Science.gov

Sample records for 2-keto-3-deoxy-d-glycero-d-galactonononate-9-phosphate phosphatase defines

  1. Structure-function analysis of 2-keto-3-deoxy-D-glycero-D-galactonononate-9-phosphate phosphatase defines specificity elements in type C0 haloalkanoate dehalogenase family members.

    PubMed

    Lu, Zhibing; Wang, Liangbing; Dunaway-Mariano, Debra; Allen, Karen N

    2009-01-09

    The phosphotransferases of the haloalkanoate dehalogenase superfamily (HADSF) act upon a wide range of metabolites in all eukaryotes and prokaryotes and thus constitute a significant force in cell function. The challenge posed for biochemical function assignment of HADSF members is the identification of the structural determinants that target a specific metabolite. The "8KDOP" subfamily of the HADSF is defined by the known structure and catalytic activity of 2-keto-3-deoxy-8-phospho-d-manno-octulosonic acid (KDO-8-P) phosphatase. Homologues of this enzyme have been uniformly annotated as KDO-8-P phosphatase. One such gene, BT1713, from the Bacteroides thetaiotaomicron genome was recently found to encode the enzyme 2-keto-3-deoxy-d-glycero-d-galacto-9-phosphonononic acid (KDN-9-P) phosphatase in the biosynthetic pathway of the 9-carbon alpha-keto acid, 2-keto-3-deoxy-d-glycero-d-galactonononic acid (KDN). To find the structural elements that provide substrate-specific interactions and to allow identification of genomic sequence markers, the x-ray crystal structures of BT1713 liganded to the cofactor Mg(2+)and complexed with tungstate or VO(3)(-)/Neu5Ac were determined to 1.1, 1.85, and 1.63 A resolution, respectively. The structures define the active site to be at the subunit interface and, as confirmed by steady-state kinetics and site-directed mutagenesis, reveal Arg-64(*), Lys-67(*), and Glu-56 to be the key residues involved in sugar binding that are essential for BT1713 catalytic function. Bioinformatic analyses of the differentially conserved residues between BT1713 and KDO-8-P phosphatase homologues guided by the knowledge of the structure-based specificity determinants define Glu-56 and Lys-67(*) to be the key residues that can be used in future annotations.

  2. Integrative proteomics and biochemical analyses define Ptc6p as the Saccharomyces cerevisiae pyruvate dehydrogenase phosphatase.

    PubMed

    Guo, Xiao; Niemi, Natalie M; Coon, Joshua J; Pagliarini, David J

    2017-07-14

    The pyruvate dehydrogenase complex (PDC) is the primary metabolic checkpoint connecting glycolysis and mitochondrial oxidative phosphorylation and is important for maintaining cellular and organismal glucose homeostasis. Phosphorylation of the PDC E1 subunit was identified as a key inhibitory modification in bovine tissue ∼50 years ago, and this regulatory process is now known to be conserved throughout evolution. Although Saccharomyces cerevisiae is a pervasive model organism for investigating cellular metabolism and its regulation by signaling processes, the phosphatase(s) responsible for activating the PDC in S. cerevisiae has not been conclusively defined. Here, using comparative mitochondrial phosphoproteomics, analyses of protein-protein interactions by affinity enrichment-mass spectrometry, and in vitro biochemistry, we define Ptc6p as the primary PDC phosphatase in S. cerevisiae Our analyses further suggest additional substrates for related S. cerevisiae phosphatases and describe the overall phosphoproteomic changes that accompany mitochondrial respiratory dysfunction. In summary, our quantitative proteomics and biochemical analyses have identified Ptc6p as the primary-and likely sole-S. cerevisiae PDC phosphatase, closing a key knowledge gap about the regulation of yeast mitochondrial metabolism. Our findings highlight the power of integrative omics and biochemical analyses for annotating the functions of poorly characterized signaling proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily.

    PubMed Central

    Thaller, M. C.; Schippa, S.; Rossolini, G. M.

    1998-01-01

    Members of a new molecular family of bacterial nonspecific acid phosphatases (NSAPs), indicated as class C, were found to share significant sequence similarities to bacterial class B NSAPs and to some plant acid phosphatases, representing the first example of a family of bacterial NSAPs that has a relatively close eukaryotic counterpart. Despite the lack of an overall similarity, conserved sequence motifs were also identified among the above enzyme families (class B and class C bacterial NSAPs, and related plant phosphatases) and several other families of phosphohydrolases, including bacterial phosphoglycolate phosphatases, histidinol-phosphatase domains of the bacterial bifunctional enzymes imidazole-glycerolphosphate dehydratases, and bacterial, eukaryotic, and archaeal phosphoserine phosphatases and threalose-6-phosphatases. These conserved motifs are clustered within two domains, separated by a variable spacer region, according to the pattern [FILMAVT]-D-[ILFRMVY]-D-[GSNDE]-[TV]-[ILVAM]-[AT S VILMC]-X-¿YFWHKR)-X-¿YFWHNQ¿-X( 102,191)-¿KRHNQ¿-G-D-¿FYWHILVMC¿-¿QNH¿-¿FWYGP¿-D -¿PSNQYW¿. The dephosphorylating activity common to all these proteins supports the definition of this phosphatase motif and the inclusion of these enzymes into a superfamily of phosphohydrolases that we propose to indicate as "DDDD" after the presence of the four invariant aspartate residues. Database searches retrieved various hypothetical proteins of unknown function containing this or similar motifs, for which a phosphohydrolase activity could be hypothesized. PMID:9684901

  4. Structure-Function Analysis of 2-Keto-3-Deoxy-D-Glycero-D-Galacto-Nononate-9-Phosphate Phosphatase Defines Specificity Elements in Type C0 had Family Members

