Science.gov

Sample records for 2-acrylamido-2-methyl-1-propanesulfonic acid amps

  1. SYNTHESIS AND IN VITRO CHARACTERIZATION OF HYDROXYPROPYL METHYLCELLULOSE-GRAFT-POLY (ACRYLIC ACID/2-ACRYLAMIDO-2-METHYL-1-PROPANESULFONIC ACID) POLYMERIC NETWORK FOR CONTROLLED RELEASE OF CAPTOPRIL.

    PubMed

    Furqan Muhammad, Iqbal; Mahmood, Ahmad; Aysha, Rashid

    2016-01-01

    A super-absorbent hydrogel was developed by crosslinking of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and acrylic acid with hydroxypropyl methylcellulose (HPMC) for controlled release drug delivery of captopril, a well known antihypertensive drug. Acrylic acid and AMPS were polymerized and crosslinked with HPMC by free radical polymerization, a widely used chemical crosslinking method. N,N'-methylenebisacrylamide (MBA) and potassium persulfate (KPS) were added as cross-linker and initiator, respectively. The hydrogel formulation was loaded with captopril (as model drug). The concentration of captopril was monitored at 205 nm using UV spectrophotometer. Equilibrium swelling ratio was determined at pH 2, 4.5 and 7.4 to evaluate the pH responsiveness of the formed hydrogel. The super-absorbent hydrogels were evaluated by FTIR, SEM, XRD, and thermal analysis (DSC and TGA). The formation of new copolymeric network was determined by FTIR, XRD, TGA and DSC analysis. The hydrogel formulations with acrylic acid and AMPS ratio of 4: 1 and lower amounts of crosslinker had shown maximum swelling. Moreover, higher release rate of captopril was observed at pH 7.4 than at pH 2, because of more swelling capacity of copolymer with increasing pH of the aqueous medium. The present research work confirms the development of a stable hydrogel comprising of HPMC with acrylic acid and AMPS. The prepared hydrogels exhibited pH sensitive behav-ior. This superabsorbent composite prepared could be a successful drug carrier for treating hypertension. PMID:27008813

  2. 2-Acrylamido-2-methyl-1-propanesulfonic Acid Grafted Poly(vinylidene fluoride-co-hexafluoropropylene)-Based Acid-/Oxidative-Resistant Cation Exchange for Membrane Electrolysis.

    PubMed

    Pandey, Ravi P; Das, Arindam K; Shahi, Vinod K

    2015-12-30

    For developing acid-/oxidative-resistant aliphatic-polymer-based cation-exchange membrane (CEM), macromolecular modification of poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-co-HFP) was carried out by controlled chemical grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS). To introduce the unsaturation suitable for chemical grafting, dehydrofluorination of commercially available PVDF-co-HFP was achieved under alkaline medium. Sulfonated copolymer (SCP) was prepared by the free radical copolymerization of dehydofluorinated PVDF-co-HFP (DHPVDF-co-HFP) and AMPS in the presence of free radical initiator. Prepared SCP-based CEMs were analyzed for their morphological characteristics, ion-exchange capacity (IEC), water uptake, conductivity, and stabilities (mechanical, chemical, and thermal) in comparison with state-of-art Nafion117 membrane. High bound water content avoids the membrane dehydration, and most optimal (SCP-1.33) membrane exhibited about ∼2.5-fold high bound water content in comparison with that of Nafion117 membrane. Bunsen reaction of iodine-sulfur (I-S) was successfully performed by direct-contact-mode membrane electrolysis in a two-compartment electrolytic cell using different SCP membranes. High current efficiency (83-99%) confirmed absence of any side reaction and 328.05 kJ mol-H2(-1) energy was required for to produce 1 mol of H2 by electrolytic cell with SCP-1.33 membrane. In spite of low conductivity for reported SCP membrane in comparison with that of Nafion117 membrane, SCP-1.33 membrane was assessed as suitable candidate for electrolysis because of its low-cost nature and excellent stabilities in highly acidic environment may be due to partial fluorinated segments in the membrane structure.

  3. 2-Acrylamido-2-methyl-1-propanesulfonic Acid Grafted Poly(vinylidene fluoride-co-hexafluoropropylene)-Based Acid-/Oxidative-Resistant Cation Exchange for Membrane Electrolysis.

    PubMed

    Pandey, Ravi P; Das, Arindam K; Shahi, Vinod K

    2015-12-30

    For developing acid-/oxidative-resistant aliphatic-polymer-based cation-exchange membrane (CEM), macromolecular modification of poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-co-HFP) was carried out by controlled chemical grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS). To introduce the unsaturation suitable for chemical grafting, dehydrofluorination of commercially available PVDF-co-HFP was achieved under alkaline medium. Sulfonated copolymer (SCP) was prepared by the free radical copolymerization of dehydofluorinated PVDF-co-HFP (DHPVDF-co-HFP) and AMPS in the presence of free radical initiator. Prepared SCP-based CEMs were analyzed for their morphological characteristics, ion-exchange capacity (IEC), water uptake, conductivity, and stabilities (mechanical, chemical, and thermal) in comparison with state-of-art Nafion117 membrane. High bound water content avoids the membrane dehydration, and most optimal (SCP-1.33) membrane exhibited about ∼2.5-fold high bound water content in comparison with that of Nafion117 membrane. Bunsen reaction of iodine-sulfur (I-S) was successfully performed by direct-contact-mode membrane electrolysis in a two-compartment electrolytic cell using different SCP membranes. High current efficiency (83-99%) confirmed absence of any side reaction and 328.05 kJ mol-H2(-1) energy was required for to produce 1 mol of H2 by electrolytic cell with SCP-1.33 membrane. In spite of low conductivity for reported SCP membrane in comparison with that of Nafion117 membrane, SCP-1.33 membrane was assessed as suitable candidate for electrolysis because of its low-cost nature and excellent stabilities in highly acidic environment may be due to partial fluorinated segments in the membrane structure. PMID:26642107

  4. Hemocompatible poly(NIPAm-MBA-AMPS) colloidal nanoparticles as carriers of anti-inflammatory cell penetrating peptides.

    PubMed

    Bartlett, Rush L; Medow, Matthew R; Panitch, Alyssa; Seal, Brandon

    2012-04-01

    Anionic copolymer systems containing sulfated monomers have great potential for delivery of cationic therapeutics, but N-isopropylacrylamide (NIPAm) 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) copolymer nanoparticles have seen limited characterization to date with regard to physical properties relevant to loading and release of therapeutics. Characterization of polymeric nanoparticles incorporating AMPS showed an increased size and decreased thermodynamic swelling ratios of AMPS containing particles as compared to NIPAm nanoparticles lacking AMPS. Particles with increasing AMPS addition showed an increased propensity for uniformity, intraparticle colloidal stability, and drug loading capacity. Peptide encapsulated in particles was shielded from peptide degradation in serum. Particles were shown not impede blood coagulation or to cause hemolysis. This study has demonstrated that AMPS incorporation into traditional NIPAm nanoparticles presents a tunable parameter for changing particle LCST, size, swelling ratio, ζ potential, and cationic peptide loading potential. This one-pot synthesis results in a thermosensitive anionic nanoparticle system that is a potentially useful platform to deliver cationic cell penetrating peptides.

  5. Hemocompatible poly(NIPAm-MBA-AMPS) colloidal nanoparticles as carriers of anti-inflammatory cell penetrating peptides.

    PubMed

    Bartlett, Rush L; Medow, Matthew R; Panitch, Alyssa; Seal, Brandon

    2012-04-01

    Anionic copolymer systems containing sulfated monomers have great potential for delivery of cationic therapeutics, but N-isopropylacrylamide (NIPAm) 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) copolymer nanoparticles have seen limited characterization to date with regard to physical properties relevant to loading and release of therapeutics. Characterization of polymeric nanoparticles incorporating AMPS showed an increased size and decreased thermodynamic swelling ratios of AMPS containing particles as compared to NIPAm nanoparticles lacking AMPS. Particles with increasing AMPS addition showed an increased propensity for uniformity, intraparticle colloidal stability, and drug loading capacity. Peptide encapsulated in particles was shielded from peptide degradation in serum. Particles were shown not impede blood coagulation or to cause hemolysis. This study has demonstrated that AMPS incorporation into traditional NIPAm nanoparticles presents a tunable parameter for changing particle LCST, size, swelling ratio, ζ potential, and cationic peptide loading potential. This one-pot synthesis results in a thermosensitive anionic nanoparticle system that is a potentially useful platform to deliver cationic cell penetrating peptides. PMID:22452800

  6. Structural organization of films based on polyaniline/polysulfonic acid complexes depending on the synthesis method

    SciTech Connect

    Simagina, L. V. Gaynutdinov, R. V.; Stepina, N. D.; Sorokina, K. L.; Morozova, O. V.; Shumakovich, G. P.; Yaropolov, A. I.; Tolstikhina, A. L.

    2010-07-15

    The optical properties and morphology of complexes based on polyaniline (PANI) and poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPS), depending on their synthesis conditions, have been characterized by UV-visible spectroscopy and atomic force microscopy. The dependence of the electron absorption spectra of PANI/PAMPS complexes and the surface topography of their films on the initiation way of PANI formation (chemical and enzymatic) and the use of promoters of aniline polymerization has been investigated. The aniline polymerization kinetics with and without polymerization promoters has been studied. All PANI/PAMPS complexes are found to have a nanocomposite time-stable structure.

  7. Poly(NIPAm-AMPS) nanoparticles for targeted delivery of anti-inflammatory cell penetrating peptides

    NASA Astrophysics Data System (ADS)

    Bartlett, Rush Lloyd, II

    Inflammatory diseases such as osteoarthritis and rheumatoid arthritis cause $127.8 billion in US healthcare expenditures each year and are the cause of disability for 27% of disabled persons in the United States. Current treatment options rarely halt disease progression and often result in significant unwanted and debilitating side effects. Our laboratory has previously developed a family of cell penetrating peptides (CPPs) which inhibit the activity of mitogen activated protein kinase activate protein kinase 2 (MK2). MK2 mediates the inflammatory response by activating Tristetraprline (TTP). Once activated, TTP rapidly stabilizes AU rich regions of pro-inflammatory cytokine mRNA which allows translation of pro-inflammatory cytokines to occur. Blocking MK2 with our labs CPPs yields a decrease in inflammatory activity but CPPs by are highly non specific and prone to rapid enzymatic degradation in vivo.. In order to increase the potency of MK2 inhibiting CPPs we have developed a novel nanoparticle drug carrier composed of poly(N-isopropylacrylamide-co-2-acrylamido-2-methyl-1-propanesulfonic acid). This drug carrier has been shown to have preliminary efficacy in vitro and ex vivo for suppressing pro-inflammatory cytokine production when releasing CPPs. This thesis will present progress made on three aims: Specific Aim 1) Create and validate a NIPAm based drug delivery system that mimics the binding and release previously observed between cell penetrating peptides and glycosaminoglycans. Specific Aim 2) Engineer degradability into poly(NIPAm-AMPS) nanoparticles to enable more drug to be released and qualify that system in vitro. Specific Aim 3) Validate poly(NIPAm-AMPS) nanoparticles for targeted drug delivery in an ex vivo inflammatory model. Overall we have developed a novel anionic nanoparticle system that is biocompatible and efficient at loading and releasing cell penetrating peptides to inflamed tissue. Once loaded with a CPP the nanoparticle drug complex is

  8. Preparation and evaluation of rigid porous polyacrylamide-based strong cation-exchange monolithic columns for capillary electrochromatography.

    PubMed

    Dong, Jing; Ou, Junjie; Dong, Xiaoli; Wu, Renan; Ye, Mingliang; Zou, Hanfa

    2007-11-01

    A CEC monolithic column with strong cation-exchange (SCX) stationary phase based on hydrophilic monomers was prepared by in situ polymerization of acrylamide, methylenebisacrylamide, and 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) in a complete organic binary porogenic solvent consisting of DMSO and dodecanol. The sulfonic groups provided by the monomer AMPS on the surface of the stationary phase generate an EOF from anode to cathode, and serve as an SCX stationary phase at the same time. The monolithic stationary phase exhibited normal-phase chromatographic behavior for neutral analytes. For charged analytes, electrostatic interaction/repulsion with the monolith was observed. The strong SCX monolithic column has been successfully employed in the electrochromatographic separation of basic drugs, peptides, and alkaloids extracted from natural products.

  9. Superabsorbent nanocomposite (alginate-g-PAMPS/MMT): synthesis, characterization and swelling behavior.

    PubMed

    Yadav, Mithilesh; Rhee, Kyong Yop

    2012-09-01

    A superabsorbent composite (alginate-g-PAMPS/MMT) was prepared by graft copolymerization from alginate, 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) and Na+ montmorillonite (MMT) in an inert atmosphere. Effects of polymerization variables on water absorbency, including the content of Na+ montmorillonite, sodium alginate, N,N'-methylenebisacrylamide and AMPS, were studied. The introduced montmorillonite formed a loose and porous surface and improved the water absorbency of the alginate-g-PAMPS/MMT superabsorbent composite. Swelling behaviors of the superabsorbent composites in various cationic salt solutions (NaCl, CaCl2 and FeCl3) and anionic salt solutions (NaCl and Na2SO4) were also systematically investigated. The superabsorbent composite was further characterized using Fourier transform infrared spectroscopy (FTIR), rheology, thermogravimetric analysis (TGA), X-ray diffraction (XRD) and scanning electron microscopy (SEM) taking alginate-g-PAMPS as a reference. PMID:24751026

  10. Preparation and evaluation of rigid porous polyacrylamide-based strong cation-exchange monolithic columns for capillary electrochromatography.

    PubMed

    Dong, Jing; Ou, Junjie; Dong, Xiaoli; Wu, Renan; Ye, Mingliang; Zou, Hanfa

    2007-11-01

    A CEC monolithic column with strong cation-exchange (SCX) stationary phase based on hydrophilic monomers was prepared by in situ polymerization of acrylamide, methylenebisacrylamide, and 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) in a complete organic binary porogenic solvent consisting of DMSO and dodecanol. The sulfonic groups provided by the monomer AMPS on the surface of the stationary phase generate an EOF from anode to cathode, and serve as an SCX stationary phase at the same time. The monolithic stationary phase exhibited normal-phase chromatographic behavior for neutral analytes. For charged analytes, electrostatic interaction/repulsion with the monolith was observed. The strong SCX monolithic column has been successfully employed in the electrochromatographic separation of basic drugs, peptides, and alkaloids extracted from natural products. PMID:17924588

  11. Preparation and characterization of polymer electrolyte membranes based on silicon-containing core-shell structured nanocomposite latex particles

    NASA Astrophysics Data System (ADS)

    Zhong, Shuangling; Sun, Chenggang; Gao, Yushan; Cui, Xuejun

    2015-09-01

    A series of silicon-containing core-shell structured polyacrylate/2-acrylamido-2-methyl-1-propanesulfonic acid (SiO2-CS-PA/A) nanocomposite latex particles are prepared by the emulsifier-free emulsion polymerization of acrylate monomers and various amount of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) with colloidal nanosilica particles as seed. The chemical and morphological structures of latex particles with high monomer conversion are determined using Fourier transform infrared (FTIR), dynamic light scattering (DLS) and transmission electron microscopy (TEM). The SiO2-CS-PA/A nanocomposite membranes are fabricated through pouring the latex onto a clean surface of glass and drying at 60 °C for 10 h and 120 °C for 2 h. The nanocomposite membranes possess good thermal and dimensional stability. In addition, in comparison to Nafion® 117, the nanocomposite membranes exhibit moderate proton conductivity, significantly better methanol barrier and selectivity. The methanol diffusion coefficient is in the range of 1.03 × 10-8 to 5.26 × 10-8 cm2 s-1 which is about two orders of magnitude lower than that of Nafion® 117 (2.36 × 10-6 cm2 s-1). The SiO2-CS-PA/A 5 membrane shows the highest selectivity value (2.34 × 105 S cm-3) which is approximately 11.0 times of that (2.13 × 104 S cm-3) of Nafion® 117. These results indicate that the nanocomposite membranes are promising candidates to be used as polymer electrolyte membranes in direct methanol fuel cells.

  12. A Doped Polyaniline Modified Electrode Amperometric Biosensor for Gluconic Acid Determination in Grapes

    PubMed Central

    Albanese, Donatella; Malvano, Francesca; Sannini, Adriana; Pilloton, Roberto; Di Matteo, Marisa

    2014-01-01

    In winemaking gluconic acid is an important marker for quantitative evaluation of grape infection by Botrytis cinerea. A screen-printed amperometric bienzymatic sensor for the determination of gluconic acid based on gluconate kinase (GK) and 6-phospho-D-gluconate dehydrogenase (6PGDH) coimmobilized onto polyaniline/poly (2-acrylamido-2-methyl-1-propanesulfonic acid; PANI-PAAMPSA) is reported in this study. The conductive polymer electrodeposed on the working electrode surface allowed the detection of NADH at low potential (0.1 V) with a linear range from 4 × 10−3 to 1 mM (R2 = 0.99) and a sensitivity of 419.44 nA·mM−1. The bienzymatic sensor has been optimized with regard to GK/6PGDH enzymatic unit ratio and ATP/NADP+ molar ratio which resulted equal to 0.33 and 1.2, respectively. Under these conditions a sensitivity of 255.2 nA·mM−1, a limit of detection of 5 μM and a Relative Standard Deviation (RSD) of 4.2% (n = 5) have been observed. Finally, the biosensor has been applied for gluconic acid measurements in must grape samples and the matrix effect has been taken into consideration. The results have been compared with those obtained on the same samples with a commercial kit based on a spectrophotometric enzyme assay and were in good agreement, showing the capability of the bienzymatic PANI-PAAMPSA biosensor for gluconic acid measurements and thus for the evaluation of Botrytis cinerea infection in grapes. PMID:24960084

  13. [Preparation of a strong cation-exchange polymer monolith and its application in determination of melamine in milk products].

    PubMed

    Ma, Qiao; Hu, Xizhou; Huang, Jincui; Feng, Yuqi

    2009-09-01

    A poly (2-acrylamido-2-methyl-1-propanesulfonic acid-co-ethylene dimethacrylate) (AMPS-co-EDMA) monolith was prepared in a fused-silica capillary (530 microm i.d.) and applied for polymer monolith microextraction (PMME). With the optimal ratio of N, N-dimethyl-formamide (DMF, porogen) and polyethylene glycol (PEG, co-porogen), the resulting monolith exhibited satisfactory permeability, high mechanical strength and good stability in aqueous buffer. The effects of several parameters to PMME were investigated, such as pH value, inorganic salt and organic phase concentration of the sample matrix. It demonstrated that the melamine was captured on the poly (AMPS-co-EDMA) monolith mainly through strong cation-exchange and hydrophobic interactions. A novel approach is presented for the determination of melamine in milk products by coupling PMME to high performance liquid chromatography with ultraviolet detection. Because of the high extraction capacity of the monolith towards melamine, low detection limits (S/N = 3, 0.9 mg/kg) and quantification limits (S/N = 10, 0.3 mg/kg) were obtained. The method showed good linearity ranging from 0.5 to 80 mg/kg. Excellent reproducibility of the method was exhibited by intraday and interday precisions, yielding the relative standard deviations not larger than 7.5%. The proposed method is simple, rapid, sensitive, and low cost.

  14. Immobilization of Stimuli-Responsive Nanogels onto Honeycomb Porous Surfaces and Controlled Release of Proteins.

    PubMed

    De León, A S; Molina, M; Wedepohl, S; Muñoz-Bonilla, A; Rodríguez-Hernández, J; Calderón, M

    2016-02-23

    In this article, we describe the formation of functional honeycomb-like porous surfaces fabricated by the breath figures technique using blends of either amino-terminated poly(styrene) or a poly(styrene)-b-poly(acrylic acid) block copolymer with homopoly(styrene). Thus, the porous interfaces exhibited either amino or acid groups selectively located inside of the holes, which were subsequently employed to anchor stimuli-responsive nanogels by electrostatic interactions. These nanogels were prepared from poly(N-isopropylacrylamide) (PNIPAM) cross-linked with dendritic polyglycerol (dPG) and semi-interpenetrated with either 2-(dimethylamino)ethyl methacrylate (DMAEMA) or 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS) to produce positively and negatively charged nanogel surfaces, respectively. The immobilization of these semi-interpenetrated networks onto the surfaces allowed us to have unique stimuli-responsive surfaces with both controlled topography and composition. More interestingly, the surfaces exhibited stimuli-responsive behavior by variations on the pH or temperature. Finally, the surfaces were evaluated regarding their capacity to induce a thermally triggered protein release at temperatures above the cloud point temperature (T(cp)) of the nanogels. PMID:26818564

  15. Synthesis, characterization and application of a new chelating resin for solid phase extraction, preconcentration and determination of trace metals in some dairy samples by flame atomic absorption spectrometry.

    PubMed

    Daşbaşı, Teslima; Saçmacı, Şerife; Çankaya, Nevin; Soykan, Cengiz

    2016-11-15

    In this study, a simple and rapid solid phase extraction/preconcentration procedure was developed for determination of Cd(II), Co(II), Cr(III), Cu(II), Fe(III), Mn(II), Pb(II), and Zn(II) trace metals by flame atomic absorption spectrometry (FAAS). A new chelating resin, poly(N-cyclohexylacrylamide-co-divinylbenzene-co-2-acrylamido-2-methyl-1-propanesulfonic acid) (NCA-co-DVB-co-AMPS) (hereafter CDAP) was synthesized and characterized. The influences of the analytical parameters such as pH of the sample solution, type and concentration of eluent, flow rates of the sample and eluent, volume of the sample and eluent, amount of chelating resin, and interference of ions were examined. The limit of detection (LOD) of analytes were found (3s) to be in the range of 0.65-1.90μgL(-1). Preconcentration factor (PF) of 200 and the relative standard deviation (RSD) of ⩽2% were achieved (n=11). The developed method was applied for determination of analytes in some dairy samples and certified reference materials. PMID:27283608

  16. Adhesion, Proliferation and Migration of NIH/3T3 Cells on Modified Polyaniline Surfaces

    PubMed Central

    Rejmontová, Petra; Capáková, Zdenka; Mikušová, Nikola; Maráková, Nela; Kašpárková, Věra; Lehocký, Marián; Humpolíček, Petr

    2016-01-01

    Polyaniline shows great potential and promises wide application in the biomedical field thanks to its intrinsic conductivity and material properties, which closely resemble natural tissues. Surface properties are crucial, as these predetermine any interaction with biological fluids, proteins and cells. An advantage of polyaniline is the simple modification of its surface, e.g., by using various dopant acids. An investigation was made into the adhesion, proliferation and migration of mouse embryonic fibroblasts on pristine polyaniline films and films doped with sulfamic and phosphotungstic acids. In addition, polyaniline films supplemented with poly (2-acrylamido-2-methyl-1-propanesulfonic) acid at various ratios were tested. Results showed that the NIH/3T3 cell line was able to adhere, proliferate and migrate on the pristine polyaniline films as well as those films doped with sulfamic and phosphotungstic acids; thus, utilization of said forms in biomedicine appears promising. Nevertheless, incorporating poly (2-acrylamido-2-methyl-1-propanesulfonic) acid altered the surface properties of the polyaniline films and significantly affected cell behavior. In order to reveal the crucial factor influencing the surface/cell interaction, cell behavior is discussed in the context of the surface energy of individual samples. It was clearly demonstrated that the lesser the difference between the surface energy of the sample and cell, the more cyto-compatible the surface is. PMID:27649159

  17. Adhesion, Proliferation and Migration of NIH/3T3 Cells on Modified Polyaniline Surfaces.

    PubMed

    Rejmontová, Petra; Capáková, Zdenka; Mikušová, Nikola; Maráková, Nela; Kašpárková, Věra; Lehocký, Marián; Humpolíček, Petr

    2016-01-01

    Polyaniline shows great potential and promises wide application in the biomedical field thanks to its intrinsic conductivity and material properties, which closely resemble natural tissues. Surface properties are crucial, as these predetermine any interaction with biological fluids, proteins and cells. An advantage of polyaniline is the simple modification of its surface, e.g., by using various dopant acids. An investigation was made into the adhesion, proliferation and migration of mouse embryonic fibroblasts on pristine polyaniline films and films doped with sulfamic and phosphotungstic acids. In addition, polyaniline films supplemented with poly (2-acrylamido-2-methyl-1-propanesulfonic) acid at various ratios were tested. Results showed that the NIH/3T3 cell line was able to adhere, proliferate and migrate on the pristine polyaniline films as well as those films doped with sulfamic and phosphotungstic acids; thus, utilization of said forms in biomedicine appears promising. Nevertheless, incorporating poly (2-acrylamido-2-methyl-1-propanesulfonic) acid altered the surface properties of the polyaniline films and significantly affected cell behavior. In order to reveal the crucial factor influencing the surface/cell interaction, cell behavior is discussed in the context of the surface energy of individual samples. It was clearly demonstrated that the lesser the difference between the surface energy of the sample and cell, the more cyto-compatible the surface is. PMID:27649159

  18. Adhesion, Proliferation and Migration of NIH/3T3 Cells on Modified Polyaniline Surfaces.

    PubMed

    Rejmontová, Petra; Capáková, Zdenka; Mikušová, Nikola; Maráková, Nela; Kašpárková, Věra; Lehocký, Marián; Humpolíček, Petr

    2016-09-15

    Polyaniline shows great potential and promises wide application in the biomedical field thanks to its intrinsic conductivity and material properties, which closely resemble natural tissues. Surface properties are crucial, as these predetermine any interaction with biological fluids, proteins and cells. An advantage of polyaniline is the simple modification of its surface, e.g., by using various dopant acids. An investigation was made into the adhesion, proliferation and migration of mouse embryonic fibroblasts on pristine polyaniline films and films doped with sulfamic and phosphotungstic acids. In addition, polyaniline films supplemented with poly (2-acrylamido-2-methyl-1-propanesulfonic) acid at various ratios were tested. Results showed that the NIH/3T3 cell line was able to adhere, proliferate and migrate on the pristine polyaniline films as well as those films doped with sulfamic and phosphotungstic acids; thus, utilization of said forms in biomedicine appears promising. Nevertheless, incorporating poly (2-acrylamido-2-methyl-1-propanesulfonic) acid altered the surface properties of the polyaniline films and significantly affected cell behavior. In order to reveal the crucial factor influencing the surface/cell interaction, cell behavior is discussed in the context of the surface energy of individual samples. It was clearly demonstrated that the lesser the difference between the surface energy of the sample and cell, the more cyto-compatible the surface is.

  19. Understanding Correlations Between Structure and Redox Properties in Aqueously-Dispersible, Electrically-Conductive, Polymer-Acid-Doped Polyaniline

    NASA Astrophysics Data System (ADS)

    Tarver, Jacob Daniel

    Template synthesis of polyaniline, or PANI, on poly(2-acrylamido-2-methyl-1-propanesulfonic acid), or PAAMPSA, yields aqueously-dispersible PANI-PAAMPSA particles. Through pH-resolved cyclic voltammetry and UV-vis/NIR spectroscopy measurements, PANI-PAAMPSA exhibits stable and reversible transitions to and from PANI's fully oxidized, intermediate, and fully reduced oxidation states of pernigraniline, emeraldine salt, and leucoemeraldine, respectively, in buffer solutions across a pH range of 3-7. Above pH 7, PANI-PAAMPSA exhibits direct transitions between its pernigraniline and leucoemeraldine states. Each of these states possesses unique optical properties, thus imbuing PANI-PAAMPSA with polyelectrochromism without the need to incorporate any comonomers. Transitions between each of PANI's oxidation states approach 95% completion within 10 seconds. Hysteresis, however, is observed in the electrochromic response as the film is subjected to random cycling, a conditioning effect that is attributed to the gradual relaxation of PANI-PAAMPSA particles as the electrostatic interactions between the two polymers is electrochemically moderated. Solvent-annealing PANI-PAAMPSA in dichloroacetic acid (DCA) induces dramatic structural relaxations, resulting in significant enhancements in terms of stability and reversibility in PANI-PAAMPSA's polyelectrochromic response. This DCA treatment equilibrates the structure within PANI-PAAMPSA films, obviating the dynamic relaxation processes that occur during polyelectrochromic switching with untreated films. The influence of internal film structure on PANI-PAAMPSA's polyelectrochromic ability is further investigated as a function of PANI-PAAMPSA particle size by controlling PAAMPSA's molecular characteristics. The kinetics of PANI-PAAMPSA's electrochromic transitions exhibit an inverse relationship between reaction rate and particle size. By modeling the transmission response, analogies are drawn between polymer crystallization

  20. Influence of polyelectrolyte on the thermosensitive property of PNIPAAm-based copolymer hydrogels.

    PubMed

    Zhang, Xian-Zheng; Chu, Chih-Chang

    2007-09-01

    A new family of poly(NIPAAm-co-2-acrylamido-2-methyl-1-propanesulfonic acid) [P(NIPAAm-co-AMPSA)] hydrogels was synthesized by incorporating negative charged AMPSA to the backbone of the PNIPAAm-based hydrogel. The effect of polyelectrolyte (i.e., PAMPSA) on the thermosensitive property of PNIPAAm hydrogels was investigated. It was found that P(NIPAAm-co-AMPSA) hydrogels exhibited unique honey-comb-like 3D porous structure having rigid cell wall as well as enhanced mechanical property. The incorporation of AMPSA into PNIPAAm backbones also led to a significant increase in swelling capability at room temperature when comparing to pure PNIPAAm hydrogels. In addition, the shrinking rate upon heating was significantly improved if the AMPSA content in P(NIPAAm-co-AMPSA) hydrogels was less than 10 wt%. PMID:17483894

  1. Oligoaniline-containing supramolecular block copolymer nanodielectric materials.

    PubMed

    Hardy, Christopher G; Islam, Md Sayful; Gonzalez-Delozier, Dioni; Ploehn, Harry J; Tang, Chuanbing

    2012-05-14

    We report a new generation of nanodielectric energy storage materials based on supramolecular block copolymers. In our approach, highly polarizable, conducting nanodomains are embedded within an insulating matrix through block copolymer microphase separation. An applied electric field leads to electronic polarization of the conducting domains. The high interfacial area of microphase-separated domains amplifies the polarization, leading to high dielectric permittivity. Specifically, reversible addition fragmentation transfer (RAFT) polymerization was used to prepare block copolymers with poly(methyl acrylate) (PMA) as the insulating segment and a strongly acidic dopant moiety, poly-(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA), as the basis for the conducting segment. The PAMPSA block was complexed with an oligoaniline trimer to form a dopant-conjugated moiety complex that is electronically conductive after oxidation. For the undoped neat block copolymers, the increase of the PMA block length leads to a transition in dielectric properties from ionic conductor to dielectric capacitor with polarization resulting from migration of protons within the isolated PAMPSA domains. The oligoaniline-doped copolymers show remarkably different dielectric properties. At frequencies above 200 kHz, they exhibit characteristics of dielectric capacitors with much higher permittivity and lower dielectric loss than the corresponding undoped copolymers. PMID:22331602

  2. Synthesis of magnetic composite nanoparticles enveloped in copolymers specified for scale inhibition application

    NASA Astrophysics Data System (ADS)

    Do, Bao Phuong Huu; Dung Nguyen, Ba; Duy Nguyen, Hoang; Nguyen, Phuong Tung

    2013-12-01

    We report the synthesis of magnetic iron oxide nanoparticles encapsulated in maleic acid-2-acrylamido-2-methyl-1-propanesulfonate based polymer. This composite nanoparticle is specified for the high-pressure/high-temperature (HPHT) oilfield scale inhibition application. The process includes a facile-ultrasound-supported addition reaction to obtain iron oxide nanoparticles with surface coated by oleic acid. Then via inverse microemulsion polymerization with selected monomers, the specifically designed copolymers have been formatted in nanoscale. The structure and morphology of obtained materials were characterized by transmission electron microscopy (TEM), x-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and the thermal stability. The effectiveness of synthesized compounds as a carbonate scale inhibitor was investigated by testing method NACE standard TM 03-074-95 at aging temperature of 70, 90 and 120 °C. The magnetic nanocomposite particles can be easily collected and detected demonstrating their superior monitoring ability, which is absent in the case of conventional copolymer-based scale inhibitor.

  3. Exploiting the Different Polarity in Piezoresistive Characteristics of Conducting Polymers for Strain Gauge Applications

    NASA Astrophysics Data System (ADS)

    Sezen, Melda; Register, Jeffrey T.; Yao, Yao; Glisic, Branko; Loo, Yueh-Lin

    2015-03-01

    Piezoresistivity defines the change in resistance of a material in response to mechanical stress. We exploited the effects of structural modifications on the piezoresistive properties of conducting polymers, poly(2-acrylamido-2-methyl-1-propanesulfonic acid) doped polyaniline, PANI-PAAMPSA, and poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate), PEDOT:PSS, for strain gauge applications. Under tensile deformation, the resistances of as-cast PANI-PAAMPSA and PEDOT:PSS increase due to increased separation between the electrostatically stabilized conducting polymer particles. Upon solvent annealing in dichloroacetic acid, DCA, PANI-PAAMPSA's resistance decreases whereas PEDOT:PSS's resistance still increases with tension. While DCA treatment reduces the electrostatic interactions between PANI and PAAMPSA, it only removes the PSS overlayer in PEDOT:PSS. The change in the polarity of PANI-PAAMPSA's piezoresistivity is attributed to the unlocking of the globular structure of the as-synthesized conducting polymer complex with DCA-treatment, which then enables strain-induced crystallization on deformation. By tuning the piezoresistive characteristics of the polymers through structural modification, we can design strain gauge circuits for monitoring the conditions of civil structures.

  4. Oligoaniline-containing supramolecular block copolymer nanodielectric materials.

    PubMed

    Hardy, Christopher G; Islam, Md Sayful; Gonzalez-Delozier, Dioni; Ploehn, Harry J; Tang, Chuanbing

    2012-05-14

    We report a new generation of nanodielectric energy storage materials based on supramolecular block copolymers. In our approach, highly polarizable, conducting nanodomains are embedded within an insulating matrix through block copolymer microphase separation. An applied electric field leads to electronic polarization of the conducting domains. The high interfacial area of microphase-separated domains amplifies the polarization, leading to high dielectric permittivity. Specifically, reversible addition fragmentation transfer (RAFT) polymerization was used to prepare block copolymers with poly(methyl acrylate) (PMA) as the insulating segment and a strongly acidic dopant moiety, poly-(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA), as the basis for the conducting segment. The PAMPSA block was complexed with an oligoaniline trimer to form a dopant-conjugated moiety complex that is electronically conductive after oxidation. For the undoped neat block copolymers, the increase of the PMA block length leads to a transition in dielectric properties from ionic conductor to dielectric capacitor with polarization resulting from migration of protons within the isolated PAMPSA domains. The oligoaniline-doped copolymers show remarkably different dielectric properties. At frequencies above 200 kHz, they exhibit characteristics of dielectric capacitors with much higher permittivity and lower dielectric loss than the corresponding undoped copolymers.

  5. Preliminary studies of an 18-crown-6 ether modified magnetic cation exchange polymer in rapid (90)Sr bioassay.

    PubMed

    Hrdina, Amy; Lai, Edward; Li, Chunsheng; Sadi, Baki; Kramer, Gary

    2011-08-01

    A cation exchange polymer resin embedded with magnetic nanoparticles and modified with crown ether was developed for urinalysis to rapidly monitor levels of (90)Sr exposure in humans who have been involved in a nuclear event. Invention of the resin matrix of 2-acrylamido-2-methyl-1-propanesulfonic acid cross-linked with divinylbenzene incorporated a Sr(2+) chelating agent, di-tert-butyl-cyclohexano-18-crown-6 through surface immobilization using a molecular modifier 1-octanol. The performance of these magnetic cation exchange resin particles was investigated by separating (90)Sr in the presence of (90)Y progeny. Masking agents and precipitants were examined to ascertain that sodium hydroxide at pH 7.5 was capable of selectively removing 89 ± 2% (90)Y before subsequent (90)Sr uptake. Preliminary investigations in rapid urinalysis were successful in isolating 83 ± 2% (90)Sr when pH was optimized to 9, with a sample turnover time <2 h, which is promising for radiological emergencies.

  6. Blood coagulation and platelet adhesion on polyaniline films.

    PubMed

    Humpolíček, Petr; Kuceková, Zdenka; Kašpárková, Věra; Pelková, Jana; Modic, Martina; Junkar, Ita; Trchová, Miroslava; Bober, Patrycja; Stejskal, Jaroslav; Lehocký, Marián

    2015-09-01

    Polyaniline is a promising conducting polymer with still increasing application potential in biomedicine. Its surface modification can be an efficient way how to introduce desired functional groups and to control its properties while keeping the bulk characteristics of the material unchanged. The purpose of the study was to synthetize thin films of pristine conducting polyaniline hydrochloride, non-conducting polyaniline base and polyaniline modified with poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA) and investigate chosen parameters of their hemocompatibility. The modification was performed either by introduction of PAMPSA during the synthesis or by reprotonation of polyaniline base. The polyaniline hydrochloride and polyaniline base had no impact on blood coagulation and platelet adhesion. By contrast, the polyaniline reprotonated with PAMPSA completely hindered coagulation thanks to its interaction with coagulation factors Xa, Va and IIa. The significantly lower platelets adhesion was also found on this surface. Moreover, this film maintains its conductivity at pH of 6, which is an improvement in comparison with standard polyaniline hydrochloride losing most of its conductivity at pH of 4. Polyaniline film with PAMPSA introduced during synthesis had an impact on platelet adhesion but not on coagulation. The combined conductivity, anticoagulation activity, low platelet adhesion and improved conductivity at pH closer to physiological, open up new possibilities for application of polyaniline reprotonated by PAMPSA in blood-contacting devices, such as catheters or blood vessel grafts.

  7. Facile fabrication of hierarchical ZnO microstructures assisted with PAMPSA and enhancement of green emission

    NASA Astrophysics Data System (ADS)

    Huang, Qiang; Cun, Tangxiang; Zuo, Wenbin; Liu, Jianping

    2015-03-01

    We report the fabrication of hierarchically microstructured flower-like ZnO by a facile and single-step procedure involving poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA) assisted aqueous chemical method. The shapes and sizes can be controlled just by varying the concentrations of the water-soluble polymer. When a suitable PAMPAS concentration was utilized, uniform well-defined and mono-dispersed chrysanthemum-like ZnO microstructures based on nanorod building blocks were obtained. The formation mechanism of the hierarchical structure was presented. The structured studies using XRD, HRTEM and SAED reveal these ZnO nanorods are composed of a single phase nature with wurtzite structure and grow along with the c-axis. FTIR spectrum indicated the incorporation of a trace of PAMPSA into ZnO crystals. HRTEM, Raman and XPS analyses showed that the hierarchical ZnO microstructures contain high concentration of oxygen vacancies which enable them exhibiting a significant intense deep-level emission centered at green luminescence in its photoluminescence spectra. They also show enhanced photocatalytic efficiency in degradation of methylene blue. It is hoped that the present work may provide a simple method to fabricate ZnO hierarchical microstructures and a positive relationship among polar plane, oxygen vacancy and green emission.

  8. In-situ graft-polymerization preparation of cation-exchange supermacroporous cryogel with sulfo groups in glass columns.

    PubMed

    Yao, Kejian; Yun, Junxian; Shen, Shaochuan; Chen, Fang

    2007-07-20

    Graft polymerization of monomer chains with expected functional groups onto the matrix pore surfaces by initiator is an effective approach for introducing ion-exchange groups to cryogel matrix to get anion- or cation-exchange supermacroporous cryogels. In this work, a novel cation-exchange cryogel with sulfo binding groups was prepared by grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) onto polyacrylamide-based cryogels in glass columns. The grafting polymerization was achieved in an in-situ manner which was performed by pumping the initiator and the reactive solution of graft monomer with sulfo binding groups directly through a cryogel bed pre-produced in a glass column under frozen condition. The axial liquid dispersion characteristics within the monolithic cryogel beds before and after the in-situ polymerization were compared by measuring residence time distributions (RTDs) at various liquid flow rates using tracer pulse-response method. Microstructure morphology of pores within cryogels was analyzed by scanning electron microscopy (SEM). Chromatography of lysozyme was carried out to reveal the protein breakthrough and elution characteristics in the obtained cryogel beds.

  9. Synthesis of Polymer-Coated Magnetic Nanoparticles from Red Mud Waste for Enhanced Oil Recovery in Offshore Reservoirs

    NASA Astrophysics Data System (ADS)

    Nguyen, T. P.; Le, U. T. P.; Ngo, K. T.; Pham, K. D.; Dinh, L. X.

    2016-07-01

    Buried red mud waste from groundwater refineries can cause pollution. The aim of this paper is to utilize this mud for the synthesis of Fe3O4 magnetic nanoparticles (MNPs). Then, MNPs are encapsulated by a copolymer of methyl methacrylate and 2-acrylamido-2-methyl-1-propanesulfonate via oleic acid linker. MNPs are prepared by a controlled co-precipitation method in the presence of a dispersant and surface-modified agents to achieve a high hydrophobic or hydrophilic surface. Mini-emulsion polymerization was conducted to construct a core-shell structure with MNPs as core and the copolymer as shell. The core-shell structure of the obtained particles enables them to disperse well in brine and to stabilize at high-temperature environments. The chemical structures and morphology of this nanocomposite were investigated by Fourier transform infrared spectroscopy, transmission electron microscopy, and field emission scanning electron microscopy. The thermal stability of the nanocomposite was evaluated via a thermogravimetric analysis method for the solid state and an annealing experiment for the liquid state. The nanocomposite is about 14 nm, disperses well in brine and is thermally stable in the solid state. The blends of synthesized nanocomposite and carboxylate surfactant effectively reduced the interfacial tension between crude oil and brine, and remained thermally stable after 31 days annealed at 100°C. Therefore, a nanofluid of copolymer/magnetic nanocomposite can be applied as an enhanced oil recovery agent for harsh environments in offshore reservoirs.

  10. Blood coagulation and platelet adhesion on polyaniline films.

    PubMed

    Humpolíček, Petr; Kuceková, Zdenka; Kašpárková, Věra; Pelková, Jana; Modic, Martina; Junkar, Ita; Trchová, Miroslava; Bober, Patrycja; Stejskal, Jaroslav; Lehocký, Marián

    2015-09-01

    Polyaniline is a promising conducting polymer with still increasing application potential in biomedicine. Its surface modification can be an efficient way how to introduce desired functional groups and to control its properties while keeping the bulk characteristics of the material unchanged. The purpose of the study was to synthetize thin films of pristine conducting polyaniline hydrochloride, non-conducting polyaniline base and polyaniline modified with poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPSA) and investigate chosen parameters of their hemocompatibility. The modification was performed either by introduction of PAMPSA during the synthesis or by reprotonation of polyaniline base. The polyaniline hydrochloride and polyaniline base had no impact on blood coagulation and platelet adhesion. By contrast, the polyaniline reprotonated with PAMPSA completely hindered coagulation thanks to its interaction with coagulation factors Xa, Va and IIa. The significantly lower platelets adhesion was also found on this surface. Moreover, this film maintains its conductivity at pH of 6, which is an improvement in comparison with standard polyaniline hydrochloride losing most of its conductivity at pH of 4. Polyaniline film with PAMPSA introduced during synthesis had an impact on platelet adhesion but not on coagulation. The combined conductivity, anticoagulation activity, low platelet adhesion and improved conductivity at pH closer to physiological, open up new possibilities for application of polyaniline reprotonated by PAMPSA in blood-contacting devices, such as catheters or blood vessel grafts. PMID:26119372

  11. In-situ graft-polymerization preparation of cation-exchange supermacroporous cryogel with sulfo groups in glass columns.

    PubMed

    Yao, Kejian; Yun, Junxian; Shen, Shaochuan; Chen, Fang

    2007-07-20

    Graft polymerization of monomer chains with expected functional groups onto the matrix pore surfaces by initiator is an effective approach for introducing ion-exchange groups to cryogel matrix to get anion- or cation-exchange supermacroporous cryogels. In this work, a novel cation-exchange cryogel with sulfo binding groups was prepared by grafting of 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) onto polyacrylamide-based cryogels in glass columns. The grafting polymerization was achieved in an in-situ manner which was performed by pumping the initiator and the reactive solution of graft monomer with sulfo binding groups directly through a cryogel bed pre-produced in a glass column under frozen condition. The axial liquid dispersion characteristics within the monolithic cryogel beds before and after the in-situ polymerization were compared by measuring residence time distributions (RTDs) at various liquid flow rates using tracer pulse-response method. Microstructure morphology of pores within cryogels was analyzed by scanning electron microscopy (SEM). Chromatography of lysozyme was carried out to reveal the protein breakthrough and elution characteristics in the obtained cryogel beds. PMID:17517417

  12. High resolution interferometry as a tool for characterization of swelling of weakly charged hydrogels subjected to amphiphile and cyclodextrin exposure.

    PubMed

    Gao, Ming; Gawel, Kamila; Stokke, Bjørn Torger

    2013-01-15

    A high resolution interferometric technique was used to determine swelling behavior of weakly charged polyacrylamide hydrogels in the presence of oppositely charged surfactants and subsequent exposure to cyclodextrins. Hydrogels of copolymerized acrylamide and 2-acrylamido-2-methyl-1-propanesulfonic acid (0.22, 0.44, 0.88 mol%) crosslinked with bisacrylamide (3, 6, 12 mol%) were employed. The equilibrium swelling and swelling kinetics of the hydrogels were determined with 2nm resolution of the optical length and sampled at approximately 1 Hz. These properties were determined for the hydrogels exposed to cationic surfactants dodecyltrimethylammonium bromide (DTAB) and cetyltrimethylammonium bromide (CTAB) at concentrations from 10(-7) up to 2×10(-3)M. The distribution of surfactant within one AAM-co-AMPSA hydrogel equilibrated in CTAB/perylene solution was investigated by confocal laser scanning microscopy. Hydrogels equilibrated at selected surfactant concentrations were subsequently exposed to cyclodextrins (α-CD, β-CD, methyl-β-CD and γ-CD) forming inclusion complexes with the surfactants. The results show different types of behavior for the two surfactants used, arising from the difference in the length of surfactant hydrophobic tail. The changes in the surfactant induced swelling of the hydrogels are suggested to arise from the net effect of electrostatic screening of sulfonic acid-amide group interactions and surfactant micellization. Hydrogels with the largest charge density and the lowest crosslink density yielded the most pronounced changes in swelling properties on exposure to DTAB or CTAB. The hydrogels displayed swelling kinetics on stepwise changes in surfactant concentrations that depended on the surfactant concentration range. The high resolution monitoring of hydrogel swelling associated with supramolecular complex formation in three-component systems hydrogel-amphiphilic molecule-cyclodextrin provides more details on the swelling behavior than

  13. EPR, charge transport, and spin dynamics in doped polyanilines

    NASA Astrophysics Data System (ADS)

    Kon'kin, A. L.; Shtyrlin, V. G.; Garipov, R. R.; Aganov, A. V.; Zakharov, A. V.; Krinichnyi, V. I.; Adams, P. N.; Monkman, A. P.

    2002-08-01

    Charge transport and magnetic properties of films of polyaniline (PAN) doped with 10-camphorsulfonic acid and 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) have been studied by conductivity, magnetic-susceptibility superconducting quantum interference device measurements, and 3-cm and 8-mm electron paramagnetic resonance (EPR) spectroscopy at doping levels (x) from 0.3 to 0.9 over a temperature range from 15 to 300 K. The temperature dependences of conductivities were explained in terms of the advanced multiphase heterogeneous granular metallic (HGM) model with percolation including disordered metallic (DM) and nonmetallic (NM) phases. The anomalous conductivity change in the PAN-AMPSAx system at T>240 K was accounted quantitatively for a solid-phase equilibrium with the occurrence of the disordered anion phase from the metallic islands. A means for analysis of the EPR line shape in conducting media has been developed and, with this, conductivity and microwave dielectric constants were estimated and two EPR signals, R1 and R2, were detected in both systems. It was shown that R1 signal belongs to pinned radicals of isolated polymer chains, whereas R2 is the weight-averaged signal, resulting from three types of paramagnetic centers, localized and mobile spins in the NM and DM phases, which interact via exchange. From the temperature and frequency dependences of the R2 linewidth the spin-diffusion parameters for the NM phase in both systems were determined. It was found that the HGM model allows good explanation of both charge transport and spin diffusion in the doped polyaniline films.

  14. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  15. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP.

  16. Effects of dibutyryl cyclic AMP and papaverine on intrahepatocytic bile acid transport. Role of vesicle transport.

    PubMed

    Hoshino, M; Ohiwa, T; Hayakawa, T; Kamiya, Y; Tanaka, A; Hirano, A; Kumai, T; Katagiri, K; Miyaji, M; Takeuchi, T

    1993-09-01

    The secondary messenger cyclic AMP plays an important role in regulating biliary excretory function by stimulating the transcytotic vesicle transport system, whereas papaverine exerts an inhibitory effect on this system. We therefore investigated their effects on bile acid-induced cytotoxicity and intrahepatocytic content of bile acid in primary cultured rat hepatocytes. Simultaneous addition of 1 mM dibutyryl cyclic AMP (DBcAMP), an analogue of cAMP, with 1 mM taurochenodeoxycholic acid (TCDCA) significantly decreased the release of lactate dehydrogenase (LDH) as compared with the case with 1 mM TCDCA alone (7.1 +/- 0.13% of total versus 10.7 +/- 0.3%). In contrast, 0.1 mM papaverine approximately doubled the amount of LDH (22.0 +/- 0.6% of total versus 10.7 +/- 0.3%; P < 0.01). The intracellular content of TCDCA 180 min after the administration of 1 mM TCDCA alone was 20.8 +/- 0.7 nmol/mg protein, that after simultaneous administration of 1 mM DBcAMP, 16.2 +/- 1.0 nmol/mg protein, and that after the simultaneous administration of 0.1 mM papaverine, 38.5 +/- 1.9 nmol/mg protein. A clear correlation between the release of LDH from hepatocytes and the intracellular content of TCDCA was thus observed. When given together with 1 mM taurocholic acid (TCA) or 1 mM tauroursodeoxycholic acid (TUDCA), papaverine exerted little effect on cytotoxicity or intrahepatocytic bile acid content. When cells were bathed in a medium free of bile acid after pretreatment with 1 mM TCDCA and 1 mM DBcAMP, additional exposure to DBcAMP for 30 min significantly stimulated reduction of intracellular TCDCA content (30.2 +/- 0.4% of total versus 44.0 +/- 1.4%).(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Cesium absorption from acidic solutions using ammonium molybdophosphate on a polyacrylonitrile support (AMP-PAN)

    SciTech Connect

    Miller, C.J.; Olson, A.L.; Johnson, C.K.

    1995-12-01

    Recent efforts at the Idaho Chemical Processing Plant (ICPP) have included evaluation of cesium removal technologies as applied to ICPP acidic radioactive waste streams. Ammonium molybdophosphate (AMP) immobilized on a polyacrylonitrile support (AMP-PAN) has been studied as an ion exchange agent for cesium removal from acidic waste solutions. Capacities, distribution coefficients, elutability, and kinetics of cesium-extraction have been evaluated. Exchange breakthrough curves using small columns have been determined from 1M HNO{sub 3} and simulated waste solutions. The theoretical capacity of AMP is 213 g Cs/kg AMP. The average experimental capacity in batch contacts with various acidic solutions was 150 g Cs/kg AMP. The measured cesium distribution coefficients from actual waste solutions were 3287 mL/g for dissolved zirconia calcines, and 2679 mL/g for sodium-bearing waste. The cesium in the dissolved alumina calcines was analyzed for; however, the concentration was below analytical detectable limits resulting in inconclusive results. The reaction kinetics are very rapid (2-10 minutes). Cesium absorption appears to be independent of acid concentration over the range tested (0.1 M to 5 M HNO{sub 3}).

  18. Regulation of laminin and entactin mRNA levels by retinoic acid and dibutyryl cyclic AMP

    SciTech Connect

    Durkin, M.E.; Phillips, S.L.; Carlin, B.E.; Merlie, J.P.; Chung, A.E.

    1986-05-01

    Retinoic acid and dibutyryl cAMP induced F9 embryonal carcinoma cells to differentiate to parietal endoderm; the morphological changes were accompanied by the increased synthesis of the basement membrane glycoproteins laminin and entactin. cDNA clones have been isolated for the A (400 kD), B1 (220 kD), and B2 (205 kD) chains of laminin. Northern blot analysis indicated that the A, B1, and B2 chains were encoded by RNA species of 9.8, 6.0, and 8.0 kb, respectively. The kinetics of induction of the laminin mRNAs were studied by dot-blotting dilutions of RNA extracted from F9 cells cultured in retinoic acid and dibutyryl cAMP for increasing amounts of time and hybridizing to /sup 32/P-labeled recombinant plasmids. Very low levels of the A and B chain RNAs were found in uninduced cells, and a large increase occurred between 48 and 72 hr of growth in retinoic acid and dibutyryl cAMP. A cDNA clone was also obtained for entactin, a 150 kD glycoprotein that forms a complex with laminin. Retinoic acid and dibutyryl cAMP treatment also increased the amount of entactin RNA in F9 cells. These results suggested that a common mechanism may exist for the coordinate regulation of the 4 basement membrane protein genes during differentiation.

  19. Modulation of norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes by n-3 fatty acids.

    PubMed

    Delton-Vandenbroucke, I; Sarda, N; Molière, P; Lagarde, M; Gharib, A

    1996-10-01

    This work showed that docosahexaenoic (22:6n-3) and eicosapentaenoic (20:5n-3) acid supplementation for 48 h have opposite effects on the norepinephrine-stimulated cyclic AMP accumulation in rat pinealocytes. We found that 22:6n-3 supplementation of pineal cells, done by increasing specifically 22:6n-3 in phospholipid and triacylglycerol pools, led to inhibition of norepinephrine-stimulated cyclic AMP production whereas 20:5n-3 supplementation, by increasing 20:5n-3, and 22:5n-3 and 22:6n-3 in the same pools, stimulated it. In contrast, direct treatment of pinealocytes with each fatty acid (50 microM) did not affect cyclic AMP production in the presence of (0.1-10 microM) norepinephrine. The results indicate that, using pharmacological agents such as forskolin or prazosin: (a) neither basal nor forskolin-stimulated cyclic AMP levels were modified in fatty acid-supplemented cells compared to control cells; (b) in the presence of 1 microM prazosin, the activation by 20:5n-3 was still effective whereas no additional inhibition of norepinephrine stimulation was observed in 22:6n-3-supplemented cells. Taken together our results suggest that 22:6n-3 or 20:5n-3 supplementation modulates specifically the alpha 1- or beta-adrenoceptors in the rat pineal gland.

  20. Cyclic Amp-Dependent Resuscitation of Dormant Mycobacteria by Exogenous Free Fatty Acids

    PubMed Central

    Shleeva, Margarita; Goncharenko, Anna; Kudykina, Yuliya; Young, Danielle; Young, Michael; Kaprelyants, Arseny

    2013-01-01

    One third of the world population carries a latent tuberculosis (TB) infection, which may reactivate leading to active disease. Although TB latency has been known for many years it remains poorly understood. In particular, substances of host origin, which may induce the resuscitation of dormant mycobacteria, have not yet been described. In vitro models of dormant (“non-culturable”) cells of Mycobacterium smegmatis (mc2155) and Mycobacterium tuberculosis H37Rv were used. We found that the resuscitation of dormant M. smegmatis and M. tuberculosis cells in liquid medium was stimulated by adding free unsaturated fatty acids (FA), including arachidonic acid, at concentrations of 1.6–10 µM. FA addition enhanced cAMP levels in reactivating M. smegmatis cells and exogenously added cAMP (3–10 mM) or dibutyryl-cAMP (0.5–1 mM) substituted for FA, causing resuscitation of M. smegmatis and M. tuberculosis dormant cells. A M. smegmatis null-mutant lacking MSMEG_4279, which encodes a FA-activated adenylyl cyclase (AC), could not be resuscitated by FA but it was resuscitated by cAMP. M. smegmatis and M. tuberculosis cells hyper-expressing AC were unable to form non-culturable cells and a specific inhibitor of AC (8-bromo-cAMP) prevented FA-dependent resuscitation. RT-PCR analysis revealed that rpfA (coding for resuscitation promoting factor A) is up-regulated in M. smegmatis in the beginning of exponential growth following the cAMP increase in lag phase caused by FA-induced cell activation. A specific Rpf inhibitor (4-benzoyl-2-nitrophenylthiocyanate) suppressed FA-induced resuscitation. We propose a novel pathway for the resuscitation of dormant mycobacteria involving the activation of adenylyl cyclase MSMEG_4279 by FAs resulted in activation of cellular metabolism followed later by increase of RpfA activity which stimulates cell multiplication in exponential phase. The study reveals a probable role for lipids of host origin in the resuscitation of dormant mycobacteria

  1. Role of the AMP-activated protein kinase in regulating fatty acid metabolism during exercise.

    PubMed

    Steinberg, Gregory R

    2009-06-01

    During moderate-intensity exercise, fatty acids are the predominant substrate for working skeletal muscle. The release of fatty acids from adipose tissue stores, combined with the ability of skeletal muscle to actively fine tune the gradient between fatty acid and carbohydrate metabolism, depending on substrate availability and energetic demands, requires a coordinated system of metabolic control. Over the past decade, since the discovery that AMP-activated protein kinase (AMPK) was increased in accordance with exercise intensity, there has been significant interest in the proposed role of this ancient stress-sensing kinase as a critical integrative switch controlling metabolic responses during exercise. In this review, studies examining the role of AMPK as a regulator of fatty acid metabolism in both adipose tissue and skeletal muscle during exercise will be discussed. Exercise induces activation of AMPK in adipocytes and regulates triglyceride hydrolysis and esterfication through phosphorylation of hormone sensitive lipase (HSL) and glycerol-3-phosphate acyl-transferase, respectively. In skeletal muscle, exercise-induced activation of AMPK is associated with increases in fatty acid uptake, phosphorylation of HSL, and increased fatty acid oxidation, which is thought to occur via the acetyl-CoA carboxylase-malony-CoA-CPT-1 signalling axis. Despite the importance of AMPK in regulating fatty acid metabolism under resting conditions, recent evidence from transgenic models of AMPK deficiency suggest that alternative signalling pathways may also be important for the control of fatty acid metabolism during exercise.

  2. cAMP increases mitochondrial cholesterol transport through the induction of arachidonic acid release inside this organelle in Leydig cells.

