ethylene oxide)-block-(sodium 2-acrylamido-2-methyl-1-propanesulfonate)]. In vitro cellular uptake images with the COEs are obtained with good biocompatibility by confocal single-photon and two-photon microscopy. The ex vivo and in vivo images of a mouse xenograft model treated with the Q-FlBBTFl/v exhibit a substantially stronger fluorescence signal at the tumor site than at the other organs, highlighting the potential of the COE/v as an NIR fluorescent imaging agent for the diagnosis of cancer. PMID:27267787

  20. Differential effects on cAMP on the MAP kinase cascade: evidence for a cAMP-insensitive step that can bypass Raf-1.

    PubMed Central

    Faure, M; Bourne, H R

    1995-01-01

    Because cAMP exerts opposite effects on cell proliferation in different cell types, we undertook to study its effect on the mitogen-activated protein kinase (MAPK) pathway in three cell lines (Rat-1, Swiss-3T3, and COS-7) chosen for their different mitogenic responses to cAMP. We measured the effect of cAMP on MAPK, MEK, and Raf-1 activities after stimulation by agonists acting through a tyrosine kinase receptor (epidermal growth factor) or a G protein-coupled receptor (lysophosphatidic acid). In Rat-1 cells we found that cAMP strongly inhibited all three activities (MAPK, MEK, and Raf-1), in good agreement with its effect on cell proliferation in these cells. In Swiss-3T3 and COS-7 cells, on the contrary, cAMP did not inhibit epidermal growth factor- and lysophosphatidic acid-induced stimulation of MAPK and MEK activities, and even stimulated MAPK activity slightly on its own. Again these results are in good agreement with the proliferative effect of cAMP in Swiss-3T3 cells. Raf-1 activity on the hand, was inhibited by cAMP in Swiss-3T3 and COS-7 as it was in Rat-1 cells. This result indicates that signaling pathways in Swiss-3T3 and COS-7 cells can activate MEK and MAPK in a Raf-1-independent and cAMP-insensitive manner. Our results add to growing evidence for the existence of Ras- and/or Raf-1-independent pathways leading to MEK and MAPK activation. Images PMID:7579705

  1. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  2. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  3. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  4. Cyclic AMP can promote APL progression and protect myeloid leukemia cells against anthracycline-induced apoptosis

    PubMed Central

    Gausdal, G; Wergeland, A; Skavland, J; Nguyen, E; Pendino, F; Rouhee, N; McCormack, E; Herfindal, L; Kleppe, R; Havemann, U; Schwede, F; Bruserud, Ø; Gjertsen, B T; Lanotte, M; Ségal-Bendirdjian, E; Døskeland, S O

    2013-01-01

    We show that cyclic AMP (cAMP) elevating agents protect blasts from patients with acute promyelocytic leukemia (APL) against death induced by first-line anti-leukemic anthracyclines like daunorubicin (DNR). The cAMP effect was reproduced in NB4 APL cells, and shown to depend on activation of the generally cytoplasmic cAMP-kinase type I (PKA-I) rather than the perinuclear PKA-II. The protection of both NB4 cells and APL blasts was associated with (inactivating) phosphorylation of PKA site Ser118 of pro-apoptotic Bad and (activating) phosphorylation of PKA site Ser133 of the AML oncogene CREB. Either event would be expected to protect broadly against cell death, and we found cAMP elevation to protect also against 2-deoxyglucose, rotenone, proteasome inhibitor and a BH3-only mimetic. The in vitro findings were mirrored by the findings in NSG mice with orthotopic NB4 cell leukemia. The mice showed more rapid disease progression when given cAMP-increasing agents (prostaglandin E2 analog and theophylline), both with and without DNR chemotherapy. The all-trans retinoic acid (ATRA)-induced terminal APL cell differentiation is a cornerstone in current APL treatment and is enhanced by cAMP. We show also that ATRA-resistant APL cells, believed to be responsible for treatment failure with current ATRA-based treatment protocols, were protected by cAMP against death. This suggests that the beneficial pro-differentiating and non-beneficial pro-survival APL cell effects of cAMP should be weighed against each other. The results suggest also general awareness toward drugs that can affect bone marrow cAMP levels in leukemia patients. PMID:23449452

  5. 8-Chloro-cAMP induces apoptotic cell death in a human mammary carcinoma cell (MCF-7) line.

    PubMed Central

    Bøe, R.; Gjertsen, B. T.; Døskeland, S. O.; Vintermyr, O. K.

    1995-01-01

    8-Cl-cAMP and 8-NH2-cAMP induced MCF-7 cell death. The type(s) of cell death were studied in more detail and compared with the cell death type (apoptosis) induced by okadaic acid, an inhibitor of serine/threonine phosphatases. By morphological criteria dying cells showed loss of cell-cell interactions and microvilli, condensation of nuclear chromatin and segregation of cytoplasmic organelles. By in situ nick end-labelling, using digoxigenin-conjugated dUTP as probe, a large fraction of 8-Cl-cAMP, 8-NH2-cAMP and 8-Cl-adenosine-exposed cells stained positively in the advanced stages of death. In the early phase of chromatin condensation the cells stained negatively. Specific (internucleosomal) DNA fragmentation was not observed. The MCF-7 cell death induced by 8-Cl-cAMP and 8-NH2-cAMP was not mediated by activation of the cAMP kinase since more stable cAMP analogues (8-CPT-cAMP and N6-benzoyl-cAMP) or forskolin failed to induce death. Furthermore, 8-Cl-cAMP action was counteracted by adenosine deaminase and 3-isobutyl-1-methylxanthine, and mimicked by 8-Cl-adenosine, a major metabolite of 8-Cl-cAMP. It is concluded that 8-Cl- and 8-NH2-cAMP can induce morphological and biochemical effects resembling apoptotic cell death in MCF-7 cells through their conversion into potent cytotoxic metabolite(s). Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7577461

  6. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  7. The dependence of Escherichia coli asparaginase II formation on cyclic AMP and cyclic AMP receptor protein.

    PubMed

    Russell, L; Yamazaki, H

    1978-05-01

    The amount of asparaginase II in an Escherichia coli wild-type strain (cya+, crp+) markedly increased upon a shift from aerobic to anaerobic growth. However, no such increase occurred in a mutant (cya) lacking cyclic AMP synthesis unless supplemented with exogenous cyclic AMP. Since a mutant (crp) deficient in cyclic AMP receptor protein also did not support the anaerobic formation of this enzyme, it is concluded that the formation of E. coli asparaginase II depends on both cyclic AMP and cyclic AMP receptor protein. PMID:207402

  8. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  9. Cyclic di-AMP mediates biofilm formation.

    PubMed

    Peng, Xian; Zhang, Yang; Bai, Guangchun; Zhou, Xuedong; Wu, Hui

    2016-03-01

    Cyclic di-AMP (c-di-AMP) is an emerging second messenger in bacteria. It has been shown to play important roles in bacterial fitness and virulence. However, transduction of c-di-AMP signaling in bacteria and the role of c-di-AMP in biofilm formation are not well understood. The level of c-di-AMP is modulated by activity of di-adenylyl cyclase that produces c-di-AMP and phosphodiesterase (PDE) that degrades c-di-AMP. In this study, we determined that increased c-di-AMP levels by deletion of the pdeA gene coding for a PDE promoted biofilm formation in Streptococcus mutans. Deletion of pdeA upregulated expression of gtfB, the gene coding for a major glucan producing enzyme. Inactivation of gtfB blocked the increased biofilm by the pdeA mutant. Two c-di-AMP binding proteins including CabPA (SMU_1562) and CabPB (SMU_1708) were identified. Interestingly, only CabPA deficiency inhibited both the increased biofilm formation and the upregulated expression of GtfB observed in the pdeA mutant. In addition, CabPA but not CabPB interacted with VicR, a known transcriptional factor that regulates expression of gtfB, suggesting that a signaling link between CabPA and GtfB through VicR. Increased biofilm by the pdeA deficiency also enhanced bacterial colonization of Drosophila in vivo. Taken together, our studies reveal a new role of c-di-AMP in mediating biofilm formation through a CabPA/VicR/GtfB signaling network in S. mutans. PMID:26564551

  10. Intracellular signaling in the regulation of renal Na-K-ATPase. I. Role of cyclic AMP and phospholipase A2.

    PubMed Central

    Satoh, T; Cohen, H T; Katz, A I

    1992-01-01

    We have reported that dopamine (DA) inhibits Na-K-ATPase activity in the cortical collecting duct (CCD) by stimulating the DA1 receptor, and the present study was designed to evaluate the mechanism of this effect. Short-term exposure (15-30 min) of microdissected rat CCD to DA, a DA1 agonist (fenoldopam), vasopressin (AVP), forskolin, or dibutyryl cAMP (dBcAMP), which increase cAMP content by different mechanisms, strongly (approximately 60%) inhibited Na-K-ATPase activity. 2',5'-dideoxyadenosine, an inhibitor of adenylate cyclase, completely blocked Na-K-ATPase inhibition by DA or fenoldopam, and IP20, an inhibitor peptide of cAMP-dependent protein kinase A (PKA), abolished the Na:K pump effect of all the cAMP agonists listed above. To verify whether the mechanism of pump inhibition by agents that increase cell cAMP involves phospholipase A2 (PLA2), we used mepacrine, a PLA2 inhibitor, which also abolished Na-K-ATPase inhibition by DA or fenoldopam, as well as by AVP, forskolin, or dBcAMP. Arachidonic acid (10(-7) - 10(-4) M) inhibited Na-K-ATPase activity in dose-dependent fashion. Corticosterone, which induces lipomodulin, a PLA2 inhibitor protein inactivated by PKA, equally abolished the pump effects of DA, fenoldopam, forskolin, and dBcAMP, suggesting that lipomodulin might act between PKA and PLA2 in cAMP-dependent pump regulation. We conclude that dopamine inhibits Na-K-ATPase activity in the CCD through a DA1 receptor-mediated cAMP-PKA pathway that involves the stimulation of PLA2 and arachidonic acid release, possibly mediated by inactivation of lipomodulin. This pathway is shared by other agonists that increase cell cAMP and thus stimulate PKA activity. PMID:1349027

  11. A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP.

    PubMed

    Commichau, Fabian M; Dickmanns, Achim; Gundlach, Jan; Ficner, Ralf; Stülke, Jörg

    2015-07-01

    Second messengers are key components of many signal transduction pathways. In addition to cyclic AMP, ppGpp and cyclic di-GMP, many bacteria use also cyclic di-AMP as a second messenger. This molecule is synthesized by distinct classes of diadenylate cyclases and degraded by phosphodiesterases. The control of the intracellular c-di-AMP pool is very important since both a lack of this molecule and its accumulation can inhibit growth of the bacteria. In many firmicutes, c-di-AMP is essential, making it the only known essential second messenger. Cyclic di-AMP is implicated in a variety of functions in the cell, including cell wall metabolism, potassium homeostasis, DNA repair and the control of gene expression. To understand the molecular mechanisms behind these functions, targets of c-di-AMP have been identified and characterized. Interestingly, c-di-AMP can bind both proteins and RNA molecules. Several proteins that interact with c-di-AMP are required to control the intracellular potassium concentration. In Bacillus subtilis, c-di-AMP also binds a riboswitch that controls the expression of a potassium transporter. Thus, c-di-AMP is the only known second messenger that controls a biological process by interacting with both a protein and the riboswitch that regulates its expression. Moreover, in Listeria monocytogenes c-di-AMP controls the activity of pyruvate carboxylase, an enzyme that is required to replenish the citric acid cycle. Here, we review the components of the c-di-AMP signaling system. PMID:25869574

  12. Detection of ESBL- and AmpC-producing E. coli isolates from urinary tract infections

    PubMed Central

    Shayan, Sara; Bokaeian, Mohammad

    2015-01-01

    Background: Extended-spectrum β-lactamases (ESBLs) and AmpC enzymes have been observed in virtually all species of the family Enterobacteriaceae. The β-lactamase producing bacteria cause many serious infections, including urinary tract infections. These enzymes are predominantly plasmid mediated. There are no recommended guidelines for detection of this resistance mechanism and there is a need to address this issue as much as the detection of ESBLs. This study was undertaken to characterize ESBL and AmpC producers among Escherichia coli by polymerase chain reaction (PCR), which were initially screened by phenotypic method. Materials and Methods: A total of 90 isolates of E. coli were recovered from the urinary tract during a 7-month period, and were screened for ESBLs and AmpC production by disk diffusion test using cefoxitin (30 μg) disks and confirmed by combined disk diffusion test using phenyl boronic acid. The presence of genes encoding CIT, FOX, and TEM was detected by PCR. Results: On disk diffusion test, 59 of 90 isolates were resistant to third generation of cephalosporins; of these 37 (62.7%) and 3 (5%) were ESBL and AmpC producers, respectively. PCR showed that 29 (49.1%) and 3 (5%) were positive for blaTEM and blaCMY-2, respectively. Conclusion: ESBL- and AmpC-producing E. coli isolates cause significant resistance to cephalosporin. There is a need for a correct and reliable phenotypic test to identify AmpC β-lactamases and to discriminate between AmpC and ESBL producers. This work showed that boronic acid can differentiate ESBL enzymes from AmpC enzymes. PMID:26605249

  13. Amp-hour counting charge control for photovoltaic hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-10-01

    An amp-hour counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based photovoltaic hybrid charge controller. This work included extensive laboratory and field testing of the charge algorithm on vented lead-antimony and valve regulated lead-acid batteries. The test results have shown that with proper setup amp-hour counting charge control is more effective than conventional voltage regulated sub-array shedding in returning the lead-acid battery to a high state of charge.

  14. Nucleoprotein structure influences the response of the mouse mammary tumor virus promoter to activation of the cyclic AMP signalling pathway.

    PubMed Central

    Pennie, W D; Hager, G L; Smith, C L

    1995-01-01

    Recent studies have provided evidence of crosstalk between steroid receptors and cyclic AMP (cAMP) signalling pathways in the regulation of gene expression. A synergism between intracellular phosphorylation inducers and either glucocorticoids or progestins has been shown to occur during activation of the mouse mammary tumor virus (MMTV) promoter. We have investigated the effect of 8-Br-cAMP and okadaic acid, modulators of cellular kinases and phosphatases, on the hormone-induced activation of the MMTV promoter in two forms: a transiently transfected template with a disorganized, accessible nucleoprotein structure and a stably replicating template with an ordered, inaccessible nucleoprotein structure. Both okadaic acid and 8-Br-cAMP synergize significantly with either glucocorticoids or progestins in activating the transiently transfected MMTV template. In contrast, 8-Br-cAMP, but not okadaic acid, is antagonistic to hormone-induced activation of the stably replicating MMTV template. Nuclear run-on experiments demonstrate that this inhibition is a transcriptional effect on both hormone-induced transcription and basal transcription. Surprisingly, 8-Br-cAMP does not inhibit glucocorticoid-induced changes in restriction enzyme access and nuclear factor 1 binding. However, association of a complex with the TATA box region is inhibited in the presence of 8-Br-cAMP. Thus, cAMP treatment interferes with the initiation process but does not inhibit interaction of the receptor with the template. Since the replicated, ordered MMTV templates and the transfected, disorganized templates show opposite responses to 8-Br-cAMP treatment, we conclude that chromatin structure can influence the response of a promoter to activation of the cAMP signalling pathway. PMID:7891707

  15. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  16. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  17. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    PubMed Central

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  18. An antimicrobial peptide Ar-AMP from amaranth (Amaranthus retroflexus L.) seeds.

    PubMed

    Lipkin, Aleksey; Anisimova, Veronika; Nikonorova, Aleksandra; Babakov, Aleksey; Krause, Eberhardt; Bienert, Mikhael; Grishin, Eugene; Egorov, Tsezi

    2005-10-01

    A 30-residue antimicrobial peptide Ar-AMP was isolated from the seeds of amaranth Amaranthus retroflexus L. essentially by a single step procedure using reversed-phase HPLC, and its in vitro biological activities were studied. The complete amino acid sequence of Ar-AMP was determined by Edman degradation in combination with mass spectrometric methods. In addition, the cDNA encoding Ar-AMP was obtained and sequenced. The cDNA encodes a precursor protein consisting of the N-terminal putative signal sequence of 25 amino acids, a mature peptide of 30 amino acids and a 34-residue long C-terminal region cleaved during post-translational processing. According to sequence similarity the Ar-AMP belongs to the hevein-like family of antimicrobial peptides with six cysteine residues. In spite of the fact that seeds were collected in 1967 and lost their germination capacity, Ar-AMP retained its biological activities. It effectively inhibited the growth of different fungi tested: Fusarium culmorium (Smith) Sacc., Helminthosporium sativum Pammel., King et Bakke, Alternaria consortiale Fr., and Botrytis cinerea Pers., caused morphological changes in Rhizoctonia solani Kühn at micromolar concentrations and protected barley seedlings from H. sativum infection. PMID:16126239

  19. Mutagenesis of the cyclic AMP receptor protein of Escherichia coli: targeting positions 83, 127 and 128 of the cyclic nucleotide binding pocket.

    PubMed Central

    Lee, E J; Glasgow, J; Leu, S F; Belduz, A O; Harman, J G

    1994-01-01

    The cyclic 3', 5' adenosine monophosphate (cAMP) binding pocket of the cAMP receptor protein (CRP) of Escherichia coli was mutagenized to substitute cysteine or glycine for serine 83; cysteine, glycine, isoleucine, or serine for threonine 127; and threonine or alanine for serine 128. Cells that expressed the binding pocket residue-substituted forms of CRP were characterized by measurements of beta-galactosidase activity. Purified wild-type and mutant CRP preparations were characterized by measurement of cAMP binding activity and by their capacity to support lacP activation in vitro. CRP structure was assessed by measurement of sensitivity to protease and DTNB-mediated subunit crosslinking. The results of this study show that cAMP interactions with serine 83, threonine 127 and serine 128 contribute to CRP activation and have little effect on cAMP binding. Amino acid substitutions that introduce hydrophobic amino acid side chain constituents at either position 127 or 128 decrease CRP discrimination of cAMP and cGMP. Finally, cAMP-induced CRP structural change(s) that occur in or near the CRP hinge region result from cAMP interaction with threonine 127; substitution of threonine 127 by cysteine, glycine, isoleucine, or serine produced forms of CRP that contained, independently of cAMP binding, structural changes similar to those of the wild-type CRP:cAMP complex. Images PMID:8065899

  20. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  1. AmpC β-Lactamases

    PubMed Central

    Jacoby, George A.

    2009-01-01

    Summary: AmpC β-lactamases are clinically important cephalosporinases encoded on the chromosomes of many of the Enterobacteriaceae and a few other organisms, where they mediate resistance to cephalothin, cefazolin, cefoxitin, most penicillins, and β-lactamase inhibitor-β-lactam combinations. In many bacteria, AmpC enzymes are inducible and can be expressed at high levels by mutation. Overexpression confers resistance to broad-spectrum cephalosporins including cefotaxime, ceftazidime, and ceftriaxone and is a problem especially in infections due to Enterobacter aerogenes and Enterobacter cloacae, where an isolate initially susceptible to these agents may become resistant upon therapy. Transmissible plasmids have acquired genes for AmpC enzymes, which consequently can now appear in bacteria lacking or poorly expressing a chromosomal blaAmpC gene, such as Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Resistance due to plasmid-mediated AmpC enzymes is less common than extended-spectrum β-lactamase production in most parts of the world but may be both harder to detect and broader in spectrum. AmpC enzymes encoded by both chromosomal and plasmid genes are also evolving to hydrolyze broad-spectrum cephalosporins more efficiently. Techniques to identify AmpC β-lactamase-producing isolates are available but are still evolving and are not yet optimized for the clinical laboratory, which probably now underestimates this resistance mechanism. Carbapenems can usually be used to treat infections due to AmpC-producing bacteria, but carbapenem resistance can arise in some organisms by mutations that reduce influx (outer membrane porin loss) or enhance efflux (efflux pump activation). PMID:19136439

  2. Inducing coproporphyria in rat hepatocyte cultures using cyclic AMP and cyclic AMP-releasing agents.

    PubMed

    De Matteis, Francesco; Harvey, Carolyn

    2005-07-01

    Cyclic AMP (c-AMP), added on its own to rat hepatocyte cultures, caused a marked accumulation of coproporphyrin III. The results obtained by comparing the effect of c-AMP to that of exogenous 5-aminolevulinate (ALA), and from adding c-AMP and ALA together, indicated that the coproporphyrinogen III metabolism was blocked, even though no inhibition of the relevant enzyme, coproporphyrinogen oxidase, could be demonstrated. Preferential accumulation of coproporphyrin could also be produced in cultures of rat hepatocytes by agents that raise the cellular levels of cyclic AMP, such as glucagon. The effect of supplementing the culture medium with triiodothyronine (T3) on the response of rat hepatocytes to c-AMP was also investigated. T3, which is known to stimulate mitochondrial respiration, uncoupling O2 consumption from ATP synthesis, produced a c-AMP-like effect when given on its own and potentiated the effect of c-AMP, with an apparent increase in the severity of the metabolic block. It is suggested that an oxidative mechanism may be activated in c-AMP and T3-induced coproporphyria, preferentially involving the mitochondrial compartment, leading to oxidation of porphyrinogen intermediates of haem biosynthesis, especially coproporphyrinogen. Coproporphyin, the fully oxidized aromatic derivative produced, cannot be metabolized and will therefore accumulate. PMID:15902420

  3. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  4. Molecular and kinetic alterations of muscle AMP deaminase during chronic creatine depletion.

    PubMed

    Rush, J W; Tullson, P C; Terjung, R L

    1998-02-01

    We examined a possible mechanism to account for the maintenance of peak AMP deamination rate in fast-twitch muscle of rats fed the creatine analog beta-guanidinopropionic acid (beta-GPA), in spite of reduced abundance of the enzyme AMP deaminase (AMPD). AMPD enzymatic capacity (determined at saturating AMP concentration) and AMPD protein abundance (Western blot) were coordinately reduced approximately 80% in fast-twitch white gastrocnemius muscle by beta-GPA feeding over 7 wk. Kinetic analysis of AMPD in the soluble cell fraction demonstrated a single Michaelis-Menten constant (Km; approximately 1.5 mM) in control muscle extracts. An additional high-affinity Km (approximately 0.03 mM) was revealed at low AMP concentrations in extracts of beta-GPA-treated muscle. The kinetic alteration in AMPD reflects increased molecular activity at low AMP concentrations; this could account for high rates of deamination in beta-GPA-treated muscle in situ, despite the loss of AMPD enzyme protein. The elimination of this kinetic effect by treatment of beta-GPA-treated muscle extracts with acid phosphatase in vitro suggests that phosphorylation is involved in the kinetic control of skeletal muscle AMPD in vivo. PMID:9486137

  5. STIMULATION OF MUSCLE PROTEIN SYNTHESIS BY GLUCOSE IN NEONATES IS AMP KINASE INDEPENDENT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Muscle protein synthesis is elevated in the neonate, in part due to an elevated response to the rise in amino acids and insulin after a meal. Recent evidence suggests that glucose may also play a role in the regulation of protein synthesis. AMP kinase has been recognized as an energy sensor and a ...

  6. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  7. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  8. Proteomic and Metabolic Analyses of S49 Lymphoma Cells Reveal Novel Regulation of Mitochondria by cAMP and Protein Kinase A.

    PubMed

    Wilderman, Andrea; Guo, Yurong; Divakaruni, Ajit S; Perkins, Guy; Zhang, Lingzhi; Murphy, Anne N; Taylor, Susan S; Insel, Paul A

    2015-09-01

    Cyclic AMP (cAMP), acting via protein kinase A (PKA), regulates many cellular responses, but the role of mitochondria in such responses is poorly understood. To define such roles, we used quantitative proteomic analysis of mitochondria-enriched fractions and performed functional and morphologic studies of wild-type (WT) and kin(-) (PKA-null) murine S49 lymphoma cells. Basally, 75 proteins significantly differed in abundance between WT and kin(-) S49 cells. WT, but not kin(-), S49 cells incubated with the cAMP analog 8-(4-chlorophenylthio)adenosine cAMP (CPT-cAMP) for 16 h have (a) increased expression of mitochondria-related genes and proteins, including ones in pathways of branched-chain amino acid and fatty acid metabolism and (b) increased maximal capacity of respiration on branched-chain keto acids and fatty acids. CPT-cAMP also regulates the cellular rate of ATP-utilization, as the rates of both ATP-linked respiration and proton efflux are decreased in WT but not kin(-) cells. CPT-cAMP protected WT S49 cells from glucose or glutamine deprivation, In contrast, CPT-cAMP did not protect kin(-) cells or WT cells treated with the PKA inhibitor H89 from glutamine deprivation. Under basal conditions, the mitochondrial structure of WT and kin(-) S49 cells is similar. Treatment with CPT-cAMP produced apoptotic changes (i.e. decreased mitochondrial density and size and loss of cristae) in WT, but not kin(-) cells. Together, these findings show that cAMP acts via PKA to regulate multiple aspects of mitochondrial function and structure. Mitochondrial perturbation thus likely contributes to cAMP/PKA-mediated cellular responses. PMID:26203188

  9. Proteomic and Metabolic Analyses of S49 Lymphoma Cells Reveal Novel Regulation of Mitochondria by cAMP and Protein Kinase A*

    PubMed Central

    Wilderman, Andrea; Guo, Yurong; Divakaruni, Ajit S.; Perkins, Guy; Zhang, Lingzhi; Murphy, Anne N.; Taylor, Susan S.; Insel, Paul A.

    2015-01-01

    Cyclic AMP (cAMP), acting via protein kinase A (PKA), regulates many cellular responses, but the role of mitochondria in such responses is poorly understood. To define such roles, we used quantitative proteomic analysis of mitochondria-enriched fractions and performed functional and morphologic studies of wild-type (WT) and kin− (PKA-null) murine S49 lymphoma cells. Basally, 75 proteins significantly differed in abundance between WT and kin− S49 cells. WT, but not kin−, S49 cells incubated with the cAMP analog 8-(4-chlorophenylthio)adenosine cAMP (CPT-cAMP) for 16 h have (a) increased expression of mitochondria-related genes and proteins, including ones in pathways of branched-chain amino acid and fatty acid metabolism and (b) increased maximal capacity of respiration on branched-chain keto acids and fatty acids. CPT-cAMP also regulates the cellular rate of ATP-utilization, as the rates of both ATP-linked respiration and proton efflux are decreased in WT but not kin− cells. CPT-cAMP protected WT S49 cells from glucose or glutamine deprivation, In contrast, CPT-cAMP did not protect kin− cells or WT cells treated with the PKA inhibitor H89 from glutamine deprivation. Under basal conditions, the mitochondrial structure of WT and kin− S49 cells is similar. Treatment with CPT-cAMP produced apoptotic changes (i.e. decreased mitochondrial density and size and loss of cristae) in WT, but not kin− cells. Together, these findings show that cAMP acts via PKA to regulate multiple aspects of mitochondrial function and structure. Mitochondrial perturbation thus likely contributes to cAMP/PKA-mediated cellular responses. PMID:26203188

  10. Strategies to overcome extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases in shigellae.

    PubMed

    Livermore, David M; Mushtaq, Shazad; Nguyen, Tue; Warner, Marina

    2011-05-01

    Oral cephalosporins and mecillinam are used to treat Shigella infections, but are compromised by extended-spectrum β-lactamases (ESBLs) and plasmid AmpC β-lactamases. Potential solutions include combining an oral or intravenous cephalosporin with a β-lactamase inhibitor (BLI) or using an oral penem. These strategies were examined using Escherichia coli transconjugants and clinical isolates with ESBLs or AmpC, as a proxy for shigellae. The Clinical and Laboratory Standards Institute agar dilution method was used with inocula of 10(4) and 10(6) colony-forming units/spot. ESBLs conferred resistance to the cephalosporins and mecillinam, at least at high inoculum, although: (i) ceftibuten was significantly compromised only by SHV and CTX-M-15 ESBLs, but not by TEM or CTX-M-9 and -14; (ii) cefdinir was little affected by TEM-type ESBLs, and mecillinam was little affected by CTX-M-9 group enzymes. The BLI clavulanic acid reduced the minimum inhibitory concentrations (MICs) of cephalosporins and mecillinam to ≤2 mg/L for ESBL-producers, even at high inocula; sulbactam in particular and tazobactam were less effective, especially against SHV types. Strains with AmpC were resistant to all cephalosporins±inhibitors, but mecillinam remained active (MIC=1 mg/L) against a strain with AmpC alone, whereas strains with TEM-1+AmpC were susceptible to mecillinam+clavulanic acid at ≤2 mg/L. Faropenem was active against all ESBL- and AmpC-producers at 4 mg/L, with little inoculum effect or inhibitor potentiation. In conclusion, cephalosporin+clavulanic acid combinations overcame ESBLs, with ceftibuten+clavulanic acid being particularly promising. Mecillinam+clavulanic acid and faropenem overcame both ESBLs and AmpC enzymes. Clinical utility will depend also on a drug's ability to reach intracellular shigellae in the intestinal epithelium and this deserves exploration for clavulanic acid and faropenem. PMID:21276715

  11. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein.

    PubMed

    Underwood, Adam J; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-12-01

    Cyclic di-AMP (c-di-AMP) is a recently recognized bacterial signaling molecule. In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed using a novel pneumococcal c-di-AMP binding protein (CabP). With this method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. PMID:25239824

  12. Involvement of the Pepper Antimicrobial Protein CaAMP1 Gene in Broad Spectrum Disease Resistance1[C][OA

    PubMed Central

    Lee, Sung Chul; Hwang, In Sun; Choi, Hyong Woo; Hwang, Byung Kook

    2008-01-01

    Pathogen-inducible antimicrobial defense-related proteins have emerged as key antibiotic peptides and enzymes involved in disease resistance in plants. A novel antimicrobial protein gene, CaAMP1 (for Capsicum annuum ANTIMICROBIAL PROTEIN1), was isolated from pepper (C. annuum) leaves infected with Xanthomonas campestris pv vesicatoria. Expression of the CaAMP1 gene was strongly induced in pepper leaves not only during pathogen infection but also after exposure to abiotic elicitors. The purified recombinant CaAMP1 protein possessed broad-spectrum antimicrobial activity against phytopathogenic bacteria and fungi. CaAMP1:smGFP fusion protein was localized mainly in the external and intercellular regions of onion (Allium cepa) epidermal cells. The virus-induced gene silencing technique and gain-of-function transgenic plants were used to determine the CaAMP1 gene function in plant defense. Silencing of CaAMP1 led to enhanced susceptibility to X. campestris pv vesicatoria and Colletotrichum coccodes infection, accompanied by reduced PATHOGENESIS-RELATED (PR) gene expression. In contrast, overexpression of CaAMP1 in Arabidopsis (Arabidopsis thaliana) conferred broad-spectrum resistance to the hemibiotrophic bacterial pathogen Pseudomonas syringae pv tomato, the biotrophic oomycete Hyaloperonospora parasitica, and the fungal necrotrophic pathogens Fusarium oxysporum f. sp. matthiolae and Alternaria brassicicola. CaAMP1 overexpression induced the salicylic acid pathway-dependent genes PR1 and PR5 but not the jasmonic acid-dependent defense gene PDF1.2 during P. syringae pv tomato infection. Together, these results suggest that the antimicrobial CaAMP1 protein is involved in broad-spectrum resistance to bacterial and fungal pathogen infection. PMID:18676663

  13. "Store-operated" cAMP signaling contributes to Ca2+-activated Cl- secretion in T84 colonic cells.

    PubMed

    Nichols, Jonathan M; Maiellaro, Isabella; Abi-Jaoude, Joanne; Curci, Silvana; Hofer, Aldebaran M

    2015-10-15

    Apical cAMP-dependent CFTR Cl(-) channels are essential for efficient vectorial movement of ions and fluid into the lumen of the colon. It is well known that Ca(2+)-mobilizing agonists also stimulate colonic anion secretion. However, CFTR is apparently not activated directly by Ca(2+), and the existence of apical Ca(2+)-dependent Cl(-) channels in the native colonic epithelium is controversial, leaving the identity of the Ca(2+)-activated component unresolved. We recently showed that decreasing free Ca(2+) concentration ([Ca(2+)]) within the endoplasmic reticulum (ER) lumen elicits a rise in intracellular cAMP. This process, which we termed "store-operated cAMP signaling" (SOcAMPS), requires the luminal ER Ca(2+) sensor STIM1 and does not depend on changes in cytosolic Ca(2+). Here we assessed the degree to which SOcAMPS participates in Ca(2+)-activated Cl(-) transport as measured by transepithelial short-circuit current (Isc) in polarized T84 monolayers in parallel with imaging of cAMP and PKA activity using fluorescence resonance energy transfer (FRET)-based reporters in single cells. In Ca(2+)-free conditions, the Ca(2+)-releasing agonist carbachol and Ca(2+) ionophore increased Isc, cAMP, and PKA activity. These responses persisted in cells loaded with the Ca(2+) chelator BAPTA-AM. The effect on Isc was enhanced in the presence of the phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine (IBMX), inhibited by the CFTR inhibitor CFTRinh-172 and the PKA inhibitor H-89, and unaffected by Ba(2+) or flufenamic acid. We propose that a discrete component of the "Ca(2+)-dependent" secretory activity in the colon derives from cAMP generated through SOcAMPS. This alternative mode of cAMP production could contribute to the actions of diverse xenobiotic agents that disrupt ER Ca(2+) homeostasis, leading to diarrhea. PMID:26316590

  14. A spontaneous change in the intracellular cyclic AMP level in Aspergillus niger is influenced by the sucrose concentration in the medium and by light.

    PubMed Central

    Gradisnik-Grapulin, M; Legisa, M

    1997-01-01

    A spontaneous rise in intracellular cyclic AMP (cAMP) levels was observed in the early stages of Aspergillus niger growth under conditions yielding large amounts of citric acid. The amount of cAMP formed was found to depend on the initial concentration of sucrose in the medium. Under higher-sucrose conditions, the cAMP peak appeared earlier and was higher, while in lower-sucrose media a flattened peak was observed later in fermentation. Since in media with higher concentrations of sucrose intracellular citric acid starts to accumulate earlier and more rapidly, cAMP synthesis may be triggered by intracellular acidification, which is caused by the dissociation of citric acid. No spontaneous increase in cAMP concentrations could be detected when the cells were grown in continuously illuminated cultures, suggesting that A. niger phosphodiesterase (PDE) is photoregulated. More evidence for the activation of PDE by light was obtained from morphological studies under light and dark conditions in the presence of cAMP or N6,O2'-dibutyryl cAMP, and this idea was additionally supported by experiments in which PDE inhibitors were tested. PMID:9212431

  15. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  16. Capsaicinoids regulate airway anion transporters through Rho kinase- and cyclic AMP-dependent mechanisms.

    PubMed

    Hibino, Yoshitaka; Morise, Masahiro; Ito, Yasushi; Mizutani, Takefumi; Matsuno, Tadakatsu; Ito, Satoru; Hashimoto, Naozumi; Sato, Mitsuo; Kondo, Masashi; Imaizumi, Kazuyoshi; Hasegawa, Yoshinori

    2011-10-01

    To investigate the effects of capsaicinoids on airway anion transporters, we recorded and analyzed transepithelial currents in human airway epithelial Calu-3 cells. Application of capsaicin (100 μM) attenuated vectorial anion transport, estimated as short-circuit currents (I(SC)), before and after stimulation by forskolin (10 μM) with concomitant reduction of cytosolic cyclic AMP (cAMP) levels. The capsaicin-induced inhibition of I(SC) was also observed in the response to 8-bromo-cAMP (1 mM, a cell-permeable cAMP analog) and 3-isobutyl-1-methylxanthine (1 mM, an inhibitor of phosphodiesterases). The capsaicin-induced inhibition of I(SC) was attributed to suppression of bumetanide (an inhibitor of the basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1)- and 4,4'-dinitrostilbene-2,2'-disulfonic acid (an inhibitor of basolateral HCO(3)(-)-dependent anion transporters)-sensitive components, which reflect anion uptake via basolateral cAMP-dependent anion transporters. In contrast, capsaicin potentiated apical Cl(-) conductance, which reflects conductivity through the cystic fibrosis transmembrane conductance regulator, a cAMP-regulated Cl(-) channel. All these paradoxical effects of capsaicin were mimicked by capsazepine. Forskolin application also increased phosphorylated myosin phosphatase target subunit 1, and the phosphorylation was prevented by capsaicin and capsazepine, suggesting that these capsaicinoids assume aspects of Rho kinase inhibitors. We also found that the increments in apical Cl(-) conductance were caused by conventional Rho kinase inhibitors, Y-27632 (20 μM) and HA-1077 (20 μM), with selective inhibition of basolateral Na(+)-K(+)-2 Cl(-) cotransporter 1. Collectively, capsaicinoids inhibit cAMP-mediated anion transport through down-regulation of basolateral anion uptake, paradoxically accompanied by up-regulation of apical cystic fibrosis transmembrane conductance regulator-mediated anion conductance. The latter is mediated by inhibition of Rho

  17. Astrocyte arachidonate and palmitate uptake and metabolism is differentially modulated by dibutyryl-cAMP treatment.

    PubMed

    Seeger, D R; Murphy, C C; Murphy, E J

    2016-07-01

    Astrocytes play a vital role in brain lipid metabolism; however the impact of the phenotypic shift in astrocytes to a reactive state on arachidonic acid metabolism is unknown. Therefore, we determined the impact of dibutyryl-cAMP (dBcAMP) treatment on radiolabeled arachidonic acid ([1-(14)C]20:4n-6) and palmitic acid ([1-(14)C]16:0) uptake and metabolism in primary cultured murine cortical astrocytes. In dBcAMP treated astrocytes, total [1-(14)C]20:4n-6 uptake was increased 1.9-fold compared to control, while total [1-(14)C]16:0 uptake was unaffected. Gene expression of long-chain acyl-CoA synthetases (Acsl), acyl-CoA hydrolase (Acot7), fatty acid binding protein(s) (Fabp) and alpha-synuclein (Snca) were determined using qRT-PCR. dBcAMP treatment increased expression of Acsl3 (4.8-fold) and Acsl4 (1.3-fold), which preferentially use [1-(14)C]20:4n-6 and are highly expressed in astrocytes, consistent with the increase in [1-(14)C]20:4n-6 uptake. However, expression of Fabp5 and Fabp7 were significantly reduced by 25% and 45%, respectively. Acot7 (20%) was also reduced, suggesting dBcAMP treatment favors acyl-CoA formation. dBcAMP treatment enhanced [1-(14)C]20:4n-6 (2.2-fold) and [1-(14)C]16:0 (1.6-fold) esterification into total phospholipids, but the greater esterification of [1-(14)C]20:4n-6 is consistent with the observed uptake through increased Acsl, but not Fabp expression. Although total [1-(14)C]16:0 uptake was not affected, there was a dramatic decrease in [1-(14)C]16:0 in the free fatty acid pool as esterification into the phospholipid pool was increased, which is consistent with the increase in Acsl3 and Acsl4 expression. In summary, our data demonstrates that dBcAMP treatment increases [1-(14)C]20:4n-6 uptake in astrocytes and this increase appears to be due to increased expression of Acsl3 and Acsl4 coupled with a reduction in Acot7 expression. PMID:27255639

  18. AMPS/PC - AUTOMATIC MANUFACTURING PROGRAMMING SYSTEM

    NASA Technical Reports Server (NTRS)

    Schroer, B. J.