    SciTech Connect

    Lu, Z.; Wang, L; Dunaway-Mariano, D; Allen, K

    2009-01-01

    The phosphotransferases of the haloalkanoate dehalogenase superfamily (HADSF) act upon a wide range of metabolites in all eukaryotes and prokaryotes and thus constitute a significant force in cell function. The challenge posed for biochemical function assignment of HADSF members is the identification of the structural determinants that target a specific metabolite. The '8KDOP' subfamily of the HADSF is defined by the known structure and catalytic activity of 2-keto-3-deoxy-8-phospho-d-manno-octulosonic acid (KDO-8-P) phosphatase. Homologues of this enzyme have been uniformly annotated as KDO-8-P phosphatase. One such gene, BT1713, from the Bacteroides thetaiotaomicron genome was recently found to encode the enzyme 2-keto-3-deoxy-d-glycero-d-galacto-9-phosphonononic acid (KDN-9-P) phosphatase in the biosynthetic pathway of the 9-carbon ?-keto acid, 2-keto-3-deoxy-d-glycero-d-galactonononic acid (KDN). To find the structural elements that provide substrate-specific interactions and to allow identification of genomic sequence markers, the x-ray crystal structures of BT1713 liganded to the cofactor Mg2+and complexed with tungstate or Formula/Neu5Ac were determined to 1.1, 1.85, and 1.63 A resolution, respectively. The structures define the active site to be at the subunit interface and, as confirmed by steady-state kinetics and site-directed mutagenesis, reveal Arg-64*, Lys-67*, and Glu-56 to be the key residues involved in sugar binding that are essential for BT1713 catalytic function. Bioinformatic analyses of the differentially conserved residues between BT1713 and KDO-8-P phosphatase homologues guided by the knowledge of the structure-based specificity determinants define Glu-56 and Lys-67* to be the key residues that can be used in future annotations.

  5. Human monoclonal antibodies isolated from type I diabetes patients define multiple epitopes in the protein tyrosine phosphatase-like IA-2 antigen.

    PubMed

    Kolm-Litty, V; Berlo, S; Bonifacio, E; Bearzatto, M; Engel, A M; Christie, M; Ziegler, A G; Wild, T; Endl, J

    2000-10-15

    Protein tyrosine phosphatase-like IA-2 autoantigen is one of the major targets of humoral autoimmunity in patients with insulin-dependant diabetes mellitus (IDDM). In an effort to define the epitopes recognized by autoantibodies against IA-2, we generated five human mAbs (hAbs) from peripheral B lymphocytes isolated from patients most of whom had been recently diagnosed for IDDM. Determination and fine mapping of the critical regions for autoantibody binding was performed by RIA using mutant and chimeric constructs of IA-2- and IA-2beta-regions. Four of the five IgG autoantibodies recognized distinct epitopes within the protein tyrosine phosphatase (PTP)-like domain of IA-2. The minimal region required for binding by three of the PTP-like domain-specific hAbs could be located to aa 777-979. Two of these hAbs cross-reacted with the related IA-2beta PTP-like domain (IA-2beta aa 741-1033). A further PTP-like domain specific hAb required the entire PTP-like domain (aa 687-979) for binding, but critical amino acids clustered in the N-terminal region 687-777. An additional epitope could be localized within the juxtamembrane domain (aa 603-779). In competition experiments, the epitope recognized by one of the hAbs was shown to be targeted by 10 of 14 anti-IA-2-positive sera. Nucleotide sequence analysis of this hAb revealed that it used a V(H) germline gene (DP-71) preferably expressed in autoantibodies associated with IDDM. The presence of somatic mutations in both heavy and light chain genes and the high affinity or this Ab suggest that the immune response to IA-2 is Ag driven.

  6. Single amino acid charge switch defines clinically distinct proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1)-associated inflammatory diseases.

    PubMed

    Holzinger, Dirk; Fassl, Selina Kathleen; de Jager, Wilco; Lohse, Peter; Röhrig, Ute F; Gattorno, Marco; Omenetti, Alessia; Chiesa, Sabrina; Schena, Francesca; Austermann, Judith; Vogl, Thomas; Kuhns, Douglas B; Holland, Steven M; Rodríguez-Gallego, Carlos; López-Almaraz, Ricardo; Arostegui, Juan I; Colino, Elena; Roldan, Rosa; Fessatou, Smaragdi; Isidor, Bertrand; Poignant, Sylvaine; Ito, Koichi; Epple, Hans-Joerg; Bernstein, Jonathan A; Jeng, Michael; Frankovich, Jennifer; Lionetti, Geraldina; Church, Joseph A; Ong, Peck Y; LaPlant, Mona; Abinun, Mario; Skinner, Rod; Bigley, Venetia; Sachs, Ulrich J; Hinze, Claas; Hoppenreijs, Esther; Ehrchen, Jan; Foell, Dirk; Chae, Jae Jin; Ombrello, Amanda; Aksentijevich, Ivona; Sunderkoetter, Cord; Roth, Johannes

    2015-11-01

    Hyperzincemia and hypercalprotectinemia (Hz/Hc) is a distinct autoinflammatory entity involving extremely high serum concentrations of the proinflammatory alarmin myeloid-related protein (MRP) 8/14 (S100A8/S100A9 and calprotectin). We sought to characterize the genetic cause and clinical spectrum of Hz/Hc. Proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1) gene sequencing was performed in 14 patients with Hz/Hc, and their clinical phenotype was compared with that of 11 patients with pyogenic arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome. PSTPIP1-pyrin interactions were analyzed by means of immunoprecipitation and Western blotting. A structural model of the PSTPIP1 dimer was generated. Cytokine profiles were analyzed by using the multiplex immunoassay, and MRP8/14 serum concentrations were analyzed by using an ELISA. Thirteen patients were heterozygous for a missense mutation in the PSTPIP1 gene, resulting in a p.E250K mutation, and 1 carried a mutation resulting in p.E257K. Both mutations substantially alter the electrostatic potential of the PSTPIP1 dimer model in a region critical for protein-protein interaction. Patients with Hz/Hc have extremely high MRP8/14 concentrations (2045 ± 1300 μg/mL) compared with those with PAPA syndrome (116 ± 74 μg/mL) and have a distinct clinical phenotype. A specific cytokine profile is associated with Hz/Hc. Hz/Hc mutations altered protein binding of PSTPIP1, increasing interaction with pyrin through phosphorylation of PSTPIP1. Mutations resulting in charge reversal in the y-domain of PSTPIP1 (E→K) and increased interaction with pyrin cause a distinct autoinflammatory disorder defined by clinical and biochemical features not found in patients with PAPA syndrome, indicating a unique genotype-phenotype correlation for mutations in the PSTPIP1 gene. This is the first inborn autoinflammatory syndrome in which inflammation is driven by uncontrolled release of members of the alarmin family. Copyright