    PubMed

    Castillo, Ana Fernanda; Cornejo Maciel, Fabiana; Castilla, Rocío; Duarte, Alejandra; Maloberti, Paula; Paz, Cristina; Podestá, Ernesto J

    2006-11-01

    We have investigated the direct effect of arachidonic acid on cholesterol transport in intact cells or isolated mitochondria from steroidogenic cells and the effect of cyclic-AMP on the specific release of this fatty acid inside the mitochondria. We show for the first time that cyclic-AMP can regulate the release of arachidonic acid in a specialized compartment of MA-10 Leydig cells, e.g. the mitochondria, and that the fatty acid induces cholesterol transport through a mechanism different from the classical pathway. Arachidonic acid and arachidonoyl-CoA can stimulate cholesterol transport in isolated mitochondria from nonstimulated cells. The effect of arachidonoyl-CoA is inhibited by the reduction in the expression or in the activity of a mitochondrial thioesterase that uses arachidonoyl-CoA as a substrate to release arachidonic acid. cAMP-induced arachidonic acid accumulation into the mitochondria is also reduced when the mitochondrial thioesterase activity or expression is blocked. This new feature in the regulation of cholesterol transport by arachidonic acid and the release of arachidonic acid in specialized compartment of the cells could offer novel means for understanding the regulation of steroid synthesis but also would be important in other situations such as neuropathological disorders or oncology disorders, where cholesterol transport plays an important role.

  3. Synthesis of glial fibrillary acidic protein in rat C6 glioma in chemically defined medium: cyclic AMP-dependent transcriptional and translational regulation.

    PubMed

    Messens, J; Slegers, H

    1992-06-01

    Glial fibrillary acidic protein (GFA) expression was induced in rat C6 glioma in chemically defined medium by the addition of N6, O2'-dibutyryl cyclic AMP (dbcAMP). Induction was dependent on the increase in intracellular cyclic AMP (cAMP), which was linearly correlated with added dbcAMP. Contrary to GFA mRNA synthesis, which can be obtained by cAMP-dependent and -independent pathways, translation of mRNA into GFA was observed only above a cellular cAMP concentration of approximately 0.2 fmol/cell. dbcAMP stimulation did not affect the vimentin concentration, which remained at a low level, but changed the cellular morphology from a bipolar to a stellate shape. A similar morphological change was observed after stimulation of C6 with lipopolysaccharide (LPS). However, LPS did not significantly increase the intracellular concentration of cAMP and the LPS-induced mRNA was not translated into GFA. Our results indicate that GFA synthesis is regulated at the mRNA level and at the translational level and that a cAMP-dependent mechanism determines the ultimate synthesis of GFA by a yet unknown mechanism.

  4. Regulation of monocarboxylic acid transporter-1 by cAMP dependent vesicular trafficking in brain microvascular endothelial cells.

    PubMed

    Uhernik, Amy L; Li, Lun; LaVoy, Nathan; Velasquez, Micah J; Smith, Jeffrey P

    2014-01-01

    In this study, a detailed characterization of Monocarboxylic Acid Transporter-1 (Mct1) in cytoplasmic vesicles of cultured rat brain microvascular endothelial cells shows them to be a diverse population of endosomes intrinsic to the regulation of the transporter by a brief 25 to 30 minute exposure to the membrane permeant cAMP analog, 8Br-cAMP. The vesicles are heterogeneous in size, mobility, internal pH, and co-localize with discreet markers of particular types of endosomes including early endosomes, clathrin coated vesicles, caveolar vesicles, trans-golgi, and lysosomes. The vesicular localization of Mct1 was not dependent on its N or C termini, however, the size and pH of Mct1 vesicles was increased by deletion of either terminus demonstrating a role for the termini in vesicular trafficking of Mct1. Using a novel BCECF-AM based assay developed in this study, 8Br-cAMP was shown to decrease the pH of Mct1 vesicles after 25 minutes. This result and method were confirmed in experiments with a ratiometric pH-sensitive EGFP-mCherry dual tagged Mct1 construct. Overall, the results indicate that cAMP signaling reduces the functionality of Mct1 in cerebrovascular endothelial cells by facilitating its entry into a highly dynamic vesicular trafficking pathway that appears to lead to the transporter's trafficking to autophagosomes and lysosomes.

  5. Regulation of Monocarboxylic Acid Transporter-1 by cAMP Dependent Vesicular Trafficking in Brain Microvascular Endothelial Cells

    PubMed Central

    Uhernik, Amy L.; Li, Lun; LaVoy, Nathan; Velasquez, Micah J.; Smith, Jeffrey P.

    2014-01-01

    In this study, a detailed characterization of Monocarboxylic Acid Transporter-1 (Mct1) in cytoplasmic vesicles of cultured rat brain microvascular endothelial cells shows them to be a diverse population of endosomes intrinsic to the regulation of the transporter by a brief 25 to 30 minute exposure to the membrane permeant cAMP analog, 8Br-cAMP. The vesicles are heterogeneous in size, mobility, internal pH, and co-localize with discreet markers of particular types of endosomes including early endosomes, clathrin coated vesicles, caveolar vesicles, trans-golgi, and lysosomes. The vesicular localization of Mct1 was not dependent on its N or C termini, however, the size and pH of Mct1 vesicles was increased by deletion of either terminus demonstrating a role for the termini in vesicular trafficking of Mct1. Using a novel BCECF-AM based assay developed in this study, 8Br-cAMP was shown to decrease the pH of Mct1 vesicles after 25 minutes. This result and method were confirmed in experiments with a ratiometric pH-sensitive EGFP-mCherry dual tagged Mct1 construct. Overall, the results indicate that cAMP signaling reduces the functionality of Mct1 in cerebrovascular endothelial cells by facilitating its entry into a highly dynamic vesicular trafficking pathway that appears to lead to the transporter's trafficking to autophagosomes and lysosomes. PMID:24454947

  6. 2-Octynoic Acid Inhibits Hepatitis C Virus Infection through Activation of AMP-Activated Protein Kinase

    PubMed Central

    Yang, Darong; Xue, Binbin; Wang, Xiaohong; Yu, Xiaoyan; Liu, Nianli; Gao, Yimin; Liu, Chen; Zhu, Haizhen

    2013-01-01

    Many chronic hepatitis C virus (HCV)-infected patients with current therapy do not clear the virus. It is necessary to find novel treatments. The effect of 2-octynoic acid (2-OA) on HCV infection in human hepatocytes was examined. The mechanism of 2-OA antiviral activity was explored. Our data showed that 2-OA abrogated lipid accumulation in HCV replicon cells and virus-infected hepatocytes. It suppressed HCV RNA replication and infectious virus production with no cytotoxicity to the host cells. 2-OA did not affect hepatitis B virus replication in HepG2.2.15 cells derived from HepG2 cells transfected with full genome of HBV. Further study demonstrated that 2-OA activated AMP-activated protein kinase (AMPK) and inhibited acetyl-CoA carboxylase in viral-infected cells. Compound C, a specific inhibitor of AMPK, inhibited AMPK activity and reversed the reduction of intracellular lipid accumulation and the antiviral effect of 2-OA. Knockdown of AMPK expression by RNA interference abolished the activation of AMPK by 2-OA and blocked 2-OA antiviral activity. Interestingly, 2-OA induced interferon-stimulated genes (ISGs) and inhibited microRNA-122 (miR-122) expression in virus-infected hepatocytes. MiR-122 overexpression reversed the antiviral effect of 2-OA. Furthermore, knockdown of AMPK expression reversed both the induction of ISGs and suppression of miR-122 by 2-OA, implying that activated AMPK induces the intracellular innate response through the induction of ISGs and inhibiting miR-122 expression. 2-OA inhibits HCV infection through regulation of innate immune response by activated AMPK. These findings reveal a novel mechanism by which active AMPK inhibits HCV infection. 2-OA and its derivatives hold promise for novel drug development for chronic hepatitis C. PMID:23741428

  7. The amino acid sequence of GTP:AMP phosphotransferase from beef-heart mitochondria. Extensive homology with cytosolic adenylate kinase.

    PubMed

    Wieland, B; Tomasselli, A G; Noda, L H; Frank, R; Schulz, G E

    1984-09-01

    The amino acid sequence of GTP:AMP phosphotransferase (AK3) from beef-heart mitochondria has been determined, except for one segment of about 33 residues in the middle of the polypeptide chain. The established sequence has been unambiguously aligned to the sequence of cytosolic ATP:AMP phosphotransferase (AK1) from pig muscle, allowing for six insertions and deletions. With 30% of all aligned residues being identical, the homology between AK3 and AK1 is well established. As derived from the known three-dimensional structure of AK1, the missing segment is localized at a small surface area of the molecule, far apart from the active center. The pattern of conserved residues demonstrates that earlier views on substrate binding have to be modified. The observation of three different consecutive N-termini indicates enzyme processing.

  8. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin.

  9. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells.

    PubMed

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  10. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells

    PubMed Central

    Maruta, Hitomi; Yoshimura, Yukihiro; Araki, Aya; Kimoto, Masumi; Takahashi, Yoshitaka; Yamashita, Hiromi

    2016-01-01

    Previously, we found that orally administered acetic acid decreased lipogenesis in the liver and suppressed lipid accumulation in adipose tissue of Otsuka Long-Evans Tokushima Fatty rats, which exhibit hyperglycemic obesity with hyperinsulinemia and insulin resistance. Administered acetic acid led to increased phosphorylation of AMP-activated protein kinase (AMPK) in both liver and skeletal muscle cells, and increased transcripts of myoglobin and glucose transporter 4 (GLUT4) genes in skeletal muscle of the rats. It was suggested that acetic acid improved the lipid metabolism in skeletal muscles. In this study, we examined the activation of AMPK and the stimulation of GLUT4 and myoglobin expression by acetic acid in skeletal muscle cells to clarify the physiological function of acetic acid in skeletal muscle cells. Acetic acid added to culture medium was taken up rapidly by L6 cells, and AMPK was phosphorylated upon treatment with acetic acid. We observed increased gene and protein expression of GLUT4 and myoglobin. Uptake of glucose and fatty acids by L6 cells were increased, while triglyceride accumulation was lower in treated cells compared to untreated cells. Furthermore, treated cells also showed increased gene and protein expression of myocyte enhancer factor 2A (MEF2A), which is a well-known transcription factor involved in the expression of myoglobin and GLUT4 genes. These results indicate that acetic acid enhances glucose uptake and fatty acid metabolism through the activation of AMPK, and increases expression of GLUT4 and myoglobin. PMID:27348124

  11. Comparative Analysis of Dibutyric cAMP and Butyric Acid on the Differentiation of Human Eosinophilic Leukemia EoL-1 Cells

    PubMed Central

    2015-01-01

    Purification of enough numbers of circulating eosinophils is difficult because eosinophils account for less than 5% peripheral blood leukocytes. Human eosinophilic leukemia EoL-1 cells have been considered an in vitro source of eosinophils as they can differentiate into mature eosinophil-like cells when incubated with dibutyryl cAMP (dbcAMP) or butyric acid. In this study, the viability and phenotypic maturation of EoL-1 cells stimulated by either dbcAMP or butyric acid were comparatively analyzed. After treatment with 100 µM dbcAMP or 0.5 µM butyric acid, EoL-1 cells showed morphological signs of differentiation, although the number of nonviable EoL-1 cells was significantly increased following butyric acid treatment. Stimulation of EoL-1 cells with 0.5 µM butyric acid more effectively induced the expression of mature eosinophil markers than stimulation with dbcAMP. These results suggest that treatment of EoL-1 cells with 0.5 µM butyric acid for limited duration could be an effective strategy for inducing their differentiation. Considering that expression of CCR3 was not sufficient in EoL-1 cells stimulated with 0.5 µM butyric acid, treatment of the chemically stimulated EoL-1 cells with cytokines, which primarily support eosinophil maturation, would help to obtain differentiated EoL-1 cells with greater functional maturity. PMID:26770185

  12. Comparative Analysis of Dibutyric cAMP and Butyric Acid on the Differentiation of Human Eosinophilic Leukemia EoL-1 Cells.

    PubMed

    Jung, YunJae

    2015-12-01

    Purification of enough numbers of circulating eosinophils is difficult because eosinophils account for less than 5% peripheral blood leukocytes. Human eosinophilic leukemia EoL-1 cells have been considered an in vitro source of eosinophils as they can differentiate into mature eosinophil-like cells when incubated with dibutyryl cAMP (dbcAMP) or butyric acid. In this study, the viability and phenotypic maturation of EoL-1 cells stimulated by either dbcAMP or butyric acid were comparatively analyzed. After treatment with 100 µM dbcAMP or 0.5 µM butyric acid, EoL-1 cells showed morphological signs of differentiation, although the number of nonviable EoL-1 cells was significantly increased following butyric acid treatment. Stimulation of EoL-1 cells with 0.5 µM butyric acid more effectively induced the expression of mature eosinophil markers than stimulation with dbcAMP. These results suggest that treatment of EoL-1 cells with 0.5 µM butyric acid for limited duration could be an effective strategy for inducing their differentiation. Considering that expression of CCR3 was not sufficient in EoL-1 cells stimulated with 0.5 µM butyric acid, treatment of the chemically stimulated EoL-1 cells with cytokines, which primarily support eosinophil maturation, would help to obtain differentiated EoL-1 cells with greater functional maturity.

  13. Preferential hydrophobic interactions are responsible for a preference of D-amino acids in the aminoacylation of 5'-AMP with hydrophobic amino acids

    NASA Technical Reports Server (NTRS)

    Lacey, J. C. Jr; Wickramasinghe, N. S.; Sabatini, R. S.

    1992-01-01

    We have studied the chemistry of aminoacyl AMP to model reactions at the 3' terminus of aminoacyl tRNA for the purpose of understanding the origin of protein synthesis. The present studies relate to the D, L preference in the esterification of 5'-AMP. All N-acetyl amino acids we studied showed faster reaction of the D-isomer, with a generally decreasing preference for D-isomer as the hydrophobicity of the amino acid decreased. The beta-branched amino acids, Ile and Val, showed an extreme preference for D-isomer. Ac-Leu, the gamma-branched amino acid, showed a slightly low D/L ratio relative to its hydrophobicity. The molecular basis for these preferences for D-isomer is understandable in the light of our previous studies and seems to be due to preferential hydrophobic interaction of the D-isomer with adenine. The preference for hydrophobic D-amino acids can be decreased by addition of an organic solvent to the reaction medium. Conversely, peptidylation with Ac-PhePhe shows a preference for the LL isomer over the DD isomer.

  14. Folic acid supplementation during high-fat diet feeding restores AMPK activation via an AMP-LKB1-dependent mechanism.

    PubMed

    Sid, Victoria; Wu, Nan; Sarna, Lindsei K; Siow, Yaw L; House, James D; O, Karmin

    2015-11-15

    AMPK is an endogenous energy sensor that regulates lipid and carbohydrate metabolism. Nonalcoholic fatty liver disease (NAFLD) is regarded as a hepatic manifestation of metabolic syndrome with impaired lipid and glucose metabolism and increased oxidative stress. Our recent study showed that folic acid supplementation attenuated hepatic oxidative stress and lipid accumulation in high-fat diet-fed mice. The aim of the present study was to investigate the effect of folic acid on hepatic AMPK during high-fat diet feeding and the mechanisms involved. Male C57BL/6J mice were fed a control diet (10% kcal fat), a high-fat diet (60% kcal fat), or a high-fat diet supplemented with folic acid (26 mg/kg diet) for 5 wk. Mice fed a high-fat diet exhibited hyperglycemia, hepatic cholesterol accumulation, and reduced hepatic AMPK phosphorylation. Folic acid supplementation restored AMPK phosphorylation (activation) and reduced blood glucose and hepatic cholesterol levels. Activation of AMPK by folic acid was mediated through an elevation of its allosteric activator AMP and activation of its upstream kinase, namely, liver kinase B1 (LKB1) in the liver. Consistent with in vivo findings, 5-methyltetrahydrofolate (bioactive form of folate) restored phosphorylation (activation) of both AMPK and LKB1 in palmitic acid-treated HepG2 cells. Activation of AMPK by folic acid might be responsible for AMPK-dependent phosphorylation of HMG-CoA reductase, leading to reduced hepatic cholesterol synthesis during high-fat diet feeding. These results suggest that folic acid supplementation may improve cholesterol and glucose metabolism by restoration of AMPK activation in the liver.

  15. Highly efficient peptide formation from N-acetylaminoacyl-AMP anhydride and free amino acid

    NASA Technical Reports Server (NTRS)

    Mullins, D. W., Jr.; Lacey, J. C., Jr.

    1983-01-01

    The kinetics of formation of the N-blocked dipeptide, N-acetylglycylglycine, from N-acetylglycyl adenylate anhydride and glycine in aqueous solution at 25 C, and at various PH's are reported. The reaction is of interest in that over a physiologically relevant pH range (6-8), peptide synthesis proceeds more rapidly than hydrolysis, even at those pH's at which this compound becomes increasingly susceptible to base-catalyzed hydrolysis. Under similar conditions, the corresponding unblocked aminoacyl adenylate anhydrides are considerably more unstable, and undergo appreciable hydrlysis in the presence of free amino acid. Because N-blocked aminoacyl adenylate anhydrides serve as model compounds of peptidyl adenylate anhydrides, these results suggest that primitive amino acid polymerization systems may have operated by cyclic reactivation of the peptidyl carboxyl group, rather than that of the incoming amino acid.

  16. Studies on adenosine triphosphate transphosphorylases. Amino acid sequence of rabbit muscle ATP-AMP transphosphorylase.

    PubMed

    Kuby, S A; Palmieri, R H; Frischat, A; Fischer, A H; Wu, L H; Maland, L; Manship, M

    1984-05-22

    The total amino acid sequence of rabbit muscle adenylate kinase has been determined, and the single polypeptide chain of 194 amino acid residues starts with N-acetylmethionine and ends with leucyllysine at its carboxyl terminus, in agreement with the earlier data on its amino acid composition [Mahowald, T. A., Noltmann, E. A., & Kuby, S. A. (1962) J. Biol. Chem. 237, 1138-1145] and its carboxyl-terminus sequence [Olson, O. E., & Kuby, S. A. (1964) J. Biol. Chem. 239, 460-467]. Elucidation of the primary structure was based on tryptic and chymotryptic cleavages of the performic acid oxidized protein, cyanogen bromide cleavages of the 14C-labeled S-carboxymethylated protein at its five methionine sites (followed by maleylation of peptide fragments), and tryptic cleavages at its 12 arginine sites of the maleylated 14C-labeled S-carboxymethylated protein. Calf muscle myokinase, whose sequence has also been established, differs primarily from the rabbit muscle myokinase's sequence in the following: His-30 is replaced by Gln-30; Lys-56 is replaced by Met-56; Ala-84 and Asp 85 are replaced by Val-84 and Asn-85. A comparison of the four muscle-type adenylate kinases, whose covalent structures have now been determined, viz., rabbit, calf, porcine, and human [for the latter two sequences see Heil, A., Müller, G., Noda, L., Pinder, T., Schirmer, H., Schirmer, I., & Von Zabern, I. (1974) Eur. J. Biochem. 43, 131-144, and Von Zabern, I., Wittmann-Liebold, B., Untucht-Grau, R., Schirmer, R. H., & Pai, E. F. (1976) Eur. J. Biochem. 68, 281-290], demonstrates an extraordinary degree of homology.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. A reliable phenotypic assay for detection of ESBLs and AmpCs in MBL-producing gram-negative bacteria with the use of aminophenylboronic acid, dipicolinic acid and cloxacillin.

    PubMed

    Datta, Saswati; Chatterjee, Somdatta; Mitra, Shravani; Basu, Sulagna

    2015-08-01

    ESBLs and AmpCs may escape detection when they coexist with metallo-β-lactamases such as New Delhi Metallo-β-lactamases-1. In this study a combination disk assay was established using cefotaxime, cefotaxime/clavulanic acid, cefotaxime/clavulanic acid/cloxacillin, cefoxitin and cefoxitin/phenylboronic acid/cloxacillin on Mueller Hinton agar supplemented with dipicolinic acid for determination of β-lactamases in the presence of NDM-1.

  18. AMP kinase activation with AICAR further increases fatty acid oxidation and blunts triacylglycerol hydrolysis in contracting rat soleus muscle.

    PubMed

    Smith, Angela C; Bruce, Clinton R; Dyck, David J

    2005-06-01

    Muscle contraction increases glucose uptake and fatty acid (FA) metabolism in isolated rat skeletal muscle, due at least in part to an increase in AMP-activated kinase activity (AMPK). However, the extent to which AMPK plays a role in the regulation of substrate utilization during contraction is not fully understood. We examined the acute effects of 5-aminoimidazole-4-carboxamide riboside (AICAR; 2 mm), a pharmacological activator of AMPK, on FA metabolism and glucose oxidation during high intensity tetanic contraction in isolated rat soleus muscle strips. Muscle strips were exposed to two different FA concentrations (low fatty acid, LFA, 0.2 mm; high fatty acid, HFA, 1 mm) to examine the role that FA availability may play in both exogenous and endogenous FA metabolism with contraction and AICAR. Synergistic increases in AMPK alpha2 activity (+45%; P<0.05) were observed after 30 min of contraction with AICAR, which further increased exogenous FA oxidation (LFA: +71%, P<0.05; HFA: +46%, P<0.05) regardless of FA availability. While there were no changes in triacylglycerol (TAG) esterification, AICAR did increase the ratio of FA partitioned to oxidation relative to TAG esterification (LFA: +65%, P<0.05). AICAR significantly blunted endogenous TAG hydrolysis (LFA: -294%, P<0.001; HFA: -117%, P<0.05), but had no effect on endogenous oxidation rates, suggesting a better matching between TAG hydrolysis and subsequent oxidative needs of the muscle. There was no effect of AICAR on the already elevated rates of glucose oxidation during contraction. These results suggest that FA metabolism is very sensitive to AMPK alpha2 stimulation during contraction.

  19. Uric acid-dependent inhibition of AMP kinase induces hepatic glucose production in diabetes and starvation: evolutionary implications of the uricase loss in hominids.

    PubMed

    Cicerchi, Christina; Li, Nanxing; Kratzer, James; Garcia, Gabriela; Roncal-Jimenez, Carlos A; Tanabe, Katsuyuki; Hunter, Brandi; Rivard, Christopher J; Sautin, Yuri Y; Gaucher, Eric A; Johnson, Richard J; Lanaspa, Miguel A

    2014-08-01

    Reduced AMP kinase (AMPK) activity has been shown to play a key deleterious role in increased hepatic gluconeogenesis in diabetes, but the mechanism whereby this occurs remains unclear. In this article, we document that another AMP-dependent enzyme, AMP deaminase (AMPD) is activated in the liver of diabetic mice, which parallels with a significant reduction in AMPK activity and a significant increase in intracellular glucose accumulation in human HepG2 cells. AMPD activation is induced by a reduction in intracellular phosphate levels, which is characteristic of insulin resistance and diabetic states. Increased gluconeogenesis is mediated by reduced TORC2 phosphorylation at Ser171 by AMPK in these cells, as well as by the up-regulation of the rate-limiting enzymes PEPCK and G6Pc. The mechanism whereby AMPD controls AMPK activation depends on the production of a specific AMP downstream metabolite through AMPD, uric acid. In this regard, humans have higher uric acid levels than most mammals due to a mutation in uricase, the enzyme involved in uric acid degradation in most mammals, that developed during a period of famine in Europe 1.5 × 10(7) yr ago. Here, working with resurrected ancestral uricases obtained from early hominids, we show that their expression on HepG2 cells is enough to blunt gluconeogenesis in parallel with an up-regulation of AMPK activity. These studies identify a key role AMPD and uric acid in mediating hepatic gluconeogenesis in the diabetic state, via a mechanism involving AMPK down-regulation and overexpression of PEPCK and G6Pc. The uricase mutation in the Miocene likely provided a survival advantage to help maintain glucose levels under conditions of near starvation, but today likely has a role in the pathogenesis of diabetes.

  20. Effects of cAMP modulators on long-chain fatty-acid uptake and utilization by electrically stimulated rat cardiac myocytes.

    PubMed Central

    Luiken, J J F P; Willems, J; Coort, S L M; Coumans, W A; Bonen, A; Van Der Vusse, G J; Glatz, J F C

    2002-01-01

    Recently, we established that cellular contractions increase long-chain fatty-acid (FA) uptake by cardiac myocytes. This increase is dependent on the transport function of an 88 kDa membrane FA transporter, FA translocase (FAT/CD36), and, in analogy to skeletal muscle, is likely to involve its translocation from an intracellular pool to the sarcolemma. In the present study, we investigated whether cAMP-dependent signalling is involved in this translocation process. Isoproterenol, dibutyryl-cAMP and the phosphodiesterase (PDE) inhibitor, amrinone, which markedly raised the intracellular cAMP level, did not affect cellular FA uptake, but influenced the fate of intracellular FAs by directing these to mitochondrial oxidation in electrostimulated cardiac myocytes. The PDE inhibitors 3-isobutyl-1-methylxanthine, milrinone and dipyridamole each significantly stimulated FA uptake as well as intracellular cAMP levels, but these effects were quantitatively unrelated. The stimulatory effects of these PDE inhibitors were antagonized by sulpho- N -succinimidylpalmitate, indicating the involvement of FAT/CD36, albeit that the different PDE inhibitors use different molecular mechanisms to stimulate FAT/CD36-mediated FA uptake. Notably, 3-isobutyl-1-methylxanthine and milrinone increased the intrinsic activity of FAT/CD36, possibly through its covalent modification, and dipyridamole induces translocation of FAT/CD36 to the sarcolemma. Elevation of intracellular cGMP, but not of cAMP, by the PDE inhibitor zaprinast did not have any effect on FA uptake and metabolism by cardiac myocytes. The stimulatory effects of PDE inhibitors on cardiac FA uptake should be considered when applying these agents in clinical medicine. PMID:12093365

  1. The synthesis and characterization of environmentally-responsive water-swellable and water-soluble polymers for wastewater remediation

    NASA Astrophysics Data System (ADS)

    Armentrout, Rodney Scott

    The primary research goal is the development of new polymeric materials that demonstrate the environmentally-responsive sequestration of common water foulants, including surfactants and oils. Water-swellable and water-soluble polymers have been synthesized, structurally characterized, and their physical properties have been determined. In addition, the ability of the materials to sequester model water foulants has been evaluated. Anionic crosslinked polymer networks of 2-acrylamido-2-methyl-1-propanesulfonic acid, acrylamide, and methylene bisacrylamide have been synthesized and characterized by determining the equilibrium water contents as a function of ionic content of the polymer network. The molar ratio of bound surfactant to ionic group was determined to be less than one for all hydrogels studied, indicating an ion-exchange binding mechanism with minimal hydrophobic interactions between bound and unbound surfactant molecules is responsible for surfactant binding. Cationic crosslinked cyclopolymer networks of N,N-diallyl- N-methyl amine (DAMA) and N,N,N,N-tetraallyl ammonium chloride (TAAC) have been synthesized and characterized by determining the equilibrium water content as a function of pH. A maximum in the equilibrium water content is observed for pH-6 when the polymer is fully ionized. The solubilization of a model water foulant, p-cresol, by the polymeric surfactant, Pluronic F127, has been studied via equilibrium dialysis, dynamic light scattering and ultrafiltration experiments. It has been shown that at 25°C p-cresol is readily solubilized by F127 since the polymeric surfactant exists in a multimer conformation. Ultrafiltration experiments have demonstrated that the polymer-foulant binding interactions are largely unaffected by shear in a hollow fiber membrane. Copolymers of the zwitterionic monomer, 3-(N,N-diallyl- N-methyl ammonio) propane sulfonate (DAMAPS) and N,N-diallyl- N,N-dimethylammonium chloride (DADMAC) (the DADS series) or the p

  2. The β-lactamase gene regulator AmpR is a tetramer that recognizes and binds the D-Ala-D-Ala motif of its repressor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide.

    PubMed

    Vadlamani, Grishma; Thomas, Misty D; Patel, Trushar R; Donald, Lynda J; Reeve, Thomas M; Stetefeld, Jörg; Standing, Kenneth G; Vocadlo, David J; Mark, Brian L

    2015-01-30

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal D-Ala-D-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the D-Ala-D-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  3. The β-Lactamase Gene Regulator AmpR Is a Tetramer That Recognizes and Binds the d-Ala-d-Ala Motif of Its Repressor UDP-N-acetylmuramic Acid (MurNAc)-pentapeptide*

    PubMed Central

    Vadlamani, Grishma; Thomas, Misty D.; Patel, Trushar R.; Donald, Lynda J.; Reeve, Thomas M.; Stetefeld, Jörg; Standing, Kenneth G.; Vocadlo, David J.; Mark, Brian L.

    2015-01-01

    Inducible expression of chromosomal AmpC β-lactamase is a major cause of β-lactam antibiotic resistance in the Gram-negative bacteria Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is induced by the LysR-type transcriptional regulator (LTTR) AmpR, which activates ampC expression in response to changes in peptidoglycan (PG) metabolite levels that occur during exposure to β-lactams. Under normal conditions, AmpR represses ampC transcription by binding the PG precursor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. When exposed to β-lactams, however, PG catabolites (1,6-anhydroMurNAc-peptides) accumulate in the cytosol, which have been proposed to competitively displace UDP-MurNAc-pentapeptide from AmpR and convert it into an activator of ampC transcription. Here we describe the molecular interactions between AmpR (from Citrobacter freundii), its DNA operator, and repressor UDP-MurNAc-pentapeptide. Non-denaturing mass spectrometry revealed AmpR to be a homotetramer that is stabilized by DNA containing the T-N11-A LTTR binding motif and revealed that it can bind four repressor molecules in an apparently stepwise manner. A crystal structure of the AmpR effector-binding domain bound to UDP-MurNAc-pentapeptide revealed that the terminal d-Ala-d-Ala motif of the repressor forms the primary contacts with the protein. This observation suggests that 1,6-anhydroMurNAc-pentapeptide may convert AmpR into an activator of ampC transcription more effectively than 1,6-anhydroMurNAc-tripeptide (which lacks the d-Ala-d-Ala motif). Finally, small angle x-ray scattering demonstrates that the AmpR·DNA complex adopts a flat conformation similar to the LTTR protein AphB and undergoes only a slight conformational change when binding UDP-MurNAc-pentapeptide. Modeling the AmpR·DNA tetramer bound to UDP-MurNAc-pentapeptide predicts that the UDP-MurNAc moiety of the repressor participates in modulating AmpR function. PMID:25480792

  4. The sequential mechanism of guanidine hydrochloride-induced denaturation of cAMP receptor protein from Escherichia coli. A fluorescent study using 8-anilino-1-naphthalenesulfonic acid.

    PubMed

    Malecki, J; Wasylewski, Z

    1998-11-01

    cAMP receptor protein (CRP) regulates expression of a number of genes in Escherichia coli. The protein is a homodimer and each monomer is folded into two structural domains. The biological activation of CRP upon cAMP binding may involve the subunit realignment as well as reorientation between the domains within each subunit. In order to study the interactions between the subunits or domains, we performed stopped-flow measurements of the guanidine hydrochloride (GuHCI)-induced denaturation of CRP. The changes in CRP structure induced by GuHCl were monitored using both intrinsic Trp fluorescence as well as the fluorescence of an extrinsic probe, 8-anilino-1-Naphthalenesulfonic acid (ANS). Results of CRP denaturation using Trp fluorescence detection are consistent with a two-step model [Malecki, and Wasylewski, (1997), Eur. J. Biochem. 243, 660], where the dissociation of dimer into subunits is followed by the monomer unfolding. The denaturation of CRP monitored by ANS fluorescence reveals the existence of two additional processes. One occurs before the dissociation of CRP into subunits, whereas the second takes place after the dissociation, but prior to proper subunit unfolding. These additional processes suggest that CRP denaturation is described by a more complicated mechanism than a simple three-state equilibrium and may involve additional changes in both inter- and intrasubunit interactions. We also report the effect of cAMP on the kinetics of CRP subunit unfolding and refolding. PMID:9988521

  5. Release of anti-inflammatory peptides from thermosensitive nanoparticles with degradable cross-links suppresses pro-inflammatory cytokine production.

    PubMed

    Poh, Scott; Lin, Jenny B; Panitch, Alyssa

    2015-04-13

    Pro-inflammatory cytokines tumor necrosis factor α (TNF-α) and interleukin 6 (IL-6) are mediators in the development of many inflammatory diseases. To demonstrate that macrophages take up and respond to thermosensitive nanoparticle drug carriers, we synthesized PEGylated poly(N-isopropylacrylamide-2-acrylamido-2-methyl-1-propanesulfonate) particles cross-linked with degradable disulfide (N,N'-bis(acryloyl)cystamine) (NGPEGSS). An anti-inflammatory peptide (KAFAK) was loaded and released from the thermosensitive nanoparticles and shown to suppress levels of TNF-α and IL-6 production in macrophages. Cellular uptake of fluorescent, thermosensitive, and degradable nanoparticles and therapeutic efficacy of free KAFAK peptide compared to that of KAFAK loaded in PEGylated degradable thermosensitive nanoparticles were examined. The data suggests that the degradable, thermosensitive nanoparticles loaded with KAFAK may be an effective tool to treat inflammatory diseases.

  6. Arachidonic acid release from rat Leydig cells: the involvement of G protein, phospholipase A2 and regulation of cAMP production.

    PubMed

    Ronco, A M; Moraga, P F; Llanos, M N

    2002-01-01

    We have previously demonstrated that the release of arachidonic acid (AA) from human chorionic gonadotropin (hCG)-stimulated Leydig cells occurs in a dose- and time-dependent manner. In addition, the amount of AA released was dependent on the hormone-receptor interaction and the concentration of LH-hCG binding sites on the cell surface. The present study was conducted to evaluate the involvement of phospholipase A(2) (PLA(2)) and G proteins in AA release from hormonally stimulated rat Leydig cells, and the possible role of this fatty acid in cAMP production. Cells were first prelabelled with [(14)C]AA to incorporate the fatty acid into cell phospholipids, and then treated in different ways to evaluate AA release. hCG (25 mIU) increased the release of AA to 180+/-12% when compared with AA released from control cells, arbitrarily set as 100%. Mepacrine and parabromophenacyl bromide (pBpB), two PLA(2) inhibitors, decreased the hormone-stimulated AA release to 85+/-9 and 70+/-24% respectively. Conversely, melittin, a PLA(2) stimulator, increased the release of AA up to 200% over control. The inhibitory effect of mepacrine on the release of AA was evident in hCG-treated Leydig cells, but not in the melittin-treated cells. To determine if the release of AA was also mediated through a G protein, cells were first permeabilized and subsequently treated with pertussis toxin or GTPgammaS, a non-hydrolyzable analog of GTP. Results demonstrate that GTPgammaS was able to induce a similar level of the release of AA as hCG. In addition, pertussis toxin completely abolished the stimulatory effect of hCG on the release of AA, indicating that a member of the G(i) family was involved in the hCG-dependent release of AA. Cells treated with PLA(2) inhibitors did not modify cAMP production, but exogenously added AA significantly reduced cAMP production from hCG-treated Leydig cells, in a manner dependent on the concentration of AA and hCG. Results presented here suggest an involvement of

  7. 24-hydroxyursolic acid from the leaves of the Diospyros kaki (Persimmon) induces apoptosis by activation of AMP-activated protein kinase.

    PubMed

    Khanal, Prem; Oh, Won-Keun; Thuong, Phuong Thien; Cho, Sung Dae; Choi, Hong Seok

    2010-05-01

    There are multiple lines of evidence that persimmon extract and its constituents have potent antitumor activity against human cancer cells. However, the molecular mechanisms of 24-hydroxyursolic acid, a triterpenoid found in persimmon, on antitumor activities are not yet understood. Here, we demonstrate that 24-hydroxyursolic acid inhibited cell proliferation, strongly activated AMP-activated protein kinase (AMPK) and mediated critical anticancer effects by inhibition of cyclooxygenase (COX-2) expression in HT-29 cells. In addition, 24-hydroxyursolic acid induced cellular apoptosis by activation of poly(ADP-ribose) polymerase (PARP), caspase-3, and phosphorylation of p53 at Ser15. It also strongly induced DNA fragmentation in HT-29 cells and thereby significantly inhibited colony formation of HT-29 cells in soft agar. In addition, 24-hydroxyursolic acid blocked the EGF-induced ERKs phosphorylation and led to the inhibition of AP-1 activity and cell transformation in JB6 CL41 cells. Collectively, these findings are the first to reveal a molecular basis for the anticarcinogenic action of 24-hydroxyursolic acid and might account for the reported chemopreventive and chemotherapic effects of persimmon extracts.

  8. Broth Microdilution Method To Detect Extended-Spectrum β-Lactamases and AmpC β-Lactamases in Enterobacteriaceae Isolates by Use of Clavulanic Acid and Boronic Acid as Inhibitors ▿

    PubMed Central

    Jeong, Seok Hoon; Song, Wonkeun; Kim, Jae-Seok; Kim, Han-Sung; Lee, Kyu Man

    2009-01-01

    This study was designed to evaluate the performance of the broth microdilution (BMD) method to detect production of extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases in Enterobacteriaceae by using clavulanic acid (CA) and boronic acid (BA) as ESBL and AmpC β-lactamase inhibitors, respectively. A total of 100 clinical isolates of Enterobacteriaceae were analyzed. Mueller-Hinton broth containing serial twofold dilutions of cefotaxime (CTX), ceftazidime (CAZ), aztreonam (ATM), or cefepime (FEP) with or without either or both CA and BA was prepared. An eightfold or greater decrease in the MIC of CTX, CAZ, ATM, or FEP in the presence of CA and BA was considered a positive result for ESBL and plasmid-mediated AmpC β-lactamase (PABL), respectively. In tests with CA, expanded-spectrum β-lactams containing BA (CTX-BA, CAZ-BA, ATM-BA, and FEP-BA) showed higher positive rates in detecting ESBL producers than those without BA. The combination of CTX- and CAZ-based BMD tests with CA and BA showed sensitivity and specificity of 100% for the detection of ESBLs and PABLs. The BMD testing could be applicable for routine use in commercially available semiautomated systems for the detection of ESBLs and PABLs in Enterobacteriaceae. PMID:19710269

  9. Modulatory effects of steroid hormones, oxytocin, arachidonic acid, forskolin and cyclic AMP on the expression of aquaporin 1 and aquaporin 5 in the porcine uterus during placentation.

    PubMed

    Skowronska, A; Mlotkowska, P; Okrasa, S; Nielsen, S; Skowronski, M T

    2016-04-01

    Aquaporins (AQPs) are proteins forming trans-membrane channels responsible for water transport. AQP1 and AQP5 are present in structures of the female reproductive system. In the uterus, these AQPs are involved in water movement between the intraluminal, interstitial and capillary compartments and their uterine expression is essential throughout the pregnancy, including its early stages. Thus, the study aimed to assess the influence of P4 (progesterone), E2 (estradiol), OT (oxytocin), AA (arachidonic acid), cAMP and FSK (forskolin) on the AQP1 and AQP5 mRNA and protein expression in the uterine tissue of gilts on Days 30 - 32 of gestation (the placentation period), following short (3 h) and long (24 h) incubations. Steroid hormones influenced the expression of AQP1 and AQP5; E2 up-regulated, but P4 down-regulated mRNAs of these AQPs, whereas the protein level of studied AQPs was increased by both steroids. OT treatment decreased AQP1 (after 24 h), but increased AQP5 (after 3 h) mRNA expression. Treatment with AA significantly reduced the AQP1 expression at the mRNA level, but stimulated at the protein level. The expression of AQP5 mRNA and protein was stimulated by AA. FSK markedly decreased AQP1 mRNA, but increased of AQP5 after 3-h incubation. In turn, cAMP stimulated and inhibited transcription of AQP5 after 3- and 24-h incubations, respectively. Immunohistochemical analysis confirmed the uterine localization of AQP1 in the apical and basal membranes of endothelial cells and AQP5 in the apical membranes of epithelial cells under control condition. Treatments with P4, E2, AA, cAMP or FSK have caused additional appearance of AQP5 labeling in the basolateral membranes of epithelial cells. These results suggest a participation of steroid hormones (P4 and E2), AA derivatives and cAMP in controlling the expression of AQP1 and AQP5 as well as the distribution of AQP5 in the uterine tissue of pregnant gilts during placentation (Days 30 - 32 of gestation). PMID:27226190

  10. meso-Dihydroguaiaretic acid inhibits hepatic lipid accumulation by activating AMP-activated protein kinase in human HepG2 cells.

    PubMed

    Lee, Myoung-Su; Kim, Kyung Jin; Kim, Daeyoung; Lee, Kyung-Eun; Hwang, Jae-Kwan

    2011-01-01

    Hepatic lipid accumulation is a major risk factor for dyslipidemia, nonalcoholic fatty liver disease, and insulin resistance. The present study was conducted to evaluate hypolipidemic effects of meso-dihydroguaiaretic acid (MDA), anti-oxidative and anti-inflammatory compound isolated from the Myristica fragrans HOUTT., by oil red O staining, reverse transcription-polymerase chain reaction (RT-PCR), and Western blot. MDA significantly inhibited insulin-induced hepatic lipid accumulation in a dose-dependent manner. The lipid-lowering effect of MDA was accompanied by increased expression of proteins involved in fatty acid oxidation and decreased expression of lipid synthetic proteins. In addition, MDA activated AMP-activated protein kinase (AMPK) as determined by phosphorylation of acetyl-CoA carboxylase (ACC), a downstream target of AMPK. The effects of MDA on lipogenic protein expression were suppressed by pretreatment with compound C, an AMPK inhibitor. Taken together, these findings show that MDA inhibits insulin-induced lipid accumulation in human HepG2 cells by suppressing expression of lipogenic proteins through AMPK signaling, suggesting a potent lipid-lowering agent. PMID:21963507

  11. Nordihydroguaiaretic acid protects against high-fat diet-induced fatty liver by activating AMP-activated protein kinase in obese mice

    SciTech Connect

    Lee, Myoung-Su; Kim, Daeyoung; Jo, Keunae; Hwang, Jae-Kwan

    2010-10-08

    Research highlights: {yields} NDGA decreases high-fat diet-induced body weight gain and adiposity. {yields} NDGA reduces high-fat diet-induced triglyceride accumulation in liver. {yields} NDGA improves lipid storage in vitro through altering lipid regulatory proteins. {yields} Inhibition of lipid storage in vivo and in vitro is mediated by AMPK activation. -- Abstract: Nonalcoholic fatty liver disease, one of the most common causes of chronic liver disease, is strongly associated with metabolic syndrome. Nordihydroguaiaretic acid (NDGA) has been reported to inhibit lipoprotein lipase; however, the effect of NDGA on hepatic lipid metabolism remains unclear. We evaluated body weight, adiposity, liver histology, and hepatic triglyceride content in high-fat diet (HFD)-fed C57BL/6J mice treated with NDGA. In addition, we characterized the underlying mechanism of NDGA's effects in HepG2 hepatocytes by Western blot and RT-PCR analysis. NDGA (100 or 200 mg/kg/day) reduced weight gain, fat pad mass, and hepatic triglyceride accumulation, and improved serum lipid parameters in mice fed a HFD for 8 weeks. NDGA significantly increased AMP-activated protein kinase (AMPK) phosphorylation in the liver and in HepG2 hepatocytes. NDGA downregulated the level of mature SREBP-1 and its target genes (acetyl-CoA carboxylase and fatty acid synthase), but, it upregulated expression of genes involved in fatty acid oxidation, such as peroxisome proliferator-activated receptor (PPAR){alpha}, PPAR{gamma} coactivator-1, carnitine palmitoyl transferase-1, and uncoupling protein-2. The specific AMPK inhibitor compound C attenuated the effects of NDGA on expression of lipid metabolism-related proteins in HepG2 hepatocytes. The beneficial effects of NDGA on HFD-induced hepatic triglyceride accumulation are mediated through AMPK signaling pathways, suggesting a potential target for preventing NAFLD.

  12. Coffee polyphenol caffeic acid but not chlorogenic acid increases 5'AMP-activated protein kinase and insulin-independent glucose transport in rat skeletal muscle.

    PubMed

    Tsuda, Satoshi; Egawa, Tatsuro; Ma, Xiao; Oshima, Rieko; Kurogi, Eriko; Hayashi, Tatsuya

    2012-11-01

    Chlorogenic acid is an ester of caffeic and quinic acids, and is one of the most widely consumed polyphenols because it is abundant in foods, especially coffee. We explored whether chlorogenic acid and its metabolite, caffeic acid, act directly on skeletal muscle to stimulate 5'-adenosine monophosphate-activated protein kinase (AMPK). Incubation of rat epitrochlearis muscles with Krebs buffer containing caffeic acid (≥0.1 mM, ≥30 min) but not chlorogenic acid increased the phosphorylation of AMPKα Thr(172), an essential step for kinase activation, and acetyl CoA carboxylase Ser(79), a downstream target of AMPK, in a dose- and time-dependent manner. Analysis of isoform-specific AMPK activity revealed that AMPKα2 activity increased significantly, whereas AMPKα1 activity did not change. This enzyme activation was associated with a reduction in phosphocreatine content and an increased rate of 3-O-methyl-d-glucose transport activity in the absence of insulin. These results suggest that caffeic acid but not chlorogenic acid acutely stimulates skeletal muscle AMPK activity and insulin-independent glucose transport with a reduction of the intracellular energy status. PMID:22227267

  13. Activation of the AMP-Activated Protein Kinase by Eicosapentaenoic Acid (EPA, 20:5 n-3) Improves Endothelial Function In Vivo

    PubMed Central

    Wu, Yong; Zhang, Cheng; Dong, Yunzhou; Wang, Shuangxi; Song, Ping; Viollet, Benoit; Zou, Ming-Hui

    2012-01-01

    The aim of the present study was to test the hypothesis that the cardiovascular-protective effects of eicosapentaenoic acid (EPA) may be due, in part, to its ability to stimulate the AMP-activated protein kinase (AMPK)-induced endothelial nitric oxide synthase (eNOS) activation. The role of AMPK in EPA-induced eNOS phosphorylation was investigated in bovine aortic endothelial cells (BAEC), in mice deficient of either AMPKα1 or AMPKα2, in eNOS knockout (KO) mice, or in Apo-E/AMPKα1 dual KO mice. EPA-treatment of BAEC increased both AMPK-Thr172 phosphorylation and AMPK activity, which was accompanied by increased eNOS phosphorylation, NO release, and upregulation of mitochondrial uncoupling protein-2 (UCP-2). Pharmacologic or genetic inhibition of AMPK abolished EPA-enhanced NO release and eNOS phosphorylation in HUVEC. This effect of EPA was absent in the aortas isolated from either eNOS KO mice or AMPKα1 KO mice fed a high-fat, high-cholesterol (HFHC) diet. EPA via upregulation of UCP-2 activates AMPKα1 resulting in increased eNOS phosphorylation and consequent improvement of endothelial function in vivo. PMID:22532857

  14. Endogenous Ligand for GPR120, Docosahexaenoic Acid, Exerts Benign Metabolic Effects on the Skeletal Muscles via AMP-activated Protein Kinase Pathway*

    PubMed Central

    Kim, Nami; Lee, Jung Ok; Lee, Hye Jeong; Kim, Hyung Ip; Kim, Joong Kwan; Lee, Yong Woo; Lee, Soo Kyung; Kim, Su Jin; Park, Sun Hwa; Kim, Hyeon Soo

    2015-01-01

    Docosahexaenoic acid (DHA) is an endogenous ligand of G protein-coupled receptor 120 (GPR120). However, the mechanisms underlying DHA action are poorly understood. In this study, DHA stimulated glucose uptake in the skeletal muscles in an AMP-activated protein kinase (AMPK)-dependent manner. GPR120-mediated increase in intracellular Ca2+ was critical for DHA-mediated AMPK phosphorylation and glucose uptake. In addition, DHA stimulated GLUT4 translocation AMPK-dependently. Inhibition of AMPK and Ca2+/calmodulin-dependent protein kinase kinase blocked DHA-induced glucose uptake. DHA and GW9508, a GPR120 agonist, increased GPR120 expression. DHA-mediated glucose uptake was not observed in GPR120 knockdown conditions. DHA increased AMPK phosphorylation, glucose uptake, and intracellular Ca2+ concentration in primary cultured myoblasts. Taken together, these results indicated that the beneficial metabolic role of DHA was attributed to its ability to regulate glucose via the GPR120-mediated AMPK pathway in the skeletal muscles. PMID:26134561

  15. Differential regulation of nicotinic acid-adenine dinucleotide phosphate and cADP-ribose production by cAMP and cGMP.

    PubMed Central

    Wilson, H L; Galione, A

    1998-01-01

    The sea urchin egg has been used as a system to study calcium-release mechanisms induced by inositol 1,4,5-trisphosphate (IP3), cADP-ribose (cADPR), and more recently, nicotinic acid-adenine dinucleotide phosphate (NAADP). In order that cADPR and NAADP may be established as endogenous messengers for calcium release, the existence of intracellular enzymes capable of metabolizing these molecules must be demonstrated. In addition, intracellular levels of cADPR and NAADP should be under the control of extracellular stimuli. It has been shown that cGMP stimulates the synthesis of cADPR in the sea urchin egg. The present study shows that the sea urchin egg is capable of synthesizing and degrading NAADP. cADPR and NAADP synthetic activities appear to be separate, with different cellular localizations, pH and temperature optima. We suggest that in the sea urchin egg, cADPR and NAADP production may be differentially regulated by receptor-coupled second messengers, with cADPR production being regulated by cGMP and NAADP production modulated by cAMP. PMID:9560312

  16. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases.

  17. Resistance to Cefepime and Cefpirome Due to a 4-Amino-Acid Deletion in the Chromosome-Encoded AmpC β-Lactamase of a Serratia marcescens Clinical Isolate

    PubMed Central

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-01-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The blaAmpC gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the blaAmpC gene from S. marcescens HD had a 12-nucleotide deletion compared to the blaAmpC gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the β-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type β-lactamases. PMID:14982755

  18. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate.

    PubMed

    Mammeri, Hedi; Poirel, Laurent; Bemer, Pascal; Drugeon, Henri; Nordmann, Patrice

    2004-03-01

    A multiresistant Serratia marcescens strain, HD, isolated from a patient with a urinary tract infection, was resistant to amino-, carboxy-, and ureidopenicillins, ceftazidime, and cefepime and was susceptible to cefotaxime and ceftriaxone, according to the guidelines of the NCCLS. No synergy was found between expanded-spectrum cephalosporins and clavulanic acid, according to the double-disk synergy test. The bla(AmpC) gene of the strain was amplified by PCR and cloned into Escherichia coli DH10B, giving rise to high-level resistance to ceftazidime, cefepime, and cefpirome. Sequencing analysis revealed that the bla(AmpC) gene from S. marcescens HD had a 12-nucleotide deletion compared to the bla(AmpC) gene from reference strain S. marcescens S3, leading to a 4-amino-acid deletion located in the H-10 helix of the beta-lactamase. Kinetic analysis showed that this enzyme significantly hydrolyzed ceftazidime, cefepime, and cefpirome. This work underlined that resistance to the latest expanded-spectrum cephalosporins may be mediated by structurally modified AmpC-type beta-lactamases. PMID:14982755

  19. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  20. AMP-activated Protein Kinase α2 Subunit Is Required for the Preservation of Hepatic Insulin Sensitivity by n-3 Polyunsaturated Fatty Acids

    PubMed Central

    Jelenik, Tomas; Rossmeisl, Martin; Kuda, Ondrej; Jilkova, Zuzana Macek; Medrikova, Dasa; Kus, Vladimir; Hensler, Michal; Janovska, Petra; Miksik, Ivan; Baranowski, Marcin; Gorski, Jan; Hébrard, Sophie; Jensen, Thomas E.; Flachs, Pavel; Hawley, Simon; Viollet, Benoit; Kopecky, Jan

    2010-01-01

    OBJECTIVE The induction of obesity, dyslipidemia, and insulin resistance by high-fat diet in rodents can be prevented by n-3 long-chain polyunsaturated fatty acids (LC-PUFAs). We tested a hypothesis whether AMP-activated protein kinase (AMPK) has a role in the beneficial effects of n-3 LC-PUFAs. RESEARCH DESIGN AND METHODS Mice with a whole-body deletion of the α2 catalytic subunit of AMPK (AMPKα2−/−) and their wild-type littermates were fed on either a low-fat chow, or a corn oil-based high-fat diet (cHF), or a cHF diet with 15% lipids replaced by n-3 LC-PUFA concentrate (cHF+F). RESULTS Feeding a cHF diet induced obesity, dyslipidemia, hepatic steatosis, and whole-body insulin resistance in mice of both genotypes. Although cHF+F feeding increased hepatic AMPKα2 activity, the body weight gain, dyslipidemia, and the accumulation of hepatic triglycerides were prevented by the cHF+F diet to a similar degree in both AMPKα2−/− and wild-type mice in ad libitum-fed state. However, preservation of hepatic insulin sensitivity by n-3 LC-PUFAs required functional AMPKα2 and correlated with the induction of adiponectin and reduction in liver diacylglycerol content. Under hyperinsulinemic-euglycemic conditions, AMPKα2 was essential for preserving low levels of both hepatic and plasma triglycerides, as well as plasma free fatty acids, in response to the n-3 LC-PUFA treatment. CONCLUSIONS Our results show that n-3 LC-PUFAs prevent hepatic insulin resistance in an AMPKα2-dependent manner and support the role of adiponectin and hepatic diacylglycerols in the regulation of insulin sensitivity. AMPKα2 is also essential for hypolipidemic and antisteatotic effects of n-3 LC-PUFA under insulin-stimulated conditions. PMID:20693347

  1. Species differences in the effects of prostaglandins on inositol trisphosphate accumulation, phosphatidic acid formation, myosin light chain phosphorylation and contraction in iris sphincter of the mammalian eye: interaction with the cyclic AMP system.

    PubMed

    Yousufzai, S Y; Chen, A L; Abdel-Latif, A A

    1988-12-01

    Comparative studies on the effects of prostaglandins (PGs) on 1,2-diacylglycerol, measured as phosphatidic acid (PA), and inositol trisphosphate (IP3) production, cyclic AMP (cAMP) formation, myosin light chain (MLC) phosphorylation and contraction in the iris sphincter smooth muscle of rabbit, bovine and other mammalian species were undertaken and functional and biochemical relationships between the IP3-Ca++ and cAMP second messenger systems were demonstrated. The findings obtained from these studies can be summarized as follows: 1) all PGs investigated, including PGE2, PGF2 alpha, PGF2 alpha-ester, PGE1 and PGA2 increased IP3 accumulation and PA formation, and the extent of stimulation was dependent on the animal species. Thus, PGF2 alpha-ester (1 microM), the most potent of the PGs, increased IP3 accumulation in rabbit and bovine sphincters by 33 and 58%, respectively, and increased PA formation by 67 and 56%, respectively. The PG increased IP3 accumulation in both rabbit and bovine sphincters very rapidly (T1/2 values about 26 sec) and in a dose-dependent manner. 2) The PG had no effect on MLC phosphorylation in the rabbit sphincter, but it increased that of the bovine by 36%. 3) The PG increased cAMP formation by 75% in the rabbit sphincter but it had no effect on that of the bovine. 4) The PG induced a maximal contractile response in the bovine sphincter but it had no effect on that of the rabbit. 5) In the bovine, PGA2 induced IP3 accumulation and contraction, without an effect on cAMP formation; however, in the rabbit, cat and dog it increased cAMP formation and had no effect on IP3 accumulation and contraction.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. β-Guanidinopropionic acid extends the lifespan of Drosophila melanogaster via an AMP-activated protein kinase-dependent increase in autophagy.

    PubMed

    Yang, Si; Long, Li-Hong; Li, Di; Zhang, Jian-Kang; Jin, Shan; Wang, Fang; Chen, Jian-Guo

    2015-12-01

    Previous studies have demonstrated that AMP-activated protein kinase (AMPK) controls autophagy through the mammalian target of rapamycin (mTOR) and Unc-51 like kinase 1 (ULK1/Atg1) signaling, which augments the quality of cellular housekeeping, and that β-guanidinopropionic acid (β-GPA), a creatine analog, leads to a chronic activation of AMPK. However, the relationship between β-GPA and aging remains elusive. In this study, we hypothesized that feeding β-GPA to adult Drosophila produces the lifespan extension via activation of AMPK-dependent autophagy. It was found that dietary administration of β-GPA at a concentration higher than 900 mm induced a significant extension of the lifespan of Drosophila melanogaster in repeated experiments. Furthermore, we found that Atg8 protein, the homolog of microtubule-associated protein 1A/1B-light chain 3 (LC3) and a biomarker of autophagy in Drosophila, was significantly upregulated by β-GPA treatment, indicating that autophagic activity plays a role in the effect of β-GPA. On the other hand, when the expression of Atg5 protein, an essential protein for autophagy, was reduced by RNA interference (RNAi), the effect of β-GPA on lifespan extension was abolished. Moreover, we found that AMPK was also involved in this process. β-GPA treatment significantly elevated the expression of phospho-T172-AMPK levels, while inhibition of AMPK by either AMPK-RNAi or compound C significantly attenuated the expression of autophagy-related proteins and lifespan extension in Drosophila. Taken together, our results suggest that β-GPA can induce an extension of the lifespan of Drosophila via AMPK-Atg1-autophagy signaling pathway.

  3. Replacement of glutamic acid 29 with glutamine leads to a loss of cooperativity for AMP with porcine fructose-1,6-bisphosphatase.

    PubMed

    Chen, M; Chen, L; Fromm, H J

    1994-02-25

    Mutations in the AMP binding site of porcine fructose-1,6-bisphosphatase were carried out by site-specific mutagenesis based on the crystal structure of the enzyme (Ke, H., Zhang, Y., and Lipscomb, W.L. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 5243-5247). The mutant and wild-type enzymes were characterized by SDS-polyacrylamide gel electrophoresis, circular dichroism spectrometry, and initial rate kinetics. One of the mutant forms of fructose-1,6-bisphosphatase, Glu-29-->Gln, is ligated to the phosphoryl moiety of AMP, a potent inhibitor of the reaction, whereas the other mutant, Thr-31-->Val, is associated with the purine base of AMP. No discernible alteration in structure as measured by circular dichroism spectrometry was noted for the mutants relative to the wild-type enzyme. As expected, major changes in kinetic parameters between the mutants and the wild-type enzyme were associated with inhibition by AMP. AMP, a competitive inhibitor with respect to Mg2+ in the fructose-1,6-bisphosphatase reaction, exhibits cooperativity in the case of the wild-type and the mutant Thr-31-->Val enzymes with a Hill coefficient of 2.0. On the other hand, cooperativity is completely lost in the case of Glu-29-->Gln fructose-1,6-bisphosphatase.