    1994-01-01

    The AMPS/PC system is a simulation tool designed to aid the user in defining the specifications of a manufacturing environment and then automatically writing code for the target simulation language, GPSS/PC. The domain of problems that AMPS/PC can simulate are manufacturing assembly lines with subassembly lines and manufacturing cells. The user defines the problem domain by responding to the questions from the interface program. Based on the responses, the interface program creates an internal problem specification file. This file includes the manufacturing process network flow and the attributes for all stations, cells, and stock points. AMPS then uses the problem specification file as input for the automatic code generator program to produce a simulation program in the target language GPSS. The output of the generator program is the source code of the corresponding GPSS/PC simulation program. The system runs entirely on an IBM PC running PC DOS Version 2.0 or higher and is written in Turbo Pascal Version 4 requiring 640K memory and one 360K disk drive. To execute the GPSS program, the PC must have resident the GPSS/PC System Version 2.0 from Minuteman Software. The AMPS/PC program was developed in 1988.

  19. Isolation of novel ribozymes that ligate AMP-activated RNA substrates

    NASA Technical Reports Server (NTRS)

    Hager, A. J.; Szostak, J. W.

    1997-01-01

    BACKGROUND: The protein enzymes RNA ligase and DNA ligase catalyze the ligation of nucleic acids via an adenosine-5'-5'-pyrophosphate 'capped' RNA or DNA intermediate. The activation of nucleic acid substrates by adenosine 5'-monophosphate (AMP) may be a vestige of 'RNA world' catalysis. AMP-activated ligation seems ideally suited for catalysis by ribozymes (RNA enzymes), because an RNA motif capable of tightly and specifically binding AMP has previously been isolated. RESULTS: We used in vitro selection and directed evolution to explore the ability of ribozymes to catalyze the template-directed ligation of AMP-activated RNAs. We subjected a pool of 10(15) RNA molecules, each consisting of long random sequences flanking a mutagenized adenosine triphosphate (ATP) aptamer, to ten rounds of in vitro selection, including three rounds involving mutagenic polymerase chain reaction. Selection was for the ligation of an oligonucleotide to the 5'-capped active pool RNA species. Many different ligase ribozymes were isolated; these ribozymes had rates of reaction up to 0.4 ligations per hour, corresponding to rate accelerations of approximately 5 x10(5) over the templated, but otherwise uncatalyzed, background reaction rate. Three characterized ribozymes catalyzed the formation of 3'-5'-phosphodiester bonds and were highly specific for activation by AMP at the ligation site. CONCLUSIONS: The existence of a new class of ligase ribozymes is consistent with the hypothesis that the unusual mechanism of the biological ligases resulted from a conservation of mechanism during an evolutionary replacement of a primordial ribozyme ligase by a more modern protein enzyme. The newly isolated ligase ribozymes may also provide a starting point for the isolation of ribozymes that catalyze the polymerization of AMP-activated oligonucleotides or mononucleotides, which might have been the prebiotic analogs of nucleoside triphosphates.

  20. cAMP phosphodiesterase and activator protein of mammalian cAMP phosphodiesterase from Trypanosoma cruzi.

    PubMed

    Gonçalves, M F; Zingales, B; Colli, W

    1980-04-01

    Epimastigote forms of Trypanosoma cruzi contain a soluble cAMP phosphodiesterase. Optimal activity was found at pH 8.0 and in the presence of 5 mM Mn2+. Other cations were less efficient and did not give rise to an additional stimulation when added in the presence of optimal concentrations of Mn2+. The enzyme is not Ca2+ dependent. The apparent Km of the enzyme for the substrate is 40 microM and no kinetic evidence for the existence of two enzymes has been found. Theophylline and caffein did not inhibit the T. cruzi cAMP phosphodiesterase. The enzyme activity does not change during cell growth suggesting that the fluctuation observed in the levels of cAMP are largely a response to variations in adenylyl cyclase activity. The intracellular concentrations of cAMP ranged between 0.04--0.15 microM. No evidence that the T. cruzi cAMP phosphodiesterase is regulated by an endogenous activator could be found. However, T. cruzi contains a heat-stable, low molecular weight, non-dialysable protein that activates mammalian cAMP phosphodiesterase in the presence of Ca2+. The properties so far studied of such an activator suggest that it might be equivalent to other Ca2+-dependent regulators described in vertebrate and invertebrate species. PMID:6255327

  1. High adenylyl cyclase activity and in vivo cAMP fluctuations in corals suggest central physiological role.

    PubMed

    Barott, K L; Helman, Y; Haramaty, L; Barron, M E; Hess, K C; Buck, J; Levin, L R; Tresguerres, M

    2013-01-01

    Corals are an ecologically and evolutionarily significant group, providing the framework for coral reef biodiversity while representing one of the most basal of metazoan phyla. However, little is known about fundamental signaling pathways in corals. Here we investigate the dynamics of cAMP, a conserved signaling molecule that can regulate virtually every physiological process. Bioinformatics revealed corals have both transmembrane and soluble adenylyl cyclases (AC). Endogenous cAMP levels in live corals followed a potential diel cycle, as they were higher during the day compared to the middle of the night. Coral homogenates exhibited some of the highest cAMP production rates ever to be recorded in any organism; this activity was inhibited by calcium ions and stimulated by bicarbonate. In contrast, zooxanthellae or mucus had >1000-fold lower AC activity. These results suggest that cAMP is an important regulator of coral physiology, especially in response to light, acid/base disturbances and inorganic carbon levels. PMID:23459251

  2. Mutagenesis of the cyclic AMP receptor protein of Escherichia coli: targeting positions 72 and 82 of the cyclic nucleotide binding pocket.

    PubMed Central

    Belduz, A O; Lee, E J; Harman, J G

    1993-01-01

    The 3', 5' cyclic adenosine monophosphate (cAMP) binding pocket of the cAMP receptor protein (CRP) of Escherichia coli was mutagenized to substitute leucine, glutamine, or aspartate for glutamate 72; and lysine, histidine, leucine, isoleucine, or glutamine for arginine 82. Substitutions were made in wild-type CRP and in a CRP*, or cAMP-independent, form of the protein to assess the effects of the amino acid substitutions on CRP structure. Cells containing the binding pocket residue-substituted forms of CRP were characterized through beta-galactosidase activity and by measurement of cAMP binding activity. This study confirms a role for both glutamate 72 and arginine 82 in cAMP binding and activation of CRP. Glutamine or leucine substitution of glutamate 72 produced forms of CRP having low affinity for the cAMP and unresponsive to the nucleotide. Aspartate substituted for glutamate 72 produced a low affinity cAMP-responsive form of CRP. CRP has a stringent requirement for the positioning of the position 72 glutamate carboxyl group within the cyclic nucleotide binding pocket. Results of this study also indicate that there are differences in the binding requirements of cAMP and cGMP, a competitive inhibitor of cAMP binding to CRP. PMID:8388097

  3. Role of 2′,3′-cyclic nucleotide 3′-phosphodiesterase in the renal 2′,3′-cAMP-adenosine pathway

    PubMed Central

    Gillespie, Delbert G.; Mi, Zaichuan; Cheng, Dongmei; Bansal, Rashmi; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Energy depletion increases the renal production of 2′,3′-cAMP (a positional isomer of 3′,5′-cAMP that opens mitochondrial permeability transition pores) and 2′,3′-cAMP is converted to 2′-AMP and 3′-AMP, which in turn are metabolized to adenosine. Because the enzymes involved in this “2′,3′-cAMP-adenosine pathway” are unknown, we examined whether 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase) participates in the renal metabolism of 2′,3′-cAMP. Western blotting and real-time PCR demonstrated expression of CNPase in rat glomerular mesangial, preglomerular vascular smooth muscle and endothelial, proximal tubular, thick ascending limb and collecting duct cells. Real-time PCR established the expression of CNPase in human glomerular mesangial, proximal tubular and vascular smooth muscle cells; and the level of expression of CNPase was greater than that for phosphodiesterase 4 (major enzyme for the metabolism of 3′,5′-cAMP). Overexpression of CNPase in rat preglomerular vascular smooth muscle cells increased the metabolism of exogenous 2′,3′-cAMP to 2′-AMP. Infusions of 2′,3′-cAMP into isolated CNPase wild-type (+/+) kidneys increased renal venous 2′-AMP, and this response was diminished by 63% in CNPase knockout (−/−) kidneys, whereas the conversion of 3′,5′-cAMP to 5′-AMP was similar in CNPase +/+ vs. −/− kidneys. In CNPase +/+ kidneys, energy depletion (metabolic poisons) increased kidney tissue levels of adenosine and its metabolites (inosine, hypoxanthine, xanthine, and uric acid) without accumulation of 2′,3′-cAMP. In contrast, in CNPase −/− kidneys, energy depletion increased kidney tissue levels of 2′,3′-cAMP and abolished the increase in adenosine and its metabolites. In conclusion, kidneys express CNPase, and renal CNPase mediates in part the renal 2′,3′-cAMP-adenosine pathway. PMID:24808540

  4. AMP18 interacts with the anion exchanger SLC26A3 and enhances its expression in gastric cancer cells.

    PubMed

    Di Stadio, Chiara Stella; Altieri, Filomena; Miselli, Giuseppina; Elce, Ausilia; Severino, Valeria; Chambery, Angela; Quagliariello, Vincenzo; Villano, Valentina; de Dominicis, Gianfranco; Rippa, Emilia; Arcari, Paolo

    2016-02-01

    AMP18 is a stomach-specific secreted protein expressed in normal gastric mucosa but absent in gastric cancer. AMP18 plays a major role in maintaining gastric mucosa integrity and is characterized by the presence of a BRICHOS domain consisting of about 100 amino acids, present also in several unrelated proteins, and probably endowed with a chaperon-like activity. In this work, we exploited a functional proteomic strategy to identify potential AMP18 interactors with the aim to add knowledge on its functional role within gastric cell lines and tissues. To this purpose, recombinant biotinylated AMP18 was purified and incubated with protein extract from human normal gastric mucosa by applying an affinity chromatography strategy. The interacting proteins were identified by peptide mass fingerprinting using MALDI-TOF mass spectrometry. The pool of interacting proteins contained SLC26A3, a protein expressed in the apical membrane of intestinal epithelial cells, supposed to play a critical role in Cl(-) absorption and fluid homeostasis. The interaction was also confirmed by Western blot with anti-SLC26A3 on transfected AGS cell extract following AMP18 pull-down. Furthermore, the interaction between AMP18 and SLC26A3 was also validated by confocal microscopy that showed a co-localization of both proteins at plasma membrane level. More importantly, for the first time, we showed that SLC26A3 is down-regulated in gastric cancer and that the overexpression of AMP18 in AMP-transfected gastric cancer cells up-regulated the expression of SLC26A3 both at transcriptional and translational level, the latter probably through the activation of the MAP kinases pathway. These findings strongly suggest that AMP18 might play an anti-inflammatory role in maintaining mucosal integrity also by regulating SLC26A3 level. PMID:26700142

  5. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  6. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  7. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  8. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  9. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  10. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  11. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  12. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  13. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  14. Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP

    PubMed Central

    Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

    2011-01-01

    Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

  15. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  16. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  17. Copper regulates cyclic-AMP-dependent lipolysis.

    PubMed

    Krishnamoorthy, Lakshmi; Cotruvo, Joseph A; Chan, Jefferson; Kaluarachchi, Harini; Muchenditsi, Abigael; Pendyala, Venkata S; Jia, Shang; Aron, Allegra T; Ackerman, Cheri M; Wal, Mark N Vander; Guan, Timothy; Smaga, Lukas P; Farhi, Samouil L; New, Elizabeth J; Lutsenko, Svetlana; Chang, Christopher J

    2016-08-01

    Cell signaling relies extensively on dynamic pools of redox-inactive metal ions such as sodium, potassium, calcium and zinc, but their redox-active transition metal counterparts such as copper and iron have been studied primarily as static enzyme cofactors. Here we report that copper is an endogenous regulator of lipolysis, the breakdown of fat, which is an essential process in maintaining body weight and energy stores. Using a mouse model of genetic copper misregulation, in combination with pharmacological alterations in copper status and imaging studies in a 3T3-L1 white adipocyte model, we found that copper regulates lipolysis at the level of the second messenger, cyclic AMP (cAMP), by altering the activity of the cAMP-degrading phosphodiesterase PDE3B. Biochemical studies of the copper-PDE3B interaction establish copper-dependent inhibition of enzyme activity and identify a key conserved cysteine residue in a PDE3-specific loop that is essential for the observed copper-dependent lipolytic phenotype. PMID:27272565

  18. Association of purified skeletal-muscle AMP deaminase with a histidine-proline-rich-glycoprotein-like molecule.

    PubMed Central

    Ranieri-Raggi, M; Montali, U; Ronca, F; Sabbatini, A; Brown, P E; Moir, A J; Raggi, A

    1997-01-01

    Denaturation of rabbit skeletal-muscle AMP deaminase in acidic medium followed by chromatography on DEAE-cellulose in 8 M urea atpH 8.0 allows separation of two main peptide components of similar apparent molecular mass (75-80 kDa) that we tentatively assume correspond to two different enzyme subunits. Whereas the amino acid composition of one of the two peptides is in good agreement with that derived from the nucleotide sequence of the known rat and human AMPD1 cDNAs, the second component shows much higher contents of proline, glycine and histidine. N-Terminal sequence analysis of the fragments liberated by limited proteolysis with trypsin of the novel peptide reveals a striking similarity to the fragments produced by plasmin cleavage of the rabbit plasma protein called histidine-proline-rich glycoprotein (HPRG). However, some divergence is observed between the sequence of one of the fragments liberated from AMP deaminase by a more extensive trypsinization and rabbit plasma HPRG in the region containing residues 472-477. A fragment with a blocked N-terminus, which was found among those liberated by proteolysis with pepsin of either whole AMP deaminase or the novel component of the enzyme, shows an amino acid composition quite different from that of the N-terminus of the known subunit of AMP deaminase. By coupling this observation with the detection in freshly prepared AMP deaminase of a low yield of the sequence (LTPTDX) corresponding to that of HPRG N-terminus, it can be deduced that in comparison with HPRG, the putative HPRG-like component of AMP deaminase contains an additional fragment with a blocked N-terminus, which is liberated by a proteolytic process during purification of the enzyme. The implications of the association to rabbit skeletal-muscle AMP deaminase of a HPRG-like protein species are discussed. PMID:9307011

  19. Identification of DHA-23, a novel plasmid-mediated and inducible AmpC beta-lactamase from Enterobacteriaceae in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan; Wu, Hsueh-Hsia

    2015-01-01

    Objectives: AmpC β-lactamases are classified as Amber Class C and Bush Group 1. AmpC β-lactamases can hydrolyze broad and extended-spectrum cephalosporins, and are not inhibited by β-lactamase inhibitors such as clavulanic acid. This study was conducted to identify DHA-23, a novel plasmid-mediated and inducible AmpC β-lactamase obtained from Enterobacteriaceae. Methods: A total of 210 carbapenem-resistant Enterobacteriaceae isolates were collected from a medical center (comprising two branches) in Northern Taiwan during 2009–2012. AmpC β-lactamase genes were analyzed through a polymerase chain reaction using plasmid DNA templates and gene sequencing. The genetic relationships of the isolates were typed using pulsed-field gel electrophoresis following the digestion of intact genomic DNA by using XbaI. Results: Three enterobacterial isolates (one Escherichia coli and two Klebsiella pneumoniae) were obtained from three hospitalized patients. All three isolates were resistant or intermediately susceptible to all β-lactams, and exhibited reduced susceptibility to carbapenems. These three isolates expressed a novel AmpC β-lactamase, designated DHA-23, approved by the curators of the Lahey website. DHA-23 differs from DHA-1 and DHA-6 by one amino acid substitution (Ser245Ala), exhibiting three amino acid changes compared with DHA-7 and DHA-Morganella morganii; three amino acid changes compared with DHA-3; four amino acid changes compared with DHA-5; and eight amino acid changes compared with DHA-2 (>97% identity). This AmpC β-lactamase is inducible using a system involving ampR. Conclusion: This is the first report to address DHA-23, a novel AmpC β-lactamase. DHA-type β-lactamases are continuous threat in Taiwan. PMID:25999942

  20. The Cyclic AMP Phenotype of Fragile X and Autism

    PubMed Central

    Kelley, Daniel J; Bhattacharyya, Anita; Lahvis, Garet P; Yin, Jerry CP; Malter, Jim; Davidson, Richard J

    2008-01-01

    Cyclic AMP (cAMP) is a second messenger involved in many processes including mnemonic processing and anxiety. Memory deficits and anxiety are noted in the phenotype of fragile X (FX), the most common heritable cause of mental retardation and autism. Here we review reported observations of altered cAMP cascade function in FX and autism. Cyclic AMP is a potentially useful biochemical marker to distinguish autism comorbid with FX from autism per se and the cAMP cascade may be a viable therapeutic target for both FX and autism. PMID:18601949

  1. Regulation of cAMP Intracellular Levels in Human Platelets Stimulated by 2-Arachidonoylglycerol.

    PubMed

    Signorello, Maria Grazia; Leoncini, Giuliana

    2016-05-01

    We demonstrated that in human platelets the endocannabinoid 2-arachidonoylglycerol (2-AG) decreased dose- and time-dependently cAMP intracellular levels. No effect on cAMP decrease induced by 2-AG was observed in the presence of the adenylate cyclase inhibitor SQ22536 as well in platelets pretreated with the thromboxane A2 receptor antagonist, SQ29548 or with aspirin, inhibitor of arachidonic acid metabolism through the cyclooxygenase pathway. An almost complete recovering of cAMP level was measured in platelets pretreated with the specific inhibitor of phosphodiesterase (PDE) 3A, milrinone. In platelets pretreated with LY294002 or MK2206, inhibitors of PI3K/AKT pathway, and with U73122, inhibitor of phospholipase C pathway, only a partial prevention was shown. cAMP intracellular level depends on synthesis by adenylate cyclase and hydrolysis by PDEs. In 2-AG-stimulated platelets adenylate cyclase activity seems to be unchanged. In contrast PDEs appear to be involved. In particular PDE3A was specifically activated, as milrinone reversed cAMP reduction by 2-AG. 2-AG enhanced PDE3A activity through its phosphorylation. The PI3K/AKT pathway and PKC participate to this PDE3A phosphorylation/activation mechanism as it was greatly inhibited by platelet pretreatment with LY294002, MK2206, U73122, or the PKC specific inhibitor GF109203X. Taken together these data suggest that 2-AG potentiates its power of platelet agonist reducing cAMP intracellular level. J. Cell. Biochem. 117: 1240-1249, 2016. © 2015 Wiley Periodicals, Inc. PMID:26460717

  2. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  3. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP. PMID:26378231

  4. Cyclic AMP phosphodiesterase in Salmonella typhimurium: characteristics and physiological function.

    PubMed

    Botsford, J L

    1984-11-01

    The physiological function of cyclic AMP (cAMP) phosphodiesterase in Salmonella typhimurium was investigated with strains which were isogenic except for the cpd locus. In crude broken-cell extracts the properties of the enzyme were found to be similar to those reported for Escherichia coli. The specific activity in the mutant was less than 1% that in the wild type. Rates of cAMP production in the mutant were as much as twice those observed in the wild type. The amount of cAMP accumulated when cells grew overnight with limiting glucose was 4.5-fold greater in the mutant than in the wild type. The intracellular concentration of cAMP in the two strains was measured directly, using four different techniques to wash the cells to remove extracellular cAMP. The cAMP level in the cpd strain was only 25% greater than in the wild type. The functional concentration of the cAMP receptor protein-cAMP complex was estimated indirectly from the specific activity of beta-galactosidase in the two strains after introducing F'lac. When cells were grown with carbon sources permitting synthesis of different levels of cAMP, the specific activity of the enzyme was at most 25% greater in the cpd strain. The cpd strain was more sensitive to the effects of exogenous cAMP. Exogenous cAMP relieved both permanent and transient catabolite repression of the lac operon at lower concentrations in the cpd strain than in the wild type. When cells grew with glucose, glycerol, or ribose, exogenous cAMP inhibited growth of the mutant strain more than the wild type. PMID:6094495

  5. Phenotypic and Molecular Characterization of Plasmid Mediated AmpC among Clinical Isolates of Klebsiella pneumoniae Isolated from Different Hospitals in Tehran

    PubMed Central

    Azimi, Leila; Erajiyan, Gholamreza; Talebi, Malihe; Owlia, Parviz; Bina, Mahsa; Shojaie, Ali

    2015-01-01

    Introduction: Klebsiella pneumoniae is one of the main opportunistic pathogens which can cause different types of infections. Production of beta-lactamases like AmpC and ESBL mostly lead to beta-lactam resistance in these Gram-Negative bacteria. The aim of this study was the detection of AmpC-producing K. pneumoniae in clinical isolates. Materials and Methods: Three hundred and three isolates of K. pneumoniae were identified. Double disc method including cefoxitin with cefepime and using boronic acid with cloxacillin were performed as two phenotypic methods for detection of AmpC. Amplification of AmpC gene was performed by PCR. Results: Eight and three isolates showed positive results in double disc method and by using boronic acid with cloxacillin, respectively. Five isolates had specific band for AmpC gene after electrophoresis. Conclusion: Our results were indicated the low prevalence of AmpC-producer-K. pnemoniae in Iran. On the other hand these two tested phenotypic methods showed low sensitivity for detection of AmpC. PMID:26046018

  6. Cyclic Di-AMP Impairs Potassium Uptake Mediated by a Cyclic Di-AMP Binding Protein in Streptococcus pneumoniae

    PubMed Central

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M.; Zhang, Yang; Metzger, Dennis W.

    2014-01-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  7. Cyclic di-AMP impairs potassium uptake mediated by a cyclic di-AMP binding protein in Streptococcus pneumoniae.

    PubMed

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-02-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  8. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response. PMID:26276689

  9. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish.

    PubMed

    Lundegaard, Pia R; Anastasaki, Corina; Grant, Nicola J; Sillito, Rowland R; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J Douglas; Porteous, David J; Patton, E Elizabeth

    2015-10-22

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  10. Internal gastargets in AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Postma, O.; van den Brand, J. F. J.; van Leeuwen, E.; Doets, M.; Kraan, M.

    1997-05-01

    Internal gas targets in AmPS A.P. Kaan, O. Postma, J.F.J. van den Brand, E. van Leeuwen, M. Doets, M. Kra= an National Institute for Nuclear Physics and High Energy Physics; Kruislaan 409; 1098 SJ Amsterdam; Holland In the Amsterdam Puls Stretcher/storage ring AmPS(1 GeV electrons), we designed a set-up in order to accommodate a gas target with a density of 1016 mol/cm2. The storage cell needed for this purpose is a aluminium tube with a length of 40 cm, a diameter of 15 mm and a wall thickness of 25 =B5m. Three sets of conductance limiters on both sides of the target, combined with dry turbopumps are designed to be used as differential pumping stations. These limiters cause discontinuities in the beam path and must therefor be retractable and radio frequency compatible in both positions. Low =B5 materials must be used because of the depolarisation effects of changing magnetic fields. The calculations show that the flow resistance's are sufficient to reduce the load of the getter pumps to a level with which the lifetime of the pump elements remain acceptable. The design of the mechanics and the vacuum system will be explained. Recent results from the measurements after installation in combination with the influence on the lifetime on the beam will be presented

  11. Oscillations of cAMP with the cardiac cycle.

    PubMed

    Wikman-Coffelt, J; Sievers, R; Coffelt, R J; Parmley, W W

    1983-03-16

    Oscillations of cAMP with the cardiac cycle were demonstrated in the rat heart using a stimulator-triggered rapid freeze-clamp to decrease the temperature of the heart from 37 degrees C to -80 degrees C in 5 msec (20,000 degrees/sec) at a predetermined phase of the cardiac cycle. The nucleotide, cAMP, oscillated 60% with the cardiac cycle during normal working conditions, the higher cAMP value occurring during systole. PMID:6301471

  12. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  13. Cardiac cAMP: production, hydrolysis, modulation and detection.

    PubMed

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3',5'-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  14. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  15. Detection of amp C in Enterobacter cloacae in China.

    PubMed

    Zhang, Y L; Li, J T; Zhao, M W

    2001-10-01

    PCR amplification of 55 strains of Enterobacter cloacae indicated 51 of them had amp C structural gene verified by DNA sequence and Southern blotting. All PCR products were cleaved into 666- and 328-bp fragments by Kpn1 restriction enzyme. Imipenem was the most potent inducer for mRNA expression of amp C gene and beta-lactamase activity. The beta-Lactamase inhibitor R0481220 strongly inhibited Amp C beta-lactamases; 96.4% (53/55) of Enterobacter cloacae producing Amp C enzyme were susceptible to cefepime. PMID:11691570

  16. Mechanisms Restricting Diffusion of Intracellular cAMP

    PubMed Central

    Agarwal, Shailesh R.; Clancy, Colleen E.; Harvey, Robert D.

    2016-01-01

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells. PMID:26795432

  17. Inhibition of hormone-sensitive lipase gene expression by cAMP and phorbol esters in 3T3-F442A and BFC-1 adipocytes.

    PubMed Central

    Plée-Gautier, E; Grober, J; Duplus, E; Langin, D; Forest, C

    1996-01-01

    Hormone-sensitive lipase (HSL) catalyses the rate-limiting step in adipocyte lipolysis. Short-term hormonal regulation of HSL activity is well characterized, whereas little is known about the control of HSL gene expression. We have measured HSL mRNA content of 3T3-F442A and BFC-1 adipocytes in response to the cAMP analogue 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP) and to the phorbol ester phorbol 12-myristate 13-acetate (PMA) by Northern blot, using a specific mouse cDNA fragment. Treatment of the cells for 12 or 6 h with, respectively, 0.5 mM 8-CPT-cAMP or 1 microM PMA produced a maximal decrease of about 60% in HSL mRNA. These effects were unaffected by the protein-synthesis inhibitor anisomycin, suggesting that cAMP and PMA actions were direct. The reduction in HSL mRNA was accompanied by a reduction in HSL total activity. The intracellular routes that cAMP and PMA follow for inducing such an effect seemed clearly independent. (i) After desensitization of the protein kinase C regulation pathway by a 24 h treatment of the cells with 1 microM PMA, PMA action was abolished whereas cAMP was still fully active. (ii) Treatment with saturating concentrations of both agents produced an additive effect. (iii) The synthetic glucocorticoid dexamethasone had no proper effect on HSL gene expression but potentiated cAMP action without affecting PMA action. cAMP inhibitory action on HSL is unexpected. Indeed, the second messenger of catecholamines is the main activator of HSL by phosphorylation. We envision that a long-term cAMP treatment of adipocytes induces a counter-regulatory process that reduces HSL content and, ultimately, limits fatty acid depletion from stored triacylglycerols. PMID:8836156

  18. Forskolin and derivatives as tools for studying the role of cAMP.

    PubMed

    Alasbahi, R H; Melzig, M F

    2012-01-01

    protoberberine alkaloid palmatine on the active ion transport across rat colonic epithelium, the inhibitory effect of retinoic acid on HIV-1-induced podocyte proliferation, the whitening activity of luteolin, the effect of cilostazol on nitric oxide production, an effect that is involved in capillary-like tube formation in human aortic endothelial cells, the apoptotic effect of bullatacin, the effects of paraoxon and chlorpyrifos oxon on nervous system. Moreover, cAMP was found to play a role in acute and chronic exposure to ethanol, in morphine dependence and withdrawal and in behavioral sensitization to cocaine as well as in the protection against cisplatin-induced oxidative injuries. PMID:22393824

  19. [Gastric Acid].

    PubMed

    Ruíz Chávez, R

    1996-01-01

    Gastric acid, a product of parietal cells secretion, full fills multiple biological roles which are absolutely necessary to keep corporal homeostasis. The production of the acid depends upon an effector cellular process represented in the first step by histamine, acetilcholine and gastrin, first messengers of the process. These interact with specific receptors than in sequence activate second messengers -cAMP and the calcium-calmodulin system- which afterwards activate a kinase. An specific protein is then phosphorilated by this enzyme, being the crucial factor that starts the production of acid. Finally, a proton bomb, extrudes the acid towards the gastric lumen. The secretion process mentioned above, is progressive lyactivated in three steps, two of which are stimulators -cephalic and gastric phases- and the other one inhibitor or intestinal phase. These stages are started by mental and neurological phenomena -thought, sight, smell or memory-; by food, drugs or other ingested substances; and by products of digestion. Changes in regulation of acid secretion, in the structure of gastro-duodenal mucosal barrier by a wide spectrum of factors and agents including food, drugs and H. pylori, are the basis of acid-peptic disease, entity in which gastric acid plays a fundamental role. From the therapeutic point of view, so at the theoretical as at the practical levels, t is possible to interfere with the secretion of acid by neutralization of some of the steps of the effector cellular process. An adequate knowledge of the basics related to gastric acid, allows to create strategies for the clinical handling of associated pathology, specifically in relation to peptic acid disease in all of the known clinical forms. PMID:12165790

  20. The cAMP-binding proteins of Leishmania are not the regulatory subunits of cAMP-dependent protein kinase.

    PubMed

    Banerjee, C; Sarkar, D

    2001-09-01

    The most commonly used method to determine the cAMP binding activity in cytosolic extracts of promastigotes of Leishmania spp. underestimated by approximately 11.5-fold the total amount of [(3)H]cAMP bound, when compared with results obtained by the modified Millipore filter technique. Three cAMP-binding proteins (BPI, BPII and BPIII) were partially purified and characterized. The native molecular masses of BPI, BPII and BPIII were estimated to be 105, 155 and 145 kDa, respectively. The binding of [(3)H]cAMP to these proteins was affected to different extents by several cAMP analogues. Antibodies directed against the types I and II regulatory subunits of PKA did not cross-react with the leishmanial extract. Photoaffinity labeling of the cytosolic extracts with 8-N(3)-[(32)P]cAMP specifically labeled a band of M(r) 116000 and a band of M(r) 80000 partially saturable by cAMP. From these results, it is concluded that the leishmanial cAMP-binding proteins appear to belong to a different class distinct from the regulatory subunits of cAMP-dependent protein kinases. PMID:11544092

  1. An investigation of fluidized bed electrowinning of cobalt using 50 and 1000 Amp cells

    NASA Astrophysics Data System (ADS)

    Dubrovsky, M.; Evans, J. W.

    1982-09-01

    50 Amp and 1000 Amp cells equipped with fluidized bed cathodes were used to investigate the electrowinning of cobalt from sulfate solutions. The catholytes employed ranged in cobalt concentration from 100 to 4.8 grams per liter of cobalt and from acid (pH ≃1) to near neutral (pH ≃6). Superficial current densities up to 1.09 A cm-2 were used. The cells were equipped with a nearly impermeable diaphragm, permitting the use of an anolyte of composition different from that of the catholyte. The current efficiency for cobalt deposition (as conveniently determined by measuring the rate of hydrogen evolution), electrical energy consumption, and appearance of the deposit were studied as a function of catholyte composition. Reasonable current efficiencies were observed. The electrical energy consumptions were much higher than that of conventional electrowinning, but this was shown to be due to the anode chamber and diaphragm resistance losses rather than the fluidized cathode.

  2. An investigation of fluidized bed electrowinning of cobalt using 50 and 1000 Amp cells

    NASA Astrophysics Data System (ADS)

    Dubrovsky, M.; Evans, J. W.

    1991-12-01

    50 Amp and 1000 Amp cells equipped with fluidized bed cathodes were used to investigate the electrowinning of cobalt from sulfate solutions. The catholytes employed ranged in cobalt concentration from 100 to 4.8 grams per liter of cobalt and from acid (pH ≏1) to near neutral (pH-6). Superficial current densities up to 1.09 A cm-2 were used. The cells were equipped with a nearly impermeable diaphragm, permitting the use of an anolyte of composition different from that of the catholyte. The current efficiency for cobalt deposition (as conveniently determined by measuring the rate of hydrogen evolution), electrical energy consumption, and appearance of the deposit were studied as a function of catholyte composition. Reasonable current efficiencies were observed. The electrical energy consumptions were much higher than that of conventional electrowinning, but this was shown to be due to the anode chamber and diaphragm resistance losses rather than the fluidized cathode.

  3. Comparision of Three Laboratory Tests for Detection of AmpC β Lactamases in Klebsiella Species and E. Coli

    PubMed Central

    Deotale, V.S.; Mendiratta, D.K.; Narang, P.

    2014-01-01

    Background and Objective: AmpC β lactamases are one of the important causes of drug resistance in gram negative bacteria. Failure to detect these enzymes in the laboratory has contributed to therapeutic failures but there are till date no standard guideline available. This study was therefore undertaken to evaluate three phenotypic laboratory tests and the inhibitors used in two of the tests to detect AmpC β lactamases produced by E. coli and Klebsiella species as they are most commonly isolated organisms. Methods: E. coli and Klebsiella isolates from different clinical samples were tested for ESBLs production as per CLSI guidelines and excluded from the study. The non-ESBLs isolates were then screened for AmpC β lactamases production, by cefoxitin and then confirmed by three different methods, i.e., Disc Potentiation Test (DPT) , Double Disc Synergy Test (DDST) and Modified Three Dimensional Test (M3DT) which in the absence of molecular methods, was taken as the gold standard. Boronic acid and cloxacillin were used as inhibitory agents in the Disc Potentiation and Double Disc synergy Tests. Results: A total of 2,933 isolates were tested out of which 165 isolates were detected as non ESBLs producers,135 (81.82%) when screened for AmpC β lactamases based on resistance to cefoxitin were labelled as positive. 30 (18.18%) cefoxitin sensitive isolates were labelled as probably non AmpC producers . M3DT, in addition to detecting all the 135 (100%) cefoxitin resistant isolates, also detected 5 (16.67%) cefoxitin sensitive isolates as AmpC producers. Other phenotypic tests, DPT and DDST with different inhibitors like boronic acid and cloxacillin in different potencies were all found to be less sensitive. The best results among these two methods were obtained with DDST using cloxacillin 500μg. Conclusion: In the absence of recommended guidelines for AmpC detection, the study reports, among the tests performed, M3DT as the best phenotypic method for AmpC confirmation

  4. Structural basis for the extended substrate spectrum of AmpC BER and structure-guided discovery of the inhibition activity of citrate against the class C β-lactamases AmpC BER and CMY-10.

    PubMed

    Na, Jung Hyun; Cha, Sun Shin

    2016-08-01

    AmpC BER is an extended substrate spectrum class C β-lactamase with a two-amino-acid insertion in the R2 loop compared with AmpC EC2. The crystal structures of AmpC BER (S64A mutant) and AmpC EC2 were determined. Structural comparison of the two proteins revealed that the insertion increases the conformational flexibility of the R2 loop. Two citrate molecules originating from the crystallization solution were observed in the active site of the S64A mutant. One citrate molecule makes extensive interactions with active-site residues that are highly conserved among class C β-lactamases, whereas the other one is weakly bound. Based on this structural observation, it is demonstrated that citrate, a primary metabolite that is widely used as a food additive, is a competitive inhibitor of two class C β-lactamases (AmpC BER and CMY-10). Consequently, the data indicate enhancement of the flexibility of the R2 loop as an operative strategy for molecular evolution of extended-spectrum class C β-lactamases, and also suggest that the citrate scaffold is recognized by the active sites of class C β-lactamases. PMID:27487828

  5. Mutations in β-Lactamase AmpC Increase Resistance of Pseudomonas aeruginosa Isolates to Antipseudomonal Cephalosporins

    PubMed Central

    Berrazeg, M.; Jeannot, K.; Ntsogo Enguéné, Véronique Yvette; Broutin, I.; Loeffert, S.; Fournier, D.