  7. Sac phosphatase domain proteins.

    PubMed Central

    Hughes, W E; Cooke, F T; Parker, P J

    2000-01-01

    Advances in our understanding of the roles of phosphatidylinositol phosphates in controlling cellular functions such as endocytosis, exocytosis and the actin cytoskeleton have included new insights into the phosphatases that are responsible for the interconversion of these lipids. One of these is an entirely novel class of phosphatase domain found in a number of well characterized proteins. Proteins containing this Sac phosphatase domain include the yeast Saccharomyces cerevisiae proteins Sac1p and Fig4p. The Sac phosphatase domain is also found within the mammalian phosphoinositide 5-phosphatase synaptojanin and the yeast synaptojanin homologues Inp51p, Inp52p and Inp53p. These proteins therefore contain both Sac phosphatase and 5-phosphatase domains. This review describes the Sac phosphatase domain-containing proteins and their actions, with particular reference to the genetic and biochemical insights provided by study of the yeast Saccharomyces cerevisiae. PMID:10947947

  8. Teaching resources. Protein phosphatases.

    PubMed

    Salton, Stephen R

    2005-03-01

    This Teaching Resource provides lecture notes and slides for a class covering the structure and function of protein phosphatases and is part of the course "Cell Signaling Systems: A Course for Graduate Students." The lecture begins with a discussion of the importance of phosphatases in physiology, recognized by the award of a Nobel Prize in 1992, and then proceeds to describe the two types of protein phosphatases: serine/threonine and tyrosine phosphatases. The information covered includes the structure, regulation, and substrate specificity of protein phosphatases, with an emphasis on their importance in disease and clinical settings.

  9. Structure of Acid phosphatases.

    PubMed

    Araujo, César L; Vihko, Pirkko T

    2013-01-01

    Acid phosphatases are enzymes that have been studied extensively due to the fact that their dysregulation is associated with pathophysiological conditions. This characteristic has been exploited for the development of diagnostic and therapeutic methods. As an example, prostatic acid phosphatase was the first marker for metastatic prostate cancer diagnosis and the dysregulation of tartrate resistant acid phosphatase is associated with abnormal bone resorption linked to osteoporosis. The pioneering crystallization studies on prostatic acid phosphatase and mammalian tartrate-resistant acid phosphatase conformed significant milestones towards the elucidation of the mechanisms followed by these enzymes (Schneider et al., EMBO J 12:2609-2615, 1993). Acid phosphatases are also found in nonmammalian species such as bacteria, fungi, parasites, and plants, and most of them share structural similarities with mammalian acid phosphatase enzymes. Acid phosphatase (EC 3.1.3.2) enzymes catalyze the hydrolysis of phosphate monoesters following the general equation. Phosphate monoester + H2O -->/<-- alcohol + phosphate. The general classification "acid phosphatase" relies only on the optimum acidic pH for the enzymatic activity in assay conditions using non-physiological substrates. These enzymes accept a wide range of substrates in vitro, ranging from small organic molecules to phosphoproteins, constituting a heterogeneous group of enzymes from the structural point of view. These structural differences account for the divergence in cofactor dependences and behavior against substrates, inhibitors, and activators. In this group only the tartrate-resistant acid phosphatase is a metallo-enzyme whereas the other members do not require metal-ion binding for their catalytic activity. In addition, tartrate-resistant acid phosphatase and erythrocytic acid phosphatase are not inhibited by L-(+)-tartrate ion while the prostatic acid phosphatase is tartrate-sensitive. This is an important

  10. 3-Phosphoglycerate Phosphatase in Plants

    PubMed Central

    Randall, D. D.; Tolbert, N. E.; Gremel, D.

    1971-01-01

    3-Phosphoglycerate phosphatase and phosphoglycolate phosphatase were found in leaves of all 52 plants examined. Activities of both phosphatases varied widely between 1 to 20 micromoles per minute per milligram chlorophyll. Plants were grouped into two categories based upon the relative ratio of activity of 3-phosphoglycerate phosphatase to phosphoglycolate phosphatase. This ratio varied between 2:1 to 4:1 in the C4-plants except corn leaves which had a low level of 3-phosphoglycerate phosphatase. This ratio was reversed and varied between 1:2 to 1:6 in all C3-plants except one bean variety which had large amounts of both phosphatases. By differential grinding procedures for C4 plants a major part of the 3-phosphoglycerate phosphatase was found in the mesophyll cells and P-glycolate phosphatase in the bundle sheath cells. Phosphoglycolate phosphatase, but not 3-phosphoglycerate phosphatase, was located in chloroplasts of C3- and C4- plants. Formation of 3-phosphoglycerate phosphatase increased 4- to 12-fold during greening of etiolated sugarcane leaves. This cytosol phosphatase displayed a diurnal variation in sugarcane leaves by increasing 50% during late daylight hours and early evening. It is proposed that the soluble form of 3-phosphoglycerate phosphatase is necessary for carbon transport between the bundle sheath and mesophyll cells during photosynthesis by C4-plants. In C3- and C4-plants this phosphatase initiates the conversion of 3-phosphoglycerate to serine which is an alternate metabolic pathway to glycolate metabolism and photorespiration. PMID:16657822

  11. Alkaline phosphatase: an overview.

    PubMed

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    2014-07-01

    Alkaline phosphatase (ALP; E.C.3.I.3.1.) is an ubiquitous membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at basic pH values. Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP. The intestinal and placental ALP loci are located near the end of long arm of chromosome 2 and L/B/K ALP is located near the end of the short arm of chromosome 1. Although ALPs are present in many mammalian tissues and have been studied for the last several years still little is known about them. The bone isoenzyme may be involved in mammalian bone calcification and the intestinal isoenzyme is thought to play a role in the transport of phosphate into epithelial cells of the intestine. In this review, we tried to provide an overview about the various forms, structure and functions of alkaline phosphatase with special focus on liver/bone/kidney alkaline phosphatase.

  12. Phosphatidyl glycerophosphate phosphatase.

    PubMed

    Chang, Y Y; Kennedy, E P

    1967-09-01

    An enzyme (phosphatidyl glycerophosphate phosphatase) that catalyzes the formation of phosphatidyl glycerol from phosphatidyl glycerophosphate has been rendered soluble by treatment of the particulate fraction of E. coli with Triton X-100 in the presence of EDTA, and has been partially purified. The enzyme is specific for phosphatidyl glycerophosphate and does not catalyze the hydrolysis of other simple phosphomonoesters. It requires Mg(++) for activity and is inhibited by sulfhydryl agents. Some other properties of the enzyme are also described.

  13. Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism

    PubMed Central

    Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.