  4. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2016-07-12

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  5. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  6. The vasorelaxant effect of 8(17),12E,14-labdatrien-18-oic acid involves stimulation of adenylyl cyclase and cAMP/PKA pathway: Evidences by pharmacological and molecular docking studies.

    PubMed

    Ribeiro, Luciano A A; Alencar Filho, Edilson B; Coelho, Maisa C; Silva, Bagnólia A

    2015-10-01

    The relaxant effect of 8(17),12E,14-labdatrien-18-oic acid (LBD) was investigated on isolated aortic rings and compared with forskolin (FSK), a standard and potent activator of adenylyl cyclase (AC) with relaxing effect. The presence of potassium channel blockers, such as glibenclamide (ATP-blocker), apamin (SKCa-blocker), charybdotoxin (BKCa-blocker) did not significantly affect either the LBD or FSK concentration-response curves. However, in the presence of 4-aminopyridine (KV-blocker), the relaxant effect for both diterpenes was significantly attenuated, with reduction of its relative potencies. Moreover, the relaxation induced by 8-Br-cAMP, an analog of cAMP, was also significantly attenuated in the same conditions, i.e., in the presence of 4-aminopyridine. The presence of aminophylline, a nonselective phosphodiesterase inhibitor, caused a significant increasing in the potency for both LBD and FSK. On the other hand, the presence of Rp-cAMPS, a selective PKA-inhibitor, significantly attenuated the relaxant effect of LBD. In this work, in the same experimental conditions, both labdane-type diterpenes presented remarkably similar results; FSK, however, presented a higher potency (100-fold) than LBD. Thus, the hypothesis that LBD could be a novel AC-activator emerged. To assess that hypothesis, computational molecular docking studies were performed. Crystallographic structure of adenylyl cyclase/forskolin complex (1AB8) was obtained from RSCB Protein Data Bank and used to compare the modes of interaction of the native ligand and LBD. The computational data shows many similarities between LBD and FSK concerning the interaction with the regulatory site of AC. Taken together, the results presented here pointed to LBD as a novel AC-activator. PMID:26144373

  7. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  8. Electrochromic and photonic devices utilizing polymer colloidal particles

    NASA Astrophysics Data System (ADS)

    Shim, Goo Hwan

    switched more than 100 times with 5% drop of transmittance contrast ratio and PEDOT-based ECD could be switched more than 1000 times with 7% drop of transmittance contrast ratio at lambdamax. In addition to the single ICP-based ECDs, ECDs having the PANI and PEDOT blended electrochromic layer was fabricated to achieve the tuning of the absorption spectra of the ECD. The blended electrochromic layer was formed through the inkjet printing of the blended PANI-silica and PEDOT-silica inks on an ITO-PET film. Micro pixelated ECDs having 500 mum sized patterns and large area static image ECDs having 5 cm sized patterns are fabricated employing the inkjet printed electrochromic layers. Moreover, dual image display ECDs could be fabricated through the inkjet printing of two different electrochromic materials on the same electrode. In the second part, a reflection-type ECDs employing PS PCCA film both as reflection mirror and polymeric electrolyte is presented. This work realizes the modulation of the rejected light from a PS PCCA structure through the electrochemical switching of the electrochromic material, PANI-poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPS) composites. Film processible conducting polymer PANI-PAMPS was first synthesized then spun cast on an ITO-PET film to form an electrochromic layer. The reflection-type PANI-PAMPS-based ECD, employing PS PCCA both as a mirror and a polymeric electrolyte was fabricated. Resulting reflection-type ECDs exhibited the modulation of reflectance from the stop band of the PCCA with the 3% reflectance contrast ratio at 562 nm. The third part presents the dynamic tuning of a photoluminescent dye through the coupling of a Rhodamine B dye to the PS CCA. Reflectance and photoluminescence spectra of this luminescent dye-coupled ordered structures showed modification of emission in the region of the stop band. An adjustment of the interparticle distance could modify the emission spectra of the dye labeled particles by varying the

  9. A novel cysteine-rich antifungal peptide ToAMP4 from Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, Eugene A; Andreev, Yaroslav A; Odintsova, T I; Kozlov, S A; Grishin, Eugene V; Egorov, Tsezi A

    2013-09-01

    A novel peptide named ToAMP4 was isolated from Taraxacum officinale Wigg. flowers by a combination of acetic acid extraction and different types of chromatography: affinity, size-exclusion, and RP-HPLC. The amino acid sequence of ToAMP4 was determined by automated Edman degradation. The peptide is basic, consists of 41 amino acids, and incorporates three disulphide bonds. Due to the unusual cysteine spacing pattern, ToAMP4 does not belong to any known plant AMP family, but classifies together with two other antimicrobial peptides ToAMP1 and ToAMP2 previously isolated from the dandelion flowers. To study the biological activity of ToAMP4, it was successfully produced in a prokaryotic expression system as a fusion protein with thioredoxin. The recombinant peptide was shown to be identical to the native ToAMP4 by chromatographic behavior, molecular mass, and N-terminal amino acid sequence. The peptide displays broad-spectrum antifungal activity against important phytopathogens. Two ToAMP4-mediated inhibition strategies depending on the fungus were demonstrated. The results obtained add to our knowledge on the structural and functional diversity of AMPs in plants.

  10. Nesfatin-1 Stimulates Fatty-Acid Oxidation by Activating AMP-Activated Protein Kinase in STZ-Induced Type 2 Diabetic Mice

    PubMed Central

    Xu, Huan; Wang, Peng-fei; Cai, Gui-ju; Song, Hai-feng; Wang, Chang-chen; Dong, Zhao-tong; Ju, Yan-jiao; Jiang, Zheng-yao

    2013-01-01

    Nesfatin-1 is an anorexigenic peptide involved in energy homeostasis. Recently, nesfatin-1 was reported to decrease blood glucose level and improve insulin sensitivity in high-fat diet-fed rats. However, little information is known about the influence of nesfatin-1 on lipid metabolism either in physiological or diabetic condition. This study undertook whether nesfatin-1 was involved in the pathophysiology in Streptozotocin-induced type 2 diabetic mice (T2DM), which was induced by a combination of high-calorie diet and two low-doses Streptozotocin. We observed that plasma nesfatin-1 was significantly increased while expression of nesfatin-1 neurons were decreased in hypothalamus in diabetes group compared to only high-calorie diet control group; intravenous injection of nesfatin-1 decreased 0–1h, 0–2h, 0–3h cumulative food intake in T2DM, but 0–24h total food intake had no difference between groups. Body weight and plasma FFA were normalized after nesfatin-1(10 µg/Kg) administration for 6 days. These results suggested that nesfatin-1 improved lipid disorder in T2DM. It was found that blood glucose and insulin resistance coefficient decreased with treatment of nesfatin-1 (both in 1 µg/Kg and 10 µg/Kg doses) in diabetes mice. For further understanding the role of nesfatin-1 on lipid metabolism, we detected p-AMPK and p-ACC of skeletal muscle in T2DM using western blotting. The expression of p-AMPK and p-ACC increased when nesfatin-1 was given with doses 1 µg/Kg but not in doses 10 µg/Kg. Taken together, nesfatin-1 participated in the development of T2DM and stimulated free fatty acid utilization via AMPK-ACC pathway in skeletal muscle in T2DM. PMID:24391760

  11. Dehydroeburicoic Acid from Antrodia camphorata Prevents the Diabetic and Dyslipidemic State via Modulation of Glucose Transporter 4, Peroxisome Proliferator-Activated Receptor α Expression and AMP-Activated Protein Kinase Phosphorylation in High-Fat-Fed Mice.

    PubMed

    Kuo, Yueh-Hsiung; Lin, Cheng-Hsiu; Shih, Chun-Ching

    2016-01-01

    This study investigated the potential effects of dehydroeburicoic acid (TT), a triterpenoid compound from Antrodia camphorata, in vitro and examined the effects and mechanisms of TT on glucose and lipid homeostasis in high-fat-diet (HFD)-fed mice. The in vitro study examined the effects of a MeOH crude extract (CruE) of A. camphorata and Antcin K (AnK; the main constituent of fruiting body of this mushroom) on membrane glucose transporter 4 (GLUT4) and phospho-Akt in C2C12 myoblasts cells. The in vitro study demonstrated that treatment with CruE, AnK and TT increased the membrane levels of glucose transporter 4 (GLUT4) and phospho-Akt at different concentrations. The animal experiments were performed for 12 weeks. Diabetic mice were randomly divided into six groups after 8 weeks of HFD-induction and treated with daily oral gavage doses of TT (at three dose levels), fenofibrate (Feno) (at 0.25 g/kg body weight), metformin (Metf) (at 0.3 g/kg body weight) or vehicle for another 4 weeks while on an HFD diet. HFD-fed mice exhibited increased blood glucose levels. TT treatment dramatically lowered blood glucose levels by 34.2%~43.4%, which was comparable to the antidiabetic agent-Metf (36.5%). TT-treated mice reduced the HFD-induced hyperglycemia, hypertriglyceridemia, hyperinsulinemia, hyperleptinemia, and hypercholesterolemia. Membrane levels of GLUT4 were significantly higher in CruE-treated groups in vitro. Skeletal muscle membrane levels of GLUT4 were significantly higher in TT-treated mice. These groups of mice also displayed lower mRNA levels of glucose-6-phosphatase (G6 Pase), an inhibitor of hepatic glucose production. The combination of these agents produced a net hypoglycemic effect in TT-treated mice. TT treatment enhanced the expressions of hepatic and skeletal muscle AMP-activated protein kinase (AMPK) phosphorylation in mice. TT-treated mice exhibited enhanced expression of hepatic fatty acid oxidation enzymes, including peroxisome proliferator

  12. Dehydroeburicoic Acid from Antrodia camphorata Prevents the Diabetic and Dyslipidemic State via Modulation of Glucose Transporter 4, Peroxisome Proliferator-Activated Receptor α Expression and AMP-Activated Protein Kinase Phosphorylation in High-Fat-Fed Mice

    PubMed Central

    Kuo, Yueh-Hsiung; Lin, Cheng-Hsiu; Shih, Chun-Ching

    2016-01-01

    This study investigated the potential effects of dehydroeburicoic acid (TT), a triterpenoid compound from Antrodia camphorata, in vitro and examined the effects and mechanisms of TT on glucose and lipid homeostasis in high-fat-diet (HFD)-fed mice. The in vitro study examined the effects of a MeOH crude extract (CruE) of A. camphorata and Antcin K (AnK; the main constituent of fruiting body of this mushroom) on membrane glucose transporter 4 (GLUT4) and phospho-Akt in C2C12 myoblasts cells. The in vitro study demonstrated that treatment with CruE, AnK and TT increased the membrane levels of glucose transporter 4 (GLUT4) and phospho-Akt at different concentrations. The animal experiments were performed for 12 weeks. Diabetic mice were randomly divided into six groups after 8 weeks of HFD-induction and treated with daily oral gavage doses of TT (at three dose levels), fenofibrate (Feno) (at 0.25 g/kg body weight), metformin (Metf) (at 0.3 g/kg body weight) or vehicle for another 4 weeks while on an HFD diet. HFD-fed mice exhibited increased blood glucose levels. TT treatment dramatically lowered blood glucose levels by 34.2%~43.4%, which was comparable to the antidiabetic agent-Metf (36.5%). TT-treated mice reduced the HFD-induced hyperglycemia, hypertriglyceridemia, hyperinsulinemia, hyperleptinemia, and hypercholesterolemia. Membrane levels of GLUT4 were significantly higher in CruE-treated groups in vitro. Skeletal muscle membrane levels of GLUT4 were significantly higher in TT-treated mice. These groups of mice also displayed lower mRNA levels of glucose-6-phosphatase (G6 Pase), an inhibitor of hepatic glucose production. The combination of these agents produced a net hypoglycemic effect in TT-treated mice. TT treatment enhanced the expressions of hepatic and skeletal muscle AMP-activated protein kinase (AMPK) phosphorylation in mice. TT-treated mice exhibited enhanced expression of hepatic fatty acid oxidation enzymes, including peroxisome proliferator

  13. Tormentic acid, a major component of suspension cells of Eriobotrya japonica, suppresses high-fat diet-induced diabetes and hyperlipidemia by glucose transporter 4 and AMP-activated protein kinase phosphorylation.

    PubMed

    Wu, Jin-Bin; Kuo, Yueh-Hsiung; Lin, Cheng-Hsiu; Ho, Hui-Ya; Shih, Chun-Ching

    2014-11-01

    This study was designed to evaluate the effects and mechanism of tormentic acid (PTA) on diabetes and dyslipidemia in high-fat (HF)-fed mice. Feeding C57BL/6J mice with a HF diet for 12 weeks induced type 2 diabetes and hyperlipidemia. During the last 4 weeks, the mice were given orally PTA (at two dosages) or rosiglitazone (Rosi) or water. In this study, the HF diet increased glucose, triglyceride, insulin, and leptin levels, whereas PTA effectively prevented these phenomena and ameliorated insulin resistance. PTA reduced visceral fat mass and hepatic triacylglycerol contents; moreover, PTA significantly decreased both the area of adipocytes and ballooning degeneration of hepatocytes. PTA caused increased skeletal muscular AMP-activated protein kinase (AMPK) phosphorylation and Akt phosphorylation and glucose transporter 4 (GLUT4) proteins, but reduced the hepatic expressions of phosphenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6 Pase) genes. PTA enhanced skeletal muscular Akt phosphorylation and increased insulin sensitivity. PTA also enhanced phospho-AMPK in the liver. Therefore, it is possible that the activation of AMPK by PTA results in decreasing hepatic glucose production while increasing skeletal muscular GLUT4 contents, thus contributing to attenuating the diabetic state. Moreover, PTA exhibits an antihyperlipidemic effect by down-regulations of the hepatic sterol regulatory element binding protein-1c (SREBP-1c) and apolipoprotein C-III (apo C-III) and an increased peroxisome proliferator activated receptor (PPAR)-α expression, thus resulting in decreases in blood triglycerides. These findings demonstrated that PTA was effective for the treatment of diabetes and hyperlipidemia in HF-fed mice.

  14. Purification, characterization, and sequencing of novel antimicrobial peptides, Tu-AMP 1 and Tu-AMP 2, from bulbs of tulip (Tulipa gesneriana L.).

    PubMed

    Fujimura, Masatoshi; Ideguchi, Mineo; Minami, Yuji; Watanabe, Keiichi; Tadera, Kenjiro

    2004-03-01

    Novel antimicrobial peptides (AMP), designated Tu-AMP 1 and Tu-AMP 2, were purified from the bulbs of tulip (Tulipa gesneriana L.) by chitin affinity chromatography and reverse-phase high-performance liquid chromatography (HPLC). They bind to chitin in a reversible way. They were basic peptides having isoelectric points of over 12. Tu-AMP 1 and Tu-AMP 2 had molecular masses of 4,988 Da and 5,006 Da on MALDI-TOF MS analysis, and their extinction coefficients of 1% aqueous solutions at 280 nm were 3.3 and 3.4, respectively. Half of all amino acid residues of Tu-AMP 1 and Tu-AMP 2 were occupied by cysteine, arginine, lysine, and proline. The concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic bacteria and fungi were 2 to 20 microg/ml. The structural characteristics of Tu-AMP 1 and Tu-AMP 2 indicated that they were novel thionin-like antimicrobial peptides, though Tu-AMP 2 was a heterodimer composes of two short peptides joined with disulfide bonds.

  15. 3':5'-cyclic AMP and hormonal control of puparium formation in the fleshfly Sarcophaga bullata.

    PubMed

    Fraenkel, G; Blechl, A; Blechl, J; Herman, P; Seligman, M I

    1977-05-01

    Injection of 3':5'-cyclic AMP (cAMP) into larvae of the fly Sarcophaga bullata 3-4 hr before the beginning of puparium formation (red-spiracle stage) greatly accelerates the onset of tanning without affecting initiation of puparium formation (anterior retraction). Accelerated tanning resembles real tanning in two important respects: the solubility of cuticular proteins becomes reduced and [U-14C]tyrosine is incorporated into the cuticle. Of a number of cAMP analogues tested, 3':5'- cyclic GMP, 2':3'-cyclic AMP, and 5'-AMP were inactive, dibutyryl-3':5'-cAMP had only slight activity, and cyclic IMP and deoxy-3':5'-cAMP showed some activity. Theophylline enhanced the effect of small doses of cAMP or of blood, diluted 1:8, active in the puparium tanning factor. Injection of dopa, dopamine, acetyldopamine, or epinephrine, but not of tyrosine, had an accelerating effect similar to that of cAMP. The tanning-inhibiting effect of DL-alpha-methyl-alpha-hydrazino-beta-(3,4-dihydroxyphenyl)propionic acid monohydrate is reversed by dopamine or epinephrine, but not by tyrosine, dopa, or cAMP. Evidence is presented to indicate that the responses to cAMP are not artifacts but reflect actual biochemical events during tanning.

  16. Farnesoid X receptor activation by chenodeoxycholic acid induces detoxifying enzymes through AMP-activated protein kinase and extracellular signal-regulated kinase 1/2-mediated phosphorylation of CCAAT/enhancer binding protein β.

    PubMed

    Noh, Kyoung; Kim, Young Mi; Kim, Young Woo; Kim, Sang Geon

    2011-08-01

    Farnesoid X receptor (FXR) regulates redox homeostasis and elicits a cytoprotective effect. CCAAT/enhancer binding protein-β (C/EBPβ) plays a role in regulating the expression of hepatocyte-specific genes and contributes to hepatocyte protection and liver regeneration. In view of the role of FXR in xenobiotic metabolism and hepatocyte survival, this study investigated the potential of FXR to activate C/EBPβ for the induction of detoxifying enzymes and the responsible regulatory pathway. Chenodeoxycholic acid (CDCA), a major component in bile acids, activates FXR. In HepG2 cells, CDCA treatment activated C/EBPβ, as shown by increases in its phosphorylation, nuclear accumulation, and expression. 3-(2,6-Dichlorophenyl)-4-(3'-carboxy-2-chlorostilben-4-yl-)oxymethyl-5-isopropyl-isoxazole (GW4064), a synthetic FXR ligand, had similar effects. In addition, CDCA enhanced luciferase gene transcription from the construct containing -1.65-kb GSTA2 promoter, which contained C/EBP response element (pGL-1651). Moreover, CDCA treatment activated AMP-activated protein kinase (AMPK), which led to extracellular signal-regulated kinase 1/2 (ERK1/2) activation, as evidenced by the results of experiments using a dominant-negative mutant of AMPKα and chemical inhibitor. The activation of ERK1/2 was responsible for the activating phosphorylation of C/EBPβ. FXR knockdown attenuated the ability of CDCA to activate AMPK and ERK1/2 and phosphorylate C/EBPβ. Consistently, enforced expression of FXR promoted the phosphorylation of AMPKα, ERK1/2, and C/EBPβ, verifying that C/EBPβ phosphorylation elicited by CDCA results from the activation of AMPK and ERK1/2 by FXR. In mice, CDCA treatment activated C/EBPβ with the induction of detoxifying enzymes in the liver. Our results demonstrate that CDCA induces antioxidant and xenobiotic-metabolizing enzymes by activating C/EBPβ through AMPK-dependent ERK1/2 pathway downstream of FXR.

  17. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  18. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  19. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  20. Schwann Cells Metabolize Extracellular 2',3'-cAMP to 2'-AMP.

    PubMed

    Verrier, Jonathan D; Kochanek, Patrick M; Jackson, Edwin K

    2015-08-01

    The 3',5'-cAMP-adenosine pathway (3',5'-cAMP→5'-AMP→adenosine) and the 2',3'-cAMP-adenosine pathway (2',3'-cAMP→2'-AMP/3'-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2',3'-cAMP-adenosine pathway via their robust expression of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase; converts 2',3'-cAMP to 2'-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2',3'-cAMP-adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2',3'-cAMP-adenosine pathway to the 3',5'-cAMP-adenosine pathway in Schwann cells, we examined the metabolism of 2',3'-cAMP, 2'-AMP, 3'-AMP, 3',5'-cAMP, and 5'-AMP in primary rat Schwann cells in culture. Addition of 2',3'-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2'-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2',3'-cAMP to 3'-AMP or 3',5'-cAMP to either 3'-AMP or 5'-AMP. Although Schwann cells slightly converted 2',3'-cAMP and 2'-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2',3'-cAMP and extracellular 2'-AMP. These findings indicate that Schwann cells do not have a robust 3',5'-cAMP-adenosine pathway but do have a 2',3'-cAMP-adenosine pathway; however, because the pathway mostly involves 2'-AMP formation rather than 3'-AMP, and because the conversion of 2'-AMP to adenosine is slow, metabolism of 2',3'-cAMP mostly results in the accumulation of 2'-AMP. Accumulation of 2'-AMP in peripheral nerves postinjury could have pathophysiological consequences. PMID:25998049

  1. Cyclic Di-AMP Homeostasis in Bacillus subtilis

    PubMed Central

    Mehne, Felix M. P.; Gunka, Katrin; Eilers, Hinnerk; Herzberg, Christina; Kaever, Volkhard; Stülke, Jörg

    2013-01-01

    The genome of the Gram-positive soil bacterium Bacillus subtilis encodes three potential diadenylate cyclases that may synthesize the signaling nucleotide cyclic di-AMP (c-di-AMP). These enzymes are expressed under different conditions in different cell compartments, and they localize to distinct positions in the cell. Here we demonstrate the diadenylate cyclase activity of the so far uncharacterized enzymes CdaA (previously known as YbbP) and CdaS (YojJ). Our work confirms that c-di-AMP is essential for the growth of B. subtilis and shows that an excess of the molecule is also harmful for the bacteria. Several lines of evidence suggest that the diadenylate cyclase CdaA is part of the conserved essential cda-glm module involved in cell wall metabolism. In contrast, the CdaS enzyme seems to provide c-di-AMP for spores. Accumulation of large amounts of c-di-AMP impairs the growth of B. subtilis and results in the formation of aberrant curly cells. This phenotype can be partially suppressed by elevated concentrations of magnesium. These observations suggest that c-di-AMP interferes with the peptidoglycan synthesis machinery. The activity of the diadenylate cyclases is controlled by distinct molecular mechanisms. CdaA is stimulated by a regulatory interaction with the CdaR (YbbR) protein. In contrast, the activity of CdaS seems to be intrinsically restricted, and a single amino acid substitution is sufficient to drastically increase the activity of the enzyme. Taken together, our results support the idea of an important role for c-di-AMP in B. subtilis and suggest that the levels of the nucleotide have to be tightly controlled. PMID:23192352

  2. DBcAMP stimulates vesicle transport and HRP excretion in isolated perfused rat liver.

    PubMed

    Hayakawa, T; Bruck, R; Ng, O C; Boyer, J L

    1990-11-01

    To clarify the effect of adenosine 3',5'-cyclic monophosphate (cAMP) on the transcytotic vesicle pathway, we measured the biliary excretion of bile acid, phospholipid, and horseradish peroxidase (HRP) in the isolated perfused rat liver (IPRL) with or without infusion of N6,2'-O-dibutyryl-cAMP (DBcAMP). A linear relationship between bile flow and bile acid excretion was observed in both control and DBcAMP-infused livers. DBcAMP increased the y-axis intercept from 1.10 +/- 0.16 to 1.48 +/- 0.19 microliters.min-1.g liver-1 (P less than 0.01) and the slope from 6.5 +/- 1.99 to 10.77 +/- 1.71 microliters/mumol bile acid (P less than 0.01). DBcAMP also increased the biliary excretion of bile acid and phospholipid during a 1.0 mumol/min infusion of taurocholate. When HRP was pulse loaded for 1 min, HRP appeared in bile in early (4-6 min) and late (20-25 min) peaks. DBcAMP markedly increased the late peak of HRP from 0.33 +/- 0.08 to 1.15 +/- 0.32 ng.min-1.g liver-1 (P less than 0.01), a phenomenon blocked by colchicine. An electron-microscopic morphometric analysis indicated that DBcAMP increased both the density and %area of HRP-containing vesicles in the pericanalicular area, compared with controls, 18 min after a 1-min pulse of HRP. DBcAMP had no effect on the uptake rate of HRP in 4-h primary hepatocyte cultures but stimulated biliary excretion of HRP when preloaded in the IPRL. These findings indicate that cAMP regulates excretory function in part by stimulating the microtubule-dependent transcytotic vesicle transport system.

  3. Increase in Endogenous and Exogenous Cyclic AMP Levels Inhibits Sclerotial Development in Sclerotinia sclerotiorum

    PubMed Central

    Rollins, Jeffrey A.; Dickman, Martin B.

    1998-01-01

    Growth and development of a wild-type Sclerotinia sclerotiorum isolate were examined in the presence of various pharmacological compounds to investigate signal transduction pathways that influence the development of sclerotia. Compounds known to increase endogenous cyclic AMP (cAMP) levels in other organisms by inhibiting phosphodiesterase activity (caffeine and 3-isobutyl-1-methyl xanthine) or by activating adenylate cyclase (NaF) reduced or eliminated sclerotial development in S. sclerotiorum. Growth in the presence of 5 mM caffeine correlated with increased levels of endogenous cAMP in mycelia. In addition, incorporation of cAMP into the growth medium decreased or eliminated the production of sclerotia in a concentration-dependent manner and increased the accumulation of oxalic acid. Inhibition of sclerotial development was cAMP specific, as exogenous cyclic GMP, AMP, and ATP did not influence sclerotial development. Transfer of developing cultures to cAMP-containing medium at successive time points demonstrated that cAMP inhibits development prior to or during sclerotial initiation. Together, these results indicate that cAMP plays a role in the early transition between mycelial growth and sclerotial development. PMID:9647827

  4. cAMP Signaling Prevents Podocyte Apoptosis via Activation of Protein Kinase A and Mitochondrial Fusion

    PubMed Central

    Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y.; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  5. Crystal structure of the AmpR effector binding domain provides insight into the molecular regulation of inducible ampc beta-lactamase.

    PubMed

    Balcewich, Misty D; Reeve, Thomas M; Orlikow, Evan A; Donald, Lynda J; Vocadlo, David J; Mark, Brian L

    2010-07-30

    Hyperproduction of AmpC beta-lactamase (AmpC) is a formidable mechanism of resistance to penicillins and cephalosporins in Gram-negative bacteria such as Pseudomonas aeruginosa and Enterobacteriaceae. AmpC expression is regulated by the LysR-type transcriptional regulator AmpR. ampR and ampC genes form a divergent operon with overlapping promoters to which AmpR binds and regulates the transcription of both genes. AmpR induces ampC by binding to one member of the family of 1,6-anhydro-N-acetylmuramyl peptides, which are cytosolic catabolites of peptidoglycan that accumulate during beta-lactam challenge. To gain structural insights into AmpR regulation, we determined the crystal structure of the effector binding domain (EBD) of AmpR from Citrobacter freundii up to 1.83 A resolution. The AmpR EBD is dimeric and each monomer comprises two subdomains that adopt alpha/beta Rossmann-like folds. Located between the monomer subdomains is a pocket that was found to bind the crystallization buffer molecule 2-(N-morpholino)ethanesulfonic acid. The pocket, together with a groove along the surface of subdomain I, forms a putative effector binding site into which a molecule of 1,6-anhydro-N-acetylmuramyl pentapeptide could be modeled. Amino acid substitutions at the base of the interdomain pocket either were found to render AmpR incapable of inducing ampC (Thr103Val, Ser221Ala and Tyr264Phe) or resulted in constitutive ampC expression (Gly102Glu). While the substitutions that prevented ampC induction did not alter the overall AmpR EBD structure, circular dichroism spectroscopy revealed that the nonconservative Gly102Glu mutation affected EBD secondary structure, confirming previous work suggesting that Gly102Glu induces a conformational change to result in constitutive AmpC production. PMID:20594961

  6. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  7. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  8. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  9. Autocrine activation of neuronal NMDA receptors by aspartate mediates dopamine- and cAMP-induced CREB-dependent gene transcription.

    PubMed

    Almeida, Luis E F; Murray, Peter D; Zielke, H Ronald; Roby, Clinton D; Kingsbury, Tami J; Krueger, Bruce K

    2009-10-01

    cAMP can stimulate the transcription of many activity-dependent genes via activation of the transcription factor, cAMP response element-binding protein (CREB). However, in mouse cortical neuron cultures, prior to synaptogenesis, neither cAMP nor dopamine, which acts via cAMP, stimulated CREB-dependent gene transcription when NR2B-containing NMDA receptors (NMDARs) were blocked. Stimulation of transcription by cAMP was potentiated by inhibitors of excitatory amino acid uptake, suggesting a role for extracellular glutamate or aspartate in cAMP-induced transcription. Aspartate was identified as the extracellular messenger: enzymatic scavenging of l-aspartate, but not glutamate, blocked stimulation of CREB-dependent gene transcription by cAMP; moreover, cAMP induced aspartate but not glutamate release. Together, these results suggest that cAMP acts via an autocrine or paracrine pathway to release aspartate, which activates NR2B-containing NMDARs, leading to Ca(2+) entry and activation of transcription. This cAMP/aspartate/NMDAR signaling pathway may mediate the effects of transmitters such as dopamine on axon growth and synaptogenesis in developing neurons or on synaptic plasticity in mature neural networks.

  10. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  11. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel.

  12. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex.

    PubMed

    Guérin, François; Isnard, Christophe; Cattoir, Vincent; Giard, Jean Christophe

    2015-12-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-D-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  13. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  14. AMP-18 protects barrier function of colonic epithelial cells: role of tight junction proteins

    PubMed Central

    Walsh-Reitz, Margaret M.; Huang, Erick F.; Musch, Mark W.; Chang, Eugene B.; Martin, Terence E.; Kartha, Sreedharan; Toback, F. Gary

    2005-01-01

    AMP-18, a novel gastric antrum mucosal protein, and a synthetic peptide of amino acids 77-97, have mitogenic and motogenic properties for epithelial cells. The possibility that AMP-18 is also protective was evaluated in the colonic mucosa of mice and monolayer cultures of human colonic epithelial Caco2/bbe (C2) cells. Administration of AMP peptide to mice with dextran sulfate sodium (DSS)-induced colonic injury delayed the onset of bloody diarrhea, and reduced weight loss. Treatment of C2 cells with AMP peptide protected monolayers against decreases in transepithelial electrical resistance (TER) induced by the oxidant monochloramine, indomethacin, or DSS. A molecular mechanism for these barrier-protective effects was sought by asking if AMP peptide acted on specific tight junction (TJ) proteins. Immunoblots of detergent-insoluble fractions of C2 cells treated with AMP peptide exhibited increased accumulation of specific TJ proteins. Occludin immunoreactivity was also increased in detergent-insoluble fractions obtained from colonic mucosal cells of mice injected with AMP peptide. Laser scanning confocal microscopy (CF) supported the capacity of AMP peptide to enhance accumulation of occludin and ZO-1 in TJ domains of C2 cell monolayers, and together with immunoblot analysis showed that the peptide protected against loss of these TJ proteins following oxidant injury. AMP peptide also protected against a fall in TER during disruption of actin filaments by cytochalasin D, and stabilized perijunctional actin during oxidant injury when assessed by CF. These findings suggest that AMP-18 could protect the intestinal mucosal barrier by acting on specific TJ proteins and stabilizing perijunctional actin. PMID:15961882

  15. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  16. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  17. Biochemical and Molecular Characterization of Three New Variants of AmpC β-Lactamases from Morganella morganii

    PubMed Central

    Power, Pablo; Galleni, Moreno; Ayala, Juan A.; Gutkind, Gabriel

    2006-01-01

    Morganella morganii produces an inducible, chromosomally encoded AmpC β-lactamase. We describe in this study three new variants of AmpC within this species with apparent pIs of 6.6 (M19 from M. morganii strain PP19), 7.4 (M29 from M. morganii strain PP29), and 7.8 (M37 from M. morganii strain PP37). After gene sequencing, deduced amino acid sequences displayed one to six substitutions when compared to the available Morganella AmpC sequences. An AmpR-encoding gene was also found upstream of ampC, including the LysR regulators' helix-turn-helix DNA-binding domain and the putative T-N11-A-protected region in the ampR-ampC intercistronic sequence. All three AmpC variants were purified from in vitro-generated derepressed mutants and showed overall similar kinetic parameters. None of the observed amino acid changes, occurring at the surface of the protein, appear to have a major influence in their catalytic properties. Morganella AmpCs exhibit the highest catalytic efficiencies (kcat/Km) on classical penicillins, cefoxitin, narrow-spectrum cephalosporins, and cefotaxime. Cefotaxime was more effectively hydrolyzed than other oxyimino-cephalosporins, whereas cefepime was 3 log-fold less efficiently hydrolyzed than other cephalosporins such as cephalothin. Several differences with other AmpC β-lactamases were found. Ampicillin was more efficiently hydrolyzed than benzylpenicillin. High kcat/Km values were observed for oxacillin and piperacillin, which are usually poor substrates for AmpC. A fairly efficient hydrolysis of imipenem was detected as well. Aztreonam, carbenicillin, and tazobactam were effective transient inactivators of these variants. PMID:16495258

  18. Biochemical and molecular characterization of three new variants of AmpC beta-lactamases from Morganella morganii.

    PubMed

    Power, Pablo; Galleni, Moreno; Ayala, Juan A; Gutkind, Gabriel

    2006-03-01

    Morganella morganii produces an inducible, chromosomally encoded AmpC beta-lactamase. We describe in this study three new variants of AmpC within this species with apparent pIs of 6.6 (M19 from M. morganii strain PP19), 7.4 (M29 from M. morganii strain PP29), and 7.8 (M37 from M. morganii strain PP37). After gene sequencing, deduced amino acid sequences displayed one to six substitutions when compared to the available Morganella AmpC sequences. An AmpR-encoding gene was also found upstream of ampC, including the LysR regulators' helix-turn-helix DNA-binding domain and the putative T-N11-A-protected region in the ampR-ampC intercistronic sequence. All three AmpC variants were purified from in vitro-generated derepressed mutants and showed overall similar kinetic parameters. None of the observed amino acid changes, occurring at the surface of the protein, appear to have a major influence in their catalytic properties. Morganella AmpCs exhibit the highest catalytic efficiencies (k(cat)/K(m)) on classical penicillins, cefoxitin, narrow-spectrum cephalosporins, and cefotaxime. Cefotaxime was more effectively hydrolyzed than other oxyimino-cephalosporins, whereas cefepime was 3 log-fold less efficiently hydrolyzed than other cephalosporins such as cephalothin. Several differences with other AmpC beta-lactamases were found. Ampicillin was more efficiently hydrolyzed than benzylpenicillin. High k(cat)/K(m) values were observed for oxacillin and piperacillin, which are usually poor substrates for AmpC. A fairly efficient hydrolysis of imipenem was detected as well. Aztreonam, carbenicillin, and tazobactam were effective transient inactivators of these variants.

  19. Role of cyclic AMP in pulmonary xenobiotic metabolism with special emphasis on benzo(a)pyrene

    SciTech Connect

    Schaeffer, V.H.

    1986-01-01

    This thesis was intended to investigate the role of the intracellular regulator, cAMP, on pulmonary xenobiotic metabolism using the well-studied carcinogen, benzo(a)pyrene (BP) as a representative xenobiotic. Lung slices from rats administered N/sup 6/, O/sup 2/', dibutyryl cAMP (DcAMP), theophylline or forskolin, all of which elevated biologically reactive cAMP levels in the lung, showed an increased ability to metabolize (/sup 3/H)-BP. This effect occurred beyond 6 hr following treatment and reached a maximum at 12 hr, at a time when cAMP content had already peaked and returned to basal levels. The perfusion of BP through the isolated lungs of animals administered DcAMP in vivo indicated that the BP metabolites primarily responsible for the cyclic nucleotide-induced increase in metabolism were the 3-hydroxy BP, 9-hydroxy BP, BP 9, 10 diol, BP-glucuronides and BP-glutathione conjugates. Kinetic analysis indicated that the Km component of these reactions was altered without a corresponding change in Vmax, suggesting that elevated pulmonary cAMP content may be affecting the detoxication enzymes, UDP-glucuronyltransferase and sulfotransferase. Studies with pulmonary microsomes from DcAMP-treated animals indicated that the cyclic nucleotide not only enhanced the hydroxylation of BP but also the cytochrome P450-dependent hydroxylation of coumarin. This is supported by the fact that DcAMP administration in vivo also enhanced phosphorylation of two classes of nuclear proteins, histones and nuclear acidic proteins, believed to play a role in the transcription of RNA and DNA.

  20. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  1. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  2. Nucleoprotein structure influences the response of the mouse mammary tumor virus promoter to activation of the cyclic AMP signalling pathway.

    PubMed Central

    Pennie, W D; Hager, G L; Smith, C L

    1995-01-01

    Recent studies have provided evidence of crosstalk between steroid receptors and cyclic AMP (cAMP) signalling pathways in the regulation of gene expression. A synergism between intracellular phosphorylation inducers and either glucocorticoids or progestins has been shown to occur during activation of the mouse mammary tumor virus (MMTV) promoter. We have investigated the effect of 8-Br-cAMP and okadaic acid, modulators of cellular kinases and phosphatases, on the hormone-induced activation of the MMTV promoter in two forms: a transiently transfected template with a disorganized, accessible nucleoprotein structure and a stably replicating template with an ordered, inaccessible nucleoprotein structure. Both okadaic acid and 8-Br-cAMP synergize significantly with either glucocorticoids or progestins in activating the transiently transfected MMTV template. In contrast, 8-Br-cAMP, but not okadaic acid, is antagonistic to hormone-induced activation of the stably replicating MMTV template. Nuclear run-on experiments demonstrate that this inhibition is a transcriptional effect on both hormone-induced transcription and basal transcription. Surprisingly, 8-Br-cAMP does not inhibit glucocorticoid-induced changes in restriction enzyme access and nuclear factor 1 binding. However, association of a complex with the TATA box region is inhibited in the presence of 8-Br-cAMP. Thus, cAMP treatment interferes with the initiation process but does not inhibit interaction of the receptor with the template. Since the replicated, ordered MMTV templates and the transfected, disorganized templates show opposite responses to 8-Br-cAMP treatment, we conclude that chromatin structure can influence the response of a promoter to activation of the cAMP signalling pathway. PMID:7891707

  3. Amp-hour counting charge control for photovoltaic hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-10-01

    An amp-hour counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based photovoltaic hybrid charge controller. This work included extensive laboratory and field testing of the charge algorithm on vented lead-antimony and valve regulated lead-acid batteries. The test results have shown that with proper setup amp-hour counting charge control is more effective than conventional voltage regulated sub-array shedding in returning the lead-acid battery to a high state of charge.

  4. Amp-hour counting control for PV hybrid power systems

    SciTech Connect

    Hund, T.D.; Thompson, B.

    1997-06-01

    The performance of an amp-hour (Ah) counting battery charge control algorithm has been defined and tested using the Digital Solar Technologies MPR-9400 microprocessor based PV hybrid charge controller. This work included extensive field testing of the charge algorithm on flooded lead-antimony and valve regulated lead-acid (VRLA) batteries. The test results after one-year have demonstrated that PV charge utilization, battery charge control, and battery state of charge (SOC) has been significantly improved by providing maximum charge to the batteries while limiting battery overcharge to manufacturers specifications during variable solar resource and load periods.

  5. Mutagenesis of the cyclic AMP receptor protein of Escherichia coli: targeting positions 83, 127 and 128 of the cyclic nucleotide binding pocket.

    PubMed Central

    Lee, E J; Glasgow, J; Leu, S F; Belduz, A O; Harman, J G

    1994-01-01

    The cyclic 3', 5' adenosine monophosphate (cAMP) binding pocket of the cAMP receptor protein (CRP) of Escherichia coli was mutagenized to substitute cysteine or glycine for serine 83; cysteine, glycine, isoleucine, or serine for threonine 127; and threonine or alanine for serine 128. Cells that expressed the binding pocket residue-substituted forms of CRP were characterized by measurements of beta-galactosidase activity. Purified wild-type and mutant CRP preparations were characterized by measurement of cAMP binding activity and by their capacity to support lacP activation in vitro. CRP structure was assessed by measurement of sensitivity to protease and DTNB-mediated subunit crosslinking. The results of this study show that cAMP interactions with serine 83, threonine 127 and serine 128 contribute to CRP activation and have little effect on cAMP binding. Amino acid substitutions that introduce hydrophobic amino acid side chain constituents at either position 127 or 128 decrease CRP discrimination of cAMP and cGMP. Finally, cAMP-induced CRP structural change(s) that occur in or near the CRP hinge region result from cAMP interaction with threonine 127; substitution of threonine 127 by cysteine, glycine, isoleucine, or serine produced forms of CRP that contained, independently of cAMP binding, structural changes similar to those of the wild-type CRP:cAMP complex. Images PMID:8065899

  6. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  7. Isolation and Some Properties of the Antimicrobial Peptide (Pa-AMP) from the Seeds of Pokeweed (Phytolacca americana).

    PubMed

    Minami, Y; Higuchi, S; Yagi, F; Tadera, K

    1998-01-01

    An antimicrobial peptide, designated Pa-AMP, was purified by gel filtration on Sephadex G-75 followed by S-Sepharose, Cosmosil-SP, and reverse-phase HPLC from the seeds of pokeweed (Phytolacca americana). Pa-AMP is a basic peptide having an isoelectric point of over 10 and its extinction coefficient at 280 nm of 1% aqueous solution was 7.7. Pa-AMP has a molecular mass of 4 kDa and 3.4 kDa on tricine SDS-PAGE under nonreducing and reducing conditions, respectively. The N-terminal amino acid of Pa-AMP was blocked. The concentrations of peptide required for 50% inhibition (IC50) of the growth of plant pathogenic fungi, Gram-positive, and Gram-negative bacteria were 3 to 41 μg/ml. Differing from other peptides, Pa-AMP inhibited the growth of some Gram-negative bacteria.

  8. Cyclic nucleotides of cone-dominant retinas. Reduction of cyclic AMP levels by light and by cone degeneration.

    PubMed

    Farber, D B; Souza, D W; Chase, D G; Lolley, R N

    1981-01-01

    Dark-adapted retinas or whole eyes of 13-line ground squirrels (Citellus tridecemlineatus) and western fence lizards (Sceloporus occidentalis) contain higher levels of cyclic AMP than of cyclic GMP. In these cone-dominant retinas, light reduces cyclic AMP content selectively. Freezing of dark- or light-adapted retinas or eyes also reduces cyclic AMP content, with only minimal changes in cyclic GMP levels. In addition, exposure of frozen retinas of dark-adapted ground squirrel to light results in a significant decrease in cyclic AMP content. The destruction of cone visual cells of ground squirrel retina by iodoacetic acid injection decreases the cyclic nucleotide content of the dark-adapted retina. Considering the relative loss of cyclic nucleotides from cone degeneration, we estimate that the content of cyclic AMP in visual cells of ground squirrel retina is about four times greater than that of cyclic GMP. PMID:6256308

  9. Changes in nephrogenous cyclic AMP excretion and plasma cyclic AMP following treatment of hyperthyroidism.

    PubMed

    Naafs, M A; van der Velden, P C; Fischer, H R; Koorevaar, G; van Duin, S; Hackeng, W H; Schopman, W; Silberbusch, J

    1984-08-01

    Plasma cyclic AMP (PcAMP) concentration and the excretion of cyclic AMP/dl GF were estimated in 11 thyrotoxic patients before and after medical treatment. PcAMP concentrations were significantly higher during hyperthyroidism (2.30 +/- 0.69 vs 1.88 +/- 0.71 nmol/dl; P less than 0.05), and total urinary cyclic AMP (TcAMP) excretion showed no significant changes (3.24 +/- 0.64 vs 3.44 +/- 1.77 nmol/dl GF). Nephrogenous (NcAMP) excretion rose significantly (1.00 +/- 0.82 vs 1.68 +/- 1.31 mmol/dl GF; P less than 0.025). The increase in NcAMP excretion correlated significantly with the decrease in serum T3 levels (r = -0.46; P less than 0.05). Serum iPTH levels showed no significant change. Both the serum Ca, corrected for serum total protein and TmPO4/GFR declined after treatment (respectively 2.44 +/- 0.13 vs 2.33 +/- 0.08 mmol/l; P less than 0.05 and 1.18 +/- 0.29 vs 1.05 +/- 0.22 mmol/l; P less than 0.05). It is concluded that the rise in NcAMP excretion corroborates the concept of increasing parathyroid activity following the treatment of hyperthyroidism. PMID:6206676

  10. Effects of cyclic AMP on growth and differentiation of rat retinoblastoma-like tumor cells in vitro.

    PubMed

    Nishida, T; Mukai, N; Solish, S P; Pomeroy, M

    1982-02-01

    We examined the effects of cyclic AMP (cAMP) on the growth and differentiation of RAO 188 cells, a cultured cell line derived from a retinoblastoma-like tumor induced in an inbred rat by intravitreous inoculation with human adenovirus serotype 12. After adding cAMP analogs (dibutyryl cAMP and 8-bromo cAMP) and phosphodiesterase inhibitors (theophylline, amino-phylline, and 1-methyl-3-isobutyl xanthine) to the RAO 188 cell culture medium, we measured changes in cell incorporation of the DNA and RNA precursors 14C-thymidine and 3H-uridine, and we observed the morphologic alterations of RAO 188 by phase-contrast and transmission and scanning electron microscopy. Incorporation of the labeled precursors decreased with increased concentrations of cAMP analogs and phosphodiesterase inhibitors. Incorporation of the labeled precursors was inhibited shortly after the addition of dibutyryl cAMP to the culture medium. The effect was maximal at 8 hr and was sustained for up to 48 hr. Reversibility of cAMP effects on incorporation gradually decreased for 10 days; at 10 days these effects were essentially irreversible. Neuritelike processes developed shortly after cAMP analog treatment and formed a network after 24 hr. Transmission electron microscopy disclosed changes in the cell membrane and cytoplasm of cells treated with 8-bromo cAMP and theophylline: perturbation of the cell membrane and the appearance of intercellular junctional devices and microfilaments. The activity of glutamate decarboxylase, which is involved in the biosynthesis of gamma-aminobutyric acid, was increased in treated cells. These results show that cAMP decreases DNA and RNA synthesis and cell proliferation and facilitates morphologic and biochemical differentiation of RAO 188 cells.

  11. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  12. Strain-dependent occurrence of functional GTP:AMP phosphotransferase (AK3) in Saccharomyces cerevisiae.

    PubMed

    Schricker, R; Magdolen, V; Strobel, G; Bogengruber, E; Breitenbach, M; Bandlow, W

    1995-12-29

    The gene for yeast GTP:AMP phosphotransferase (PAK3) was found to encode a nonfunctional protein in 10 laboratory strains and one brewers' strain. The protein product showed high similarity to vertebrate AK3 and was located exclusively in the mitochondrial matrix. The deduced amino acid sequence revealed a protein that was shorter at the carboxyl terminus than all other known adenylate kinases. Introduction of a +1 frameshift into the 3'-terminal region of the gene extended homology of the deduced amino acid sequence to other members of the adenylate kinase family including vertebrate AK3. Frameshift mutations obtained after in vitro and in vivo mutagenesis were capable of complementing the adk1 temperature-conditional deficiency in Escherichia coli, indicating that the frameshift led to the expression of a protein that could phosphorylate AMP. Some yeasts, however, including strain D273-10B, two wine yeasts, and two more distantly related yeast genera, harbored an active allele, named AKY3, which contained a +1 frameshift close to the carboxyl terminus as compared with the laboratory strains. The encoded protein exhibited GTP:AMP and ITP:AMP phosphotransferase activities but did not accept ATP as phosphate donor. Although single copy in the haploid genome, disruption of the AKY3 allele displayed no phenotype, excluding the possibility that laboratory and brewers' strains had collected second site suppressors. It must be concluded that yeast mitochondria can completely dispense with GTP:AMP phosphotransferase activity.

  13. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  14. NMR studies of the AMP-binding site and mechanism of adenylate kinase.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1987-03-24

    NMR has previously been used to determine the conformation of enzyme-bound MgATP and to locate the MgATP-binding site on adenylate kinase [Fry, D. C., Kuby, S. A., & Mildvan, A. S. (1985) Biochemistry 24, 4680-4694]. To determine the conformation and location of the other substrate, AMP, distances have been measured from Cr3+AMPPCP, a linear competitive inhibitor with respect to MgATP, to six protons and to the phosphorus atom of AMP on adenylate kinase, with the paramagnetic probe-T1 method. Time-dependent nuclear Overhauser effects (NOEs) have been used to measure five interproton distances on enzyme-bound AMP. These distances were used to determine the conformation of bound AMP in addition to its position with respect to metal-ATP. Enzyme-bound AMP exhibits a high anti-glycosyl torsional angle (chi = 110 +/- 10 degrees), a 3'-endo,2'-exo ribose pucker (delta = 105 +/- 10 degrees), and gauche-trans orientations about the C4'-C5' bond (gamma = 180 +/- 10 degrees) and the C5'-O5' bond (beta = 170 +/- 20 degrees). The distance from Cr3+ to the phosphorus of AMP is 5.9 +/- 0.3 A, indicating a reaction coordinate distance of approximately 3 A, which is consistent with an associative SN2 mechanism for the phosphoryl transfer. Ten intermolecular NOEs, from protons of the enzyme to those of AMP, were detected, indicating the proximity of at least three hydrophobic amino acids to bound AMP. These constraints, together with the conformation of AMP and the intersubstrate distances, were used to position AMP into the X-ray structure of adenylate kinase. The AMP binding site is found to be near (less than or equal to 4 A from) Leu-116, Arg-171, Val-173, Val-182, and Leu-190; all of these residues have been found to be invariant in muscle-type rabbit, calf, human, porcine [Kuby, S. A., Palmieri, R. H., Frischat, A., Fischer, A. H., Wu, L. H., Maland, L., & Manship, M. (1984) Biochemistry 23, 2393-2399], and chicken adenylate kinase [Kishi, F., Maruyama, M., Tanizawa, Y

  15. Vv-AMP1, a ripening induced peptide from Vitis vinifera shows strong antifungal activity

    PubMed Central

    de Beer, Abré; Vivier, Melané A

    2008-01-01

    Background Latest research shows that small antimicrobial peptides play a role in the innate defense system of plants. These peptides typically contribute to preformed defense by developing protective barriers around germinating seeds or between different tissue layers within plant organs. The encoding genes could also be upregulated by abiotic and biotic stimuli during active defense processes. The peptides display a broad spectrum of antimicrobial activities. Their potent anti-pathogenic characteristics have ensured that they are promising targets in the medical and agricultural biotechnology sectors. Results A berry specific cDNA sequence designated Vv-AMP1, Vitis vinifera antimicrobial peptide 1, was isolated from Vitis vinifera. Vv-AMP1 encodes for a 77 amino acid peptide that shows sequence homology to the family of plant defensins. Vv-AMP1 is expressed in a tissue specific, developmentally regulated manner, being only expressed in berry tissue at the onset of berry ripening and onwards. Treatment of leaf and berry tissue with biotic or abiotic factors did not lead to increased expression of Vv-AMP1 under the conditions tested. The predicted signal peptide of Vv-AMP1, fused to the green fluorescent protein (GFP), showed that the signal peptide allowed accumulation of its product in the apoplast. Vv-AMP1 peptide, produced in Escherichia coli, had a molecular mass of 5.495 kDa as determined by mass spectrometry. Recombinant Vv-AMP1 was extremely heat-stable and showed strong antifungal activity against a broad spectrum of plant pathogenic fungi, with very high levels of activity against the wilting disease causing pathogens Fusarium oxysporum and Verticillium dahliae. The Vv-AMP1 peptide did not induce morphological changes on the treated fungal hyphae, but instead strongly inhibited hyphal elongation. A propidium iodide uptake assay suggested that the inhibitory activity of Vv-AMP1 might be associated with altering the membrane permeability of the fungal

  16. Proteomic and Metabolic Analyses of S49 Lymphoma Cells Reveal Novel Regulation of Mitochondria by cAMP and Protein Kinase A.

    PubMed

    Wilderman, Andrea; Guo, Yurong; Divakaruni, Ajit S; Perkins, Guy; Zhang, Lingzhi; Murphy, Anne N; Taylor, Susan S; Insel, Paul A

    2015-09-01

    Cyclic AMP (cAMP), acting via protein kinase A (PKA), regulates many cellular responses, but the role of mitochondria in such responses is poorly understood. To define such roles, we used quantitative proteomic analysis of mitochondria-enriched fractions and performed functional and morphologic studies of wild-type (WT) and kin(-) (PKA-null) murine S49 lymphoma cells. Basally, 75 proteins significantly differed in abundance between WT and kin(-) S49 cells. WT, but not kin(-), S49 cells incubated with the cAMP analog 8-(4-chlorophenylthio)adenosine cAMP (CPT-cAMP) for 16 h have (a) increased expression of mitochondria-related genes and proteins, including ones in pathways of branched-chain amino acid and fatty acid metabolism and (b) increased maximal capacity of respiration on branched-chain keto acids and fatty acids. CPT-cAMP also regulates the cellular rate of ATP-utilization, as the rates of both ATP-linked respiration and proton efflux are decreased in WT but not kin(-) cells. CPT-cAMP protected WT S49 cells from glucose or glutamine deprivation, In contrast, CPT-cAMP did not protect kin(-) cells or WT cells treated with the PKA inhibitor H89 from glutamine deprivation. Under basal conditions, the mitochondrial structure of WT and kin(-) S49 cells is similar. Treatment with CPT-cAMP produced apoptotic changes (i.e. decreased mitochondrial density and size and loss of cristae) in WT, but not kin(-) cells. Together, these findings show that cAMP acts via PKA to regulate multiple aspects of mitochondrial function and structure. Mitochondrial perturbation thus likely contributes to cAMP/PKA-mediated cellular responses. PMID:26203188

  17. Proteomic and Metabolic Analyses of S49 Lymphoma Cells Reveal Novel Regulation of Mitochondria by cAMP and Protein Kinase A.

    PubMed

    Wilderman, Andrea; Guo, Yurong; Divakaruni, Ajit S; Perkins, Guy; Zhang, Lingzhi; Murphy, Anne N; Taylor, Susan S; Insel, Paul A

    2015-09-01

    Cyclic AMP (cAMP), acting via protein kinase A (PKA), regulates many cellular responses, but the role of mitochondria in such responses is poorly understood. To define such roles, we used quantitative proteomic analysis of mitochondria-enriched fractions and performed functional and morphologic studies of wild-type (WT) and kin(-) (PKA-null) murine S49 lymphoma cells. Basally, 75 proteins significantly differed in abundance between WT and kin(-) S49 cells. WT, but not kin(-), S49 cells incubated with the cAMP analog 8-(4-chlorophenylthio)adenosine cAMP (CPT-cAMP) for 16 h have (a) increased expression of mitochondria-related genes and proteins, including ones in pathways of branched-chain amino acid and fatty acid metabolism and (b) increased maximal capacity of respiration on branched-chain keto acids and fatty acids. CPT-cAMP also regulates the cellular rate of ATP-utilization, as the rates of both ATP-linked respiration and proton efflux are decreased in WT but not kin(-) cells. CPT-cAMP protected WT S49 cells from glucose or glutamine deprivation, In contrast, CPT-cAMP did not protect kin(-) cells or WT cells treated with the PKA inhibitor H89 from glutamine deprivation. Under basal conditions, the mitochondrial structure of WT and kin(-) S49 cells is similar. Treatment with CPT-cAMP produced apoptotic changes (i.e. decreased mitochondrial density and size and loss of cristae) in WT, but not kin(-) cells. Together, these findings show that cAMP acts via PKA to regulate multiple aspects of mitochondrial function and structure. Mitochondrial perturbation thus likely contributes to cAMP/PKA-mediated cellular responses.

  18. Proteomic and Metabolic Analyses of S49 Lymphoma Cells Reveal Novel Regulation of Mitochondria by cAMP and Protein Kinase A*

    PubMed Central

    Wilderman, Andrea; Guo, Yurong; Divakaruni, Ajit S.; Perkins, Guy; Zhang, Lingzhi; Murphy, Anne N.; Taylor, Susan S.; Insel, Paul A.