    2015-01-01

    Mutation-dependent overproduction of intrinsic β-lactamase AmpC is considered the main cause of resistance of clinical strains of Pseudomonas aeruginosa to antipseudomonal penicillins and cephalosporins. Analysis of 31 AmpC-overproducing clinical isolates exhibiting a greater resistance to ceftazidime than to piperacillin-tazobactam revealed the presence of 17 mutations in the β-lactamase, combined with various polymorphic amino acid substitutions. When overexpressed in AmpC-deficient P. aeruginosa 4098, the genes coding for 20/23 of these AmpC variants were found to confer a higher (2-fold to >64-fold) resistance to ceftazidime and ceftolozane-tazobactam than did the gene from reference strain PAO1. The mutations had variable effects on the MICs of ticarcillin, piperacillin-tazobactam, aztreonam, and cefepime. Depending on their location in the AmpC structure and their impact on β-lactam MICs, they could be assigned to 4 distinct groups. Most of the mutations affecting the omega loop, the R2 domain, and the C-terminal end of the protein were shared with extended-spectrum AmpCs (ESACs) from other Gram-negative species. Interestingly, two new mutations (F121L and P154L) were predicted to enlarge the substrate binding pocket by disrupting the stacking between residues F121 and P154. We also found that the reported ESACs emerged locally in a variety of clones, some of which are epidemic and did not require hypermutability. Taken together, our results show that P. aeruginosa is able to adapt to efficacious β-lactams, including the newer cephalosporin ceftolozane, through a variety of mutations affecting its intrinsic β-lactamase, AmpC. Data suggest that the rates of ESAC-producing mutants are ≥1.5% in the clinical setting. PMID:26248364

  6. Low-intensity contraction activates the alpha1-isoform of 5'-AMP-activated protein kinase in rat skeletal muscle.

    PubMed

    Toyoda, Taro; Tanaka, Satsuki; Ebihara, Ken; Masuzaki, Hiroaki; Hosoda, Kiminori; Sato, Kenji; Fushiki, Tohru; Nakao, Kazuwa; Hayashi, Tatsuya

    2006-03-01

    Skeletal muscle expresses two catalytic subunits, alpha1 and alpha2, of the 5'-AMP-activated protein kinase (AMPK), which has been implicated in contraction-stimulated glucose transport and fatty acid oxidation. Muscle contraction activates the alpha2-containing AMPK complex (AMPKalpha2), but this activation may occur with or without activation of the alpha1-containing AMPK complex (AMPKalpha1), suggesting that AMPKalpha2 is the major isoform responsible for contraction-induced metabolic events in skeletal muscle. We report for the first time that AMPKalpha1, but not AMPKalpha2, can be activated in contracting skeletal muscle. Rat epitrochlearis muscles were isolated and incubated in Krebs-Ringer bicarbonate buffer containing pyruvate. In muscles stimulated to contract at a frequency of 1 and 2 Hz during the last 2 min of incubation, AMPKalpha1 activity increased twofold and AMPKalpha2 activity remained unchanged. Muscle stimulation did not change the muscle AMP concentration or the AMP-to-ATP ratio. AMPK activation was associated with increased phosphorylation of Thr(172) of the alpha-subunit, the primary activation site. Muscle stimulation increased the phosphorylation of acetyl-CoA carboxylase (ACC), a downstream target of AMPK, and the rate of 3-O-methyl-d-glucose transport. In contrast, increasing the frequency (>or=5 Hz) or duration (>or=5 min) of contraction activated AMPKalpha1 and AMPKalpha2 and increased AMP concentration and the AMP/ATP ratio. These results suggest that 1) AMPKalpha1 is the predominant isoform activated by AMP-independent phosphorylation in low-intensity contracting muscle, 2) AMPKalpha2 is activated by an AMP-dependent mechanism in high-intensity contracting muscle, and 3) activation of each isoform enhances glucose transport and ACC phosphorylation in skeletal muscle. PMID:16249251

  7. PDE4 cAMP phosphodiesterases: modular enzymes that orchestrate signalling cross-talk, desensitization and compartmentalization.

    PubMed Central

    Houslay, Miles D; Adams, David R

    2003-01-01

    cAMP is a second messenger that controls many key cellular functions. The only way to inactivate cAMP is to degrade it through the action of cAMP phosphodiesterases (PDEs). PDEs are thus poised to play a key regulatory role. PDE4 cAMP-specific phosphodiesterases appear to have specific functions with selective inhibitors serving as potent anti-inflammatory agents. The recent elucidation of the structure of the PDE4 catalytic unit allows for molecular insight into the mode of catalysis as well as substrate and inhibitor selectivity. The four PDE4 genes encode over 16 isoforms, each of which is characterized by a unique N-terminal region. PDE4 isoforms play a pivotal role in controlling functionally and spatially distinct pools of cAMP by virtue of their unique intracellular targeting. Targeting occurs by association with proteins, such as arrestins, SRC family tyrosyl kinases, A-kinase anchoring proteins ('AKAPs') and receptor for activated C kinase 1 ('RACK1'), and, in the case of isoform PDE4A1, by a specific interaction (TAPAS-1) with phosphatidic acid. PDE4 isoforms are 'designed' to be regulated by extracellular-signal-related protein kinase (ERK), which binds to anchor sites on the PDE4 catalytic domain that it phosphorylates. The upstream conserved region 1 (UCR1) and 2 (UCR2) modules that abut the PDE4 catalytic unit confer regulatory functions by orchestrating the functional outcome of phosphorylation by cAMP-dependent protein kinase ('PKA') and ERK. PDE4 enzymes stand at a crossroads that allows them to integrate various signalling pathways with that of cAMP in spatially distinct compartments. PMID:12444918

  8. Antimicrobial peptide (Cn-AMP2) from liquid endosperm of Cocos nucifera forms amyloid-like fibrillar structure.

    PubMed

    Gour, Shalini; Kaushik, Vibha; Kumar, Vijay; Bhat, Priyanka; Yadav, Subhash C; Yadav, Jay K

    2016-04-01

    Cn-AMP2 is an antimicrobial peptide derived from liquid endosperm of coconut (Cocos nucifera). It consists of 11 amino acid residues and predicted to have high propensity for β-sheet formation that disposes this peptide to be amyloidogenic. In the present study, we have examined the amyloidogenic propensities of Cn-AMP2 in silico and then tested the predictions under in vitro conditions. The in silico study revealed that the peptide possesses high amyloidogenic propensity comparable with Aβ. Upon solubilisation and agitation in aqueous buffer, Cn-AMP2 forms visible aggregates that display bathochromic shift in the Congo red absorbance spectra, strong increase in thioflavin T fluorescence and fibrillar morphology under transmission electron microscopy. All these properties are typical of an amyloid fibril derived from various proteins/peptides including Aβ. PMID:27028204

  9. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5‧ monophosphate (AMP)

    NASA Astrophysics Data System (ADS)

    Hammami, K.; Feki, H. El; Marsan, O.; Drouet, C.

    2015-10-01

    This work investigates the interaction between the nucleotide adenosine 5‧ monophosphate molecule (AMP) and a biomimetic nanocrystalline carbonated apatite as a model for bone mineral. The analogy of the apatite phase used in this work with biological apatite was first pointed out by complementary techniques. AMP adsorption isotherms were then investigated. Obtained data were fitted to a Sips isotherm with an exponent greater than one suggesting positive cooperativity among adsorbed molecules. The data were compared to a previous study relative to the adsorption of another nucleotide, cytidine monophosphate (CMP) onto a similar substrate, evidencing some effect of the chemical nature of the nucleic base. An enhanced adsorption was observed under acidic (pH 6) conditions as opposed to pH 7.4, which parallels the case of DNA adsorption on biomimetic apatite. An estimated standard Gibbs free energy associated to the adsorption process (ΔG°ads ≅ -22 kJ/mol) intermediate between "physisorption" and "chemisorption" was found. The analysis of the solids after adsorption pointed to the preservation of the main characteristics of the apatite substrate but shifts or enhancements of Raman bands attributed to AMP showed the existence of chemical interactions involving both the phosphate and adenine parts of AMP. This contribution adds to the works conducted in view of better understanding the interaction of DNA/RNA and their constitutive nucleotides and the surface of biomimetic apatites. It could prove helpful in disciplines such as bone diagenesis (DNA/apatite interface in aged bones) or nanomedicine (setup of DNA- or RNA-loaded apatite systems). Also, the adsorption of nucleic acids on minerals like apatites could have played a role in the preservation of such biomolecules in the varying conditions known to exist at the origin of life on Earth, underlining the importance of dedicated adsorption studies.

  10. Beam optics of the AmPS extraction line

    NASA Astrophysics Data System (ADS)

    Hoekstra, R.

    1991-01-01

    The beam optics of the AmPS (Amsterdam Pulse Stretcher) are described. Definitions are outlined, and the beam elements and parameters are given. Developments relating to the electrostatic septum, chicane, beam transformer and bending through 90 degrees are described. The performance of the AmPS and beam diagnostics are discussed.

  11. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  12. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  13. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  14. Activated cAMP receptors switch encystation into sporulation

    PubMed Central

    Kawabe, Yoshinori; Morio, Takahiro; James, John L.; Prescott, Alan R.; Tanaka, Yoshimasa; Schaap, Pauline

    2009-01-01

    Metazoan embryogenesis is controlled by a limited number of signaling modules that are used repetitively at successive developmental stages. The development of social amoebas shows similar reiterated use of cAMP-mediated signaling. In the model Dictyostelium discoideum, secreted cAMP acting on 4 cAMP receptors (cARs1-4) coordinates cell movement during aggregation and fruiting body formation, and induces the expression of aggregation and sporulation genes at consecutive developmental stages. To identify hierarchy in the multiple roles of cAMP, we investigated cAR heterogeneity and function across the social amoeba phylogeny. The gene duplications that yielded cARs 2-4 occurred late in evolution. Many species have only a cAR1 ortholog that duplicated independently in the Polysphondylids and Acytostelids. Disruption of both cAR genes of Polysphondylium pallidum (Ppal) did not affect aggregation, but caused complete collapse of fruiting body morphogenesis. The stunted structures contained disorganized stalk cells, which supported a mass of cysts instead of spores; cAMP triggered spore gene expression in Ppal, but not in the cAR null mutant, explaining its sporulation defect. Encystation is the survival strategy of solitary amoebas, and lower taxa, like Ppal, can still encyst as single cells. Recent findings showed that intracellular cAMP accumulation suffices to trigger encystation, whereas it is a complementary requirement for sporulation. Combined, the data suggest that cAMP signaling in social amoebas evolved from cAMP-mediated encystation in solitary amoebas; cAMP secretion in aggregates prompted the starving cells to form spores and not cysts, and additionally organized fruiting body morphogenesis. cAMP-mediated aggregation was the most recent innovation. PMID:19369200

  15. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 3, book 2: AMPS equipment to Spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The interfaces between AMPS Payload No.(TBD) and Spacelab are described. The interfaces specified cover the AMPS physical, electrical, and thermal interfaces that are established to prescribe the standard Spacelab configuration required to perform the mission. If the configuration definition changes due to change of Spacelab equipment model, or serial numbers, then reidentification of the Labcraft payload may be required.

  16. Plasmid-Mediated AmpC: Prevalence in Community-Acquired Isolates in Amsterdam, the Netherlands, and Risk Factors for Carriage

    PubMed Central

    Reuland, E. Ascelijn; Halaby, Teysir; Hays, John P.; de Jongh, Denise M. C.; Snetselaar, Henrieke D. R.; van Keulen, Marte; Elders, Petra J. M.; Savelkoul, Paul H. M.; Vandenbroucke-Grauls, Christina M. J. E.; al Naiemi, Nashwan

    2015-01-01

    Objectives The objective of this study was to determine the prevalence of pAmpC beta-lactamases in community-acquired Gram negative bacteria in the Netherlands, and to identify possible risk factors for carriage of these strains. Methods Fecal samples were obtained from community-dwelling volunteers. Participants also returned a questionnaire for analysis of risk factors. Screening for pAmpC was performed with selective enrichment broth and a selective screening agar. Confirmation of AmpC-production was performed with two double disc combination tests: cefotaxime and ceftazidime with either boronic acid or cloxacillin as inhibitor. Multiplex PCR was used as gold standard for detection of pAmpC. 16S rRNA PCR and AFLP were performed as required, plasmids were identified by PCR-based replicon typing. Questionnaire results were analyzed with SPSS, version 20.0. Results Fecal samples were obtained from 550 volunteers; mean age 51 years (range: 18–91), 61% were females. pAmpC was present in seven E. coli isolates (7/550, 1.3%, 0.6–2.7 95% CI): six CMY-2-like pAmpC and one DHA. ESBL-encoding genes were found in 52/550 (9.5%, 7.3–12.2 95% CI) isolates; these were predominantly blaCTX-M genes. Two isolates had both ESBL and pAmpC. Admission to a hospital in the previous year was the only risk factor we identified. Conclusions Our data indicate that the prevalence of pAmpC in the community seems still low. However, since pAmpC-producing isolates were not identified as ESBL producers by routine algorithms, there is consistent risk that further increase of their prevalence might go undetected. PMID:25587716

  17. Emergence of co-production of plasmid-mediated AmpC beta-lactamase and ESBL in cefoxitin-resistant uropathogenic Escherichia coli.

    PubMed

    Ghosh, B; Mukherjee, M

    2016-09-01

    Plasmid-mediated AmpC (pAmpC) and ESBL co-production was detected in Escherichia coli a major etiologic agent of urinary tract infection. Isolates resistant to cefoxitin by CLSI methodology were tested for pAmpC beta-lactamase using phenylboronic acid and ESBLs by combined disk diffusion method. pAmpC/ESBL genes were characterized by PCR and sequencing. Transconjugation experiments were done to study the transfer of pAmpC and ESBL production from clinical isolates as donor to E. coli J53 AziR as recipient. Incompatibility groups of transmissible plasmids were classified by PCR-based replicon typing (PBRT). Among 148 urine culture positive isolates, E. coli was reported in 39.86 % (59/148), with 93.22 % (55/59) of cefoxitin resistance. pAmpC production was detected in 25, with varied distribution of blaCMY-2 and blaDHA-1type genes alone (n = 13 and 7 respectively) or in combination (n = 5). ESBL co-production was observed in 88 % (22/25) of pAmpC producing isolates with predominance of blaTEM (n = 20). Twenty-three transconjugants showed transmission of pAmpC-and ESBL-resistant genes with co-carriage of blaCMY-2 and blaTEM (n = 15) in plasmids of IncF type (n = 9) being predominant, followed by IncI1 (n = 4) and IncH1 (n = 2) in combination. All clinical isolates were clonally diverse. Resistance against different beta-lactams in uropathogenic E. coli has been an emerging concern in resource- poor countries such as India. Knowledge on the occurrence of AmpC beta-lactamases and ESBL amongst this pathogen and its transmission dynamics may aid in hospital infection control. PMID:27250633

  18. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  19. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  20. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  1. cAMP-induced Mitochondrial Compartment Biogenesis

    PubMed Central

    Yoboue, Edgar D.; Augier, Eric; Galinier, Anne; Blancard, Corinne; Pinson, Benoît; Casteilla, Louis; Rigoulet, Michel; Devin, Anne

    2012-01-01

    Cell fate and proliferation are tightly linked to the regulation of the mitochondrial energy metabolism. Hence, mitochondrial biogenesis regulation, a complex process that requires a tight coordination in the expression of the nuclear and mitochondrial genomes, has a major impact on cell fate and is of high importance. Here, we studied the molecular mechanisms involved in the regulation of mitochondrial biogenesis through a nutrient-sensing pathway, the Ras-cAMP pathway. Activation of this pathway induces a decrease in the cellular phosphate potential that alleviates the redox pressure on the mitochondrial respiratory chain. One of the cellular consequences of this modulation of cellular phosphate potential is an increase in the cellular glutathione redox state. The redox state of the glutathione disulfide-glutathione couple is a well known important indicator of the cellular redox environment, which is itself tightly linked to mitochondrial activity, mitochondria being the main cellular producer of reactive oxygen species. The master regulator of mitochondrial biogenesis in yeast (i.e. the transcriptional co-activator Hap4p) is positively regulated by the cellular glutathione redox state. Using a strain that is unable to modulate its glutathione redox state (Δglr1), we pinpoint a positive feedback loop between this redox state and the control of mitochondrial biogenesis. This is the first time that control of mitochondrial biogenesis through glutathione redox state has been shown. PMID:22396541

  2. AMP-18 Targets p21 to Maintain Epithelial Homeostasis

    PubMed Central

    Chen, Peili; Li, Yan Chun; Toback, F. Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD. PMID:25919700

  3. Cordycepin activates AMP-activated protein kinase (AMPK) via interaction with the γ1 subunit

    PubMed Central

    Wu, Chongming; Guo, Yanshen; Su, Yan; Zhang, Xue; Luan, Hong; Zhang, Xiaopo; Zhu, Huixin; He, Huixia; Wang, Xiaoliang; Sun, Guibo; Sun, Xiaobo; Guo, Peng; Zhu, Ping

    2014-01-01

    Cordycepin is a bioactive component of the fungus Cordyceps militaris. Previously, we showed that cordycepin can alleviate hyperlipidemia through enhancing the phosphorylation of AMP-activated protein kinase (AMPK), but the mechanism of this stimulation is unknown. Here, we investigated the potential mechanisms of cordycepin-induced AMPK activation in HepG2 cells. Treatment with cordycepin largely reduced oleic acid (OA)-elicited intracellular lipid accumulation and increased AMPK activity in a dose-dependent manner. Cordycepin-induced AMPK activation was not accompanied by changes in either the intracellular levels of AMP or the AMP/ATP ratio, nor was it influenced by calmodulin-dependent protein kinase kinase (CaMKK) inhibition; however, this activation was significantly suppressed by liver kinase B1 (LKB1) knockdown. Molecular docking, fluorescent and circular dichroism measurements showed that cordycepin interacted with the γ1 subunit of AMPK. Knockdown of AMPKγ1 by siRNA substantially abolished the effects of cordycepin on AMPK activation and lipid regulation. The modulating effects of cordycepin on the mRNA levels of key lipid regulatory genes were also largely reversed when AMPKγ1 expression was inhibited. Together, these data suggest that cordycepin may inhibit intracellular lipid accumulation through activation of AMPK via interaction with the γ1 subunit. PMID:24286368

  4. Imaging cytoplasmic cAMP in mouse brainstem neurons

    PubMed Central

    Mironov, SL; Skorova, E; Taschenberger, G; Hartelt, N; Nikolaev, VO; Lohse, MJ; Kügler, S

    2009-01-01

    Background cAMP is an ubiquitous second messenger mediating various neuronal functions, often as a consequence of increased intracellular Ca2+ levels. While imaging of calcium is commonly used in neuroscience applications, probing for cAMP levels has not yet been performed in living vertebrate neuronal tissue before. Results Using a strictly neuron-restricted promoter we virally transduced neurons in the organotypic brainstem slices which contained pre-Bötzinger complex, constituting the rhythm-generating part of the respiratory network. Fluorescent cAMP sensor Epac1-camps was expressed both in neuronal cell bodies and neurites, allowing us to measure intracellular distribution of cAMP, its absolute levels and time-dependent changes in response to physiological stimuli. We recorded [cAMP]i changes in the micromolar range after modulation of adenylate cyclase, inhibition of phosphodiesterase and activation of G-protein-coupled metabotropic receptors. [cAMP]i levels increased after membrane depolarisation and release of Ca2+ from internal stores. The effects developed slowly and reached their maximum after transient [Ca2+]i elevations subsided. Ca2+-dependent [cAMP]i transients were suppressed after blockade of adenylate cyclase with 0.1 mM adenylate cyclase inhibitor 2'5'-dideoxyadenosine and potentiated after inhibiting phosphodiesterase with isobutylmethylxanthine and rolipram. During paired stimulations, the second depolarisation and Ca2+ release evoked bigger cAMP responses. These effects were abolished after inhibition of protein kinase A with H-89 pointing to the important role of phosphorylation of calcium channels in the potentiation of [cAMP]i transients. Conclusion We constructed and characterized a neuron-specific cAMP probe based on Epac1-camps. Using viral gene transfer we showed its efficient expression in organotypic brainstem preparations. Strong fluorescence, resistance to photobleaching and possibility of direct estimation of [cAMP] levels using

  5. FRET measurements of intracellular cAMP concentrations and cAMP analog permeability in intact cells.

    PubMed

    Börner, Sebastian; Schwede, Frank; Schlipp, Angela; Berisha, Filip; Calebiro, Davide; Lohse, Martin J; Nikolaev, Viacheslav O

    2011-04-01

    Real-time measurements of second messengers in living cells, such as cAMP, are usually performed by ratiometric fluorescence resonance energy transfer (FRET) imaging. However, correct calibration of FRET ratios, accurate calculations of absolute cAMP levels and actual permeabilities of different cAMP analogs have been challenging. Here we present a protocol that allows precise measurements of cAMP concentrations and kinetics by expressing FRET-based cAMP sensors in cells and modulating them with an inhibitor of adenylyl cyclase activity and a cell-permeable cAMP analog that fully inhibits and activates the sensors, respectively. Using this protocol, we observed different basal cAMP levels in primary mouse cardiomyocytes, thyroid cells and in 293A cells. The protocol can be generally applied for calibration of second messenger or metabolite concentrations measured by FRET, and for studying kinetics and pharmacological properties of their membrane-permeable analogs. The complete procedure, including cell preparation and FRET measurements, takes 3-6 d. PMID:21412271

  6. Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires β-catenin

    PubMed Central

    Parakh, Tehnaz N.; Hernandez, Jennifer A.; Grammer, Jean C.; Weck, Jennifer; Hunzicker-Dunn, Mary; Zeleznik, Anthony J.; Nilson, John H.

    2006-01-01

    Estrogens profoundly influence the physiology and pathology of reproductive and other tissues. Consequently, emphasis has been placed on delineating the mechanisms underlying regulation of estrogen levels. Circulating levels of estradiol in women are controlled by follicle-stimulating hormone (FSH), which regulates transcription of the aromatase gene (CYP19A1) in ovarian granulosa cells. Previous studies have focused on two downstream effectors of the FSH signal, cAMP and the orphan nuclear receptor steroidogenic factor-1 (NR5A1). In this report, we present evidence for β-catenin (CTNNB1) as an essential transcriptional regulator of CYP19A1. FSH induction of select steroidogenic enzyme mRNAs, including Cyp19a1, is enhanced by β-catenin. Additionally, β-catenin is present in transcription complexes assembled on the endogenous gonad-specific CYP19A1 promoter, as evidenced by chromatin immunoprecipitation assays. Transient expression and RNAi studies demonstrate that FSH- and cAMP-dependent regulation of this promoter is sensitive to alterations in the level of β-catenin. The stimulatory effect of β-catenin is mediated through functional interactions with steroidogenic factor-1 that involve four acidic residues within its ligand-binding domain, mutation of which attenuates FSH/cAMP-induced Cyp19a1 mRNA accumulation. Together, these data demonstrate that β-catenin is essential for FSH/cAMP-regulated gene expression in the ovary, identifying a central and previously unappreciated role for β-catenin in estrogen biosynthesis, and a potential broader role in other aspects of follicular maturation. PMID:16895991

  7. Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase

    SciTech Connect

    Tondi, D.; Powers, R.A.; Negri, M.C.; Caselli, M.C.; Blazquez, J.; Costi, M.P.; Shoichet, B.K.

    2010-03-08

    Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore new inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but

  8. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  9. Cyclic di-AMP: another second messenger enters the fray.

    PubMed

    Corrigan, Rebecca M; Gründling, Angelika

    2013-08-01

    Nucleotide signalling molecules contribute to the regulation of cellular pathways in all forms of life. In recent years, the discovery of new signalling molecules in bacteria and archaea, as well as the elucidation of the pathways they regulate, has brought insights into signalling mechanisms not only in bacterial and archaeal cells but also in eukaryotic host cells. Here, we provide an overview of the synthesis and regulation of cyclic di-AMP (c-di-AMP), one of the latest cyclic nucleotide second messengers to be discovered in bacteria. We also discuss the currently known receptor proteins and pathways that are directly or indirectly controlled by c-di-AMP, the domain structure of the enzymes involved in its production and degradation, and the recognition of c-di-AMP by the eukaryotic host. PMID:23812326

  10. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  11. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  12. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  13. Regulation of cAMP by Phosphodiesterases in Erythrocytes

    PubMed Central

    Adderley, Shaquria P.; Sprague, Randy S.; Stephenson, Alan H.; Hanson, Madelyn S.

    2010-01-01

    The erythrocyte, a cell responsible for carrying and delivering oxygen in the body, has often been regarded as simply a vehicle for the circulation of hemoglobin. However, it has become evident that this cell also participates in the regulation of vascular caliber in the microcirculation via release of the potent vasodilator, adenosine triphosphate (ATP). The regulated release of ATP from erythrocytes occurs via a defined signaling pathway and requires increases in cyclic 3’ 5’ adenosine monophosphate (cAMP). It is well recognized that cAMP is a critical second messenger in diverse signaling pathways. In all cells increases in cAMP are localized and regulated by the activity of phosphodiesterases (PDEs). In erythrocytes activation of either β adrenergic receptors (β 2AR) or the prostacyclin receptor (IPR) results in increases in cAMP and ATP release. Receptor-mediated increases in cAMP are tightly regulated by distinct PDEs associated with each signaling pathway as shown by the finding that selective inhibitors of the PDEs localized to each pathway potentiate both increases in cAMP and ATP release. Here we review the profile of PDEs identified in erythrocytes, their association with specific signaling pathways and their role in the regulation of ATP release from these cells. Understanding the contribution of PDEs to the control of ATP release from erythrocytes identifies this cell as a potential target for the development of drugs for the treatment of vascular disease. PMID:20631411

  14. Dibutyryl cyclic AMP reduces the radiosensitivity of cultured endothelial cells

    SciTech Connect

    Ward, W.; Molteni, A.; Ts'ao, C.; Hinz, J. )

    1991-03-11

    The purpose of this study was to determine whether dibutyryl cyclic AMP modifies the radiosensitivity of confluent monolayers of bovine aortic endothelial cells (BAEC). Three indices of BAEC function were monitored from 4-24 hrs after exposure to 1-10 Gy of {sup 60}Co gamma rays: the release of {sup 51}Cr from prelabeled cells, and release of lactate dehydrogenase (LDH) and plasminogen activator (PLA) into the culture medium. There was a time- and radiation dose-dependent increase in {sup 51}Cr, LDH and PLA release from the BAEC, detectable within 12 hrs after 5 Gy or higher, and by 24 hrs after 1 Gy or higher. This increased release was accompanied by a radiation dose-dependent decrease in {sup 51}Cr and LDH, and an increase in PLA activity in the lysate of cells adherent to the monolayer at 24 hrs. The continuous presence of cAMP from 1 hr before to 24 hrs after irradiation reduced all of these radiation reactions, although mM concentrations of cAMP were required for significant sparing. The presence of cAMP from 1 hr before to 10 min after irradiation had no effect on BAEC sensitivity, whereas cAMP added 10 min after irradiation was fully as effective as continuously administered drug. Thus, cultured BAEC exhibit membrane dysfunction within 24 hrs after clinically relevant radiation doses, and this dysfunction is ameliorated by cAMP present after irradiation.

  15. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  16. Expression of the type I regulatory subunit of cAMP-dependent protein kinase in Escherichia coli

    SciTech Connect

    Saraswat, L.D.; Filutowicz, M.

    1986-05-01

    The cDNA for the bovine type I regulatory subunit of cAMP-dependent protein kinase has been inserted into the expression vector pUC7. When E. coli JM105 was transformed with this plasmid, R-subunit was expressed in amounts that approached 2-4 mg/liter. The expressed protein was visualized in total cell extracts by photolabeling with 8-N/sub 3/-(/sup 32/P)-cAMP following transfer from SDS polyacrylamide gels to nitrocellulose. Expression of R-subunit was independent of IPTG. R-subunit accumulated in large amounts only in the stationary phase of growth. The addition of IPTG during the log phase of growth actually blocked the accumulation of R-subunit. The soluble, dimeric R-subunit was purifided to homogeneity by affinity chromatography. This R-subunit bound 2 mol cAMP/mol R monomer, reassociated with C-subunit to form cAMP-dependent holoenzyme, and migrated as a dimer on SDS polyacrylamide gels in the absence of reducing agents. The expressed protein was also susceptible to limited proteolysis yielding a monomeric cAMP-binding fragment having a molecular weight of 35,000. In all of these properties the expressed protein was indistinguishable from R/sup I/ purified from bovine tissue even though the R-subunit expressed in E. coli represents a fusion protein that contains 10 additional amino acids at the amino terminus that are provided by the lac Z gene of the vector. The NH/sub 2/-terminal sequence was confirmed by amino acid sequencing.

  17. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 2: AMPS payload to spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The AMPS to Spacelab Interface Control Document which is to be used as a guide for format and information content in generating specific AMPS Mission ICDs is presented. This document is meant to supplement the Spacelab Payload Accommodations Handbook in that it only defines interfaces which are not discussed in the handbook to the level required for design purposes. The AMPS Top Level Requirements Tree, illustrates this ICD by a shaded area and its relationship to the other AMPS technical documents. Other interface documents shown are the Level II, AMPS to Space Shuttle Vehicle ICD and the Level III, AMPS to Instruments ICD.

  18. Enterobacteria modulate intestinal bile acid transport and homeostasis through apical sodium-dependent bile acid transporter (SLC10A2) expression.

    PubMed

    Miyata, Masaaki; Yamakawa, Hiroki; Hamatsu, Mayumi; Kuribayashi, Hideaki; Takamatsu, Yuki; Yamazoe, Yasushi

    2011-01-01

    In our study, ampicillin (AMP)-mediated decrease of enterobacteria caused increases in hepatic bile acid concentration through (at least in part) elevation of bile acid synthesis in C57BL/6N mice. We investigated the involvement of enterobacteria on intestinal bile acid absorption in AMP-treated mice in the present study. Fecal enterobacterial levels and fecal bile acid excretion rates were markedly decreased in mice treated with AMP (100 mg/kg) for 3 days, whereas bile acid concentrations in portal blood were significantly increased compared with those in mice treated with a vehicle. Ileal apical sodium-dependent bile acid transporter (SLC10A2) mRNA levels and ileal SLC10A2 protein levels in brush-border membranes were significantly increased compared with those in mice treated with the vehicle. In AMP-treated mice, total bile acid levels were increased, whereas levels of enterobacteria-biotransformed bile acid, taurodeoxycholic acid, and cholic acid were decreased in intestinal lumen. These phenomena were also observed in farnesoid X receptor-null mice treated with AMP for 3 days. Discontinuation of AMP administration after 3 days (vehicle administration for 4 days) increased levels of fecal enterobacteria, fecal bile acid excretion, and taurodeoxycholic acid and cholic acid in the intestinal lumen, whereas the discontinuation decreased ileal SLC10A2 expression and bile acid concentrations in the portal blood. Coadministration of taurodeoxycholic acid or cholic acid decreased ileal SLC10A2 expression in mice treated with AMP. These results suggest that enterobacteria-mediated bile acid biotransformation modulates intestinal bile acid transport and homeostasis through down-regulation of ileal SLC10A2 expression. PMID:20884752

  19. Stimulation of Ca2+ uptake by cyclic AMP and protein kinase in sarcoplasmic reticulum-rich and sarcolemma-rich microsomal fractions from rabbit heart.

    PubMed

    Will, H; Schirpke, B; Wollenberger, A

    1976-01-01

    The effect of cyclic AMP on Ca2+ uptake by rabbit heart microsomal vesicular fractions representing mainly fragments of either sarcoplasmic reticulum or sarcolemma was investigated in the presence and absence of soluble cardiac protein kinase and with microsomes prephosphorylated by cyclic AMP-dependent protein kinase. The acceleration of oxalate-promoted Ca2+ uptake by fragmented sarcoplasmic reticulum following cyclic AMP-dependent membrane protein phosphorylation, observed by other authors, was confirmed. In addition it was found that the acceleration was greatest at pH 7.2 and almost negligible at pH 6.0 and pH 7.8. A very marked increase in Ca2+ uptake by cyclic AMP-dependent membrane protein phosphorylation was observed in the presence of boric acid, a reversible inhibitor of Ca2+ uptake. In addition to the microsomal fraction thought to represent mainly fragments of the sarcoplasmic reticulum, the effect of protein kinase and cyclic AMP on Ca2+ uptake was investigated in a cardiac sarcolemma-enriched membrane fraction. Ca2+ uptake by sarcolemmal vesicles, unlike Ca2+ uptake by sarcoplasmic reticulum vesicles, was inhibited by low doses of digitoxin. The acceleration of oxalate-promoted Ca2+ uptake by cyclic AMP and soluble cardiac protein kinase, however, was quite similar to what was seen in preparations of fragmented sarcoplasmic reticulum, which suggests that it may reflect an acceleration of active Ca2+ transport across the myocardial cell surface membrane. PMID:185862

  20. Induction of a Torpor-Like State by 5’-AMP Does Not Depend on H2S Production

    PubMed Central

    Dugbartey, George J.; Bouma, Hjalmar R.; Strijkstra, Arjen M.; Boerema, Ate S.; Henning, Robert H.

    2015-01-01

    Background Therapeutic hypothermia is used to reduce ischemia/reperfusion injury (IRI) during organ transplantation and major surgery, but does not fully prevent organ injury. Interestingly, hibernating animals undergo repetitive periods of low body temperature called ‘torpor’ without signs of organ injury. Recently, we identified an essential role of hydrogen sulfide (H2S) in entrance into torpor and preservation of kidney integrity during hibernation. A torpor-like state can be induced pharmacologically by injecting 5’-Adenosine monophosphate (5’-AMP). The mechanism by which 5’-AMP leads to the induction of a torpor-like state, and the role of H2S herein, remains to be unraveled. Therefore, we investigated whether induction of a torpor-like state by 5-AMP depends on H2S production. Methods To study the role of H2S on the induction of torpor, amino-oxyacetic acid (AOAA), a non-specific inhibitor of H2S, was administered before injection with 5'-AMP to block endogenous H2S production in Syrian hamster. To assess the role of H2S on maintenance of torpor induced by 5’-AMP, additional animals were injected with AOAA during torpor. Key Results During the torpor-like state induced by 5’-AMP, the expression of H2S- synthesizing enzymes in the kidneys and plasma levels of H2S were increased. Blockade of these enzymes inhibited the rise in the plasma level of H2S, but neither precluded torpor nor induced arousal. Remarkably, blockade of endogenous H2S production was associated with increased renal injury. Conclusions Induction of a torpor-like state by 5’-AMP does not depend on H2S, although production of H2S seems to attenuate renal injury. Unraveling the mechanisms by which 5’-AMP reduces the metabolism without organ injury may allow optimization of current strategies to limit (hypothermic) IRI and improve outcome following organ transplantation, major cardiac and brain surgery. PMID:26295351

  1. Glucagon-like peptide-1 increases cAMP but fails to augment contraction in adult rat cardiac myocytes.

    PubMed

    Vila Petroff, M G; Egan, J M; Wang, X; Sollott, S J

    2001-08-31

    The gut hormone, glucagon-like peptide-1 (GLP-1), which is secreted in nanomolar amounts in response to nutrients in the intestinal lumen, exerts cAMP/protein kinase A-mediated insulinotropic actions in target endocrine tissues, but its actions in heart cells are unknown. GLP-1 (10 nmol/L) increased intracellular cAMP (from 5.7+/-0.5 to 13.1+/-0.12 pmol/mg protein) in rat cardiac myocytes. The effects of cAMP-doubling concentrations of both GLP-1 and isoproterenol (ISO, 10 nmol/L) on contraction amplitude, intracellular Ca(2+) transient (CaT), and pH(i) in indo-1 and seminaphthorhodafluor (SNARF)-1 loaded myocytes were compared. Whereas ISO caused a characteristic increase (above baseline) in contraction amplitude (160+/-34%) and CaT (70+/-5%), GLP-1 induced a significant decrease in contraction amplitude (-27+/-5%) with no change in the CaT after 20 minutes. Neither pertussis toxin treatment nor exposure to the cGMP-stimulated phosphodiesterase (PDE2) inhibitor erythro-9-(2-hydroxy-3-nonyl)adenine or the nonselective PDE inhibitor 3-isobutyl-1-methylxanthine nor the phosphatase inhibitors okadaic acid or calyculin A unmasked an ISO-mimicking response of GLP-1. In SNARF-1-loaded myocytes, however, both ISO and GLP-1 caused an intracellular acidosis (DeltapH(i) -0.09+/-0.02 and -0.08+/-0.03, respectively). The specific GLP-1 antagonist exendin 9-39 and the cAMP inhibitory analog Rp-8CPT-cAMPS inhibited both the GLP-1-induced intracellular acidosis and the negative contractile effect. We conclude that in contrast to beta-adrenergic signaling, GLP-1 increases cAMP but fails to augment contraction, suggesting the existence of functionally distinct adenylyl cyclase/cAMP/protein kinase A compartments, possibly determined by unique receptor signaling microdomains that are not controlled by pertussis toxin-sensitive G proteins or by enhanced local PDE or phosphatase activation. Furthermore, GLP-1 elicits a cAMP-dependent modest negative inotropic effect produced by a

  2. Insulin alters cAMP-activated lipolysis but not cAMP-inhibited glycogen synthase in permeabilized adipocytes

    SciTech Connect

    Mooney, R.A.; Wisniewski, J.L.

    1986-05-01

    Lipolysis and, to a lesser extent, glycogen synthase activity are regulated in adipocytes by cellular cAMP and counter-regulated by insulin. These activities were measured in situ in digitonin (20 ..mu..g/ml) permeabilized rat adipocytes. Incorporation of /sup 3/H UDP-glucose into endogenous glycogen in the presence of KF, EDTA and 10mM glucose-6-phosphate was the basis of the G.S. assay. Cellular GS activity determined by this technique was 1.4 +/- 0.2 fold greater than that of matched homogenates. Insulin treatment of intact cells prior to permeabilization increased GS activity ratio (-/+ G-6-P) 2.5 fold when subsequently measured by the in situ assay. Following digitonin permeabilization, addition of cAMP to the suspension medium increased lipolysis 7 fold and decreased GS activity ratio to 0.38 +/- 0.01 from a basal value of 0.44 +/- 0.06. ATP had a negligible effect on lipolysis but decreased GS to 0.16 +/- 0.04. ATP plus cAMP was only slightly more effective on GS than ATP alone. Insulin at 10/sup -9/M inhibited cAMP-dependent lipolysis by 27% but had no effect on the cAMP- or ATP-dependent decrease in GS. These results suggest that insulin's counter-regulatory mechanisms on these two cAMP-dependent processes may be different.

  3. In vitro and in vivo characterization of the Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodiesterase CpdA, required for cAMP homeostasis and virulence factor regulation.

    PubMed

    Fuchs, Erin L; Brutinel, Evan D; Klem, Erich R; Fehr, Anthony R; Yahr, Timothy L; Wolfgang, Matthew C

    2010-06-01

    Cyclic AMP (cAMP) is an important second messenger signaling molecule that controls a wide variety of eukaryotic and prokaryotic responses to extracellular cues. For cAMP-dependent signaling pathways to be effective, the intracellular cAMP concentration is tightly controlled at the level of synthesis and degradation. In the opportunistic human pathogen Pseudomonas aeruginosa, cAMP is a key regulator of virulence gene expression. To better understand the role of cAMP homeostasis in this organism, we identified and characterized the enzyme CpdA, a putative cAMP phosphodiesterase. We demonstrate that CpdA possesses 3',5'-cAMP phosphodiesterase activity in vitro and that it utilizes an iron-dependent catalytic mechanism. Deletion of cpdA results in the accumulation of intracellular cAMP and altered regulation of P. aeruginosa virulence traits. Further, we demonstrate that the cAMP-dependent transcription factor Vfr directly regulates cpdA expression in response to intracellular cAMP accumulation, thus providing a feedback mechanism for controlling cAMP levels and fine-tuning virulence factor expression. PMID:20348254

  4. cAMP-dependent activation of mammalian target of rapamycin (mTOR) in thyroid cells. Implication in mitogenesis and activation of CDK4.