    2016-01-01

    Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589

  14. Cracking the phosphatase code: docking interactions determine substrate specificity.

    PubMed

    Roy, Jagoree; Cyert, Martha S

    2009-12-08

    Phosphoserine- and phosphothreonine-directed phosphatases display remarkable substrate specificity, yet the sites that they dephosphorylate show little similarity in amino acid sequence. Studies reveal that docking interactions are key for the recognition of substrates and regulators by two conserved phosphatases, protein phosphatase 1 (PP1) and the Ca2+-calmodulin-dependent phosphatase calcineurin. In each case, a small degenerate sequence motif in the interacting protein directs low-affinity binding to a docking surface on the phosphatase that is distinct from the active site; several such interactions combine to confer overall binding specificity. Some docking surfaces are conserved, such as a hydrophobic groove on a face opposite the active site that serves as a major recognition surface for the "RVxF" motif of proteins that interact with PP1 and the "PxIxIT" motif of substrates of calcineurin. Secondary motifs combine with this primary targeting sequence to specify phosphatase binding. A comprehensive interactome for mammalian PP1 was described, analysis of which defines several PP1-binding motifs. Studies of "LxVP," a secondary calcineurin-binding sequence, establish that this motif is a conserved feature of calcineurin substrates and that the immunosuppressants FK506 and cyclosporin A inhibit the phosphatase by interfering with LxVP-mediated docking.

  15. Separation of Alkaline Phosphatase Isoenzymes from Various Rat Tissues Using Flat-Bed Acrylamide Gel Isoelectric Focusing,

    DTIC Science & Technology

    1981-12-22

    Technical Bulletin No. 104. Alkaline phosphatase activity was expressed as 1 micromole of p- nitrophenol hydrolyzed per hour and specific alkaline... phosphatase activity was defined as the number of micromoles of p- nitrophenol hydrolyzed per hour per microgram of protein. The total protein was determined... phosphatase activity is known or suspected. Importantly, the procedure is easily adapted for acid phosphatase examination by merely changing the pH and

  16. [Alkaline phosphatase in Amoeba proteus].

    PubMed

    Sopina, V A

    2005-01-01

    In free-living Amoeba proteus (strain B), 3 phosphatase were found after disc-electrophoresis of 10 microg of protein in PAGE and using 1-naphthyl phosphate as a substrate a pH 9.0. These phosphatases differed in their electrophoretic mobilities - "slow" (1-3 bands), "middle" (one band) and "fast" (one band). In addition to 1-naphthyl phosphate, "slow" phosphatases were able to hydrolyse 2-naphthyl phosphate and p-nitrophenyl phosphate. They were slightly activated by Mg2+, completely inhibited by 3 chelators (EDTA, EGTA and 1,10-phenanthroline), L-cysteine, sodium dodecyl sulfate and Fe2+, Zn2+ and Mn2+ (50 mM), considerably inactivated by orthovanadate, molybdate, phosphatase inhibitor cocktail 1, p-nitrophenyl phosphate, Na2HPO4, DL-dithiothreitol and urea and partly inhibited by H2O2, DL-phenylalanine, 2-mercaptoethanol, phosphatase inhibitor cocktail 2 and Ca2+. Imidazole, L-(+)-tartrate, okadaic acid, NaF and sulfhydryl reagents -p-(hydroxy-mercuri)benzoate and N-ethylmaleimide - had no influence on the activity of "slow" phosphatases. "Middle" and "fast" phosphatases, in contrast to "slow" ones, were not inactivated by 3 chelators. The "middle" phosphatase differed from the "fast" one by smaller resistance to urea, Ca2+, Mn2+, phosphates and H2O2 and greater resistance to dithiothreitol and L-(+)-tartrate. In addition, the "fast" phosphatase was inhibited by L-cysteine but the "middle" one was activated by it. Of 5 tested ions (Mg2+, Cu2+, Mn2+, Ca2+ and Zn2+), only Zn2+ reactivated "slow" phosphatases after their inactivation by EDTA treatment. The reactivation of apoenzyme was only partial (about 35 %). Thus, among phosphatases found in amoebae at pH 9.0, only "slow" ones are Zn-metalloenzymes and may be considered as alkaline phosphatases (EC 3.1.3.1). It still remains uncertain, to which particular phosphatase class "middle" and "fast" phosphatases (pH 9.0) may belong.

  17. Soybean root nodule acid phosphatase.

    PubMed Central

    Penheiter, A R; Duff, S M; Sarath, G

    1997-01-01

    Acid phosphatases are ubiquitous enzymes that exhibit activity against a variety of substrates in vitro, although little is known about their intracellular function. In this study, we report the isolation, characterization, and partial sequence of the major acid phosphatase from soybean (Glycine max L.) root nodules. The phosphatase was purified predominantly as a heterodimer with subunits of 28 and 31 kD; homodimers of both subunits were also observed and exhibited phosphatase activity. In addition to the general phosphatase substrate, p-nitrophenyl phosphate, the heterodimeric form of the enzyme readily hydrolyzed 5'-nucleotides, flavin mononucleotide, and O-phospho-L-Tyr. Low or negligible activity was observed with ATP or polyphosphate. Purified nodule acid phosphatase was stimulated by magnesium, inhibited by calcium and EDTA, and competitively inhibited by cGMP and cAMP with apparent Ki values of 7 and 12 microM, respectively. Partial N-terminal and internal sequencing of the nodule acid phosphatase revealed homology to the soybean vegetative storage proteins. There was a 17-fold increase in enzyme activity and a noticeable increase in protein levels detected by immunoblotting methods during nodule development. Both of these parameters were low in young nodules and reached a peak in mature, functional nodules, suggesting that this enzyme is important for efficient nodule metabolism. PMID:9193092

  18. Multisystemic functions of alkaline phosphatases.

    PubMed

    Buchet, René; Millán, José Luis; Magne, David

    2013-01-01

    Human and mouse alkaline phosphatases (AP) are encoded by a multigene family expressed ubiquitously in multiple tissues. Gene knockout (KO) findings have helped define some of the precise exocytic functions of individual isozymes in bone, teeth, the central nervous system, and in the gut. For instance, deficiency in tissue-nonspecific alkaline phosphatase (TNAP) in mice (Alpl (-/-) mice) and humans leads to hypophosphatasia (HPP), an inborn error of metabolism characterized by epileptic seizures in the most severe cases, caused by abnormal metabolism of pyridoxal-5'-phosphate (the predominant form of vitamin B6) and by hypomineralization of the skeleton and teeth featuring rickets and early loss of teeth in children or osteomalacia and dental problems in adults caused by accumulation of inorganic pyrophosphate (PPi). Enzyme replacement therapy with mineral-targeting TNAP prevented all the manifestations of HPP in mice, and clinical trials with this protein therapeutic are showing promising results in rescuing life-threatening HPP in infants. Conversely, TNAP induction in the vasculature during generalized arterial calcification of infancy (GACI), type II diabetes, obesity, and aging can cause medial vascular calcification. TNAP inhibitors, discussed extensively in this book, are in development to prevent pathological arterial calcification. The brush border enzyme intestinal alkaline phosphatase (IAP) plays an important role in fatty acid (FA) absorption, in protecting gut barrier function, and in determining the composition of the gut microbiota via its ability to dephosphorylate lipopolysaccharide (LPS). Knockout mice (Akp3 (-/-)) deficient in duodenal-specific IAP (dIAP) become obese, and develop hyperlipidemia and hepatic steatosis when fed a high-fat diet (HFD). These changes are accompanied by upregulation in the jejunal-ileal expression of the Akp6 IAP isozyme (global IAP, or gIAP) and concomitant upregulation of FAT/CD36, a phosphorylated fatty acid