    2015-01-01

    Cyclic AMP (cAMP), acting via protein kinase A (PKA), regulates many cellular responses, but the role of mitochondria in such responses is poorly understood. To define such roles, we used quantitative proteomic analysis of mitochondria-enriched fractions and performed functional and morphologic studies of wild-type (WT) and kin− (PKA-null) murine S49 lymphoma cells. Basally, 75 proteins significantly differed in abundance between WT and kin− S49 cells. WT, but not kin−, S49 cells incubated with the cAMP analog 8-(4-chlorophenylthio)adenosine cAMP (CPT-cAMP) for 16 h have (a) increased expression of mitochondria-related genes and proteins, including ones in pathways of branched-chain amino acid and fatty acid metabolism and (b) increased maximal capacity of respiration on branched-chain keto acids and fatty acids. CPT-cAMP also regulates the cellular rate of ATP-utilization, as the rates of both ATP-linked respiration and proton efflux are decreased in WT but not kin− cells. CPT-cAMP protected WT S49 cells from glucose or glutamine deprivation, In contrast, CPT-cAMP did not protect kin− cells or WT cells treated with the PKA inhibitor H89 from glutamine deprivation. Under basal conditions, the mitochondrial structure of WT and kin− S49 cells is similar. Treatment with CPT-cAMP produced apoptotic changes (i.e. decreased mitochondrial density and size and loss of cristae) in WT, but not kin− cells. Together, these findings show that cAMP acts via PKA to regulate multiple aspects of mitochondrial function and structure. Mitochondrial perturbation thus likely contributes to cAMP/PKA-mediated cellular responses. PMID:26203188

  19. Trans-Cinnamic Acid Increases Adiponectin and the Phosphorylation of AMP-Activated Protein Kinase through G-Protein-Coupled Receptor Signaling in 3T3-L1 Adipocytes

    PubMed Central

    Kopp, Christina; Singh, Shiva P.; Regenhard, Petra; Müller, Ute; Sauerwein, Helga; Mielenz, Manfred

    2014-01-01

    Adiponectin and intracellular 5′adenosine monophosphate-activated protein kinase (AMPK) are important modulators of glucose and fat metabolism. Cinnamon exerts beneficial effects by improving insulin sensitivity and blood lipids, e.g., through increasing adiponectin concentrations and AMPK activation. The underlying mechanism is unknown. The Gi/Go-protein-coupled receptor (GPR) 109A stimulates adiponectin secretion after binding its ligand niacin. Trans-cinnamic acid (tCA), a compound of cinnamon is another ligand. We hypothesize whether AMPK activation and adiponectin secretion by tCA is transmitted by GPR signaling. Differentiated 3T3-L1 cells were incubated with pertussis toxin (PTX), an inhibitor of Gi/Go-protein-coupling, and treated with different tCA concentrations. Treatment with tCA increased adiponectin and the pAMPK/AMPK ratio (p ≤ 0.001). PTX incubation abolished the increased pAMPK/AMPK ratio and adiponectin secretion. The latter remained increased compared to controls (p ≤ 0.002). tCA treatment stimulated adiponectin secretion and AMPK activation; the inhibitory effect of PTX suggests GPR is involved in tCA stimulated signaling. PMID:24557583

  20. Strategies to overcome extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases in shigellae.

    PubMed

    Livermore, David M; Mushtaq, Shazad; Nguyen, Tue; Warner, Marina

    2011-05-01

    Oral cephalosporins and mecillinam are used to treat Shigella infections, but are compromised by extended-spectrum β-lactamases (ESBLs) and plasmid AmpC β-lactamases. Potential solutions include combining an oral or intravenous cephalosporin with a β-lactamase inhibitor (BLI) or using an oral penem. These strategies were examined using Escherichia coli transconjugants and clinical isolates with ESBLs or AmpC, as a proxy for shigellae. The Clinical and Laboratory Standards Institute agar dilution method was used with inocula of 10(4) and 10(6) colony-forming units/spot. ESBLs conferred resistance to the cephalosporins and mecillinam, at least at high inoculum, although: (i) ceftibuten was significantly compromised only by SHV and CTX-M-15 ESBLs, but not by TEM or CTX-M-9 and -14; (ii) cefdinir was little affected by TEM-type ESBLs, and mecillinam was little affected by CTX-M-9 group enzymes. The BLI clavulanic acid reduced the minimum inhibitory concentrations (MICs) of cephalosporins and mecillinam to ≤2 mg/L for ESBL-producers, even at high inocula; sulbactam in particular and tazobactam were less effective, especially against SHV types. Strains with AmpC were resistant to all cephalosporins±inhibitors, but mecillinam remained active (MIC=1 mg/L) against a strain with AmpC alone, whereas strains with TEM-1+AmpC were susceptible to mecillinam+clavulanic acid at ≤2 mg/L. Faropenem was active against all ESBL- and AmpC-producers at 4 mg/L, with little inoculum effect or inhibitor potentiation. In conclusion, cephalosporin+clavulanic acid combinations overcame ESBLs, with ceftibuten+clavulanic acid being particularly promising. Mecillinam+clavulanic acid and faropenem overcame both ESBLs and AmpC enzymes. Clinical utility will depend also on a drug's ability to reach intracellular shigellae in the intestinal epithelium and this deserves exploration for clavulanic acid and faropenem. PMID:21276715

  1. cAMP signalling meets mitochondrial compartments.

    PubMed

    Lefkimmiatis, Konstantinos

    2014-04-01

    Mitochondria are highly dynamic organelles comprising at least three distinct areas, the OMM (outer mitochondrial membrane), the IMS (intermembrane space) and the mitochondrial matrix. Physical compartmentalization allows these organelles to host different functional domains and therefore participate in a variety of important cellular actions such as ATP synthesis and programmed cell death. In a surprising homology, it is now widely accepted that the ubiquitous second messenger cAMP uses the same stratagem, compartmentalization, in order to achieve the characteristic functional pleiotropy of its pathway. Accumulating evidence suggests that all the main mitochondrial compartments contain segregated cAMP cascades; however, the regulatory properties and functional significance of such domains are not fully understood and often remain controversial issues. The present mini-review discusses our current knowledge of how the marriage between mitochondrial and cAMP compartmentalization is achieved and its effects on the biology of the cell. PMID:24646228

  2. Intracellular cyclic AMP not calcium, determines the direction of vesicle movement in melanophores: direct measurement by fluorescence ratio imaging

    PubMed Central

    1992-01-01

    Intracellular movement of vesiculated pigment granules in angelfish melanophores is regulated by a signalling pathway that triggers kinesin and dyneinlike microtubule motor proteins. We have tested the relative importance of intracellular Ca2+ ([Ca2+]i) vs cAMP ([cAMP]i) in the control of such motility by adrenergic agonists, using fluorescence ratio imaging and many ways to artificially stimulate or suppress signals in these pathways. Fura-2 imaging reported a [Ca2+]i elevation accompanying pigment aggregation, but this increase was not essential since movement was not induced with the calcium ionophore, ionomycin, nor was movement blocked when the increases were suppressed by withdrawal of extracellular Ca2+ or loading of intracellular BAPTA. The phosphatase inhibitor, okadaic acid, blocked aggregation and induced dispersion at concentrations that suggested that the protein phosphatase PP-1 or PP-2A was continuously turning phosphate over during intracellular motility. cAMP was monitored dynamically in single living cells by microinjecting cAMP-dependent kinase in which the catalytic and regulatory subunits were labeled with fluorescein and rhodamine respectively (Adams et al., 1991. Nature (Lond.). 349:694- 697). Ratio imaging of F1CRhR showed that the alpha 2-adrenergic receptor-mediated aggregation was accompanied by a dose-dependent decrease in [cAMP]i. The decrease in [cAMP]i was both necessary and sufficient for aggregation, since cAMP analogs or microinjected free catalytic subunit of A kinase-blocked aggregation or caused dispersal, whereas the cAMP antagonist RpcAMPs or the microinjection of the specific kinase inhibitor PKI5-24 amide induced aggregation. Our conclusion that cAMP, not calcium, controls bidirectional microtubule dependent motility in melanophores might be relevant to other instances of non-muscle cell motility. PMID:1348251

  3. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-10-15

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate.

  4. AMP decreases the efficiency of skeletal-muscle mitochondria.

    PubMed Central

    Cadenas, S; Buckingham, J A; St-Pierre, J; Dickinson, K; Jones, R B; Brand, M D

    2000-01-01

    Mitochondrial proton leak in rat muscle is responsible for approx. 15% of the standard metabolic rate, so its modulation could be important in regulating metabolic efficiency. We report in the present paper that physiological concentrations of AMP (K(0.5)=80 microM) increase the resting respiration rate and double the proton conductance of rat skeletal-muscle mitochondria. This effect is specific for AMP. AMP also doubles proton conductance in skeletal-muscle mitochondria from an ectotherm (the frog Rana temporaria), suggesting that AMP activation is not primarily for thermogenesis. AMP activation in rat muscle mitochondria is unchanged when uncoupling protein-3 is doubled by starvation, indicating that this protein is not involved in the AMP effect. AMP activation is, however, abolished by inhibitors and substrates of the adenine nucleotide translocase (ANT), suggesting that this carrier (possibly the ANT1 isoform) mediates AMP activation. AMP activation of ANT could be important for physiological regulation of metabolic rate. PMID:11023814

  5. Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

    PubMed

    Weng, Shu-Fen; Chao, Yuh-Fen; Lin, Juey-Wen

    2004-02-13

    Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response. PMID:14741712

  6. Adenylate cyclase and the cyclic AMP receptor protein modulate stress resistance and virulence capacity of uropathogenic Escherichia coli.

    PubMed

    Donovan, Grant T; Norton, J Paul; Bower, Jean M; Mulvey, Matthew A

    2013-01-01

    In many bacteria, the second messenger cyclic AMP (cAMP) interacts with the transcription factor cAMP receptor protein (CRP), forming active cAMP-CRP complexes that can control a multitude of cellular activities, including expanded carbon source utilization, stress response pathways, and virulence. Here, we assessed the role of cAMP-CRP as a regulator of stress resistance and virulence in uropathogenic Escherichia coli (UPEC), the principal cause of urinary tract infections worldwide. Deletion of genes encoding either CRP or CyaA, the enzyme responsible for cAMP synthesis, attenuates the ability of UPEC to colonize the bladder in a mouse infection model, dependent on intact innate host defenses. UPEC mutants lacking cAMP-CRP grow normally in the presence of glucose but are unable to utilize alternate carbon sources like amino acids, the primary nutrients available to UPEC within the urinary tract. Relative to the wild-type UPEC isolate, the cyaA and crp deletion mutants are sensitive to nitrosative stress and the superoxide generator methyl viologen but remarkably resistant to hydrogen peroxide (H(2)O(2)) and acid stress. In the mutant strains, H(2)O(2) resistance correlates with elevated catalase activity attributable in part to enhanced translation of the alternate sigma factor RpoS. Acid resistance was promoted by both RpoS-independent and RpoS-dependent mechanisms, including expression of the RpoS-regulated DNA-binding ferritin-like protein Dps. We conclude that balanced input from many cAMP-CRP-responsive elements, including RpoS, is critical to the ability of UPEC to handle the nutrient limitations and severe environmental stresses present within the mammalian urinary tract.

  7. Astrocyte arachidonate and palmitate uptake and metabolism is differentially modulated by dibutyryl-cAMP treatment.

    PubMed

    Seeger, D R; Murphy, C C; Murphy, E J

    2016-07-01

    Astrocytes play a vital role in brain lipid metabolism; however the impact of the phenotypic shift in astrocytes to a reactive state on arachidonic acid metabolism is unknown. Therefore, we determined the impact of dibutyryl-cAMP (dBcAMP) treatment on radiolabeled arachidonic acid ([1-(14)C]20:4n-6) and palmitic acid ([1-(14)C]16:0) uptake and metabolism in primary cultured murine cortical astrocytes. In dBcAMP treated astrocytes, total [1-(14)C]20:4n-6 uptake was increased 1.9-fold compared to control, while total [1-(14)C]16:0 uptake was unaffected. Gene expression of long-chain acyl-CoA synthetases (Acsl), acyl-CoA hydrolase (Acot7), fatty acid binding protein(s) (Fabp) and alpha-synuclein (Snca) were determined using qRT-PCR. dBcAMP treatment increased expression of Acsl3 (4.8-fold) and Acsl4 (1.3-fold), which preferentially use [1-(14)C]20:4n-6 and are highly expressed in astrocytes, consistent with the increase in [1-(14)C]20:4n-6 uptake. However, expression of Fabp5 and Fabp7 were significantly reduced by 25% and 45%, respectively. Acot7 (20%) was also reduced, suggesting dBcAMP treatment favors acyl-CoA formation. dBcAMP treatment enhanced [1-(14)C]20:4n-6 (2.2-fold) and [1-(14)C]16:0 (1.6-fold) esterification into total phospholipids, but the greater esterification of [1-(14)C]20:4n-6 is consistent with the observed uptake through increased Acsl, but not Fabp expression. Although total [1-(14)C]16:0 uptake was not affected, there was a dramatic decrease in [1-(14)C]16:0 in the free fatty acid pool as esterification into the phospholipid pool was increased, which is consistent with the increase in Acsl3 and Acsl4 expression. In summary, our data demonstrates that dBcAMP treatment increases [1-(14)C]20:4n-6 uptake in astrocytes and this increase appears to be due to increased expression of Acsl3 and Acsl4 coupled with a reduction in Acot7 expression. PMID:27255639

  8. Preparation and in vitro/in vivo characterization of tranilast-AMP clay complex for improving drug dissolution and bioavailability.

    PubMed

    Yang, Liang; Shao, Yating; Han, Hyo-Kyung

    2014-12-01

    The present study aimed to develop an effective oral formulation of tranilast (TL), a poorly soluble anti-inflammatory drug, via the formation of drug complex with 3-aminopropyl functionalized magnesium phyllosilicate (AMP clay) and improve the pH-dependent drug dissolution and bioavailability of TL. The drug-clay complex (TL-AMP complex) was prepared by co-precipitation method and its structural properties were characterized by X-ray powder diffraction, Fourier transform infrared spectroscopy and transmission electron microscopy. The dissolution profiles of TL-AMP complex were evaluated at different pHs. The formation of TL-AMP complex significantly improved the dissolution rate as well as the extent of drug release at acidic pHs, while the dissolution of untreated TL was negligible at pH 1.2 and 4.0. TL-AMP complex also achieved faster drug release than untreated drug (about 90 vs 30 % within 30 min) at pH 6.8. After oral administration to rats, TL-AMP complex enhanced significantly (p < 0.05) oral drug exposure and increased Cmax and AUC by six- and threefolds, respectively, compared to untreated TL. In conclusion, TL-AMP complex may be promising to improve the pH-dependent dissolution as well as bioavailability of TL.

  9. Isolation of novel ribozymes that ligate AMP-activated RNA substrates

    NASA Technical Reports Server (NTRS)

    Hager, A. J.; Szostak, J. W.

    1997-01-01

    BACKGROUND: The protein enzymes RNA ligase and DNA ligase catalyze the ligation of nucleic acids via an adenosine-5'-5'-pyrophosphate 'capped' RNA or DNA intermediate. The activation of nucleic acid substrates by adenosine 5'-monophosphate (AMP) may be a vestige of 'RNA world' catalysis. AMP-activated ligation seems ideally suited for catalysis by ribozymes (RNA enzymes), because an RNA motif capable of tightly and specifically binding AMP has previously been isolated. RESULTS: We used in vitro selection and directed evolution to explore the ability of ribozymes to catalyze the template-directed ligation of AMP-activated RNAs. We subjected a pool of 10(15) RNA molecules, each consisting of long random sequences flanking a mutagenized adenosine triphosphate (ATP) aptamer, to ten rounds of in vitro selection, including three rounds involving mutagenic polymerase chain reaction. Selection was for the ligation of an oligonucleotide to the 5'-capped active pool RNA species. Many different ligase ribozymes were isolated; these ribozymes had rates of reaction up to 0.4 ligations per hour, corresponding to rate accelerations of approximately 5 x10(5) over the templated, but otherwise uncatalyzed, background reaction rate. Three characterized ribozymes catalyzed the formation of 3'-5'-phosphodiester bonds and were highly specific for activation by AMP at the ligation site. CONCLUSIONS: The existence of a new class of ligase ribozymes is consistent with the hypothesis that the unusual mechanism of the biological ligases resulted from a conservation of mechanism during an evolutionary replacement of a primordial ribozyme ligase by a more modern protein enzyme. The newly isolated ligase ribozymes may also provide a starting point for the isolation of ribozymes that catalyze the polymerization of AMP-activated oligonucleotides or mononucleotides, which might have been the prebiotic analogs of nucleoside triphosphates.

  10. Chromosomally Encoded AmpC-Type β-Lactamase in a Clinical Isolate of Proteus mirabilis

    PubMed Central

    Bret, L.; Chanal-Claris, C.; Sirot, D.; Chaibi, E. B.; Labia, R.; Sirot, J.

    1998-01-01

    A clinical strain of Proteus mirabilis (CF09) isolated from urine specimens of a patient displayed resistance to amoxicillin (MIC >4,096 μg/ml), ticarcillin (4,096 μg/ml), cefoxitin (64 μg/ml), cefotaxime (256 μg/ml), and ceftazidime (128 μg/ml) and required an elevated MIC of aztreonam (4 μg/ml). Clavulanic acid did not act synergistically with cephalosporins. Two β-lactamases with apparent pIs of 5.6 and 9.0 were identified by isoelectric focusing on a gel. Substrate and inhibition profiles were characteristic of an AmpC-type β-lactamase with a pI of 9.0. Amplification by PCR with primers for ampC genes (Escherichia coli, Enterobacter cloacae, and Citrobacter freundii) of a 756-bp DNA fragment from strain CF09 was obtained only with C. freundii-specific primers. Hybridization results showed that the ampC gene is only chromosomally located while the TEM gene is plasmid located. After cloning of the gene, analysis of the complete nucleotide sequence (1,146 bp) showed that this ampC gene is close to blaCMY-2, from which it differs by three point mutations leading to amino acid substitutions Glu → Gly at position 22, Trp → Arg at position 201, and Ser → Asn at position 343. AmpC β-lactamases derived from that of C. freundii (LAT-1, LAT-2, BIL-1, and CMY-2) have been found in Klebsiella pneumoniae, E. coli, and Enterobacter aerogenes and have been reported to be plasmid borne. This is the first example of a chromosomally encoded AmpC-type β-lactamase observed in P. mirabilis. We suggest that it be designated CMY-3. PMID:9593136

  11. High adenylyl cyclase activity and in vivo cAMP fluctuations in corals suggest central physiological role

    PubMed Central

    Barott, K. L.; Helman, Y.; Haramaty, L.; Barron, M. E.; Hess, K. C.; Buck, J.; Levin, L. R.; Tresguerres, M.

    2013-01-01

    Corals are an ecologically and evolutionarily significant group, providing the framework for coral reef biodiversity while representing one of the most basal of metazoan phyla. However, little is known about fundamental signaling pathways in corals. Here we investigate the dynamics of cAMP, a conserved signaling molecule that can regulate virtually every physiological process. Bioinformatics revealed corals have both transmembrane and soluble adenylyl cyclases (AC). Endogenous cAMP levels in live corals followed a potential diel cycle, as they were higher during the day compared to the middle of the night. Coral homogenates exhibited some of the highest cAMP production rates ever to be recorded in any organism; this activity was inhibited by calcium ions and stimulated by bicarbonate. In contrast, zooxanthellae or mucus had >1000-fold lower AC activity. These results suggest that cAMP is an important regulator of coral physiology, especially in response to light, acid/base disturbances and inorganic carbon levels. PMID:23459251

  12. Mutagenesis of the cyclic AMP receptor protein of Escherichia coli: targeting positions 72 and 82 of the cyclic nucleotide binding pocket.

    PubMed Central

    Belduz, A O; Lee, E J; Harman, J G

    1993-01-01

    The 3', 5' cyclic adenosine monophosphate (cAMP) binding pocket of the cAMP receptor protein (CRP) of Escherichia coli was mutagenized to substitute leucine, glutamine, or aspartate for glutamate 72; and lysine, histidine, leucine, isoleucine, or glutamine for arginine 82. Substitutions were made in wild-type CRP and in a CRP*, or cAMP-independent, form of the protein to assess the effects of the amino acid substitutions on CRP structure. Cells containing the binding pocket residue-substituted forms of CRP were characterized through beta-galactosidase activity and by measurement of cAMP binding activity. This study confirms a role for both glutamate 72 and arginine 82 in cAMP binding and activation of CRP. Glutamine or leucine substitution of glutamate 72 produced forms of CRP having low affinity for the cAMP and unresponsive to the nucleotide. Aspartate substituted for glutamate 72 produced a low affinity cAMP-responsive form of CRP. CRP has a stringent requirement for the positioning of the position 72 glutamate carboxyl group within the cyclic nucleotide binding pocket. Results of this study also indicate that there are differences in the binding requirements of cAMP and cGMP, a competitive inhibitor of cAMP binding to CRP. PMID:8388097

  13. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  14. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  15. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended...

  16. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  17. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  18. Effect of ovine luteinizing hormone (oLH) charge isoforms on VEGF and cAMP production.

    PubMed

    Montero-Pardo, Arnulfo; Diaz, Daniel; Olivares, Aleida; González-Padilla, Everardo; Murcia, Clara; Gómez-Chavarín, Margarita; Gutiérrez-Ospina, Gabriel; Perera-Marín, Gerardo

    2015-12-01

    Although an increase in VEGF expression and synthesis in association with LH has been established; it is unknown if all LH isoforms act similarly. This study evaluated the production of cAMP and VEGF among LH isoforms in two in vitro bioassays. The LH was obtained from hypophyses and the group of isoforms was isolated by chromatofocusing. cAMP production was assessed using the in vitro bioassay of HEK-293 cells and VEGF production was evaluated in granulosa cells. Immunological activity was measured with a homologous RIA. Immunoactivity and bioactivity for each isoform were compared against a standard, by estimating the IC50 and the EC50. The basic isoforms were more immunoactive than the standard. The neutral and the moderately acidic had an immunological activity similar to the standard. The acidic isoform was the least immunoreactive. cAMP production at the EC50 dose was similar among the basic isoforms, the moderately acidic and the standard; for the neutral and the acidic, the EC50 dose was higher. It was observed that compared with the control, VEGF production at the lowest LH dose was no different in the standard and each isoform. In the intermediate dose, a positive response was caused in the standard and the neutral and basic isoforms. Although the acidic isoform showed a dose-dependent response, it was not significant relative to the control. In conclusion, the basic isoform generated the greatest cAMP and VEGF production, similar to the reference standard, and the acidic the smallest.

  19. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  20. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  1. Cyclic AMP-dependent protein phosphorylation in isolated neuronal growth cones from developing rat forebrain.

    PubMed

    Lockerbie, R O; Eddé, B; Prochiantz, A

    1989-03-01

    We have shown recently that neuronal growth cones isolated from developing rat forebrain possess an appreciable activity of adenylate cyclase, which produces cyclic AMP and can be stimulated by various neurotransmitter receptor agonists and by forskolin. To investigate cyclic AMP-mediated biochemical mechanisms in isolated growth cones, we have centered the present study on cyclic AMP-dependent protein phosphorylation. One-dimensional gel electrophoretic analysis showed that cyclic AMP analogs increased incorporation of 32P into several phosphoproteins in molecular mass ranges of 50-58 and 76-82 kilodaltons, including those of 82, 76, and 51 kilodaltons. Two-dimensional electrophoresis, using isoelectric focusing in the first dimension, resolved phosphorylated alpha- and beta-tubulin species, actin, a very acidic protein (isoelectric point 4.0) with a molecular mass of 93 kilodaltons, and two proteins (x and x') closely neighboring beta-tubulin. Two other phosphoproteins seen in the gels had molecular masses of 56 and 51 kilodaltons (respective isoelectric points, 4.5 and 4.4) and, along with the 93-kilodalton phosphoprotein, were highly enriched in the isolated growth cones. Only the tubulin and actin species were major proteins in the isolated growth cones. Cyclic AMP analogs enhanced incorporation of 32P into phosphoproteins x and x', and, as assessed by immunoprecipitation, into beta-tubulin. Peptide digest experiments suggested that phosphoproteins x and x' are unrelated to beta-tubulin. Nonequilibrium two-dimensional electrophoresis resolved many phosphoproteins, of which a 79- and 75-kilodalton doublet, a 74-kilodalton species, and a 58-kilodalton doublet showed enhanced incorporation of 32P in the presence of cyclic AMP.

  2. Cyclic AMP efflux inhibitors as potential therapeutic agents for leukemia

    PubMed Central

    Perez, Dominique R.; Smagley, Yelena; Garcia, Matthew; Carter, Mark B.; Evangelisti, Annette; Matlawska-Wasowska, Ksenia; Winter, Stuart S.; Sklar, Larry A.; Chigaev, Alexandre

    2016-01-01

    Apoptotic evasion is a hallmark of cancer. We propose that some cancers may evade cell death by regulating 3′-5′-cyclic adenosine monophosphate (cAMP), which is associated with pro-apoptotic signaling. We hypothesize that leukemic cells possess mechanisms that efflux cAMP from the cytoplasm, thus protecting them from apoptosis. Accordingly, cAMP efflux inhibition should result in: cAMP accumulation, activation of cAMP-dependent downstream signaling, viability loss, and apoptosis. We developed a novel assay to assess cAMP efflux and performed screens to identify inhibitors. In an acute myeloid leukemia (AML) model, several identified compounds reduced cAMP efflux, appropriately modulated pathways that are responsive to cAMP elevation (cAMP-responsive element-binding protein phosphorylation, and deactivation of Very Late Antigen-4 integrin), and induced mitochondrial depolarization and caspase activation. Blocking adenylyl cyclase activity was sufficient to reduce effects of the most potent compounds. These compounds also decreased cAMP efflux and viability of B-lineage acute lymphoblastic leukemia (B-ALL) cell lines and primary patient samples, but not of normal primary peripheral blood mononuclear cells. Our data suggest that cAMP efflux is a functional feature that could be therapeutically targeted in leukemia. Furthermore, because some of the identified drugs are currently used for treating other illnesses, this work creates an opportunity for repurposing. PMID:27129155

  3. Analysis of a novel cyclic Amp inducible prespore gene in Dictyostelium discoideum: evidence for different patterns of cAMP regulation.

    PubMed

    Agarwal, A; Sloger, M S; Oyama, M; Blumberg, D D

    1994-09-01

    The D7 cDNA clone hybridizes to a 2.8 kb mRNA which first appears at the mound stage of development in the cellular slime mold Dictyostelium discoideum. This gene which is cyclic AMP (cAMP) inducible and is expressed specifically in the prespore cells contains an open reading frame interrupted by only one intron. The predicted amino acid sequence indicates a novel prespore protein which differs from all of the previously described prespore proteins in that it contains no internal repeats and does not share any homology with any of the other prespore genes. The amino acid sequence predicts a protein of 850 amino acids with a molecular weight of 95,343 daltons and an isoelectric point of 4.25. The protein is very rich in glutamine (13.8%), asparagine (10.6%) and glutamic acid (10.4%) with one potential glycosylation site and 28 possible sites for phosphorylation. The amino terminus is hydrophobic with characteristics of a signal sequence while the entire carboxyl half of the protein is notable for its hydrophilicity. Comparison of cAMP regulation of the D7 gene with the regulation of two other cAMP regulated prespore genes, the PL3(SP87) gene and the Psa(D19), reveals some striking differences. Disaggregation in the presence of cAMP results in transient degradation of mRNA for all three genes. The transcription rate for the D7 and PsA(D19) genes remains relatively unaffected by disaggregation but there is a rapid although transient decline in the transcription rate of the PL3(SP87) gene. Although the accumulation of all three mRNAs is first detectable at mound stage, transcription of the D7 and PsA(D19) genes is detected earlier in development, at rippling aggregate stage several hours prior to the earliest time when transcription of the PL3(SP87) gene is detected. Analysis of the promoter region of the D7 gene reveals three CA like boxes flanked by direct repeats as well as four G rich regions that may serve as regulatory elements. PMID:7988791

  4. PPARgamma-dependent regulation of adenylate cyclase 6 amplifies the stimulatory effect of cAMP on renin gene expression.

    PubMed

    Desch, Michael; Schubert, Thomas; Schreiber, Andrea; Mayer, Sandra; Friedrich, Björn; Artunc, Ferruh; Todorov, Vladimir T

    2010-11-01

    The second messenger cAMP plays an important role in the regulation of renin gene expression. Nuclear receptor peroxisome proliferator-activated receptor-γ (PPARγ) is known to stimulate renin gene transcription acting through PPARγ-binding sequences in renin promoter. We show now that activation of PPARγ by unsaturated fatty acids or thiazolidinediones drastically augments the cAMP-dependent increase of renin mRNA in the human renin-producing cell line Calu-6. The underlying mechanism involves potentiation of agonist-induced cAMP increase and up-regulation of adenylate cyclase 6 (AC6) gene expression. We identified a palindromic element with a 3-bp spacer (Pal3) in AC6 intron 1 (AC6Pal3). AC6Pal3 bound PPARγ and mediated trans-activation by PPARγ agonist. AC6 knockdown decreased basal renin mRNA level and attenuated the maximal PPARγ-dependent stimulation of the cAMP-induced renin gene expression. AC6Pal3 decoy oligonucleotide abrogated the PPARγ-dependent potentiation of cAMP-induced renin gene expression. Treatment of mice with PPARγ agonist increased AC6 mRNA kidney levels. Our data suggest that in addition to its direct effect on renin gene transcription, PPARγ "sensitizes" renin gene to cAMP via trans-activation of AC6 gene. AC6 has been identified as PPARγ target gene with a functional Pal3 sequence.

  5. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP.

  6. Activation of AMP-activated protein kinase signaling pathway by adiponectin and insulin in mouse adipocytes: requirement of acyl-CoA synthetases FATP1 and Acsl1 and association with an elevation in AMP/ATP ratio.

    PubMed

    Liu, Qingqing; Gauthier, Marie-Soleil; Sun, Lei; Ruderman, Neil; Lodish, Harvey

    2010-11-01

    Adiponectin activates AMP-activated protein kinase (AMPK) in adipocytes, but the underlying mechanism remains unclear. Here we tested the hypothesis that AMP, generated in activating fatty acids to their CoA derivatives, catalyzed by acyl-CoA synthetases, is involved in AMPK activation by adiponectin. Moreover, in adipocytes, insulin affects the subcellular localization of acyl-CoA synthetase FATP1. Thus, we also tested whether insulin activates AMPK in these cells and, if so, whether it activates through a similar mechanism. We examined these hypotheses by measuring the AMP/ATP ratio and AMPK activation on adiponectin and insulin stimulation and after knocking down acyl-CoA synthetases in adipocytes. We show that adiponectin activation of AMPK is accompanied by an ∼2-fold increase in the cellular AMP/ATP ratio. Moreover, FATP1 and Acsl1, the 2 major acyl-CoA synthetase isoforms in adipocytes, are essential for AMPK activation by adiponectin. We also show that after 40 min. insulin activated AMPK in adipocytes, which was coupled with a 5-fold increase in the cellular AMP/ATP ratio. Knockdown studies show that FATP1 and Acsl1 are required for these processes, as well as for stimulation of long-chain fatty acid uptake by adiponection and insulin. These studies demonstrate that a change in cellular energy state is associated with AMPK activation by both adiponectin and insulin, which requires the activity of FATP1 and Acsl1.

  7. The Regulatory Repertoire of Pseudomonas aeruginosa AmpC ß-Lactamase Regulator AmpR Includes Virulence Genes

    PubMed Central

    Balasubramanian, Deepak; Schneper, Lisa; Merighi, Massimo; Smith, Roger; Narasimhan, Giri; Lory, Stephen; Mathee, Kalai

    2012-01-01

    In Enterobacteriaceae, the transcriptional regulator AmpR, a member of the LysR family, regulates the expression of a chromosomal β-lactamase AmpC. The regulatory repertoire of AmpR is broader in Pseudomonas aeruginosa, an opportunistic pathogen responsible for numerous acute and chronic infections including cystic fibrosis. In addition to regulating ampC, P. aeruginosa AmpR regulates the sigma factor AlgT/U and production of some quorum sensing (QS)-regulated virulence factors. In order to better understand the ampR regulon, we compared the transcriptional profile generated using DNA microarrays of the prototypic P. aeruginosa PAO1 strain with its isogenic ampR deletion mutant, PAOΔampR. Transcriptome analysis demonstrates that the AmpR regulon is much more extensive than previously thought, with the deletion of ampR influencing the differential expression of over 500 genes. In addition to regulating resistance to β-lactam antibiotics via AmpC, AmpR also regulates non-β-lactam antibiotic resistance by modulating the MexEF-OprN efflux pump. Other virulence mechanisms including biofilm formation and QS-regulated acute virulence factors are AmpR-regulated. Real-time PCR and phenotypic assays confirmed the microarray data. Further, using a Caenorhabditis elegans model, we demonstrate that a functional AmpR is required for P. aeruginosa pathogenicity. AmpR, a member of the core genome, also regulates genes in the regions of genome plasticity that are acquired by horizontal gene transfer. Further, we show differential regulation of other transcriptional regulators and sigma factors by AmpR, accounting for the extensive AmpR regulon. The data demonstrates that AmpR functions as a global regulator in P. aeruginosa and is a positive regulator of acute virulence while negatively regulating biofilm formation, a chronic infection phenotype. Unraveling this complex regulatory circuit will provide a better understanding of the bacterial response to antibiotics and how the

  8. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response.

  9. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  10. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  11. Inhibition of hormone-sensitive lipase gene expression by cAMP and phorbol esters in 3T3-F442A and BFC-1 adipocytes.

    PubMed

    Plée-Gautier, E; Grober, J; Duplus, E; Langin, D; Forest, C

    1996-09-15

    Hormone-sensitive lipase (HSL) catalyses the rate-limiting step in adipocyte lipolysis. Short-term hormonal regulation of HSL activity is well characterized, whereas little is known about the control of HSL gene expression. We have measured HSL mRNA content of 3T3-F442A and BFC-1 adipocytes in response to the cAMP analogue 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP) and to the phorbol ester phorbol 12-myristate 13-acetate (PMA) by Northern blot, using a specific mouse cDNA fragment. Treatment of the cells for 12 or 6 h with, respectively, 0.5 mM 8-CPT-cAMP or 1 microM PMA produced a maximal decrease of about 60% in HSL mRNA. These effects were unaffected by the protein-synthesis inhibitor anisomycin, suggesting that cAMP and PMA actions were direct. The reduction in HSL mRNA was accompanied by a reduction in HSL total activity. The intracellular routes that cAMP and PMA follow for inducing such an effect seemed clearly independent. (i) After desensitization of the protein kinase C regulation pathway by a 24 h treatment of the cells with 1 microM PMA, PMA action was abolished whereas cAMP was still fully active. (ii) Treatment with saturating concentrations of both agents produced an additive effect. (iii) The synthetic glucocorticoid dexamethasone had no proper effect on HSL gene expression but potentiated cAMP action without affecting PMA action. cAMP inhibitory action on HSL is unexpected. Indeed, the second messenger of catecholamines is the main activator of HSL by phosphorylation. We envision that a long-term cAMP treatment of adipocytes induces a counter-regulatory process that reduces HSL content and, ultimately, limits fatty acid depletion from stored triacylglycerols.

  12. Regulation of Mct1 by cAMP-dependent internalization in rat brain endothelial cells.

    PubMed

    Smith, Jeffrey P; Uhernik, Amy L; Li, Lun; Liu, Zejian; Drewes, Lester R

    2012-10-22

    In the cerebrovascular endothelium, monocarboxylic acid transporter 1 (Mct1) controls blood-brain transport of short chain monocarboxylic and keto acids, including pyruvate and lactate, to support brain energy metabolism. Mct1 function is acutely decreased in rat brain cerebrovascular endothelial cells by β-adrenergic signaling through cyclic adenosine monophosphate (cAMP); however, the mechanism for this acute reduction in transport capacity is unknown. In this report, we demonstrate that cAMP induces the dephosphorylation and internalization of Mct1 from the plasma membrane into caveolae and early endosomes in the RBE4 rat brain cerebrovascular endothelial cell line. Additionally, we provide evidence that Mct1 constitutively cycles through clathrin vesicles and recycling endosomes in a pathway that is not dependent upon cAMP signaling in these cells. Our results are important because they show for the first time the regulated and unregulated vesicular trafficking of Mct1 in cerebrovascular endothelial cells; processes which have significance for better understanding normal brain energy metabolism, and the etiology and potential therapeutic approaches to treating brain diseases, such as stroke, in which lactic acidosis is a key component.

  13. Revisiting cAMP signaling in the carotid body

    PubMed Central

    Nunes, Ana R.; Holmes, Andrew P.; Conde, Sílvia V.; Gauda, Estelle B.; Monteiro, Emília C.

    2014-01-01

    Chronic carotid body (CB) activation is now recognized as being essential in the development of hypertension and promoting insulin resistance; thus, it is imperative to characterize the chemotransduction mechanisms of this organ in order to modulate its activity and improve patient outcomes. For several years, and although controversial, cyclic adenosine monophosphate (cAMP) was considered an important player in initiating the activation of the CB. However, its relevance was partially displaced in the 90s by the emerging role of the mitochondria and molecules such as AMP-activated protein kinase and O2-sensitive K+ channels. Neurotransmitters/neuromodulators binding to metabotropic receptors are essential to chemotransmission in the CB, and cAMP is central to this process. cAMP also contributes to raise intracellular Ca2+ levels, and is intimately related to the cellular energetic status (AMP/ATP ratio). Furthermore, cAMP signaling is a target of multiple current pharmacological agents used in clinical practice. This review (1) provides an outline on the classical view of the cAMP-signaling pathway in the CB that originally supported its role in the O2/CO2 sensing mechanism, (2) presents recent evidence on CB cAMP neuromodulation and (3) discusses how CB activity is affected by current clinical therapies that modify cAMP-signaling, namely dopaminergic drugs, caffeine (modulation of A2A/A2B receptors) and roflumilast (PDE4 inhibitors). cAMP is key to any process that involves metabotropic receptors and the intracellular pathways involved in CB disease states are likely to involve this classical second messenger. Research examining the potential modification of cAMP levels and/or interactions with molecules associated with CB hyperactivity is currently in its beginning and this review will open doors for future explorations. PMID:25389406

  14. Pre-Amp Box Platform Analysis

    SciTech Connect

    Kirby, K.; Kurita, C.; /Fermilab

    1989-01-17

    A platform to be used for the installation and repair of the high voltage pre-amp boxes on the CC cryostat has been designed to support a uniform load of 30 Ibs./sq. ft. However, according to the standards set by both the American National Standard and the Uniform Building Code, the minimum uniformly distributed design load for a structure used as an 'elevated platform or walkway' is 60 lbs./sq. ft. The existing platform was tested with a uniform load of 40 lbs./sq. ft. with no major problems occurring during the testing. Considering a 40 lbs./sq. ft. load to be the minimum acceptable value for 'residential' use, and the platform in hand to be better categorized as an 'elevated platform or walkway', the platform is carefully re-analyzed for a 60 lbs./sq. ft. uniformly distributed load.

  15. An investigation of fluidized bed electrowinning of cobalt using 50 and 1000 Amp cells

    NASA Astrophysics Data System (ADS)

    Dubrovsky, M.; Evans, J. W.

    1982-09-01

    50 Amp and 1000 Amp cells equipped with fluidized bed cathodes were used to investigate the electrowinning of cobalt from sulfate solutions. The catholytes employed ranged in cobalt concentration from 100 to 4.8 grams per liter of cobalt and from acid (pH ≃1) to near neutral (pH ≃6). Superficial current densities up to 1.09 A cm-2 were used. The cells were equipped with a nearly impermeable diaphragm, permitting the use of an anolyte of composition different from that of the catholyte. The current efficiency for cobalt deposition (as conveniently determined by measuring the rate of hydrogen evolution), electrical energy consumption, and appearance of the deposit were studied as a function of catholyte composition. Reasonable current efficiencies were observed. The electrical energy consumptions were much higher than that of conventional electrowinning, but this was shown to be due to the anode chamber and diaphragm resistance losses rather than the fluidized cathode.

  16. An investigation of fluidized bed electrowinning of cobalt using 50 and 1000 Amp cells

    NASA Astrophysics Data System (ADS)

    Dubrovsky, M.; Evans, J. W.

    1991-12-01

    50 Amp and 1000 Amp cells equipped with fluidized bed cathodes were used to investigate the electrowinning of cobalt from sulfate solutions. The catholytes employed ranged in cobalt concentration from 100 to 4.8 grams per liter of cobalt and from acid (pH ≏1) to near neutral (pH-6). Superficial current densities up to 1.09 A cm-2 were used. The cells were equipped with a nearly impermeable diaphragm, permitting the use of an anolyte of composition different from that of the catholyte. The current efficiency for cobalt deposition (as conveniently determined by measuring the rate of hydrogen evolution), electrical energy consumption, and appearance of the deposit were studied as a function of catholyte composition. Reasonable current efficiencies were observed. The electrical energy consumptions were much higher than that of conventional electrowinning, but this was shown to be due to the anode chamber and diaphragm resistance losses rather than the fluidized cathode.

  17. Export of cyclic AMP by avian red cells and inhibition by prostaglandin A/sub 1/

    SciTech Connect

    Heasley, L.E.

    1985-01-01

    The mechanism by which PGA/sub 1/ inhibits cAMP export by avian red cells was studied, to provide details on the molecular mechanism of a prostaglandin action and on the process of cAMP export itself. The interaction of PGA/sub 1/ with pigeon red cells is a multi-step process of uptake, metabolism and secretion. (/sup 3/H)PGA rapidly enters red cells and is promptly metabolized (V/sub max/ greater than or equal to 1 nmol/min/10/sup 7/ cells) to a compound (5) that remains in the aqueous layer after ethyl acetate extraction. Chromatographic analyses, amino acid content and fast atom bombardment mass spectrometry reveal that the polar metabolite is conjugated with glutathione (PGA/sub 1/-GSH) at C-11 via a thioether bond and is largely (80%) reduced to the C-9 hydroxyl derivative.

  18. PDE4 cAMP phosphodiesterases: modular enzymes that orchestrate signalling cross-talk, desensitization and compartmentalization.

    PubMed Central

    Houslay, Miles D; Adams, David R

    2003-01-01

    cAMP is a second messenger that controls many key cellular functions. The only way to inactivate cAMP is to degrade it through the action of cAMP phosphodiesterases (PDEs). PDEs are thus poised to play a key regulatory role. PDE4 cAMP-specific phosphodiesterases appear to have specific functions with selective inhibitors serving as potent anti-inflammatory agents. The recent elucidation of the structure of the PDE4 catalytic unit allows for molecular insight into the mode of catalysis as well as substrate and inhibitor selectivity. The four PDE4 genes encode over 16 isoforms, each of which is characterized by a unique N-terminal region. PDE4 isoforms play a pivotal role in controlling functionally and spatially distinct pools of cAMP by virtue of their unique intracellular targeting. Targeting occurs by association with proteins, such as arrestins, SRC family tyrosyl kinases, A-kinase anchoring proteins ('AKAPs') and receptor for activated C kinase 1 ('RACK1'), and, in the case of isoform PDE4A1, by a specific interaction (TAPAS-1) with phosphatidic acid. PDE4 isoforms are 'designed' to be regulated by extracellular-signal-related protein kinase (ERK), which binds to anchor sites on the PDE4 catalytic domain that it phosphorylates. The upstream conserved region 1 (UCR1) and 2 (UCR2) modules that abut the PDE4 catalytic unit confer regulatory functions by orchestrating the functional outcome of phosphorylation by cAMP-dependent protein kinase ('PKA') and ERK. PDE4 enzymes stand at a crossroads that allows them to integrate various signalling pathways with that of cAMP in spatially distinct compartments. PMID:12444918

  19. Structural basis for the extended substrate spectrum of AmpC BER and structure-guided discovery of the inhibition activity of citrate against the class C β-lactamases AmpC BER and CMY-10.

    PubMed

    Na, Jung Hyun; Cha, Sun Shin

    2016-08-01

    AmpC BER is an extended substrate spectrum class C β-lactamase with a two-amino-acid insertion in the R2 loop compared with AmpC EC2. The crystal structures of AmpC BER (S64A mutant) and AmpC EC2 were determined. Structural comparison of the two proteins revealed that the insertion increases the conformational flexibility of the R2 loop. Two citrate molecules originating from the crystallization solution were observed in the active site of the S64A mutant. One citrate molecule makes extensive interactions with active-site residues that are highly conserved among class C β-lactamases, whereas the other one is weakly bound. Based on this structural observation, it is demonstrated that citrate, a primary metabolite that is widely used as a food additive, is a competitive inhibitor of two class C β-lactamases (AmpC BER and CMY-10). Consequently, the data indicate enhancement of the flexibility of the R2 loop as an operative strategy for molecular evolution of extended-spectrum class C β-lactamases, and also suggest that the citrate scaffold is recognized by the active sites of class C β-lactamases. PMID:27487828

  20. Antimicrobial peptide (Cn-AMP2) from liquid endosperm of Cocos nucifera forms amyloid-like fibrillar structure.

    PubMed

    Gour, Shalini; Kaushik, Vibha; Kumar, Vijay; Bhat, Priyanka; Yadav, Subhash C; Yadav, Jay K

    2016-04-01

    Cn-AMP2 is an antimicrobial peptide derived from liquid endosperm of coconut (Cocos nucifera). It consists of 11 amino acid residues and predicted to have high propensity for β-sheet formation that disposes this peptide to be amyloidogenic. In the present study, we have examined the amyloidogenic propensities of Cn-AMP2 in silico and then tested the predictions under in vitro conditions. The in silico study revealed that the peptide possesses high amyloidogenic propensity comparable with Aβ. Upon solubilisation and agitation in aqueous buffer, Cn-AMP2 forms visible aggregates that display bathochromic shift in the Congo red absorbance spectra, strong increase in thioflavin T fluorescence and fibrillar morphology under transmission electron microscopy. All these properties are typical of an amyloid fibril derived from various proteins/peptides including Aβ. PMID:27028204

  1. Expression of the lipid transfer protein Ace-AMP1 in transgenic wheat enhances antifungal activity and defense responses.

    PubMed

    Roy-Barman, Subhankar; Sautter, Christof; Chattoo, Bharat B

    2006-08-01

    To enhance fungal disease resistance, wheat plants (cv. Bobwhite) were engineered to constitutively express the potent antimicrobial protein Ace-AMP1 from Allium cepa, driven by a maize ubiquitin promoter along with its first intron. The bar gene was used for selection of putative transformants on medium containing phosphinothricin (PPT). Transgene inheritance, integration and stability of expression were confirmed over two generations by PCR, Southern, northern and western blot analyses, respectively. The levels of Ace-AMP1 in different transgenic lines correlated with the transcript levels of the transgene. Up to 50% increase in resistance to Blumeria graminis f. sp. tritici was detected in detached leaf assays. In ears of transgenic wheat inoculated with Neovossia indica, Ace-AMP1 intensified expression of defense-related genes. Elevated levels of salicylic acid and of transcripts of phenylalanine ammonia lyase (PAL), glucanase (PR2) and chitinase (PR3) in the transgenic plants indicated manifestation of systemic acquired resistance (SAR). PMID:16906444

  2. Mutants of PC12 cells with altered cyclic AMP responses

    SciTech Connect

    Block, T.; Kon, C.; Breckenridge, B.M.

    1984-10-01

    PCl2 cells, derived from a rat pheochromocytoma, were mutagenized and selected in media containing agents known to elevate intracellular concentrations of cyclic AMP (cAMP). More than 40 clones were isolated by selection with cholera toxin or 2-chloroadenosine or both. The variants that were deficient in accumulating cAMP were obtained by using a protocol in which 1 ..mu..m 8-bromo-cAMP was included in addition to the agonist. Certain of these variants were partially characterized with respect to the site of altered cAMP metabolism. The profiles of adenylate cyclase activity responsiveness of certain variants to guanosine-5'-(BETA,..gamma..-imido) triphosphate and to forskolin resembled those of UNC and cyc phenotypes of S49 lymphoma cells, which are functionally deficient in the GTP-sensitive coupling protein, N/sub s/. Other variants were characterized by increased cyclic nucleotide phosphodiesterase activity at low substrate concentration. Diverse morphological traits were observed among the variants, but it was not possible to assign them to a particular cAMP phenotype. Two revertants of a PCl2 mutant were isolated and observed to have regained a cellular cAMP response to 2-chloroadenosine and to forskolin. It is hoped that these PCl2 mutants will have utility for defining cAMP-mediated functions, including any links to the action of nerve growth factor, in cells derived from the neural crest.

  3. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion

    PubMed Central

    Schwede, Frank; Chepurny, Oleg G.; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A.; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E.; MacDonald, Patrick E.; Genieser, Hans-G.; Herberg, Friedrich W.

    2015-01-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  4. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  5. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  6. Enzymatic characterization of AMP phosphorylase and ribose-1,5-bisphosphate isomerase functioning in an archaeal AMP metabolic pathway.

    PubMed

    Aono, Riku; Sato, Takaaki; Yano, Ayumu; Yoshida, Shosuke; Nishitani, Yuichi; Miki, Kunio; Imanaka, Tadayuki; Atomi, Haruyuki

    2012-12-01

    AMP phosphorylase (AMPpase), ribose-1,5-bisphosphate (R15P) isomerase, and type III ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) have been proposed to constitute a novel pathway involved in AMP metabolism in the Archaea. Here we performed a biochemical examination of AMPpase and R15P isomerase from Thermococcus kodakarensis. R15P isomerase was specific for the α-anomer of R15P and did not recognize other sugar compounds. We observed that activity was extremely low with the substrate R15P alone but was dramatically activated in the presence of AMP. Using AMP-activated R15P isomerase, we reevaluated the substrate specificity of AMPpase. AMPpase exhibited phosphorylase activity toward CMP and UMP in addition to AMP. The [S]-v plot (plot of velocity versus substrate concentration) of the enzyme toward AMP was sigmoidal, with an increase in activity observed at concentrations higher than approximately 3 mM. The behavior of the two enzymes toward AMP indicates that the pathway is intrinsically designed to prevent excess degradation of intracellular AMP. We further examined the formation of 3-phosphoglycerate from AMP, CMP, and UMP in T. kodakarensis cell extracts. 3-Phosphoglycerate generation was observed from AMP alone, and from CMP or UMP in the presence of dAMP, which also activates R15P isomerase. 3-Phosphoglycerate was not formed when 2-carboxyarabinitol 1,5-bisphosphate, a Rubisco inhibitor, was added. The results strongly suggest that these enzymes are actually involved in the conversion of nucleoside monophosphates to 3-phosphoglycerate in T. kodakarensis.

  7. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5‧ monophosphate (AMP)

    NASA Astrophysics Data System (ADS)

    Hammami, K.; Feki, H. El; Marsan, O.; Drouet, C.

    2015-10-01

    This work investigates the interaction between the nucleotide adenosine 5‧ monophosphate molecule (AMP) and a biomimetic nanocrystalline carbonated apatite as a model for bone mineral. The analogy of the apatite phase used in this work with biological apatite was first pointed out by complementary techniques. AMP adsorption isotherms were then investigated. Obtained data were fitted to a Sips isotherm with an exponent greater than one suggesting positive cooperativity among adsorbed molecules. The data were compared to a previous study relative to the adsorption of another nucleotide, cytidine monophosphate (CMP) onto a similar substrate, evidencing some effect of the chemical nature of the nucleic base. An enhanced adsorption was observed under acidic (pH 6) conditions as opposed to pH 7.4, which parallels the case of DNA adsorption on biomimetic apatite. An estimated standard Gibbs free energy associated to the adsorption process (ΔG°ads ≅ -22 kJ/mol) intermediate between "physisorption" and "chemisorption" was found. The analysis of the solids after adsorption pointed to the preservation of the main characteristics of the apatite substrate but shifts or enhancements of Raman bands attributed to AMP showed the existence of chemical interactions involving both the phosphate and adenine parts of AMP. This contribution adds to the works conducted in view of better understanding the interaction of DNA/RNA and their constitutive nucleotides and the surface of biomimetic apatites. It could prove helpful in disciplines such as bone diagenesis (DNA/apatite interface in aged bones) or nanomedicine (setup of DNA- or RNA-loaded apatite systems). Also, the adsorption of nucleic acids on minerals like apatites could have played a role in the preservation of such biomolecules in the varying conditions known to exist at the origin of life on Earth, underlining the importance of dedicated adsorption studies.

  8. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  9. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  10. 8-Chloro-cAMP-related changes on mice uteri.

    PubMed

    Actis, Andrea; Croci, Máximo; Levin, Emanuel; Bergoc, Rosa

    2002-05-22

    Histopathological effects of cAMP analog (8-Chloro-cAMP), tamoxifen, and medroxyprogesterone, alone or combined, upon BALB/c mice uteri are reported. 8-Chloro-cAMP diminished uterine weight, but did not modify its histopathology or estral cycle significantly. Tamoxifen diminished uterine weight showing cystic hyperplasia and an estral cycle arrested at diestrus. Medroxyprogesterone increased uterine weight, caused a swelling of the endometrium and a pseudopregnancy estrus. When combined with 8-Chloro-cAMP, tamoxifen or medroxyprogesterone always had a predominant effect. We concluded that the effects of 8-Chloro-cAMP on mice uteri did not cause significant changes on its histopathology, but diminished its weight.

  11. Control of bacterial exoelectrogenesis by c-AMP-GMP.

    PubMed

    Nelson, James W; Sudarsan, Narasimhan; Phillips, Grace E; Stav, Shira; Lünse, Christina E; McCown, Phillip J; Breaker, Ronald R

    2015-04-28

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes.

  12. Molecular epidemiology, resistance profiles and clinical features in clinical plasmid-mediated AmpC-producing Enterobacteriaceae.

    PubMed

    Gude, M Jose; Seral, Cristina; Sáenz, Yolanda; Cebollada, Rocío; González-Domínguez, María; Torres, Carmen; Castillo, F Javier

    2013-12-01

    During the 30 months of surveillance period, 85 pAmpC-producing isolates were detected (prevalence 0.56% overall): blaCMY-2 gene in 70 E. coli, 2 K. pneumoniae and 6 P. mirabilis isolates; and the blaDHA-1 gene in 4 E. coli and 3 K. pneumoniae. In 8.23% of them, other β-lactamases (predominantly OXA-1) were identified. All pAmpC-producing isolates were susceptible to carbapenems, whereas high resistance to nalidixic acid, ciprofloxacin and trimethoprim-sulfamethoxazole was observed among pAmpC-producing isolates (80%, 60%, and 44.7%, respectively). In hospital patients, predisposing factors such as prior antibiotic use, previous hospitalization, presence of an indwelling device, invasive urinary tract procedures and mechanical ventilation were observed. In the community setting, urinary tract infection was the most common type of infection related to pAmpC-producing isolates. A wide heterogeneity of clones was found among our E. coli isolates by PFGE, suggesting that this mechanism of resistance is not due to the dissemination of a clonal strain. Surveillance of these resistance mechanisms in the community is thus needed. Awareness of pAmpC dynamic is required to prevent introduction into hospitals and to control the spread of this emerging resistance within the community.

  13. [Expression optimization and characterization of Tenebrio molitor antimicrobiol peptides TmAMP1m in Escherichia coli].

    PubMed

    Alimu, Reyihanguli; Mao, Xinfang; Liu, Zhongyuan

    2013-06-01

    To improve the expression level of tmAMP1m gene from Tenebrio molitor in Escherichia coli, we studied the effects of expression level and activity of the fusion protein HIS-TmAMP1m by conditions, such as culture temperature, inducing time and the final concentration of inductor Isopropyl beta-D-thiogalactopyranoside (IPTG). We analyzed the optimum expression conditions by Tricine-SDS-PAGE electrophoresis, meanwhile, detected its antibacterial activity by using agarose cavity diffusion method. The results suggest that when inducing the recombinant plasmid with a final IPTG concentration of 0.1 mmol/L at 37 degrees C for 4 h, there was the highest expression level of fusion protein HIS-TmAMP1m in Escherichia coli. Under these conditions, the expression of fusion protein accounted for 40% of the total cell lysate with the best antibacterial activity. We purified the fusion protein HIS-TmAMPlm with nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography matrices. Western blotting analysis indicates that the His monoclonal antibody could be specifically bound to fusion protein HIS-TmAMPlm. After expression by inducing, the fusion protein could inhibit the growth of host cell transformed by pET30a-tmAMP1m. The fusion protein HIS-TmAMP1m had better stability and remained higher antibacterial activities when incubated at 100 degrees C for 10 h, repeated freeze thawing at -20 degrees C, dissolved in strong acid and alkali, or treated by organic solvents and protease. Moreover, the minimum inhibitory concentration results demonstrated that the fusion protein HIS-TmAMP1m has a good antibacterial activity against Staphylococcus aureus, Staphylococcus sp., Corynebacterium glutamicum, Bacillus thuringiensis, Corynebacterium sp. This study laid the foundation to promote the application of insect antimicrobial peptides and further research. PMID:24063242

  14. Plasmid-Mediated AmpC: Prevalence in Community-Acquired Isolates in Amsterdam, the Netherlands, and Risk Factors for Carriage

    PubMed Central

    Reuland, E. Ascelijn; Halaby, Teysir; Hays, John P.; de Jongh, Denise M. C.; Snetselaar, Henrieke D. R.; van Keulen, Marte; Elders, Petra J. M.; Savelkoul, Paul H. M.; Vandenbroucke-Grauls, Christina M. J. E.; al Naiemi, Nashwan

    2015-01-01

    Objectives The objective of this study was to determine the prevalence of pAmpC beta-lactamases in community-acquired Gram negative bacteria in the Netherlands, and to identify possible risk factors for carriage of these strains. Methods Fecal samples were obtained from community-dwelling volunteers. Participants also returned a questionnaire for analysis of risk factors. Screening for pAmpC was performed with selective enrichment broth and a selective screening agar. Confirmation of AmpC-production was performed with two double disc combination tests: cefotaxime and ceftazidime with either boronic acid or cloxacillin as inhibitor. Multiplex PCR was used as gold standard for detection of pAmpC. 16S rRNA PCR and AFLP were performed as required, plasmids were identified by PCR-based replicon typing. Questionnaire results were analyzed with SPSS, version 20.0. Results Fecal samples were obtained from 550 volunteers; mean age 51 years (range: 18–91), 61% were females. pAmpC was present in seven E. coli isolates (7/550, 1.3%, 0.6–2.7 95% CI): six CMY-2-like pAmpC and one DHA. ESBL-encoding genes were found in 52/550 (9.5%, 7.3–12.2 95% CI) isolates; these were predominantly blaCTX-M genes. Two isolates had both ESBL and pAmpC. Admission to a hospital in the previous year was the only risk factor we identified. Conclusions Our data indicate that the prevalence of pAmpC in the community seems still low. However, since pAmpC-producing isolates were not identified as ESBL producers by routine algorithms, there is consistent risk that further increase of their prevalence might go undetected. PMID:25587716

  15. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  16. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.

    PubMed

    DiFrancesco, D; Tortora, P

    1991-05-01

    Cyclic AMP acts as a second messenger in the modulation of several ion channels that are typically controlled by a phosphorylation process. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity. These actions are mediated by cAMP and underlie control of spontaneous rate by neurotransmitters. Whether the cAMP modulation of if is mediated by channel phosphorylation is, however, still unknown. Here we investigate the action of cAMP on if in excised patches of cardiac pacemaker cells and find that cAMP activates if by a mechanism independent of phosphorylation, involving a direct interaction with the channels at their cytoplasmic side. Cyclic AMP activates if by shifting its activation curve to more positive voltages, in agreement with whole-cell results. This is the first evidence of an ion channel whose gating is dually regulated by voltage and direct cAMP binding.

  17. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  18. [cAMP as a regulator of the phototransduction cascade].

    PubMed

    Astakhova, L A; Kapitskiĭ, S V; Govardovskiĭ, V I; Firsov, M L

    2012-11-01

    Until recently, it has generally been believed that cyclic AMP plays an important role in supporting circadian cycles in the vertebrate retina, but does not directly control the photoreceptors' phototransduction cascade. However, the cAMP levels in photoreceptors oscillate during the day/night cycle, and the cAMP turnover in photoreceptors may be light-dependent. Thus it is natural to suggest that the cAMP-dependent protein phosphorylation may be a mechanism of tuning phototransduction to lighting conditions. In the present review, we summarize available information on the structure and operation of the retinal pacemaker, role(s) of cAMP in its functioning, and identified intracellular targets that could be controlled by cAMP. We discuss our recent results that show that cAMP changes do regulate the phototransduction cascade. This regulation may substantially extend the range of photoreceptor's adaptation by increasing its sensitivity at night, and reducing the sensitivity in bright light. PMID:23431758

  19. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  20. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens.