    PubMed

    Blancquaert, Sara; Wang, Lifu; Paternot, Sabine; Coulonval, Katia; Dumont, Jacques E; Harris, Thurl E; Roger, Pierre P

    2010-07-01

    How cAMP-dependent protein kinases [protein kinase A (PKA)] transduce the mitogenic stimulus elicited by TSH in thyroid cells to late activation of cyclin D3-cyclin-dependent kinase 4 (CDK4) remains enigmatic. Here we show in PC Cl3 rat thyroid cells that TSH/cAMP, like insulin, activates the mammalian target of rapamycin (mTOR)-raptor complex (mTORC1) leading to phosphorylation of S6K1 and 4E-BP1. mTORC1-dependent S6K1 phosphorylation in response to both insulin and cAMP required amino acids, whereas inhibition of AMP-activated protein kinase and glycogen synthase kinase 3 enhanced insulin but not cAMP effects. Unlike insulin, TSH/cAMP did not activate protein kinase B or induce tuberous sclerosis complex 2 phosphorylation at T1462 and Y1571. However, like insulin, TSH/cAMP produced a stable increase in mTORC1 kinase activity that was associated with augmented 4E-BP1 binding to raptor. This could be caused in part by T246 phosphorylation of PRAS40, which was found as an in vitro substrate of PKA. Both in PC Cl3 cells and primary dog thyrocytes, rapamycin inhibited DNA synthesis and retinoblastoma protein phosphorylation induced by TSH and insulin. Although rapamycin reduced cyclin D3 accumulation, the abundance of cyclin D3-CDK4 complexes was not affected. However, rapamycin inhibited the activity of these complexes by decreasing the TSH and insulin-mediated stimulation of activating T172 phosphorylation of CDK4. We propose that mTORC1 activation by TSH, at least in part through PKA-dependent phosphorylation of PRAS40, crucially contributes to mediate cAMP-dependent mitogenesis by regulating CDK4 T172-phosphorylation. PMID:20484410

  5. Influence of cyclic nucleotides (cAMP) on inositol phospholipid (InsPL) metabolism in cultured mesangial (MS) cells

    SciTech Connect

    Troyer, D.A.; Venkatachalam, M.A.; Bonventre, J.V.; Kreisberg, J.I.

    1986-03-01

    Elevation of cAMP inhibits hormone-induced contraction of MS cells, and in other cell types, reduces stimulated InsPL metabolism. The authors found that neither isobutylmethylxanthine (MIX, 0.5 mM), which increases MS cell cAMP levels 4-fold, nor forskolin (100 ..mu..M) altered vasopressin (VP, 10 nM) induced release of /sup 3/H-inositol trisphosphate from prelabelled MS cells. Also, maneuvers which elevated cAMP did not block the VP-induced rise of intracellular calcium as measured by quin-2. Further, neither MIX nor isoproterenol affected the stimulation of glycolysis by VP as measured by lactic acid production. MIX diminished VP stimulated /sup 32/P orthophosphate (/sup 32/P) incorporation into phosphatidylinositol 4,5-bisphosphate, phosphatidylinositol 4-phosphate and phosphatidylinositol. The /sup 32/P content in phosphoinositides of cells treated with MIX and VP was 65% of that in cells treated with VP only. However, the authors found that the specific activity of /sup 32/P in ATP in the presence of MIX + VP was 74% of that with VP alone. Thus, the apparent suppression of /sup 32/P incorporation due to MIX was attributable to a concurrent diminution of the specific activity of /sup 32/P in ATP. The authors conclude that increases of cAMP interfere with contraction distal to PIP/sub 2/ hydrolysis, inositol phosphate release, calcium mobilization, and enhancement of glycolysis.

  6. Targeting AMP-activated protein kinase as a novel therapeutic approach for the treatment of metabolic disorders.

    PubMed

    Viollet, B; Mounier, R; Leclerc, J; Yazigi, A; Foretz, M; Andreelli, F

    2007-12-01

    In the light of recent studies in humans and rodents, AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, has been described as an integrator of regulatory signals monitoring systemic and cellular energy status. AMP-activated protein kinase (AMPK) has been proposed to function as a 'fuel gauge' to monitor cellular energy status in response to nutritional environmental variations. Recently, it has been proposed that AMPK could provide a link in metabolic defects underlying progression to the metabolic syndrome. AMPK is a heterotrimeric enzyme complex consisting of a catalytic subunit alpha and two regulatory subunits beta and gamma. AMPK is activated by rising AMP and falling ATP. AMP activates the system by binding to the gamma subunit that triggers phosphorylation of the catalytic alpha subunit by the upstream kinases LKB1 and CaMKKbeta (calmodulin-dependent protein kinase kinase). AMPK system is a regulator of energy balance that, once activated by low energy status, switches on ATP-producing catabolic pathways (such as fatty acid oxidation and glycolysis), and switches off ATP-consuming anabolic pathways (such as lipogenesis), both by short-term effect on phosphorylation of regulatory proteins and by long-term effect on gene expression. As well as acting at the level of the individual cell, the system also regulates food intake and energy expenditure at the whole body level, in particular by mediating the effects of insulin sensitizing adipokines leptin and adiponectin. AMPK is robustly activated during skeletal muscle contraction and myocardial ischaemia playing a role in glucose transport and fatty acid oxidation. In liver, activation of AMPK results in enhanced fatty acid oxidation as well as decreased glucose production. Moreover, the AMPK system is one of the probable targets for the anti-diabetic drugs biguanides and thiazolidinediones. Thus, the relationship between AMPK activation and beneficial metabolic

  7. [cAMP cascade in regulation of protein glycosylation].

    PubMed

    Surman, Magdalena; Janik, Marcelina

    2014-01-01

    O- and N-glycosylation are the most common and complex of the post-translational modifications. Both are enzymatic processes and it was suggested that both could be regulated by cAMP cascade at the early stages. N-glycosylation starts with the formation of lipid-linked oligosaccharides and this process is catalysed by crucial glycosyltransferase - dolichol phosphate mannose synthase. The results of several studies strongly suggest that the cAMP acting through a cAMP-dependent protein kinase A-mediated protein phosphorylation/dephosphorylation cycle may modulate activation of this enzyme. It was shown that cAMP can also up regulate another enzyme involved in phosphodolichole synthesis - cis-prenyltransferase. The mechanism acting here is the alteration of the rate of its gene expression. cAMP cascade is also involved in regulation of O-glycosylation since phosphorylation of human glutamine:fructose-6-phosphate amidotransferase results in depletion of O-GlcNAc structure formation. These observation suggested an important role of GPCRs and their ligand in regulation of N- and O-glycan synthesis. PMID:26263760

  8. Cyclic AMP Regulates Social Behavior in African Trypanosomes

    PubMed Central

    Oberholzer, Michael; Saada, Edwin A.

    2015-01-01

    ABSTRACT The protozoan parasite Trypanosoma brucei engages in surface-induced social behavior, termed social motility, characterized by single cells assembling into multicellular groups that coordinate their movements in response to extracellular signals. Social motility requires sensing and responding to extracellular signals, but the underlying mechanisms are unknown. Here we report that T. brucei social motility depends on cyclic AMP (cAMP) signaling systems in the parasite’s flagellum (synonymous with cilium). Pharmacological inhibition of cAMP-specific phosphodiesterase (PDE) completely blocks social motility without impacting the viability or motility of individual cells. Using a fluorescence resonance energy transfer (FRET)-based sensor to monitor cAMP dynamics in live cells, we demonstrate that this block in social motility correlates with an increase in intracellular cAMP levels. RNA interference (RNAi) knockdown of the flagellar PDEB1 phenocopies pharmacological PDE inhibition, demonstrating that PDEB1 is required for social motility. Using parasites expressing distinct fluorescent proteins to monitor individuals in a genetically heterogeneous community, we found that the social motility defect of PDEB1 knockdowns is complemented by wild-type parasites in trans. Therefore, PDEB1 knockdown cells are competent for social motility but appear to lack a necessary factor that can be provided by wild-type cells. The combined data demonstrate that the role of cyclic nucleotides in regulating microbial social behavior extends to African trypanosomes and provide an example of transcomplementation in parasitic protozoa. PMID:25922395

  9. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  10. Effect of cAMP on the cholesterol side-chain cleavage enzyme complex (CSCC) in MA-10 Leydig tumor cell mitochondria

    SciTech Connect

    Chaudhary, L.R.; Stocco, D.M.

    1986-05-01

    The rate limiting step in steroid biosynthesis is catalyzed by the cholesterol side-chain cleavage complex (CSCC) which is located on the matrix side of the inner mitochondrial membrane. It has been shown that addition of cAMP or LH/hCG to MA-10 mouse Leydig tumor cells in culture increases the production of progesterone as the major steroid. To examine the effect of cAMP on CSCC activity, cells were grown in culture flasks in the presence or absence of 10/sup -3/M cAMP for 3 h. Cells were harvested and mitochondria were isolated. Reaction conditions were optimized and contained 465000 DPM (26-/sup 14/C)cholesterol, 10mM NaCN, 0.5mM NADPH, 5mM CaCl/sub 2/, 60mM KCl and mitochondria. Reactions were stopped by the addition of ethanol and water and liberated (26-/sup 14/C)isocaproic acid was separated from uncleaved cholesterol by extraction with hexane and chloroform resulting in the retention of isocaproic acid in the aqueous layer. These experiments demonstrated a significant increase in (/sup 14/C)isocaproic acid production by mitochondria isolated from the cells grown in the presence of cAMP when compared to controls indicating that cAMP enhances the production of progesterone by increasing the activity of CSCC. Whether cAMP brings about this increase primarily through phosphorylation/dephosphorylation reactions or through some other mechanism is not clear at this time.

  11. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  12. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  13. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  14. Pulse charging of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1980-01-01

    Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

  15. Studies related to primitive chemistry. A proton and nitrogen-14 nuclear magnetic resonance amino acid and nucleic acid constituents and a and their possible relation to prebiotic

    NASA Technical Reports Server (NTRS)

    Manatt, S. L.; Cohen, E. A.; Shiller, A. M.; Chan, S. I.

    1973-01-01

    Preliminary proton nuclear magnetic resonance (NMR) studies were made to determine the applicability of this technique for the study of interactions between monomeric and polymeric amino acids with monomeric nucleic acid bases and nucleotides. Proton NMR results for aqueous solutions (D2O) demonstrated interactions between the bases cytosine and adenine and acidic and aromatic amino acids. Solutions of 5'-AMP admixed with amino acids exhibited more complex behavior but stacking between aromatic rings and destacking at high amino acids concentration was evident. The multisite nature of 5'-AMP was pointed out. Chemical shift changes for adenine and 5'-AMP with three water soluble polypeptides demonstrated that significant interactions exist. It was found that the linewidth-pH profile of each amino acid is unique. It is concluded that NMR techniques can give significant and quantitative data on the association of amino acid and nucleic acid constituents.

  16. Methamphetamine and HIV-1-induced neurotoxicity: Role of trace amine associated receptor 1 cAMP signaling in astrocytes

    PubMed Central

    Cisneros, Irma E.

    2014-01-01

    Methamphetamine (METH) is abused by about 5% of the United States population with approximately 10–15% of human immunodeficiency virus-1 (HIV-1) patients reporting its use. METH abuse accelerates the onset and severity of HIV-associated neurocognitive disorders (HAND) and astrocyte-induced neurotoxicity. METH activates G-protein coupled receptors such as trace amine associated receptor 1 (TAAR1) increasing intracellular cyclic adenosine monophosphate (cAMP) levels in presynaptic cells of monoaminergic systems. In the present study, we investigated the effects of METH and HIV-1 on primary human astrocyte TAAR1 expression, function and glutamate clearance. Our results demonstrate combined conditions increased TAAR1 mRNA levels 7-fold and increased intracellular cAMP levels. METH and beta-phenylethylamine (β-PEA), known TAAR1 agonists, increased intracellular cAMP levels in astrocytes. Further, TAAR1 knockdown significantly reduced intracellular cAMP levels in response to METH/β-PEA, indicating signaling through astrocyte TAAR1. METH +/− HIV-1 decreased excitatory amino acid transporter-2 (EAAT-2) mRNA and significantly decreased glutamate clearance. RNA interference for TAAR1 prevented METH-mediated decreases in EAAT-2. TAAR1 knockdown significantly increased glutamate clearance, which was further heightened significantly by METH. Moreover, TAAR1 overexpression significantly decreased EAAT-2 levels and glutamate clearance that were further reduced by METH. Taken together, our data show that METH treatment activated TAAR1 leading to intracellular cAMP in human astrocytes and modulated glutamate clearance abilities. Furthermore, molecular alterations in astrocyte TAAR1 levels correspond to changes in astrocyte EAAT-2 levels and function. To our knowledge this is the first report implicating astrocyte TAAR1 as a novel receptor for METH during combined injury in the context of HAND. PMID:24950453

  17. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  18. AMP-activated protein kinase is activated by non-steroidal anti-inflammatory drugs.

    PubMed

    King, Tanya S; Russe, Otto Quintus; Möser, Christine V; Ferreirós, Nerea; Kynast, Katharina L; Knothe, Claudia; Olbrich, Katrin; Geisslinger, Gerd; Niederberger, Ellen

    2015-09-01

    AMP-activated kinase (AMPK) is a cellular energy sensor, which is activated in stages of increased adenosine triphosphate (ATP) consumption. Its activation has been associated with a number of beneficial effects such as decrease of inflammatory processes and inhibition of disease progression of diabetes and obesity. A recent study suggested that salicylate, the active metabolite of the non-steroidal anti-inflammatory drug (NSAID) acetyl-salicylic acid (aspirin), is able to activate AMPK pharmacologically. This observation raised the question whether or not other NSAIDs might also act as AMPK activators and whether this action might contribute to their cyclooxygenase (COX)-independent anti-inflammatory properties. In this study, we investigated mouse and human neuronal cells and liver tissue of mice after treatment with various NSAIDs. Our results showed that the non-selective acidic NSAIDs ibuprofen and diclofenac induced AMPK activation similar to aspirin while the COX-2 selective drug etoricoxib and the non-opioid analgesic paracetamol, both drugs have no acidic structure, failed to activate AMPK. In conclusion, our results revealed that AMPK can be activated by specific non-steroidal anti-inflammatory drugs such as salicylic acid, ibuprofen or diclofenac possibly depending on the acidic structure of the drugs. AMPK might therefore contribute to their antinociceptive and anti-inflammatory properties. PMID:26049010

  19. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  20. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  1. Formation of dAMP-glycerol and dAMP-Tris Derivatives by Thermococcus kodakaraensis DNA Primase*

    PubMed Central

    Chemnitz Galal, Wiebke; Pan, Miao; Giulian, Gary; Yuan, Wei; Li, Shuwei; Edwards, James L.; Marino, John P.; Kelman, Zvi; Hurwitz, Jerard

    2012-01-01

    In the presence of dATP, glycerol, and Tris buffer, the DNA primase isolated from Thermococcus kodakaraensis catalyzed the formation of dAMP and two products that were identified as dAMP-glycerol and dAMP-Tris. These products were formed by the T. kodakaraensis p41 catalytic subunit alone and the T. kodakaraensis p41-p46 complex in the absence of a DNA template. They were not formed with preparations containing the catalytically inactive p41 subunit. Similar glycerol and Tris derivatives as well as dNMPs were also formed with dGTP, dCTP, or dTTP. The mechanism contributing to the formation of these products and its implications in the initiation reaction catalyzed by the T. kodakaraensis primase are discussed. PMID:22427647

  2. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios

    PubMed Central

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  3. Mitochondrial Cyclic AMP Response Element-binding Protein (CREB) Mediates Mitochondrial Gene Expression and Neuronal Survival*S

    PubMed Central

    Lee, Junghee; Kim, Chun-Hyung; Simon, David K.; Aminova, Lyaylya R.; Andreyev, Alexander Y.; Kushnareva, Yulia E.; Murphy, Anne N.; Lonze, Bonnie E.; Kim, Kwang-Soo; Ginty, David D.; Ferrante, Robert J.; Ryu, Hoon; Ratan, Rajiv R.

    2008-01-01

    Cyclic AMP response element-binding protein (CREB) is a widely expressed transcription factor whose role in neuronal protection is now well established. Here we report that CREB is present in the mitochondrial matrix of neurons and that it binds directly to cyclic AMP response elements (CREs) found within the mitochondrial genome. Disruption of CREB activity in the mitochondria decreases the expression of a subset of mitochondrial genes, including the ND5 subunit of complex I, down-regulates complex I-dependent mitochondrial respiration, and increases susceptibility to 3-nitropropionic acid, a mitochondrial toxin that induces a clinical and pathological phenotype similar to Huntington disease. These results demonstrate that regulation of mitochondrial gene expression by mitochondrial CREB, in part, underlies the protective effects of CREB and raise the possibility that decreased mitochondrial CREB activity contributes to the mitochondrial dysfunction and neuronal loss associated with neurodegenerative disorders. PMID:16207717

  4. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  5. Cyclic di-AMP homeostasis in bacillus subtilis: both lack and high level accumulation of the nucleotide are detrimental for cell growth.

    PubMed

    Mehne, Felix M P; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-18

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  6. Role of cyclic nucleotide phosphodiesterase isoforms in cAMP compartmentation following β2-adrenergic stimulation of ICa,L in frog ventricular myocytes

    PubMed Central

    Jurevičius, Jonas; Skeberdis, V Arvydas; Fischmeister, Rodolphe

    2003-01-01

    The role of cyclic nucleotide phosphodiesterase (PDE) isoforms in the β2-adrenergic stimulation of the L-type Ca2+ current (ICa,L) was investigated in frog ventricular myocytes using double patch-clamp and double-barrelled microperfusion techniques. Isoprenaline (ISO, 1 nM to 10 μM) was applied on one half of the cell, either alone or in the presence of PDE inhibitors, and the local and distant responses of ICa,L were used to determine the gradient of local vs. distant cAMP concentration (α). IBMX (100 μM), a non-selective PDE inhibitor, reduced α from 40 to 4.4 indicating a 9-fold reduction in intracellular cAMP compartmentation when all PDE activity was blocked. While PDE1 and PDE2 inhibition had no effect, PDE3 inhibition by milrinone (3 μM) or PDE4 inhibition by Ro 20-1724 (3 μM) reduced α by 6- and 4-fold, respectively. A simultaneous application of milrinone and Ro 20-1724 produced a similar effect to IBMX, showing that PDE3 and PDE4 were the major PDEs accounting for cAMP compartmentation. Okadaic acid (3 μM), a non-selective phosphatase inhibitor, or H89 (1 μM), an inhibitor of cAMP-dependent protein kinase (PKA), had no effect on the distant response of ICa,L to ISO indicating that PDE activation by PKA played a minor role in cAMP compartmentation. Our results demonstrate that PDE activity determines the degree of cAMP compartmentation in frog ventricular cells upon β2-adrenergic stimulation. PDE3 and PDE4 subtypes play a major role in this process, and contribute equally to ensure a functional coupling of β2-adrenergic receptors with nearby Ca2+ channels via local elevations of cAMP. PMID:12815180

  7. Use of Bio-Amp, a commercial bio-additive for the treatment of grease trap wastewater containing fat, oil, and grease.

    PubMed

    Tang, Hao L; Xie, Yuefeng F; Chen, Yen-Chih

    2012-11-01

    This research investigated the application of Bio-Amp, a commercial bio-additive for the treatment of fat, oil, and grease (FOG) in a grease trap, and evaluated potential impacts of treated effluent on downstream collection system and treatment processes. Results show that after Bio-Amp treatment, FOG deposit formation was reduced by 40%, implicating a potential reduction of sewer line blockages. Chemical oxygen demand (COD), total nitrogen (TN), total phosphorus (TP) and total fatty acids were reduced by 39%, 33%, 56%, and 59%, respectively, which represents an overall loading reduction of 9% COD, 5% TN and 40% TP received by the treatment plant from all the dining halls. On the other hand, readily biodegradable COD fractions significantly increased, which implies a potential improvement on Bio-P removal. Overall, the results showed that application of Bio-Amp in grease trap provides potential reduction of sewer line blockages, and can also alleviate downstream treatment burden. PMID:22989634

  8. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  9. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  10. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  11. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  12. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  13. cAMP signaling in cortisol-producing adrenal adenoma.

    PubMed

    Calebiro, Davide; Di Dalmazi, Guido; Bathon, Kerstin; Ronchi, Cristina L; Beuschlein, Felix

    2015-10-01

    The cAMP signaling pathway is one of the major players in the regulation of growth and hormonal secretion in adrenocortical cells. Although its role in the pathogenesis of adrenocortical hyperplasia associated with Cushing's syndrome has been clarified, a clear involvement of the cAMP signaling pathway and of one of its major downstream effectors, the protein kinase A (PKA), in sporadic adrenocortical adenomas remained elusive until recently. During the last year, a report by our group and three additional independent groups showed that somatic mutations of PRKACA, the gene coding for the catalytic subunit α of PKA, are a common genetic alteration in patients with Cushing's syndrome due to adrenal adenomas, occurring in 35-65% of the patients. In vitro studies revealed that those mutations are able to disrupt the association between catalytic and regulatory subunits of PKA, leading to a cAMP-independent activity of the enzyme. Despite somatic PRKACA mutations being a common finding in patients with clinically manifest Cushing's syndrome, the pathogenesis of adrenocortical adenomas associated with subclinical hypercortisolism seems to rely on a different molecular background. In this review, the role of cAMP/PKA signaling in the regulation of adrenocortical cell function and its alterations in cortisol-producing adrenocortical adenomas will be summarized, with particular focus on recent developments. PMID:26139209

  14. Characteristics of cyclic AMP transport by marine bacteria

    SciTech Connect

    Ammerman, J.W.; Azam, F.

    1987-12-01

    Uptake and autoradiography experiments with natural populations of marine bacteria, sea water cultures, and cultured isolates showed that the high-affinity cyclic AMP transport system in marine bacteria has stringent structural requirements, is found in a minority of cells in mixed bacterial assemblages, and appears to be related to the culture growth state.

  15. Metabolic benefits of inhibiting cAMP-PDEs with resveratrol.

    PubMed

    Chung, Jay H

    2012-10-01

    Calorie restriction (CR) extends lifespan in species ranging from yeast to mammals. There is evidence that CR also protects against aging-related diseases in non-human primates. This has led to an intense interest in the development of CR-mimetics to harness the beneficial effects of CR to treat aging-related diseases. One CR-mimetic that has received a great deal of attention is resveratrol. Resveratrol extends the lifespan of obese mice and protects against obesity-related diseases such as type 2 diabetes. The specific mechanism of resveratrol action has been difficult to elucidate because resveratrol has a promiscuous target profile. A recent finding indicates that the metabolic effects of resveratrol may result from competitive inhibition of cAMP-degrading phosphodiesterases (PDEs), which increases cAMP levels. The cAMP-dependent pathways activate AMP-activated protein kinase (AMPK), which is essential for the metabolic effects of resveratrol. Inhibiting PDE4 with rolipram reproduces all of the metabolic benefits of resveratrol, including protection against diet-induced obesity and an increase in mitochondrial function, physical stamina and glucose tolerance in mice. This discovery suggests that PDE inhibitors may be useful for treating metabolic diseases associated with aging. PMID:23700542

  16. MiAMP1, a novel protein from Macadamia integrifolia adopts a Greek key beta-barrel fold unique amongst plant antimicrobial proteins.

    PubMed

    McManus, A M; Nielsen, K J; Marcus, J P; Harrison, S J; Green, J L; Manners, J M; Craik, D J

    1999-10-29

    MiAMP1 is a recently discovered 76 amino acid residue, highly basic protein from the nut kernel of Macadamia integrifolia which possesses no sequence homology to any known protein and inhibits the growth of several microbial plant pathogens in vitro while having no effect on mammalian or plant cells. It is considered to be a potentially useful tool for the genetic engineering of disease resistance in transgenic crop plants and for the design of new fungicides. The three-dimensional structure of MiAMP1 was determined through homonuclear and heteronuclear ((15)N) 2D NMR spectroscopy and subsequent simulated annealing calculations with the ultimate aim of understanding the structure-activity relationships of the protein. MiAMP1 is made up of eight beta-strands which are arranged in two Greek key motifs. These Greek key motifs associate to form a Greek key beta-barrel. This structure is unique amongst plant antimicrobial proteins and forms a new class which we term the beta-barrelins. Interestingly, the structure of MiAMP1 bears remarkable similarity to a yeast killer toxin from Williopsis mrakii. This toxin acts by inhibiting beta-glucan synthesis and thereby cell wall construction in sensitive strains of yeast. The structural similarity of MiAMP1 and WmKT, which originate from plant and fungal phyla respectively, may reflect a similar mode of action. PMID:10543955

  17. Glucose becomes one of the worst carbon sources for E.coli on poor nitrogen sources due to suboptimal levels of cAMP

    PubMed Central

    Bren, Anat; Park, Junyoung O.; Towbin, Benjamin D.; Dekel, Erez; Rabinowitz, Joshua D.; Alon, Uri

    2016-01-01

    In most conditions, glucose is the best carbon source for E. coli: it provides faster growth than other sugars, and is consumed first in sugar mixtures. Here we identify conditions in which E. coli strains grow slower on glucose than on other sugars, namely when a single amino acid (arginine, glutamate, or proline) is the sole nitrogen source. In sugar mixtures with these nitrogen sources, E. coli still consumes glucose first, but grows faster rather than slower after exhausting glucose, generating a reversed diauxic shift. We trace this counterintuitive behavior to a metabolic imbalance: levels of TCA-cycle metabolites including α-ketoglutarate are high, and levels of the key regulatory molecule cAMP are low. Growth rates were increased by experimentally increasing cAMP levels, either by adding external cAMP, by genetically perturbing the cAMP circuit or by inhibition of glucose uptake. Thus, the cAMP control circuitry seems to have a ‘bug’ that leads to slow growth under what may be an environmentally rare condition. PMID:27109914

  18. Glucose becomes one of the worst carbon sources for E.coli on poor nitrogen sources due to suboptimal levels of cAMP.

    PubMed

    Bren, Anat; Park, Junyoung O; Towbin, Benjamin D; Dekel, Erez; Rabinowitz, Joshua D; Alon, Uri

    2016-01-01

    In most conditions, glucose is the best carbon source for E. coli: it provides faster growth than other sugars, and is consumed first in sugar mixtures. Here we identify conditions in which E. coli strains grow slower on glucose than on other sugars, namely when a single amino acid (arginine, glutamate, or proline) is the sole nitrogen source. In sugar mixtures with these nitrogen sources, E. coli still consumes glucose first, but grows faster rather than slower after exhausting glucose, generating a reversed diauxic shift. We trace this counterintuitive behavior to a metabolic imbalance: levels of TCA-cycle metabolites including α-ketoglutarate are high, and levels of the key regulatory molecule cAMP are low. Growth rates were increased by experimentally increasing cAMP levels, either by adding external cAMP, by genetically perturbing the cAMP circuit or by inhibition of glucose uptake. Thus, the cAMP control circuitry seems to have a 'bug' that leads to slow growth under what may be an environmentally rare condition. PMID:27109914

  19. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  20. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  1. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  2. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  3. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  4. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  5. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  6. Stimulators of AMP-activated kinase (AMPK) inhibit seawater- but not cAMP-induced oocyte maturation in a marine worm: Implications for interactions between cAMP and AMPK signaling.

    PubMed

    Stricker, Stephen A; Swiderek, Lee; Nguyen, Thanh

    2010-06-01

    Previous studies have shown that elevations in intraoocytic cAMP prevent mammalian oocytes from maturing, whereas cAMP degradation allows these oocytes to begin maturation, as evidenced by the onset of oocyte nuclear disassembly (="germinal vesicle breakdown", GVBD). Moreover, such cAMP degradation not only reduces cAMP levels but also generates AMP, which in turn can stimulate AMP-activated kinase (AMPK), a well-documented inducer of GVBD in mice. Alternatively, in some marine invertebrates, intraoocytic cAMP triggers, rather than blocks, GVBD, and whether AMPK up- or downregulates maturation in these species has not been tested. Thus, AMPK was monitored in the nemertean worm Cerebratulus during GVBD stimulated by seawater (SW) or cAMP elevators. In oocytes lacking surrounding follicle cells, AMPK activity was initially elevated in immature oocytes but subsequently reduced during SW- or cAMP-induced GVBD, given that the catalytic alpha-subunit of AMPK in maturing oocytes displayed a decreased stimulatory phosphorylation at T172 and an increased inhibitory phosphorylation at S485/491. Accordingly, AMPK-mediated phosphorylation of acetyl-CoA carboxylase, a known target of active AMPK, also declined during maturation. Moreover, treatments with either ice-cold calcium-free seawater (CaFSW) or AMPK agonists dissolved in SW maintained AMPK activity and inhibited GVBD. Conversely, adding cAMP elevators to CaFSW- or SW-solutions of AMPK activators restored GVBD while promoting S485/491 phosphorylation and AMPK deactivation. Collectively, such findings not only demonstrate for the first time that intraoocytic AMPK can block GVBD in the absence of surrounding follicle cells, but these results also provide evidence for a novel GVBD-regulating mechanism involving AMPK deactivation by cAMP-mediated S485/491 phosphorylation. PMID:20336704

  7. Alkaline pH- and cAMP-induced V-ATPase membrane accumulation is mediated by protein kinase A in epididymal clear cells.

    PubMed

    Pastor-Soler, Núria M; Hallows, Kenneth R; Smolak, Christy; Gong, Fan; Brown, Dennis; Breton, Sylvie

    2008-02-01

    In the epididymis, low luminal bicarbonate and acidic pH maintain sperm quiescent during maturation and storage. The vacuolar H(+)-ATPase (V-ATPase) in epididymal clear cells plays a major role in luminal acidification. We have shown previously that cAMP, luminal alkaline pH, and activation of the bicarbonate-regulated soluble adenylyl cyclase (sAC) induce V-ATPase apical accumulation in these cells, thereby stimulating proton secretion into the epididymal lumen. Here we examined whether protein kinase A (PKA) is involved in this response. Confocal immunofluorescence labeling on rat epididymis perfused in vivo showed that at luminal acidic pH (6.5), V-ATPase was distributed between short apical microvilli and subapical endosomes. The specific PKA activator N(6)-monobutyryl-3'-5'-cyclic monophosphate (6-MB-cAMP, 1 mM) induced elongation of apical microvilli and accumulation of V-ATPase in these structures. The PKA inhibitor myristoylated-PKI (mPKI, 10 microM) inhibited the apical accumulation of V-ATPase induced by 6-MB-cAMP. Perfusion at pH 6.5 with 8-(4-chlorophenylthio)-2-O-methyl-cAMP (8CPT-2-O-Me-cAMP; 10 microM), an activator of the exchange protein activated by cAMP (Epac), did not induce V-ATPase apical accumulation. When applied at a higher concentration (100 microM), 8CPT-2-O-Me-cAMP induced V-ATPase apical accumulation, but this effect was completely inhibited by mPKI, suggesting crossover effects on the PKA pathway with this compound at high concentrations. Importantly, the physiologically relevant alkaline pH-induced apical V-ATPase accumulation was completely inhibited by pretreatment with mPKI. We conclude that direct stimulation of PKA activity by cAMP is necessary and sufficient for the alkaline pH-induced accumulation of V-ATPase in clear cell apical microvilli. PMID:18160485

  8. The plasma cyclic-AMP response to noise in humans and rats—short-term exposure to various noise levels

    NASA Astrophysics Data System (ADS)

    Iwamoto, M.; Dodo, H.; Ishii, F.; Yoneda, J.; Yamazaki, S.; Goto, H.

    1988-12-01

    Rats were exposed to short-term noise which was found to activate the hypothalamohypophyseal-adrenal system and result in a decrease of adrenal ascorbic acid (AAA) and an increase of serum corticosterone (SCS). The threshold limit value lay between 60 and 70 dB(A). To characterize better the effect of noise on the human hypothalamo-hypophyseal-adrenal system, a large group of subjects was exposed to short-term noise at 85 dB(A) and higher, and tested for levels of adrenocortical steroid (cortisol) and anterior pituitary hormones such as ACTH, growth hormone (GH) and prolactin (PRL). Results in humans showed hyperfunction of the hypothalamo-pituitary system. However, as the responses in rats and humans differed, a further experiment was performed using C-AMP, a second messenger mediating many of the effects of a variety of hormones. Plasma C-AMP in humans and rats increased significantly after exposure to noise greater than 70 dB(A). We suggest that plasma C-AMP could be useful as a sensitive index for noise-related stress in the daily living environment of humans and rats.

  9. LPA Is a Chemorepellent for B16 Melanoma Cells: Action through the cAMP-Elevating LPA5 Receptor

    PubMed Central

    Jongsma, Maikel; Matas-Rico, Elisa; Rzadkowski, Adrian; Jalink, Kees; Moolenaar, Wouter H.

    2011-01-01

    Lysophosphatidic acid (LPA), a lipid mediator enriched in serum, stimulates cell migration, proliferation and other functions in many cell types. LPA acts on six known G protein-coupled receptors, termed LPA1–6, showing both overlapping and distinct signaling properties. Here we show that, unexpectedly, LPA and serum almost completely inhibit the transwell migration of B16 melanoma cells, with alkyl-LPA(18∶1) being 10-fold more potent than acyl-LPA(18∶1). The anti-migratory response to LPA is highly polarized and dependent on protein kinase A (PKA) but not Rho kinase activity; it is associated with a rapid increase in intracellular cAMP levels and PIP3 depletion from the plasma membrane. B16 cells express LPA2, LPA5 and LPA6 receptors. We show that LPA-induced chemorepulsion is mediated specifically by the alkyl-LPA-preferring LPA5 receptor (GPR92), which raises intracellular cAMP via a noncanonical pathway. Our results define LPA5 as an anti-migratory receptor and they implicate the cAMP-PKA pathway, along with reduced PIP3 signaling, as an effector of chemorepulsion in B16 melanoma cells. PMID:22195035

  10. cAMP-inducible chloride conductance in mouse fibroblast lines stably expressing the human cystic fibrosis transmembrane conductance regulator.

    PubMed Central

    Rommens, J M; Dho, S; Bear, C E; Kartner, N; Kennedy, D; Riordan, J R; Tsui, L C; Foskett, J K

    1991-01-01

    A cAMP-inducible chloride permeability has been detected in mouse fibroblast (L cell) lines upon stable integration of a full-length cDNA encoding the human cystic fibrosis transmembrane conductance regulator (CFTR). As indicated by a Cl(-)-indicator dye, the Cl- permeability of the plasma membrane increases by 10- to 30-fold within 2 min after treatment of the cells with forskolin, an activator of adenylyl cyclase. The properties of the conductance are similar to those described in secretory epithelial cells; the whole-cell current-voltage relationship is linear and there is no evidence of voltage-dependent inactivation or activation. In contrast, this cAMP-dependent Cl- flux is undetectable in the untransfected cells or cells harboring defective cDNA constructs, including one with a phenylalanine deletion at amino acid position 508 (delta F508), the most common mutation causing cystic fibrosis. These observations are consistent with the hypothesis that the CFTR is a cAMP-dependent Cl- channel. The availability of a heterologous (nonepithelial) cell type expressing the CFTR offers an excellent system to understand the basic mechanisms underlying this CFTR-associated ion permeability and to study the structure and function of the CFTR. Images PMID:1715567

  11. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity. PMID:26607336

  12. The Crystal Structures of Apo and cAMP-Bound GlxR from Corynebacterium glutamicum Reveal Structural and Dynamic Changes upon cAMP Binding in CRP/FNR Family Transcription Factors

    PubMed Central

    Townsend, Philip D.; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A.; Cole, Stewart T.; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J.; Pohl, Ehmke

    2014-01-01

    The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition. PMID:25469635

  13. Piperlongumine as a potential activator of AMP-activated protein kinase in HepG2 cells.

    PubMed

    Ryu, Jahee; Kim, Myoung-Jin; Kim, Tae-Oh; Huh, Tae-Lin; Lee, Sung-Eun

    2014-01-01

    AMP-activated protein kinase (AMPK) is a key regulator of fatty acid biosynthesis and fatty acid oxidation throughout the body. Piperlongumine (PL) isolated from Piper longum (L.) was shown to potently upregulate activation of AMPK via phosphorylation and inactivation of acetyl-CoA carboxylases in cultured HepG2 cells, presumably enhancing the transfer of fatty acids into mitochondrial cells by inhibiting malonyl-CoA production. PL showed cytotoxicity on HepG2 cell growth at the concentration of 5 μM of PL, while more than 80% of HepG2 cells were survived at the concentration of 2 μM of PL. Overall, the results of this study indicate that PL activates AMPK phosphorylation and possesses cytotoxicity in HepG2 cells. PMID:24853732

  14. Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.

    PubMed

    Passner, J M; Schultz, S C; Steitz, T A

    2000-12-15

    After an allosteric transition produced by the binding of cyclic AMP (cAMP), the Escherichia coli catabolite gene activator protein (CAP) binds DNA specifically and activates transcription. The three-dimensional crystal structure of the CAP-cAMP complex has been refined at 2.1 A resolution, thus enabling a better evaluation of the structural basis for CAP phenotypes, the interactions of cAMP with CAP and the roles played by water structure. A review of mutational analysis of CAP together with the additional structural information presented here suggests a possible mechanism for the cAMP-induced allostery required for DNA binding and transcriptional activation. We hypothesize that cAMP binding may reorient the coiled-coil C-helices, which provide most of the dimer interface, thereby altering the relative positions of the DNA-binding domains of the CAP dimer. Additionally, cAMP binding may cause a further rearrangement of the DNA-binding and cAMP-binding domains of CAP via a flap consisting of beta-strands 4 and 5 which lies over the cAMP. PMID:11124031

  15. Purification of the surface cAMP receptor in Dictyostelium

    SciTech Connect

    Klein, P.; Knox, B.; Borleis, J.; Devreotes, P.

    1987-01-05

    We have previously identified and demonstrated reversible ligand-induced modification of the major cell surface cAMP receptor in Dictyostelium discoideum. The receptor, or a subunit of it, has been purified to homogeneity by hydroxylapatite chromatography followed by two-dimensional preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purification was monitored by following /sup 32/Pi incorporated by photoaffinity labeling with 8-azido-(/sup 32/P)cAMP or by in vivo labeling with /sup 32/Pi. Two interconvertible forms of the receptor, designated R (Mr 40,000) and D (Mr 43,000), co-purified. Two-dimensional peptide maps of independently purified and /sup 125/I-iodinated R and D forms of the receptor were nearly identical but did have several distinct peptides. The estimated 6000-fold purification required is consistent with the number of cell surface binding sites assuming there are not multiple binding sites/polypeptide. In the accompanying article we report the generation of a monospecific polyclonal antiserum which has helped to further elucidate the physical properties and developmental regulation of the cAMP receptor.