  19. The acid phosphatases of Thermoascus crustaceus, a thermophilic fungus.

    PubMed

    Arnold, W N; Garrison, R G; Mann, L C; Wallace, D P

    1988-01-01

    Thermoascus crustaceus, a filamentous, thermophilic ascomycete with pathogenic potential was cultured on Sabouraud's liquid medium at temperatures from 27 to 47 degrees C for periods up to 7 days. Growth rate and yield were optimal at 37 degrees C. Morphological changes were confined to the cell walls, the thickness being greatest at 47 degrees C, which were also more resistant to mechanical disruption. Significant amounts of acid phosphatase (EC 3.1.3.2) activity occurred in the spent media of all cultures but were greatest at 37 degrees C. The proportions of acid phosphatase activity which were operationally defined as soluble or bound were also documented; the optimum pH for acid phosphatase activity in all fractions was 5.0. Extracts were subjected to polyacrylamide gel electrophoresis under non-denaturing conditions and the gels were stained for acid phosphatase activity. This revealed four electrophoretically distinct acid phosphatases which had different susceptibilities to inhibition by fluoride, phosphate, or tartrate. Effects of growth temperature, or phosphate supplement in the culture medium, on the acid phosphatase isoenzyme pattern were judged to be minor. Cytochemistry at the electron microscope level indicated acid phosphatase activity on the surface, in the periplasmic space, and in the cytoplasm, but no trends with regard to growth conditions. A substantial temperature range can be tolerated by this species but it is concluded that neither the general shape of the cells nor the acid phosphatase isoenzyme pattern changes substantially; this contrasts with previously documented differences for this class of enzyme in dimorphic Sporotrix schenckii.

  20. Structural Genomics of Protein Phosphatases

    SciTech Connect

    Almo,S.; Bonanno, J.; Sauder, J.; Emtage, S.; Dilorenzo, T.; Malashkevich, V.; Wasserman, S.; Swaminathan, S.; Eswaramoorthy, S.; et al

    2007-01-01

    The New York SGX Research Center for Structural Genomics (NYSGXRC) of the NIGMS Protein Structure Initiative (PSI) has applied its high-throughput X-ray crystallographic structure determination platform to systematic studies of all human protein phosphatases and protein phosphatases from biomedically-relevant pathogens. To date, the NYSGXRC has determined structures of 21 distinct protein phosphatases: 14 from human, 2 from mouse, 2 from the pathogen Toxoplasma gondii, 1 from Trypanosoma brucei, the parasite responsible for African sleeping sickness, and 2 from the principal mosquito vector of malaria in Africa, Anopheles gambiae. These structures provide insights into both normal and pathophysiologic processes, including transcriptional regulation, regulation of major signaling pathways, neural development, and type 1 diabetes. In conjunction with the contributions of other international structural genomics consortia, these efforts promise to provide an unprecedented database and materials repository for structure-guided experimental and computational discovery of inhibitors for all classes of protein phosphatases.

  1. Colorimetric Determination of Pure Mg2+-dependent Phosphatidate Phosphatase Activity

    PubMed Central

    Havriluk, Tara; Lozy, Fred; Siniossoglou, Symeon; Carman, George M.

    2008-01-01

    The malachite green-molybdate reagent was used for a colorimetric assay of pure Mg2+-dependent phosphatidate phosphatase activity. This enzyme plays a major role in fat metabolism. Enzyme activity was linear with time and protein concentration, and with the concentration of water-soluble dioctanoyl phosphatidate. The colorimetric assay was used to examine enzyme inhibition by phenylglyoxal, propranolol, and dimethyl sulfoxide. Pure enzyme and a water-soluble phosphatidate substrate were required for the assay, which should be applicable to a well-defined large-scale screen of Mg2+-dependent phosphatidate phosphatase inhibitors (or activators). PMID:17910939

  2. A glutamate switch controls voltage-sensitive phosphatase function

    PubMed Central

    Liu, Lijun; Kohout, Susy C.; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R.; Isacoff, Ehud Y.; Minor, Daniel L.

    2012-01-01

    Ciona intestinalis voltage sensing phosphatase Ci-VSP couples a voltage-sensing domain (VSD) to a lipid phosphatase similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a key loop, termed the “gating loop”, that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation. PMID:22562138

  3. A glutamate switch controls voltage-sensitive phosphatase function.

    PubMed

    Liu, Lijun; Kohout, Susy C; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R; Isacoff, Ehud Y; Minor, Daniel L

    2012-05-06

    The Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) couples a voltage-sensing domain (VSD) to a lipid phosphatase that is similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a crucial loop, termed the 'gating loop', that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation.

  4. Phosphotyrosine Substrate Sequence Motifs for Dual Specificity Phosphatases

    PubMed Central

    Zhao, Bryan M.; Keasey, Sarah L.; Tropea, Joseph E.; Lountos, George T.; Dyas, Beverly K.; Cherry, Scott; Raran-Kurussi, Sreejith; Waugh, David S.; Ulrich, Robert G.