    PubMed

    Kalivoda, Eric J; Stella, Nicholas A; Aston, Marissa A; Fender, James E; Thompson, Paul P; Kowalski, Regis P; Shanks, Robert M Q

    2010-03-01

    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli cAMP-phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens.

  1. AMP-18 Targets p21 to Maintain Epithelial Homeostasis.

    PubMed

    Chen, Peili; Li, Yan Chun; Toback, F Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21 WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD.

  2. Cyclic AMP inhibits secretion from electroporated human neutrophils.

    PubMed

    Smolen, J E; Stoehr, S J; Kuczynski, B

    1991-02-01

    It has long been known that intracellular cAMP inhibits and cGMP enhances intact neutrophil function. However, these effects are modest and require relatively high concentrations of the cyclic nucleotides. We decided to re-examine the effects of cyclic nucleotides on Ca2(+)-induced secretion by electroporated cells. This system allowed us to bypass normal cell surface receptor-ligand interactions as well as to directly expose the intracellular space to native cyclic nucleotides. We found that concentrations of cAMP as low as 3 microM inhibited Ca2(+)-induced secretion; 30-300 microM cAMP was maximally inhibitory. cAMP was actually slightly more potent than dibutyryl cAMP, a membrane-permeant derivative. In contrast, cGMP was only slightly stimulatory at 3 microM and modestly inhibitory at 300 microM; dibutyryl cGMP was ineffective. A more detailed investigation of the effects of cAMP showed that inhibition was only obtained in the presence of Mg2+. Half-maximal inhibition by cAMP occurred at 10-30 microM. Inhibition by cAMP was achieved by shifting the Ca2+ dose-response curve for secretion to the right; this was observed for the release of both specific granules (vitamin B12 binding protein) and azurophil granules (B-glucuronidase). We previously showed that ATP could enhance Ca2(+)-induced secretion in the presence of Mg2+, apparently by interacting with a cell surface purine receptor. However, increasing concentrations of ATP could not overcome inhibition by cAMP; this suggested that cAMP acted at some site other than the purine receptor. Inhibition by cAMP was also less apparent in the presence of the protein kinase C agonist phorbol myristate acetate (PMA), suggesting that the cyclic nucleotide did not produce systemic desensitization of the neutrophils. In summary, these results demonstrate that low, physiologically relevant concentrations of cAMP can modulate neutrophil responsiveness. PMID:1846904

  3. Phenolic diterpenes from rosemary suppress cAMP responsiveness of gluconeogenic gene promoters.

    PubMed

    Yun, Young Sook; Noda, Sachie; Shigemori, Genta; Kuriyama, Ryunosuke; Takahashi, Shigeru; Umemura, Mariko; Takahashi, Yuji; Inoue, Hideshi

    2013-06-01

    The cAMP/protein kinase A/cAMP response element (CRE)-binding protein pathway is important for various physiological aspects including regulation of gluconeogenic gene expression. Rosemary, a well-known herb, has been reported to decrease blood glucose levels. We found that methanol extracts of rosemary suppressed forskolin (FSK)-stimulated luciferase expression under the control of CRE, as well as the promoters for cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) and glucose-6-phosphatase (G6Pase) catalytic subunit genes in human hepatoma HepG2 cells. Three abietane-type diterpenes and two flavonoids were isolated from the rosemary extracts. Among these, 7-O-methylrosmanol (1) and royleanonic acid (3) effectively suppressed FSK-induced luciferase expression under the control of the CRE, PEPCK-C and G6Pase gene promoters. PEPCK-C and G6Pase, which play a key role in the homeostatic regulation of blood glucose levels, are important for managing type II diabetes mellitus. Therefore, the ability of rosemary and its components to suppress cAMP responsiveness of the PEPCK-C or G6Pase gene may contribute to its antihyperglycemic activity.

  4. Multiple Facets of cAMP Signalling and Physiological Impact: cAMP Compartmentalization in the Lung

    PubMed Central

    Oldenburger, Anouk; Maarsingh, Harm; Schmidt, Martina

    2012-01-01

    Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target. PMID:24281338

  5. Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase

    SciTech Connect

    Tondi, D.; Powers, R.A.; Negri, M.C.; Caselli, M.C.; Blazquez, J.; Costi, M.P.; Shoichet, B.K.

    2010-03-08

    Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore new inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but

  6. Interaction between cAMP-dependent and insulin-dependent signal pathways in tyrosine phosphorylation in primary cultures of rat hepatocytes.

    PubMed Central

    Ito, Y; Uchijima, Y; Ariga, M; Seki, T; Takenaka, A; Hakuno, F; Takahashi, S I; Ariga, T; Noguchi, T

    1997-01-01

    The present studies were undertaken to determine whether the interaction between cAMP-dependent and insulin-dependent pathways in primary cultures of rat hepatocytes affects biological functions and tyrosine phosphorylation. Quiescent hepatocytes were pretreated with dibutyryl cAMP or cAMP-generating agents such as glucagon, and then treated or not with insulin. Preincubation for 6 h with dibutyryl cAMP or glucagon enhanced the effect of insulin on DNA synthesis, but not the effect of insulin on amino acid transport or glycogen and protein synthesis. Tyrosine phosphorylation of intracellular proteins was determined by immunoblot analysis using an anti-phosphotyrosine antibody. Maximum tyrosine phosphorylation of a 195 kDa protein, which may be a substrate of insulin receptor kinase, of 175-180 kDa proteins, including insulin receptor substrate (IRS)-1, and of 90-95 kDa proteins, including the insulin receptor beta-subunit, was reached within 30 s of incubation with insulin. Pretreatment for about 3 h with dibutyryl cAMP or cAMP-generating agents clearly increased insulin-dependent tyrosine phosphorylation of the 195 kDa protein, but not IRS-1, IRS-2 or the insulin receptor beta-subunit. Because dibutyryl cAMP and cAMP-generating agents did not increase insulin receptor number or its kinase activity, the effect of cAMP on this potentiation of tyrosine phosphorylation is assumed to be exerted at a step distal to insulin receptor kinase activation. The potentiation by cAMP pretreatment of insulin-stimulated tyrosine phosphorylation may in part be secondary to inhibition of phosphotyrosine phosphatase activity, because cAMP pretreatment blunted the effect of Na3VO4 on the net tyrosine phosphorylation of the 195 kDa protein as compared with cells pretreated with no additive. In summary, the interactions between cAMP-dependent and insulin-dependent pathways that lead to augmentation of DNA synthesis appear to parallel the changes in tyrosine phosphorylation. Further

  7. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  8. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  9. ^amp;+^amp;-p Electroproduction Cross Sections off Protons in the Second Resonance Region

    NASA Astrophysics Data System (ADS)

    Fedotov, Gleb; Gothe, Ralf; Mokeev, Victor

    2013-04-01

    In this talk we present preliminary ^amp;+^amp;-p electroproduction cross sections off protons in the kinematical area of W from 1.4 to 1.8 GeV and Q^2 from 0.4 to 1.1 GeV^2. Our kinematical coverage in part overlap with previous CLAS measurements, but offers more than a factor six finer binning in Q^2. The physics analysis of these data within the framework of the JM model will allow us to determine the electrocouplings and the partial πδ, ρp decay widths of several high lying nucleon resonances S31(1620), S11(1650), F15(1685), D33(1700), P13(1720) and to further explore the evidence for the 3/2^+(1720) candidate-state. Analysis of the single pion electroproduction data measured with CLAS in the aforementioned kinematic region is in progress. Single and charged double pion exclusive channels are major contributors to the meson electroproduction in the N* excitation region with different non-resonant mechanisms. A successful description of all observables in these exclusive channels with consistent N* electrocouplings will offer evidence for the reliable evaluation of these fundamental quantities.

  10. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  11. Amp Synthesis in Aqueous Solution of Adenosine and Phosphorus Pentoxide

    NASA Astrophysics Data System (ADS)

    Yamagata, Y.; Kojima, H.; Ejiri, K.; Inomata, K.

    1982-12-01

    Possible formation of a P4O10 molecule in magma, the stability of the molecule in hydrous volcanic gas at high temperatures and a possible prebiotic phosphate cycle were discussed in relation to chemical evolution. To demonstrate the utility of phosphorus pentoxide as a phosphorylating agent, aqueous solutions of adenosine (0.02M) and phosphorus pentoxide (0.2M) were incubated at 37°C for 5 months. The pH of the solutions was adjusted every day or every few days to each fixed value (9.0, 10.5, 11.5, 12.5) with 10 N NaOH. The HPLC analysis showed the formation of 2'-AMP, 3'-AMP, 5'-AMP, cyclic (2' 3')-AMP and cyclic (3' 5')-AMP. The main components of the products were 2'- and 3'-AMP, though cyclic (2' 3')-AMP was the main component in the early period of the incubation at pH 9.0. The yields (conversion rate of adenosine to AMPs) were increased almost linearly with the incubation time for 5 months in the case of pH 9.0. The final yields were about 3% (pH 9.0), 6% (pH 9.0, 1 M NaCl), 5% (pH 9.0, 0.01 M CaCl2, 0.01 M MgCl2), 7% (pH 9.0, 0.5 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 9% (pH 9.0, 1 M NaCl, 0.01 M CaCl2, 0.01 M MgCl2), 32% (pH 10.5), 43% (pH 11.5), 35% (pH 12.5).

  12. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  13. Bacterial Cyclic AMP-Phosphodiesterase Activity Coordinates Biofilm Formation

    PubMed Central

    Kalivoda, Eric J.; Brothers, Kimberly M.; Stella, Nicholas A.; Schmitt, Matthew J.; Shanks, Robert M. Q.

    2013-01-01

    Biofilm-related infections are a major contributor to human disease, and the capacity for surface attachment and biofilm formation are key attributes for the pathogenesis of microbes. Serratia marcescens type I fimbriae-dependent biofilms are coordinated by the adenylate cyclase, CyaA, and the cyclic 3′,5′-adenosine monophosphate (cAMP)-cAMP receptor protein (CRP) complex. This study uses S. marcescens as a model system to test the role of cAMP-phosphodiesterase activity in controlling biofilm formation. Herein we describe the characterization of a putative S. marcescens cAMP-phosphodiesterase gene (SMA3506), designated as cpdS, and demonstrated to be a functional cAMP-phosphodiesterase both in vitro and in vivo. Deletion of cpdS resulted in defective biofilm formation and reduced type I fimbriae production, whereas multicopy expression of cpdS conferred a type I fimbriae-dependent hyper-biofilm. Together, these results support a model in which bacterial cAMP-phosphodiesterase activity modulates biofilm formation. PMID:23923059

  14. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  15. The Search for a π1(1400) Exotic Meson in the γp->^amp;++η^amp;- System

    NASA Astrophysics Data System (ADS)

    Schott, Diane

    2013-04-01

    Over twenty years ago QCD-inspired models of hadronic states suggested the existence of mesons beyond the Naive Quark Model (NQM), which motivated a rigorous search for exotic mesons. The lightest of these states is the π1(1400) decaying to η^amp;- observed by experiment E852 at Brookhaven and the VES collaboration at IHEP. Photoproduction is predicted to favor production of a J^PC=1^-+ gluonic excitation resulting in the increase of the ratio of π1 to a2 mesons. A Partial Wave Analysis was conducted on the reaction γp->^amp;++X->p^amp;+^amp;-(η), using the ^amp;++ to select the pion exchange. The analysis has shown the final spectra of the resonance decaying to η^amp;- to be dominated by the quantum state of J^PC=2^++ corresponding to the presence of the a2(1320). The J^PC=1^-+ state, shows no structure in the intensity distribution. The phase difference between the J^PC=1^-+ and J^PC=2^++ amplitudes show the interference between the two states. This is the first spin-parity analysis of the ηπ final state in photoproduction.

  16. cAMP-dependent activation of mammalian target of rapamycin (mTOR) in thyroid cells. Implication in mitogenesis and activation of CDK4.

    PubMed

    Blancquaert, Sara; Wang, Lifu; Paternot, Sabine; Coulonval, Katia; Dumont, Jacques E; Harris, Thurl E; Roger, Pierre P

    2010-07-01

    How cAMP-dependent protein kinases [protein kinase A (PKA)] transduce the mitogenic stimulus elicited by TSH in thyroid cells to late activation of cyclin D3-cyclin-dependent kinase 4 (CDK4) remains enigmatic. Here we show in PC Cl3 rat thyroid cells that TSH/cAMP, like insulin, activates the mammalian target of rapamycin (mTOR)-raptor complex (mTORC1) leading to phosphorylation of S6K1 and 4E-BP1. mTORC1-dependent S6K1 phosphorylation in response to both insulin and cAMP required amino acids, whereas inhibition of AMP-activated protein kinase and glycogen synthase kinase 3 enhanced insulin but not cAMP effects. Unlike insulin, TSH/cAMP did not activate protein kinase B or induce tuberous sclerosis complex 2 phosphorylation at T1462 and Y1571. However, like insulin, TSH/cAMP produced a stable increase in mTORC1 kinase activity that was associated with augmented 4E-BP1 binding to raptor. This could be caused in part by T246 phosphorylation of PRAS40, which was found as an in vitro substrate of PKA. Both in PC Cl3 cells and primary dog thyrocytes, rapamycin inhibited DNA synthesis and retinoblastoma protein phosphorylation induced by TSH and insulin. Although rapamycin reduced cyclin D3 accumulation, the abundance of cyclin D3-CDK4 complexes was not affected. However, rapamycin inhibited the activity of these complexes by decreasing the TSH and insulin-mediated stimulation of activating T172 phosphorylation of CDK4. We propose that mTORC1 activation by TSH, at least in part through PKA-dependent phosphorylation of PRAS40, crucially contributes to mediate cAMP-dependent mitogenesis by regulating CDK4 T172-phosphorylation. PMID:20484410

  17. GABAB receptors modulate catecholamine secretion in chromaffin cells by a mechanism involving cyclic AMP formation.

    PubMed Central

    Oset-Gasque, M. J.; Parramón, M.; González, M. P.

    1993-01-01

    1. The function of gamma-aminobutyric acidB (GABAB) receptors in modulation of catecholamine secretion by chromaffin cells and the possible mechanism involved in this action have been examined. 2. The GABAB agonists (-)-baclofen and 3-aminopropylphosphinic acid (3-APPA) were found to induce a dose-dependent increase of basal catecholamine secretion. The EC50s were 151 +/- 35 microM and 225 +/- 58 microM for baclofen and 3-APPA, respectively. This stimulatory effect was specific since it could be blocked by 0.5 mM of the specific GABAB antagonist CGP-35348. 3. In contrast, preincubation of chromaffin cells with the GABAB agonists was found to inhibit, in a dose-dependent manner, the catecholamine secretion evoked by 10 microM nicotine and 200 microM muscimol. 4. The effects of GABAB agonists on both basal and evoked catecholamine secretion were found to be accompanied by parallel changes in intracellular calcium concentration ([Ca2+]i). GABAB agonists produced a dose-dependent increase in [Ca2+]i which was partially blocked by CGP 35348, but they produced a strong inhibition of the [Ca2+]i increase induced by nicotine and muscimol. 5. The GABAB agonists also produced a dose-dependent increase in intracellular cyclic AMP levels, there being a direct correlation between both increase in catecholamine secretion and in intracellular cyclic AMP levels. 6. The pretreatment of chromaffin cells with pertussis toxin doubled the catecholamine secretion and increased by four times the intracellular cyclic AMP levels evoked by GABAB agonists. 7. The possible involvement of adenylate cyclase in the mechanism of GABAA receptor modulation of catecholamine secretion is discussed. PMID:8306105

  18. Phenotypic and molecular characterization of plasmid mediated AmpC β-lactamases among Escherichia coli, Klebsiella spp., and Proteus mirabilis isolated from urinary tract infections in Egyptian hospitals.

    PubMed

    Helmy, Mai M; Wasfi, Reham

    2014-01-01

    The incidence of resistance by Enterobacteriaceae to β-lactam/β-lactamase inhibitors combination is increasing in Egypt. Three phenotypic techniques, comprising AmpC disk diffusion and inhibition dependent methods using phenylboronic acid (PBA) and cloxacillin, were compared to PCR based method for detection of plasmid mediated AmpC β-lactamase in common urinary tract isolates. A total of 143 isolates, including E. coli, Klebsiella pneumonia, and Proteus mirabilis, were collected from urinary tract infections cases in Egyptian hospitals. Plasmid encoded AmpC genes were detected by PCR in 88.46% of cefoxitin resistant isolates. The most prevalent AmpC gene family was CIT including CMY-2, CMY-4, and two CMY-2 variants. The second prevalent gene was DHA-1 which was detected in E. coli and Klebsiella pneumonia. The genes EBC, FOX, and MOX were also detected but in small percentage. Some isolates were identified as having more than one pAmpC gene. The overall sensitivity and specificity of phenotypic tests for detection of AmpC β-lactamase showed that AmpC disk diffusion and inhibition dependent method by cloxacillin were the most sensitive and the most specific disk tests. PCR remains the gold standard for detection of AmpC β-lactamases. This study represents the first report of CMY-2 variants of CMY-42 and CMY-102 β-lactamase-producing E. coli, Klebsiella pneumonia, and Proteus mirabilis isolates in Egypt.

  19. Influence of cyclic nucleotides (cAMP) on inositol phospholipid (InsPL) metabolism in cultured mesangial (MS) cells

    SciTech Connect

    Troyer, D.A.; Venkatachalam, M.A.; Bonventre, J.V.; Kreisberg, J.I.

    1986-03-01

    Elevation of cAMP inhibits hormone-induced contraction of MS cells, and in other cell types, reduces stimulated InsPL metabolism. The authors found that neither isobutylmethylxanthine (MIX, 0.5 mM), which increases MS cell cAMP levels 4-fold, nor forskolin (100 ..mu..M) altered vasopressin (VP, 10 nM) induced release of /sup 3/H-inositol trisphosphate from prelabelled MS cells. Also, maneuvers which elevated cAMP did not block the VP-induced rise of intracellular calcium as measured by quin-2. Further, neither MIX nor isoproterenol affected the stimulation of glycolysis by VP as measured by lactic acid production. MIX diminished VP stimulated /sup 32/P orthophosphate (/sup 32/P) incorporation into phosphatidylinositol 4,5-bisphosphate, phosphatidylinositol 4-phosphate and phosphatidylinositol. The /sup 32/P content in phosphoinositides of cells treated with MIX and VP was 65% of that in cells treated with VP only. However, the authors found that the specific activity of /sup 32/P in ATP in the presence of MIX + VP was 74% of that with VP alone. Thus, the apparent suppression of /sup 32/P incorporation due to MIX was attributable to a concurrent diminution of the specific activity of /sup 32/P in ATP. The authors conclude that increases of cAMP interfere with contraction distal to PIP/sub 2/ hydrolysis, inositol phosphate release, calcium mobilization, and enhancement of glycolysis.

  20. Intraoperative urinary cyclic AMP monitoring in primary hyperparathyroidism.

    PubMed Central

    Schenk, W G; Wills, M; MacLeod, M S; Hanks, J B

    1993-01-01

    OBJECTIVE: This study examined the utility of intraoperative urinary cyclic 3'5' adenosine monophosphate (UcAMP), an indicator of parathyroid (PTH) hormone end-organ activity, as a "biochemical frozen section," signaling the real-time resolution of PTH hyperactivity during surgery for primary hyperparathyroidism. SUMMARY BACKGROUND DATA: The unsuccessful initial neck exploration for primary hyperparathyroidism, leaving the patient with persistent hyperfunctioning parathyroid tissue, results in part from the surgeon's inability intraoperatively to correlate a gland's gross appearance and size estimation with physiologic function. Preoperative imaging, intraoperative imaging, and intraoperative histologic/cytologic surveillance have not resolved this dilemma. METHODS: Twenty-seven patients underwent a prospective intraoperative UcAMP monitoring protocol. The patients all had a clinical diagnosis of primary hyperparathyroidism and an average preoperative serum calcium of 12.0 +/- 0.3 mg/dl. UcAMP was assayed intraoperatively using 20-minute nonequilibrium radioimmunoassay providing real-time feedback to the operating team. RESULTS: All patients had an elevated UcAMP confirming PTh hyperactivity at the beginning of the procedure. One patient, subsequently found to have an supernumerary ectopic adenoma, had four normal glands identified intraoperatively, and his intraoperative UcAMP values corroborated persistent hyperparathyroidism, the UcAMP of the remaining 26 patients decreased from 7.0 +/- 1.1 to 2.7 +/- 0.7 nm.dl GF (p < .00005) after complete adenoma excision, and they remain normocalcemic. The protocol provided useful and relevant information to the operating team, and aided in surgical decision-making, in 10 of the 27 cases (37%). CONCLUSION: Intraoperative biochemical surveillance with ucAMP monitoring reliably signals resolution of PTH hyperfunction. It is a useful adjunct to the surgeon's skill, judgment, and experience in parathyroid surgery. PMID:8387765

  1. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  2. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  3. Cyclic AMP, a nonessential regulator of the cell cycle.

    PubMed Central

    Coffino, P; Gray, J W; Tomkins, G M

    1975-01-01

    Flow-microfluorimetric analysis has been carried out on populations of exponentially growing S49 mouse lymphoma cells treated with dibutyryl cyclic AMP. The drug produces a specific concentration-dependent block in the G-1 phase of the cell cycle while other phases of the cycle are not perceptibly altered. The cell cycle of a line of mutant cells lacking the cyclic AMP-dependent protein kinase is not affected by the drug. Since these mutant cells have been shown to maintain a normal cell cycle, even in the presence of high levels of cyclic AMP, periodic fluctuations in the levels of the cyclic nucleotide cannot be required for or determine progression through the cell cycle. PMID:165491

  4. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  5. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  6. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence.

  7. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells

    PubMed Central

    Khan, D. R.; Guillemette, C.; Sirard, M. A.

    2015-01-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3′5′-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca2+) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  8. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  9. The field concept in Ampère's magnetostatics

    NASA Astrophysics Data System (ADS)

    Davis, Artice M.

    2009-08-01

    We update Ampère's theory using vector notation and derive his expression for the force between two current elements. We assume that the two elements are in different current loops and integrate over one to obtain the force on a differential element in the second. This procedure allows us to define the magnetic field in a natural manner and to derive the Lorentz force for a current segment. We equate the magnetic moments of current and permanent magnet dipoles and show that Biot and Savart could have performed their experiment using a small current loop, thus establishing the Biot-Savart law as a consequence of Ampère's theory.

  10. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  11. Mutagenesis and chemical rescue indicate residues involved in beta-aspartyl-AMP formation by Escherichia coli asparagine synthetase B.

    PubMed

    Boehlein, S K; Walworth, E S; Richards, N G; Schuster, S M

    1997-05-01

    Site-directed mutagenesis and kinetic studies have been employed to identify amino acid residues involved in aspartate binding and transition state stabilization during the formation of beta-aspartyl-AMP in the reaction mechanism of Escherichia coli asparagine synthetase B (AS-B). Three conserved amino acids in the segment defined by residues 317-330 appear particularly crucial for enzymatic activity. For example, when Arg-325 is replaced by alanine or lysine, the resulting mutant enzymes possess no detectable asparagine synthetase activity. The catalytic activity of the R325A AS-B mutant can, however, be restored to about 1/6 of that of wild-type AS-B by the addition of guanidinium HCl (GdmHCl). Detailed kinetic analysis of the rescued activity suggests that Arg-325 is involved in stabilization of a pentacovalent intermediate leading to the formation beta-aspartyl-AMP. This rescue experiment is the second example in which the function of a critical arginine residue that has been substituted by mutagenesis is restored by GdmHCl. Mutation of Thr-322 and Thr-323 also produces enzymes with altered kinetic properties, suggesting that these threonines are involved in aspartate binding and/or stabilization of intermediates en route to beta-aspartyl-AMP. These experiments are the first to identify residues outside of the N-terminal glutamine amide transfer domain that have any functional role in asparagine synthesis.

  12. Structural effects in photopolymerized sodium AMPS hydrogels crosslinked with poly(ethylene glycol) diacrylate for use as burn dressings.

    PubMed

    Nalampang, Kanarat; Panjakha, Rachanida; Molloy, Robert; Tighe, Brian J

    2013-01-01

    Synthetic hydrogel polymers were prepared by free radical photopolymerization in aqueous solution of the sodium salt of 2-acrylamido-2-methylpropane sulfonic acid (Na-AMPS). Poly(ethylene glycol) diacrylate (PEGDA) and 4,4'-azo-bis(4-cyanopentanoic acid) were used as the crosslinker and UV-photoinitiator, respectively. The effects of varying the Na-AMPS monomer concentration within the range of 30-50% w/v and the crosslinker concentration within the range of 0.1-1.0% mol (relative to monomer) were studied in terms of their influence on water absorption properties. The hydrogel sheets exhibited extremely high swelling capacities in aqueous media which were dependent on monomer concentration, crosslink density, and the ionic strength and composition of the immersion medium. The effects of varying the number-average molecular weight of the PEGDA crosslinker from [Formula: see text] = 250 to 700 were also investigated. Interestingly, it was found that increasing the molecular weight and therefore the crosslink length at constant crosslink density decreased both the rate of water absorption and the equilibrium water content. Cytotoxicity testing by the direct contact method with mouse fibroblast L929 cells indicated that the synthesized hydrogels were nontoxic. On the basis of these results, it is considered that photopolymerized Na-AMPS hydrogels crosslinked with PEGDA show considerable potential for biomedical use as dressings for partial thickness burns. This paper describes some structural effects which are relevant to their design as biomaterials for this particular application. PMID:23796031

  13. Role of ecdysone, pupariation factors, and cyclic AMP in formation and tanning of the puparium of the fleshfly Sarcophaga bullata.

    PubMed

    Seligman, M; Blechl, A; Blechl, J; Herman, P; Fraenkel, G

    1977-10-01

    Two pupariation factors, anterior retraction factor (ARF) and puparium tanning factor (PTF), are absent from the hemolymph of larvae at the time of tanning accelerated by ARF/PTF, cyclic AMP, or dopamine. ARF and PTF are not involved in derepression of dopa decarboxylase (aromatic L-amino-acid decarboxylase, aromatic L-amino-acid carboxy-lyase, EC 4.1.1.28) synthesis initiated by ecdysone. Tanning is entirely inhibited by injection of two transcriptional inhibitors, actinomycin and BrdUrd, and two translational inhibitors, puromycin and cycloheximide. Retraction activity is more severely inhibited by the transcriptional than by the translational inhibitors. A tanning response is initiated by cyclic AMP in the presence of the transcriptional but not the translational inhibitors. Dihydric tanning substances (dopa, dopamine) initiate tanning in the presence of both types of inhibitors. Release of ARF and PTF from the central nervous system is inhibited by the four inhibitors. ARF totally reverses the inhibitory effects on retraction, whereas PTF does not reverse inhibition of tanning. These data are interpreted to mean that PTF is concerned with the regulation of two components of the tanning response: (i) acceleration of synthesis of a particular protein (associated with the tyrosine hydroxylation complex), and (ii) activation via cyclic AMP of a component of the tyrosine hydroxylating system.

  14. Luteinizing hormone-releasing hormone (LHRH) attenuates morphine-induced inhibition of cyclic AMP (cAMP) in opioid-responsive SK-N-SH cells.

    PubMed

    Ratka, A; Simpkins, J W

    1997-04-01

    SK-N-SH cells were used to assess the effects of luteinizing hormone-releasing hormone (LHRH) on opioid receptor-mediated changes in cyclic AMP (cAMP). Prostaglandin E1 (PGE1, 1 microM) caused a dramatic increase in cAMP levels. Treatment with 10 microM morphine (MOR) significantly inhibited the stimulatory effect of PGE1, LHRH (0.8 microM) caused an increase in the basal level of intracellular cAMP and potentiated the stimulatory effect of PGE1 on cAMP accumulation. In cells pretreated with LHRH the inhibitory effect of MOR on cAMP accumulation was significantly attenuated. An LHRH antagonist had no effect on cAMP. The involvement of pertussis toxin (PTX)-sensitive G proteins in the actions of LHRH was studied. PTX increased the stimulatory effect of PGE1 on cAMP and attenuated the inhibitory effect of MOR. However, PTX pretreatment prevented the effects of LHRH on the intracellular actions of PGE1 but exerted an additive effect with LHRH in blocking the MOR-induced decrease in cAMP levels. We conclude that LHRH attenuates the inhibitory, opioid receptor-mediated effect of MOR on intracellular cAMP accumulation in SK-N-SH cells, and that the G protein-independent mechanism may be involved in LHRH-induced attenuation of the inhibitory effect of MOR on neuronal cAMP.

  15. AMP-activated protein kinase is activated by non-steroidal anti-inflammatory drugs.

    PubMed

    King, Tanya S; Russe, Otto Quintus; Möser, Christine V; Ferreirós, Nerea; Kynast, Katharina L; Knothe, Claudia; Olbrich, Katrin; Geisslinger, Gerd; Niederberger, Ellen

    2015-09-01

    AMP-activated kinase (AMPK) is a cellular energy sensor, which is activated in stages of increased adenosine triphosphate (ATP) consumption. Its activation has been associated with a number of beneficial effects such as decrease of inflammatory processes and inhibition of disease progression of diabetes and obesity. A recent study suggested that salicylate, the active metabolite of the non-steroidal anti-inflammatory drug (NSAID) acetyl-salicylic acid (aspirin), is able to activate AMPK pharmacologically. This observation raised the question whether or not other NSAIDs might also act as AMPK activators and whether this action might contribute to their cyclooxygenase (COX)-independent anti-inflammatory properties. In this study, we investigated mouse and human neuronal cells and liver tissue of mice after treatment with various NSAIDs. Our results showed that the non-selective acidic NSAIDs ibuprofen and diclofenac induced AMPK activation similar to aspirin while the COX-2 selective drug etoricoxib and the non-opioid analgesic paracetamol, both drugs have no acidic structure, failed to activate AMPK. In conclusion, our results revealed that AMPK can be activated by specific non-steroidal anti-inflammatory drugs such as salicylic acid, ibuprofen or diclofenac possibly depending on the acidic structure of the drugs. AMPK might therefore contribute to their antinociceptive and anti-inflammatory properties. PMID:26049010

  16. Pulse charging of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1980-01-01

    Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

  17. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  18. Glucose-induced hyperaccumulation of cyclic AMP and defective glucose repression in yeast strains with reduced activity of cyclic AMP-dependent protein kinase.

    PubMed

    Mbonyi, K; van Aelst, L; Argüelles, J C; Jans, A W; Thevelein, J M

    1990-09-01

    Addition of glucose or related fermentable sugars to derepressed cells of the yeast Saccharomyces cerevisiae triggers a RAS-mediated cyclic AMP (cAMP) signal that induces a protein phosphorylation cascade. In yeast mutants (tpk1w1, tpk2w1, and tpk3w1) containing reduced activity of cAMP-dependent protein kinase, fermentable sugars, as opposed to nonfermentable carbon sources, induced a permanent hyperaccumulation of cAMP. This finding confirms previous conclusions that fermentable sugars are specific stimulators of cAMP synthesis in yeast cells. Despite the huge cAMP levels present in these mutants, deletion of the gene (BCY1) coding for the regulatory subunit of cAMP-dependent protein kinase severely reduced hyperaccumulation of cAMP. Glucose-induced hyperaccumulation of cAMP was also observed in exponential-phase glucose-grown cells of the tpklw1 and tpk2w1 strains but not the tpk3w1 strain even though addition of glucose to glucose-repressed wild-type cells did not induce a cAMP signal. Investigation of mitochondrial respiration by in vivo 31P nuclear magnetic resonance spectroscopy showed the tpk1w1 and tpk2w1 strains, to be defective in glucose repression. These results are consistent with the idea that the signal transmission pathway from glucose to adenyl cyclase contains a glucose-repressible protein. They also show that a certain level of cAMP-dependent protein phosphorylation is required for glucose repression. Investigation of the glucose-induced cAMP signal and glucose-induced activation of trehalase in derepressed cells of strains containing only one of the wild-type TPK genes indicates that the transient nature of the cAMP signal is due to feedback inhibition by cAMP-dependent protein kinase.

  19. Role of cyclo-oxygenase-2 induction in interleukin-1β induced attenuation of cultured human airway smooth muscle cell cyclic AMP generation in response to isoprenaline

    PubMed Central

    Pang, Linhua; Holland, Elaine; Knox, Alan J

    1998-01-01

    Airway smooth muscle (ASM) in human asthma shows reduced relaxation and cyclic AMP generation in response to β-adrenoceptor agonists. IL-β attenuates cyclic AMP generation but the underlying mechanism is unclear. We have reported that IL-1β induces cyclo-oxygenase-2 (COX-2) in human ASM cells and results in a marked increase in prostanoid generation with PGE2 and PGI2 as the major products.We investigated the role of COX-2 induction and prostanoid release (measured as PGE2) in IL-1β induced attenuation of cyclic AMP generation in response to the β-adrenoceptor agonist isoprenaline (ISO).Pre-treatment of human ASM cells with IL-1β significantly attenuated cyclic AMP generation in response to high concentrations of ISO (1.0–10.0 μM) in a time- and concentration-dependent manner. The effect was accompanied by a high concentration of PGE2 release. The non-selective COX inhibitor indomethacin (Ind), the selective COX-2 inhibitor NS-398, the protein synthesis inhibitors cycloheximide (CHX) and actinomycin D and the steroid dexamethasone (Dex) all abolished the PGE2 release and prevented the attenuated cyclic AMP generation.COX substrate arachidonic acid time- and concentration-dependently mimicked IL-1β induced attenuation and the effect was prevented by the non-selective COX inhibitors Ind and flurbiprofen, but not by NS-398, CHX and Dex.In contrast to IL-1β, TNFα and IFNγ, which are ineffective in inducing COX-2 and releasing PGE2 from human ASM cells, did not affect the cyclic AMP formation.Our study demonstrates that COX-2 induction and the consequent release of prostanoids plays a crucial role in IL-1β induced attenuation of human ASM cell cyclic AMP response to ISO. PMID:9863663

  20. Palmitoleate Reverses High Fat-induced Proinflammatory Macrophage Polarization via AMP-activated Protein Kinase (AMPK)*

    PubMed Central

    Chan, Kenny L.; Pillon, Nicolas J.; Sivaloganathan, Darshan M.; Costford, Sheila R.; Liu, Zhi; Théret, Marine; Chazaud, Benedicte; Klip, Amira

    2015-01-01

    A rise in tissue-embedded macrophages displaying “M1-like” proinflammatory polarization is a hallmark of metabolic inflammation during a high fat diet or obesity. Here we show that bone marrow-derived macrophages (BMDM) from high fat-fed mice retain a memory of their dietary environment in vivo (displaying the elevated proinflammatory genes Cxcl1, Il6, Tnf, Nos2) despite 7-day differentiation and proliferation ex vivo. Notably, 6-h incubation with palmitoleate (PO) reversed the proinflammatory gene expression and cytokine secretion seen in BMDM from high fat-fed mice. BMDM from low fat-fed mice exposed to palmitate (PA) for 18 h ex vivo also showed elevated expression of proinflammatory genes (Cxcl1, Il6, Tnf, Nos2, and Il12b) associated with M1 polarization. Conversely, PO treatment increased anti-inflammatory genes (Mrc1, Tgfb1, Il10, Mgl2) and oxidative metabolism, characteristic of M2 macrophages. Therefore, saturated and unsaturated fatty acids bring about opposite macrophage polarization states. Coincubation of BMDM with both fatty acids counteracted the PA-induced Nos2 expression in a PO dose-dependent fashion. PO also prevented PA-induced IκBα degradation, RelA nuclear translocation, NO production, and cytokine secretion. Mechanistically, PO exerted its anti-inflammatory function through AMP-activated protein kinase as AMP kinase knockout or inhibition by Compound C offset the PO-dependent prevention of PA-induced inflammation. These results demonstrate a nutritional memory of BMDM ex vivo, highlight the plasticity of BMDM polarization in response to saturated and unsaturated fatty acids, and identify the potential to reverse diet- and saturated fat-induced M1-like polarization by administering palmitoleate. These findings could have applicability to reverse obesity-linked inflammation in metabolically relevant tissues. PMID:25987561

  1. Palmitoleate Reverses High Fat-induced Proinflammatory Macrophage Polarization via AMP-activated Protein Kinase (AMPK).

    PubMed

    Chan, Kenny L; Pillon, Nicolas J; Sivaloganathan, Darshan M; Costford, Sheila R; Liu, Zhi; Théret, Marine; Chazaud, Benedicte; Klip, Amira

    2015-07-01

    A rise in tissue-embedded macrophages displaying "M1-like" proinflammatory polarization is a hallmark of metabolic inflammation during a high fat diet or obesity. Here we show that bone marrow-derived macrophages (BMDM) from high fat-fed mice retain a memory of their dietary environment in vivo (displaying the elevated proinflammatory genes Cxcl1, Il6, Tnf, Nos2) despite 7-day differentiation and proliferation ex vivo. Notably, 6-h incubation with palmitoleate (PO) reversed the proinflammatory gene expression and cytokine secretion seen in BMDM from high fat-fed mice. BMDM from low fat-fed mice exposed to palmitate (PA) for 18 h ex vivo also showed elevated expression of proinflammatory genes (Cxcl1, Il6, Tnf, Nos2, and Il12b) associated with M1 polarization. Conversely, PO treatment increased anti-inflammatory genes (Mrc1, Tgfb1, Il10, Mgl2) and oxidative metabolism, characteristic of M2 macrophages. Therefore, saturated and unsaturated fatty acids bring about opposite macrophage polarization states. Coincubation of BMDM with both fatty acids counteracted the PA-induced Nos2 expression in a PO dose-dependent fashion. PO also prevented PA-induced IκBα degradation, RelA nuclear translocation, NO production, and cytokine secretion. Mechanistically, PO exerted its anti-inflammatory function through AMP-activated protein kinase as AMP kinase knockout or inhibition by Compound C offset the PO-dependent prevention of PA-induced inflammation. These results demonstrate a nutritional memory of BMDM ex vivo, highlight the plasticity of BMDM polarization in response to saturated and unsaturated fatty acids, and identify the potential to reverse diet- and saturated fat-induced M1-like polarization by administering palmitoleate. These findings could have applicability to reverse obesity-linked inflammation in metabolically relevant tissues.

  2. Cyclic AMP modulates electrical signaling in a weakly electric fish.

    PubMed

    McAnelly, L; Silva, A; Zakon, H H

    2003-04-01

    Many species of electric fish show diurnal or socially elicited variation in electric organ discharge amplitude. In Sternopygus macrurus, activation of protein kinase A by 8-bromo-cAMP increases electrocyte sodium current magnitude. To determine whether the behavioral plasticity in electric organ discharge amplitude is controlled by electrocyte biophysical properties, we examined whether the effects of phosphorylation on ion currents in the electric organ translate directly into electric organ discharge changes. We injected the electric organ of restrained fish with 8-bromo-cAMP and monitored the electric organ discharge. The effect of protein kinase A activation on electrocyte action potentials was examined in isolated electric organ using two-electrode current clamp. Electric organ discharge and action potential amplitude and pulse duration increased in response to 8-bromo-cAMP. Pulse and action potential duration both increased by about 25%. However, the increase in electric organ discharge amplitude (approximately 400%) was several-fold greater than the action potential amplitude increase (approximately 40%). Resting membrane resistance decreased in electrocytes exposed to 8-bromo-cAMP. We propose that in the Thevenin equivalent circuit of the electric organ a moderate increase in action potential amplitude combined with a decrease in internal resistance produces a greater voltage drop across the external resistance (the water around the fish), accounting for the large increase in the externally recorded electric organ discharge.

  3. Cyclic AMP signalling pathways in the regulation of uterine relaxation

    PubMed Central

    Yuan, Wei; López Bernal, Andrés

    2007-01-01

    Studying the mechanism(s) of uterine relaxation is important and will be helpful in the prevention of obstetric difficulties such as preterm labour, which remains a major cause of perinatal mortality and morbidity. Multiple signalling pathways regulate the balance between maintaining relative uterine quiescence during gestation, and the transition to the contractile state at the onset of parturition. Elevation of intracellular cyclic AMP promotes myometrial relaxation, and thus quiescence, via effects on multiple intracellular targets including calcium channels, potassium channels and myosin light chain kinase. A complete understanding of cAMP regulatory pathways (synthesis and hydrolysis) would assist in the development of better tocolytics to delay or inhibit preterm labour. Here we review the enzymes involved in cAMP homoeostasis (adenylyl cyclases and phosphodiesterases) and possible myometrial substrates for the cAMP dependent protein kinase. We must emphasise the need to identify novel pharmacological targets in human pregnant myometrium to achieve safe and selective uterine relaxation when this is indicated in preterm labour or other obstetric complications. PMID:17570154

  4. Fluorescence study of Escherichia coli cyclic AMP receptor protein.

    PubMed

    Wasylewski, M; Małecki, J; Wasylewski, Z

    1995-07-01

    Time-resolved, steady-state fluorescence and fluorescence-detected circular dichroism (FDCD) have been used to resolve the fluorescence contributions of the two tryptophan residues, Trp-13 and Trp-85, in the cyclic AMP receptor protein (CRP). The iodide and acrylamide quenching data show that in CRP one tryptophan residue, Trp-85, is buried within the protein matrix and the other, Trp-13, is moderately exposed on the surface of the protein. Fluorescence-quenching-resolved spectra show that Trp-13 has emission at about 350 nm and contributes 76-83% to the total fluorescence emission. The Trp-85, unquenchable by iodide and acrylamide, has the fluorescence emission at about 337 nm. The time-resolved fluorescence measurements show that Trp-13 has a longer fluorescence decay time. The Trp-85 exhibits a shorter fluorescence decay time. In the CRP-cAMP complex the Trp-85, previously buried in the apoprotein becomes totally exposed to the iodide and acrylamide quenchers. The FDCD spectra indicate that in the CRP-cAMP complex Trp-85 remains in the same environment as in the protein alone. It has been proposed that the binding of cAMP to CRP is accompanied by a hinge reorientation of two protein domains. This allows for penetration of the quencher molecules into the Trp-85 residue previously buried in the protein matrix. PMID:8590598

  5. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  6. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  7. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  8. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  9. Glucose becomes one of the worst carbon sources for E.coli on poor nitrogen sources due to suboptimal levels of cAMP

    PubMed Central

    Bren, Anat; Park, Junyoung O.; Towbin, Benjamin D.; Dekel, Erez; Rabinowitz, Joshua D.; Alon, Uri

    2016-01-01

    In most conditions, glucose is the best carbon source for E. coli: it provides faster growth than other sugars, and is consumed first in sugar mixtures. Here we identify conditions in which E. coli strains grow slower on glucose than on other sugars, namely when a single amino acid (arginine, glutamate, or proline) is the sole nitrogen source. In sugar mixtures with these nitrogen sources, E. coli still consumes glucose first, but grows faster rather than slower after exhausting glucose, generating a reversed diauxic shift. We trace this counterintuitive behavior to a metabolic imbalance: levels of TCA-cycle metabolites including α-ketoglutarate are high, and levels of the key regulatory molecule cAMP are low. Growth rates were increased by experimentally increasing cAMP levels, either by adding external cAMP, by genetically perturbing the cAMP circuit or by inhibition of glucose uptake. Thus, the cAMP control circuitry seems to have a ‘bug’ that leads to slow growth under what may be an environmentally rare condition. PMID:27109914

  10. MiAMP1, a novel protein from Macadamia integrifolia adopts a Greek key beta-barrel fold unique amongst plant antimicrobial proteins.

    PubMed

    McManus, A M; Nielsen, K J; Marcus, J P; Harrison, S J; Green, J L; Manners, J M; Craik, D J

    1999-10-29

    MiAMP1 is a recently discovered 76 amino acid residue, highly basic protein from the nut kernel of Macadamia integrifolia which possesses no sequence homology to any known protein and inhibits the growth of several microbial plant pathogens in vitro while having no effect on mammalian or plant cells. It is considered to be a potentially useful tool for the genetic engineering of disease resistance in transgenic crop plants and for the design of new fungicides. The three-dimensional structure of MiAMP1 was determined through homonuclear and heteronuclear ((15)N) 2D NMR spectroscopy and subsequent simulated annealing calculations with the ultimate aim of understanding the structure-activity relationships of the protein. MiAMP1 is made up of eight beta-strands which are arranged in two Greek key motifs. These Greek key motifs associate to form a Greek key beta-barrel. This structure is unique amongst plant antimicrobial proteins and forms a new class which we term the beta-barrelins. Interestingly, the structure of MiAMP1 bears remarkable similarity to a yeast killer toxin from Williopsis mrakii. This toxin acts by inhibiting beta-glucan synthesis and thereby cell wall construction in sensitive strains of yeast. The structural similarity of MiAMP1 and WmKT, which originate from plant and fungal phyla respectively, may reflect a similar mode of action.

  11. MiAMP1, a novel protein from Macadamia integrifolia adopts a Greek key beta-barrel fold unique amongst plant antimicrobial proteins.

    PubMed

    McManus, A M; Nielsen, K J; Marcus, J P; Harrison, S J; Green, J L; Manners, J M; Craik, D J

    1999-10-29

    MiAMP1 is a recently discovered 76 amino acid residue, highly basic protein from the nut kernel of Macadamia integrifolia which possesses no sequence homology to any known protein and inhibits the growth of several microbial plant pathogens in vitro while having no effect on mammalian or plant cells. It is considered to be a potentially useful tool for the genetic engineering of disease resistance in transgenic crop plants and for the design of new fungicides. The three-dimensional structure of MiAMP1 was determined through homonuclear and heteronuclear ((15)N) 2D NMR spectroscopy and subsequent simulated annealing calculations with the ultimate aim of understanding the structure-activity relationships of the protein. MiAMP1 is made up of eight beta-strands which are arranged in two Greek key motifs. These Greek key motifs associate to form a Greek key beta-barrel. This structure is unique amongst plant antimicrobial proteins and forms a new class which we term the beta-barrelins. Interestingly, the structure of MiAMP1 bears remarkable similarity to a yeast killer toxin from Williopsis mrakii. This toxin acts by inhibiting beta-glucan synthesis and thereby cell wall construction in sensitive strains of yeast. The structural similarity of MiAMP1 and WmKT, which originate from plant and fungal phyla respectively, may reflect a similar mode of action. PMID:10543955

  12. Role of CNPase in the oligodendrocytic extracellular 2',3'-cAMP-adenosine pathway.

    PubMed

    Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Bansal, Rashmi; Goebbels, Sandra; Nave, Klaus-Armin; Kochanek, Patrick M; Jackson, Edwin K

    2013-10-01

    Extracellular adenosine 3',5'-cyclic monophosphate (3',5'-cAMP) is an endogenous source of localized adenosine production in many organs. Recent studies suggest that extracellular 2',3'-cAMP (positional isomer of 3',5'-cAMP) is also a source of adenosine, particularly in the brain in vivo post-injury. Moreover, in vitro studies show that both microglia and astrocytes can convert extracellular 2',3'-cAMP to adenosine. Here, we examined the ability of primary mouse oligodendrocytes and neurons to metabolize extracellular 2',3'-cAMP and their respective adenosine monophosphates (2'-AMP and 3'-AMP). Cells were also isolated from mice deficient in 2',3'-cyclic nucleotide-3'-phosphodiesterase (CNPase). Oligodendrocytes metabolized 2',3'-cAMP to 2'-AMP with 10-fold greater efficiency than did neurons (and also more than previously examined microglia and astrocytes); whereas, the production of 3'-AMP was minimal in both oligodendrocytes and neurons. The production of 2'-AMP from 2',3'-cAMP was reduced by 65% in CNPase -/- versus CNPase +/+ oligodendrocytes. Oligodendrocytes also converted 2'-AMP to adenosine, and this was also attenuated in CNPase -/- oligodendrocytes. Inhibition of classic 3',5'-cAMP-3'-phosphodiesterases with 3-isobutyl-1-methylxanthine did not block metabolism of 2',3'-cAMP to 2'-AMP and inhibition of classic ecto-5'-nucleotidase (CD73) with α,β-methylene-adenosine-5'-diphosphate did not attenuate the conversion of 2'-AMP to adenosine. These studies demonstrate that oligodendrocytes express the extracellular 2',3'-cAMP-adenosine pathway (2',3'-cAMP → 2'-AMP → adenosine). This pathway is more robustly expressed in oligodendrocytes than in all other CNS cell types because CNPase is the predominant enzyme that metabolizes 2',3'-cAMP to 2-AMP in CNS cells. By reducing levels of 2',3'-cAMP (a mitochondrial toxin) and increasing levels of adenosine (a neuroprotectant), oligodendrocytes may protect axons from injury. PMID:23922219

  13. Studies related to primitive chemistry. A proton and nitrogen-14 nuclear magnetic resonance amino acid and nucleic acid constituents and a and their possible relation to prebiotic

    NASA Technical Reports Server (NTRS)

    Manatt, S. L.; Cohen, E. A.; Shiller, A. M.; Chan, S. I.

    1973-01-01

    Preliminary proton nuclear magnetic resonance (NMR) studies were made to determine the applicability of this technique for the study of interactions between monomeric and polymeric amino acids with monomeric nucleic acid bases and nucleotides. Proton NMR results for aqueous solutions (D2O) demonstrated interactions between the bases cytosine and adenine and acidic and aromatic amino acids. Solutions of 5'-AMP admixed with amino acids exhibited more complex behavior but stacking between aromatic rings and destacking at high amino acids concentration was evident. The multisite nature of 5'-AMP was pointed out. Chemical shift changes for adenine and 5'-AMP with three water soluble polypeptides demonstrated that significant interactions exist. It was found that the linewidth-pH profile of each amino acid is unique. It is concluded that NMR techniques can give significant and quantitative data on the association of amino acid and nucleic acid constituents.

  14. Role of AMP-activated protein kinase in metabolic depression in animals.

    PubMed

    Rider, Mark H

    2016-01-01

    AMP-activated protein kinase (AMPK) is a highly conserved eukaryotic protein serine/threonine kinase that controls cellular and whole body energy homoeostasis. AMPK is activated during energy stress by a rise in AMP:ATP ratio and maintains energy balance by phosphorylating targets to switch on catabolic ATP-generating pathways, while at the same time switching off anabolic ATP-consuming processes. Metabolic depression is a strategy used by many animals to survive environmental stress and has been extensively studied across phylogeny by comparative biochemists and physiologists, but the role of AMPK has only recently been addressed. This review first deals with the evolution of AMPK in eukaryotes (excluding plants and fungi) and its regulation. Changes in adenine nucleotides and AMPK activation are described in animals during environmental energy stress, before considering the involvement of AMPK in controlling β-oxidation, fatty acid synthesis, triacylglycerol mobilization and protein synthesis. Lastly, strategies are presented to validate the role of AMPK in mediating metabolic depression by phosphorylating downstream targets.

  15. Presence of free cyclic AMP receptor protein and regulation of its level by cyclic AMP in neuroblastoma-glioma hybrid cells.

    PubMed Central

    Walter, U; Costa, M R; Breakefield, X O; Greengard, P

    1979-01-01

    Neuroblastoma-glioma hybrid cells of line 108CC-5 were found to contain high levels of soluble adenosine 3',5'-cyclic monophosphate (cAMP)-dependent protein kinase activity and high levels of two specific cAMP receptor proteins, RI and RII. Treatment of the hybrid cells with dibutyryl cAMP increased the level of RI but did not significantly affect the level either of RII or of cAMP-dependent protein kinase activity. The effect of dibutyryl cAMP could be mimicked by prostaglandin E1 and 3-isobutyl-1-methylxanthine, both of which are known to raise cAMP levels in neuroblastoma-glioma hybrid cells. Both in control as well as in dibutyryl cAMP-treated cells, RII but not RI was associated with cAMP-dependent protein kinase. Several lines of evidence suggest that RI represents the free regulatory subunit of type I cAMP-dependent protein kinase. The presence of this regulatory subunit as free cAMP receptor protein in neuroblastoma-glioma hybrid cells may be of significance with respect to the regulation of growth and differentiation in tumor cells. Images PMID:226964

  16. Trehalase activity and cyclic AMP content during early development of Mucor rouxii spores.

    PubMed Central

    Dewerchin, M A; Van Laere, A J

    1984-01-01

    Incubation of Mucor rouxii sporangiospores in complex medium under aerobic conditions resulted in a transient 20-fold increase in trehalase activity. Maximum activity was reached after 15 min. Simultaneously, the cyclic AMP (cAMP) content increased approximately eightfold, reaching a maximum within 10 min. Increases in trehalase activity and cAMP content were also observed under anaerobic conditions (CO2). The extent of trehalase activation and the changes in cAMP content, during both aerobic and anaerobic incubation, varied with the medium used. Trehalase was activated in vitro by a cAMP- and ATP-dependent process. An even faster activation was obtained when cAMP was replaced by the catalytic subunit of beef heart protein kinase. The coincidence of, and the correlation between, increased cAMP contents and trehalase activities support the involvement of a cAMP-dependent phosphorylation in the in vivo regulation of trehalase activity. PMID:6327611

  17. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens.

  18. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  19. Emergence of a cefepime- and cefpirome-resistant Citrobacter freundii clinical isolate harbouring a novel chromosomally encoded AmpC beta-lactamase, CMY-37.

    PubMed

    Ahmed, Ashraf M; Shimamoto, Tadashi

    2008-09-01

    Citrobacter freundii strain 4306 was isolated from a urine specimen of a patient in March 2006 in Palestine. This strain showed a unique multidrug resistance phenotype, as it was resistant both to 7-alpha-methoxy- and oxyimino-cephalosporins, including cefepime, cefpirome and monobactams, in addition to quinolones, streptomycin and trimethoprim/sulfamethoxazole. Clavulanic acid did not act synergistically with cephalosporins by the double-disk synergy test. Molecular characterisation showed that the resistance to 7-alpha-methoxy- and oxyimino-cephalosporins was due to a novel AmpC beta-lactamase, designated CMY-37, with an isoelectric point of approximately 9.0. CMY-37 is a variant of C. freundii chromosomal AmpC enzymes with at least seven amino acid substitutions. One of these substitutions, L316I, is located within the R2 loop that is considered the hotspot region responsible for the extended substrate spectrum in class C beta-lactamases. The blaCMY-37 gene was cloned and expressed in Escherichia coli TG1. CMY-37 is chromosomally encoded and is not associated with ISEcp1-like element. Phylogenetic analysis suggested that CMY-37 is the origin of many plasmid-mediated AmpC beta-lactamases. This study highlights the emergence of cefepime and cefpirome resistance in C. freundii owing to a new type of AmpC beta-lactamase.

  20. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity.

  1. The plasma cyclic-AMP response to noise in humans and rats—short-term exposure to various noise levels

    NASA Astrophysics Data System (ADS)

    Iwamoto, M.; Dodo, H.; Ishii, F.; Yoneda, J.; Yamazaki, S.; Goto, H.

    1988-12-01

    Rats were exposed to short-term noise which was found to activate the hypothalamohypophyseal-adrenal system and result in a decrease of adrenal ascorbic acid (AAA) and an increase of serum corticosterone (SCS). The threshold limit value lay between 60 and 70 dB(A). To characterize better the effect of noise on the human hypothalamo-hypophyseal-adrenal system, a large group of subjects was exposed to short-term noise at 85 dB(A) and higher, and tested for levels of adrenocortical steroid (cortisol) and anterior pituitary hormones such as ACTH, growth hormone (GH) and prolactin (PRL). Results in humans showed hyperfunction of the hypothalamo-pituitary system. However, as the responses in rats and humans differed, a further experiment was performed using C-AMP, a second messenger mediating many of the effects of a variety of hormones. Plasma C-AMP in humans and rats increased significantly after exposure to noise greater than 70 dB(A). We suggest that plasma C-AMP could be useful as a sensitive index for noise-related stress in the daily living environment of humans and rats.

  2. The Crystal Structures of Apo and cAMP-Bound GlxR from Corynebacterium glutamicum Reveal Structural and Dynamic Changes upon cAMP Binding in CRP/FNR Family Transcription Factors

    PubMed Central

    Townsend, Philip D.; Jungwirth, Britta; Pojer, Florence; Bußmann, Michael; Money, Victoria A.; Cole, Stewart T.; Pühler, Alfred; Tauch, Andreas; Bott, Michael; Cann, Martin J.; Pohl, Ehmke

    2014-01-01

    The cyclic AMP-dependent transcriptional regulator GlxR from Corynebacterium glutamicum is a member of the super-family of CRP/FNR (cyclic AMP receptor protein/fumarate and nitrate reduction regulator) transcriptional regulators that play central roles in bacterial metabolic regulatory networks. In C. glutamicum, which is widely used for the industrial production of amino acids and serves as a non-pathogenic model organism for members of the Corynebacteriales including Mycobacterium tuberculosis, the GlxR homodimer controls the transcription of a large number of genes involved in carbon metabolism. GlxR therefore represents a key target for understanding the regulation and coordination of C. glutamicum metabolism. Here we investigate cylic AMP and DNA binding of GlxR from C. glutamicum and describe the crystal structures of apo GlxR determined at a resolution of 2.5 Å, and two crystal forms of holo GlxR at resolutions of 2.38 and 1.82 Å, respectively. The detailed structural analysis and comparison of GlxR with CRP reveals that the protein undergoes a distinctive conformational change upon cyclic AMP binding leading to a dimer structure more compatible to DNA-binding. As the two binding sites in the GlxR homodimer are structurally identical dynamic changes upon binding of the first ligand are responsible for the allosteric behavior. The results presented here show how dynamic and structural changes in GlxR lead to optimization of orientation and distance of its two DNA-binding helices for optimal DNA recognition. PMID:25469635

  3. Regulatory components in Citrobacter freundii ampC beta-lactamase induction.

    PubMed

    Lindberg, F; Westman, L; Normark, S

    1985-07-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase similar to the constitutively expressed ampC beta-lactamase of Escherichia coli. In the latter species the ampC gene is located next to the fumarate reductase (frd) operon, whereas in C. freundii the ampC gene is known to be separated from frd by 1100 base pairs. This intervening DNA segment carries a gene, ampR, coding for a 31-kilodalton polypeptide. The cloned C. freundii OS60 ampC gene is inducible by beta-lactam antibiotics in E. coli, but only in the presence of an intact ampR gene. In the absence of inducer the AmpR protein represses C. freundii ampC synthesis 2.5-fold. Addition of beta-lactams induced expression from the cloned ampC beta-lactamase gene 11-fold. Thus, the AmpR protein has a positive effect on ampC expression in the presence of inducing beta-lactams. Two spontaneous mutants of C. freundii were isolated that constitutively overproduce the ampC beta-lactamase. The mutations in both these strains occurred outside the frd-amp region, suggesting that there is at least one additional component in the regulatory system. With the cloned C. freundii ampC gene in E. coli, mutants with the same phenotype could be obtained. These mutations were located on the E. coli chromosome. The constitutive beta-lactamase overproduction in these mutants requires the presence of an intact ampR gene.