  16. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  17. Sustained cyclic AMP production by parathyroid hormone receptor endocytosis

    PubMed Central

    Ferrandon, Sébastien; Feinstein, Timothy N; Castro, Marian; Wang, Bin; Bouley, Richard; Potts, John T; Gardella, Thomas J; Vilardaga, Jean-Pierre

    2011-01-01

    Cell signaling mediated by the G protein-coupled parathyroid hormone receptor type 1 (PTHR) is fundamental to bone and kidney physiology. It has been unclear how the two ligand systems—PTH, endocrine and homeostatic, and PTH-related peptide (PTHrP), paracrine—can effectively operate with only one receptor and trigger different durations of the cAMP responses. Here we analyze the ligand response by measuring the kinetics of activation and deactivation for each individual reaction step along the PTHR signaling cascade. We found that during the time frame of G protein coupling and cAMP production, PTHrP1–36 action was restricted to the cell surface, whereas PTH1–34 had moved to internalized compartments where it remained associated with the PTHR and Gαs, potentially as a persistent and active ternary complex. Such marked differences suggest a mechanism by which PTH and PTHrP induce differential responses, and these results indicate that the central tenet that cAMP production originates exclusively at the cell membrane must be revised. PMID:19701185

  18. Activation of GPR4 by Acidosis Increases Endothelial Cell Adhesion through the cAMP/Epac Pathway

    PubMed Central

    Leffler, Nancy R.; Asch, Adam S.; Witte, Owen N.; Yang, Li V.

    2011-01-01

    Endothelium-leukocyte interaction is critical for inflammatory responses. Whereas the tissue microenvironments are often acidic at inflammatory sites, the mechanisms by which cells respond to acidosis are not well understood. Using molecular, cellular and biochemical approaches, we demonstrate that activation of GPR4, a proton-sensing G protein-coupled receptor, by isocapnic acidosis increases the adhesiveness of human umbilical vein endothelial cells (HUVECs) that express GPR4 endogenously. Acidosis in combination with GPR4 overexpression further augments HUVEC adhesion with U937 monocytes. In contrast, overexpression of a G protein signaling-defective DRY motif mutant (R115A) of GPR4 does not elicit any increase of HUVEC adhesion, indicating the requirement of G protein signaling. Downregulation of GPR4 expression by RNA interference reduces the acidosis-induced HUVEC adhesion. To delineate downstream pathways, we show that inhibition of adenylate cyclase by inhibitors, 2′,5′-dideoxyadenosine (DDA) or SQ 22536, attenuates acidosis/GPR4-induced HUVEC adhesion. Consistently, treatment with a cAMP analog or a Gi signaling inhibitor increases HUVEC adhesiveness, suggesting a role of the Gs/cAMP signaling in this process. We further show that the cAMP downstream effector Epac is important for acidosis/GPR4-induced cell adhesion. Moreover, activation of GPR4 by acidosis increases the expression of vascular adhesion molecules E-selectin, VCAM-1 and ICAM-1, which are functionally involved in acidosis/GPR4-mediated HUVEC adhesion. Similarly, hypercapnic acidosis can also activate GPR4 to stimulate HUVEC adhesion molecule expression and adhesiveness. These results suggest that acidosis/GPR4 signaling regulates endothelial cell adhesion mainly through the Gs/cAMP/Epac pathway and may play a role in the inflammatory response of vascular endothelial cells. PMID:22110680

  19. 4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models

    PubMed Central

    Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3′, 5′-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3′, 5′-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  20. SET Protein Interacts with Intracellular Domains of the Gonadotropin-releasing Hormone Receptor and Differentially Regulates Receptor Signaling to cAMP and Calcium in Gonadotrope Cells*

    PubMed Central

    Avet, Charlotte; Garrel, Ghislaine; Denoyelle, Chantal; Laverrière, Jean-Noël; Counis, Raymond; Cohen-Tannoudji, Joëlle; Simon, Violaine

    2013-01-01

    In mammals, the receptor of the neuropeptide gonadotropin-releasing hormone (GnRHR) is unique among the G protein-coupled receptor (GPCR) family because it lacks the carboxyl-terminal tail involved in GPCR desensitization. Therefore, mechanisms involved in the regulation of GnRHR signaling are currently poorly known. Here, using immunoprecipitation and GST pull-down experiments, we demonstrated that SET interacts with GnRHR and targets the first and third intracellular loops. We delineated, by site-directed mutagenesis, SET binding sites to the basic amino acids 66KRKK69 and 246RK247, located next to sequences required for receptor signaling. The impact of SET on GnRHR signaling was assessed by decreasing endogenous expression of SET with siRNA in gonadotrope cells. Using cAMP and calcium biosensors in gonadotrope living cells, we showed that SET knockdown specifically decreases GnRHR-mediated mobilization of intracellular cAMP, whereas it increases its intracellular calcium signaling. This suggests that SET influences signal transfer between GnRHR and G proteins to enhance GnRHR signaling to cAMP. Accordingly, complexing endogenous SET by introduction of the first intracellular loop of GnRHR in αT3-1 cells significantly reduced GnRHR activation of the cAMP pathway. Furthermore, decreasing SET expression prevented cAMP-mediated GnRH stimulation of Gnrhr promoter activity, highlighting a role of SET in gonadotropin-releasing hormone regulation of gene expression. In conclusion, we identified SET as the first direct interacting partner of mammalian GnRHR and showed that SET contributes to a switch of GnRHR signaling toward the cAMP pathway. PMID:23233674

  1. Rapid, efficient charging of lead-acid and nickel-zinc traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1978-01-01

    Lead-acid and nickel-zinc traction cells were rapidly and efficiently charged using a high rate tapered direct current (HRTDC) charge method which could possibly be used for on-the-road service recharge of electric vehicles. The HRTDC method takes advantage of initial high cell charge acceptance and uses cell gassing rate and temperature as an indicator of charging efficiency. On the average, in these preliminary tests, 300 amp-hour nickel-zinc traction cells were given a HRTDC (initial current 500 amps, final current 100 amps) to 78 percent of rated amp-hour capacity within 53 minutes at an amp-hour efficiency of 92 percent and an energy efficiency of 52 percent. Three hundred amp-hour lead-acid traction cells were charged to 69 percent of rated amp-hour capacity within 46 minutes at an amp-hour efficiency of 91 percent with an energy efficiency of 64 percent. In order to find ways to further decrease the recharge times, the effect of periodically (0 to 400 Hz) pulse discharging cells during a constant current charging process (94% duty cycle) was investigated. Preliminary data indicate no significant effect of this type of pulse discharging during charge on charge acceptance of lead-acid or nickel-zinc cells.

  2. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  3. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and

  4. THE ABC TRANSPORTER, AbcB3, MEDIATES cAMP EXPORT IN D. DISCOIDEUM DEVELOPMENT

    PubMed Central

    Miranda, Edward Roshan; Nam, Edward A.; Kuspa, Adam; Shaulsky, Gad

    2014-01-01

    Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development. PMID:25448698

  5. Cyclic Amp phosphodiesterase activity in normal and inflamed human dental pulp.

    PubMed

    Spoto, G; Menna, V; Serra, E; Santoleri, F; Perfetti, G; Ciavarelli, L; Trentini, P

    2004-01-01

    Cyclic AMP phosphodiesterase (cAMP PDE) seems to be important in pulp tissues. High levels of cAMP PDE have been demonstrated to be in dental pulp cells. In the present study cAMP PDE activity was analyzed in normal healthy human dental pulps, in reversible pulpitis and in irreversible pulpitis. Enzymatic cAMP PDE control values for normal healthy pulps were 12.14 +/- 3.74 nmols/mg of proteins. In reversible pulpitis the cAMP PDE activity increased almost 2.5 times. In irreversible pulpitis specimens the values increased 4.5 times compared with normal healthy pulps activity. The differences between the groups (control vs. reversible pulpitis and vs. irreversible pulpitis) were statistically significant. These results could point to a role of cAMP PDE in the initial pulp response after injury. PMID:16857100

  6. An Investigation of the Adsorption Characteristics of 5'ATP and 5'AMP onto the Surface of Caso4 x 2H2O

    NASA Technical Reports Server (NTRS)

    Calderon, J.; Sweeney, M. A.

    1984-01-01

    A model has been proposed in which solid surfaces can act as a site for cataletic activity of condensation reactions for certain biomolecules. From this model, the adsorption characteristics of 5'ATP and 5'AMP onto the surface of CaSO4.2H2O was chosen for study. It has been proven that 5'ATP and 5'AMP do adsorb onto the surface of CaSO4. Studies were then made to determine the dependence of absorption versus time, concentration, ionic strength and pH. It was found that the adsorption of the nucleotides is highly pH dependent, primarily determined by the phosphate acid groups of the nucleic acid molecule. From this investigation, the data obtained is discussed in relation to the model for the prebiotic earth.

  7. Aptasensors based on supramolecular structures of nucleic acid-stabilized Ag nanoclusters.

    PubMed

    Sharon, Etery; Enkin, Natalie; Albada, H Bauke; Willner, Itamar

    2015-01-21

    Two-sized luminescent nucleic acid-functionalized Ag nanoclusters (NCs) are implemented for the analysis and multiplexed detection of adenosine monophosphate, AMP, and of cocaine using aptamer-ligand complexes. PMID:25449885

  8. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  9. Dysregulation of hepatic cAMP levels via altered Pde4b expression plays a critical role in alcohol-induced steatosis.

    PubMed

    Avila, Diana V; Barker, David F; Zhang, JingWen; McClain, Craig J; Barve, Shirish; Gobejishvili, Leila

    2016-09-01

    Alcohol-induced hepatic steatosis is a significant risk factor for progressive liver disease. Cyclic adenosine monophosphate (cAMP) signalling has been shown to significantly regulate lipid metabolism; however, the role of altered cAMP homeostasis in alcohol-mediated hepatic steatosis has never been studied. Our previous work demonstrated that increased expression of hepatic phosphodiesterase 4 (Pde4), which specifically hydrolyses and decreases cAMP levels, plays a pathogenic role in the development of liver inflammation/injury. The aim of this study was to examine the role of PDE4 in alcohol-induced hepatic steatosis. C57BL/6 wild-type and Pde4b knockout (Pde4b(-/-) ) mice were pair-fed control or ethanol liquid diets. One group of wild-type mice received rolipram, a PDE4-specific inhibitor, during alcohol feeding. We demonstrate for the first time that an early increase in PDE4 enzyme expression and a resultant decrease in hepatic cAMP levels are associated with the significant reduction in carnitine palmitoyltransferase 1A (Cpt1a) expression. Notably, alcohol-fed (AF) Pde4b(-/-) mice and AF wild-type mice treated with rolipram had significantly lower hepatic free fatty acid content compared with AF wild-type mice. Importantly, PDE4 inhibition in alcohol-fed mice prevented the decrease in hepatic Cpt1a expression via the Pparα/Sirt1/Pgc1α pathway. These results demonstrate that the alcohol- induced increase in hepatic Pde4, specifically Pde4b expression, and compromised cAMP signalling predispose the liver to impaired fatty acid oxidation and the development of steatosis. Moreover, these data also suggest that hepatic PDE4 may be a clinically relevant therapeutic target for the treatment of alcohol-induced hepatic steatosis. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:27287961

  10. Role of Tissue-Specific Transcription Factor LFB3 in a Cyclic AMP-Responsive Enhancer of the Urokinase-Type Plasminogen Activator Gene in LLC-PK1 Cells

    PubMed Central

    Soubt, Mazin Khalil; Marksitzer, René; Menoud, Pierre-Alain; Nagamine, Yoshikuni

    1998-01-01

    A cyclic AMP (cAMP)-inducible enhancer in the pig urokinase-type plasminogen activator gene located 3.4 kb upstream of the transcription initiation site is composed of three protein-binding domains, A, B, and C. Domains A and B each contain a CRE (cAMP response element)-like sequence but require the adjoining C domain for full cAMP responsiveness. A tissue-specific transcription factor, LFB3/HNF1β/vHNF1, binds to the C domain. Mutation analyses suggest that the imperfect CRE and LFB3-binding sequences are required for tight coupling of hormonal and tissue-specific regulation. CREB and ATF1 bind to domains A and B, and this binding is enhanced upon phosphorylation by cAMP-dependent protein kinase (protein kinase A [PKA]). Analysis in a mammalian two-hybrid system revealed that CREB/ATF1 and LFB3 interact and that transactivation potential is enhanced by PKA activation. Interestingly, however, phosphorylation of CREB at Ser-133 does not contribute to its interaction with LFB3. The region of LFB3 involved in its interaction with CREB/ATF1 lies, at least partly, between amino acids 400 and 450. Deletion of this region removed the ability of LFB3 to mediate cAMP induction of the ABC enhancer but did not impair its basal transactivation activity on the albumin promoter. Thus, the two activities are distinct functions of LFB3. PMID:9671480

  11. Properties of Starch-Poly(acrylamide-co-2-acrylamido-2-methylpropanesulfonic acid) Graft Copolymers Prepared by Reactive Extrusion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of starch with acrylamide and 2-acrylamido-2-methylpropanesulfonic acid (AMPS) were prepared by reactive extrusion in a twin-screw extruder. The weight ratio of total monomer to starch was fixed at 1:3, while the molar fraction of AMPS in the monomer feed ranged from 0 to 0.119. Mon...

  12. Acetate supplementation increases brain phosphocreatine and reduces AMP levels with no effect on mitochondrial biogenesis

    PubMed Central

    Bhatt, Dhaval P.; Houdek, Heidi M.; Watt, John A.; Rosenberger, Thad A.

    2013-01-01

    Acetate supplementation in rats increases plasma acetate and brain acetyl-CoA levels. Although acetate is used as a marker to study glial energy metabolism, the effect that acetate supplementation has on normal brain energy stores has not been quantified. To determine the effect(s) that an increase in acetyl-CoA levels has on brain energy metabolism, we measured brain nucleotide, phosphagen and glycogen levels, and quantified cardiolipin content and mitochondrial number in rats subjected to acetate supplementation. Acetate supplementation was induced with glyceryl triacetate (GTA) by oral gavage (6 g/Kg body weight). Rats used for biochemical analysis were euthanized using head-focused microwave irradiation at 2, and 4 hr following treatment to immediately stop metabolism. We found that acetate did not alter brain ATP, ADP, NAD, GTP levels, or the energy charge ratio [ECR, (ATP + ½ ADP) / (ATP + ADP + AMP)] when compared to controls. However, after 4 hr of treatment brain phosphocreatine levels were significantly elevated with a concomitant reduction in AMP levels with no change in glycogen levels. In parallel studies where rats were treated with GTA for 28 days, we found that acetate did not alter brain glycogen and mitochondrial biogenesis as determined by measuring brain cardiolipin content, the fatty acid composition of cardiolipin and using quantitative ultra-structural analysis to determine mitochondrial density/unit area of cytoplasm in hippocampal CA3 neurons. Collectively, these data suggest that an increase in brain acetyl-CoA levels by acetate supplementation does increase brain energy stores however it has no effect on brain glycogen and neuronal mitochondrial biogenesis. PMID:23321384

  13. The Deacylation Mechanism of AmpC [beta]-Lactamase at Ultrahigh Resolution

    SciTech Connect

    Chen, Yu; Minasov, George; Roth, Tomer A.; Prati, Fabio; Shoichet, Brian K.

    2010-03-05

    {beta}-Lactamases confer bacterial resistance to {beta}-lactam antibiotics, such as penicillins. The characteristic class C {beta}-lactamase AmpC catalyzes the reaction with several key residues including Ser64, Tyr150, and Lys67. Here, we describe a 1.07 {angstrom} X-ray crystallographic structure of AmpC {beta}-lactamase in complex with a boronic acid deacylation transition-state analogue. The high quality of the electron density map allows the determination of many proton positions. The proton on the Tyr150 hydroxyl group is clearly visible and is donated to the boronic oxygen mimicking the deacylation water. Meanwhile, Lys67 hydrogen bonds with Ser64O{gamma}, Asn152O{delta}1, and the backbone oxygen of Ala220. This suggests that this residue is positively charged and has relinquished the hydrogen bond with Tyr150 observed in acyl-enzyme complex structures. Together with previous biochemical and NMR studies, these observations indicate that Tyr150 is protonated throughout the reaction coordinate, disfavoring mechanisms that involve a stable tyrosinate as the general base for deacylation. Rather, the hydroxyl of Tyr150 appears to be well positioned to electrostatically stabilize the negative charge buildup in the tetrahedral high-energy intermediate. This structure, in itself, appears consistent with a mechanism involving either Tyr150 acting as a transient catalytic base in conjunction with a neutral Lys67 or the lactam nitrogen as the general base. Whereas mutagenesis studies suggest that Lys67 may be replaced by an arginine, disfavoring the conjugate base mechanism, distinguishing between these two hypotheses may ultimately depend on direct determination of the pKa of Lys67 along the reaction coordinate.

  14. Involvement of calyculin A inhibitable protein phosphatases in the cyclic AMP signal transduction pathway of mouse corticotroph tumour (AtT20) cells

    PubMed Central

    Antaraki, A; Ang, K L; Antoni, F A

    1997-01-01

    The role of non-calcineurin protein phosphatases in the cyclic AMP signal transduction pathway was examined in mouse pituitary corticotroph tumour (AtT20) cells. Blockers of protein phosphatases, calyculin A and okadaic acid, were applied in AtT20 cells depleted of rapidly mobilizable pools of intracellular calcium and activated by various cyclic AMP generating agonists. Inhibitors of cyclic nucleotide phosphodiesterases were present throughout. The accumulation of cyclic AMP was monitored by radioimmunoassay, phosphodiesterase activity in cell homogenates was measured by radiometric assay. Neither calyculin A nor okadaic acid altered basal cyclic AMP levels but cyclic AMP formation induced by 41 amino acid residue corticotrophin releasing-factor (CRF) was strongly inhibited (up to 80%). 1-Norokadaone was inactive. Similar data were also obtained when isoprenaline or pituitary adenylate cyclase activating peptide1–38 were used as agonists. Pertussis toxin did not modify the inhibition of CRF-induced cyclic AMP production by calyculin A. Pretreatment with calyculin A completely prevented the stimulation of cyclic AMP formation by cholera toxin even in the presence of 0.5 mM isobutylmethylxanthine (IBMX) and 0.1 mM rolipram. Cholera toxin mediated ADP-ribosylation of the 45K and 52K molecular weight Gsα isoforms in membranes from calyculin A-pretreated cells was enhanced to 150–200% when compared with controls. Cholera toxin-induced cyclic AMP was reduced by calyculin A within 10 min when calyculin A was applied after a 90 min pretreatment with cholera toxin. Under these conditions the effect of calyculin A could be blocked by the combination of 0.5 mM IBMX and 0.1 mM rolipram, but not by 0.5 mM IBMX alone. Phosphodiesterase activity in AtT20 cell homogenates showed a significant, 2.7 fold increase after treatment with calyculin A. In control cells phosphodiesterase activity was blocked by 80% in the presence of IBMX (0.5 mM), or IBMX plus

  15. Exchange protein directly activated by cAMP (epac): a multidomain cAMP mediator in the regulation of diverse biological functions.

    PubMed

    Schmidt, Martina; Dekker, Frank J; Maarsingh, Harm

    2013-04-01

    Since the discovery nearly 60 years ago, cAMP is envisioned as one of the most universal and versatile second messengers. The tremendous feature of cAMP to tightly control highly diverse physiologic processes, including calcium homeostasis, metabolism, secretion, muscle contraction, cell fate, and gene transcription, is reflected by the award of five Nobel prizes. The discovery of Epac (exchange protein directly activated by cAMP) has ignited a new surge of cAMP-related research and has depicted novel cAMP properties independent of protein kinase A and cyclic nucleotide-gated channels. The multidomain architecture of Epac determines its activity state and allows cell-type specific protein-protein and protein-lipid interactions that control fine-tuning of pivotal biologic responses through the "old" second messenger cAMP. Compartmentalization of cAMP in space and time, maintained by A-kinase anchoring proteins, phosphodiesterases, and β-arrestins, contributes to the Epac signalosome of small GTPases, phospholipases, mitogen- and lipid-activated kinases, and transcription factors. These novel cAMP sensors seem to implement certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Agonists and antagonists selective for Epac are developed and will support further studies on the biologic net outcome of the activation of Epac. This will increase our current knowledge on the pathophysiology of devastating diseases, such as diabetes, cognitive impairment, renal and heart failure, (pulmonary) hypertension, asthma, and chronic obstructive pulmonary disease. Further insights into the cAMP dynamics executed by the Epac signalosome will help to optimize the pharmacological treatment of these diseases. PMID:23447132

  16. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  17. Cardiac myocyte–secreted cAMP exerts paracrine action via adenosine receptor activation

    PubMed Central

    Sassi, Yassine; Ahles, Andrea; Truong, Dong-Jiunn Jeffery; Baqi, Younis; Lee, Sang-Yong; Husse, Britta; Hulot, Jean-Sébastien; Foinquinos, Ariana; Thum, Thomas; Müller, Christa E.; Dendorfer, Andreas; Laggerbauer, Bernhard; Engelhardt, Stefan

    2014-01-01

    Acute stimulation of cardiac β-adrenoceptors is crucial to increasing cardiac function under stress; however, sustained β-adrenergic stimulation has been implicated in pathological myocardial remodeling and heart failure. Here, we have demonstrated that export of cAMP from cardiac myocytes is an intrinsic cardioprotective mechanism in response to cardiac stress. We report that infusion of cAMP into mice averted myocardial hypertrophy and fibrosis in a disease model of cardiac pressure overload. The protective effect of exogenous cAMP required adenosine receptor signaling. This observation led to the identification of a potent paracrine mechanism that is dependent on secreted cAMP. Specifically, FRET-based imaging of cAMP formation in primary cells and in myocardial tissue from murine hearts revealed that cardiomyocytes depend on the transporter ABCC4 to export cAMP as an extracellular signal. Extracellular cAMP, through its metabolite adenosine, reduced cardiomyocyte cAMP formation and hypertrophy by activating A1 adenosine receptors while delivering an antifibrotic signal to cardiac fibroblasts by A2 adenosine receptor activation. Together, our data reveal a paracrine role for secreted cAMP in intercellular signaling in the myocardium, and we postulate that secreted cAMP may also constitute an important signal in other tissues. PMID:25401477

  18. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  19. A novel biosensor to study cAMP dynamics in cilia and flagella.

    PubMed

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca(2+), basal SACY activity is suppressed by Ca(2+). Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. PMID:27003291

  20. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  1. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  2. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  3. Novel reciprocal regulation of cAMP signaling and apoptosis by orphan G-protein-coupled receptor GPRC5A gene expression

    SciTech Connect

    Hirano, Minoru; Zang, Liqing; Oka, Takehiko; Ito, Yoshiyuki; Shimada, Yasuhito; Nishimura, Yuhei; Tanaka, Toshio . E-mail: tanaka@doc.medic.mie-u.ac.jp

    2006-12-08

    GPRC5A is a member of G-protein-coupled receptors, which was originally identified as an all-trans-retinoic acid-induced gene. Although recent studies reported that this gene was highly expressed in the cancer cell lines and that GPRC5A might positively regulate cell proliferation, its mechanism remains unknown. We investigated the upstream and downstream signaling of GPRC5A and its biological function, and found that cAMP signaling is the novel GPRC5A induction pathway. When GPRC5A gene was overexpressed, intracellular cAMP concentration was decreased, and Gs{alpha} gene expression was downregulated. On the other hand, RNA interference of GPRC5A increased mRNA levels of Gs{alpha} and intracellular cAMP, reduced cell number, and induced apoptosis. Conversely, cell number was increased by GPRC5A overexpression. We first report the novel negative feedback model of cAMP signaling through GPRC5A gene expression. This evidence explains one of the mechanisms of the GPRC5A-regulated cell growth in some cancer cell lines.

  4. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    PubMed

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. PMID:26984404

  5. Design and membrane-disruption mechanism of charge-enriched AMPs exhibiting cell selectivity, high-salt resistance, and anti-biofilm properties.

    PubMed

    Han, Hyo Mi; Gopal, Ramamourthy; Park, Yoonkyung

    2016-02-01

    Cationic antimicrobial peptides (AMPs) are essential components of the innate immune system, offering protection against invading pathogenic bacteria. In nature, AMPs serve as antibiotics with broad-spectrum antimicrobial and anti-biofilm properties. However, low effective stability in high-salt environments and physiological instability in biological membranes limit the applicability of naturally occurring AMPs as novel therapeutics. We therefore designed short synthetic cationic peptides by substituting key residues in myxinidin, an AMP derived from the epidermal mucus of hagfish, with lysine (Lys, K), arginine (Arg, R), and tryptophan (Trp, W). The resultant myxinidin analogs exhibited strong antimicrobial activity against both Gram-positive and Gram-negative bacteria, including multidrug-resistant strains, even under high-salt conditions. Moreover, these peptides showed high binding affinity for both lipopolysaccharides and lipoteichoic acids and inhibited biofilm formation by most bacteria, but did not cause significant lysis of human red blood cells and were not cytotoxic to normal human keratinocytes. Circular dichroism analysis revealed that myxinidin and its analogs assumed α-helical or β-sheet structures within artificial liposomes and bacterial membranes. In addition, bacterial killing and membrane permeation experiments demonstrated that the myxinidin analogs permeated through bacterial membranes, leading to cytoplasmic disruption and cell death. Taken together, these findings suggest myxinidin analogs may be promising candidate antibiotic agents for therapeutic application against antibiotic-resistant bacteria. PMID:26450121

  6. Effects of cold exposure on cyclic AMP concentration in plasma, liver, and brown and white adipose tissues in cold-acclimated rats

    NASA Astrophysics Data System (ADS)

    Habara, Yoshiaki

    1989-06-01

    Effects of acute cold exposure on plasma energy substrates and tissue 3',5'-adenosine monophosphate (cAMP) were analyzed in intact rats, to define an involvement of the nucleotide in nonshivering thermogenesis (NST) and resultant cold acclimation. After an acute cold exposure to -5°C, the plasma glucose level increased gradually in warm-kept control rats (C) while it decreased significantly in cold-acclimated rats (CA). However, it was increased considerably by an extreme cold exposure to -15°C in both C and CA. By contrast, plasma levels of free fatty acids (FFA) increased immediately after cold exposure and the release lasted during the period of exposure especially in C. The cold exposure also increased plasma cAMP concentration but no concomitant increase was found in the liver. In both brown (IBAT) and white (WAT) adipose tissues the nucleotide concentration showed a stepwise decrease. The observed correlation between lipolysis and plasma cAMP response after cold exposure suggests an involvement of the adenylate cyclase-cAMP system in NST via lipid metabolism, at least, in the early stages of cold acclimation.

  7. Fecal carriage of extended-spectrum β-lactamases and AmpC-producing Escherichia coli in a Libyan community

    PubMed Central

    2014-01-01

    Background Extended-spectrum β-lactamases (ESBLs), including the AmpC type, are important mechanisms of resistance among Enterobacteriaeceae. CTX-M type extended-spectrum β- lactamases, of which there are now over 90 variants, are distributed globally, yet appear to vary in regional distribution. AmpC β-lactamases hydrolyze third generation cephalosporins, but are resistant to inhibition by clavulanate or other β-lactamase inhibitors in vitro. Fecal carriage and rates of colonization by bacteria harboring these resistance mechanisms have been reported in patients with community-acquired infections and in healthy members of their households. Expression of these ESBLs compromises the efficacy of current antibacterial therapies, potentially increasing the seriousness of hospital- and community-acquired Escherichia coli (E. coli) infections. To investigate the occurrence of ESBL-producing E. coli in human fecal flora isolated from two pediatric populations residing in the Libyan cities Zleiten and Abou El Khoms. Isolates were further studied to characterize genes encoding β-lactam resistance, and establish genetic relationships. Methods Antibiotic resistance profiles of phenotypically characterized E. coli isolates recovered from the stools of 243 Libyan children during two surveillance periods in 2001 and 2007 were determined by the disk diffusion method. ESBL-screening was performed using the cephalosporin/clavulanate double synergy disc method, and the AmpC-phenotype was confirmed by the aminophenyl-boronic acid test. ESBL genes were molecularly characterized. Phylogenetic group and multilocus sequence typing (MLST) were determined for ESBL-producing isolates and PFGE was performed to compare banding profiles of some dominant strains. Results ESBLs were identified in 13.4% (18/134) of E. coli isolates, and nine isolates (6.7%) demonstrated AmpC activity; all 18 isolates contained a CTX-M gene. Three CTX-M gene families (CTX-M-1, n = 9; CTX-M-15, n = 8

  8. Isodihydrocapsiate stimulates plasma glucose uptake by activation of AMP-activated protein kinase.

    PubMed

    Hwang, Seung-Lark; Yang, Byung-Keun; Lee, Jai-Youl; Kim, Jeong-Han; Kim, Byung-Dong; Kim, Byung-Hong; Suh, Ki-Hyoung; Kim, Dae Young; Kim, Dae-Yong; Kim, Moon Sung; Song, Hebok; Park, Byeoung-Soo; Huh, Tae-Lin

    2008-06-27

    AMP-activated protein kinase (AMPK) is an energy-sensing enzyme that is implicated as a key factor in controlling whole body homeostasis, including fatty acid oxidation and glucose uptake. We report that a synthetic structural isomer of dihydrocapsiate, isodihydrocapsiate (8-methylnonanoic acid 3-hydroxy-4-methoxy benzyl ester) improves type 2 diabetes by activating AMPK through the LKB1 pathway. In L6 myotube cells, phosphorylation of AMPK and acetyl-CoA carboxylase (ACC) and glucose uptake were significantly increased, whereas these effects were attenuated by an AMPK inhibitor, compound C. In addition, increased phosphorylation of AMPK and ACC by isodihydrocapsiate was significantly reduced by radicicol, an LKB1 destabilizer, suggesting that increased glucose uptake in L6 cells with isodihydrocapsiate treatment is predominantly accomplished by a LKB1-mediated AMPK activation pathway. Oral administration of isodihydrocapsiate to diabetic (db/db) mice reduced blood glucose levels by 40% after a 4-week treatment period. Our results support the development of isodihydrocapsiate as a potential therapeutic agent to target AMPK in type 2 diabetes. PMID:18435912

  9. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  10. Nucleotide sequences of fic and fic-1 genes involved in cell filamentation induced by cyclic AMP in Escherichia coli.

    PubMed Central

    Kawamukai, M; Matsuda, H; Fujii, W; Utsumi, R; Komano, T

    1989-01-01

    The nucleotide sequences of fic-1 involved in the cell filamentation induced by cyclic AMP in Escherichia coli and its normal counterpart fic were analyzed. The open reading frame of both fic-1 and fic coded for 200 amino acids. The Gly at position 55 in the Fic protein was changed to Arg in the Fic-1 protein. The promoter activity of fic was confirmed by fusing fic and lacZ. The gene downstream from fic was found to be pabA (p-aminobenzoate). There is an open reading frame (ORF190) coding for 190 amino acids upstream from the fic gene. Computer-assisted analysis showed that Fic has sequence similarity with part of CDC28 of Saccharomyces cerevisiae, CDC2 of Schizosaccharomyces pombe, and FtsA of E. coli. In addition, ORF190 has sequence similarity with the cyclosporin A-binding protein cyclophilin. PMID:2546924

  11. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  12. cAMP and Ca2+ signaling in secretory epithelia: Crosstalk and Synergism

    PubMed Central

    Ahuja, Malini; Jha, Archana; Maléth, Jozsef; Park, Seonghee; Muallem, Shmuel

    2014-01-01

    The Ca2+ and cAMP/PKA pathways are the primary signaling systems in secretory epithelia that control virtually all secretory gland functions. Interaction and crosstalk in Ca2+ and cAMP signaling occur at multiple levels to control and tune the activity of each other. Physiologically, Ca2+ and cAMP signaling operate at 5–10% of maximal strength, but synergize to generate the maximal response. Although synergistic action of the Ca2+ and cAMP signaling is the common mode of signaling and has been known for many years, we know very little of the molecular mechanism and mediators of the synergism. In this review, we discuss crosstalk between the Ca2+ and cAMP signaling and the function of IRBIT (IP3 receptors binding protein release with IP3) as a third messenger that mediates the synergistic action of the Ca2+ and cAMP signaling. PMID:24613710

  13. Electrostatic steering enhances the rate of cAMP binding to phosphodiesterase: Brownian dynamics modeling.

    PubMed

    Huang, Yu-ming M; Huber, Gary; McCammon, J Andrew

    2015-11-01

    Signaling in cells often involves co-localization of the signaling molecules. Most experimental evidence has shown that intracellular compartmentalization restricts the range of action of the second messenger, 3'-5'-cyclic adenosine monophosphate (cAMP), which is degraded by phosphodiesterases (PDEs). The objective of this study is to understand the details of molecular encounter that may play a role in efficient operation of the cAMP signaling apparatus. The results from electrostatic potential calculations and Brownian dynamics simulations suggest that positive potential of the active site from PDE enhances capture of diffusing cAMP molecules. This electrostatic steering between cAMP and the active site of a PDE plays a major role in the enzyme-substrate encounter, an effect that may be of significance in sequestering cAMP released from a nearby binding site or in attracting more freely diffusing cAMP molecules. PMID:26346301

  14. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  15. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  16. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  17. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  18. Molecular cloning and subcellular distribution of the novel PDE4B4 cAMP-specific phosphodiesterase isoform.

    PubMed Central

    Shepherd, Malcolm; McSorley, Theresa; Olsen, Aileen E; Johnston, Lee Ann; Thomson, Neil C; Baillie, George S; Houslay, Miles D; Bolger, Graeme B

    2003-01-01

    We have isolated cDNAs encoding PDE4B4, a new cAMP-specific phosphodiesterase (PDE4) isoform with novel properties. The amino acid sequence of PDE4B4 demonstrates that it is encoded by the PDE4B gene, but that it differs from the previously isolated PDE4B1, PDE4B2 and PDE4B3 isoforms by the presence of a novel N-terminal region of 17 amino acids. PDE4B4 contains both of the upstream conserved region 1 (UCR1) and UCR2 regulatory units that are characteristic of 'long' PDE4 isoforms. RNase protection demonstrated that PDE4B4 mRNA is expressed preferentially in liver, skeletal muscle and various regions of the brain, which differs from the pattern of tissue distribution of the other known PDE4B long forms, PDE4B1 and PDE4B3. Expression of PDE4B4 cDNA in COS7 cells produced a protein of 85 kDa under denaturing conditions. Subcellular fractionation of recombinant, COS7-cell expressed PDE4B4 showed that the protein was localized within the cytosol, which was confirmed by confocal microscopic analysis of living COS7 cells transfected with a green fluorescent protein-PDE4B4 chimaera. PDE4B4 exhibited a K(m) for cAMP of 5.4 microM and a V(max), relative to that of the long PDE4B1 isoform, of 2.1. PDE4B4 was inhibited by the prototypical PDE4 inhibitor rolipram [4-[3-(cyclopentoxyl)-4-methoxyphenyl]-2-pyrrolidinone] with an IC(50) of 83 nM. Treatment of COS7 cells with forskolin, to elevate cAMP levels, produced activation of PDE4B4, which was associated with the phosphorylation of PDE4B4 on Ser-56 within UCR1. The unique tissue distribution and intracellular targeting of PDE4B4 suggests that this isoform may have a distinct functional role in regulating cAMP levels in specific cell types. PMID:12441002

  19. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  20. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  1. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  2. Role of site-selective cAMP analogs in the control and reversal of malignancy.

    PubMed

    Cho-Chung, Y S; Clair, T; Tortora, G; Yokozaki, H

    1991-01-01

    Two isoforms of cAMP receptor protein, RI and RII, the regulatory subunits of cAMP-dependent protein kinase, transduce opposite signals, the RI being stimulatory and the RII being inhibitory of cell proliferation. In normal cells RI and RII exist at a specific physiological ratio whereas in cancer cells such physiological balance of these receptor proteins is disrupted. Reversal and suppression of malignancy can be achieved when the physiologic ratio of these intracellular signal transducers of cAMP is restored as shown by the use of site-selective cAMP analogs, antisense oligodeoxynucleotides or gene transfer, suggesting new approaches to cancer control. PMID:1653961

  3. Active site coupling in PDE:PKA complexes promotes resetting of mammalian cAMP signaling.

    PubMed

    Krishnamurthy, Srinath; Moorthy, Balakrishnan Shenbaga; Xin Xiang, Lim; Xin Shan, Lim; Bharatham, Kavitha; Tulsian, Nikhil Kumar; Mihalek, Ivana; Anand, Ganesh S

    2014-09-16

    Cyclic 3'5' adenosine monophosphate (cAMP)-dependent-protein kinase (PKA) signaling is a fundamental regulatory pathway for mediating cellular responses to hormonal stimuli. The pathway is activated by high-affinity association of cAMP with the regulatory subunit of PKA and signal termination is achieved upon cAMP dissociation from PKA. Although steps in the activation phase are well understood, little is known on how signal termination/resetting occurs. Due to the high affinity of cAMP to PKA (KD ∼ low nM), bound cAMP does not readily dissociate from PKA, thus begging the question of how tightly bound cAMP is released from PKA to reset its signaling state to respond to subsequent stimuli. It has been recently shown that phosphodiesterases (PDEs) can catalyze dissociation of bound cAMP and thereby play an active role in cAMP signal desensitization/termination. This is achieved through direct interactions with the regulatory subunit of PKA, thereby facilitating cAMP dissociation and hydrolysis. In this study, we have mapped direct interactions between a specific cyclic nucleotide phosphodiesterase (PDE8A) and a PKA regulatory subunit (RIα isoform) in mammalian cAMP signaling, by a combination of amide hydrogen/deuterium exchange mass spectrometry, peptide array, and computational docking. The interaction interface of the PDE8A:RIα complex, probed by peptide array and hydrogen/deuterium exchange mass spectrometry, brings together regions spanning the phosphodiesterase active site and cAMP-binding sites of RIα. Computational docking combined with amide hydrogen/deuterium exchange mass spectrometry provided a model for parallel dissociation of bound cAMP from the two tandem cAMP-binding domains of RIα. Active site coupling suggests a role for substrate channeling in the PDE-dependent dissociation and hydrolysis of cAMP bound to PKA. This is the first instance, to our knowledge, of PDEs directly interacting with a cAMP-receptor protein in a mammalian system, and

  4. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  5. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  6. A Universal Stress Protein (USP) in Mycobacteria Binds cAMP

    PubMed Central

    Banerjee, Arka; Adolph, Ramona S.; Gopalakrishnapai, Jayashree; Kleinboelting, Silke; Emmerich, Christiane; Steegborn, Clemens; Visweswariah, Sandhya S.