    2015-01-01

    Protein tyrosine phosphatases dephosphorylate tyrosine residues of proteins, whereas, dual specificity phosphatases (DUSPs) are a subgroup of protein tyrosine phosphatases that dephosphorylate not only Tyr(P) residue, but also the Ser(P) and Thr(P) residues of proteins. The DUSPs are linked to the regulation of many cellular functions and signaling pathways. Though many cellular targets of DUSPs are known, the relationship between catalytic activity and substrate specificity is poorly defined. We investigated the interactions of peptide substrates with select DUSPs of four types: MAP kinases (DUSP1 and DUSP7), atypical (DUSP3, DUSP14, DUSP22 and DUSP27), viral (variola VH1), and Cdc25 (A-C). Phosphatase recognition sites were experimentally determined by measuring dephosphorylation of 6,218 microarrayed Tyr(P) peptides representing confirmed and theoretical phosphorylation motifs from the cellular proteome. A broad continuum of dephosphorylation was observed across the microarrayed peptide substrates for all phosphatases, suggesting a complex relationship between substrate sequence recognition and optimal activity. Further analysis of peptide dephosphorylation by hierarchical clustering indicated that DUSPs could be organized by substrate sequence motifs, and peptide-specificities by phylogenetic relationships among the catalytic domains. The most highly dephosphorylated peptides represented proteins from 29 cell-signaling pathways, greatly expanding the list of potential targets of DUSPs. These newly identified DUSP substrates will be important for examining structure-activity relationships with physiologically relevant targets. PMID:26302245

  5. Hydrocephalus Defined

    MedlinePlus

    ... narrow pathways. CSF is in constant production and absorption; it has a defined pathway from the lateral ... there is an imbalance of production and/or absorption. With most types of hydrocephalus, the fluid gets ...

  6. Mechanism of the phosphatase component of Clostridium thermocellum polynucleotide kinase-phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2006-01-01

    Polynucleotide kinase-phosphatase (Pnkp) from Clostridium thermocellum catalyzes ATP-dependent phosphorylation of 5'-OH termini of DNA or RNA polynucleotides and Ni(2+)/Mn(2+)-dependent dephosphorylation of 2',3' cyclic phosphate, 2'-phosphate, and 3'-phosphate ribonucleotides. CthPnkp is an 870-amino-acid polypeptide composed of three domains: an N-terminal module similar to bacteriophage T4 polynucleotide kinase, a central module that resembles the dinuclear metallo-phosphoesterase superfamily, and a C-terminal ligase-like adenylyltransferase domain. Here we conducted a mutational analysis of CthPnkp that identified 11 residues required for Ni(2+)-dependent phosphatase activity with 2'-AMP and 3'-AMP. Eight of the 11 CthPnkp side chains were also required for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. The ensemble of essential side chains includes the conserved counterparts (Asp187, His189, Asp233, Arg237, Asn263, His264, His323, His376, and Asp392 in CthPnkp) of all of the amino acids that form the dinuclear metal-binding site and the phosphate-binding site of bacteriophage lambda phosphatase. Three residues (Asp236, His264, and Arg237) required for activity with 2'-AMP or 3'-AMP were dispensable for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. Our findings, together with available structural information, provide fresh insights to the metallophosphoesterase mechanism, including the roles of His264 and Asp236 in proton donation to the leaving group. Deletion analysis defined an autonomous phosphatase domain, CthPnkp-(171-424).

  7. Alkaline Phosphatase in Normal Infants

    PubMed Central

    Stephen, Joan M. L.; Stephenson, Pearl

    1971-01-01

    Alkaline phosphatase was measured in plasma from children receiving vitamin D supplements in day nurseries in the London area, and from children exposed to sunlight in the West Indies. The distribution of values showed that there was no precise upper limit which could be used in the diagnosis of subclinical vitamin D deficiency. PMID:5576029

  8. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B

    PubMed Central

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-01-01

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations. PMID:24821770

  9. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B.

    PubMed

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-05-27

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations.

  10. Protein tyrosine phosphatase: enzymatic assays.

    PubMed

    Montalibet, Jacqueline; Skorey, Kathryn I; Kennedy, Brian P

    2005-01-01

    Activity assays for tyrosine phosphatases are based on the hydrolysis of a arylphosphate moiety from a synthetic substrate yielding a spectroscopically active product. Many different substrates can be used for these assays with p-nitrophenyl phosphate (pNPP), fluorescein diphosphate (FDP), and 6,8-difluoro-4-methylumbellyferyl phosphate (DiFMUP) being the most efficient and versatile. Equally, larger molecules such as phosphotyrosyl peptides can also be used to mimic more natural substrates. Activity assays include the determinations of the rate of dephosphorylation and calculations of kinetic constants such as k(cat) and K(M). These assays are useful to identify and characterize tyrosine phosphatases and are commonly used to evaluate the efficiency of inhibitors.

  11. Alkaline phosphatase of Physarum polycephalum is insoluble.

    PubMed

    Furuhashi, Kiyoshi

    2008-02-01

    The plasmodia of Physarum polycephalum grow as multinucleated cells in the presence of sufficient humidity and nutriment. Under non-illuminating conditions, stresses such as low temperature or high concentrations of salts transform the plasmodia into spherules whereas dehydration induces sclerotization. Some phosphatases including protein phosphatase and acid phosphatase have been purified from the plasmodia, but alkaline phosphatase remains to be elucidated. Phosphatase of the plasmodia, spherules and sclerotia was visualized by electrophoresis gel-staining assay using 5-bromo-4-chloro-3-indolyl phosphate. Insoluble fractions of the sclerotia were abundant in phosphatase activity. The phosphatase which was extracted by nonionic detergent was subjected to column chromatography and preparative electrophoresis. Purified phosphatase showed the highest activity at pH 8.8, indicating that this enzyme belongs to alkaline phosphatase. The apparent molecular mass from sodium dodecyl sulfate-polyacrylamide gel electrophoresis under non-reducing condition was estimated to be 100 kDa whereas that under reducing was 105 kDa. An amount of 1% sodium dodecyl sulfate or 0.5 M NaCl had no effects on the activity although the phosphatase showed heat instability, Mg(2+)-dependency and sensitivity to 2-glycerophosphate or NaF. The extracting conditions and enzymatic properties suggest that this alkaline phosphatase which is in a membrane-bound form plays important roles in phosphate metabolism.