  4. Protein Kinase A-Dependent and -Independent Signaling Pathways Contribute to Cyclic AMP-Stimulated Proliferation

    PubMed Central

    Cass, Lisa A.; Summers, Scott A.; Prendergast, Gregory V.; Backer, Jonathan M.; Birnbaum, Morris J.; Meinkoth, Judy L.

    1999-01-01

    The effects of cyclic AMP (cAMP) on cell proliferation are cell type specific. Although the growth-inhibitory effects of cAMP have been well studied, much less is known regarding how cAMP stimulates proliferation. We report that cAMP stimulates proliferation through both protein kinase A (PKA)-dependent and PKA-independent signaling pathways and that phosphatidylinositol 3-kinase (PI3K) is required for cAMP-stimulated mitogenesis. In cells where cAMP is a mitogen, cAMP-elevating agents stimulate membrane ruffling, Akt phosphorylation, and p70 ribosomal S6 protein kinase (p70s6k) activity. cAMP effects on ruffle formation and Akt were PKA independent but sensitive to wortmannin. In contrast, cAMP-stimulated p70s6k activity was repressed by PKA inhibitors but not by wortmannin or microinjection of the N-terminal SH2 domain of the p85 regulatory subunit of PI3K, indicating that p70s6k and Akt can be regulated independently. Microinjection of highly specific inhibitors of PI3K or Rac1, or treatment with the p70s6k inhibitor rapamycin, impaired cAMP-stimulated DNA synthesis, demonstrating that PKA-dependent and -independent pathways contribute to cAMP-mediated mitogenesis. Direct elevation of PI3K activity through microinjection of an antibody that stimulates PI3K activity or stable expression of membrane-localized p110 was sufficient to confer hormone-independent DNA synthesis when accompanied by elevations in p70s6k activity. These findings indicate that multiple pathways contribute to cAMP-stimulated mitogenesis, only some of which are PKA dependent. Furthermore, they demonstrate that the ability of cAMP to stimulate both p70s6k- and PI3K-dependent pathways is an important facet of cAMP-regulated cell cycle progression. PMID:10454535

  5. Membrane physical properties do not explain increased cyclic AMP production in hepatocytes from rats fed menhaden oil.

    PubMed

    Bizeau, M E; Hazel, J R

    2000-06-01

    To study the effect of altering plasma membrane fatty acid composition on the glucagon signal transduction pathway, cAMP accumulation was measured in hepatocytes from rats fed diets containing either menhaden oil (MO) or coconut oil (CO). Hepatocytes from MO-fed animals produced significantly more cAMP in response to glucagon and forskolin compared to CO-fed animals. Glucagon receptor number and affinity were similar in MO- and CO-fed rats. Liver plasma membranes from MO-fed animals were enriched in long-chain n-3 fatty acids and contained significantly lower amounts of saturated C10-C16 and 18:1n-9 than CO-fed animals. Membrane physical properties were examined using both Fourier transform infrared spectroscopy (FTIR) and the fluorescent probe 1,6-diphenyl-1,3,5-hexatriene (DPH). FTIR analysis revealed that below 34 degrees C, CO membranes were more ordered than MO membranes. However, as assay temperature approached 37 degrees C, MO and CO membranes became similarly ordered. DPH polarization values indicated no differences in membrane order at 37 degrees C, whereas membrane order was decreased in CO-fed animals at 25 degrees C. These data indicate the importance of assay temperature in assessing the influence of membrane physical properties on the activity of signal transduction pathways. Whereas increased signal transduction activity has been correlated to reduced membrane order in MO-fed animals, these data indicate that at physiological temperatures membrane order did not vary between groups. Enhanced cAMP accumulation in response to forskolin indicates that adenylate cyclase activity or content may be elevated in MO- vs. CO-fed rats. Enhanced adenylate cyclase activity may result, in part, from changes in specific fatty acids in hepatocyte plasma membranes without demonstrable changes in membrane physical properties.

  6. Epidermal chalone and cyclic AMP: an in vivo study.

    PubMed

    Elgjo, K

    1975-01-01

    Water extracts of skin contain two factors that inhibit epidermal cell proliferation: one substance inhibits epidermal cells in the G2 phase (the epidermal G2 inhibitor), and another inhibits the transit of cells from the G1 phase into the S phase (the epidermal G1 inhibitor). Pretreatment of mice with a beta-receptor antagonist (propranolol) abolished the activity of the G2 inhibitor but not that of the G1 inhibitor. After pretreatment with both propranolol and a phosphodiesterase inhibitor (caffine)the G2 inhibitor had full effect. Cafine alone had a moderately inhibitory effect on epidermal G2 cells and enhanced the depressing effect of the G1 inhibitor on epidermal DNA synthesis. AMP level in epidermis to be active. Cyclic AMP is probably also involved in the regulation of the rate of transit of epidermal G1 cells into the S phase but the epidermal cyclic AMP level seems not to be so critical for the efficacy of the epidermal G2 inhibitor in epidermal cell differentiation. PMID:162919

  7. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  8. Cyclic AMP and its functional relationship in Tetrahymena: a comparison between phagocytosis and glucose uptake.

    PubMed

    Csaba, G; Nagy, S U; Lantos, T

    1978-01-01

    In Tetrahymena, an increase in the level of cAMP is accompanied by an increased phagocytotic rate, whereas increased sugar uptake is parallelled by a decreased cAMP level. The increase in cAMP level seems to be decisive with respect to phagocytosis as a basic phenomenon of life. In the action of epinephrine, however, some mechanism other than cAMP mediation may be involved. Depending on concentration, one hormone may provoke either an increase or a decrease in cAMP level, and this in turn triggers the corresponding function.

  9. cAMP-dependent chloride secretion mediates tubule enlargement and cyst formation by cultured mammalian collecting duct cells.

    PubMed

    Montesano, Roberto; Ghzili, Hafida; Carrozzino, Fabio; Rossier, Bernard C; Féraille, Eric

    2009-02-01

    Polycystic kidney diseases result from disruption of the genetically defined program that controls the size and geometry of renal tubules. Cysts which frequently arise from the collecting duct (CD) result from cell proliferation and fluid secretion. From mCCD(cl1) cells, a differentiated mouse CD cell line, we isolated a clonal subpopulation (mCCD-N21) that retains morphogenetic capacity. When grown in three-dimensional gels, mCCD-N21 cells formed highly organized tubular structures consisting of a palisade of polarized epithelial cells surrounding a cylindrical lumen. Subsequent addition of cAMP-elevating agents (forskolin or cholera toxin) or of membrane-permeable cAMP analogs (CPT-cAMP) resulted in rapid and progressive dilatation of existing tubules, leading to the formation of cystlike structures. When grown on filters, mCCD-N21 cells exhibited a high transepithelial resistance as well as aldosterone- and/or vasopressin-induced amiloride-sensitive and -insensitive current. The latter was in part inhibited by Na(+)-K(+)-2Cl(-) cotransporter (bumetanide) and chloride channel (NPPB) inhibitors. Real-time PCR analysis confirmed the expression of NKCC1, the ubiquitous Na(+)-K(+)-2Cl(-) cotransporter and cystic fibrosis transmembrane regulator (CFTR) in mCCD-N21 cells. Tubule enlargement and cyst formation were prevented by inhibitors of Na(+)-K(+)-2Cl(-) cotransporters (bumetanide or ethacrynic acid) or CFTR (NPPB or CFTR inhibitor-172). These results further support the notion that cAMP signaling plays a key role in renal cyst formation, at least in part by promoting chloride-driven fluid secretion. This new in vitro model of tubule-to-cyst conversion affords a unique opportunity for investigating the molecular mechanisms that govern the architecture of epithelial tubes, as well as for dissecting the pathophysiological processes underlying cystic kidney diseases.

  10. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  11. Orthologous and Paralogous AmpD Peptidoglycan Amidases from Gram-Negative Bacteria

    PubMed Central

    Rivera, Ivanna; Molina, Rafael; Lee, Mijoon; Mobashery, Shahriar

    2016-01-01

    Cell wall recycling and β-lactam antibiotic resistance are linked in Enterobacteriaceae and in Pseudomonas aeruginosa. This process involves a large number of murolytic enzymes, among them a cytoplasmic peptidoglycan amidase AmpD, which plays an essential role by cleaving the peptide stem from key intermediates en route to the β-lactamase production (a resistance mechanism) and cell wall recycling. Uniquely, P. aeruginosa has two additional paralogues of AmpD, designated AmpDh2 and AmpDh3, which are periplasmic enzymes. Despite the fact that AmpDh2 and AmpDh3 share a common motif for their respective catalytic domains, they are each comprised of multidomain architectures and exhibit distinct oligomerization properties. We review herein the structural and biochemical properties of orthologous and paralogous AmpD proteins and discuss their implication in cell wall recycling and antibiotic resistance processes. PMID:27326855

  12. A Fluorescent Transport Assay Enables Studying AmpG Permeases Involved in Peptidoglycan Recycling and Antibiotic Resistance.

    PubMed

    Perley-Robertson, G Evan; Yadav, Anuj K; Winogrodzki, Judith L; Stubbs, Keith A; Mark, Brian L; Vocadlo, David J

    2016-09-16

    Inducible AmpC β-lactamases deactivate a broad-spectrum of β-lactam antibiotics and afford antibiotic resistance in many Gram-negative bacteria. The disturbance of peptidoglycan recycling caused by β-lactam antibiotics leads to accumulation of GlcNAc-1,6-anhydroMurNAc-peptides, which are transported by AmpG to the cytoplasm where they are processed into AmpC inducers. AmpG transporters are poorly understood; however, their loss restores susceptibility toward β-lactam antibiotics, highlighting AmpG as a potential target for resistance-attenuating therapeutics. We prepare a GlcNAc-1,6-anhydroMurNAc-fluorophore conjugate and, using live E. coli spheroplasts, quantitatively analyze its transport by AmpG and inhibition of this process by a competing substrate. Further, we use this transport assay to evaluate the function of two AmpG homologues from Pseudomonas aeruginosa and show that P. aeruginosa AmpG (Pa-AmpG) but not AmpP (Pa-AmpP) transports this probe substrate. We corroborate these results by AmpC induction assays with Pa-AmpG and Pa-AmpP. This fluorescent AmpG probe and spheroplast-based transport assay will enable improved understanding of PG recycling and of permeases from the major facilitator superfamily of transport proteins and may aid in identification of AmpG antagonists that combat AmpC-mediated resistance toward β-lactam antibiotics.

  13. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  14. An Investigation of the Adsorption Characteristics of 5'ATP and 5'AMP onto the Surface of Caso4 x 2H2O

    NASA Technical Reports Server (NTRS)

    Calderon, J.; Sweeney, M. A.

    1984-01-01

    A model has been proposed in which solid surfaces can act as a site for cataletic activity of condensation reactions for certain biomolecules. From this model, the adsorption characteristics of 5'ATP and 5'AMP onto the surface of CaSO4.2H2O was chosen for study. It has been proven that 5'ATP and 5'AMP do adsorb onto the surface of CaSO4. Studies were then made to determine the dependence of absorption versus time, concentration, ionic strength and pH. It was found that the adsorption of the nucleotides is highly pH dependent, primarily determined by the phosphate acid groups of the nucleic acid molecule. From this investigation, the data obtained is discussed in relation to the model for the prebiotic earth.

  15. Dysregulation of hepatic cAMP levels via altered Pde4b expression plays a critical role in alcohol-induced steatosis.

    PubMed

    Avila, Diana V; Barker, David F; Zhang, JingWen; McClain, Craig J; Barve, Shirish; Gobejishvili, Leila

    2016-09-01

    Alcohol-induced hepatic steatosis is a significant risk factor for progressive liver disease. Cyclic adenosine monophosphate (cAMP) signalling has been shown to significantly regulate lipid metabolism; however, the role of altered cAMP homeostasis in alcohol-mediated hepatic steatosis has never been studied. Our previous work demonstrated that increased expression of hepatic phosphodiesterase 4 (Pde4), which specifically hydrolyses and decreases cAMP levels, plays a pathogenic role in the development of liver inflammation/injury. The aim of this study was to examine the role of PDE4 in alcohol-induced hepatic steatosis. C57BL/6 wild-type and Pde4b knockout (Pde4b(-/-) ) mice were pair-fed control or ethanol liquid diets. One group of wild-type mice received rolipram, a PDE4-specific inhibitor, during alcohol feeding. We demonstrate for the first time that an early increase in PDE4 enzyme expression and a resultant decrease in hepatic cAMP levels are associated with the significant reduction in carnitine palmitoyltransferase 1A (Cpt1a) expression. Notably, alcohol-fed (AF) Pde4b(-/-) mice and AF wild-type mice treated with rolipram had significantly lower hepatic free fatty acid content compared with AF wild-type mice. Importantly, PDE4 inhibition in alcohol-fed mice prevented the decrease in hepatic Cpt1a expression via the Pparα/Sirt1/Pgc1α pathway. These results demonstrate that the alcohol- induced increase in hepatic Pde4, specifically Pde4b expression, and compromised cAMP signalling predispose the liver to impaired fatty acid oxidation and the development of steatosis. Moreover, these data also suggest that hepatic PDE4 may be a clinically relevant therapeutic target for the treatment of alcohol-induced hepatic steatosis. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:27287961

  16. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  17. Rapid, efficient charging of lead-acid and nickel-zinc traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1978-01-01

    Lead-acid and nickel-zinc traction cells were rapidly and efficiently charged using a high rate tapered direct current (HRTDC) charge method which could possibly be used for on-the-road service recharge of electric vehicles. The HRTDC method takes advantage of initial high cell charge acceptance and uses cell gassing rate and temperature as an indicator of charging efficiency. On the average, in these preliminary tests, 300 amp-hour nickel-zinc traction cells were given a HRTDC (initial current 500 amps, final current 100 amps) to 78 percent of rated amp-hour capacity within 53 minutes at an amp-hour efficiency of 92 percent and an energy efficiency of 52 percent. Three hundred amp-hour lead-acid traction cells were charged to 69 percent of rated amp-hour capacity within 46 minutes at an amp-hour efficiency of 91 percent with an energy efficiency of 64 percent. In order to find ways to further decrease the recharge times, the effect of periodically (0 to 400 Hz) pulse discharging cells during a constant current charging process (94% duty cycle) was investigated. Preliminary data indicate no significant effect of this type of pulse discharging during charge on charge acceptance of lead-acid or nickel-zinc cells.

  18. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  19. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  20. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  1. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  2. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  3. Involvement of calyculin A inhibitable protein phosphatases in the cyclic AMP signal transduction pathway of mouse corticotroph tumour (AtT20) cells

    PubMed Central

    Antaraki, A; Ang, K L; Antoni, F A

    1997-01-01

    The role of non-calcineurin protein phosphatases in the cyclic AMP signal transduction pathway was examined in mouse pituitary corticotroph tumour (AtT20) cells. Blockers of protein phosphatases, calyculin A and okadaic acid, were applied in AtT20 cells depleted of rapidly mobilizable pools of intracellular calcium and activated by various cyclic AMP generating agonists. Inhibitors of cyclic nucleotide phosphodiesterases were present throughout. The accumulation of cyclic AMP was monitored by radioimmunoassay, phosphodiesterase activity in cell homogenates was measured by radiometric assay. Neither calyculin A nor okadaic acid altered basal cyclic AMP levels but cyclic AMP formation induced by 41 amino acid residue corticotrophin releasing-factor (CRF) was strongly inhibited (up to 80%). 1-Norokadaone was inactive. Similar data were also obtained when isoprenaline or pituitary adenylate cyclase activating peptide1–38 were used as agonists. Pertussis toxin did not modify the inhibition of CRF-induced cyclic AMP production by calyculin A. Pretreatment with calyculin A completely prevented the stimulation of cyclic AMP formation by cholera toxin even in the presence of 0.5 mM isobutylmethylxanthine (IBMX) and 0.1 mM rolipram. Cholera toxin mediated ADP-ribosylation of the 45K and 52K molecular weight Gsα isoforms in membranes from calyculin A-pretreated cells was enhanced to 150–200% when compared with controls. Cholera toxin-induced cyclic AMP was reduced by calyculin A within 10 min when calyculin A was applied after a 90 min pretreatment with cholera toxin. Under these conditions the effect of calyculin A could be blocked by the combination of 0.5 mM IBMX and 0.1 mM rolipram, but not by 0.5 mM IBMX alone. Phosphodiesterase activity in AtT20 cell homogenates showed a significant, 2.7 fold increase after treatment with calyculin A. In control cells phosphodiesterase activity was blocked by 80% in the presence of IBMX (0.5 mM), or IBMX plus

  4. Intracellular pH in frog skin: Effects of Na sup + , volume, and cAMP

    SciTech Connect

    Civan, M.M.; Cragoe, E.J. Jr.; Peterson-Yantorno, K. Merck Sharp Dohme Research Laboratories, West Point, PA )

    1988-07-01

    Single skins were analyzed by {sup 31}P-nuclear magnetic resonance (NMR) spectroscopy during alternative perfusion with control and experimental solutions. Intracellular (pH{sub c}) and extracellular (pH{sub o}) pH were monitored by measuring the spectral frequencies of intracellular P{sub i} and external methylphosphonate, respectively. Base-line pH{sub c} was 7.20 {plus minus} 0.02 (SE) when pH{sub o} was 6.99 {plus minus} 0.02. A 4-acetamido-4{prime}-isothiocyanostilbene-2,2{prime}-disulfonic acid (SITS)-inhibitable, HCO{sup {minus}}{sub 3}-dependent alkaline shift in pH{sub c} can be elicited by replacing external Cl{sup {minus}} by gluconate or sulfate. The authors now report that this effect is observed even in sodium-free media. The substitution of gluconate for external Cl{sup {minus}} has also been reported to shrink cell volume. This shrinkage can be minimized by replacing Cl{sup {minus}} with gluconate during perfusion with hypotonic, rather than isotonic, media. Conducted in this manner, the anionic substitution produced a much smaller alkaline shift in pH{sub c}. In the presence of the Na-H antiport blocker 5-(N-methyl-N-isobutyl)amiloride (MIA), restoration of external Na{sup +} did not increase pH{sub c}. Adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) also alters pH{sub c}. The data suggest that frog skin regulates pH{sub c} by the parallel operation of Na-H and Na{sup +}-independent Cl-HCO{sub 3} antiports. Cell volume and cAMP may play regulating roles in this epithelium.

  5. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    PubMed

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. PMID:26984404

  6. Effects of cold exposure on cyclic AMP concentration in plasma, liver, and brown and white adipose tissues in cold-acclimated rats

    NASA Astrophysics Data System (ADS)

    Habara, Yoshiaki

    1989-06-01

    Effects of acute cold exposure on plasma energy substrates and tissue 3',5'-adenosine monophosphate (cAMP) were analyzed in intact rats, to define an involvement of the nucleotide in nonshivering thermogenesis (NST) and resultant cold acclimation. After an acute cold exposure to -5°C, the plasma glucose level increased gradually in warm-kept control rats (C) while it decreased significantly in cold-acclimated rats (CA). However, it was increased considerably by an extreme cold exposure to -15°C in both C and CA. By contrast, plasma levels of free fatty acids (FFA) increased immediately after cold exposure and the release lasted during the period of exposure especially in C. The cold exposure also increased plasma cAMP concentration but no concomitant increase was found in the liver. In both brown (IBAT) and white (WAT) adipose tissues the nucleotide concentration showed a stepwise decrease. The observed correlation between lipolysis and plasma cAMP response after cold exposure suggests an involvement of the adenylate cyclase-cAMP system in NST via lipid metabolism, at least, in the early stages of cold acclimation.

  7. Novel reciprocal regulation of cAMP signaling and apoptosis by orphan G-protein-coupled receptor GPRC5A gene expression

    SciTech Connect

    Hirano, Minoru; Zang, Liqing; Oka, Takehiko; Ito, Yoshiyuki; Shimada, Yasuhito; Nishimura, Yuhei; Tanaka, Toshio . E-mail: tanaka@doc.medic.mie-u.ac.jp

    2006-12-08

    GPRC5A is a member of G-protein-coupled receptors, which was originally identified as an all-trans-retinoic acid-induced gene. Although recent studies reported that this gene was highly expressed in the cancer cell lines and that GPRC5A might positively regulate cell proliferation, its mechanism remains unknown. We investigated the upstream and downstream signaling of GPRC5A and its biological function, and found that cAMP signaling is the novel GPRC5A induction pathway. When GPRC5A gene was overexpressed, intracellular cAMP concentration was decreased, and Gs{alpha} gene expression was downregulated. On the other hand, RNA interference of GPRC5A increased mRNA levels of Gs{alpha} and intracellular cAMP, reduced cell number, and induced apoptosis. Conversely, cell number was increased by GPRC5A overexpression. We first report the novel negative feedback model of cAMP signaling through GPRC5A gene expression. This evidence explains one of the mechanisms of the GPRC5A-regulated cell growth in some cancer cell lines.

  8. Op. amps in power amplification: a laboratory exercise on feedback

    NASA Astrophysics Data System (ADS)

    Borcherds, P. H.

    1984-05-01

    Rapid and continuing developments in electronics make it necessary to revise constantly the teaching of electronics and to replace obsolescent laboratory exercises. The author describes a new exercise which believes helps students' (and lecturers') understanding of negative feedback. A power amplifier is constructed from an operational amplifier (op. amp.) together with a complementary pair of transistors as an output stage. To make the exercise more realistic a low impedance (8 Omega ) loudspeaker is used as the load. The amplifier is developed and tested stage by stage, and at each stage the defects apparent at the previous stage are eliminated.

  9. Fecal carriage of extended-spectrum β-lactamases and AmpC-producing Escherichia coli in a Libyan community

    PubMed Central

    2014-01-01

    Background Extended-spectrum β-lactamases (ESBLs), including the AmpC type, are important mechanisms of resistance among Enterobacteriaeceae. CTX-M type extended-spectrum β- lactamases, of which there are now over 90 variants, are distributed globally, yet appear to vary in regional distribution. AmpC β-lactamases hydrolyze third generation cephalosporins, but are resistant to inhibition by clavulanate or other β-lactamase inhibitors in vitro. Fecal carriage and rates of colonization by bacteria harboring these resistance mechanisms have been reported in patients with community-acquired infections and in healthy members of their households. Expression of these ESBLs compromises the efficacy of current antibacterial therapies, potentially increasing the seriousness of hospital- and community-acquired Escherichia coli (E. coli) infections. To investigate the occurrence of ESBL-producing E. coli in human fecal flora isolated from two pediatric populations residing in the Libyan cities Zleiten and Abou El Khoms. Isolates were further studied to characterize genes encoding β-lactam resistance, and establish genetic relationships. Methods Antibiotic resistance profiles of phenotypically characterized E. coli isolates recovered from the stools of 243 Libyan children during two surveillance periods in 2001 and 2007 were determined by the disk diffusion method. ESBL-screening was performed using the cephalosporin/clavulanate double synergy disc method, and the AmpC-phenotype was confirmed by the aminophenyl-boronic acid test. ESBL genes were molecularly characterized. Phylogenetic group and multilocus sequence typing (MLST) were determined for ESBL-producing isolates and PFGE was performed to compare banding profiles of some dominant strains. Results ESBLs were identified in 13.4% (18/134) of E. coli isolates, and nine isolates (6.7%) demonstrated AmpC activity; all 18 isolates contained a CTX-M gene. Three CTX-M gene families (CTX-M-1, n = 9; CTX-M-15, n = 8

  10. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  11. AMP-activated protein kinase alpha2 deficiency affects cardiac cardiolipin homeostasis and mitochondrial function

    PubMed Central

    Athéa, Yoni; Viollet, Benoît; Mateo, Philippe; Rousseau, Delphine; Novotova, Marta; Garnier, Anne; Vaulont, Sophie; Wilding, James R.; Grynberg, Alain; Veksler, Vladimir; Hoerter, Jacqueline; Ventura-Clapier, Renée

    2007-01-01

    AMP-activated protein kinase (AMPK) plays an important role in controlling energy homeostasis and is envisioned as a promising target to treat metabolic disorders. In the heart, AMPK is involved in short-term regulation and in transcriptional control of proteins involved in energy metabolism. Here, we investigated whether deletion of AMPKα2, the main cardiac catalytic isoform, alters mitochondrial function and biogenesis. Body weight, heart weight and AMPKα1 expression were similar in control littermate and AMPKa2−/− mice. Despite normal oxygen consumption in perfused hearts, maximal oxidative capacity, measured using saponin permeabilized cardiac fibers, was ≈30 % lower in AMPKa2−/− mice with octanoate, pyruvate or glutamate+malate but not with succinate as substrates, showing an impairment at complex-I of the respiratory chain. This effect was associated with a 25% decrease in mitochondrial cardiolipin content, the main mitochondrial membrane phospholipid that is crucial for complex-I activity, and by a 13% decrease in mitochondrial content of linoleic acid, the main fatty acid of cardiolipins. The decrease in cardiolipin content could be explained by mRNA down-regulation of rate limiting enzymes of both cardiolipin synthesis (CDS2) and remodeling (ALCAT1). These data reveal a new role for AMPKα2 subunit in the regulation of cardiac muscle oxidative capacity via cardiolipin homeostasis. PMID:17327449

  12. Properties of Starch-Poly(acrylamide-co-2-acrylamido-2-methylpropanesulfonic acid) Graft Copolymers Prepared by Reactive Extrusion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of starch with acrylamide and 2-acrylamido-2-methylpropanesulfonic acid (AMPS) were prepared by reactive extrusion in a twin-screw extruder. The weight ratio of total monomer to starch was fixed at 1:3, while the molar fraction of AMPS in the monomer feed ranged from 0 to 0.119. Mon...

  13. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases.

  14. Cyclic AMP Can Decrease Expression of Genes Subject to Catabolite Repression in Saccharomyces cerevisiae

    PubMed Central

    Zaragoza, Oscar; Lindley, Chris; Gancedo, Juana M.

    1999-01-01

    External cyclic AMP (cAMP) hindered the derepression of gluconeogenic enzymes in a pde2 mutant of Saccharomyces cerevisiae, but it did not prevent invertase derepression. cAMP reduced nearly 20-fold the transcription driven by upstream activation sequence (UAS1FBP1) from FBP1, encoding fructose-1,6-bisphosphatase; it decreased 2-fold the activation of transcription by UAS2FBP1. Nuclear extracts from cells derepressed in the presence of cAMP were impaired in the formation of specific UASFBP1-protein complexes in band shift experiments. cAMP does not appear to act through the repressing protein Mig1. Control of FBP1 transcription through cAMP is redundant with other regulatory mechanisms. PMID:10198033

  15. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  16. Expression of Dm-AMP1 in rice confers resistance to Magnaporthe oryzae and Rhizoctonia solani.

    PubMed

    Jha, Sanjay; Tank, Harsukh G; Prasad, Bishun Deo; Chattoo, Bharat B

    2009-02-01

    Magnaporthe oryzae and Rhizoctonia solani, are among the most important pathogens of rice, severely limiting its productivity. Dm-AMP1, an antifungal plant defensin from Dahlia merckii, was expressed in rice (Oryza sativa L. sp. indica cv. Pusa basmati 1) using Agrobacterium tumefaciens-mediated transformation. Expression levels of Dm-AMP1 ranged from 0.43% to 0.57% of total soluble protein in transgenic plants. It was observed that constitutive expression of Dm-AMP1 suppresses the growth of M. oryzae and R. solani by 84% and 72%, respectively. Transgenic expression of Dm-AMP1 was not accompanied by an induction of pathogenesis-related (PR) gene expression, indicating that the expression of DmAMP1 directly inhibits the pathogen. The results of in vitro, in planta and microscopic analyses suggest that Dm-AMP1 expression has the potential to provide broad-spectrum disease resistance in rice. PMID:18618285

  17. Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy.

    PubMed

    Yang, Haihua; Yang, Linghai

    2016-08-01

    In mammals, cyclic adenosine monophosphate (cAMP) is an intracellular second messenger that is usually elicited by binding of hormones and neurotransmitters to G protein-coupled receptors (GPCRs). cAMP exerts many of its physiological effects by activating cAMP-dependent protein kinase (PKA), which in turn phosphorylates and regulates the functions of downstream protein targets including ion channels, enzymes, and transcription factors. cAMP/PKA signaling pathway regulates glucose homeostasis at multiple levels including insulin and glucagon secretion, glucose uptake, glycogen synthesis and breakdown, gluconeogenesis, and neural control of glucose homeostasis. This review summarizes recent genetic and pharmacological studies concerning the regulation of glucose homeostasis by cAMP/PKA in pancreas, liver, skeletal muscle, adipose tissues, and brain. We also discuss the strategies for targeting cAMP/PKA pathway for research and potential therapeutic treatment of type 2 diabetes mellitus (T2D). PMID:27194812

  18. Rewiring global regulator cAMP receptor protein (CRP) to improve E. coli tolerance towards low pH.

    PubMed

    Basak, Souvik; Geng, Hefang; Jiang, Rongrong

    2014-03-10

    Bioprocesses such as production of organic acids or acid hydrolysis of bioresources during biofuel production often suffer limitations due to microbial sensitivity under acidic conditions. Approaches for improving the acid tolerance of these microbes have mainly focused on using metabolic engineering tools. Here, we tried to improve strain acidic tolerance from its transcription level, i.e. we adopted error-prone PCR method to engineer global regulator cAMP receptor protein (CRP) of Escherichia coli to improve its performance at low pH. The best mutant AcM1 was identified from random mutagenesis libraries based on its growth performance. AcM1 almost doubled (0.113h(-1)) the growth rate of the control (0.062h(-1)) at pH 4.24. It also demonstrated better thermotolerance than the control at 48°C, whose growth was completely inhibited at this temperature. Quantitative real time reverse transcription PCR results revealed a stress response overlap among low pH stress-, oxidative stress- and osmotic stress-related genes. The chief enzyme responsible for cell acid tolerance, glutamate decarboxylase, demonstrated over twofold activity in AcM1 compared to the control. Differential binding properties of AcM1 mutant CRP with Class-I, II, and III CRP-dependent promoters suggested that modifications to native CRP may lead to transcription profile changes. Hence, we believe that transcriptional engineering of global regulator CRP can provide a new strain engineering alternative for E. coli.

  19. Reanalyzing the Ampère-Maxwell Law

    NASA Astrophysics Data System (ADS)

    Hill, S. Eric

    2011-09-01

    In a recent TPT article, I addressed a common miscommunication about Faraday's law, namely, that introductory texts often say the law expresses a causal relationship between the magnetic fields time variation and the electric fields circulation. In that article, I demonstrated that these field behaviors share a common cause in a time-varying current density. From that, many readers may have rightly guessed at a symmetric conclusion: while the Ampère-Maxwell law is commonly said to express a causal relation between the electric fields time variation and the magnetic fields circulation, these field behaviors share a distinct, common cause. Together, Faraday's law and the Ampère-Maxwell law constitute half of Maxwell's laws that form a foundation for almost all of electricity and magnetism. By misrepresenting these two laws, introductory texts not only present students with unnecessary conceptual hurdles early in their physics educations but also leave them with enduring misunderstandings about the very foundation of electricity and magnetism. Fortunately, compared to what is commonly taught, the actual cause of these field variations is conceptually simpler and more consistent with what the students will have already learned in the introductory texts' own earlier chapters.

  20. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    PubMed Central

    Škrnjug, Ivana

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity – a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines. PMID:25295996

  1. Regulation of cAMP-dependent Protein Kinases

    PubMed Central

    Diskar, Mandy; Zenn, Hans-Michael; Kaupisch, Alexandra; Kaufholz, Melanie; Brockmeyer, Stefanie; Sohmen, Daniel; Berrera, Marco; Zaccolo, Manuela; Boshart, Michael; Herberg, Friedrich W.; Prinz, Anke

    2010-01-01

    cAMP-dependent protein kinases are reversibly complexed with any of the four isoforms of regulatory (R) subunits, which contain either a substrate or a pseudosubstrate autoinhibitory domain. The human protein kinase X (PrKX) is an exemption as it is inhibited only by pseudosubstrate inhibitors, i.e. RIα or RIβ but not by substrate inhibitors RIIα or RIIβ. Detailed examination of the capacity of five PrKX-like kinases ranging from human to protozoa (Trypanosoma brucei) to form holoenzymes with human R subunits in living cells shows that this preference for pseudosubstrate inhibitors is evolutionarily conserved. To elucidate the molecular basis of this inhibitory pattern, we applied bioluminescence resonance energy transfer and surface plasmon resonance in combination with site-directed mutagenesis. We observed that the conserved αH-αI loop residue Arg-283 in PrKX is crucial for its RI over RII preference, as a R283L mutant was able to form a holoenzyme complex with wild type RII subunits. Changing the corresponding αH-αI loop residue in PKA Cα (L277R), significantly destabilized holoenzyme complexes in vitro, as cAMP-mediated holoenzyme activation was facilitated by a factor of 2–4, and lead to a decreased affinity of the mutant C subunit for R subunits, significantly affecting RII containing holoenzymes. PMID:20819953

  2. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  3. Nucleotide sequences of fic and fic-1 genes involved in cell filamentation induced by cyclic AMP in Escherichia coli.

    PubMed Central

    Kawamukai, M; Matsuda, H; Fujii, W; Utsumi, R; Komano, T

    1989-01-01

    The nucleotide sequences of fic-1 involved in the cell filamentation induced by cyclic AMP in Escherichia coli and its normal counterpart fic were analyzed. The open reading frame of both fic-1 and fic coded for 200 amino acids. The Gly at position 55 in the Fic protein was changed to Arg in the Fic-1 protein. The promoter activity of fic was confirmed by fusing fic and lacZ. The gene downstream from fic was found to be pabA (p-aminobenzoate). There is an open reading frame (ORF190) coding for 190 amino acids upstream from the fic gene. Computer-assisted analysis showed that Fic has sequence similarity with part of CDC28 of Saccharomyces cerevisiae, CDC2 of Schizosaccharomyces pombe, and FtsA of E. coli. In addition, ORF190 has sequence similarity with the cyclosporin A-binding protein cyclophilin. PMID:2546924

  4. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  5. Impact of AmpC Derepression on Fitness and Virulence: the Mechanism or the Pathway?

    PubMed Central

    Pérez-Gallego, Marcelo; Torrens, Gabriel; Castillo-Vera, Jane; Moya, Bartolomé; Zamorano, Laura; Hultenby, Kjell; Albertí, Sebastián; Mellroth, Peter; Henriques-Normark, Birgitta; Normark, Staffan

    2016-01-01

    ABSTRACT Understanding the interplay between antibiotic resistance and bacterial fitness and virulence is essential to guide individual treatments and improve global antibiotic policies. A paradigmatic example of a resistance mechanism is the intrinsic inducible chromosomal β-lactamase AmpC from multiple Gram-negative bacteria, including Pseudomonas aeruginosa, a major nosocomial pathogen. The regulation of ampC expression is intimately linked to peptidoglycan recycling, and AmpC-mediated β-lactam resistance is frequently mediated by inactivating mutations in ampD, encoding an N-acetyl-anhydromuramyl-l-alanine amidase, affecting the levels of ampC-activating muropeptides. Here we dissect the impact of the multiple pathways causing AmpC hyperproduction on P. aeruginosa fitness and virulence. Through a detailed analysis, we demonstrate that the lack of all three P. aeruginosa AmpD amidases causes a dramatic effect in fitness and pathogenicity, severely compromising growth rates, motility, and cytotoxicity; the latter effect is likely achieved by repressing key virulence factors, such as protease LasA, phospholipase C, or type III secretion system components. We also show that ampC overexpression is required but not sufficient to confer the growth-motility-cytotoxicity impaired phenotype and that alternative pathways leading to similar levels of ampC hyperexpression and resistance, such as those involving PBP4, had no fitness-virulence cost. Further analysis indicated that fitness-virulence impairment is caused by overexpressing ampC in the absence of cell wall recycling, as reproduced by expressing ampC from a plasmid in an AmpG (muropeptide permease)-deficient background. Thus, our findings represent a major step in the understanding of β-lactam resistance biology and its interplay with fitness and pathogenesis. PMID:27795406

  6. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  7. Cyclic AMP pathway modifies memory through neural cell adhesion molecule alterations in the rat hippocampus.

    PubMed

    Razmi, Ali; Sahebgharani, Mousa; Khani, Mohammad Hossein; Paylakhi, Seyed Hassan; Faizi, Mehrdad; Zarrindast, Mohammad-Reza

    2014-01-01

    Neural Cell Adhesion Molecules (NCAMs) are known to influence memory by affecting neural cell-cell and cell-extracellular matrix junctions. This study investigated the possible role of cAMP pathway in the expression of hippocampal NCAM and its polysialylated derivative (PSA-NCAM). The following pharmacological tools were employed for manipulation of cAMP pathway: a) forskolin; the activator of adenylyl cyclase (AC), b) 8-Br-cAMP; a protein kinase A (PKA) agonist, c) 8-pCPT-2'-O-Me-cAMP; a selective enhancer of exchange protein activated by cAMP (Epac) and d) Rp-cAMP; a PKA inhibitor. Memory acquisition was tested by passive avoidance paradigm after injecting the above compounds for three consecutive days into the CA1 region of dorsal hippocampus of rats. Forskolin and 8-Br-cAMP enhanced memory retrieval while Rp-cAMP significantly reduced memory and NCAM levels. 8-pCPT-2'-O-Me-cAMP failed to alter memory performance or NCAM levels as compared to vehicle. We observed no significant changes in PSA-NCAM, however the expression of St8sia4 and St8sia2 (the polysialyltransferase isoforms) were altered. The mRNA levels of St8sia4 was down-regulated by 8-Br-cAMP, Rp-cAMP and 8-pCPT while forskolin led to almost 3 and 5 fold increase in mRNAs of St8sia2 and St8sia4, respectively. The current insight might endorse the predominant role of PKA as compared to Epac in cAMP pathway in expression of NCAM and memory function. PMID:24901853

  8. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  9. Butyrate activates the cAMP-protein kinase A-cAMP response element-binding protein signaling pathway in Caco-2 cells.

    PubMed

    Wang, Aihua; Si, Hongwei; Liu, Dongmin; Jiang, Honglin

    2012-01-01

    Butyrate is a major SCFA produced by microbial fermentation of dietary fiber in the gastrointestinal tract. Butyrate is widely thought to mediate the benefits of fiber and resistant starch consumption to colon health in humans. Besides serving as a substrate for energy production, butyrate has many regulatory effects in animals. Little is known about the signaling mechanisms underlying the regulatory effects of butyrate and other SCFA. In this study, we determined whether butyrate can activate cAMP-protein kinase A (PKA)- cAMP response element (CRE)-binding protein (CREB) signaling in Caco-2 cells, a model of intestinal epithelial cells. Butyrate promoted luciferase expression from a CRE-reporter construct, induced phosphorylation of CREB, increased the activity of PKA, and elevated the levels of cAMP in Caco-2 cells. These data suggest that butyrate activates cAMP-PKA-CREB signaling in Caco-2 cells. Butyrate, however, had no effect on the activities of adenylyl cyclase (AC) and phosphodiesterase (PDE), two enzymes that determine the production and degradation of intracellular cAMP, respectively. Because the activities of AC and PDE are primarily regulated by G protein-coupled receptor (GPR)-mediated intracellular signaling, lack of an effect of butyrate on these two enzymes suggests that butyrate does not activate cAMP-PKA-CREB signaling through GPR. Butyrate-treated Caco-2 cells had greater concentrations of ATP than untreated cells. Because ATP is the substrate for cAMP production, this difference suggests that butyrate may activate cAMP-PKA-CREB signaling in Caco-2 cells through increased ATP production. Overall, this study raises the possibility that some of the regulatory effects of butyrate in animals, including those on the colonocytes, may be mediated by the cAMP-PKA-CREB signaling pathway at the cellular level.

  10. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  11. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  12. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  13. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  14. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.

    PubMed Central

    Montminy, M R; Sevarino, K A; Wagner, J A; Mandel, G; Goodman, R H

    1986-01-01

    We have examined the regulation of somatostatin gene expression by cAMP in PC12 rat pheochromocytoma cells transfected with the rat somatostatin gene. Forskolin at 10 microM caused a 4-fold increase in somatostatin mRNA levels within 4 hr of treatment in stably transfected cells. Chimeric genes containing the somatostatin gene promoter fused to the bacterial reporter gene encoding chloramphenicol acetyltransferase were also induced by cAMP in PC12 cells. To delineate the sequences required for response to cAMP, we constructed a series of promoter deletion mutants. Our studies defined a region between 60 and 29 base pairs upstream from the transcriptional initiation site that conferred cAMP responsiveness when placed adjacent to the simian virus 40 promoter. Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP. cAMP responsiveness was greatly reduced when the somatostatin fusion genes were transfected into the mutant PC12 line A126-1B2, which is deficient in cAMP-dependent protein kinase 2. Our studies indicate that transcriptional regulation of the somatostatin gene by cAMP requires protein kinase 2 activity and may depend upon a highly conserved promoter element. Images PMID:2875459

  15. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis.

    PubMed

    Zhou, Zhiwen; Tanaka, Kenji F; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  16. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  17. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  18. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  19. Molecular cloning and subcellular distribution of the novel PDE4B4 cAMP-specific phosphodiesterase isoform.

    PubMed Central

    Shepherd, Malcolm; McSorley, Theresa; Olsen, Aileen E; Johnston, Lee Ann; Thomson, Neil C; Baillie, George S; Houslay, Miles D; Bolger, Graeme B

    2003-01-01

    We have isolated cDNAs encoding PDE4B4, a new cAMP-specific phosphodiesterase (PDE4) isoform with novel properties. The amino acid sequence of PDE4B4 demonstrates that it is encoded by the PDE4B gene, but that it differs from the previously isolated PDE4B1, PDE4B2 and PDE4B3 isoforms by the presence of a novel N-terminal region of 17 amino acids. PDE4B4 contains both of the upstream conserved region 1 (UCR1) and UCR2 regulatory units that are characteristic of 'long' PDE4 isoforms. RNase protection demonstrated that PDE4B4 mRNA is expressed preferentially in liver, skeletal muscle and various regions of the brain, which differs from the pattern of tissue distribution of the other known PDE4B long forms, PDE4B1 and PDE4B3. Expression of PDE4B4 cDNA in COS7 cells produced a protein of 85 kDa under denaturing conditions. Subcellular fractionation of recombinant, COS7-cell expressed PDE4B4 showed that the protein was localized within the cytosol, which was confirmed by confocal microscopic analysis of living COS7 cells transfected with a green fluorescent protein-PDE4B4 chimaera. PDE4B4 exhibited a K(m) for cAMP of 5.4 microM and a V(max), relative to that of the long PDE4B1 isoform, of 2.1. PDE4B4 was inhibited by the prototypical PDE4 inhibitor rolipram [4-[3-(cyclopentoxyl)-4-methoxyphenyl]-2-pyrrolidinone] with an IC(50) of 83 nM. Treatment of COS7 cells with forskolin, to elevate cAMP levels, produced activation of PDE4B4, which was associated with the phosphorylation of PDE4B4 on Ser-56 within UCR1. The unique tissue distribution and intracellular targeting of PDE4B4 suggests that this isoform may have a distinct functional role in regulating cAMP levels in specific cell types. PMID:12441002

  20. Opposing needling promotes behavior recovery and exerts neuroprotection via the cAMP/PKA/CREB signal transduction pathway in transient MCAO rats

    PubMed Central

    JIANG, YIJING; YANG, SHANLI; TAO, JING; LIN, ZHICHENG; YE, XIAOQIAN; YOU, YONGMEI; PENG, JUN; HONG, ZHENFENG; CHEN, LIDIAN

    2016-01-01

    The aim of the present study was to investigate whether the cyclic adenosine 3′,5′-monophosphate (cAMP)/protein kinase A(PKA)/cAMP-responsive element binding protein (CREB) signal transduction pathway triggered by γ-aminobutyric acid class B (GABAB) receptor activation is involved in neuroprotection against ischemia and behavioral recovery induced by opposing needling (ON). A total of 80 rats were randomly divided into four groups: A sham operation group, an ischemia group, an ON group and an ON group effectively inhibited by the GABAB receptor antagonist, CGP35384 (n=20/group). The behavior of the rats was assessed by their neurological deficit score, whereas the impairment of gait was examined using the CatWalk system. The volume of cerebral infarction was examined upon treatment with 2,3,5-triphenyltetrazolium chloride. The expression levels of CREB, GABAB1 and GABAB2 were examined by western blotting and reverse transcription-quantitative polymerase chain reaction, and the activity of adenylyl cyclase (AC), cAMP and PKA in the serum was detected using an enzyme-linked immunosorbent assay. In the present study, in comparison with other groups, the ON group exhibited a reduced score for the neurological deficit, the stride length and swing speed were improved, and the volume of infarction was reduced. However, these effects were reversed upon administration of CGP35384. Additionally, the expression levels of CREB, GABAB1 and GABAB2 were increased in the ON group. The levels of AC, cAMP and PKA in the serum were also increased in the ON group, whereas the addition of CGP35384 reversed these effects. The results of the present study demonstrated that ON markedly protected the brain against transient cerebral ischemic injury, and this effect was possibly mediated by the activation of the GABAB/cAMP/PKA/CREB signal transduction pathway. These findings implied that ON may be a potential therapeutic method for treating stroke. PMID:26780954

  1. Terminal truncations in amp C beta-lactamase from a clinical isolate of Pseudomonas aeruginosa.

    PubMed

    Walther-Rasmussen, J; Johnsen, A H; Høiby, N

    1999-07-01

    AmpC beta-lactamases from strains of Pseudomonas aeruginosa have previously been shown to be heterogeneous with respect to their isoelectric point (pI). In order to elucidate the origin of this heterogeneity enzymes were isolated from a clinical isolate of a multiresistant P. aeruginosa strain and biochemically characterized. The purification was accomplished in four chromatographic steps comprising dye-affinity, size-exclusion, hydrophobic interaction chromatography, and chromatofocusing; this resulted in five forms with pI values of 9.1, 8.7, 8.3, 8.2, and 7.6. When analysed by SDS/PAGE and agarose IEF each separated beta-lactamase appeared to be both size- and charge-homogeneous. The specific activities of the variants were very similar. MS of each isolated beta-lactamase form showed minor differences in molecular mass (range 40.0-40.8 kDa). MS of the beta-lactamase with a pI of 8.2 demonstrated the presence of two subforms. The N-terminal sequences of three of the beta-lactamases were identical to the published sequence [Lodge, J.M. , Minchin, S.D., Piddock, L.J.V. & Busby, J.W. (1990) Biochem. J. 272, 627-631], while two variants were truncated by two amino-acid residues, one of which was acidic. The previously published sequence contains an alanine as the ultimate residue, but two of the beta-lactamases showed a substitution of Ala371 for arginine, whereas in the remaining forms C-terminal truncations by one and three residues were found. Our results indicate that the P. aeruginosa strain does not harbour multiple copies of the ampC gene, but rather that the five beta-lactamase isoforms are products of a single structural gene. The combinations of the identified N- and/or C-terminal truncations explained the multiple pI values of the beta-lactamase isoforms. PMID:10406957

  2. Isolation and characterization of cAMP-resistant mutants of the H-4 rat hepatoma cells

    SciTech Connect

    Liu, A.Y.; Lin, Z.

    1987-05-01

    H-4 rat hepatoma cells were mutagenized with ethyl methane-sulfonate and the frequency of emergence of cAMP resistant mutant cells were evaluated by cloning the EMS-treated cells in a semi-solid agar medium that contained either 1-3 mM 8-bromo-cAMP plus 1 mM 3-isobutyl-1-methyl xanthine or 5 ..mu..g/ml cholera toxin plus 1 mM IBMX. cAMP resistant mutants emerged at a frequency of 8 x 10/sup -5/. 15 colonies were isolated, recloned, grown in mass culture, and cell extracts were prepared. Analysis of cAMP-dependent protein kinase demonstrated that: (1) the type II enzyme is the only cAMP-dependent protein kinase detected in extracts of the hepatoma cells; (2) of the 15 cAMP resistant clonal cell lines examined, only one (H/sub 4/M/sub 18/) was found to be devoid of cAMP-dependent protein kinase activity. In another cell line (H/sub 4/M/sub 10/) the activity was 30% of that of the parental H-4 cells; (3) there was an increase (130-300%) in cAMP-dependent protein kinase activity in 13/15 of the mutant cell lines over that of the parental H-4 cells. Analysis of cAMP-phosphodiesterase demonstrated significant increases (150-370%) in the enzyme activity in extracts of the mutants over that of the H-4 parental line. Their results suggest that while a deficiency in cAMP-dependent protein kinase may confer resistance to the hepatoma cells against the cytostatic effects of 8-bromo-cAMP and cholera toxin, other events such as overexpression of phosphodiesterase may contribute to this phenotype.

  3. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  4. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  5. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  6. cAMP/Protein Kinase A Activates Cystic Fibrosis Transmembrane Conductance Regulator for ATP Release from Rat Skeletal Muscle during Low pH or Contractions

    PubMed Central

    Cai, Weisong; Ballard, Heather J.

    2012-01-01

    We have shown that cystic fibrosis transmembrane conductance regulator (CFTR) is involved in ATP release from skeletal muscle at low pH. These experiments investigate the signal transduction mechanism linking pH depression to CFTR activation and ATP release, and evaluate whether CFTR is involved in ATP release from contracting muscle. Lactic acid treatment elevated interstitial ATP of buffer-perfused muscle and extracellular ATP of L6 myocytes: this ATP release was abolished by the non-specific CFTR inhibitor, glibenclamide, or the specific CFTR inhibitor, CFTRinh-172, suggesting that CFTR was involved, and by inhibition of lactic acid entry to cells, indicating that intracellular pH depression was required. Muscle contractions significantly elevated interstitial ATP, but CFTRinh-172 abolished the increase. The cAMP/PKA pathway was involved in the signal transduction pathway for CFTR-regulated ATP release from muscle: forskolin increased CFTR phosphorylation and stimulated ATP release from muscle or myocytes; lactic acid increased intracellular cAMP, pCREB and PKA activity, whereas IBMX enhanced ATP release from myocytes. Inhibition of PKA with KT5720 abolished lactic-acid- or contraction-induced ATP release from muscle. Inhibition of either the Na+/H+-exchanger (NHE) with amiloride or the Na+/Ca2+-exchanger (NCX) with SN6 or KB-R7943 abolished lactic-acid- or contraction-induced release of ATP from muscle, suggesting that these exchange proteins may be involved in the activation of CFTR. Our data suggest that CFTR-regulated release contributes to ATP release from contracting muscle in vivo, and that cAMP and PKA are involved in the activation of CFTR during muscle contractions or acidosis; NHE and NCX may be involved in the signal transduction pathway. PMID:23226244

  7. Cell-type-specific responses of RT4 neural cell lines to dibutyryl-cAMP: branch determination versus maturation

    SciTech Connect

    Droms, K.; Sueoka, N.

    1987-03-01

    This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP.

  8. Presence of antimicrobial resistance in coliform bacteria from hatching broiler eggs with emphasis on ESBL/AmpC-producing bacteria.

    PubMed

    Mezhoud, H; Chantziaras, I; Iguer-Ouada, M; Moula, N; Garmyn, A; Martel, A; Touati, A; Smet, A; Haesebrouck, F; Boyen, F

    2016-08-01

    Antimicrobial resistance is recognized as one of the most important global health challenges. Broilers are an important reservoir of antimicrobial resistant bacteria in general and, more particularly, extended-spectrum β-lactamases (ESBL)/AmpC-producing Enterobacteriaceae. Since contamination of 1-day-old chicks is a potential risk factor for the introduction of antimicrobial resistant Enterobacteriaceae in the broiler production chain, the presence of antimicrobial resistant coliform bacteria in broiler hatching eggs was explored in the present study. Samples from 186 hatching eggs, collected from 11 broiler breeder farms, were inoculated on MacConkey agar with or without ceftiofur and investigated for the presence of antimicrobial resistant lactose-positive Enterobacteriaceae, particularly, ESBL/AmpC-producers. Escherichia coli and Enterobacter cloacae were obtained from the eggshells in 10 out of 11 (10/11) sampled farms. The majority of the isolates were recovered from crushed eggshells after external decontamination suggesting that these bacteria are concealed from the disinfectants in the egg shell pores. Antimicrobial resistance testing revealed that approximately 30% of the isolates showed resistance to ampicillin, tetracycline, trimethoprim and sulphonamides, while the majority of isolates were susceptible to amoxicillin-clavulanic acid, nitrofurantoin, aminoglycosides, florfenicol, neomycin and apramycin. Resistance to extended-spectrum cephalosporins was detected in eight Enterobacteriaceae isolates from five different broiler breeder farms. The ESBL phenotype was confirmed by the double disk synergy test and blaSHV-12, blaTEM-52 and blaACT-39 resistance genes were detected by PCR. This report is the first to present broiler hatching eggs as carriers and a potential source of ESBL/AmpC-producing Enterobacteriaceae for broiler chicks.

  9. Polynomial solutions of the Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Aminov, Yu A.

    2014-11-01

    The question of the existence of polynomial solutions to the Monge-Ampère equation zxxzyy-zxy^2=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  10. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  11. Amp: A modular approach to machine learning in atomistic simulations

    NASA Astrophysics Data System (ADS)

    Khorshidi, Alireza; Peterson, Andrew A.

    2016-10-01

    Electronic structure calculations, such as those employing Kohn-Sham density functional theory or ab initio wavefunction theories, have allowed for atomistic-level understandings of a wide variety of phenomena and properties of matter at small scales. However, the computational cost of electronic structure methods drastically increases with length and time scales, which makes these methods difficult for long time-scale molecular dynamics simulations or large-sized systems. Machine-learning techniques can provide accurate potentials that can match the quality of electronic structure calculations, provided sufficient training data. These potentials can then be used to rapidly simulate large and long time-scale phenomena at similar quality to the parent electronic structure approach. Machine-learning potentials usually take a bias-free mathematical form and can be readily developed for a wide variety of systems. Electronic structure calculations have favorable properties-namely that they are noiseless and targeted training data can be produced on-demand-that make them particularly well-suited for machine learning. This paper discusses our modular approach to atomistic machine learning through the development of the open-source Atomistic Machine-learning Package (Amp), which allows for representations of both the total and atom-centered potential energy surface, in both periodic and non-periodic systems. Potentials developed through the atom-centered approach are simultaneously applicable for systems with various sizes. Interpolation can be enhanced by introducing custom descriptors of the local environment. We demonstrate this in the current work for Gaussian-type, bispectrum, and Zernike-type descriptors. Amp has an intuitive and modular structure with an interface through the python scripting language yet has parallelizable fortran components for demanding tasks; it is designed to integrate closely with the widely used Atomic Simulation Environment (ASE), which

  12. AMP-deaminase from thymus of patients with myasthenia gravis.

    PubMed

    Rybakowska, I; Szydłowska, M; Szrok, S; Bakuła, S; Kaletha, K

    2015-01-01

    Myasthenia gravis (MG) is characterized clinically by skeletal muscle fatigue following the excessive exercise. Interestingly most of MG patients manifest parallely also some abnormalities of the thymus.AMP-deaminase (AMPD) from human thymus was not a subject of studies up to now. In this paper, mRNA expression and some physico-chemical and immunological properties of AMPD purified from the thymus of MG patients were described. Experiments performed identified the liver isozyme (AMPD2) as the main isoform of AMPD expressed in this organ. The activity of AMPD found in this organ was higher than in other human non-(skeletal) muscle tissues indicating on role the enzyme may play in supplying of guanylates required for the intensive multiplication of thymocytes.

  13. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.

    PubMed

    Kobrinsky, Evgeny

    2015-01-01

    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  14. AMP-activated protein kinase and metabolic control

    PubMed Central

    Viollet, Benoit; Andreelli, Fabrizio

    2011-01-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, is a major regulator of cellular and whole-body energy homeostasis that coordinates metabolic pathways in order to balance nutrient supply with energy demand. It is now recognized that pharmacological activation of AMPK improves blood glucose homeostasis, lipid profile and blood pressure in insulin-resistant rodents. Indeed, AMPK activation mimics the beneficial effects of physical activity or those of calorie restriction by acting on multiple cellular targets. In addition it is now demonstrated that AMPK is one of the probable (albeit indirect) targets of major antidiabetic drugs including, the biguanides (metformin) and thiazolidinediones, as well as of insulin sensitizing adipokines (e.g., adiponectin). Taken together, such findings highlight the logic underlying the concept of targeting the AMPK pathway for the treatment of metabolic syndrome and type 2 diabetes. PMID:21484577

  15. Binding of Cyclic Di-AMP to the Staphylococcus aureus Sensor Kinase KdpD Occurs via the Universal Stress Protein Domain and Downregulates the Expression of the Kdp Potassium Transporter

    PubMed Central

    Moscoso, Joana A.; Schramke, Hannah; Tosi, Tommaso; Dehbi, Amina; Jung, Kirsten

    2015-01-01

    ABSTRACT Nucleotide signaling molecules are important intracellular messengers that regulate a wide range of biological functions. The human pathogen Staphylococcus aureus produces the signaling nucleotide cyclic di-AMP (c-di-AMP). This molecule is common among Gram-positive bacteria and in many organisms is essential for survival under standard laboratory growth conditions. In this study, we investigated the interaction of c-di-AMP with the S. aureus KdpD protein. The sensor kinase KdpD forms a two-component signaling system with the response regulator KdpE and regulates the expression of the kdpDE genes and the kdpFABC operon coding for the Kdp potassium transporter components. Here we show that the S. aureus KdpD protein binds c-di-AMP specifically and with an affinity in the micromolar range through its universal stress protein (USP) domain. This domain is located within the N-terminal cytoplasmic region of KdpD, and amino acids of a conserved SXS-X20-FTAXY motif are important for this binding. We further show that KdpD2, a second KdpD protein found in some S. aureus strains, also binds c-di-AMP, and our bioinformatics analysis indicates that a subclass of KdpD proteins in c-di-AMP-producing bacteria has evolved to bind this signaling nucleotide. Finally, we show that c-di-AMP binding to KdpD inhibits the upregulation of the kdpFABC operon under salt stress, thus indicating that c-di-AMP is a negative regulator of potassium uptake in S. aureus. IMPORTANCE Staphylococcus aureus is an important human pathogen and a major cause of food poisoning in Western countries. A common method for food preservation is the use of salt to drive dehydration. This study sheds light on the regulation of potassium uptake in Staphylococcus aureus, an important aspect of this bacterium's ability to tolerate high levels of salt. We show that the signaling nucleotide c-di-AMP binds to a regulatory component of the Kdp potassium uptake system and that this binding has an inhibitory

  16. Stimulation of cartilage amino acid uptake by growth hormone-dependent factors in serum. Mediation by adenosine 3':5'-monophosphate.