    2015-01-01

    Mycobacteria are endowed with rich and diverse machinery for the synthesis, utilization, and degradation of cAMP. The actions of cyclic nucleotides are generally mediated by binding of cAMP to conserved and well characterized cyclic nucleotide binding domains or structurally distinct cGMP-specific and -regulated cyclic nucleotide phosphodiesterase, adenylyl cyclase, and E. coli transcription factor FhlA (GAF) domain-containing proteins. Proteins with cyclic nucleotide binding and GAF domains can be identified in the genome of mycobacterial species, and some of them have been characterized. Here, we show that a significant fraction of intracellular cAMP is bound to protein in mycobacterial species, and by using affinity chromatography techniques, we identify specific universal stress proteins (USP) as abundantly expressed cAMP-binding proteins in slow growing as well as fast growing mycobacteria. We have characterized the biochemical and thermodynamic parameters for binding of cAMP, and we show that these USPs bind cAMP with a higher affinity than ATP, an established ligand for other USPs. We determined the structure of the USP MSMEG_3811 bound to cAMP, and we confirmed through structure-guided mutagenesis, the residues important for cAMP binding. This family of USPs is conserved in all mycobacteria, and we suggest that they serve as “sinks” for cAMP, making this second messenger available for downstream effectors as and when ATP levels are altered in the cell. PMID:25802331

  7. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  8. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  9. Terminal truncations in amp C beta-lactamase from a clinical isolate of Pseudomonas aeruginosa.

    PubMed

    Walther-Rasmussen, J; Johnsen, A H; Høiby, N

    1999-07-01

    AmpC beta-lactamases from strains of Pseudomonas aeruginosa have previously been shown to be heterogeneous with respect to their isoelectric point (pI). In order to elucidate the origin of this heterogeneity enzymes were isolated from a clinical isolate of a multiresistant P. aeruginosa strain and biochemically characterized. The purification was accomplished in four chromatographic steps comprising dye-affinity, size-exclusion, hydrophobic interaction chromatography, and chromatofocusing; this resulted in five forms with pI values of 9.1, 8.7, 8.3, 8.2, and 7.6. When analysed by SDS/PAGE and agarose IEF each separated beta-lactamase appeared to be both size- and charge-homogeneous. The specific activities of the variants were very similar. MS of each isolated beta-lactamase form showed minor differences in molecular mass (range 40.0-40.8 kDa). MS of the beta-lactamase with a pI of 8.2 demonstrated the presence of two subforms. The N-terminal sequences of three of the beta-lactamases were identical to the published sequence [Lodge, J.M. , Minchin, S.D., Piddock, L.J.V. & Busby, J.W. (1990) Biochem. J. 272, 627-631], while two variants were truncated by two amino-acid residues, one of which was acidic. The previously published sequence contains an alanine as the ultimate residue, but two of the beta-lactamases showed a substitution of Ala371 for arginine, whereas in the remaining forms C-terminal truncations by one and three residues were found. Our results indicate that the P. aeruginosa strain does not harbour multiple copies of the ampC gene, but rather that the five beta-lactamase isoforms are products of a single structural gene. The combinations of the identified N- and/or C-terminal truncations explained the multiple pI values of the beta-lactamase isoforms. PMID:10406957

  10. Apical ammonium inhibition of cAMP-stimulated secretion in T84 cells is bicarbonate dependent.

    PubMed

    Worrell, Roger T; Best, Alison; Crawford, Oscar R; Xu, Jie; Soleimani, Manoocher; Matthews, Jeffrey B

    2005-10-01

    Normal human colonic luminal (NH(4)(+)) concentration ([NH(4)(+)]) ranges from approximately 10 to 100 mM. However, the nature of the effects of NH(4)(+) on transport, as well as NH(4)(+) transport itself, in colonic epithelium is poorly understood. We elucidate here the effects of apical NH(4)(+) on cAMP-stimulated Cl(-) secretion in colonic T84 cells. In HEPES-buffered solutions, 10 mM apical NH(4)(+) had no significant effect on cAMP-stimulated current. In contrast, 10 mM apical NH(4)(+) reduced current within 5 min to 61 +/- 4% in the presence of 25 mM HCO(3)(-). Current inhibition was not simply due to an increase in extracellular K(+)-like cations, in that the current magnitude was 95 +/- 5% with 10 mM apical K(+) and 46 +/- 3% with 10 mM apical NH(4)(+) relative to that with 5 mM apical K(+). We previously demonstrated that inhibition of Cl(-) secretion by basolateral NH(4)(+) occurs in HCO(3)(-)-free conditions and exhibits anomalous mole fraction behavior. In contrast, apical NH(4)(+) inhibition of current in HCO(3)(-) buffer did not show anomalous mole fraction behavior and followed the absolute [NH(4)(+)] in K(+)-NH(4)(+) mixtures, where K(+) concentration + [NH(4)(+)] = 10 mM. The apical NH(4)(+) inhibitory effect was not prevented by 100 microM methazolamide, suggesting no role for apical carbonic anhydrase. However, apical NH(4)(+) inhibition of current was prevented by 10 min of pretreatment of the apical surface with 500 microM DIDS, 100 microM 4,4'-dinitrostilbene-2,2'-disulfonic acid (DNDS), or 25 microM niflumic acid, suggesting a role for NH(4)(+) action through an apical anion exchanger. mRNA and protein for the apical anion exchangers SLC26A3 [downregulated in adenoma (DRA)] and SLC26A6 [putative anion transporter (PAT1)] were detected in T84 cells by RT-PCR and Northern and Western blots. DRA and PAT1 appear to associate with CFTR in the apical membrane. We conclude that the HCO(3)(-) dependence of apical NH(4)(+) inhibition of secretion is

  11. Opposing needling promotes behavior recovery and exerts neuroprotection via the cAMP/PKA/CREB signal transduction pathway in transient MCAO rats

    PubMed Central

    JIANG, YIJING; YANG, SHANLI; TAO, JING; LIN, ZHICHENG; YE, XIAOQIAN; YOU, YONGMEI; PENG, JUN; HONG, ZHENFENG; CHEN, LIDIAN

    2016-01-01

    The aim of the present study was to investigate whether the cyclic adenosine 3′,5′-monophosphate (cAMP)/protein kinase A(PKA)/cAMP-responsive element binding protein (CREB) signal transduction pathway triggered by γ-aminobutyric acid class B (GABAB) receptor activation is involved in neuroprotection against ischemia and behavioral recovery induced by opposing needling (ON). A total of 80 rats were randomly divided into four groups: A sham operation group, an ischemia group, an ON group and an ON group effectively inhibited by the GABAB receptor antagonist, CGP35384 (n=20/group). The behavior of the rats was assessed by their neurological deficit score, whereas the impairment of gait was examined using the CatWalk system. The volume of cerebral infarction was examined upon treatment with 2,3,5-triphenyltetrazolium chloride. The expression levels of CREB, GABAB1 and GABAB2 were examined by western blotting and reverse transcription-quantitative polymerase chain reaction, and the activity of adenylyl cyclase (AC), cAMP and PKA in the serum was detected using an enzyme-linked immunosorbent assay. In the present study, in comparison with other groups, the ON group exhibited a reduced score for the neurological deficit, the stride length and swing speed were improved, and the volume of infarction was reduced. However, these effects were reversed upon administration of CGP35384. Additionally, the expression levels of CREB, GABAB1 and GABAB2 were increased in the ON group. The levels of AC, cAMP and PKA in the serum were also increased in the ON group, whereas the addition of CGP35384 reversed these effects. The results of the present study demonstrated that ON markedly protected the brain against transient cerebral ischemic injury, and this effect was possibly mediated by the activation of the GABAB/cAMP/PKA/CREB signal transduction pathway. These findings implied that ON may be a potential therapeutic method for treating stroke. PMID:26780954

  12. Prostaglandin D2 is a novel repressor of IFNγ induced indoleamine-2,3-dioxygenase via the DP1 receptor and cAMP pathway.

    PubMed

    Bassal, Nesrine Kamal; Hughes, Bernard P; Costabile, Maurizio

    2016-07-01

    Expression of elevated levels of Indoleamine 2,3-dioxygenase (IDO) is well established as a mechanism of cancer induced immunosuppression. Pharmacological inhibition of IDO activity is thus a promising alternative in the treatment of cancer. Previously we demonstrated that cyclooxygenase derived metabolites of arachidonic acid inhibited the interferon-gamma mediated induction of IDO in both THP-1 cells and human monocytes. Here we identified that of the five primary prostanoids produced by COX-1/COX-2, only PGD2 displayed significant repressor activity. PGD2 inhibited IDO activity with an IC50 of 7.2µM in THP-1 cells and 5.2µM in monocytes. PGD2 caused a significant decrease in both IDO mRNA and protein. Using receptor specific agonists, PGD2 was found to act via the DP1 receptor, while the CRTH2 receptor was not involved. A DP1 antagonist significantly reduced the activity of PGD2, while CRTH2 agonists were ineffective. PGD2 increased intracellular cAMP levels and exogenous N(6)-cAMP was also found to be highly inhibitory. The effects of PGD2 via cAMP were blocked by Rp-cAMP indicating involvement of PKA. PGD2 also stimulated CREB phosphorylation, a PKA dependent transcription factor. This is the first report demonstrating that PGD2, a prostanoid typically associated with allergy, can inhibit IDO activity via the DP1/cAMP/PKA/CREB pathway. Our findings suggest that PGD2 and its derivatives may form the basis of novel repressors of IFNγ-mediated IDO expression. PMID:26995677

  13. Outbreak of meropenem-resistant Serratia marcescens comediated by chromosomal AmpC beta-lactamase overproduction and outer membrane protein loss.

    PubMed

    Suh, Borum; Bae, Il Kwon; Kim, Juwon; Jeong, Seok Hoon; Yong, Dongeun; Lee, Kyungwon

    2010-12-01

    The aim of this study was to investigate the mechanisms involved in the meropenem resistance of Serratia marcescens clinical isolates. Meropenem-resistant (MIC range, 16 to 32 μg/ml) S. marcescens isolates were recovered from nine patients in a tertiary hospital in Seoul, South Korea, from June to November 2005. All the isolates shared identical or similar (>85% similarity) SpeI macrorestriction patterns, indicating clonal spread. PCR experiments did not detect any carbapenemase in those isolates. They carried the bla(CTX-M-22) gene located on a 150-kbp plasmid of the incompatibility group L/M; however, the addition of clavulanic acid exhibited few effects on meropenem MICs. Although meropenem MICs were reduced 4- to 16-fold with the addition of boronic acid, no plasmid-borne AmpC β-lactamase gene was detected in PCR experiments. Real-time quantitative PCR experiments showed that expression levels of the chromosomal ampC gene in those isolates were 87.06 to 155.76 times higher than that of the reference strain ATCC 8100. SDS-PAGE showed a lack of the 42-kDa outer membrane protein (OmpF). In combination with the overproduction of the chromosomal AmpC enzyme, the loss of OmpF may have played a role in the acquisition of meropenem resistance in our isolates. PMID:20876374

  14. Structure-function analysis of yeast hexokinase: structural requirements for triggering cAMP signalling and catabolite repression.

    PubMed Central

    Kraakman, L S; Winderickx, J; Thevelein, J M; De Winde, J H

    1999-01-01

    In baker's yeast (Saccharomyces cerevisiae) the hexokinases PI (Hxk1) and PII (Hxk2) are required for triggering of the activation of the Ras-cAMP pathway and catabolite repression. Specifically, Hxk2 is essential for the establishment of glucose repression, whereas either Hxk1 or Hxk2 can sustain fructose repression. Previous studies have suggested that the extent of glucose repression is inversely correlated with hexokinase catalytic activity and hence with an adequate elevation of intracellular sugar phosphate levels. However, several lines of evidence indicate that glucose 6-phosphate is not the trigger of catabolite repression in yeast. In the present study we employed site-directed mutagenesis of amino acids important for the binding of sugar and ATP, for efficient phosphoryl transfer and for the closure of the substrate-binding cleft, to obtain an insight into the structural requirements of Hxk2 for sugar-induced signalling. We show that the ATP-binding Lys-111 is not essential for catalysis in vivo or for signal triggering. Substitution of the catalytic-centre Asp-211 caused loss of catalytic activity, but high-affinity sugar binding was retained. However, this was not sufficient to cause cAMP activation nor catabolite repression. Mutation of Ser-158 abrogated glucose-induced, but not fructose-induced, repression. Moreover, 2-deoxyglucose sustained repression despite an extremely low catalytic activity. We conclude that the establishment of catabolite repression is dependent on the onset of the phosphoryl transfer reaction on hexokinase and is probably related to the stable formation of a transition intermediate and concomitant conformational changes within the enzyme. In contrast, the role of Hxk2 in Ras-cAMP activation seems to be directly connected to its catalytic function. The implications of this model are discussed. PMID:10493925

  15. Cell-type-specific responses of RT4 neural cell lines to dibutyryl-cAMP: branch determination versus maturation

    SciTech Connect

    Droms, K.; Sueoka, N.

    1987-03-01

    This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP.

  16. Presence of antimicrobial resistance in coliform bacteria from hatching broiler eggs with emphasis on ESBL/AmpC-producing bacteria.

    PubMed

    Mezhoud, H; Chantziaras, I; Iguer-Ouada, M; Moula, N; Garmyn, A; Martel, A; Touati, A; Smet, A; Haesebrouck, F; Boyen, F

    2016-08-01

    Antimicrobial resistance is recognized as one of the most important global health challenges. Broilers are an important reservoir of antimicrobial resistant bacteria in general and, more particularly, extended-spectrum β-lactamases (ESBL)/AmpC-producing Enterobacteriaceae. Since contamination of 1-day-old chicks is a potential risk factor for the introduction of antimicrobial resistant Enterobacteriaceae in the broiler production chain, the presence of antimicrobial resistant coliform bacteria in broiler hatching eggs was explored in the present study. Samples from 186 hatching eggs, collected from 11 broiler breeder farms, were inoculated on MacConkey agar with or without ceftiofur and investigated for the presence of antimicrobial resistant lactose-positive Enterobacteriaceae, particularly, ESBL/AmpC-producers. Escherichia coli and Enterobacter cloacae were obtained from the eggshells in 10 out of 11 (10/11) sampled farms. The majority of the isolates were recovered from crushed eggshells after external decontamination suggesting that these bacteria are concealed from the disinfectants in the egg shell pores. Antimicrobial resistance testing revealed that approximately 30% of the isolates showed resistance to ampicillin, tetracycline, trimethoprim and sulphonamides, while the majority of isolates were susceptible to amoxicillin-clavulanic acid, nitrofurantoin, aminoglycosides, florfenicol, neomycin and apramycin. Resistance to extended-spectrum cephalosporins was detected in eight Enterobacteriaceae isolates from five different broiler breeder farms. The ESBL phenotype was confirmed by the double disk synergy test and blaSHV-12, blaTEM-52 and blaACT-39 resistance genes were detected by PCR. This report is the first to present broiler hatching eggs as carriers and a potential source of ESBL/AmpC-producing Enterobacteriaceae for broiler chicks. PMID:27011291

  17. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  18. Role of Membrane Microdomains in Compartmentation of cAMP Signaling

    PubMed Central

    Agarwal, Shailesh R.; Yang, Pei-Chi; Rice, Monica; Singer, Cherie A.; Nikolaev, Viacheslav O.; Lohse, Martin J.; Clancy, Colleen E.; Harvey, Robert D.

    2014-01-01

    Spatially restricting cAMP production to discrete subcellular locations permits selective regulation of specific functional responses. But exactly where and how cAMP signaling is confined is not fully understood. Different receptors and adenylyl cyclase isoforms responsible for cAMP production are not uniformly distributed between lipid raft and non-lipid raft domains of the plasma membrane. We sought to determine the role that these membrane domains play in organizing cAMP responses in HEK293 cells. The freely diffusible FRET-based biosensor Epac2-camps was used to measure global cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. Disruption of lipid rafts by cholesterol depletion selectively altered cAMP responses produced by raft-associated receptors. The results indicate that receptors associated with lipid raft as well as non-lipid raft domains can contribute to global cAMP responses. In addition, basal cAMP activity was found to be significantly higher in non-raft domains. This was supported by the fact that pharmacologic inhibition of adenylyl cyclase activity reduced basal cAMP activity detected by Epac2-CAAX but not Epac2-MyrPalm or Epac2-camps. Responses detected by Epac2-CAAX were also more sensitive to direct stimulation of adenylyl cyclase activity, but less sensitive to inhibition of phosphodiesterase activity. Quantitative modeling was used to demonstrate that differences in adenylyl cyclase and phosphodiesterase activities are necessary but not sufficient to explain compartmentation of cAMP associated with different microdomains of the plasma membrane. PMID:24752595

  19. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  20. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  1. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 1: AMPS payload to shuttle ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Physical, functional, and operational interfaces between the space shuttle orbiter and the AMPS payload are described for the ground handling and test phases, prelaunch, launch and ascent, operational, stowage, and reentry and landing activities.

  2. Chlorogenic acid from honeysuckle improves hepatic lipid dysregulation and modulates hepatic fatty acid composition in rats with chronic endotoxin infusion

    PubMed Central

    Zhou, Yan; Ruan, Zheng; Wen, Yanmei; Yang, Yuhui; Mi, Shumei; Zhou, Lili; Wu, Xin; Ding, Sheng; Deng, Zeyuan; Wu, Guoyao; Yin, Yulong

    2016-01-01

    Chlorogenic acid as a natural hydroxycinnamic acid has protective effect for liver. Endotoxin induced metabolic disorder, such as lipid dysregulation and hyperlipidemia. In this study, we investigated the effect of chlorogenic acid in rats with chronic endotoxin infusion. The Sprague-Dawley rats with lipid metabolic disorder (LD group) were intraperitoneally injected endotoxin. And the rats of chlorogenic acid-LD group were daily received chlorogenic acid by intragastric administration. In chlorogenic acid-LD group, the area of visceral adipocyte was decreased and liver injury was ameliorated, as compared to LD group. In chlorogenic acid-LD group, serum triglycerides, free fatty acids, hepatic triglycerides and cholesterol were decreased, the proportion of C20:1, C24:1 and C18:3n-6, Δ9-18 and Δ6-desaturase activity index in the liver were decreased, and the proportion of C18:3n-3 acid was increased, compared to the LD group. Moreover, levels of phosphorylated AMP-activated protein kinase, carnitine palmitoyltransferase-I, and fatty acid β-oxidation were increased in chlorogenic acid-LD group compared to LD rats, whereas levels of fatty acid synthase and acetyl-CoA carboxylase were decreased. These findings demonstrate that chlorogenic acid effectively improves hepatic lipid dysregulation in rats by regulating fatty acid metabolism enzymes, stimulating AMP-activated protein kinase activation, and modulating levels of hepatic fatty acids. PMID:27013782

  3. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  4. Binding of Cyclic Di-AMP to the Staphylococcus aureus Sensor Kinase KdpD Occurs via the Universal Stress Protein Domain and Downregulates the Expression of the Kdp Potassium Transporter

    PubMed Central

    Moscoso, Joana A.; Schramke, Hannah; Tosi, Tommaso; Dehbi, Amina; Jung, Kirsten

    2015-01-01

    ABSTRACT Nucleotide signaling molecules are important intracellular messengers that regulate a wide range of biological functions. The human pathogen Staphylococcus aureus produces the signaling nucleotide cyclic di-AMP (c-di-AMP). This molecule is common among Gram-positive bacteria and in many organisms is essential for survival under standard laboratory growth conditions. In this study, we investigated the interaction of c-di-AMP with the S. aureus KdpD protein. The sensor kinase KdpD forms a two-component signaling system with the response regulator KdpE and regulates the expression of the kdpDE genes and the kdpFABC operon coding for the Kdp potassium transporter components. Here we show that the S. aureus KdpD protein binds c-di-AMP specifically and with an affinity in the micromolar range through its universal stress protein (USP) domain. This domain is located within the N-terminal cytoplasmic region of KdpD, and amino acids of a conserved SXS-X20-FTAXY motif are important for this binding. We further show that KdpD2, a second KdpD protein found in some S. aureus strains, also binds c-di-AMP, and our bioinformatics analysis indicates that a subclass of KdpD proteins in c-di-AMP-producing bacteria has evolved to bind this signaling nucleotide. Finally, we show that c-di-AMP binding to KdpD inhibits the upregulation of the kdpFABC operon under salt stress, thus indicating that c-di-AMP is a negative regulator of potassium uptake in S. aureus. IMPORTANCE Staphylococcus aureus is an important human pathogen and a major cause of food poisoning in Western countries. A common method for food preservation is the use of salt to drive dehydration. This study sheds light on the regulation of potassium uptake in Staphylococcus aureus, an important aspect of this bacterium's ability to tolerate high levels of salt. We show that the signaling nucleotide c-di-AMP binds to a regulatory component of the Kdp potassium uptake system and that this binding has an inhibitory

  5. Nicotinamide ameliorates palmitate-induced ER stress in hepatocytes via cAMP/PKA/CREB pathway-dependent Sirt1 upregulation.

    PubMed

    Li, Jiaxin; Dou, Xiaobing; Li, Songtao; Zhang, Ximei; Zeng, Yong; Song, Zhenyuan

    2015-11-01

    Nicotinamide (NAM) is the amide of nicotinic acid and a predominant precursor for NAD(+) biosynthesis via the salvage pathway. Sirt1 is a NAD(+)-dependent deacetylase, playing an important role in regulating cellular functions. Although hepatoprotective effect of NAM has been reported, the underlying mechanism remains elusive. ER stress, induced by saturated fatty acids, in specific palmitate, plays a pathological role in the development of nonalcoholic fatty liver disease. This study aims to determine the effect of NAM on palmitate-induced ER stress in hepatocytes and to elucidate molecular mechanisms behind. Both HepG2 cells and primary mouse hepatocytes were exposed to palmitate (conjugated to BSA at a 2:1 M ratio), NAM, or their combination for different durations. Cellular NAD(+) level, Sirt1 expression/activity, ER stress, as well as cAMP/PKA/CREB pathway activation were determined. NAM increased Sirt1 expression and enzymatic activity, which contributes to the ameliorative effect of NAM on palmitate-triggered ER stress. NAM increased intracellular NAD(+) level in hepatocytes, however, blocking the salvage pathway, a pathway for NAD(+) synthesis from NAM, only partially prevented NAM-induced Sirt1 upregulation while completely prevented NAD+ increase in response to NAM. Further mechanistic investigations revealed that NAM elevated intracellular cAMP level via suppressing PDE activity, leading to downstream PKA and CREB activation. Importantly, cAMP/PKA/CREB pathway blockade abolished not only NAM-induced Sirt1 upregulation, but also its protective effect against ER stress. Our results demonstrate that NAM protects hepatocytes against palmitate-induced ER stress in hepatocytes via upregulating Sirt1. Activation of the cAMP/PKA/CREB pathway plays a key role in NAM-induced Sirt1 upregulation. PMID:26352206

  6. The possible role of cyclic AMP in the neurotrophic control of skeletal muscle.

    PubMed Central

    Carlsen, R C

    1975-01-01

    1. Motoneurones provide trophic control of some of the functional characteristics of skeletal muscle fibres. This study has been designed to test whether the adenylate cyclase: cyclic AMP system may offer one potential mechanism for the mediation of neurotrophic regulation. 2. The concentration of cyclic AMP was measured at various intervals after muscle denervation. Muscle cyclic AMP concentration increases for the first 2 days after nerve section. It reaches a maximum value at 48 h and subsequently returns to the control value at 7 days. 3. Cyclic AMP concentration is unchanged by muscle disuse for the first 3 days following limb immobilization. Four days after immobilization, however, cyclic AMP increases in both the disused and contralateral control muscles. This phenomenon has been tentatively ascribed to some aspect of the inflammatory response. 4. Changing the level of nerve section, and therefore the length of the residual nerve stump, changes the temporal pattern of the increase in muscle cyclic AMP concentration. 5. Reinnervation of a denervated muscle produces a decrease in muscle cyclic AMP concentration. 6. It is concluded from the results that some aspect of nerve function provides trophic regulation of the muscle adenylate cyclase: cyclic AMP system. The mechanisms by which this regulation may be applied are considered in the Discussion. PMID:168354

  7. A Model Based on Receptor Desensitization for Cyclic AMP Signaling in Dictyostelium Cells

    PubMed Central

    Martiel, Jean-Louis; Goldbeter, Albert

    1987-01-01

    We analyze a model based on receptor modification for the cAMP signaling system that controls aggregation of the slime mold Dictyostelium discoideum after starvation. The model takes into account both the desensitization of the cAMP receptor by reversible phosphorylation and the activation of adenylate cyclase that follows binding of extracellular cAMP to the unmodified receptor. The dynamics of the signaling system is studied in terms of three variables, namely, intracellular and extracellular cAMP, and the fraction of receptor in active state. Using parameter values collected from experimental studies on cAMP signaling and receptor phosphorylation, we show that the model accounts qualitatively and, in a large measure, quantitatively for the various modes of dynamic behavior observed in the experiments: (a) autonomous oscillations of cAMP, (b) relay of suprathreshold cAMP pulses, i.e., excitability, characterized by both an absolute and a relative refractory period, and (c) adaptation to constant cAMP stimuli. A two-variable version of the model is used to demonstrate the link between excitability and oscillations by phase plane analysis. The response of the model to repetitive stimulation allows comprehension, in terms of receptor desensitization, of the role of periodic signaling in Dictyostelium and, more generally, the function of pulsatile patterns of hormone secretion. PMID:19431710

  8. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  9. cAMP biosensors applied in molecular pharmacological studies of G protein-coupled receptors.

    PubMed

    Mathiesen, Jesper Mosolff; Vedel, Line; Bräuner-Osborne, Hans

    2013-01-01

    Cyclic adenosine monophosphate (cAMP) is a common second messenger that mediates numerous biological responses. Intracellular cAMP levels are increased by activation of G(s)-coupled G protein-coupled receptors (GPCRs) and decreased by activation of G(i)-coupled GPCRs via the adenylyl cyclase. Many end-point assays for quantifying GPCR-mediated changes in intracellular cAMP levels exist. More recently, fluorescence resonance energy transfer (FRET)-based cAMP biosensors that can quantify intracellular cAMP levels in real time have been developed. These FRET-based cAMP biosensors have been used primarily in single cell FRET microscopy to monitor and visualize changes in cAMP upon GPCR activation. Here, a similar cAMP biosensor with a more efficient mCerulean/mCitrine FRET pair is described for use in the 384-well plate format. After cloning and expression in HEK293 cells, the biosensor is characterized in the 384-well plate format and used for measuring the signaling of the G(s)-coupled β(2)-adrenergic receptor. The procedures described may be applied for other FRET-based biosensors in terms of characterization and conversion to the 384-well plate format. PMID:23374187

  10. 78 FR 1264 - CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Employment and Training Administration CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative... workers of the subject firm (TA-W-80,399A; CalAmp Wireless Networks Corporation, Waseca, Minnesota... Wireless Networks Corporation, Waseca, Minnesota to apply for TAA, the Department determines that...

  11. Prostaglandin E2 inhibits apoptosis in human neutrophilic polymorphonuclear leukocytes: role of intracellular cyclic AMP levels.

    PubMed

    Ottonello, L; Gonella, R; Dapino, P; Sacchetti, C; Dallegri, F

    1998-08-01

    Human neutrophilic polymorphonuclear leukocytes (neutrophils) are terminally differentiated cells that die by undergoing apoptosis. At present, the intracellular pathways governing this process are only partially known. In particular, although the adenylate cyclase-dependent generation of cyclic AMP (cAMP) has been implicated in the triggering of apoptosis in lymphoid cells, the role of the intracellular cAMP pathway in neutrophil apoptosis remains controversial. In the present study, we found that two cAMP-elevating agents, prostaglandin E2 (PGE2) and the phosphodiesterase type IV inhibitor RO 20-1724, inhibit neutrophil apoptosis without inducing cell necrosis. When administered in combination, PGE2 and RO 20-1724 displayed additive effects. Moreover, neutrophil apoptosis was inhibited by a membrane-permeable analog of cAMP, dibutyryl-cAMP, in a dose-dependent manner. Finally, treatment of neutrophils with the protein kinase A inhibitor H-89 prevented PGE2- and RO 20-1724-induced inhibition of cell apoptosis. In conclusion, taking into account that PGE2 and other cAMP-elevating agents are well known downregulators of neutrophil functions, our results suggest that conditions favoring a state of functional rest, such as intracellular cAMP elevation, prolong the life span of neutrophils by delaying apoptosis. PMID:9694511

  12. Comparative biology of cAMP-induced germinal vesicle breakdown in marine invertebrate oocytes.

    PubMed

    Deguchi, Ryusaku; Takeda, Noriyo; Stricker, Stephen A

    2011-01-01

    During maturation, oocytes must undergo a process of nuclear disassembly, or "germinal vesicle breakdown" (GVBD), that is regulated by signaling pathways involving cyclic AMP (cAMP). In vertebrate and starfish oocytes, cAMP elevation typically prevents GVBD. Alternatively, increased concentrations of intra-oocytic cAMP trigger, rather than inhibit, GVBD in several groups of marine invertebrates. To integrate what is known about the stimulation of GVBD by intra-oocytic cAMP, this article reviews published data for ascidian, bivalve, brittle star, jellyfish, and nemertean oocytes. The bulk of the review concentrates on the three most intensively analyzed groups known to display cAMP-induced GVBD-nemerteans, ascidians, and jellyfish. In addition, this synopsis also presents some previously unpublished findings regarding the stimulatory effects of intra-oocytic cAMP on GVBD in jellyfish and the annelid worm Pseudopotamilla occelata. Finally, factors that may account for the currently known distribution of cAMP-induced GVBD across animal groups are discussed. PMID:21774023

  13. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration

    PubMed Central

    Siddiq, Mustafa M.; Hannila, Sari S.

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  14. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  15. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  16. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration.

    PubMed

    Siddiq, Mustafa M; Hannila, Sari S

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  17. Subcelluar compartmentalization of cAMP-dependent protein kinase regulatory subunits during palate ontogeny

    SciTech Connect

    Linask, K.K.; Greene, R.M. )

    1989-01-01

    Mammalian palatal ontogeny involves epithelial-mesenchymal interactions, cell differentiation, and cell movement. These events occur on days 12, 13, and 14 of gestation in the C57BL/6J mouse embryo. During this period intracellular cAMP levels and cAMP-dependent protein kinase (cAMP-dPK) levels in the palate transiently elevate. Cyclic AMP activates cAMP-dPK by binding primarily to two types of regulatory subunits of this enzyme, designated as R{sub I} and R{sub II}. To assess whether differential compartmentalization of the regulatory subunits occurs during palatal ontogeny, cytosolic, nuclear, and particulate fractions were prepared from day 12, 13, and 14 embryonic maxillary and palatal tissue. After photo-affinity labeling of each fraction with 8-azido ({sup 32}P) cAMP, SDS-PAGE, and autoradiography, autoradiograms were analyzed densitometrically. The R{sub I} isoform predominated in the nuclear and particulate fractions on all three developmental days; whereas R{sub II} predominated in the cytosolic fractions. Thus, differential compartmentalization of cAMP-dPK may be a means by which cAMP dependent responses are regulated during palatogenesis.

  18. Global and local missions of cAMP signaling in neural plasticity, learning, and memory

    PubMed Central

    Lee, Daewoo

    2015-01-01

    The fruit fly Drosophila melanogaster has been a popular model to study cAMP signaling and resultant behaviors due to its powerful genetic approaches. All molecular components (AC, PDE, PKA, CREB, etc) essential for cAMP signaling have been identified in the fly. Among them, adenylyl cyclase (AC) gene rutabaga and phosphodiesterase (PDE) gene dunce have been intensively studied to understand the role of cAMP signaling. Interestingly, these two mutant genes were originally identified on the basis of associative learning deficits. This commentary summarizes findings on the role of cAMP in Drosophila neuronal excitability, synaptic plasticity and memory. It mainly focuses on two distinct mechanisms (global versus local) regulating excitatory and inhibitory synaptic plasticity related to cAMP homeostasis. This dual regulatory role of cAMP is to increase the strength of excitatory neural circuits on one hand, but to act locally on postsynaptic GABA receptors to decrease inhibitory synaptic plasticity on the other. Thus the action of cAMP could result in a global increase in the neural circuit excitability and memory. Implications of this cAMP signaling related to drug discovery for neural diseases are also described. PMID:26300775

  19. Expression of AMP-activated protein kinase subunits during chicken embryonic and post-hatch development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is a highly conserved serine/threonine protein kinase that senses cellular energy status (AMP/ATP ratio) and acts to maintain energy homeostasis by regulating the activities of energy-consuming and energy-generating metabolic pathways. AMPK is a heterotrimeric en...

  20. Reciprocal regulation of insulin and plasma 5'-AMP in glucose homeostasis in mice.

    PubMed

    Xia, Lin; Wang, Zhongqiu; Zhang, Ying; Yang, Xiao; Zhan, Yibei; Cheng, Rui; Wang, Shiming; Zhang, Jianfa

    2015-03-01

    A previous investigation has demonstrated that plasma 5'-AMP (pAMP) exacerbates and causes hyperglycemia in diabetic mice. However, the crosstalk between pAMP and insulin signaling to regulate glucose homeostasis has not been investigated in depth. In this study, we showed that the blood glucose level was more dependent on the ratio of insulin to pAMP than on the absolute level of these two factors. Administration of 5'-AMP significantly attenuated the insulin-stimulated insulin receptor (IR) autophosphorylation in the liver and muscle tissues, resulting in the inhibition of downstream AKT phosphorylation. A docking analysis indicated that adenosine was a potential inhibitor of IR tyrosine kinase. Moreover, the 5'-AMP treatment elevated the ATP level in the pancreas and in the isolated islets, stimulating insulin secretion and increasing the plasma level of insulin. The insulin administration decreased the 5'-AMP-induced hyper-adenosine level by the up-regulation of adenosine kinase activities. Our results indicate that blood glucose homeostasis is reciprocally regulated by pAMP and insulin. PMID:25512345

  1. In Vitro and In Vivo Activities of Antimicrobial Peptides Developed Using an Amino Acid-Based Activity Prediction Method

    PubMed Central

    Wu, Xiaozhe; Wang, Zhenling; Li, Xiaolu; Fan, Yingzi; He, Gu; Wan, Yang; Yu, Chaoheng; Tang, Jianying; Li, Meng; Zhang, Xian; Zhang, Hailong; Xiang, Rong; Pan, Ying; Liu, Yan; Lu, Lian

    2014-01-01

    To design and discover new antimicrobial peptides (AMPs) with high levels of antimicrobial activity, a number of machine-learning methods and prediction methods have been developed. Here, we present a new prediction method that can identify novel AMPs that are highly similar in sequence to known peptides but offer improved antimicrobial activity along with lower host cytotoxicity. Using previously generated AMP amino acid substitution data, we developed an amino acid activity contribution matrix that contained an activity contribution value for each amino acid in each position of the model peptide. A series of AMPs were designed with this method. After evaluating the antimicrobial activities of these novel AMPs against both Gram-positive and Gram-negative bacterial strains, DP7 was chosen for further analysis. Compared to the parent peptide HH2, this novel AMP showed broad-spectrum, improved antimicrobial activity, and in a cytotoxicity assay it showed lower toxicity against human cells. The in vivo antimicrobial activity of DP7 was tested in a Staphylococcus aureus infection murine model. When inoculated and treated via intraperitoneal injection, DP7 reduced the bacterial load in the peritoneal lavage solution. Electron microscope imaging and the results indicated disruption of the S. aureus outer membrane by DP7. Our new prediction method can therefore be employed to identify AMPs possessing minor amino acid differences with improved antimicrobial activities, potentially increasing the therapeutic agents available to combat multidrug-resistant infections. PMID:24982064

  2. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  3. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  4. Hydrosmotic effect of angiotensin II in the toad skin: role of cyclic AMP.

    PubMed

    Coviello, A; Brauckmann, E S; de Atenor, M S; Apud, J A; Causarano, J

    1975-01-01

    The mechanism of action of the hydrosmotic response of the isolated skin of the toad Bufo arenarum Hensel to angiotensin II was studied by means of an indirect pharmacological approach. Angiotensin II (2.10(-10) M), vasopressin (2.10(-13) M) and theophylline (10(-4) and 10(-3) M) in subliminal doses produced a significant increase on water permeability when added in different paired combinations. Angiotensin II (2.10(-7) M) and vasopressin (2.10(-8) M) in doses producing significant effects on water permeability increased the response to submaximal doses of epinephrine (10(-6) M) but not to higher doses (10(-5) M). Acid pH (6.4) and prostaglandin E1 (2.10(-7) M) reduced significantly the hydrosmotic response to angiotensin II, but in contrast with the toad bladder, the effect was not completely abolished. Present results support the view that the hydrosmotic effect of angiotensin II in toad skin is mediated by the adenylate cyclase - cyclic AMP system. PMID:189568

  5. Regulation of ciliary motility by membrane potential in Paramecium: a role for cyclic AMP.

    PubMed

    Bonini, N M; Gustin, M C; Nelson, D L

    1986-01-01

    The membrane potential of Paramecium controls the frequency and direction of the ciliary beat, thus determining the cell's swimming behavior. Stimuli that hyperpolarize the membrane potential increase the ciliary beat frequency and therefore increase forward swimming speed. We have observed that 1) drugs that elevate intracellular cyclic AMP increased swimming speed 2-3-fold, 2) hyperpolarizing the membrane potential by manipulation of extracellular cations (e.g., K+) induced both a transient increase in, and a higher sustained level of cyclic AMP compared to the control, and 3) the swimming speed of detergent-permeabilized cells in MgATP was stimulated 2-fold by the addition of cyclic AMP. Our results suggest that the membrane potential can regulate intracellular cAMP in Paramecium and that control of swimming speed by membrane potential may in part be mediated by cAMP. PMID:2427226

  6. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  7. cAMP stimulates the ubiquitin/proteasome pathway in rat spinal cord neurons.