  12. The glucose-6-phosphatase system.

    PubMed Central

    van Schaftingen, Emile; Gerin, Isabelle

    2002-01-01

    Glucose-6-phosphatase (G6Pase), an enzyme found mainly in the liver and the kidneys, plays the important role of providing glucose during starvation. Unlike most phosphatases acting on water-soluble compounds, it is a membrane-bound enzyme, being associated with the endoplasmic reticulum. In 1975, W. Arion and co-workers proposed a model according to which G6Pase was thought to be a rather unspecific phosphatase, with its catalytic site oriented towards the lumen of the endoplasmic reticulum [Arion, Wallin, Lange and Ballas (1975) Mol. Cell. Biochem. 6, 75--83]. Substrate would be provided to this enzyme by a translocase that is specific for glucose 6-phosphate, thereby accounting for the specificity of the phosphatase for glucose 6-phosphate in intact microsomes. Distinct transporters would allow inorganic phosphate and glucose to leave the vesicles. At variance with this substrate-transport model, other models propose that conformational changes play an important role in the properties of G6Pase. The last 10 years have witnessed important progress in our knowledge of the glucose 6-phosphate hydrolysis system. The genes encoding G6Pase and the glucose 6-phosphate translocase have been cloned and shown to be mutated in glycogen storage disease type Ia and type Ib respectively. The gene encoding a G6Pase-related protein, expressed specifically in pancreatic islets, has also been cloned. Specific potent inhibitors of G6Pase and of the glucose 6-phosphate translocase have been synthesized or isolated from micro-organisms. These as well as other findings support the model initially proposed by Arion. Much progress has also been made with regard to the regulation of the expression of G6Pase by insulin, glucocorticoids, cAMP and glucose. PMID:11879177

  13. Interdomain Communication in the Mycobacterium tuberculosis Environmental Phosphatase Rv1364c*

    PubMed Central

    Greenstein, Andrew E.; Hammel, Michal; Cavazos, Alexandra; Alber, Tom

    2009-01-01

    An “environmental phosphatase” controls bacterial transcriptional responses through alternative sigma factor subunits of RNA polymerase and a partner switching mechanism has been proposed to mediate phosphatase regulation. In many bacteria, the environmental phosphatase and multiple regulators are encoded in separate genes whose products form transient complexes. In contrast, in the Mycobacterium tuberculosis homolog, Rv1364c, the phosphatase is fused to two characteristic regulatory modules with sequence similarities to anti-sigma factor kinases and anti-anti-sigma factor proteins. Here we exploit this fusion to explore interactions between the phosphatase and the regulatory domains. We show quantitatively that the anti-sigma factor kinase domain activates the phosphatase domain, the kinase-phosphatase fusion protein autophosphorylates in Escherichia coli, and phosphorylation is antagonized by the phosphatase activity. Small angle x-ray scattering defines solution structures consistent with the interdomain communication observed biochemically. Taken together, these data indicate that Rv1364c provides a single chain framework to understand the structure, function, and regulation of environmental phosphatases throughout the bacterial kingdom. PMID:19700407

  14. Defining chaos

    SciTech Connect

    Hunt, Brian R.; Ott, Edward

    2015-09-15

    In this paper, we propose, discuss, and illustrate a computationally feasible definition of chaos which can be applied very generally to situations that are commonly encountered, including attractors, repellers, and non-periodically forced systems. This definition is based on an entropy-like quantity, which we call “expansion entropy,” and we define chaos as occurring when this quantity is positive. We relate and compare expansion entropy to the well-known concept of topological entropy to which it is equivalent under appropriate conditions. We also present example illustrations, discuss computational implementations, and point out issues arising from attempts at giving definitions of chaos that are not entropy-based.

  15. Inositol polyphosphate phosphatases in human disease.

    PubMed

    Hakim, Sandra; Bertucci, Micka C; Conduit, Sarah E; Vuong, David L; Mitchell, Christina A

    2012-01-01

    Phosphoinositide signalling molecules interact with a plethora of effector proteins to regulate cell proliferation and survival, vesicular trafficking, metabolism, actin dynamics and many other cellular functions. The generation of specific phosphoinositide species is achieved by the activity of phosphoinositide kinases and phosphatases, which phosphorylate and dephosphorylate, respectively, the inositol headgroup of phosphoinositide molecules. The phosphoinositide phosphatases can be classified as 3-, 4- and 5-phosphatases based on their specificity for dephosphorylating phosphates from specific positions on the inositol head group. The SAC phosphatases show less specificity for the position of the phosphate on the inositol ring. The phosphoinositide phosphatases regulate PI3K/Akt signalling, insulin signalling, endocytosis, vesicle trafficking, cell migration, proliferation and apoptosis. Mouse knockout models of several of the phosphoinositide phosphatases have revealed significant physiological roles for these enzymes, including the regulation of embryonic development, fertility, neurological function, the immune system and insulin sensitivity. Importantly, several phosphoinositide phosphatases have been directly associated with a range of human diseases. Genetic mutations in the 5-phosphatase INPP5E are causative of the ciliopathy syndromes Joubert and MORM, and mutations in the 5-phosphatase OCRL result in Lowe's syndrome and Dent 2 disease. Additionally, polymorphisms in the 5-phosphatase SHIP2 confer diabetes susceptibility in specific populations, whereas reduced protein expression of SHIP1 is reported in several human leukaemias. The 4-phosphatase, INPP4B, has recently been identified as a tumour suppressor in human breast and prostate cancer. Mutations in one SAC phosphatase, SAC3/FIG4, results in the degenerative neuropathy, Charcot-Marie-Tooth disease. Indeed, an understanding of the precise functions of phosphoinositide phosphatases is not only

  16. Defining excellence.

    PubMed

    Mehl, B

    1993-05-01

    Excellence in the pharmacy profession, particularly pharmacy management, is defined. Several factors have a significant effect on the ability to reach a given level of excellence. The first is the economic and political climate in which pharmacists practice. Stricter controls, reduced resources, and the velocity of change all necessitate nurturing of values and a work ethic to maintain excellence. Excellence must be measured by the services provided with regard to the resources available; thus, the ability to achieve excellence is a true test of leadership and innovation. Excellence is also time dependent, and today's innovation becomes tomorrow's standard. Programs that raise the level of patient care, not those that aggrandize the profession, are the most important. In addition, basic services must be practiced at a level of excellence. Quality assessment is a way to improve care and bring medical treatment to a higher plane of excellence. For such assessment to be effective and not punitive, the philosophy of the program must be known, and the goal must be clear. Excellence in practice is dependent on factors such as political and social norms, standards of practice, available resources; perceptions, time, the motivation to progress to a higher level, and the continuous innovation required to reshape the profession to meet the needs of society.

  17. [Protein phosphatases: structure and function].

    PubMed

    Bulanova, E G; Budagian, V M

    1994-01-01

    The process of protein and enzyme systems phosphorylation is necessary for cell growth, differentiation and preparation for division and mitosis. The conformation changes of protein as a result of phosphorylation lead to increased enzyme activity and enhanced affinity to substrates. A large group of enzymes--protein kinases--is responsible for phosphorylation process in cell, which are divided into tyrosine- and serine-threonine-kinases depending on their ability to phosphorylate appropriate amino acid residues. In this review has been considered the functional importance and structure of protein phosphatases--enzymes, which are functional antagonists of protein kinases.