    PubMed

    Drezner, M K; Eisenbarth, G S; Neelon, F A; Lebovitz, H E

    1975-02-13

    The effects of growth hormone-dependent serum factors on amino acid transport and on cartilage cyclic AMP levels in embryonic chicken cartilage were studied in vitro. Cartilages incubated in medium containing rat serum showed a significantly greater uptake of alpha-amino [1-14C] isobutyrate or [1-14C] cycloleucine than control cartilages incubated in medium alone. Normal rat serum (5%) added to the incubation medium also caused an increase in cartilage cyclic AMP content (from as little as 23% to as much as 109%). The factors in serum which increase cartilage cyclic AMP and amino acid uptake are growth hormone dependent, since neither growth hormone itself nor serum from hypophysectomized rats restores these serum factors. Studies comparing the ability of sera with varying amounts of growth hormone-dependent factors to stimulate amino-aminoisobutyrate transport and to increase cartilage cyclic AMP show a striking linear correlation between the two effects (r=0.977). Theophylline and prostaglandin E1, WHICH RAISE CARTILAGE CYCLIC AMP also increase amino-aminoisobutyrate transport. Exogenous cyclic AMP, N6-monobutyryl cyclic AMP and n6, 02'-dibutyryl cyclic AMP increase cartilage amino-aminoisobutyrate transport. The data are compatible with the thesis that growth hormone-dependent serum factors increase cartilage amino acid transport by elevating cartilage cyclic AMP.

  17. Salicylate decreases production of AmpC type beta-lactamases and increases susceptibility to beta-lactams in a Morganella morganii clinical isolate.

    PubMed

    Tavío, María M; Perilli, Mariagrazia; Vila, Jordi; Becerro, Pino; Casañas, Lucía; Amicosante, Gianfranco; Jiménez de Anta, María Teresa

    2004-09-01

    The effect of salicylate, a marRAB inducer, on the resistance to beta-lactams was characterized in an AmpC beta-lactamase hyperproducer Morganella morganii clinical isolate (the M1 strain). Results were compared with those of the effect of salicylate in a wild-type M. morganii strain. Salicylate induced a decreased susceptibility to nalidixic acid, norfloxacin and tetracycline and simultaneously increased the susceptibility to beta-lactams apparently due to the repression of AmpC beta-lactamase synthesis in the M1 strain. Likewise, salicylate only repressed 46 kDa outer membrane protein expression in the wild-type strain, since the clinical isolate M1 did not express it.

  18. Asymptotic behavior on a kind of parabolic Monge-Ampère equation

    NASA Astrophysics Data System (ADS)

    Wang, Bo; Bao, Jiguang

    2015-07-01

    In this paper, we apply level set and nonlinear perturbation methods to obtain the asymptotic behavior of the solution to a kind of parabolic Monge-Ampère equation at infinity. The Jörgens-Calabi-Pogorelov theorem for parabolic and elliptic Monge-Ampère equation can be regarded as special cases of our result.

  19. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  20. A possible signal-coupling role for cyclic AMP during endocytosis in Amoeba proteus.

    PubMed

    Prusch, R D; Roscoe, J C

    1993-01-01

    Cytoplasmic levels of cAMP in Amoeba proteus were measured utilizing radioimmunoassays under control conditions and when stimulated by inducers of either pinocytosis or phagocytosis. In control cells, cytoplasmic cAMP levels were approximately 0.39 pM/mg cells. When exposed to either chemotactic peptide or mannose which stimulate phagocytosis in the amoeba, there is a rapid doubling of the cAMP level within 45 sec of stimulation which then returns to the control level within 3-5 min. Theophylline prolongs the elevation of cytoplasmic cAMP in stimulated cells and is also capable of eliciting food vacuole formation in the amoeba. In addition isoproterenol also causes food vacuole formation in the amoeba as well as a large and prolonged increase in cytoplasmic cAMP levels. Inducers of pinocytosis (BSA and Na Cl) also elicit changes in cytoplasmic cAMP in the amoeba, but the response appears to differ from that elicited by inducers of phagocytosis in that the peak cAMP levels are broader and biphasic. It is concluded that cAMP plays a signal-coupling role during the early phases of both forms of endocytosis in Amoeba proteus.

  1. BaAMPs: the database of biofilm-active antimicrobial peptides.

    PubMed

    Di Luca, Mariagrazia; Maccari, Giuseppe; Maisetta, Giuseppantonio; Batoni, Giovanna

    2015-01-01

    Antimicrobial peptides (AMPs) are increasingly being considered as novel agents against biofilms. The development of AMP-based anti-biofilm strategies strongly relies on the design of sequences optimized to target specific features of sessile bacterial/fungal communities. Although several AMP databases have been created and successfully exploited for AMP design, all of these use data collected on peptides tested against planktonic microorganisms. Here, an open-access, manually curated database of AMPs specifically assayed against microbial biofilms (BaAMPs) is presented for the first time. In collecting relevant data from the literature an effort was made to define a minimal standard set of essential information including, for each AMP, the microbial species and biofilm conditions against which it was tested, and the specific assay and peptide concentration used. The availability of these data in an organized framework will benefit anti-biofilm research and support the design of novel molecules active against biofilm. BaAMPs is accessible at http://www.baamps.it. PMID:25760404

  2. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  3. Phosphorylation and inhibition of. gamma. -glutamyl transferase activity by cAMP-dependent protein kinase

    SciTech Connect

    Kolesnichenko, L.S.; Chernov, N.N.

    1986-10-20

    It was shown that preparations of bovine kidney ..gamma..-glutamyl transferase of differing degrees of purity are phosphorylated by cAMP-dependent protein kinase. This is accompanied by a decrease in both the transferase and hydrolase activities of the enzyme. Consequently, ..gamma..-glutamyl transferase may serve as the substrate and target of the regulation of cAMP-dependent protein kinase.

  4. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  5. Changes in the cyclic AMP content during growth and development of Acetabularia.

    PubMed

    Minder, C; Vanden Driessche, T

    1978-05-26

    The 3',5'-adenosine monophosphate (cyclic-AMP) content of the unicellular alga Acetabularia has been examined at various developmental stages. It has been found that very young algae, less than 10mm in length, have a high cAMP content [more than 7 pmoles per 100 mg wet weight (WW)], but that with the growth of the algae, the cAMP content decreases rapidly, reaching the low level of 0.5--1.0 pmoles per 100mg WW. The cAMP content remains at this level until cap differentiation, after which an increase in cAMP content accompanies cap enlargement. It has been shown that these results are unlikely to be affected by changes in the cAMP content induced by variations in circadian rhythm. Treatment with theophylline (2.10(-3) M), a phosphodieterase inhibitor, results in an increase in the cAMP content and delays growth and cap formation. Experiments on the effects of theophylline upon the circadian rhythm of oxygen evolution have shown that the continuous presence of theophylline in the culture medium does not induce a phase shift in the rhythm. The cAMP content of anucleate Acetabularia shows development stage variations parallel to that of the whole algae.

  6. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent.

    PubMed

    Stella, Nicholas A; Shanks, Robert M Q

    2014-05-01

    The cyclic-nucleotide 3',5'-cyclic AMP (cAMP) is an ancient and widespread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-cyclic-AMP receptor protein regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein, similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP.

  7. Nicotinamide ameliorates palmitate-induced ER stress in hepatocytes via cAMP/PKA/CREB pathway-dependent Sirt1 upregulation.

    PubMed

    Li, Jiaxin; Dou, Xiaobing; Li, Songtao; Zhang, Ximei; Zeng, Yong; Song, Zhenyuan

    2015-11-01

    Nicotinamide (NAM) is the amide of nicotinic acid and a predominant precursor for NAD(+) biosynthesis via the salvage pathway. Sirt1 is a NAD(+)-dependent deacetylase, playing an important role in regulating cellular functions. Although hepatoprotective effect of NAM has been reported, the underlying mechanism remains elusive. ER stress, induced by saturated fatty acids, in specific palmitate, plays a pathological role in the development of nonalcoholic fatty liver disease. This study aims to determine the effect of NAM on palmitate-induced ER stress in hepatocytes and to elucidate molecular mechanisms behind. Both HepG2 cells and primary mouse hepatocytes were exposed to palmitate (conjugated to BSA at a 2:1 M ratio), NAM, or their combination for different durations. Cellular NAD(+) level, Sirt1 expression/activity, ER stress, as well as cAMP/PKA/CREB pathway activation were determined. NAM increased Sirt1 expression and enzymatic activity, which contributes to the ameliorative effect of NAM on palmitate-triggered ER stress. NAM increased intracellular NAD(+) level in hepatocytes, however, blocking the salvage pathway, a pathway for NAD(+) synthesis from NAM, only partially prevented NAM-induced Sirt1 upregulation while completely prevented NAD+ increase in response to NAM. Further mechanistic investigations revealed that NAM elevated intracellular cAMP level via suppressing PDE activity, leading to downstream PKA and CREB activation. Importantly, cAMP/PKA/CREB pathway blockade abolished not only NAM-induced Sirt1 upregulation, but also its protective effect against ER stress. Our results demonstrate that NAM protects hepatocytes against palmitate-induced ER stress in hepatocytes via upregulating Sirt1. Activation of the cAMP/PKA/CREB pathway plays a key role in NAM-induced Sirt1 upregulation. PMID:26352206

  8. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  9. cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes.

    PubMed

    Bodor, J; Spetz, A L; Strominger, J L; Habener, J F

    1996-04-16

    Stimulation of the cAMP-dependent signaling pathway exerts an inhibitory effect on the proliferation and effector functions of T cells. The ability of T cells to form high intracellular levels of cAMP is acquired during development in the human thymus and is retained by the majority of mature peripheral T lymphocytes. Here we show that elevated cAMP levels in T cells correlate with the expression of the potent transcriptional repressor ICER (inducible cAMP early repressor) previously described in the hypothalamic-pituitary-gonadal axis. Further, in transcriptional assays in vivo, ICER inhibits calcineurin-mediated expression of the interleukin 2 promoter as well as Tax-mediated transactivation of the human T-lymphotropic virus type I (HTLV-I) promoter. Thus, the induction of ICER in T cells may play an important role in the cAMP-induced quiescence and the persistent latency of HTLV-I.

  10. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  11. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  12. Positive Effect of Carbon Sources on Natural Transformation in Escherichia coli: Role of Low-Level Cyclic AMP (cAMP)-cAMP Receptor Protein in the Derepression of rpoS

    PubMed Central

    Guo, Mengyue; Wang, Huanyu; Xie, Nengbin

    2015-01-01

    ABSTRACT Natural plasmid transformation of Escherichia coli is a complex process that occurs strictly on agar plates and requires the global stress response factor σS. Here, we showed that additional carbon sources could significantly enhance the transformability of E. coli. Inactivation of phosphotransferase system genes (ptsH, ptsG, and crr) caused an increase in the transformation frequency, and the addition of cyclic AMP (cAMP) neutralized the promotional effect of carbon sources. This implies a negative role of cAMP in natural transformation. Further study showed that crp and cyaA mutations conferred a higher transformation frequency, suggesting that the cAMP-cAMP receptor protein (CRP) complex has an inhibitory effect on transformation. Moreover, we observed that rpoS is negatively regulated by cAMP-CRP in early log phase and that both crp and cyaA mutants show no transformation superiority when rpoS is knocked out. Therefore, it can be concluded that both the crp and cyaA mutations derepress rpoS expression in early log phase, whereby they aid in the promotion of natural transformation ability. We also showed that the accumulation of RpoS during early log phase can account for the enhanced transformation aroused by additional carbon sources. Our results thus demonstrated that the presence of additional carbon sources promotes competence development and natural transformation by reducing cAMP-CRP and, thus, derepressing rpoS expression during log phase. This finding could contribute to a better understanding of the relationship between nutrition state and competence, as well as the mechanism of natural plasmid transformation in E. coli. IMPORTANCE Escherichia coli, which is not usually considered to be naturally transformable, was found to spontaneously take up plasmid DNA on agar plates. Researching the mechanism of natural transformation is important for understanding the role of transformation in evolution, as well as in the transfer of pathogenicity and

  13. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  14. Role of water in the enzymatic catalysis: study of ATP + AMP → 2ADP conversion by adenylate kinase.

    PubMed

    Adkar, Bharat V; Jana, Biman; Bagchi, Biman

    2011-04-28

    The catalytic conversion ATP + AMP → 2ADP by the enzyme adenylate kinase (ADK) involves the binding of one ATP molecule to the LID domain and one AMP molecule to the NMP domain. The latter is followed by a phosphate transfer and then the release of two ADP molecules. We have computed a novel two-dimensional configurational free energy surface (2DCFES), with one reaction coordinate each for the LID and the NMP domain motions, while considering explicit water interactions. Our computed 2DCFES clearly reveals the existence of a stable half-open half-closed (HOHC) intermediate state of the enzyme. Cycling of the enzyme through the HOHC state reduces the conformational free energy barrier for the reaction by about 20 kJ/mol. We find that the stability of the HOHC state (missed in all earlier studies with implicit solvent model) is largely because of the increase of specific interactions of the polar amino acid side chains with water, particularly with the arginine and the histidine residues. Free energy surface of the LID domain is rather rugged, which can conveniently slow down LID's conformational motion, thus facilitating a new substrate capture after the product release in the catalytic cycle.

  15. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  16. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  17. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  18. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    PubMed

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  19. cAMP mediators of pulsatile insulin secretion from glucose-stimulated single beta-cells.

    PubMed

    Idevall-Hagren, Olof; Barg, Sebastian; Gylfe, Erik; Tengholm, Anders

    2010-07-23

    Pulsatile insulin release from glucose-stimulated beta-cells is driven by oscillations of the Ca(2+) and cAMP concentrations in the subplasma membrane space ([Ca(2+)](pm) and [cAMP](pm)). To clarify mechanisms by which cAMP regulates insulin secretion, we performed parallel evanescent wave fluorescence imaging of [cAMP](pm), [Ca(2+)](pm), and phosphatidylinositol 3,4,5-trisphosphate (PIP(3)) in the plasma membrane. This lipid is formed by autocrine insulin receptor activation and was used to monitor insulin release kinetics from single MIN6 beta-cells. Elevation of the glucose concentration from 3 to 11 mm induced, after a 2.7-min delay, coordinated oscillations of [Ca(2+)](pm), [cAMP](pm), and PIP(3). Inhibitors of protein kinase A (PKA) markedly diminished the PIP(3) response when applied before glucose stimulation, but did not affect already manifested PIP(3) oscillations. The reduced PIP(3) response could be attributed to accelerated depolarization causing early rise of [Ca(2+)](pm) that preceded the elevation of [cAMP](pm). However, the amplitude of the PIP(3) response after PKA inhibition was restored by a specific agonist to the cAMP-dependent guanine nucleotide exchange factor Epac. Suppression of cAMP formation with adenylyl cyclase inhibitors reduced already established PIP(3) oscillations in glucose-stimulated cells, and this effect was almost completely counteracted by the Epac agonist. In cells treated with small interfering RNA targeting Epac2, the amplitudes of the glucose-induced PIP(3) oscillations were reduced, and the Epac agonist was without effect. The data indicate that temporal coordination of the triggering [Ca(2+)](pm) and amplifying [cAMP](pm) signals is important for glucose-induced pulsatile insulin release. Although both PKA and Epac2 partake in initiating insulin secretion, the cAMP dependence of established pulsatility is mediated by Epac2.

  20. A novel indirect sequence readout component in the E. coli cyclic AMP receptor protein operator.

    PubMed

    Lindemose, Søren; Nielsen, Peter Eigil; Valentin-Hansen, Poul; Møllegaard, Niels Erik

    2014-03-21

    The cyclic AMP receptor protein (CRP) from Escherichia coli has been extensively studied for several decades. In particular, a detailed characterization of CRP interaction with DNA has been obtained. The CRP dimer recognizes a consensus sequence AANTGTGANNNNNNTCACANTT through direct amino acid nucleobase interactions in the major groove of the two operator half-sites. Crystal structure analyses have revealed that the interaction results in two strong kinks at the TG/CA steps closest to the 6-base-pair spacer (N6). This spacer exhibits high sequence variability among the more than 100 natural binding sites in the E. coli genome, but the exact role of the N6 region in CRP interaction has not previously been systematic examined. Here we employ an in vitro selection system based on a randomized N6 spacer region to demonstrate that CRP binding to the lacP1 site may be enhanced up to 14-fold or abolished by varying the N6 spacer sequences. Furthermore, on the basis of sequence analysis and uranyl (UO2(2+)) probing data, we propose that the underlying mechanism relies on N6 deformability.

  1. Curcumin attenuates diet-induced hepatic steatosis by activating AMP-activated protein kinase.

    PubMed

    Um, Min Young; Hwang, Kwang Hyun; Ahn, Jiyun; Ha, Tae Youl

    2013-09-01

    Curcumin is a well-known component of traditional turmeric (Curcuma longa), which has been reported to prevent obesity and diabetes. However, the effect of curcumin on hepatic lipid metabolism remains unclear. The aim of this study was to examine the effects of curcumin on hepatic steatosis in high-fat/cholesterol diet (HFD)-induced obese mice. Male C57BL/6J mice were fed a normal diet (ND), HFD or HFD with 0.15% curcumin (HFD+C) for 11 weeks. We found that curcumin significantly lowered the body-weight and adipose tissue weight of mice in the HFD+C group compared with the findings for the HFD group (p < 0.05). The levels of total cholesterol, fasting glucose and insulin in serum were decreased, and HFD-induced impairment of insulin sensitivity was improved by curcumin supplementation (p < 0.05). Curcumin protected against the development of hepatic steatosis by reducing hepatic fat accumulation. Moreover, curcumin activated AMP-activated protein kinase (AMPK) and elevated the gene expression of peroxisome proliferator-activated receptor alpha. By contrast, curcumin suppressed the HFD-mediated increases in sterol regulatory element-binding protein-1, acetyl-CoA carboxylase 1, fatty acid synthase and cluster of differentiation 36 expression. Taken together, these findings indicate that curcumin attenuates HFD-induced hepatic steatosis by regulating hepatic lipid metabolism via AMPK activation, suggesting its use as a therapeutic for hepatic steatosis.

  2. Hydrogen peroxide generation by monoamine oxidases in rat white adipocytes: role on cAMP production.

    PubMed

    Raimondi, L; Banchelli, G; Sgromo, L; Pirisino, R; Ner, M; Parini, A; Cambon, C

    2000-05-01

    In rat, white adipocytes monoamine oxidases (EC 1.4.3.4.) generate hydrogen peroxide (H(2)O(2)). Recent studies suggested that, in addition to its toxic features, H(2)O(2) may behave as a cell second messenger. In the present study, using fluorimetric and chemiluminescence (CL) assays, we showed that tyramine degradation by monoamine oxidases in intact adipocytes resulted in the concentration-dependent generation of H(2)O(2). In addition, we found that, in the presence of low tyramine concentrations, forskolin-dependent cAMP production was significantly increased as compared to that of the control and this increase was prevented by the monoamine oxidase inhibitor pargyline or by the H(2)O(2) trapping system homovanillic acid-peroxidase. Finally, we demonstrated that tyramine degradation by monoamine oxidases increased the ability of isoproterenol to induce cell lipolysis. Taken together, these data suggest that H(2)O(2) produced during substrate degradation by monoamine oxidases may participate in the regulation of adipocyte metabolism.

  3. Prostaglandins and muscarinic agonists induce cyclic AMP attenuation by two distinct mechanisms in the pregnant-rat myometrium. Interaction between cyclic AMP and Ca2+ signals.

    PubMed Central

    Goureau, O; Tanfin, Z; Harbon, S

    1990-01-01

    In pregnant-rat myometrium (day 21 of gestation), isoprenaline-induced cyclic AMP accumulation, resulting from receptor-mediated activation of adenylate cyclase, was negatively regulated by prostaglandins [PGE2, PGF2 alpha; EC50 (concn. giving 50% of maximal response) = 2 nM] and by the muscarinic agonist carbachol (EC50 = 2 microM). PG-induced inhibition was prevented by pertussis-toxin treatment, supporting the idea that it was mediated by the inhibitory G-protein Gi through the inhibitory pathway of the adenylate cyclase. Both isoprenaline-induced stimulation and PG-evoked inhibition of cyclic AMP were insensitive to Ca2+ depletion. By contrast, carbachol-evoked attenuation of cyclic AMP accumulation was dependent on Ca2+ and was insensitive to pertussis toxin. The inhibitory effect of carbachol was mimicked by ionomycin. Indirect evidence was thus provided for the enhancement of cyclic AMP degradation by a Ca2(+)-dependent phosphodiesterase activity in the muscarinic-mediated effect. The attenuation of cyclic AMP elicited by carbachol coincided with carbachol-stimulated inositol phosphate (InsP3, InsP2 and InsP) generation, which displayed an almost identical EC50 (3 microM) and was similarly unaffected by pertussis toxin. Both carbachol effects were reproduced by oxotremorine, whereas pilocarpine (a partial muscarinic agonist) failed to induce any decrease in cyclic AMP accumulation and concurrently was unable to stimulate the generation of inositol phosphates. These data support our proposal for a carbachol-mediated enhancement of a Ca2(+)-dependent phosphodiesterase activity, compatible with the rises in Ca2+ associated with muscarinic-induced increased generation of inositol phosphates. They further illustrate that a cross-talk between the two major transmembrane signalling systems contributed to an ultimate decrease in cyclic AMP in the pregnant-rat myometrium near term. PMID:1700899

  4. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  5. Chlorogenic acid from honeysuckle improves hepatic lipid dysregulation and modulates hepatic fatty acid composition in rats with chronic endotoxin infusion

    PubMed Central

    Zhou, Yan; Ruan, Zheng; Wen, Yanmei; Yang, Yuhui; Mi, Shumei; Zhou, Lili; Wu, Xin; Ding, Sheng; Deng, Zeyuan; Wu, Guoyao; Yin, Yulong

    2016-01-01

    Chlorogenic acid as a natural hydroxycinnamic acid has protective effect for liver. Endotoxin induced metabolic disorder, such as lipid dysregulation and hyperlipidemia. In this study, we investigated the effect of chlorogenic acid in rats with chronic endotoxin infusion. The Sprague-Dawley rats with lipid metabolic disorder (LD group) were intraperitoneally injected endotoxin. And the rats of chlorogenic acid-LD group were daily received chlorogenic acid by intragastric administration. In chlorogenic acid-LD group, the area of visceral adipocyte was decreased and liver injury was ameliorated, as compared to LD group. In chlorogenic acid-LD group, serum triglycerides, free fatty acids, hepatic triglycerides and cholesterol were decreased, the proportion of C20:1, C24:1 and C18:3n-6, Δ9-18 and Δ6-desaturase activity index in the liver were decreased, and the proportion of C18:3n-3 acid was increased, compared to the LD group. Moreover, levels of phosphorylated AMP-activated protein kinase, carnitine palmitoyltransferase-I, and fatty acid β-oxidation were increased in chlorogenic acid-LD group compared to LD rats, whereas levels of fatty acid synthase and acetyl-CoA carboxylase were decreased. These findings demonstrate that chlorogenic acid effectively improves hepatic lipid dysregulation in rats by regulating fatty acid metabolism enzymes, stimulating AMP-activated protein kinase activation, and modulating levels of hepatic fatty acids. PMID:27013782

  6. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  7. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  8. The role of the RAS pathway in iAMP21-ALL.

    PubMed

    Ryan, S L; Matheson, E; Grossmann, V; Sinclair, P; Bashton, M; Schwab, C; Towers, W; Partington, M; Elliott, A; Minto, L; Richardson, S; Rahman, T; Keavney, B; Skinner, R; Bown, N; Haferlach, T; Vandenberghe, P; Haferlach, C; Santibanez-Koref, M; Moorman, A V; Kohlmann, A; Irving, J A E; Harrison, C J

    2016-09-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAFs) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (⩾35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (⩾35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients.

  9. The role of the RAS pathway in iAMP21-ALL

    PubMed Central

    Ryan, Sarra L.; Matheson, Elizabeth; Grossmann, Vera; Sinclair, Paul; Bashton, Matthew; Schwab, Claire; Towers, Will; Partington, Matthew; Elliott, Alannah; Minto, Lynne; Richardson, Stacey; Rahman, Thahira; Keavney, Bernard; Skinner, Roderick; Bown, Nick; Haferlach, Torsten; Vandenberghe, Peter; Haferlach, Claudia; Santibanez-Koref, Mauro; Moorman, Anthony V.; Kohlmann, Alexander; Irving, Julie A. E.; Harrison, Christine J.

    2016-01-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) identifies a high-risk subtype of acute lymphoblastic leukaemia (ALL), requiring intensive treatment to reduce their relapse risk. Improved understanding of the genomic landscape of iAMP21-ALL will ascertain whether these patients may benefit from targeted therapy. We performed whole-exome sequencing of eight iAMP21-ALL samples. The mutation rate was dramatically disparate between cases (average 24.9, range 5-51) and a large number of novel variants were identified, including frequent mutation of the RAS/MEK/ERK pathway. Targeted sequencing of a larger cohort revealed that 60% (25/42) of diagnostic iAMP21-ALL samples harboured 42 distinct RAS pathway mutations. High sequencing coverage demonstrated heterogeneity in the form of multiple RAS pathway mutations within the same sample and diverse variant allele frequencies (VAF) (2-52%), similar to other subtypes of ALL. Constitutive RAS pathway activation was observed in iAMP21 samples that harboured mutations in the predominant clone (≥35% VAF). Viable iAMP21 cells from primary xenografts showed reduced viability in response to the MEK1/2 inhibitor, selumetinib, in vitro. As clonal (≥35% VAF) mutations were detected in 26% (11/42) of iAMP21-ALL, this evidence of response to RAS pathway inhibitors may offer the possibility to introduce targeted therapy to improve therapeutic efficacy in these high-risk patients. PMID:27168466

  10. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  11. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  12. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  13. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  14. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  15. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  16. From drought sensing to developmental control: evolution of cyclic AMP signaling in social amoebas.

    PubMed

    Ritchie, Allyson V; van Es, Saskia; Fouquet, Celine; Schaap, Pauline

    2008-10-01

    Amoebas and other protists commonly encyst when faced with environmental stress. Although little is known of the signaling pathways that mediate encystation, the analogous process of spore formation in dictyostelid social amoebas is better understood. In Dictyostelium discoideum, secreted cyclic AMP (cAMP) mediates the aggregation of starving amoebas and induces the differentiation of prespore cells. Intracellular cAMP acting on cAMP-dependent protein kinase (PKA) triggers the maturation of spores and prevents their germination under the prevalent conditions of high osmolality in the spore head. The osmolyte-activated adenylate cyclase, ACG, produces cAMP for prespore differentiation and inhibition of spore germination. To retrace the origin of ACG function, we investigated ACG gene conservation and function in species that span the dictyostelid phylogeny. ACG genes, osmolyte-activated ACG activity, and osmoregulation of spore germination were detected in species that represent the 4 major groups of Dictyostelia. Unlike the derived species D. discoideum, many basal Dictyostelia have retained the ancestral mechanism of encystation from solitary amoebas. In these species and in solitary amoebas, encystation is independently triggered by starvation or by high osmolality. Osmolyte-induced encystation was accompanied by an increase in cAMP and prevented by inhibition of PKA, indicating that ACG and PKA activation mediate this response. We propose that high osmolality signals drought in soil amoebas and that developmental cAMP signaling in the Dictyostelia has evolved from this stress response.

  17. The mechanisms of action of cAMP. A quantum chemical study.

    PubMed

    van Ool, P J; Buck, H M

    1982-01-01

    Quantum chemical calculations were performed on the formation of intermediates with trigonal bipyramidal (TBP) configurations in the hydrolysis of adenosine 3',5'-monophosphate (cAMP) with phosphodiesterases and the activation of protein kinases by cAMP. The results show that in the reaction sequence concerning the hydrolysis of cAMP with phosphodiesterase the TBP intermediate must possess an equatorial-apical cyclic phosphate ring with the 3'-oxygen atom in the apical position. This could be an additional reason for the sensitivity of the 3' position in cAMP towards modifications in comparison with the 5' position. According to the calculations, a mechanistic model is presented for the enzymatic hydrolysis of cAMP with the involvement of a covalently bonded enzyme-nucleotide intermediate. Also a model is offered for the activation of protein kinase by cAMP. The activation of protein kinase is assumed to proceed via diequatorial-ring-positioned TBP intermediates resulting in the formation of a covalent bond between cAMP and the protein kinase with retention of the cyclic phosphate ring. It seems likely that the enzyme-nucleotide intermediate enforces a conformational change in the enzyme, which causes the dissociation of the regulatory and catalytic subunit of the protein kinase, necessary for a physiological response.

  18. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent

    PubMed Central

    Stella, Nicholas A.; Shanks, Robert M. Q.

    2014-01-01

    The cyclic-nucleotide 3’,5’-cyclic AMP (cAMP) is an ancient and wide spread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-CRP regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

  19. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  20. Relationship between Platelet PPARs, cAMP Levels, and P-Selectin Expression: Antiplatelet Activity of Natural Products.

    PubMed

    Fuentes, Eduardo; Palomo, Iván

    2013-01-01

    Platelets are no longer considered simply as cells participating in thrombosis. In atherosclerosis, platelets are regulators of multiple processes, with the recruitment of inflammatory cells towards the lesion sites, inflammatory mediators release, and regulation of endothelial function. The antiplatelet therapy has been used for a long time in an effort to prevent and treat cardiovascular diseases. However, limited efficacy in some patients, drug resistance, and side effects are limitations of current antiplatelet therapy. In this context, a large number of natural products (polyphenols, terpenoids, alkaloids, and fatty acids) have been reported with antiplatelet activity. In this sense, the present paper describes mechanisms of antiplatelet action of natural products on platelet P-selectin expression through cAMP levels and its role as peroxisome proliferator-activated receptors agonists.

  1. Relationship between Platelet PPARs, cAMP Levels, and P-Selectin Expression: Antiplatelet Activity of Natural Products

    PubMed Central

    Fuentes, Eduardo; Palomo, Iván

    2013-01-01

    Platelets are no longer considered simply as cells participating in thrombosis. In atherosclerosis, platelets are regulators of multiple processes, with the recruitment of inflammatory cells towards the lesion sites, inflammatory mediators release, and regulation of endothelial function. The antiplatelet therapy has been used for a long time in an effort to prevent and treat cardiovascular diseases. However, limited efficacy in some patients, drug resistance, and side effects are limitations of current antiplatelet therapy. In this context, a large number of natural products (polyphenols, terpenoids, alkaloids, and fatty acids) have been reported with antiplatelet activity. In this sense, the present paper describes mechanisms of antiplatelet action of natural products on platelet P-selectin expression through cAMP levels and its role as peroxisome proliferator-activated receptors agonists. PMID:24324520

  2. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  3. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  4. Cyclic AMP levels during induction and repression of cellulase biosynthesis in Thermomonospora curvata

    SciTech Connect

    Wood, W.E.; Neubauer, D.G.; Stutzenberger, F.J.

    1984-12-01

    Specific cellulase production rates (SCPR) were compared with intracellular cyclic AMP (cAMP) levels in the thermophilic actinomycete, Thermomonospora curvata, during growth on several carbon sources in a chemically defined medium. SCPR and cAMP levels were 0.03 U (endoglucanase (EG) units) and 2 pmol per mg of dry cells, respectively, during exponential growth on glucose. These values increased to about 6 and 25, respectively, during growth on cellulose. Detectable EG production ceased when cAMP levels dropped below 10. Cellobiose (usually considered to be a cellulase inducer) caused a sharp decrease in cAMP levels and repressed EG production when added to cellulose-grown cultures. 2-deoxy-D-glucose, although nometabolizable in T. curvata, depressed cAMP to levels observed with glucose, but unlike glucose, the 2DG effect persisted until cells were washed and transferred to fresh medium. SCPR values and cAMP levels in cells grown in continuous culture under conditions of cellobiose limitation were markedly influenced by dilution rate (D). The maxima for both occurred at D = 0.085 (culture generation time of 11.8 h). When D was held constant and cellobiose concentration was increased over a 14-fold range to support higher steady state population levels, SCPR values decreased about fivefold, indicating that extracellular catabolite accumulation may be a factor in EG repression. The role of cAMP in the mechanism of this repression appears to be neither simple nor direct, since large changes (up to 200-fold) in SCPR accompany relatively small changes (10-fold) in cellular cAMP levels.

  5. Modulation of a human lymphoblastoid B cell line by cyclic AMP. Ig secretion and phosphatidylcholine metabolism

    SciTech Connect

    Shearer, W.T.; Patke, C.L.; Gilliam, E.B.; Rosenblatt, H.M.; Barron, K.S.; Orson, F.M.

    1988-09-01

    A transformed human B cell line, LA350, was found to be sensitive to cAMP-elevating agents by responding with rapid (0 to 2 h) severalfold elevations of intracellular cAMP to treatment with cholera toxin, isobutylmethylxanthine (IBMX), forskolin, and dibutyryl cAMP (all p less than 0.001). These cAMP-elevating agents also produced significant inhibitions of subsequent (48 to 72 h) Ig secretion by the same B cells as measured by a reverse hemolytic plaque assay and an enzyme-linked immunoadsorbent assay for IgM (both p less than 0.001). PMA- and IBMX-treated cells were particularly responsive to the effects of cholera toxin, showing a doubling of cAMP content and profound decrease in Ig production (p less than 0.001). Because our previous studies had correlated activation of the metabolic turnover of the phosphatidylcholine (PC) fraction of membrane phospholipids with enhanced Ig secretion, we examined the sensitivity of PC metabolism to cAMP in control and PMA-stimulated cells. Formation of PC was found to be inhibited by forskolin and IBMX (both p less than 0.002) but breakdown of PC was stimulated (p less than 0.001). These findings imply that as the enzymatic products of PC, choline phosphate and diacylglycerol, are depleted due to the combined effects of cAMP upon synthesis and turnover of PC, there is a decrease in Ig secretion. Since diacylglycerol activates protein kinase C, it appears reasonable that Ig secretion is at least partially regulated by cAMP-responsive alterations in PC metabolism produced by protein kinase C-induced phosphorylation. We conclude that the early cAMP-sensitive changes in PC metabolism in this activated B cell line may signal for subsequent alterations in Ig secretion.

  6. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  7. Modulation of dihydropyridine-sensitive calcium channels in Drosophila by a cAMP-mediated pathway.

    PubMed

    Bhattacharya, A; Gu, G G; Singh, S

    1999-06-15

    Drosophila has proved to be a valuable system for studying the structure and function of ion channels. However, relatively little is known about the regulation of ion channels, particularly that of Ca2+ channels, in Drosophila. Physiological and pharmacological differences between invertebrate and mammalian L-type Ca2+ channels raise questions on the extent of conservation of Ca2+ channel modulatory pathways. We have examined the role of cyclic adenosine monophosphate (cAMP) cascade in modulating the dihydropyridine (DHP)-sensitive Ca2+ channels in the larval muscles of Drosophila, using mutations and drugs that disrupt specific steps in this pathway. The L-type (DHP-sensitive) Ca2+ channel current was increased in the dunce mutants, which have high cAMP concentration owing to cAMP-specific phosphodiesterase (PDE) disruption. The current was decreased in the rutabaga mutants, where adenylyl cyclase (AC) activity is altered thereby decreasing the cAMP concentration. The dunce effect was mimicked by 8-Br-cAMP, a cAMP analog, and IBMX, a PDE inhibitor. The rutabaga effect was rescued by forskolin, an AC activator. H-89, an inhibitor of protein kinase-A (PKA), reduced the current and inhibited the effect of 8-Br-cAMP. The data suggest modulation of L-type Ca2+ channels of Drosophila via a cAMP-PKA mediated pathway. While there are differences in L-type channels, as well as in components of cAMP cascade, between Drosophila and vertebrates, main features of the modulatory pathway have been conserved. The data also raise questions on the likely role of DHP-sensitive Ca2+ channel modulation in synaptic plasticity, and learning and memory, processes disrupted by the dnc and the rut mutations. PMID:10380071

  8. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  9. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  10. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade.

    PubMed

    Astakhova, Luba A; Samoiliuk, Evgeniia V; Govardovskii, Victor I; Firsov, Michael L

    2012-10-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide-gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca(2+) exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca(2+)](in). Analysis by a complete model of rod phototransduction suggests that an increase of [Ca(2+)](in) might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca(2+)](in) and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  11. Association of the cyclic AMP chemotaxis receptor with the detergent- insoluble cytoskeleton of Dictyostelium discoideum

    PubMed Central

    1984-01-01

    Treatment of 6-h differentiated Dictyostelium discoideum cells with the nonionic detergent Triton X-100 dissolves away membranes and soluble components, as judged by marker enzyme distributions, leaving intact a cytoskeletal residue that contains approximately 10% of the cell protein and 50% of the actin. Nitrobenzooxadiazo-phallacidin staining for F-actin and electron microscopy of detergent-extracted whole-mounts indicate that the cytoskeletons retain the size and shape of intact cells and contain F-actin in cortical meshworks. The cytoskeletons contain little if any remaining membrane material by morphological criteria, and the plasma membrane enzymes cyclic nucleotide phosphodiesterase and alkaline phosphatase are absent from the insoluble residue, which retains only 15% of the membrane concanavalin A-binding glycoproteins. This detergent-insoluble residue retains a specific [3H]cAMP-binding site with the nucleotide specificity, rapid kinetics and approximate affinity of the cAMP receptor on intact cells. Upon detergent extraction of cells, the number of cAMP-binding sites increases 20-70%. The binding site is attached to the insoluble residue whether or not the cAMP receptor is occupied at the time of detergent addition. The pH dependence for recovery of the insoluble cAMP-binding site is much sharper than that on intact cells or membranes with an optimum at pH 6.1. Conditions of pH and ionic composition that lead to disruption of the cytoskeleton upon detergent treatment also result in the loss of cAMP binding. During differentiation, the detergent- insoluble cAMP binding increases in parallel with cell surface cAMP receptors and chemotaxis to cAMP. PMID:6693497

  12. Molecular design and genetic optimization of antimicrobial peptides containing unnatural amino acids against antibiotic-resistant bacterial infections.

    PubMed

    He, Yongkang; He, Xiaofeng

    2016-09-01

    Antimicrobial peptides (AMPs) have been the focus of intense research towards the finding of a viable alternative to current small-molecule antibiotics, owing to their commonly observed and naturally occurring resistance against pathogens. However, natural peptides have many problems such as low bioavailability and high allergenicity that largely limit the clinical applications of AMPs. In the present study, an integrative protocol that combined chemoinformatics modeling, molecular dynamics simulations, and in vitro susceptibility test was described to design AMPs containing unnatural amino acids (AMP-UAAs). To fulfill this, a large panel of synthetic AMPs with determined activity was collected and used to perform quantitative structure-activity relationship (QSAR) modeling. The obtained QSAR predictors were then employed to direct genetic algorithm (GA)-based optimization of AMP-UAA population, to which a number of commercially available, structurally diverse unnatural amino acids were introduced during the optimization process. Subsequently, several designed AMP-UAAs were confirmed to have high antibacterial potency against two antibiotic-resistant strains, i.e. multidrug-resistant Pseudomonas aeruginosa (MDRPA) and methicillin-resistant Staphylococcus aureus (MRSA), with minimum inhibitory concentration (MIC) < 10 μg/ml. Structural dynamics characterizations revealed that the most potent AMP-UAA peptide is an amphipathic helix that can spontaneously embed into an artificial lipid bilayer and exhibits a strong destructuring tendency associated with the embedding process. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 746-756, 2016.

  13. Molecular design and genetic optimization of antimicrobial peptides containing unnatural amino acids against antibiotic-resistant bacterial infections.

    PubMed

    He, Yongkang; He, Xiaofeng

    2016-09-01

    Antimicrobial peptides (AMPs) have been the focus of intense research towards the finding of a viable alternative to current small-molecule antibiotics, owing to their commonly observed and naturally occurring resistance against pathogens. However, natural peptides have many problems such as low bioavailability and high allergenicity that largely limit the clinical applications of AMPs. In the present study, an integrative protocol that combined chemoinformatics modeling, molecular dynamics simulations, and in vitro susceptibility test was described to design AMPs containing unnatural amino acids (AMP-UAAs). To fulfill this, a large panel of synthetic AMPs with determined activity was collected and used to perform quantitative structure-activity relationship (QSAR) modeling. The obtained QSAR predictors were then employed to direct genetic algorithm (GA)-based optimization of AMP-UAA population, to which a number of commercially available, structurally diverse unnatural amino acids were introduced during the optimization process. Subsequently, several designed AMP-UAAs were confirmed to have high antibacterial potency against two antibiotic-resistant strains, i.e. multidrug-resistant Pseudomonas aeruginosa (MDRPA) and methicillin-resistant Staphylococcus aureus (MRSA), with minimum inhibitory concentration (MIC) < 10 μg/ml. Structural dynamics characterizations revealed that the most potent AMP-UAA peptide is an amphipathic helix that can spontaneously embed into an artificial lipid bilayer and exhibits a strong destructuring tendency associated with the embedding process. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 746-756, 2016. PMID:27258330

  14. Role of phosphodiesterases in the shaping of sub-plasma-membrane cAMP oscillations and pulsatile insulin secretion.

    PubMed

    Tian, Geng; Sågetorp, Jenny; Xu, Yunjian; Shuai, Hongyan; Degerman, Eva; Tengholm, Anders

    2012-11-01

    Specificity and versatility in cyclic AMP (cAMP) signalling are governed by the spatial localisation and temporal dynamics of the signal. Phosphodiesterases (PDEs) are important for shaping cAMP signals by hydrolyzing the nucleotide. In pancreatic β-cells, glucose triggers sub-plasma-membrane cAMP oscillations, which are important for insulin secretion, but the mechanisms underlying the oscillations are poorly understood. Here, we investigated the role of different PDEs in the generation of cAMP oscillations by monitoring the concentration of cAMP in the sub-plasma-membrane space ([cAMP](pm)) with ratiometric evanescent wave microscopy in MIN6 cells or mouse pancreatic β-cells expressing a fluorescent translocation biosensor. The general PDE inhibitor IBMX increased [cAMP](pm), and whereas oscillations were frequently observed at 50 µM IBMX, 300 µM-1 mM of the inhibitor caused a stable increase in [cAMP](pm). The [cAMP](pm) was nevertheless markedly suppressed by the adenylyl cyclase inhibitor 2',5'-dideoxyadenosine, indicating IBMX-insensitive cAMP degradation. Among IBMX-sensitive PDEs, PDE3 was most important for maintaining a low basal level of [cAMP](pm) in unstimulated cells. After glucose induction of [cAMP](pm) oscillations, inhibitors of PDE1, PDE3 and PDE4 inhibitors the average cAMP level, often without disturbing the [cAMP](pm) rhythmicity. Knockdown of the IBMX-insensitive PDE8B by shRNA in MIN6 cells increased the basal level of [cAMP](pm) and prevented the [cAMP](pm)-lowering effect of 2',5'-dideoxyadenosine after exposure to IBMX. Moreover, PDE8B-knockdown cells showed reduced glucose-induced [cAMP](pm) oscillations and loss of the normal pulsatile pattern of insulin secretion. It is concluded that [cAMP](pm) oscillations in β-cells are caused by periodic variations in cAMP generation, and that several PDEs, including PDE1, PDE3 and the IBMX-insensitive PDE8B, are required for shaping the sub-membrane cAMP signals and pulsatile insulin release.

  15. [Adrenaline and cyclic AMP stimulation of ketopentose and sedoheptulose formation in rat liver homogenates].

    PubMed

    Kolotilova, A I; Glushankov, E P; Epifanova, Iu E

    1976-01-01

    Formation of sedoheptulose-7-phosphate and ketopentose phosphate was studied in vitro as affected by epinephrine and cAMP. No effect of epinephrine on the activity of transketolase was found with ribose-5-phosphate as a substrate of the nonoxidative reactions of the pentose phosphate ccyle. Epinephrine and cAMP enhance the formation of ketopentoses and sedoheptulose with glycogen as a main carbohydrate source, which is most pronounced in the experiments with cold preincubation. The phosphorylase system mediate influence of epinephrine and cAMP on the nonoxidative reactions products may be assumed.

  16. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  17. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release

    PubMed Central

    Atchison, Douglas K.; Harding, Pamela; Cecilia Ortiz-Capisano, M.; Peterson, Edward L.

    2012-01-01

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log10 means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot−1·h−1 (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells. PMID:22896038

  18. Parathyroid hormone stimulates juxtaglomerular cell cAMP accumulation without stimulating renin release.

    PubMed

    Atchison, Douglas K; Harding, Pamela; Cecilia Ortiz-Capisano, M; Peterson, Edward L; Beierwaltes, William H

    2012-10-15

    Parathyroid hormone (PTH) is positively coupled to the generation of cAMP via its actions on the PTH1R and PTH2R receptors. Renin secretion from juxtaglomerular (JG) cells is stimulated by elevated intracellular cAMP, and every stimulus that increases renin secretion is thought to do so via increasing cAMP. Thus we hypothesized that PTH increases renin release from primary cultures of mouse JG cells by elevating intracellular cAMP via the PTH1R receptor. We found PTH1R, but not PTH2R, mRNA expressed in JG cells. While PTH increased JG cell cAMP content from (log(10) means ± SE) 3.27 ± 0.06 to 3.92 ± 0.12 fmol/mg protein (P < 0.001), it did not affect renin release. The PTH1R-specific agonist, parathyroid hormone-related protein (PTHrP), also increased JG cell cAMP from 3.13 ± 0.09 to 3.93 ± 0.09 fmol/mg protein (P < 0.001), again without effect on renin release. PTH2R receptor agonists had no effect on cAMP or renin release. PTHrP increased cAMP in the presence of both low and high extracellular calcium from 3.31 ± 0.17 to 3.83 ± 0.20 fmol/mg protein (P < 0.01) and from 3.29 ± 0.18 to 3.63 ± 0.22 fmol/mg protein (P < 0.05), respectively, with no effect on renin release. PTHrP increased JG cell cAMP in the presence of adenylyl cyclase-V inhibition from 2.85 ± 0.17 to 3.44 ± 0.14 fmol/mg protein (P < 0.001) without affecting renin release. As a positive control, forskolin increased JG cell cAMP from 3.39 ± 0.13 to 4.48 ± 0.07 fmol/mg protein (P < 0.01) and renin release from 2.96 ± 0.10 to 3.29 ± 0.08 ng ANG I·mg prot(-1)·h(-1) (P < 0.01). Thus PTH increases JG cell cAMP via non-calcium-sensitive adenylate cyclases without affecting renin release. These data suggest compartmentalization of cAMP signaling in JG cells.

  19. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  20. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  1. Cyclic AMP regulates the biosynthesis of cellobiohydrolase in Cellulomonas flavigena growing in sugar cane bagasse.

    PubMed

    Herrera-Herrera, Jesús Antonio; Pérez-Avalos, Odilia; Salgado, Luis M; Ponce-Noyola, Teresa

    2009-10-01

    Cellulomonas flavigena produces a battery of cellulase components that act concertedly to degrade cellulose. The addition of cAMP to repressed C. flavigena cultures released catabolic repression, while addition of cAMP to induced C. flavigena cultures led to a cellobiohydrolase hyperproduction. Exogenous cAMP showed positive regulation on cellobiohydrolase production in C. flavigena grown on sugar cane bagasse. A C. flavigena cellobiohydrolase gene was cloned (named celA), which coded for a 71- kDa enzyme. Upstream, a repressor celR1, identified as a 38 kDa protein, was monitored by use of polyclonal antibodies.

  2. Phosphorylation of the human 1,25-dihydroxyvitamin D3 receptor by cAMP-dependent protein kinase, in vitro, and in transfected COS-7 cells.

    PubMed

    Jurutka, P W; Hsieh, J C; Haussler, M R

    1993-03-31

    We report that the human 1,25-dihydroxyvitamin D3 receptor is an efficient substrate for cAMP-dependent protein kinase, in vitro. This phosphorylation reaction is rapid and neither dependent upon nor significantly affected by the presence of the 1,25-dihydroxyvitamin D3 ligand. Preliminary mapping experiments utilizing C-terminal truncation mutants reveal that the primary site(s) of phosphorylation, in vitro, is localized between amino acids 133 and 201. Cotransfection of the catalytic subunit of murine cAMP-dependent protein kinase and the human 1,25-dihydroxyvitamin D3 receptor into monkey kidney (COS-7) cells not only results in a dramatic kinase-dependent increase in receptor phosphorylation but also elicits an attenuation in 1,25-dihydroxyvitamin D3-dependent transcriptional activation of a reporter gene. These observations suggest a potential role for cAMP-dependent protein kinase in the modulation of 1,25-dihydroxyvitamin D3 receptor-mediated gene regulation. PMID:8385450

  3. Relationship between inhibition of cyclic AMP production in Chinese hamster ovary cells expressing the rat D2(444) receptor and antagonist/agonist binding ratios.

    PubMed Central

    Harley, E. A.; Middlemiss, D. N.; Ragan, C. I.

    1995-01-01

    1. Radioligand binding assays using [3H]-(-)-sulpiride, in the presence of 1 mM ethylenediaminetetraacetic acid (EDTA) and 100 microM guanylylimidodiphosphate (GppNHp) and [3H]-N0437 were developed to label the low and high agonist affinity states of the rD2(444) receptor (long form of the rat D2 receptor) respectively. The ratios of the affinities of compounds in these two assays (Kapp [3H]-(-)-supiride/Kapp [3H]-N-0437) were then calculated. 2. The prediction that the binding ratio reflected the functional efficacy of a compound was supported by measurement of the ability of a number of compounds acting at dopamine receptors to inhibit rD2(444)-mediated inhibition of cyclic AMP production. When the rank order of the ratios of a number of these compounds was compared to their ability to inhibit the production of cyclic AMP, a significant correlation was seen (Spearman rank correlation coefficient = 0.943, P = 0.01). 3. In conclusion, the sulpiride/N-0437 binding ratio reliably predicted the efficacy of compounds acting at dopamine receptors to inhibit cyclic AMP production mediated by the rD2(444) receptor. PMID:7582561

  4. Solution structure of Ace-AMP1, a potent antimicrobial protein extracted from onion seeds. Structural analogies with plant nonspecific lipid transfer proteins.

    PubMed

    Tassin, S; Broekaert, W F; Marion, D; Acland, D P; Ptak, M; Vovelle, F; Sodano, P

    1998-03-17

    The three-dimensional solution structure of Ace-AMP1, an antifungal protein extracted from onion seeds, was determined using 1H NMR spectroscopy and molecular modeling. This cationic protein contains 93 amino acid residues and four disulfide bridges. Its structure was determined from 1260 NOE-derived distance restraints and 173 dihedral restraints derived from NOEs and 3JCaHNH coupling constants. The global fold involves four helical segments connected by three loops and a C-terminal tail without regular secondary structures, except for a 3(10)-helix turn and a beta-turn. The most striking feature is the absence of any continuous cavity running through the whole molecule as found in recently determined structures of nonspecific transfer proteins extracted from wheat and maize seeds, although their global folds are very similar. Consistent with the absence of a cavity in the core of Ace-AMP1, it was found that this protein, in contrast to ns-LTPs, does not bind fluorescently labeled phospholipids in solution. On the other hand, Ace-AMP1 is able to interact with phospholipid membranes as shown by the release of carboxyfluorescein from the lumen of artificial liposomes and by the induction of alterations in fluorescence polarization of fluorescently labeled phospholipids embedded in artificial liposomes. PMID:9521681

  5. 14-Deoxyandrographolide alleviates ethanol-induced hepatosteatosis through stimulation of AMP-activated protein kinase activity in rats.

    PubMed

    Mandal, Samir; Mukhopadhyay, Sibabrata; Bandhopadhyay, Sukdeb; Sen, Gargi; Biswas, Tuli

    2014-03-01

    Andrographis paniculata (AP) is a traditional medicinal plant of Ayurveda. It grows widely in Asia and is prescribed in the treatment of liver diseases. Here we have investigated the beneficial role of 14-deoxyandrographolide (14-DAG), a bioactive diterpenoid from AP, against alcoholic steatosis in rats. 14-DAG was extracted from aerial parts (leaves and stems) of AP. Rats were fed with ethanol for 8 weeks. Animals were treated with 14-DAG during the last 4 weeks of ethanol treatment. In vitro studies were undertaken in a human hepatocellular liver carcinoma cell line culture. Hepatosteatosis was assessed from histopathological studies of liver sections. Acetyl-CoA, malonyl-CoA, and triglyceride contents were determined using commercially available kits. Fatty acid synthesis was evaluated from incorporation of 1-(14)C acetate. Regulation of fatty acid oxidation and lipogenesis were monitored with immunoblotting and immunoprecipitation studies. Ethanol exposure led to hepatotoxicity, as evident from the marked enhancement in the levels of AST and ALT. The values decreased almost to control levels in response to 14-DAG treatment. Results showed that ethanol feeding induced deactivation of AMP-activated protein kinase (AMPK) that led to enhanced lipid synthesis and decreased fatty acid oxidation, culminating in hepatic fat accumulation. Treatment with 14-DAG activated AMPK through induction of cyclic AMP-protein kinase A pathway. Activation of AMPK was followed by down-regulation of sterol regulatory element binding protein-1c, acetyl-CoA carboxylase, and fatty acid synthase, leading to suppression of lipogenesis. This was associated with up-regulation of sirtuin 1 and depletion of malonyl-CoA, in favor of increased fatty acid oxidation. 14-DAG controlled ethanol-induced hepatosteatosis by interfering with dysregulation of lipid metabolism. In conclusion, our results indicated that 14-DAG was capable of preventing the development of fatty liver through AMPK

  6. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  7. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  8. Expression of orphan G-protein coupled receptor GPR174 in CHO cells induced morphological changes and proliferation delay via increasing intracellular cAMP

    SciTech Connect

    Sugita, Kazuya; Yamamura, Chiaki; Tabata, Ken-ichi; Fujita, Norihisa

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Expression of GPR174 in CHO cells induces morphological changes and proliferation delay. Black-Right-Pointing-Pointer These are due to increase in intracellular cAMP concentration. Black-Right-Pointing-Pointer Lysophosphatidylserine was identified to stimulate GPR174 leading to activate ACase. Black-Right-Pointing-Pointer The potencies of fatty acid moiety on LysoPS were oleoyl Greater-Than-Or-Slanted-Equal-To stearoyl > palmitoyl. Black-Right-Pointing-Pointer We propose that GPR174 is a lysophosphatidylserine receptor. -- Abstract: We established cell lines that stably express orphan GPCR GPR174 using CHO cells, and studied physiological and pharmacological features of the receptor. GPR174-expressing cells showed cell-cell adhesion with localization of actin filaments to cell membrane, and revealed significant delay of cell proliferation. Since the morphological changes of GPR174-cells were very similar to mock CHO cells treated with cholera toxin, we measured the concentration of intracellular cAMP. The results showed the concentration was significantly elevated in GPR174-cells. By measuring intracellular cAMP concentration in GPR174-cells, we screened lipids and nucleotides to identify ligands for GPR174. We found that lysophosphatidylserine (LysoPS) stimulated increase in intracellular cAMP in a dose-dependent manner. Moreover, phosphorylation of Erk was elevated by LysoPS in GPR174 cells. These LysoPS responses were inhibited by NF449, an inhibitor of G{alpha}{sub s} protein. These results suggested that GPR174 was a putative LysoPS receptor conjugating with G{alpha}{sub s}, and its expression induced morphological changes in CHO cells by constitutively activating adenylyl cycles accompanied with cell conjunctions and delay of proliferation.

  9. A Ric8/synembryn homolog promotes Gpa1 and Gpa2 activation to respectively regulate cyclic AMP and pheromone signaling in Cryptococcus neoformans.

    PubMed

    Gong, Jinjun; Grodsky, Jacob D; Zhang, Zhengguang; Wang, Ping

    2014-10-01

    The G protein α subunits Gpa1, Gpa2, and Gpa3 mediate signal transduction and are important in the growth and virulence of Cryptococcus neoformans. To understand how Gpa1 functions without a conventional Gβ subunit, we characterized a resistance to inhibitors of cholinesterase 8 (Ric8) homolog from C. neoformans, which shares amino acid sequence homology with other Ric8 proteins that exhibit guanine nucleotide exchange factor (GEF) activity toward Gα. We found that the ric8 mutant was reduced in capsule size and melanin formation, which could be suppressed by cyclic AMP (cAMP) supplementation or by introducing the activated GPA1(Q284L) allele. Consistent with the fact that Ric8 participates in cAMP signaling to regulate virulence, the ric8 mutant was attenuated in virulence toward mice. Interestingly, disruption of RIC8 also resulted in opposing effects on pheromone signaling, as the ric8 mutant showed reduced mating but an enhanced ability to induce the pheromone response in the mating partner. To identify Ric8 functional mechanisms, we examined the interactions between Ric8 and the three Gα proteins. Ric8 interacted with Gpa1 and Gpa2, but not Gpa3. The presence of Gpa1(Q284L) negatively affected its interaction with Ric8, whereas the activated Gpa2(Q203L) allele abolished the interaction. Collectively, these findings suggest that Ric8 functions as a GEF to facilitate the activation of Gpa1-cAMP signaling and to promote Gpa2, affecting mating efficiency. Our study highlights the distinct and conserved characteristics associated with G protein signaling and contributes to our overall understanding of how G protein α subunits function with or without a canonical Gβ partner in C. neoformans.