    PubMed

    Myeku, Natura; Wang, Hu; Figueiredo-Pereira, Maria E

    2012-10-11

    Proteasome impairment and accumulation of ubiquitinated proteins are implicated in neurodegeneration associated with different forms of spinal cord injury. We show herein that elevating cAMP in rat spinal cord neurons increases 26S proteasome activity in a protein kinase A-dependent manner. Treating spinal cord neurons with dibutyryl-cAMP (db-cAMP) also raised the levels of various components of the UPP including proteasome subunits Rpt6 and β5, polyubiquitin shuttling factor p62/sequestosome1, E3 ligase CHIP, AAA-ATPase p97 and the ubiquitin gene ubB. Finally, db-cAMP reduced the accumulation of ubiquitinated proteins, proteasome inhibition, and neurotoxicity triggered by the endogenous product of inflammation prostaglandin J2. We propose that optimizing the effects of cAMP/PKA-signaling on the UPP could offer an effective therapeutic approach to prevent UPP-related proteotoxicity in spinal cord neurons. PMID:22982149

  8. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.

    2009-01-01

    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  9. Cell-to-cell coordination for the spontaneous cAMP oscillation in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Nagano, Seido; Sakurai, Shunsuke

    2013-12-01

    We propose a new cellular dynamics scheme for the spontaneous cAMP oscillations in Dictyostelium discoideum. Our scheme seamlessly integrates both receptor dynamics and G-protein dynamics into our previously developed cellular dynamics scheme. Extensive computer simulation studies based on our new cellular dynamics scheme were conducted in mutant cells to evaluate the molecular network. The validity of our proposed molecular network as well as the controversial PKA-dependent negative feedback mechanism was supported by our simulation studies. Spontaneous cAMP oscillations were not observed in a single mutant cell. However, multicellular states of various mutant cells consistently initiated spontaneous cAMP oscillations. Therefore, cell-to-cell coordination via the cAMP receptor is essential for the robust initiation of spontaneous cAMP oscillations.

  10. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  11. Analysis of the Escherichia coli gene encoding L-asparaginase II, ansB, and its regulation by cyclic AMP receptor and FNR proteins.

    PubMed

    Jennings, M P; Beacham, I R

    1990-03-01

    Escherichia coli contains two L-asparaginase isozymes: L-asparaginase I, a low-affinity enzyme located in the cytoplasm, and L-asparaginase II, a high-affinity secreted enzyme. A molecular genetic analysis of the gene (ansA) encoding the former enzyme has previously been reported. We now present a molecular study of the gene, ansB, encoding L-asparaginase II. This gene was isolated by using oligonucleotide probes, whose sequences were based on the previously determined amino acid sequence. The nucleotide sequence of ansB, including 5'- and 3'-untranslated regions, was determined. The amino acid sequence of L-asparaginase II, deduced from this nucleotide sequence, contains differences at 11 positions when compared with the previously determined amino acid sequence. The deduced amino acid sequence also reveals a typical secretory signal peptide of 22 residues. A single region of sequence similarity is observed when ansA and ansB are compared. The transcriptional start site in ansB was determined, allowing the identification of the promoter region. The regulation of ansB was studied by using ansB'-'lacZ fusions, together with a deletion analysis of the 5' region upstream of the promoter. Regulation by cyclic AMP receptor protein and anaerobiosis (FNR protein) was confirmed, and the presence of nucleotide sequence motifs, with homology to cyclic AMP receptor protein and FNR protein-binding sites, investigated. PMID:2407723

  12. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    PubMed Central

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying; Billiar, Timothy R.

    2013-01-01

    Tumor necrosis factor α (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found that cAMP exerts its affect at the proximal level of TNF signaling by inhibiting the formation of the DISC complex upon the binding of TNF to TNFR1. In conclusion, our study shows that cAMP prevents TNF + ActD-induced apoptosis in rat hepatocytes by inhibiting DISC complex formation. PMID:22634003

  13. cAMP/PKA signaling inhibits osteogenic differentiation and bone formation in rodent models.

    PubMed

    Siddappa, Ramakrishnaiah; Mulder, Winfried; Steeghs, Ilse; van de Klundert, Christine; Fernandes, Hugo; Liu, Jun; Arends, Roel; van Blitterswijk, Clemens; de Boer, Jan

    2009-08-01

    We previously demonstrated that cAMP-mediated protein kinase A (PKA) activation induces in vitro osteogenesis and in vivo bone formation by human mesenchymal stem cells (hMSCs). To analyze the species-specific response of this phenomenon and to translate our findings into a clinical trial, suitable animal models and cell lines are desirable. In this report, we assessed whether PKA plays a similar proosteogenic role played by two commonly used PKA activators-N6,2'-O-dibutyryl-cAMP (db-cAMP) and 8-bromo cAMP (8b-cAMP)-in a number of model systems. To this end, we treated MC3T3-E1 cells, mouse calvarial osteoblasts, mouse MSCs, and rat MSCs with cAMP. We demonstrate that cAMP inhibits osteogenesis in rodent cell types, evidenced by inhibition of osteogenic markers such as alkaline phosphatase (ALP), osteocalcin (BGLAP), and collagen type 1 (COL1A1). In support of this, ex vivo-cultured mouse calvaria exposed to db-cAMP showed a reduction in bone volume. Interestingly, cAMP even stimulated adipogenic differentiation in rat MSCs. Taken together, our data demonstrate that cAMP inhibits osteogenesis in vitro and bone formation ex vivo in rodent models in contrast to our earlier findings in hMSCs. The species discrepancy in response to various osteogenic signals is a critical need to be tested in clinically relevant models to translate the fundamental findings in lower species level to clinical applications. PMID:19231969

  14. Differential regulation by AMP and ADP of AMPK complexes containing different γ subunit isoforms

    PubMed Central

    Ross, Fiona A.; Jensen, Thomas E.; Hardie, D. Grahame

    2015-01-01

    The γ subunits of heterotrimeric AMPK complexes contain the binding sites for the regulatory adenine nucleotides AMP, ADP and ATP. We addressed whether complexes containing different γ isoforms display different responses to adenine nucleotides by generating cells stably expressing FLAG-tagged versions of the γ1, γ2 or γ3 isoform. When assayed at a physiological ATP concentration (5 mM), γ1- and γ2-containing complexes were allosterically activated almost 10-fold by AMP, with EC50 values one to two orders of magnitude lower than the ATP concentration. By contrast, γ3 complexes were barely activated by AMP under these conditions, although we did observe some activation at lower ATP concentrations. Despite this, all three complexes were activated, due to increased Thr172 phosphorylation, when cells were incubated with mitochondrial inhibitors that increase cellular AMP. With γ1 complexes, activation and Thr172 phosphorylation induced by the upstream kinase LKB1 [liver kinase B1; but not calmodulin-dependent kinase kinase (CaMKKβ)] in cell-free assays was markedly promoted by AMP and, to a smaller extent and less potently, by ADP. However, effects of AMP or ADP on activation and phosphorylation of the γ2 and γ3 complexes were small or insignificant. Binding of AMP or ADP protected all three γ subunit complexes against inactivation by Thr172 dephosphorylation; with γ2 complexes, ADP had similar potency to AMP, but with γ1 and γ3 complexes, ADP was less potent than AMP. Thus, AMPK complexes containing different γ subunit isoforms respond differently to changes in AMP, ADP or ATP. These differences may tune the responses of the isoforms to fit their differing physiological roles. PMID:26542978

  15. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  16. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  17. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  18. Elevated cAMP increases aquaporin-3 plasma membrane diffusion.

    PubMed

    Marlar, Saw; Arnspang, Eva C; Koffman, Jennifer S; Løcke, Else-Merete; Christensen, Birgitte M; Nejsum, Lene N

    2014-03-15

    Regulated urine concentration takes place in the renal collecting duct upon arginine vasopressin (AVP) stimulation, where subapical vesicles containing aquaporin-2 (AQP2) are inserted into the apical membrane instantly increasing water reabsorption and urine concentration. The reabsorped water exits via basolateral AQP3 and AQP4. Upon long-term stimulation with AVP or during thirst, expression levels of both AQP2 and AQP3 are increased; however, there is so far no evidence for short-term AVP regulation of AQP3 or AQP4. To facilitate the increase in transepithelial water transport, AQP3 may be short-term regulated via changes in protein-protein interactions, incorporation into lipid rafts, and/or changes in steady-state turnover, which could result in changes in the diffusion behavior of AQP3. Thus we measured AQP3 diffusion coefficients upon stimulation with the AVP mimic forskolin to reveal if AQP3 could be short-term regulated by AVP. k-Space image correlation spectroscopy (kICS) analysis of time-lapse image sequences of basolateral enhanced green fluorescent protein-tagged AQP3 (AQP3-EGFP) revealed that the forskolin-mediated elevation of cAMP increased the diffusion coefficient by 58% from 0.0147 ± 0.0082 μm(2)/s (control) to 0.0232 ± 0.0085 μm(2)/s (forskolin, P < 0.05). Quantum dot-conjugated antibody labeling also revealed a significant increase in AQP3 diffusion upon forskolin treatment by 44% [0.0104 ± 0.0040 μm(2)/s (control) vs. 0.0150 ± 0.0016 μm(2)/s (forskolin, P < 0.05)]. Immunoelectron microscopy showed no obvious difference in AQP3-EGFP expression levels or localization in the plasma membrane upon forskolin stimulation. Thus AQP3-EGFP diffusion is altered upon increased cAMP, which may correspond to basolateral adaptations in response to the increased apical water readsorption. PMID:24452376

  19. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  20. Relationship between Platelet PPARs, cAMP Levels, and P-Selectin Expression: Antiplatelet Activity of Natural Products

    PubMed Central

    Fuentes, Eduardo; Palomo, Iván

    2013-01-01

    Platelets are no longer considered simply as cells participating in thrombosis. In atherosclerosis, platelets are regulators of multiple processes, with the recruitment of inflammatory cells towards the lesion sites, inflammatory mediators release, and regulation of endothelial function. The antiplatelet therapy has been used for a long time in an effort to prevent and treat cardiovascular diseases. However, limited efficacy in some patients, drug resistance, and side effects are limitations of current antiplatelet therapy. In this context, a large number of natural products (polyphenols, terpenoids, alkaloids, and fatty acids) have been reported with antiplatelet activity. In this sense, the present paper describes mechanisms of antiplatelet action of natural products on platelet P-selectin expression through cAMP levels and its role as peroxisome proliferator-activated receptors agonists. PMID:24324520

  1. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  2. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  3. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation

    PubMed Central

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  4. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation.

    PubMed

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  5. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  6. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  7. Sustained exposure to catecholamines affects cAMP/PKA compartmentalised signalling in adult rat ventricular myocytes.

    PubMed

    Fields, Laura A; Koschinski, Andreas; Zaccolo, Manuela

    2016-07-01

    In the heart compartmentalisation of cAMP/protein kinase A (PKA) signalling is necessary to achieve a specific functional outcome in response to different hormonal stimuli. Chronic exposure to catecholamines is known to be detrimental to the heart and disrupted compartmentalisation of cAMP signalling has been associated to heart disease. However, in most cases it remains unclear whether altered local cAMP signalling is an adaptive response, a consequence of the disease or whether it contributes to the pathogenetic process. We have previously demonstrated that isoforms of PKA expressed in cardiac myocytes, PKA-I and PKA-II, localise to different subcellular compartments and are selectively activated by spatially confined pools of cAMP, resulting in phosphorylation of distinct downstream targets. Here we investigate cAMP signalling in an in vitro model of hypertrophy in primary adult rat ventricular myocytes. By using a real time imaging approach and targeted reporters we find that that sustained exposure to catecholamines can directly affect cAMP/PKA compartmentalisation. This appears to involve a complex mechanism including both changes in the subcellular localisation of individual phosphodiesterase (PDE) isoforms as well as the relocalisation of PKA isoforms. As a result, the preferential coupling of PKA subsets with different PDEs is altered resulting in a significant difference in the level of cAMP the kinase is exposed to, with potential impact on phosphorylation of downstream targets. PMID:26475678

  8. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  9. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  10. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA

    PubMed Central

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-01-01

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  11. Detection of plasmid-mediated AmpC β-lactamase in Escherichia coli

    PubMed Central

    LIU, XIANGQUN; LIU, YONGRUI

    2016-01-01

    Escherichia coli (E. coli) is a common opportunistic pathogen for nosocomial infection. The aim of the study was to examine the phenotype, genotype and epidemiology of plasmid-mediated AmpC β-lactamases in E. coli. In total, 96 clinical isolates of repeated E. coli were collected from different hospitals between August and October 2012. Using a cefoxitin disk diffusion method to identify the phenotype of AmpC β-lactamases in E. coli, the plasmid was extracted, and multiplex polymerase chain reaction (PCR) was used to determine the amp gene. The PCR products were purified and sequenced. Of the 96 isolates strains, 43 strains were cefoxitin-resistant. Twelve (12.5%) isolates were detected to produce AmpC β-lactamases with multiplex PCR, 11 strains carried DHA type ampC-resistant genes, and one strain carried ACC type ampC-resistant genes. In conclusion, the incidence of producing a plasmid-mediated AmpC enzyme of E. coli strains was relatively high. Therefore, antibiotics such as imipenem, a carbapenem, potentially serve as the treatment of choice for the infection. PMID:27284407

  12. Osteoblast differentiation is functionally associated with decreased AMP kinase activity.

    PubMed

    Kasai, Takayuki; Bandow, Kenjiro; Suzuki, Hiraku; Chiba, Norika; Kakimoto, Kyoko; Ohnishi, Tomokazu; Kawamoto, Shin-ichiro; Nagaoka, Eiichi; Matsuguchi, Tetsuya

    2009-12-01

    Osteoblasts, originating from mesenchymal stem cells, play a pivotal role in bone formation and mineralization. Several transcription factors including runt-related transcription factor 2 (Runx2) have been reported to be essential for osteoblast differentiation, whereas the cytoplasmic signal transduction pathways controlling the differentiation process have not been fully elucidated. AMP-activated protein kinase (AMPK) is a serine-threonine kinase generally regarded as a key regulator of cellular energy homeostasis, polarity, and division. Recent lines of evidence have indicated that the activity of the catalytic alpha subunit of AMPK is regulated through its phosphorylation by upstream AMPK kinases (AMPKKs) including LKB1. Here, we explored the role of AMPK in osteoblast differentiation using in vitro culture models. Phosphorylation of AMPKalpha was significantly decreased during osteoblastic differentiation in both primary osteoblasts and MC3T3-E1, a mouse osteoblastic cell line. Conversely, the terminal differentiation of primary osteoblasts and MC3T3-E1 cells, represented by matrix mineralization, was significantly inhibited by glucose restriction and stimulation with metformin, both of which are known activators of AMPK. Matrix mineralization of MC3T3-E1 cells was also inhibited by the forced expression of a constitutively active form of AMPKalpha. Metformin significantly inhibited gene expression of Runx2 along with osteoblast differentiation markers including osteocalcin (Ocn), bone sialo protein (Bsp), and osteopontin (Opn). Thus, our present data indicate that differentiation of osteoblasts is functionally associated with decreased AMPK activity. PMID:19725053

  13. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  14. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  15. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  16. Rethinking the roles of CRP, cAMP, and sugar-mediated global regulation in the Vibrionaceae.

    PubMed

    Colton, Deanna M; Stabb, Eric V

    2016-02-01

    Many proteobacteria modulate a suite of catabolic genes using the second messenger cyclic 3', 5'-AMP (cAMP) and the cAMP receptor protein (CRP). Together, the cAMP-CRP complex regulates target promoters, usually by activating transcription. In the canonical model, the phosphotransferase system (PTS), and in particular the EIIA(Glc) component for glucose uptake, provides a mechanistic link that modulates cAMP levels depending on glucose availability, resulting in more cAMP and activation of alternative catabolic pathways when glucose is unavailable. Within the Vibrionaceae, cAMP-CRP appears to play the classical role in modulating metabolic pathways; however, it also controls functions involved in natural competence, bioluminescence, pheromone signaling, and colonization of animal hosts. For this group of marine bacteria, chitin is an ecologically relevant resource, and chitin's monomeric sugar N-acetylglucosamine (NAG) supports robust growth while also triggering regulatory responses. Recent studies with Vibrio fischeri indicate that NAG and glucose uptake share EIIA(Glc), yet the responses of cAMP-CRP to these two carbon sources are starkly different. Moreover, control of cAMP levels appears to be more dominantly controlled by export and degradation. Perhaps more surprisingly, although CRP may require cAMP, its activity can be controlled in response to glucose by a mechanism independent of cAMP levels. Future studies in this area promise to shed new light on the role of cAMP and CRP. PMID:26215147

  17. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  18. Phosphodiesterase inhibition by a gastroprotective agent irsogladine: preferential blockade of cAMP hydrolysis.

    PubMed

    Kyoi, Takashi; Oka, Michiko; Noda, Kumiko; Ukai, Yojiro

    2004-08-27

    The effect of irsogladine [2,4-diamino-6-(2,5-dichlorophenyl)-s-triazine maleate], an antiulcer drug, on contents of cyclic nucleotides including cAMP and cGMP was investigated in rat stomachs. Irsogladine concentration-dependently increased cAMP content in rat glandula stomach. However, irsogladine at higher concentration (10(-5) M) was unable to further increase cAMP level in the presence of non-selective phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine, although 3-isobutyl-1-methylxanthine by itself increased cAMP level. On the other hand, irsogladine had no effect on the glandula cGMP content. Subsequently, the effect of irsogladine on the cyclic nucleotide degradation by purified bovine brain and heart PDEs was investigated. The cAMP degradation by purified bovine brain PDE was partially suppressed by PDE1 inhibitor vinpocetin, PDE2 inhibitor erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride and PDE4 inhibitor rolipram but not by PDE3 inhibitor cilostamide, and completely inhibited by 3-isobutyl-1-methylxanthine, suggesting that is attributed almost exclusively to PDE1, PDE2 and PDE4. Meanwhile, cGMP degradation by purified bovine brain PDE was partially suppressed by erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride. Irsogladine preferentially inhibited the response to cAMP degradation compared with cGMP degradation by this brain PDE. The cAMP degradation by bovine heart PDE was almost completely inhibited by the combination with vinpocetine and cilostamide, indicating that is mediated almost exclusively by PDE1 and PDE3. Irsogladine suppressed this cAMP degradation measured in the presence of vinpocetine to almost the same extent as that determined in the presence of cilostamide. These results indicate that irsogladine produces the increase of intracellular cAMP content via non-selective inhibition of PDE isozymes, which may be a key mechanism involved in its gastroprotective actions. PMID:15302227

  19. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  20. Autophosphorylation and rapid dephosphorylation of the cAMP-dependent protein kinase from Blastocladiella emersonii zoospores.

    PubMed

    Gomes, S L; Juliani, M H; da Costa Maia, J C; Rangel-Aldao, R

    1983-06-10

    The photoaffinity label 8-azido[32P]adenosine 3':5'-monophosphate and affinity chromatography on N6-(2-aminoethyl)-cAMP-Sepharose were used to analyze the cAMP-binding proteins present in cell-free extracts of Blastocladiella emersonii zoospores. In the presence of a mixture of protease inhibitors, 8-azido[32P]cAMP was specifically and quantitatively incorporated into a major protein band of Mr = 58,000, and three minor protein bands of Mr = 50,000, Mr = 43,000, and Mr = 36,000 respectively, after autoradiography following sodium dodecyl sulfate-polyacryl-amide gel electrophoresis. In the absence of the protease inhibitors, the Mr = 58,000 protein band was converted into the lower molecular weight cAMP-binding proteins, indicating a high sensitivity of the intact Mr = 58,000 protein band to endogenous proteases. The Mr = 58,000 protein corresponded to the regulatory subunit (R), of the cAMP-dependent protein kinase of zoospores, as shown by their identical behavior on DEAE-cellulose chromatography. The partially purified protein kinase incorporated 32P from [gamma-32P] ATP . Mg2+ into R as demonstrated by the specific adsorption of the 32P-labeled protein with N6-(2-aminoethyl)-cAMP-Sepharose. The incorporated 32P group was rapidly removed by endogenous phosphoprotein phosphatases in the presence of cAMP, as shown by pulse-chase experiments with [gamma-32P]ATP. Dephosphorylation of R-cAMP and rapid proteolysis may indicate two other mechanisms, in addition to cAMP, for the control of this protein kinase in vivo. PMID:6304069

  1. Long-range signaling in growing neurons after local elevation of cyclic AMP-dependent activity

    PubMed Central

    1994-01-01

    Cyclic AMP-dependent activity at the growth cone or the soma of cultured Xenopus spinal neurons was elevated by local extracellular perfusion of the neuron with culture medium containing 8-bromoadenosine 3',5'-cyclic monophosphate (8-br-cAMP) or forskolin. During local perfusion of one of the growth cones of multipolar neurons with these drugs, the perfused growth cone showed further extension, while the distant, unperfused growth cones were inhibited in their growth. Local perfusion of the growth cone with culture medium or local perfusion with 8-br-cAMP at a cell-free region 100 microns away from the growth cone did not produce any effect on the extension of the growth cone. Reduced extension of all growth cones was observed when the perfusion with 8-br-cAMP was restricted to the soma. The distant inhibitory effect does not depend on the growth of the perfused growth cone since local coperfusion of the growth cone with 8-br-cAMP and colchicine inhibited growth on both perfused and unperfused growth cones, while local perfusion with colchicine alone inhibited only the perfused growth cone. The distant inhibitory effect was abolished when the perfusion of 8-br-cAMP was carried out together with kinase inhibitor H- 8, suggesting the involvement of cAMP-dependent protein kinase and/or its downstream factors in the long-range inhibitory signaling. Uniform exposure of the entire neuron to bath-applied 8-br-cAMP, however, led to enhanced growth activity at all growth cones. Thus, local elevation of cAMP-dependent activity produces long-range and opposite effects on distant parts of the neuron, and a cytosolic gradient of second messengers may produce effects distinctly different from those following uniform global elevation of the messenger, leading to differential growth regulation at different regions of the same neuron. PMID:7798321

  2. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  3. Relationship between inhibition of cyclic AMP production in Chinese hamster ovary cells expressing the rat D2(444) receptor and antagonist/agonist binding ratios.

    PubMed Central

    Harley, E. A.; Middlemiss, D. N.; Ragan, C. I.

    1995-01-01

    1. Radioligand binding assays using [3H]-(-)-sulpiride, in the presence of 1 mM ethylenediaminetetraacetic acid (EDTA) and 100 microM guanylylimidodiphosphate (GppNHp) and [3H]-N0437 were developed to label the low and high agonist affinity states of the rD2(444) receptor (long form of the rat D2 receptor) respectively. The ratios of the affinities of compounds in these two assays (Kapp [3H]-(-)-supiride/Kapp [3H]-N-0437) were then calculated. 2. The prediction that the binding ratio reflected the functional efficacy of a compound was supported by measurement of the ability of a number of compounds acting at dopamine receptors to inhibit rD2(444)-mediated inhibition of cyclic AMP production. When the rank order of the ratios of a number of these compounds was compared to their ability to inhibit the production of cyclic AMP, a significant correlation was seen (Spearman rank correlation coefficient = 0.943, P = 0.01). 3. In conclusion, the sulpiride/N-0437 binding ratio reliably predicted the efficacy of compounds acting at dopamine receptors to inhibit cyclic AMP production mediated by the rD2(444) receptor. PMID:7582561

  4. Metabolic flux analysis of Arthrobacter sp. CGMCC 3584 for cAMP production based on 13C tracer experiments and gas chromatography-mass spectrometry.

    PubMed

    Niu, Huanqing; Chen, Yong; Yao, Shiwei; Liu, Lixia; Yang, Chen; Li, Bingbing; Liu, Dong; Xie, Jingjing; Chen, Xiaochun; Wu, Jinglan; Ying, Hanjie

    2013-12-01

    Arthrobacter sp. CGMCC 3584 are able to produce cAMP from glucose by the purine synthesis pathway via de novo or salvage biosynthesis. In order to gain an improved understanding of its metabolism, (13)C-labeling experiment and gas chromatography-mass spectrometry (GC-MS) analysis were employed to determine the metabolic network structure and estimate the intracellular fluxes. GC-MS analysis helps to reflect the activity of the intracellular pathways and reactions. The metabolic network mainly contains glycolytic and pentose phosphate pathways, the tricarboxylic acid cycle, and the inactive glyoxylate shunt. Hypoxanthine as a precursor of cAMP and sodium fluoride as an inhibitor of glycolysis were found to increase the cAMP production, as well as the flux through the PP pathway. The effects of adding hypoxanthine and sodium fluoride are discussed based on the enzyme assays and metabolic flux analysis. In conclusion, our results provide quantitative insights into how cells manipulate the metabolic network under different culture conditions and this may be of value in metabolic regulation for desirable production. PMID:24056081

  5. Amino acids

    MedlinePlus

    Amino acids are organic compounds that combine to form proteins . Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids ...

  6. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  7. Compartmentation of cAMP signalling in cardiomyocytes in health and disease.

    PubMed

    Perera, R K; Nikolaev, V O

    2013-04-01

    3',5'-cyclic adenosine monophosphate (cAMP) is a ubiquitous second messenger critically involved in the regulation of heart function. It has been shown to act in discrete subcellular signalling compartments formed by differentially localized receptors, phosphodiesterases and protein kinases. Cardiac diseases such as hypertrophy or heart failure are associated with structural and functional remodelling of these microdomains which leads to changes in cAMP compartmentation. In this review, we will discuss recent key findings which provided new insights into cAMP compartmentation in cardiomyocytes with a particular focus on its alterations in heart disease. PMID:23383621

  8. Cyclic AMP induces maturation of trout sperm axoneme to initiate motility

    NASA Astrophysics Data System (ADS)

    Morisawa, Masaaki

    1982-02-01

    Cyclic AMP has long been implicated as an activator of sperm motility1-5. From more recent experiments using demembranated mammalian and sea urchin spermatozoa6,7, it was concluded that cyclic AMP only increases the motility of the axoneme after it has been initiated by MgATP2-. We have now carried out similar experiments using spermatozoa collected from the rainbow trout and demembranated by treatment with the detergent Triton X-100. Our results suggest that in this species, cyclic AMP is required before MgATP2- to trigger maturation of the nonmotile axoneme. Subsequent addition of an energy source then induces motility.

  9. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  10. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  11. Preparation and characterization of poly(2-acrylamido-2-methylpropane-sulfonic acid)/Chitosan hydrogel using gamma irradiation and its application in wastewater treatment

    NASA Astrophysics Data System (ADS)

    Gad, Y. H.

    2008-09-01

    Radiation grafting of chitosan with 2-acrylamido-2-methyl propane sulfonic acid (AMPS) has been successfully performed. The effect of absorbed dose (kGy) and the chitosan:AMPS ratio on graft hydrogelization was studied. The structure of the prepared hydrogel was confirmed using infrared spectroscopy (IR). Thermal properties were simultaneously studied by thermogravimetric analysis (TGA). The effect of the polymerization variables on the swelling % of the prepared hydrogel was investigated. The highest equilibrium degree of swelling (38.6 g/g) and gel % (94.7%) of the prepared chitosan-AMPS hydrogel was at 40% AMPS and absorbed dose of 10 kGy. The removal of methylene blue, acid red dye, Cd (II) and Cr (III) from composed wastewater was also investigated. The effect of pH, the chitosan:AMPS ratio and the concentration of the pollutant on the adsorption process were studied.

  12. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. PMID:27137358

  13. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  14. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  15. A Ric8/Synembryn Homolog Promotes Gpa1 and Gpa2 Activation To Respectively Regulate Cyclic AMP and Pheromone Signaling in Cryptococcus neoformans

    PubMed Central

    Gong, Jinjun; Grodsky, Jacob D.; Zhang, Zhengguang

    2014-01-01

    The G protein α subunits Gpa1, Gpa2, and Gpa3 mediate signal transduction and are important in the growth and virulence of Cryptococcus neoformans. To understand how Gpa1 functions without a conventional Gβ subunit, we characterized a resistance to inhibitors of cholinesterase 8 (Ric8) homolog from C. neoformans, which shares amino acid sequence homology with other Ric8 proteins that exhibit guanine nucleotide exchange factor (GEF) activity toward Gα. We found that the ric8 mutant was reduced in capsule size and melanin formation, which could be suppressed by cyclic AMP (cAMP) supplementation or by introducing the activated GPA1Q284L allele. Consistent with the fact that Ric8 participates in cAMP signaling to regulate virulence, the ric8 mutant was attenuated in virulence toward mice. Interestingly, disruption of RIC8 also resulted in opposing effects on pheromone signaling, as the ric8 mutant showed reduced mating but an enhanced ability to induce the pheromone response in the mating partner. To identify Ric8 functional mechanisms, we examined the interactions between Ric8 and the three Gα proteins. Ric8 interacted with Gpa1 and Gpa2, but not Gpa3. The presence of Gpa1Q284L negatively affected its interaction with Ric8, whereas the activated Gpa2Q203L allele abolished the interaction. Collectively, these findings suggest that Ric8 functions as a GEF to facilitate the activation of Gpa1-cAMP signaling and to promote Gpa2, affecting mating efficiency. Our study highlights the distinct and conserved characteristics associated with G protein signaling and contributes to our overall understanding of how G protein α subunits function with or without a canonical Gβ partner in C. neoformans. PMID:25084863

  16. Synthesis and performance evaluation of the new thickening agent of acidizing fluid

    NASA Astrophysics Data System (ADS)

    Tian, Zhenxing; Lv, Tong; Ren, Yanmei

    2010-07-01

    An acid thickener, poly (AMPS-co-DMC) was synthesized using water aqueous solution polymerization of these monomers such as 2-acrylamide-2-methylpropanesulfonic acid (AMPS) and [2-(Methacryloyloxy) ethyl] trimethylammonium chloride (DMC), with ammonium persulfate and sodium sulfite redox system as initiator, while at 65°C, 25% of the total concentration of monomer, initiator dosage of 1.6% for the monomer mass and nitrogen protection condition. The paper discussed the property evaluation of poly(AMPS-co-DMC), it was shown that poly (AMPS-co-DMC) had good acid solubility (time for dissolving in acid is 21 min); acid containing 5.0% of poly(AMPSco-DMC) had a viscosity of greater than 25.0mPa•s the shearing stability and heat resistance of the system was good and over 90% at a shear rate of 170s-1; poly(AMPS-co-DMC) performed well in the presence of standard saline at a total concentration of 40000mg/L.

  17. Role of arachidonic acid metabolites in the action of a beta adrenergic agonist on human monocyte phagocytosis.

    PubMed

    Borda, E S; Tenenbaum, A; Sales, M E; Rumi, L; Sterin-Borda, L

    1998-02-01

    The mechanisms by which beta adrenergic stimulation regulates phagocytosis of Candida albicans by human peripheral monocytes (HPM) are characterized. Isoproterenol (ISO) inhibits phagocytosis in a concentration-dependent manner. This effect was blunted by propranolol, inhibitors of phospholipase A2 (PLA2), cyclooxygenase and verapamil, pointing to a participation of arachidonic acid (AA) metabolites and calcium in the phenomenon. Prostaglandin E2 (PGE2) and dibutyryl cyclic AMP (db-cAMP) also exerted the same inhibitory effect on phagocytosis. ISO interacts with beta adrenergic receptors of HPM increasing PGE2 and cAMP. We conclude that the mechanisms by which beta adrenergic stimulation regulates phagocytosis of Candida albicans by HPM appear to be secondary to beta adrenoceptor-mediated hydrolysis of AA accompanied by an increase in PGE2 generation and cAMP production. Both PGE2 and cAMP could act as mediators of the inhibitory action of beta agonists on the HPM-phagocytosis process. PMID:9578144

  18. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  19. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  20. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  1. DOE/NEAMS AMP CAMP I 2010 - multi species transport in metal fuels

    SciTech Connect

    Dilts, Gary A

    2011-01-21

    Essential aspects from the literature of metal nuclear fuel alloys and modeling the transport of constituents therein are discussed. The essential mathematical problem is described along with relevant issues for implementation of solution algorithms in the AMP nuclear fuel code.

  2. c-di-AMP recognition by Staphylococcus aureus PstA.

    PubMed

    Müller, Martina; Hopfner, Karl-Peter; Witte, Gregor

    2015-01-01

    Cyclic-di-AMP (c-di-AMP) is a bacterial secondary messenger involved in various processes, including sensing of DNA-integrity, cell wall metabolism and potassium transport. A number of c-di-AMP receptor proteins have recently been identified in Staphylococcus aureus. One of them - PstA - possesses a ferredoxin-like fold and is structurally related to the class of PII signal-transduction proteins. PII proteins are involved in a large number of pathways, most of them associated with nitrogen metabolism. In this study we describe the mode of c-di-AMP binding and subsequent structural changes of S. aureus PstA. An altered architecture in PstA compared to canonical PII proteins results in differences in ligand coordination. PMID:25435171

  3. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  4. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  5. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  6. AMP: a science-driven web-based application for the TeraGrid

    NASA Astrophysics Data System (ADS)

    Woitaszek, M.; Metcalfe, T.; Shorrock, I.

    The Asteroseismic Modeling Portal (AMP) provides a web-based interface for astronomers to run and view simulations that derive the properties of Sun-like stars from observations of their pulsation frequencies. In this paper, we describe the architecture and implementation of AMP, highlighting the lightweight design principles and tools used to produce a functional fully-custom web-based science application in less than a year. Targeted as a TeraGrid science gateway, AMP's architecture and implementation are intended to simplify its orchestration of TeraGrid computational resources. AMP's web-based interface was developed as a traditional standalone database-backed web application using the Python-based Django web development framework, allowing us to leverage the Django framework's capabilities while cleanly separating the user interface development from the grid interface development. We have found this combination of tools flexible and effective for rapid gateway development and deployment.

  7. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  8. A QM/MM study of the 5‧-AMP DNA hydrolysis of aprataxin

    NASA Astrophysics Data System (ADS)

    Hanaoka, Kyohei; Tanaka, Wataru; Kayanuma, Megumi; Shoji, Mitsuo

    2015-07-01

    Aprataxin is a DNA repair enzyme that hydrolyzes the abnormal 5‧-AMP termini of broken DNAs. Based on quantum mechanical/molecular mechanical (QM/MM) calculations, we found that the catalytic reaction proceeds in three steps; substrate protonation, DNA deadenylation and histidine-AMP intermediate hydrolysis. The calculated activation energies for the second and third reactions are 19.0 and 10.5 kcal mol-1, which can be attributed to a penta-coordinated AMP-phosphoryl formation and closing of a water molecule, respectively. We also found that a histidine-AMP intermediate is hydrolyzed easily in the third step when a water molecule closes within 3 Å to the phosphorus nucleus.

  9. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  10. I - Prostaglandin hyperalgesia, a cAMP/Ca2+ dependent process.

    PubMed

    Ferreira, S H; Nakamura, M

    1979-08-01

    Prostaglandins stimulate cAMP increase in several biological systems including CNS. The possible participation of a cAMP/Ca2+ related mechanism in prostaglandin induced hyperalgesia in the rat paw, as measured by a modification of the Randall-Selitto method was investigated. A serie of agents was administered in the paw in an attempt to change either Ca2+ or cyclic AMP concentration at the nociceptive terminations. PGE2, dibutyryl cyclic AMP, isoprenaline, noradrenaline, adrenaline, Ca2+ionophore (A23187), BaCl2 caused a dose dependent hyperalgesia. The hyperalgesic effect of these substances was enhanced by methyl-xanthines. Cyclic GMP as well as agents which interfere with Ca2+ influx (verapamil and lanthanum) were local analgesics in normal and hyperalgesic paws. PMID:230542

  11. The genetically encoded tool set for investigating cAMP: more than the sum of its parts

    PubMed Central

    Patel, Neha; Gold, Matthew G.

    2015-01-01

    Intracellular fluctuations of the second messenger cyclic AMP (cAMP) are regulated with spatial and temporal precision. This regulation is supported by the sophisticated arrangement of cyclases, phosphodiesterases, anchoring proteins, and receptors for cAMP. Discovery of these nuances to cAMP signaling has been facilitated by the development of genetically encodable tools for monitoring and manipulating cAMP and the proteins that support cAMP signaling. In this review, we discuss the state-of-the-art in development of different genetically encoded tools for sensing cAMP and the activity of its primary intracellular receptor protein kinase A (PKA). We introduce sequences for encoding adenylyl cyclases that enable cAMP levels to be artificially elevated within cells. We chart the evolution of sequences for selectively modifying protein–protein interactions that support cAMP signaling, and for driving cAMP sensors and manipulators to different subcellular locations. Importantly, these different genetically encoded tools can be applied synergistically, and we highlight notable instances that take advantage of this property. Finally, we consider prospects for extending the utility of the tool set to support further insights into the role of cAMP in health and disease. PMID:26300778

  12. An investigation of the adsorption characteristics of 5 prime ATP and 5 prime AMP onto the surface of CaSO sub 4 x 2H sub 2 O

    NASA Technical Reports Server (NTRS)

    Calderon, J.; Sweeney, M. A.

    1986-01-01

    A model has been proposed (Lahev and Chans, 1982) in which solid surfaces can act as a site for catalytic activity of condensation reactions for certain biomolecules. From this model, the adsorption characteristics of 5'ATP and 5'AMP onto the surface of CaSO4 2H2O was chosen for study. It has been proven that 5'ATP and 5'AMP do adsorb onto the surface of CaSO4. Studies were then made to determine the dependence of adsorption versus time, concentration, ionic strength and pH. It was found that the adsorption of the nucleotides is highly pH dependent, primarily determined by the phosphate acid groups of the nucleic acid molecule. From this investigation, the data obtained are discussed in relation to the model for the prebiotic earth.

  13. Reduction of endothelial permeability in vitro by cAMP and cGMP

    SciTech Connect

    Kreienberg, P.B.; DeMichele, M.A.; Kowalczyk, P.; Minnear, F.L. )

    1990-02-26

    The cAMP enhancing-vasodilator isoproterenol has been shown previously to decrease endothelial permeability in vitro. This effect may not be unique to cAMP-enhancing agents. The authors have shown that thrombin at a concentration of 2 pM, a level which relaxes aortic vessel strips in association with increased levels of cGMP, reduces endothelial permeability. In this study, the permeability effect of cAMP and cGMP analogues were assessed by measuring the clearance of {sup 125}I-albumin across bovine pulmonary artery endothelial cell monolayers. The experiments were divided into baseline and experimental periods so that each monolayer served as its own control. The cAMP and cGMP analogues, 8-bromo-cAMP (1 mM) and 8-bromo-cGMP (1 mM), decreased clearance form a vehicle control value of 1.3{+-}0.2 (mean {+-}SD of experimental/baseline clearance, n=15 cell monolayers) to 0.7{+-}0.2 and 1.0{+-}0.2, respectively, although cGMP did not decrease clearance from its own baseline value. Coincubation of these analogues with thrombin (0.1 uM) also decreased the thrombin-induced increase in albumin clearance from 2.2{+-}0.5 to 0.8{+-}0.2 (cAMP) and 1.5{+-}0.2 (cGMP). The data indicate that in vitro both cAMP and cGMP-enhancing vasodilators would reduce endothelial permeability and that cAMP-enhancing agents would be more effective.

  14. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  15. Cooperation between cAMP signalling and sulfonylurea in insulin secretion.

    PubMed

    Shibasaki, T; Takahashi, T; Takahashi, H; Seino, S

    2014-09-01

    Although glucose is physiologically the most important regulator of insulin secretion, glucose-induced insulin secretion is modulated by hormonal and neural inputs to pancreatic β-cells. Most of the hormones and neurotransmitters evoke intracellular signals such as cAMP, Ca²⁺ , and phospholipid-derived molecules by activating G protein-coupled receptors (GPCRs). In particular, cAMP is a key second messenger that amplifies insulin secretion in a glucose concentration-dependent manner. The action of cAMP on insulin secretion is mediated by both protein kinase A (PKA)-dependent and Epac2A-dependent mechanisms. Many of the proteins expressed in β-cells are phosphorylated by PKA in vitro, but only a few proteins in which PKA phosphorylation directly affects insulin secretion have been identified. On the other hand, Epac2A activates the Ras-like small G protein Rap in a cAMP-dependent manner. Epac2A is also directly activated by various sulfonylureas, except for gliclazide. 8-pCPT-2'-O-Me-cAMP, an Epac-selective cAMP analogue, and glibenclamide, a sulfonylurea, synergistically activate Epac2A and Rap1, whereas adrenaline, which suppresses cAMP production in pancreatic β-cells, blocks activation of Epac2A and Rap1 by glibenclamide. Thus, cAMP signalling and sulfonylurea cooperatively activate Epac2A and Rap1. This interaction could account, at least in part, for the synergistic effects of incretin-related drugs and sulfonylureas in insulin secretion. Accordingly, clarification of the mechanism of Epac2A activation may provide therapeutic strategies to improve insulin secretion in diabetes. PMID:25200305

  16. Cyclic AMP-modulated phosphorylation of intermediate filament proteins in cultured avian myogenic cells.

    PubMed Central

    Gard, D L; Lazarides, E

    1982-01-01

    The intermediate filament proteins desmin and vimentin and the muscle tropomyosins were the major protein phosphate acceptors in 8-day-old myotubes incubated for 4 h in medium containing radiolabeled phosphate. The addition of isoproterenol or 8-bromo-cyclic AMP (BrcAMP) resulted in a two- to threefold increase in incorporation of 32PO4 into both desmin and vimentin, whereas no changes in the incorporation of 32PO4 into tropomyosin or other cellular proteins were observed. The BrcAMP- or hormonally induced increase in 32PO4 incorporation into desmin and vimentin was independent of protein synthesis and was not caused by stimulation of protein phosphate turnover. In addition, BrcAMP did not induce significant changes in the specific activity of the cellular ATP pool. These data suggest that the observed increase in 32PO4 incorporation represented an actual increase in phosphorylation of the intermediate filament proteins desmin and vimentin. Two-dimensional tryptic analysis of desmin from 8-day-old myotubes revealed five phosphopeptides of which two showed a 7- to 10-fold increase in 32PO4 incorporation in BrcAMP-treated myotubes. Four of the phosphopeptides identified in desmin labeled in vivo were also observed in desmin phosphorylated in vitro by bovine heart cAMP-dependent protein kinase. Although phosphorylation of desmin and vimentin was apparent in myogenic cells at all stages of differentiation, BrcAMP- and isoproterenol-induced increases in phosphorylation of these proteins were restricted to mature myotubes. These data strongly suggest that in vivo phosphorylation of the intermediate filament proteins desmin and vimentin is catalyzed by the cAMP-dependent protein kinases and that such phosphorylation may be regulated during muscle differentiation. Images PMID:6294504

  17. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  18. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  19. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  20. Structural basis of the inhibition of class C acid phosphatases by adenosine 5;#8242;-phosphorothioate

    SciTech Connect

    Singh, Harkewal; Reilly, Thomas J.; Tanner, John J.

    2012-01-20

    The inhibition of phosphatases by adenosine 5'-phosphorothioate (AMPS) was first reported in the late 1960s; however, the structural basis for the inhibition has remained unknown. Here, it is shown that AMPS is a submicromolar inhibitor of class C acid phosphatases, a group of bacterial outer membrane enzymes belonging to the haloacid dehalogenase structural superfamily. Furthermore, the 1.35-{angstrom} resolution crystal structure of the inhibited recombinant Haemophilus influenzae class C acid phosphatase was determined; this is the first structure of a phosphatase complexed with AMPS. The conformation of AMPS is identical to that of the substrate 5'-AMP, except that steric factors force a rotation of the thiophosphoryl out of the normal phosphoryl-binding pocket. This conformation is catalytically nonproductive, because the P atom is not positioned optimally for nucleophilic attack by Asp64, and the O atom of the scissile O-P bond is too far from the Asp (Asp66) that protonates the leaving group. The structure of 5'-AMP complexed with the Asp64 {yields} Asn mutant enzyme was also determined at 1.35-{angstrom} resolution. This mutation induces the substrate to adopt the same nonproductive binding mode that is observed in the AMPS complex. In this case, electrostatic considerations, rather than steric factors, underlie the movement of the phosphoryl. The structures not only provide an explanation for the inhibition by AMPS, but also highlight the precise steric and electrostatic requirements of phosphoryl recognition by class C acid phosphatases. Moreover, the structure of the Asp64 {yields} Asn mutant illustrates how a seemingly innocuous mutation can cause an unexpected structural change.

  1. Structural insights into recognition of c-di-AMP by the ydaO riboswitch.

    PubMed

    Gao, Ang; Serganov, Alexander

    2014-09-01

    Bacterial second messenger cyclic di-AMP (c-di-AMP) is implicated in signaling DNA damage and cell wall stress through interactions with several protein receptors and a widespread ydaO-type riboswitch. We report the crystal structures of c-di-AMP riboswitches from Thermoanaerobacter pseudethanolicus and Thermovirga lienii determined at ∼3.0-Å resolution. In both species, the RNA adopts an unforeseen 'square'-shaped pseudosymmetrical architecture that features two three-way junctions, a turn and a pseudoknot, positioned in the square corners. Uncharacteristically for riboswitches, the structure is stapled by two ligand molecules that span the interior of the structure and employ similar noncanonical interactions for RNA recognition. Mutations in either ligand-binding site negatively affect c-di-AMP binding, suggesting that the riboswitch-triggered genetic response requires contribution of both ligands. Our data provide what are to our knowledge the first insights into specific sensing of c-di-AMP and a molecular mechanism underlying the common c-di-AMP-dependent control of essential cellular processes in bacteria. PMID:25086507

  2. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  3. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  4. cAMP and cGMP Play an Essential Role in Galvanotaxis of Cell Fragments.

    PubMed

    Zhu, Kan; Sun, Yaohui; Miu, Anh; Yen, Michael; Liu, Bowei; Zeng, Qunli; Mogilner, Alex; Zhao, Min

    2016-06-01

    Cell fragments devoid of the nucleus and major organelles are found in physiology and pathology, for example platelets derived from megakaryocytes, and cell fragments from white blood cells and glioma cells. Platelets exhibit active chemotaxis. Fragments from white blood cells display chemotaxis, phagocytosis, and bactericidal functions. Signaling mechanisms underlying migration of cell fragments are poorly understood. Here we used fish keratocyte fragments and demonstrated striking differences in signal transduction in migration of cell fragments and parental cells in a weak electric field. cAMP or cGMP agonists completely abolished directional migration of fragments, but had no effect on parental cells. The inhibition effects were prevented by pre-incubating with cAMP and cGMP antagonists. Blocking cAMP and cGMP downstream signaling by inhibition of PKA and PKG also recovered fragment galvanotaxis. Both perturbations confirmed that the inhibitory effect was mediated by cAMP or cGMP signaling. Inhibition of cathode signaling with PI3K inhibitor LY294002 also prevented the effects of cAMP or cGMP agonists. Our results suggest that cAMP and cGMP are essential for galvanotaxis of cell fragments, in contrast to the signaling mechanisms in parental cells. PMID:26517849

  5. A Novel Conditional Genetic System Reveals That Increasing Neuronal cAMP Enhances Memory and Retrieval

    PubMed Central

    Isiegas, Carolina; McDonough, Conor; Huang, Ted; Havekes, Robbert; Fabian, Sara; Wu, Long-Jun; Xu, Hui; Zhao, Ming-Gao; Kim, Jae-Ick; Lee, Yong-Seok; Lee, Hye-Ryeon; Ko, Hyoung-Gon; Lee, Nuribalhae; Choi, Sun-Lim; Lee, Jeong-Sik; Son, Hyeon; Zhuo, Min; Kaang, Bong-Kiun; Abel, Ted

    2010-01-01

    Consistent evidence from pharmacological and genetic studies shows that cAMP is a critical modulator of synaptic plasticity and memory formation. However, the potential of the cAMP signaling pathway as a target for memory enhancement remains unclear because of contradictory findings from pharmacological and genetic approaches. To address these issues, we have developed a novel conditional genetic system in mice based on the heterologous expression of an Aplysia octopamine receptor, a G-protein-coupled receptor whose activation by its natural ligand octopamine leads to rapid and transient increases in cAMP. We find that activation of this receptor transgenically expressed in mouse forebrain neurons induces a rapid elevation of hippocampal cAMP levels, facilitates hippocampus synaptic plasticity, and enhances the consolidation and retrieval of fear memory. Our findings clearly demonstrate that acute increases in cAMP levels selectively in neurons facilitate synaptic plasticity and memory, and illustrate the potential of this heterologous system to study cAMP-mediated processes in mammalian systems. PMID:18550764

  6. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  7. Multidrug resistant AmpC β-lactamase producing Escherichia coli isolated from a paediatric hospital

    PubMed Central

    Jameel, Noor-ul-Ain; Ejaz, Hasan; Zafar, Aizza; Amin, Hafsa

    2014-01-01

    Objective : The objective of the study was to observe the antimicrobial resistance of AmpC β-lactamase producing E. coli. Methods: Six hundred and seventy E. coli were isolated from 20,257 various pathological samples collected from The Children’s Hospital and Institute of Child Health, Lahore, Pakistan. The isolates showed resistance to ceftazidime which were further examined for AmpC β-lactamase activity by Disc Potentiation method. Results: There were 670 isolates of E. coli out of which 85 (12.6%) were AmpC β-lactamase producers. Risk factors like intravenous line (76.5%), endotracheal tube (22.4%), surgery (12.9%) and urinary catheters (7.1%) were found to be associated with infection caused by AmpC β-lactamase producing E. coli. Antimicrobial resistance pattern revealed that AmpC producing E. coli were highly resistant to co-amoxiclav, ceftazidime, cefotaxime, cefuroxime, cefixime, ceftriaxone and cefoxitin (100% each). Least resistance was observed against sulbactam-cefoperazone (14.1%), cefepime (7.1%), piperacillin-tazobactam (5.9%) and none of the isolates were resistant to imipenem and meropenem. Conclusion: The minimum use of invasive devices and strict antibiotic policies can reduce the spread of AmpC β-lactamase producing E. coli. PMID:24639857

  8. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  9. Regulation of colonic apical potassium (BK) channels by cAMP and somatostatin.

    PubMed

    Perry, M D; Sandle, G I

    2009-07-01

    High-conductance apical K+ (BK) channels are present in surface colonocytes of mammalian (including human) colon. Their location makes them well fitted to contribute to the excessive intestinal K(+) losses often associated with infective diarrhea. Since many channel proteins are regulated by phosphorylation, we evaluated the roles of protein kinase A (PKA) and phosphatases in the modulation of apical BK channel activity in surface colonocytes from rat distal colon using patch-clamp techniques, having first increased channel abundance by chronic dietary K+ enrichment. We found that PKA activation using 50 micromol/l forskolin and 5 mmol/l 3-isobutyl-1-methylxanthine stimulated BK channels in cell-attached patches and the catalytic subunit of PKA (200 U/ml) had a similar effect in excised inside-out patches. The antidiarrheal peptide somatostatin (SOM; 2 micromol/l) had a G protein-dependent inhibitory effect on BK channels in cell-attached patches, which was unaffected by pretreatment with 10 micromol/l okadaic acid (an inhibitor of protein phosphatase type 1 and type 2A) but completely prevented by pretreatment with 100 micromol/l Na+ orthovanadate and 10 micromol/l BpV (inhibitors of phosphoprotein tyrosine phosphatase). SOM also inhibited apical BK channels in surface colonocytes in human distal colon. We conclude that cAMP-dependent PKA activates apical BK channels and may enhance colonic K+ losses in some cases of secretory diarrhea. SOM inhibits apical BK channels through a phosphoprotein tyrosine phosphatase-dependent mechanism, which could form the basis of new antidiarrheal strategies. PMID:19407217

  10. Kinetic and Inhibition Studies of Dihydroxybenzoate-AMP Ligase (EntE) from Escherichia coli†

    PubMed Central

    Sikora, Alison L.; Wilson, Daniel J.; Aldrich, Courtney C.; Blanchard, John S.

    2010-01-01

    Inhibition of siderophore biosynthetic pathways in pathogenic bacteria represents a promising strategy for antibacterial drug development. E. coli synthesize and secrete the small molecule iron-chelator siderophore, enterobactin, in response to intracellular iron depletion. Here we describe a detailed kinetic analysis of EntE, one of six enzymes in the enterobactin synthetase gene cluster. EntE catalyzes the ATP-dependent condensation of 2, 3-dihydroxybenzoic acid (DHB) and phosphopantetheinylated EntB (holo-EntB) to form covalently arylated EntB, a product that is vital for the final assembly of enterobactin. Initial velocity studies show that EntE proceeds via a Bi Uni Uni Bi ping-pong kinetic mechanism with a kcat equal to 2.8 s−1 and Km values of 2.5, 430, 2.9 μM for DHB, ATP, and holo-EntB-ArCP, respectively. Inhibition and direct binding experiments suggest that, during the first half-reaction (adenylation), DHB binds first to the free enzyme, followed by ATP and the release of pyrophosphate to form the adenylate intermediate. During the second half-reaction (ligation), phosphopantetheinylated EntB binds to the enzyme followed by the release of products, AMP and arylated EntB. Two hydrolytically-stable adenylate analogues, 5′-O-[N-(salicyl)sulfamoyl]adenosine (Sal-AMS) and 5′-O-[N-(2, 3-dihydroxybenzoyl)sulfamoyl]adenosine (DHB-AMS), are shown to act as slow-onset tight-binding inhibitors of the enzyme with appKi values of 0.9 and 3.8 nM, respectively. Direct binding experiments, via isothermal titration calorimetry, reveal low picomolar dissociation constants for both analogues to EntE. The tight-binding of Sal-AMS and DHB-AMS to EntE suggests that these compounds may be developed further as effective antibiotics targeted to this enzyme. PMID:20359185

  11. Antithrombin Up-regulates AMP-activated Protein Kinase Signaling during Myocardial Ischemia/Reperfusion Injury

    PubMed Central

    Ma, Yina; Wang, Jinli; Gao, Junjie; Yang, Hui; Wang, Yanqing; Manithody, Chandrashekhara; Li, Ji; Rezaie, Alireza R.

    2014-01-01

    Summary Antithrombin (AT) is a protein of the serpin superfamily involved in regulation of the proteolytic activity of the serine proteases of the coagulation system. AT is known to exhibit anti-inflammatory and cardioprotective properties when it binds to heparan sulfate proteoglycans (HSPGs) on vascular cells. AMP-activated protein kinase (AMPK) plays an important cardioprotective role during myocardial ischemia and reperfusion (I/R). To determine whether the cardioprotective signaling function of AT is mediated through the AMPK pathway, we evaluated the cardioprotective activities of wild-type AT and its two derivatives, one having high affinity and the other no affinity for heparin, in an acute I/R injury model in C57BL/6J mice in which the left anterior descending coronary artery was occluded. The serpin derivatives were given 5 min before reperfusion. The results showed that AT-WT can activate AMPK in both in vivo and ex vivo conditions. Blocking AMPK activity abolished the cardioprotective function of AT against I/R injury. The AT derivative having high affinity for heparin was more effective in activating AMPK and in limiting infraction, but the derivative lacking affinity for heparin was inactive in eliciting AMPK-dependent cardioprotective activity. Activation of AMPK by AT inhibited the inflammatory c-Jun N-terminal protein kinase (JNK) pathway during I/R. Further studies revealed that the AMPK activity induced by AT also modulates cardiac substrate metabolism by increasing glucose oxidation but inhibiting fatty acid oxidation during I/R. These results suggest that AT binds to HSPGs on heart tissues to invoke a cardioprotective function by triggering cardiac AMPK activation, thereby attenuating JNK inflammatory signaling pathways and modulating substrate metabolism during I/R. PMID:25230600

  12. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  13. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  14. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  15. T3-induced liver AMP-activated protein kinase signaling: Redox dependency and upregulation of downstream targets

    PubMed Central

    Videla, Luis A; Fernández, Virginia; Cornejo, Pamela; Vargas, Romina; Morales, Paula; Ceballo, Juan; Fischer, Alvaro; Escudero, Nicolás; Escobar, Oscar

    2014-01-01

    AIM: To investigate the redox dependency and promotion of downstream targets in thyroid hormone (T3)-induced AMP-activated protein kinase (AMPK) signaling as cellular energy sensor to limit metabolic stresses in the liver. METHODS: Fed male Sprague-Dawley rats were given a single ip dose of 0.1 mg T3/kg or T3 vehicle (NaOH 0.1 N; controls) and studied at 8 or 24 h after treatment. Separate groups of animals received 500 mg N-acetylcysteine (NAC)/kg or saline ip 30 min prior T3. Measurements included plasma and liver 8-isoprostane and serum β-hydroxybutyrate levels (ELISA), hepatic levels of mRNAs (qPCR), proteins (Western blot), and phosphorylated AMPK (ELISA). RESULTS: T3 upregulates AMPK signaling, including the upstream kinases Ca2+-calmodulin-dependent protein kinase kinase-β and transforming growth factor-β-activated kinase-1, with T3-induced reactive oxygen species having a causal role due to its suppression by pretreatment with the antioxidant NAC. Accordingly, AMPK targets acetyl-CoA carboxylase and cyclic AMP response element binding protein are phosphorylated, with the concomitant carnitine palmitoyltransferase-1α (CPT-1α) activation and higher expression of peroxisome proliferator-activated receptor-γ co-activator-1α and that of the fatty acid oxidation (FAO)-related enzymes CPT-1α, acyl-CoA oxidase 1, and acyl-CoA thioesterase 2. Under these conditions, T3 induced a significant increase in the serum levels of β-hydroxybutyrate, a surrogate marker for hepatic FAO. CONCLUSION: T3 administration activates liver AMPK signaling in a redox-dependent manner, leading to FAO enhancement as evidenced by the consequent ketogenic response, which may constitute a key molecular mechanism regulating energy dynamics to support T3 preconditioning against ischemia-reperfusion injury. PMID:25516653

  16. Involvement of a cyclic-AMP pathway in group I metabotropic glutamate receptor responses in neonatal rat cortex.

    PubMed

    Schaffhauser, H; de Barry, J; Muller, H; Heitz, M P; Gombos, G; Mutel, V

    1997-09-10

    3,5-Dihydroxyphenylglycine (DHPG), (S)-3-hydroxyphenylglycine and (S)-4-carboxy-3-hydroxyphenylglycine (S-4C3HPG) stimulated phosphoinositide hydrolysis in neonatal rat cortical slices, but with lower maximal effect, in comparison with 2S,1'S,2'S-2-(2'-carboxycyclopropyl)glycine (L-CCG I) or (1S,3R)-1-aminocyclo-pentane-1,3-dicarboxylic acid (1S,3R-ACPD). DHPG, 1S,3R-ACPD, and S-4C3HPG also evoked a rapidly desensitizing increase in [Ca2+]i in cortical layers of neonatal brain slices. (R,S)-alpha-methyl-4-tetrazolyl-phenylglycine (MTPG), and (R,S)-alpha-methyl-4-phosphono-phenylglycine (MPPG) inhibited the increase of phosphoinositide hydrolysis elicited by 1S,3R-ACPD but not that by R,S-DHPG. In contrast, the selective group II receptor agonist (1S,2S,5R,6S)-2-amino-bicyclo-[3.1.0]-hexane-2,6-dicarboxylate (LY 354740) potentiated the response of R,S-DHPG. Finally, 8-(4-chlorophenylthio)-cAMP, a membrane permeant analogue of cAMP, reversed the stimulatory effect of 1S,3R-ACPD and S-4C3HPG on phosphoinositide hydrolysis and [Ca2+]i mobilization, without affecting the response induced by R,S-DHPG. These data suggest that, in neonatal rat cortex, the activation of group II metabotropic glutamate receptors potentiates the phosphoinositide hydrolysis and [Ca2+]i responses mediated by group I metabotropic glutamate receptors. PMID:9369360

  17. Forskolin-inducible cAMP Pathway Negatively Regulates T-cell Proliferation by Uncoupling the Interleukin-2 Receptor Complex*

    PubMed Central

    Rodriguez, Georgialina; Ross, Jeremy A.; Nagy, Zsuzsanna S.; Kirken, Robert A.

    2013-01-01

    Cytokine-mediated regulation of T-cell activity involves a complex interplay between key signal transduction pathways. Determining how these signaling pathways cross-talk is essential to understanding T-cell function and dysfunction. In this work, we provide evidence that cross-talk exists between at least two signaling pathways: the Jak3/Stat5 and cAMP-mediated cascades. The adenylate cyclase activator forskolin (Fsk) significantly increased intracellular cAMP levels and reduced proliferation of the human T-cells via inhibition of cell cycle regulatory genes but did not induce apoptosis. To determine this inhibitory mechanism, effects of Fsk on IL-2 signaling was investigated. Fsk treatment of MT-2 and Kit 225 T-cells inhibited IL-2-induced Stat5a/b tyrosine and serine phosphorylation, nuclear translocation, and DNA binding activity. Fsk treatment also uncoupled IL-2 induced association of the IL-2Rβ and γc chain, consequently blocking Jak3 activation. Interestingly, phosphoamino acid analysis revealed that Fsk-treated cells resulted in elevated serine phosphorylation of Jak3 but not Stat5, suggesting that Fsk can negatively regulate Jak3 activity possibly mediated through PKA. Indeed, in vitro kinase assays and small molecule inhibition studies indicated that PKA can directly serine phosphorylate and functionally inactivate Jak3. Taken together, these findings suggest that Fsk activation of adenylate cyclase and PKA can negatively regulate IL-2 signaling at multiple levels that include IL-2R complex formation and Jak3/Stat5 activation. PMID:23341462

  18. cAMP-mediated regulation of cholesterol accumulation in cystic fibrosis and Niemann-Pick type C cells

    PubMed Central

    Manson, Mary E.; Corey, Deborah A.; White, Nicole M.; Kelley, Thomas J.

    2008-01-01

    The goal of this study was to identify a mechanism regulating cholesterol accumulation in cystic fibrosis (CF) cells. Both CFTR activation and expression are regulated by the cAMP pathway, and it is hypothesized that a feedback response involving this pathway may be involved in the phenotype of cholesterol accumulation. To examine the role of the cAMP pathway in cholesterol accumulation, we treated two CF model cell lines with the Rp diastereomer of adenosine 3′,5′-cyclic monophosphorothioate (Rp-cAMPS) and visualized by filipin staining. Rp-cAMPS treatment eliminated cholesterol accumulation in CF cells, whereas 8-bromo-cAMP treatment led to cholesterol accumulation in wild-type cells. To confirm these findings in an independent model system, we also examined the role of cAMP in modulating cholesterol accumulation in Niemann-Pick type C (NPC) fibroblasts. Expression of the protein related to NPC, NPC1, is also directly regulated by cAMP; therefore, it is postulated that NPC cells exhibit the same cAMP-mediated control of cholesterol accumulation. Cholesterol accumulation in NPC cells also was reduced by the presence of Rp-cAMPS. Expression of β-arrestin-2 (βarr2), a marker of cellular response to cAMP signaling, was significantly elevated in CF model cells, Cftr−/− MNE, primary tissue obtained by nasal scrapes from CF subjects, and in NPC fibroblasts compared with respective controls. PMID:18790990

  19. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  20. Folic Acid

    MedlinePlus

    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  1. Folic Acid

    MedlinePlus

    Folic acid is used to treat or prevent folic acid deficiency. It is a B-complex vitamin needed by ... Folic acid comes in tablets. It usually is taken once a day. Follow the directions on your prescription label ...

  2. Aspartic acid

    MedlinePlus

    ... also called asparaginic acid. Aspartic acid helps every cell in the body work. It plays a role in: Hormone production and release Normal nervous system function Plant sources of aspartic acid include: Legumes such as ...

  3. Interplay of Ca2+ and cAMP signaling in the insulin-secreting MIN6 beta-cell line.

    PubMed

    Landa, Luis R; Harbeck, Mark; Kaihara, Kelly; Chepurny, Oleg; Kitiphongspattana, Kajorn; Graf, Oliver; Nikolaev, Viacheslav O; Lohse, Martin J; Holz, George G; Roe, Michael W

    2005-09-01

    Ca2+ and cAMP are important second messengers that regulate multiple cellular processes. Although previous studies have suggested direct interactions between Ca2+ and cAMP signaling pathways, the underlying mechanisms remain unresolved. In particular, direct evidence for Ca2+-regulated cAMP production in living cells is incomplete. Genetically encoded fluorescence resonance energy transfer-based biosensors have made possible real-time imaging of spatial and temporal gradients of intracellular cAMP concentration in single living cells. Here, we used confocal microscopy, fluorescence resonance energy transfer, and insulin-secreting MIN6 cells expressing Epac1-camps, a biosynthetic unimolecular cAMP indicator, to better understand the role of intracellular Ca2+ in cAMP production. We report that depolarization with high external K+, tolbutamide, or glucose caused a rapid increase in cAMP that was dependent on extracellular Ca2+ and inhibited by nitrendipine, a Ca2+ channel blocker, or 2',5'-dideoxyadenosine, a P-site antagonist of transmembrane adenylate cyclases. Stimulation of MIN6 cells with glucose in the presence of tetraethylammonium chloride generated concomitant Ca2+ and cAMP oscillations that were abolished in the absence of extracellular Ca2+ and blocked by 2',5'-dideoxyadenosine or 3-isobutyl-1-methylxanthine, an inhibitor of phosphodiesterase. Simultaneous measurements of Ca2+ and cAMP concentrations with Fura-2 and Epac1-camps, respectively, revealed a close temporal and causal interrelationship between the increases in cytoplasmic Ca2+ and cAMP levels following membrane depolarization. These findings indicate highly coordinated interplay between Ca2+ and cAMP signaling in electrically excitable endocrine cells and suggest that Ca2+-dependent cAMP oscillations are derived from an increase in adenylate cyclase activity and periodic activation and inactivation of cAMP-hydrolyzing phosphodiesterase. PMID:15987680

  4. Genotoxicity assessment of the antiepileptic drug AMP397, an Ames-positive aromatic nitro compound.

    PubMed

    Suter, Willi; Hartmann, Andreas; Poetter, Franziska; Sagelsdorff, Peter; Hoffmann, Peter; Martus, Hans-Jörg

    2002-07-25

    AMP397 is a novel antiepileptic agent and the first competitive AMPA antagonist with high receptor affinity, good in vivo potency, and oral activity. AMP397 has a structural alert (aromatic nitro group) and was mutagenic in Salmonella typhimurium strains TA97a, TA98 and TA100 without S9, but negative in the nitroreductase-deficient strains TA98NR and TA100NR. The amino derivative of AMP397 was negative in wild-type strains TA98 and TA100. AMP397 was negative in a mouse lymphoma tk assay, which included a 24h treatment without S9. A weak micronucleus induction in vitro was found at the highest concentrations tested in V79 cells with S9. AMP397 was negative in the following in vivo studies, which included the maximum tolerated doses of 320mg/kg in mice and 2000mg/kg in rats: MutaMouse assay in colon and liver (5x320mg/kg) at three sampling times (3, 7 and 31 days after the last administration); DNA binding study in the liver of mice and rats after a single treatment with [14C]-AMP397; comet assay (1x2000mg/kg) in jejunum and liver of rats, sampling times 3 and 24h after administration; micronucleus test (2x320mg/kg) in the bone marrow of mice, sampling 24h after the second administration. Based on these results, it was concluded that AMP397 has no genotoxic potential in vivo. In particular, no genotoxic metabolite is formed in mammalian cells, and, if formed by intestinal bacteria, is unable to exert any genotoxic activity in the adjacent intestinal tissue. These data were considered to provide sufficient safety to initiate clinical development of the compound. PMID:12113769

  5. Ser364 of connexin43 and the upregulation of gap junction assembly by cAMP

    PubMed Central

    TenBroek, Erica M.; Lampe, Paul D.; Solan, Joell L.; Reynhout, James K.; Johnson, Ross G.

    2001-01-01

    The assembly of gap junctions (GJs) is a process coordinated by growth factors, kinases, and other signaling molecules. GJ assembly can be enhanced via the elevation of cAMP and subsequent stimulation of connexon trafficking to the plasma membrane. To study the positive regulation of GJ assembly, fibroblasts derived from connexin (Cx)43 knockout (KO) and wild-type (WT) mice were transfected with WT Cx43 (WTCx43) or mutant Cx43. GJ assembly between untransfected WT fibroblasts or stably transfected WTCx43/KO fibroblasts was increased two- to fivefold by 8Br-cAMP, and this increase could be blocked by inhibition of cAMP-dependent protein kinase (PKA) or truncation of the Cx43 COOH terminus (CT). Although serine 364 (S364) of the Cx43 CT was determined to be a major site of phosphorylation, the molar ratio of Cx43 phosphorylation was not increased by 8Br-cAMP. Importantly, GJ assembly between either S364ECx43/KO or S364ECx43/WT fibroblasts was stimulated by 8Br-cAMP, but that between S364ACx43/KO or S364PCx43/KO fibroblasts was not stimulated, indicating that phosphorylation or a negative charge at S364 is required for enhancement of GJ assembly by cAMP. Furthermore, GJ assembly between S364ACx43/WT fibroblasts could be stimulated by 8Br-cAMP, but could not be between S364PCx43/WT fibroblasts. Thus, S364PCx43 interferes with enhanced GJ assembly when coexpressed with WTCx43. PMID:11756479

  6. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

    PubMed Central

    El Mahdy, Taghrid S.; Shibl, Atef M.

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried blaCTX-M-15, and two isolates carried blaCTX-M-14 gene. Two CTX-M-positive E. coli isolates carried blaCMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  7. Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli.

    PubMed

    Al-Agamy, Mohamed H; El Mahdy, Taghrid S; Shibl, Atef M

    2016-01-01

    Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried bla CTX-M-15, and two isolates carried bla CTX-M-14 gene. Two CTX-M-positive E. coli isolates carried bla CMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection. PMID:27340657

  8. Nuclease-resistant c-di-AMP derivatives that differentially recognize RNA and protein receptors

    PubMed Central

    Meehan, Robert E.; Torgerson, Chad D.; Gaffney, Barbara L.; Jones, Roger A.; Strobel, Scott A.

    2016-01-01

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3’-5’-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activate specific pathways and mediate phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogs, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-AMP and structurally related second messengers by discriminating against an amine at the C2 position, more than a carbonyl at the C6 position. We also identified phosphate-modified analogs that bind both the ydaO RNA and GdpP protein with high affinity, while symmetrically-modified ribose analogs exhibited a substantial decrease in ydaO affinity, but retained high affinity for GdpP. These ligand modifications resulted in increased resistance to enzyme-catalyzed hydrolysis by the GdpP enzyme. Together, these data suggest that these c-di-AMP analogs could be useful as chemical tools to specifically target subsections of the second-messenger signaling pathways. PMID:26789423

  9. Cholesterol ester hydrolase in pig liver is activated by cyclic AMP-dependent protein kinase

    SciTech Connect

    Chen, J.J.S.; Dubin, E.; Margolis, S.

    1986-05-01

    To examine whether hepatic neutral cholesterol ester hydrolase (CEH) is regulated by phosphorylation, the authors have assayed CEH activity from pig liver cytosol by measuring /sup 14/C-oleate release from labeled cholesteryl oleate at pH 7.4. When pig liver cytosol was incubated with 2 mM Mg and 0.5 mM ATP, CEH activity was increased (141 +/- 8% of control, mean +/- SEM). Addition of 25..mu..M cyclic AMP (cAMP) further activated CEH activity (164 +/- 4% of control) as compared to incubation with Mg and ATP (p < 0.02). In the presence of 5 mM EDTA or in the absence of either Mg or ATP, no activation of CEH was observed. The activation was completely abolished by further incubation of activated cytosol with E. coli alkaline phosphatase. Activation of CEH activity was partially prevented by the addition of protein kinase inhibitor (p < 0.02) and this effect was completely reversed in the presence of exogenous cAMP-dependent protein kinase (p < 0.05). To examine further the role of the cAMP-dependent protein kinase, CEH activity was purified 240-fold by 35% (NH/sub 4/)/sub 2/SO/sub 4/ precipitation and Sepharose 4B chromatography. Incubation of partially purified CEH fractions with Mg, ATP and cAMP did not increase CEH activity. Addition of exogenous cAMP-dependent protein kinase activated CEH activity of partially purified fractions. The authors observations indicate that pig liver CEH is activated by phosphorylation mediated by cAMP-dependent protein kinase.

  10. Caveolin-3 regulates compartmentation of cardiomyocyte beta2-adrenergic receptor-mediated cAMP signaling.

    PubMed

    Wright, Peter T; Nikolaev, Viacheslav O; O'Hara, Thomas; Diakonov, Ivan; Bhargava, Anamika; Tokar, Sergiy; Schobesberger, Sophie; Shevchuk, Andrew I; Sikkel, Markus B; Wilkinson, Ross; Trayanova, Natalia A; Lyon, Alexander R; Harding, Sian E; Gorelik, Julia

    2014-02-01

    The purpose of this study was to investigate whether caveolin-3 (Cav3) regulates localization of β2-adrenergic receptor (β2AR) and its cAMP signaling in healthy or failing cardiomyocytes. We co-expressed wildtype Cav3 or its dominant-negative mutant (Cav3DN) together with the Förster resonance energy transfer (FRET)-based cAMP sensor Epac2-camps in adult rat ventricular myocytes (ARVMs). FRET and scanning ion conductance microscopy were used to locally stimulate β2AR and to measure cytosolic cAMP. Cav3 overexpression increased the number of caveolae and decreased the magnitude of β2AR-cAMP signal. Conversely, Cav3DN expression resulted in an increased β2AR-cAMP response without altering the whole-cell L-type calcium current. Following local stimulation of Cav3DN-expressing ARVMs, β2AR response could only be generated in T-tubules. However, the normally compartmentalized β2AR-cAMP signal became diffuse, similar to the situation observed in heart failure. Finally, overexpression of Cav3 in failing myocytes led to partial β2AR redistribution back into the T-tubules. In conclusion, Cav3 plays a crucial role for the localization of β2AR and compartmentation of β2AR-cAMP signaling to the T-tubules of healthy ARVMs, and overexpression of Cav3 in failing myocytes can partially restore the disrupted localization of these receptors. PMID:24345421

  11. Control of heart rate by cAMP sensitivity of HCN channels

    PubMed Central

    Alig, Jacqueline; Marger, Laurine; Mesirca, Pietro; Ehmke, Heimo; Mangoni, Matteo E.; Isbrandt, Dirk

    2009-01-01

    “Pacemaker” f-channels mediating the hyperpolarization-activated nonselective cation current If are directly regulated by cAMP. Accordingly, the activity of f-channels increases when cellular cAMP levels are elevated (e.g., during sympathetic stimulation) and decreases when they are reduced (e.g., during vagal stimulation). Although these biophysical properties seem to make f-channels ideal molecular targets for heart rate regulation by the autonomic nervous system, the exact contribution of the major If-mediating cardiac isoforms HCN2 and HCN4 to sinoatrial node (SAN) function remains highly controversial. To directly investigate the role of cAMP-dependent regulation of hyperpolarization activated cyclic nucleotide activated (HCN) channels in SAN activity, we generated mice with heart-specific and inducible expression of a human HCN4 mutation (573X) that abolishes the cAMP-dependent regulation of HCN channels. We found that hHCN4–573X expression causes elimination of the cAMP sensitivity of If and decreases the maximum firing rates of SAN pacemaker cells. In conscious mice, hHCN4–573X expression leads to a marked reduction in heart rate at rest and during exercise. Despite the complete loss of cAMP sensitivity of If, the relative extent of SAN cell frequency and heart rate regulation are preserved. Our data demonstrate that cAMP-mediated regulation of If determines basal and maximal heart rates but does not play an indispensable role in heart rate adaptation during physical activity. Our data also reveal the pathophysiologic mechanism of hHCN4–573X–linked SAN dysfunction in humans. PMID:19570998

  12. Nuclease-Resistant c-di-AMP Derivatives That Differentially Recognize RNA and Protein Receptors.

    PubMed

    Meehan, Robert E; Torgerson, Chad D; Gaffney, Barbara L; Jones, Roger A; Strobel, Scott A

    2016-02-16

    The ability of bacteria to sense environmental cues and adapt is essential for their survival. The use of second-messenger signaling molecules to translate these cues into a physiological response is a common mechanism employed by bacteria. The second messenger 3'-5'-cyclic diadenosine monophosphate (c-di-AMP) has been linked to a diverse set of biological processes involved in maintaining cell viability and homeostasis, as well as pathogenicity. A complex network of both protein and RNA receptors inside the cell activates specific pathways and mediates phenotypic outputs in response to c-di-AMP. Structural analysis of these RNA and protein receptors has revealed the different recognition elements employed by these effectors to bind the same small molecule. Herein, using a series of c-di-AMP analogues, we probed the interactions made with a riboswitch and a phosphodiesterase protein to identify the features important for c-di-AMP binding and recognition. We found that the ydaO riboswitch binds c-di-AMP in two discrete sites with near identical affinity and a Hill coefficient of 1.6. The ydaO riboswitch distinguishes between c-di-