  10. A Ric8/Synembryn Homolog Promotes Gpa1 and Gpa2 Activation To Respectively Regulate Cyclic AMP and Pheromone Signaling in Cryptococcus neoformans

    PubMed Central

    Gong, Jinjun; Grodsky, Jacob D.; Zhang, Zhengguang

    2014-01-01

    The G protein α subunits Gpa1, Gpa2, and Gpa3 mediate signal transduction and are important in the growth and virulence of Cryptococcus neoformans. To understand how Gpa1 functions without a conventional Gβ subunit, we characterized a resistance to inhibitors of cholinesterase 8 (Ric8) homolog from C. neoformans, which shares amino acid sequence homology with other Ric8 proteins that exhibit guanine nucleotide exchange factor (GEF) activity toward Gα. We found that the ric8 mutant was reduced in capsule size and melanin formation, which could be suppressed by cyclic AMP (cAMP) supplementation or by introducing the activated GPA1Q284L allele. Consistent with the fact that Ric8 participates in cAMP signaling to regulate virulence, the ric8 mutant was attenuated in virulence toward mice. Interestingly, disruption of RIC8 also resulted in opposing effects on pheromone signaling, as the ric8 mutant showed reduced mating but an enhanced ability to induce the pheromone response in the mating partner. To identify Ric8 functional mechanisms, we examined the interactions between Ric8 and the three Gα proteins. Ric8 interacted with Gpa1 and Gpa2, but not Gpa3. The presence of Gpa1Q284L negatively affected its interaction with Ric8, whereas the activated Gpa2Q203L allele abolished the interaction. Collectively, these findings suggest that Ric8 functions as a GEF to facilitate the activation of Gpa1-cAMP signaling and to promote Gpa2, affecting mating efficiency. Our study highlights the distinct and conserved characteristics associated with G protein signaling and contributes to our overall understanding of how G protein α subunits function with or without a canonical Gβ partner in C. neoformans. PMID:25084863

  11. Binding of the Citrobacter freundii AmpR regulator to a single DNA site provides both autoregulation and activation of the inducible ampC beta-lactamase gene.

    PubMed Central

    Lindquist, S; Lindberg, F; Normark, S

    1989-01-01

    Citrobacter freundii encodes an inducible chromosomal beta-lactamase. Induction requires the product of the ampR gene, which is transcribed in the opposite orientation from the ampC beta-lactamase gene. We show here that the AmpR protein acts as a transcriptional activator by binding to a DNA region immediately upstream of the ampC promoter. The DNase I footprint pattern was not affected by growth in the presence of beta-lactam inducer or by the use of extracts prepared from cells carrying the ampD2 allele leading to semiconstitutive production of beta-lactamase. It is suggested that activation of AmpR facilitates binding or open complex formation for RNA polymerase at the ampC promoter. The AmpR-binding site overlaps the ampR promoter, and beta-galactosidase activity was decreased from an ampR-lacZ transcriptional fusion when AmpR was expressed from a coresident plasmid, suggesting that ampR is autogenously controlled. The AmpR protein belongs to a family of highly homologous transcriptional activators that includes LysR, which regulates the E. coli lysine synthetase gene, and the NodD protein, which regulates expression of a number of genes involved in nodulation in Rhizobium. The lack of sequence homology to any known beta-lactam-binding protein suggests that AmpR does not bind directly to the beta-lactam inducer but interacts with a second messenger of unknown nature. Images PMID:2786868

  12. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    SciTech Connect

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon; Kanter, Joan R.; Prabhakar, Shyam; Salomonis, Nathan; Vranizan, Karen; Dubchak Inna,; Conklin, Bruce R.; Insel, Paul A.

    2005-06-01

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrest of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.

  13. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-11-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  14. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  15. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  16. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.

  17. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  18. N-Acetyl-D- and L-esters of 5'-AMP hydrolyze at different rates

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1993-01-01

    Studies of the properties of aminoacyl derivatives of 5'-AMP are aimed at understanding the origin of the process of protein synthesis. Aminoacyl (2',3') esters of 5'-AMP can serve as models of the 3'-terminus of aminoacyl tRNA. We report here on the relative rates of hydrolysis of Ac-D- and L-Phe AMP esters as a function of pH. At all pHs above 3, the rate constant of hydrolysis of the Ac-L-Phe ester is 1.7 to 2.1 times that of Ac-D-Phe ester. The D-isomer seems partially protected from hydrolysis by a stronger association with the adenine ring of the 5'-AMP.

  19. Role of the cAMP Pathway in Glucose and Lipid Metabolism.

    PubMed

    Ravnskjaer, Kim; Madiraju, Anila; Montminy, Marc

    2016-01-01

    3'-5'-Cyclic adenosine monophosphate (cyclic AMP or cAMP) was first described in 1957 as an intracellular second messenger mediating the effects of glucagon and epinephrine on hepatic glycogenolysis (Berthet et al., J Biol Chem 224(1):463-475, 1957). Since this initial characterization, cAMP has been firmly established as a versatile molecular signal involved in both central and peripheral regulation of energy homeostasis and nutrient partitioning. Many of these effects appear to be mediated at the transcriptional level, in part through the activation of the transcription factor CREB and its coactivators. Here we review current understanding of the mechanisms by which the cAMP signaling pathway triggers metabolic programs in insulin-responsive tissues.

  20. The plasma cyclic AMP response to catecholamines as potentiated by phentolamine in rats.

    PubMed

    Kunitada, S; Ui, M

    1978-05-15

    Norepinephrine failed to increase plasma cyclic AMP when injected alone into fasted rats, in contrast with sharp increases elicited by isoproterenol, epinephrine or tyramine. In rats pretreated with 6-hydroxydopamine or cocain, however, there was significant increase in plasma cyclic AMP after norepinephrine injection, suggesting that the rapid neuronal catecholamine uptake was at least partly responsible for the lack of norepinephrine action. Phentolamine was very effective in enhancing the epinephrine-, norepinephrine- or tyramine-induced increase in plasma cyclic AMP but without effect on the isoproterenol-induced increase. Blockade of postsynaptic alpha-adrenoceptors, rather than of presynaptic receptors, is likely to be involved in the phentolamine potentiation, since it was even observed in rats treated with 6-hydroxydopamine or cocaine. A discussion is presented regarding the mechanism by which cyclic AMP generation is influenced by the alpha- and beta-adrenoceptor interaction on effector cell membranes.

  1. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  2. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  3. Effect of Glucagon on Net Splanchnic Cyclic AMP Production in Normal and Diabetic Men

    PubMed Central

    Liljenquist, John E.; Bomboy, James D.; Lewis, Stephen B.; Sinclair-Smith, Bruce C.; Felts, Philip W.; Lacy, William W.; Crofford, Oscar B.; Liddle, Grant W.

    1974-01-01

    Glucagon activates hepatic adenylate cyclase, thereby increasing acutely the liver content of cyclic AMP (cAMP) as well as the release of cAMP into the hepatic vein. Insulin, on the other hand, antagonizes this glucagon-mediated cAMP production, thus providing a hypothetical mechanism through which insulin might correct some of the metabolic abnormalities of diabetes. To study this hormonal interaction in man, net splanchnic cAMP production (NScAMPP) was investigated in normal and insulin-dependent diabetic men under basal conditions and in response to intravenous glucagon, 50 ng/kg/min for 2 h. In normals (n=19), basal hepatic vein cAMP concentration was 23.6±1.1 nM and NScAMPP was 1.7±0.6 nmol/min. Glucagon stimulated NScAMPP in four normal subjects to a peak of 99.6±43 nmol/min at 25 min with a subsequent fall to 12.4±5.1 nmol/min by 90 min despite continuing glucagon infusion. Endogenous insulin secretion was stimulated as indicated by rising levels of immunoreactive insulin and C-peptide (connecting peptide) immunoreactivity, raising the possibility that endogenous insulin might be responsible for the fall in NScAMPP that followed the initial spike. In the diabetics (n=8), basal hepatic vein cAMP concentration was 24.7±1.2 nM and NScAMPP was undetectable. Glucagon stimulated NScAMPP in five diabetics to a peak of 169.9±42.6 with a subsequent fall to 17.4±3.9 nmol/min by 90 min even though endogenous insulin secretion was not stimulated (no rise in C-peptide immunoreactivity). Although the mean increase in NScAMPP was greater in the diabetics, the two groups did not differ significantly. Conclusions. In normal resting man the liver is a significant source of circulating cAMP. Diabetics do not release abnormally large amounts of hepatic cAMP under basal conditions. Glucagon markedly enhances hepatic cAMP release with a spike-decline pattern in both normal and diabetic men. The decline in hepatic cAMP release despite continuing glucagon stimulation is due

  4. SCAP/SREBP pathway is required for the full steroidogenic response to cyclic AMP.

    PubMed

    Shimizu-Albergine, Masami; Van Yserloo, Brian; Golkowski, Martin G; Ong, Shao-En; Beavo, Joseph A; Bornfeldt, Karin E

    2016-09-20

    Luteinizing hormone (LH) stimulates steroidogenesis largely through a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically dependent on the availability of cholesterol at mitochondrial sites of synthesis. This cholesterol is provided by cellular uptake of lipoproteins, mobilization of intracellular lipid, and de novo synthesis. Whether and how these pathways are coordinated by cAMP are poorly understood. Recent phosphoproteomic analyses of cAMP-dependent phosphorylation sites in MA10 Leydig cells suggested that cAMP regulates multiple steps in these processes, including activation of the SCAP/SREBP pathway. SCAP [sterol-regulatory element-binding protein (SREBP) cleavage-activating protein] acts as a cholesterol sensor responsible for regulating intracellular cholesterol balance. Its role in cAMP-mediated control of steroidogenesis has not been explored. We used two CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated protein 9) knockout approaches to test the role of SCAP in steroidogenesis. Our results demonstrate that SCAP is required for progesterone production induced by concurrent inhibition of the cAMP phosphodiesterases PDE4 and PDE8. These inhibitors increased SCAP phosphorylation, SREBP2 activation, and subsequent expression of cholesterol biosynthetic genes, whereas SCAP deficiency largely prevented these effects. Reexpression of SCAP in SCAP-deficient cells restored SREBP2 protein expression and partially restored steroidogenic responses, confirming the requirement of SCAP-SREBP2 in steroidogenesis. Inhibitors of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase and isoprenylation attenuated, whereas exogenously provided cholesterol augmented, PDE inhibitor-induced steroidogenesis, suggesting that the cholesterol substrate needed for steroidogenesis is provided by both de novo synthesis and isoprenylation-dependent mechanisms. Overall, these results demonstrate a novel role for LH/cAMP in SCAP

  5. Estradiol increases cAMP in the oviductal secretory cells through a nongenomic mechanism.

    PubMed

    Oróstica, María L; Lopez, John; Rojas, Israel; Rocco, Jocelyn; Díaz, Patricia; Reuquén, Patricia; Cardenas, Hugo; Parada-Bustamante, Alexis; Orihuela, Pedro A

    2014-09-01

    In the rat oviduct, estradiol (E2) accelerates egg transport by a nongenomic action that requires previous conversion of E2 to methoxyestrogens via catechol-O-methyltranferase (COMT) and activation of estrogen receptor (ER) with subsequent production of cAMP and inositol triphosphate (IP3). However, the role of the different oviductal cellular phenotypes on this E2 nongenomic pathway remains undetermined. The aim of this study was to investigate the effect of E2 on the levels of cAMP and IP3 in primary cultures of secretory and smooth muscle cells from rat oviducts and determine the mechanism by which E2 increases cAMP in the secretory cells. In the secretory cells, E2 increased cAMP but not IP3, while in the smooth muscle cells E2 decreased cAMP and increased IP3. Suppression of protein synthesis by actinomycin D did not prevent the E2-induced cAMP increase, but this was blocked by the ER antagonist ICI 182 780 and the inhibitors of COMT OR 486, G protein-α inhibitory (Gαi) protein pertussis toxin and adenylyl cyclase (AC) SQ 22536. Expression of the mRNA for the enzymes that metabolizes estrogens, Comt, Cyp1a1, and Cyp1b1 was found in the secretory cells, but this was not affected by E2. Finally, confocal immunofluorescence analysis showed that E2 induced colocalization between ESR1 (ERα) and Gαi in extranuclear regions of the secretory cells. We conclude that E2 differentially regulates cAMP and IP3 in the secretory and smooth muscle cells of the rat oviduct. In the secretory cells, E2 increases cAMP via a nongenomic action that requires activation of COMT and ER, coupling between ESR1 and Gαi, and stimulation of AC.

  6. Studying the regulation of endosomal cAMP production in GPCR signaling

    PubMed Central

    Gidon, Alexandre; Feinstein, Timothy N.; Xiao, Kunhong; Vilardaga, Jean-Pierre

    2016-01-01

    We describe methods based on live cell fluorescent microscopy and mass spectrometry to characterize the mechanism of endosomal cAMP production and its regulation using the parathyroid hormone (PTH) type 1 receptor as a prime example. These methods permit to measure rapid changes of cAMP levels in response to PTH, kinetics of endosomal ligand–receptor interaction, pH changes associated with receptor trafficking, and to identify the endosomal receptor interactome. PMID:26928541

  7. The ever unfolding story of cAMP signaling in trypanosomatids: vive la difference!

    PubMed Central

    Tagoe, Daniel N. A.; Kalejaiye, Titilola D.; de Koning, Harry P.

    2015-01-01

    Kinetoplastids are unicellular, eukaryotic, flagellated protozoans containing the eponymous kinetoplast. Within this order, the family of trypanosomatids are responsible for some of the most serious human diseases, including Chagas disease (Trypanosoma cruzi), sleeping sickness (Trypanosoma brucei spp.), and leishmaniasis (Leishmania spp). Although cAMP is produced during the life cycle stages of these parasites, its signaling pathways are very different from those of mammals. The absence of G-protein-coupled receptors, the presence of structurally different adenylyl cyclases, the paucity of known cAMP effector proteins and the stringent need for regulation of cAMP in the small kinetoplastid cells all suggest a significantly different biochemical pathway and likely cell biology. However, each of the main kinetoplastid parasites express four class 1-type cyclic nucleotide-specific phosphodiesterases (PDEA-D), which have highly similar catalytic domains to that of human PDEs. To date, only TbrPDEB, expressed as two slightly different isoforms TbrPDEB1 and B2, has been found to be essential when ablated. Although the genomes contain reasonably well conserved genes for catalytic and regulatory domains of protein kinase A, these have been shown to have varied structural and functional roles in the different species. Recent discovery of a role of cAMP/AMP metabolism in a quorum-sensing signaling pathway in T. brucei, and the identification of downstream cAMP Response Proteins (CARPs) whose expression levels correlate with sensitivity to PDE inhibitors, suggests a complex signaling cascade. The interplay between the roles of these novel CARPs and the quorum-sensing signaling pathway on cell division and differentiation makes for intriguing cell biology and a new paradigm in cAMP signal transduction, as well as potential targets for trypanosomatid-specific cAMP pathway-based therapeutics. PMID:26441645

  8. Cyclic-AMP Mediated Regulation of ABCB mRNA Expression in Mussel Haemocytes

    PubMed Central

    Franzellitti, Silvia; Fabbri, Elena

    2013-01-01

    Background The multixenobiotic resistance system (MXR) allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp). In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. Methodology/Principal Findings cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis) exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX) alone or in combination with 0.3 ng/L propranolol (PROP). FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin) and pharmacological modulators (PROP, forskolin, dbcAMP, and H89) of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT) decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. Conclusions This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels. PMID:23593491

  9. Blockade of beta-adrenoceptors enhances cAMP signal transduction in vivo

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Johnson, A. K.; Lewis, S. J.

    1998-01-01

    The aim of this study was to determine whether the blockade of beta-adrenoceptors would enhance cAMP-mediated signal transduction processes in vivo. The administration of the membrane permeable cAMP analogue, 8-(4-chlorophenylthiol)-cAMP (8-CPT-cAMP, 10 micromol/kg, i.v.) produced an increase in heart rate (+27 +/- 2%, P < 0.05), a fall in mean arterial blood pressure (-21 +/- 3%, P < 0.05) and falls in hindquarter (-12 +/- 3%, P < 0.05) and mesenteric (-32 +/- 3%, P < 0.05) vascular resistances in pentobarbital-anesthetized rats. The beta-adrenoceptor antagonist, propranolol (1 mg/kg, i.v.) lowered heart rate (-12 +/- 3%, P < 0.05) but did not affect mean arterial blood pressure or vascular resistances. The tachycardia, hypotension and vasodilation produced by 8-CPT-cAMP were exaggerated after administration of propranolol (P < 0.05 for all comparisons). The nitric oxide-donor, sodium nitroprusside (2 microg/kg, i.v.), produced falls in mean arterial blood pressure and vascular resistances of similar magnitude to those produced by 8-CPT-cAMP. These sodium nitroprusside-induced responses were unaffected by propranolol (P < 0.05 for all comparisons). Sodium nitroprusside also produced a minor increase in heart rate (+5 +/- 1%, P < 0.05) which was abolished by propranolol. These findings suggest that 8-CPT-cAMP directly increases heart rate and that blockade of beta-adrenoceptors enhances the potency of cAMP within the heart and vasculature.

  10. 5′-AMP impacts lymphocyte recirculation through activation of A2B receptors

    PubMed Central

    Bouma, Hjalmar R.; Mandl, Judith N.; Strijkstra, Arjen M.; Boerema, Ate S.; Kok, Jan-Willem; van Dam, Annie; IJzerman, Ad; Kroese, Frans G. M.; Henning, Robert H.

    2013-01-01

    Natural hibernation consists of torpid phases with metabolic suppression alternating with euthermic periods. Induction of torpor holds substantial promise in various medical conditions, including trauma, major surgery, and transplantation. Torpor in mice can be induced pharmacologically by 5′-AMP. Previously, we showed that during natural torpor, the reduction in body temperature results in lymphopenia via a reduction in plasma S1P. Here, we show that during torpor induced by 5′-AMP, there is a similar reduction in the number of circulating lymphocytes that is a result of their retention in secondary lymphoid organs. This lymphopenia could be mimicked by engagement of A2BRs by a selective A2BR agonist (LUF6210) in the absence of changes in temperature and prevented by A2BR antagonists during 5′-AMP-induced torpor. In addition, forced cooling of mice led to peripheral blood lymphopenia, independent of A2BR signaling. The induction of torpor using 5′-AMP impacted the migration of lymphocytes within and between secondary lymphoid organs. During torpor, the homing into LNs was impaired, and two-photon intravital microscopy revealed that cell motility was decreased significantly and rapidly upon 5′-AMP administration. Furthermore, the S1P plasma concentration was reduced by 5′-AMP but not by LUF6210. S1P plasma levels restored upon arousal. Likely, the reduced migration in LNs combined with the reduced S1P plasma level substantially reduces lymphocyte egress after injection of 5′-AMP. In conclusion, 5′-AMP induces a state of pharmacological torpor in mice, during which, lymphopenia is governed primarily by body temperature-independent suppression of lymphocyte egress from LNs. PMID:23682128

  11. Modeling mutant phenotypes and oscillatory dynamics in the Saccharomyces cerevisiae cAMP-PKA pathway

    PubMed Central

    2013-01-01

    Background The cyclic AMP-Protein Kinase A (cAMP-PKA) pathway is an evolutionarily conserved signal transduction mechanism that regulates cellular growth and differentiation in animals and fungi. We present a mathematical model that recapitulates the short-term and long-term dynamics of this pathway in the budding yeast, Saccharomyces cerevisiae. Our model is aimed at recapitulating the dynamics of cAMP signaling for wild-type cells as well as single (pde1Δ and pde2Δ) and double (pde1Δpde2Δ) phosphodiesterase mutants. Results Our model focuses on PKA-mediated negative feedback on the activity of phosphodiesterases and the Ras branch of the cAMP-PKA pathway. We show that both of these types of negative feedback are required to reproduce the wild-type signaling behavior that occurs on both short and long time scales, as well as the the observed responses of phosphodiesterase mutants. A novel feature of our model is that, for a wide range of parameters, it predicts that intracellular cAMP concentrations should exhibit decaying oscillatory dynamics in their approach to steady state following glucose stimulation. Experimental measurements of cAMP levels in two genetic backgrounds of S. cerevisiae confirmed the presence of decaying cAMP oscillations as predicted by the model. Conclusions Our model of the cAMP-PKA pathway provides new insights into how yeast respond to alterations in their nutrient environment. Because the model has both predictive and explanatory power it will serve as a foundation for future mathematical and experimental studies of this important signaling network. PMID:23680078

  12. Bile acid interactions with cholangiocytes.

    PubMed

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-06-14

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostalpha-Ostbeta. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5'-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  13. Bile acid interactions with cholangiocytes

    PubMed Central

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-01-01

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostα-Ostβ. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5’-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  14. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs).

    PubMed

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-10-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response.

  15. Dynamic fluctuations provide the basis of a conformational switch mechanism in apo cyclic AMP receptor protein.

    PubMed

    Aykaç Fas, Burcu; Tutar, Yusuf; Haliloğlu, Türkan

    2013-01-01

    Escherichia coli cyclic AMP Receptor Protein (CRP) undergoes conformational changes with cAMP binding and allosterically promotes CRP to bind specifically to the DNA. In that, the structural and dynamic properties of apo CRP prior to cAMP binding are of interest for the comprehension of the activation mechanism. Here, the dynamics of apo CRP monomer/dimer and holo CRP dimer were studied by Molecular Dynamics (MD) simulations and Gaussian Network Model (GNM). The interplay of the inter-domain hinge with the cAMP and DNA binding domains are pre-disposed in the apo state as a conformational switch in the CRP's allosteric communication mechanism. The hinge at L134-D138 displaying intra- and inter-subunit coupled fluctuations with the cAMP and DNA binding domains leads to the emergence of stronger coupled fluctuations between the two domains and describes an on state. The flexible regions at K52-E58, P154/D155 and I175 maintain the dynamic coupling of the two domains. With a shift in the inter-domain hinge position towards the N terminus, nevertheless, the latter correlations between the domains loosen and become disordered; L134-D138 dynamically interacts only with the cAMP and DNA binding domains of its own subunit, and an off state is assumed. We present a mechanistic view on how the structural dynamic units are hierarchically built for the allosteric functional mechanism; from apo CRP monomer to apo-to-holo CRP dimers.

  16. Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

    PubMed Central

    Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

    2015-01-01

    During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

  17. Pharmacological elevation of cyclic AMP and transmitter release at the mouse neuromuscular junction.

    PubMed

    Dryden, W F; Singh, Y N; Gordon, T; Lazarenko, G

    1988-03-01

    Intracellular recordings of spontaneous and evoked end-plate potentials have been made at the neuromuscular junction of mouse hemidiaphragms to determine a possible role of cyclic AMP (cAMP) in the release of acetylcholine from presynaptic terminals. Spontaneous release, as determined from the frequency of miniature end-plate potentials, was increased by drugs that inhibit phosphodiesterase: isobutylmethylxanthine (IBMX), SQ 20,009, theophylline, and caffeine; drugs that stimulate adenylate cyclase: forskolin, fluoride, and cholera toxin, and the stable analogue of cAMP: 8-bromo-cAMP but not dibutyryl cAMP. Release increased with time during maintained exposure to the drugs and generally followed a simple exponential time course with time constants ranging from 8 to 17 min at 20 degrees C, except for SQ 20,009 and cholera toxin which required longer exposure times for effect. The order of potency of the phosphodiesterase inhibitors was IBMX = SQ 20,009 greater than theophylline = caffeine. This is consistent with an effect mediated by an increase in cAMP concentrations within the nerve terminal. Evoked release, determined from the quantal content of the end-plate potential, was increased to a lesser extent than spontaneous release. The results are discussed with reference to the possible involvement of second messengers in the release of vesicles from nerve terminals in vertebrate synapses.

  18. Odor-induced cAMP production in Drosophila melanogaster olfactory sensory neurons.

    PubMed

    Miazzi, Fabio; Hansson, Bill S; Wicher, Dieter

    2016-06-15

    Insect odorant receptors are seven transmembrane domain proteins that form cation channels, whose functional properties such as receptor sensitivity are subject to regulation by intracellular signaling cascades. Here, we used the cAMP fluorescent indicator Epac1-camps to investigate the occurrence of odor-induced cAMP production in olfactory sensory neurons (OSNs) of Drosophila melanogaster We show that stimulation of the receptor complex with an odor mixture or with the synthetic agonist VUAA1 induces a cAMP response. Moreover, we show that while the intracellular Ca(2+) concentration influences cAMP production, the OSN-specific receptor OrX is necessary to elicit cAMP responses in Ca(2+)-free conditions. These results provide direct evidence of a relationship between odorant receptor stimulation and cAMP production in olfactory sensory neurons in the fruit fly antenna and show that this method can be used to further investigate the role that this second messenger plays in insect olfaction. PMID:27045092

  19. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression. PMID:26192746

  20. CREB modulates calcium signaling in cAMP-induced bone marrow stromal cells (BMSCs)

    PubMed Central

    Zhang, Linxia; Liu, Li; Thompson, Ryan; Chan, Christina

    2014-01-01

    Calcium signaling has a versatile role in many important cellular functions. Despite its importance, regulation of calcium signaling in bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) has not been explored extensively. Our previous study revealed that cyclic adenosine monophosphate (cAMP) enabled BMSCs to generate calcium signal upon stimulation by dopamine, KCl and glutamate. Concurrently, cAMP transiently activated the transcription factor cAMP response element binding protein (CREB) in BMSCs. Activity of CREB can be modulated by the calcium/calmodulin-dependent kinase signaling pathway, however, whether the calcium signaling observed in cAMP-induced BMSCs requires CREB has not been investigated. In an effort to uncover the role of CREB in the generation of calcium signaling in response to modulators such as dopamine and KCl, we knocked down CREB activity in BMSCs. Our study indicated that BMSCs, but not its close relative fibroblasts, are responsive to dopamine and KCl after cAMP treatment. Calcium signal elicited by dopamine depends, in part, on calcium influx whereas that elicited by KCl depends completely on calcium influx. Knock-down of CREB activity significantly reduced or abolished the cAMP-induced calcium response, and reintroducing a constitutively active CREB partially restored the calcium response. PMID:25154887

  1. Involvement of Type 4 cAMP-Phosphodiesterase in the Myogenic Differentiation of L6 Cells

    PubMed Central

    Naro, Fabio; Sette, Claudio; Vicini, Elena; De Arcangelis, Vania; Grange, Muriel; Conti, Marco; Lagarde, Michel; Molinaro, Mario; Adamo, Sergio; Némoz, Georges

    1999-01-01

    Myogenic cell differentiation is induced by Arg8-vasopressin, whereas high cAMP levels and protein kinase A (PKA) activity inhibit myogenesis. We investigated the role of type 4 phosphodiesterase (PDE4) during L6-C5 myoblast differentiation. Selective PDE4 inhibition resulted in suppression of differentiation induced by vasopressin. PDE4 inhibition prevented vasopressin-induced nuclear translocation of the muscle-specific transcription factor myogenin without affecting its overall expression level. The effects of PDE4 inhibition could be attributed to an increase of cAMP levels and PKA activity. RNase protection, reverse transcriptase PCR, immunoprecipitation, Western blot, and enzyme activity assays demonstrated that the PDE4D3 isoform is the major PDE4 expressed in L6-C5 myoblasts and myotubes, accounting for 75% of total cAMP-hydrolyzing activity. Vasopressin cell stimulation caused a biphasic increase of PDE4 activity, which peaked at 2 and 15 min and remained elevated for 48 h. In the continuous presence of vasopressin, cAMP levels and PKA activity were lowered. PDE4D3 overexpression increased spontaneous and vasopressin-dependent differentiation of L6-C5 cells. These results show that PDE4D3 plays a key role in the control of cAMP levels and differentiation of L6-C5 cells. Through the modulation of PDE4 activity, vasopressin inhibits the cAMP signal transduction pathway, which regulates myogenesis possibly by controlling the subcellular localization of myogenin. PMID:10588663

  2. Identification of Novel Genes Responsible for Overexpression of ampC in Pseudomonas aeruginosa PAO1

    PubMed Central

    Tsutsumi, Yuko; Tomita, Haruyoshi

    2013-01-01

    The development of resistance to antipseudomonal penicillins and cephalosporins mediated by the chromosomal ampC gene in Pseudomonas aeruginosa is of clinical importance. We isolated piperacillin-resistant mutants derived from P. aeruginosa PAO1 and analyzed two mutants that had an insertion in mpl and nuoN. One mutant, YT1677, was resistant to piperacillin and ceftazidime and had an insertion in mpl, which encodes UDP-N-acetylmuramate:l-alanyl-γ-d-glutamyl-meso-diaminopimelate ligase. The other mutant, YT7988, showed increased MICs of piperacillin, ceftazidime, cefepime, and cefoperazone, and the insertion was mapped to nuoN, which encodes NADH dehydrogenase I chain N. Complementation experiments demonstrated that these mutations resulted in higher levels of resistance to β-lactams. The expression of genes reported to be involved in β-lactam resistance was examined by real-time PCR in YT1677 and YT7988 mutants. Overexpression was observed for only ampC, and other genes were expressed normally. Deletion of the ampR gene in YT1677 and YT7988 resulted in decreased expression of ampC, indicating that the mutations in YT1677 and YT7988 affected the expression of ampC through the function of AmpR. PMID:24041903

  3. The role of ventral striatal cAMP signaling in stress-induced behaviors.

    PubMed

    Plattner, Florian; Hayashi, Kanehiro; Hernández, Adan; Benavides, David R; Tassin, Tara C; Tan, Chunfeng; Day, Jonathan; Fina, Maggy W; Yuen, Eunice Y; Yan, Zhen; Goldberg, Matthew S; Nairn, Angus C; Greengard, Paul; Nestler, Eric J; Taussig, Ronald; Nishi, Akinori; Houslay, Miles D; Bibb, James A

    2015-08-01

    The cAMP and cAMP-dependent protein kinase A (PKA) signaling cascade is a ubiquitous pathway acting downstream of multiple neuromodulators. We found that the phosphorylation of phosphodiesterase-4 (PDE4) by cyclin-dependent protein kinase 5 (Cdk5) facilitated cAMP degradation and homeostasis of cAMP/PKA signaling. In mice, loss of Cdk5 throughout the forebrain elevated cAMP levels and increased PKA activity in striatal neurons, and altered behavioral responses to acute or chronic stressors. Ventral striatum- or D1 dopamine receptor-specific conditional knockout of Cdk5, or ventral striatum infusion of a small interfering peptide that selectively targeted the regulation of PDE4 by Cdk5, produced analogous effects on stress-induced behavioral responses. Together, our results demonstrate that altering cAMP signaling in medium spiny neurons of the ventral striatum can effectively modulate stress-induced behavioral states. We propose that targeting the Cdk5 regulation of PDE4 could be a new therapeutic approach for clinical conditions associated with stress, such as depression.

  4. The Catalytic Zinc Site and Mechanism of the Metalloenzyme PR-AMP Cyclohydrolase

    PubMed Central

    D'Ordine, Robert L.; Linger, Rebecca S.; Thai, Carolyn J.; Davisson, V. Jo

    2012-01-01

    The enzyme N1-(5'-phosphoribosyl) adenosine-5'-monophosphate cyclohydrolase (PR-AMP cyclohydrolase) is a Zn2+ metalloprotein encoded by the hisI gene. It catalyzes the third step of histidine biosynthesis (Scheme 1), an uncommon ring opening of a purine heterocycle for use in primary metabolism. A three dimensional structure of the enzyme from Methanobacterium thermoautotrophicum has revealed that three conserved cysteine residues occur at the dimer interface and likely form the catalytic site. To investigate of the functions of these cysteines in the enzyme from Methanococcus vannielii, a series of biochemical studies were pursued to test the basic hypothesis regarding their roles in catalysis. Inactivation of the enzyme activity by methyl methane thiosulfonate (MMTS) or 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) also compromised the Zn2+ binding properties of the protein inducing loss of up to 90% of the metal. Overall reaction stoichiometry and the potassium cyanide (KCN) induced cleavage of the protein suggested that all three cysteines were modified in the process. The enzyme was protected from DTNB-induced inactivation by inclusion of the substrate PR-AMP while Mg2+, a metal required for catalytic activity, enhanced the rate of inactivation. Site directed mutations of the conserved C93, C109, C116 and the double mutant C109/C116 were prepared and analyzed for catalytic activity, Zn2+ content, and reactivity with DTNB. Substitution of alanine for each of the conserved cysteines showed no measurable catalytic activity and only the C116A was still capable of binding Zn2+. Reactions of DTNB with the C109A/C116A double mutant showed that C93 is completely modified within 0.5 s. A model consistent with these data involves a DTNB-induced mixed disulfide linkage between C93 and C109 or C116, followed by ejection of the active site Zn2+ and provides further evidence that the Zn2+ coordination site involves the three conserved cysteine residues. The C93 reactivity is

  5. An investigation of the adsorption characteristics of 5 prime ATP and 5 prime AMP onto the surface of CaSO sub 4 x 2H sub 2 O

    NASA Technical Reports Server (NTRS)

    Calderon, J.; Sweeney, M. A.

    1986-01-01

    A model has been proposed (Lahev and Chans, 1982) in which solid surfaces can act as a site for catalytic activity of condensation reactions for certain biomolecules. From this model, the adsorption characteristics of 5'ATP and 5'AMP onto the surface of CaSO4 2H2O was chosen for study. It has been proven that 5'ATP and 5'AMP do adsorb onto the surface of CaSO4. Studies were then made to determine the dependence of adsorption versus time, concentration, ionic strength and pH. It was found that the adsorption of the nucleotides is highly pH dependent, primarily determined by the phosphate acid groups of the nucleic acid molecule. From this investigation, the data obtained are discussed in relation to the model for the prebiotic earth.

  6. Activation of the AMP-Activated Protein Kinase (AMPK) by Nitrated Lipids in Endothelial Cells

    PubMed Central

    Wu, Yong; Dong, Yunzhou; Song, Ping; Zou, Ming-Hui

    2012-01-01

    The AMP-activated protein kinase (AMPK) is an important regulator of endothelial metabolic and functional homeostasis. Here, we examined the regulation of AMPK by nitrated oleic acid (OA-NO2) and investigated the implications in endothelial function. Treatment of bovine aortic endothelial cells (BAECs) with OA-NO2 induced a significant increase in both AMPK-Thr172 phosphorylation and AMPK activity as well as upregulation of heme oxygenase (HO)-1 and hypoxia-inducible factor (HIF)-1α. Pharmacologic inhibition or genetic ablation of HO-1 or HIF-1α abolished OA-NO2-induced AMPK phosphorylation. OA-NO2 induced a dramatic increase in extracellular signal-regulated kinase (ERK)1/2 phosphorylation that was abrogated by the HO-1 inhibitor, zinc deuteroporphyrin IX 2,4-bis-ethylene glycol (ZnBG). Inhibition of ERK1/2 using UO126 or PD98059 reduced but did not abolish OA-NO2-induced HIF-1α upregulation, suggesting that OA-NO2/HO-1-initiated HIF-1α induction is partially dependent on ERK1/2 activity. In addition, OA-NO2 enhanced endothelial intracellular Ca2+, an effect that was inhibited by the HIF-1α inhibitor, YC-1, and by HIF-1α siRNA. These results implicate the involvement of HIF-1α. Experiments using the Ca2+/calmodulin-dependent protein kinase kinase (CaMKK) inhibitor STO-609, the selective CaMKII inhibitor KN-93, and an isoform-specific siRNA demonstrated that OA-NO2-induced AMPK phosphorylation was dependent on CaMKKβ. Together, these results demonstrate that OA-NO2 activates AMPK in endothelial cells via an HO-1–dependent mechanism that increases HIF-1α protein expression and Ca2+/CaMKKβ activation. PMID:22363546

  7. Beta-endorphin 1-31 biotransformation and cAMP modulation in inflammation.

    PubMed

    Asvadi, Naghmeh Hajarol; Morgan, Michael; Herath, Herath M; Hewavitharana, Amitha K; Shaw, P Nicholas; Cabot, Peter J

    2014-01-01

    A large body of evidence now exists for the immune cell expression, production, and the release of beta-endorphin (BE 1-31) within inflamed tissue. The inflammatory milieu is characterised by increased acidity, temperature and metabolic activity. Within these harsh conditions BE 1-31 is even more susceptible to increased enzymatic degradation over that of plasma or other non-injured tissue. To elucidate the biotransformation pathways of BE 1-31 and provide an insight to the impact of inflamed tissue environments, BE 1-31 and three of its major N-terminal fragments (BE 1-11, BE 1-13 and BE 1-17) were incubated in inflamed tissue homogenates at pH 5.5 for 2 hrs. In addition, the potency of BE 1-31 and five main N--terminal fragments (BE 1-9, BE 1-11, BE 1-13, BE 1-17, BE 1-20) was assessed at mu-opioid receptors (MOR), delta-opioid receptors (DOR), and kappa-opioid receptors (KOR). Opioid receptor potency was investigated by examining the modulation of forskolin induced cAMP accumulation. The majority of the N-terminal fragment of BE 1-31 had similar efficacy to BE 1-31 at MOR. The shortest of the major N-terminal fragments (BE 1-9), had partial agonist activity at MOR but possessed the highest potency of all tested peptides at DOR. There was limited effect for BE 1-31 and the biotransformed peptides at KOR. Major N-terminal fragments produced within inflamed tissue have increased presence within inflamed tissue over that of the parent molecule BE 1-31 and may therefore contribute to BE 1-31 efficacy within disease states that involve inflammation. PMID:24618600

  8. Exposure to Hydrogen Peroxide Induces Oxidation and Activation of AMP-activated Protein Kinase*

    PubMed Central

    Zmijewski, Jaroslaw W.; Banerjee, Sami; Bae, Hongbeom; Friggeri, Arnaud; Lazarowski, Eduardo R.; Abraham, Edward

    2010-01-01

    Although metabolic conditions associated with an increased AMP/ATP ratio are primary factors in the activation of 5′-adenosine monophosphate-activated protein kinase (AMPK), a number of recent studies have shown that increased intracellular levels of reactive oxygen species can stimulate AMPK activity, even without a decrease in cellular levels of ATP. We found that exposure of recombinant AMPKαβγ complex or HEK 293 cells to H2O2 was associated with increased kinase activity and also resulted in oxidative modification of AMPK, including S-glutathionylation of the AMPKα and AMPKβ subunits. In experiments using C-terminal truncation mutants of AMPKα (amino acids 1–312), we found that mutation of cysteine 299 to alanine diminished the ability of H2O2 to induce kinase activation, and mutation of cysteine 304 to alanine totally abrogated the enhancing effect of H2O2 on kinase activity. Similar to the results obtained with H2O2-treated HEK 293 cells, activation and S-glutathionylation of the AMPKα subunit were present in the lungs of acatalasemic mice or mice treated with the catalase inhibitor aminotriazole, conditions in which intracellular steady state levels of H2O2 are increased. These results demonstrate that physiologically relevant concentrations of H2O2 can activate AMPK through oxidative modification of the AMPKα subunit. The present findings also imply that AMPK activation, in addition to being a response to alterations in intracellular metabolic pathways, is directly influenced by cellular redox status. PMID:20729205

  9. Antithrombin up-regulates AMP-activated protein kinase signalling during myocardial ischaemia/reperfusion injury.

    PubMed

    Ma, Yina; Wang, Jinli; Gao, Junjie; Yang, Hui; Wang, Yanqing; Manithody, Chandrashekhara; Li, Ji; Rezaie, Alireza R

    2015-02-01

    Antithrombin (AT) is a protein of the serpin superfamily involved in regulation of the proteolytic activity of the serine proteases of the coagulation system. AT is known to exhibit anti-inflammatory and cardioprotective properties when it binds to heparan sulfate proteoglycans (HSPGs) on vascular cells. AMP-activated protein kinase (AMPK) plays an important cardioprotective role during myocardial ischaemia and reperfusion (I/R). To determine whether the cardioprotective signaling function of AT is mediated through the AMPK pathway, we evaluated the cardioprotective activities of wild-type AT and its two derivatives, one having high affinity and the other no affinity for heparin, in an acute I/R injury model in C57BL/6J mice in which the left anterior descending coronary artery was occluded. The serpin derivatives were given 5 minutes before reperfusion. The results showed that AT-WT can activate AMPK in both in vivo and ex vivo conditions. Blocking AMPK activity abolished the cardioprotective function of AT against I/R injury. The AT derivative having high affinity for heparin was more effective in activating AMPK and in limiting infraction, but the derivative lacking affinity for heparin was inactive in eliciting AMPK-dependent cardioprotective activity. Activation of AMPK by AT inhibited the inflammatory c-Jun N-terminal protein kinase (JNK) pathway during I/R. Further studies revealed that the AMPK activity induced by AT also modulates cardiac substrate metabolism by increasing glucose oxidation but inhibiting fatty acid oxidation during I/R. These results suggest that AT binds to HSPGs on heart tissues to invoke a cardioprotective function by triggering cardiac AMPK activation, thereby attenuating JNK inflammatory signalling pathways and modulating substrate metabolism during I/R. PMID:25230600

  10. Synthesis and performance evaluation of the new thickening agent of acidizing fluid

    NASA Astrophysics Data System (ADS)

    Tian, Zhenxing; Lv, Tong; Ren, Yanmei

    2010-07-01

    An acid thickener, poly (AMPS-co-DMC) was synthesized using water aqueous solution polymerization of these monomers such as 2-acrylamide-2-methylpropanesulfonic acid (AMPS) and [2-(Methacryloyloxy) ethyl] trimethylammonium chloride (DMC), with ammonium persulfate and sodium sulfite redox system as initiator, while at 65°C, 25% of the total concentration of monomer, initiator dosage of 1.6% for the monomer mass and nitrogen protection condition. The paper discussed the property evaluation of poly(AMPS-co-DMC), it was shown that poly (AMPS-co-DMC) had good acid solubility (time for dissolving in acid is 21 min); acid containing 5.0% of poly(AMPSco-DMC) had a viscosity of greater than 25.0mPa•s the shearing stability and heat resistance of the system was good and over 90% at a shear rate of 170s-1; poly(AMPS-co-DMC) performed well in the presence of standard saline at a total concentration of 40000mg/L.

  11. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 3: AMPS payload to instruments ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    General physical, functional, and operational interface control requirements for instruments on the first AMPS payload are presented. Interface specifications are included to satisfy ground handling, prelaunch, launch, stowage, operation, and landing activities. Applicable supporting documentation to implement the information is also given.

  12. Phosphorylation of connexin 32, a hepatocyte gap-junction protein, by cAMP-dependent protein kinase, protein kinase C and Ca2+/calmodulin-dependent protein kinase II.

    PubMed

    Sáez, J C; Nairn, A C; Czernik, A J; Spray, D C; Hertzberg, E L; Greengard, P; Bennett, M V

    1990-09-11

    Phosphorylation of connexin 32, the major liver gap-junction protein, was studied in purified liver gap junctions and in hepatocytes. In isolated gap junctions, connexin 32 was phosphorylated by cAMP-dependent protein kinase (cAMP-PK), by protein kinase C (PKC) and by Ca2+/calmodulin-dependent protein kinase II (Ca2+/CaM-PK II). Connexin 26 was not phosphorylated by these three protein kinases. Phosphopeptide mapping of connexin 32 demonstrated that cAMP-PK and PKC primarily phosphorylated a seryl residue in a peptide termed peptide 1. PKC also phosphorylated seryl residues in additional peptides. CA2+/CaM-PK II phosphorylated serine and to a lesser extent, threonine, at sites different from those phosphorylated by the other two protein kinases. A synthetic peptide PSRKGSGFGHRL-amine (residues 228-239 based on the deduced amino acid sequence of rat connexin 32) was phosphorylated by cAMP-PK and by PKC, with kinetic properties being similar to those for other physiological substrates phosphorylated by these enzymes. Ca2+/CaM-PK II did not phosphorylate the peptide. Phosphopeptide mapping and amino acid sequencing of the phosphorylated synthetic peptide indicated that Ser233 of connexin 32 was present in peptide 1 and was phosphorylated by cAMP-PK or by PKC. In hepatocytes labeled with [32P]orthophosphoric acid, treatment with forskolin or 20-deoxy-20-oxophorbol 12,13-dibutyrate (PDBt) resulted in increased 32P-incorporation into connexin 32. Phosphopeptide mapping and phosphoamino acid analysis showed that a seryl residue in peptide 1 was most prominently phosphorylated under basal conditions. Treatment with forskolin or PDBt stimulated the phosphorylation of peptide 1. PDBt treatment also increased the phosphorylation of seryl residues in several other peptides. PDBt did not affect the cAMP-PK activity in hepatocytes. It has previously been shown that phorbol ester reduces dye coupling in several cell types, however in rat hepatocytes, dye coupling was not reduced

  13. Requirement of cAMP Signaling for Schwann Cell Differentiation Restricts the Onset of Myelination

    PubMed Central

    Bacallao, Ketty; Monje, Paula V.

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  14. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells

    PubMed Central

    Poole, Jill A.; Nordgren, Tara M.; DeVasure, Jane M.; Heires, Art J.; Bailey, Kristina L.; Romberger, Debra J.

    2014-01-01

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  15. cAMP-dependent protein kinase activation decreases cytokine release in bronchial epithelial cells.

    PubMed

    Wyatt, Todd A; Poole, Jill A; Nordgren, Tara M; DeVasure, Jane M; Heires, Art J; Bailey, Kristina L; Romberger, Debra J

    2014-10-15

    Lung injury caused by inhalation of dust from swine-concentrated animal-feeding operations (CAFO) involves the release of inflammatory cytokine interleukin 8 (IL-8), which is mediated by protein kinase C-ε (PKC-ε) in airway epithelial cells. Once activated by CAFO dust, PKC-ε is responsible for slowing cilia beating and reducing cell migration for wound repair. Conversely, the cAMP-dependent protein kinase (PKA) stimulates contrasting effects, such as increased cilia beating and an acceleration of cell migration for wound repair. We hypothesized that a bidirectional mechanism involving PKA and PKC regulates epithelial airway inflammatory responses. To test this hypothesis, primary human bronchial epithelial cells and BEAS-2B cells were treated with hog dust extract (HDE) in the presence or absence of cAMP. PKC-ε activity was significantly reduced in cells that were pretreated for 1 h with 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) before exposure to HDE (P < 0.05). HDE-induced IL-6, and IL-8 release was significantly lower in cells that were pretreated with 8-Br-cAMP (P < 0.05). To exclude exchange protein activated by cAMP (EPAC) involvement, cells were pretreated with either 8-Br-cAMP or 8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate (8-CPT-2Me-cAMP) (EPAC agonist). 8-CPT-2Me-cAMP did not activate PKA and did not reduce HDE-stimulated IL-6 release. In contrast, 8-Br-cAMP decreased HDE-stimulated tumor necrosis factor (TNF)-α-converting enzyme (TACE; ADAM-17) activity and subsequent TNF-α release (P < 0.001). 8-Br-cAMP also blocked HDE-stimulated IL-6 and keratinocyte-derived chemokine release in precision-cut mouse lung slices (P < 0.05). These data show bidirectional regulation of PKC-ε via a PKA-mediated inhibition of TACE activity resulting in reduced PKC-ε-mediated release of IL-6 and IL-8. PMID:25150062

  16. Requirement of cAMP signaling for Schwann cell differentiation restricts the onset of myelination.

    PubMed

    Bacallao, Ketty; Monje, Paula V

    2015-01-01

    Isolated Schwann cells (SCs) respond to cAMP elevation by adopting a differentiated post-mitotic state that exhibits high levels of Krox-20, a transcriptional enhancer of myelination, and mature SC markers such as the myelin lipid galactocerebroside (O1). To address how cAMP controls myelination, we performed a series of cell culture experiments which compared the differentiating responses of isolated and axon-related SCs to cAMP analogs and ascorbate, a known inducer of axon ensheathment, basal lamina formation and myelination. In axon-related SCs, cAMP induced the expression of Krox-20 and O1 without a concomitant increase in the expression of myelin basic protein (MBP) and without promoting axon ensheathment, collagen synthesis or basal lamina assembly. When cAMP was provided together with ascorbate, a dramatic enhancement of MBP expression occurred, indicating that cAMP primes SCs to form myelin only under conditions supportive of basal lamina formation. Experiments using a combination of cell permeable cAMP analogs and type-selective adenylyl cyclase (AC) agonists and antagonists revealed that selective transmembrane AC (tmAC) activation with forskolin was not sufficient for full SC differentiation and that the attainment of an O1 positive state also relied on the activity of the soluble AC (sAC), a bicarbonate sensor that is insensitive to forskolin and GPCR activation. Pharmacological and immunological evidence indicated that SCs expressed sAC and that sAC activity was required for morphological differentiation and the expression of myelin markers such as O1 and protein zero. To conclude, our data indicates that cAMP did not directly drive myelination but rather the transition into an O1 positive state, which is perhaps the most critical cAMP-dependent rate limiting step for the onset of myelination. The temporally restricted role of cAMP in inducing differentiation independently of basal lamina formation provides a clear example of the uncoupling of signals

  17. Studies of the cAMP mediated aggregation in Dictyostelium discoideum: receptor mediated activation of the adenylate cyclase

    SciTech Connect

    Theibert, W.E.A.B.

    1985-01-01

    Dictyostelium discoideum, a eukaryotic amoeba of the cellular slime mold family, provides an interesting paradigm in developmental biology. During development, hundreds of thousands of cells aggregate to form a multicellular aggregate. Aggregation is mediated by chemotaxis and chemical signaling. Waves of adenosine 3'-5' cyclic monophosphate (cAMP) propagate through the monolayer and provide transient gradients for chemotaxis. The author has used a reversible inhibitor of the cAMP signaling response to demonstrate that adaptation to cAMP is independent of the activation of the adenylate cyclase and therefore is not caused by the rise in intracellular cAMP. Next, it is shown that adenosine inhibits the cAMP signaling response. Inhibition is rapid, reversible, and depends on the cAMP stimulus concentration. Then the specificity of the cAMP receptors which mediates signaling is determined and compared with the receptors which mediate chemotaxis, the cGMP response, and cAMP binding antagonism. The cAMP surface receptor has been identified by photoaffinity labeling intact cells with (/sup 32/P)-8-N/sub 3/-cAMP using an ammonium sulfate binding stabilization technique. The photoactivated ligand specifically labels a polypeptide, localized to the membrane fraction, which migrates as a closely spaced doublet on SDS Page.

  18. Liver AMP/ATP ratio and fructokinase expression are related to gender differences in AMPK activity and glucose intolerance in rats ingesting liquid fructose.

    PubMed

    Vilà, Laia; Roglans, Núria; Perna, Victoria; Sánchez, Rosa M; Vázquez-Carrera, Manuel; Alegret, Marta; Laguna, Juan C

    2011-08-01

    Women, but not men, show an association between fructose consumption and an increased risk of Type 2 diabetes mellitus. As rats are considered a model for human fructose metabolism, we sought to determine whether such a gender-related difference is present in Sprague-Dawley rats and to analyze the molecular mechanism behind. Male and female Sprague-Dawley rats had free access to water or to a 10% w/v fructose solution for 14 days. Plasma analytes, liver triglycerides and enzyme activities and the expression of enzymes and transcription factors related to fatty acid metabolism, insulin signaling and glucose tolerance were determined. Fructose-fed rats had hypertriglyceridemia, steatosis and reduced fatty acid oxidation activity, although the metabolic pattern of fructose-fed female rats was different to that observed for male rats. Fructose-fed female, but not male rats, showed no change in plasma leptin; they had hyperinsulinemia, an altered glucose tolerance test and less liver insulin receptor substrate-2. Further, only fructose-fed female rats had increased adenosine 5'-monophosphate (AMP)-activated protein kinase activity, resulting in a decreased expression of hepatic nuclear factor 4 and sterol response element binding protein 1. These differences were related to the fact that liver expression of the enzyme fructokinase, controlling fructose metabolism, was markedly induced by fructose ingestion in female, but not in male rats, resulting in a significant increase in the AMP/adenosine 5'-triphosphate (ATP) ratio and, thus, AMP-activated protein kinase activation, in female rats only. The difference in fructokinase induction could explain the higher metabolic burden produced by fructose ingestion in the livers of female Sprague-Dawley rats.

  19. Structural basis of the inhibition of class C acid phosphatases by adenosine 5;#8242;-phosphorothioate

    SciTech Connect

    Singh, Harkewal; Reilly, Thomas J.; Tanner, John J.

    2012-01-20

    The inhibition of phosphatases by adenosine 5'-phosphorothioate (AMPS) was first reported in the late 1960s; however, the structural basis for the inhibition has remained unknown. Here, it is shown that AMPS is a submicromolar inhibitor of class C acid phosphatases, a group of bacterial outer membrane enzymes belonging to the haloacid dehalogenase structural superfamily. Furthermore, the 1.35-{angstrom} resolution crystal structure of the inhibited recombinant Haemophilus influenzae class C acid phosphatase was determined; this is the first structure of a phosphatase complexed with AMPS. The conformation of AMPS is identical to that of the substrate 5'-AMP, except that steric factors force a rotation of the thiophosphoryl out of the normal phosphoryl-binding pocket. This conformation is catalytically nonproductive, because the P atom is not positioned optimally for nucleophilic attack by Asp64, and the O atom of the scissile O-P bond is too far from the Asp (Asp66) that protonates the leaving group. The structure of 5'-AMP complexed with the Asp64 {yields} Asn mutant enzyme was also determined at 1.35-{angstrom} resolution. This mutation induces the substrate to adopt the same nonproductive binding mode that is observed in the AMPS complex. In this case, electrostatic considerations, rather than steric factors, underlie the movement of the phosphoryl. The structures not only provide an explanation for the inhibition by AMPS, but also highlight the precise steric and electrostatic requirements of phosphoryl recognition by class C acid phosphatases. Moreover, the structure of the Asp64 {yields} Asn mutant illustrates how a seemingly innocuous mutation can cause an unexpected structural change.

  20. AmpG is required for BlaXc beta-lactamase expression in Xanthomonas campestris pv. campestris str. 17.

    PubMed

    Yang, Tsuey-Ching; Chen, Tzu-Fan; Tsai, Jeffrey J P; Hu, Rouh-Mei

    2013-03-01

    The chromosomal ampR(Xc) -bla(Xc) module is essential for the β-lactam resistance of Xanthomonas campestris pv. campestris. Bla(Xc) β-lactamase is expressed at a high basal level in the absence of an inducer and its expression can be further induced by β-lactam. In enterobacteria, ampG encodes an inner membrane facilitator involved in the recycling of murein degradation compounds. An isogenic ampG mutant (XcampG) of X. campestris pv. campestris str. 17 (Xc17) was constructed to investigate the link between murein recycling and bla(Xc) expression. Our data demonstrate that (1) XcampG is susceptible to β-lactam antibiotics; (2) AmpG(Xc) is essential for expression of bla(Xc) ; (3) AmpGs of Xc17, Stenotrophomonas maltophilia KJ (SmKJ) and Escherichia coli DH5α can complement the defect of XcampG; (4) overexpression of AmpG(X) (c) significantly increased bla(Xc) expression; and (5) AmpG(Xc) from Xc17 is able to restore β-lactamase induction of the ampN(Xc) -ampG(Xc) double mutant of SmKJ. In Xc17, ampG(Xc) can be expressed from the promoter residing in the intergenic region of ampN(Xc) -ampG(Xc) and the expression is independent of β-lactam induction. AmpN, which is required for β-lactamases induction in SmKJ, is not required for the β-lactam antibiotic resistance of Xc17.

  1. T3-induced liver AMP-activated protein kinase signaling: Redox dependency and upregulation of downstream targets

    PubMed Central

    Videla, Luis A; Fernández, Virginia; Cornejo, Pamela; Vargas, Romina; Morales, Paula; Ceballo, Juan; Fischer, Alvaro; Escudero, Nicolás; Escobar, Oscar

    2014-01-01

    AIM: To investigate the redox dependency and promotion of downstream targets in thyroid hormone (T3)-induced AMP-activated protein kinase (AMPK) signaling as cellular energy sensor to limit metabolic stresses in the liver. METHODS: Fed male Sprague-Dawley rats were given a single ip dose of 0.1 mg T3/kg or T3 vehicle (NaOH 0.1 N; controls) and studied at 8 or 24 h after treatment. Separate groups of animals received 500 mg N-acetylcysteine (NAC)/kg or saline ip 30 min prior T3. Measurements included plasma and liver 8-isoprostane and serum β-hydroxybutyrate levels (ELISA), hepatic levels of mRNAs (qPCR), proteins (Western blot), and phosphorylated AMPK (ELISA). RESULTS: T3 upregulates AMPK signaling, including the upstream kinases Ca2+-calmodulin-dependent protein kinase kinase-β and transforming growth factor-β-activated kinase-1, with T3-induced reactive oxygen species having a causal role due to its suppression by pretreatment with the antioxidant NAC. Accordingly, AMPK targets acetyl-CoA carboxylase and cyclic AMP response element binding protein are phosphorylated, with the concomitant carnitine palmitoyltransferase-1α (CPT-1α) activation and higher expression of peroxisome proliferator-activated receptor-γ co-activator-1α and that of the fatty acid oxidation (FAO)-related enzymes CPT-1α, acyl-CoA oxidase 1, and acyl-CoA thioesterase 2. Under these conditions, T3 induced a significant increase in the serum levels of β-hydroxybutyrate, a surrogate marker for hepatic FAO. CONCLUSION: T3 administration activates liver AMPK signaling in a redox-dependent manner, leading to FAO enhancement as evidenced by the consequent ketogenic response, which may constitute a key molecular mechanism regulating energy dynamics to support T3 preconditioning against ischemia-reperfusion injury. PMID:25516653

  2. Trafficking and Gating of Hyperpolarization-activated Cyclic Nucleotide-gated Channels Are Regulated by Interaction with Tetratricopeptide Repeat-containing Rab8b-interacting Protein (TRIP8b) and Cyclic AMP at Distinct Sites*

    PubMed Central

    Han, Ye; Noam, Yoav; Lewis, Alan S.; Gallagher, Johnie J.; Wadman, Wytse J.; Baram, Tallie Z.; Chetkovich, Dane M.

    2011-01-01

    Ion channel trafficking and gating are often influenced by interactions with auxiliary subunits. Tetratricopeptide repeat-containing Rab8b-interacting protein (TRIP8b) is an auxiliary subunit for neuronal hyperpolarization-activated cyclic nucleotide-gated (HCN) channels. TRIP8b interacts directly with two distinct sites of HCN channel pore-forming subunits to control channel trafficking and gating. Here we use mutagenesis combined with electrophysiological studies to define and distinguish the functional importance of the HCN/TRIP8b interaction sites. Interaction with the last three amino acids of the HCN1 C terminus governed the effect of TRIP8b on channel trafficking, whereas TRIP8b interaction with the HCN1 cyclic nucleotide binding domain (CNBD) affected trafficking and gating. Biochemical studies revealed that direct interaction between TRIP8b and the HCN1 CNBD was disrupted by cAMP and that TRIP8b binding to the CNBD required an arginine residue also necessary for cAMP binding. In accord, increasing c