  18. Phosphatidylinositolphosphate phosphatase activities and cancer

    PubMed Central

    Rudge, Simon A.; Wakelam, Michael J. O.

    2016-01-01

    Signaling through the phosphoinositide 3-kinase pathways mediates the actions of a plethora of hormones, growth factors, cytokines, and neurotransmitters upon their target cells following receptor occupation. Overactivation of these pathways has been implicated in a number of pathologies, in particular a range of malignancies. The tight regulation of signaling pathways necessitates the involvement of both stimulatory and terminating enzymes; inappropriate activation of a pathway can thus result from activation or inhibition of the two signaling arms. The focus of this review is to discuss, in detail, the activities of the identified families of phosphoinositide phosphatase expressed in humans, and how they regulate the levels of phosphoinositides implicated in promoting malignancy. PMID:26302980

  19. Biochemistry and structure of phosphoinositide phosphatases.

    PubMed

    Kim, Young Jun; Jahan, Nusrat; Bahk, Young Yil

    2013-01-01

    Phosphoinositides are the phosphorylated derivatives of phosphatidylinositol, and play a very significant role in a diverse range of signaling processes in eukaryotic cells. A number of phosphoinositide-metabolizing enzymes, including phosphoinositide-kinases and phosphatases are involved in the synthesis and degradation of these phospholipids. Recently, the function of various phosphatases in the phosphatidylinositol signaling pathway has been of great interest. In the present review we summarize the structural insights and biochemistry of various phosphatases in regulating phosphoinositide metabolism.

  20. The relationship between the MMP system, adrenoceptors and phosphoprotein phosphatases

    PubMed Central

    Rietz, A; Spiers, JP

    2012-01-01

    The MMPs and their inhibitors [tissue inhibitor of MMPs (TIMPs) ] form the mainstay of extracellular matrix homeostasis. They are expressed in response to numerous stimuli including cytokines and GPCR activation. This review highlights the importance of adrenoceptors and phosphoprotein phosphatases (PPP) in regulating MMPs in the cardiovascular system, which may help explain some of the beneficial effects of targeting the adrenoceptor system in tissue remodelling and will establish emerging crosstalk between these three systems. Although α- and β-adrenoceptor activation increases MMP but decreases TIMP expression, MMPs are implicated in the growth stimulatory effects of adrenoceptor activation through transactivation of epidermal growth factor receptor. Furthermore, they have recently been found to catalyse the proteolysis of β-adrenoceptors and modulate vascular tone. While the mechanisms underpinning these effects are not well defined, reversible protein phosphorylation by kinases and phosphatases may be key. In particular, PPP (Ser/Thr phosphatases) are not only critical in resensitization and internalization of adrenoceptors but also modulate MMP expression. The interrelationship is complex as isoprenaline (ISO) inhibits okadaic acid [phosphoprotein phosphatase type 1/phosphoprotein phosphatase type 2A (PP2A) inhibitor]-mediated MMP expression. While this may be simply due to its ability to transiently increase PP2A activity, there is evidence for MMP-9 that ISO prevents okadaic acid-mediated expression of MMP-9 through a β-arrestin, NF-κB-dependent pathway, which is abolished by knock-down of PP2A. It is essential that crosstalk between MMPs, adrenoceptors and PPP are investigated further as it will provide important insight into how adrenoceptors modulate cardiovascular remodelling, and may identify new targets for pharmacological manipulation of the MMP system. PMID:22364165

  1. Insulin-receptor phosphotyrosyl-protein phosphatases.

    PubMed Central

    King, M J; Sale, G J

    1988-01-01

    Calmodulin-dependent protein phosphatase has been proposed to be an important phosphotyrosyl-protein phosphatase. The ability of the enzyme to attack autophosphorylated insulin receptor was examined and compared with the known ability of the enzyme to act on autophosphorylated epidermal-growth-factor (EGF) receptor. Purified calmodulin-dependent protein phosphatase was shown to catalyse the complete dephosphorylation of phosphotyrosyl-(insulin receptor). When compared at similar concentrations, 32P-labelled EGF receptor was dephosphorylated at greater than 3 times the rate of 32P-labelled insulin receptor; both dephosphorylations exhibited similar dependence on metal ions and calmodulin. Native phosphotyrosyl-protein phosphatases in cell extracts were also characterized. With rat liver, heart or brain, most (75%) of the native phosphatase activity against both 32P-labelled insulin and EGF receptors was recovered in the particulate fraction of the cell, with only 25% in the soluble fraction. This subcellular distribution contrasts with results of previous studies using artificial substrates, which found most of the phosphotyrosyl-protein phosphatase activity in the soluble fraction of the cell. Properties of particulate and soluble phosphatase activity against 32P-labelled insulin and EGF receptors are reported. The contribution of calmodulin-dependent protein phosphatase activity to phosphotyrosyl-protein phosphatase activity in cell fractions was determined by utilizing the unique metal-ion dependence of calmodulin-dependent protein phosphatase. Whereas Ni2+ (1 mM) markedly activated the calmodulin-dependent protein phosphatase, it was found to inhibit potently both particulate and soluble phosphotyrosyl-protein phosphatase activity. In fractions from rat liver, brain and heart, total phosphotyrosyl-protein phosphatase activity against both 32P-labelled receptors was inhibited by 99.5 +/- 6% (mean +/- S.E.M., 30 observations) by Ni2+. Results of Ni2+ inhibition

  2. Protein phosphatases and Alzheimer's disease.

    PubMed

    Braithwaite, Steven P; Stock, Jeffry B; Lombroso, Paul J; Nairn, Angus C

    2012-01-01

    Alzheimer's Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Inositol lipid phosphatases in membrane trafficking and human disease.

    PubMed

    Billcliff, Peter G; Lowe, Martin

    2014-07-15

    The specific interaction of phosphoinositides with proteins is critical for a plethora of cellular processes, including cytoskeleton remodelling, mitogenic signalling, ion channel regulation and membrane traffic. The spatiotemporal restriction of different phosphoinositide species helps to define compartments within the cell, and this is particularly important for membrane trafficking within both the secretory and endocytic pathways. Phosphoinositide homoeostasis is tightly regulated by a large number of inositol kinases and phosphatases, which respectively phosphorylate and dephosphorylate distinct phosphoinositide species. Many of these enzymes have been implicated in regulating membrane trafficking and, accordingly, their dysregulation has been linked to a number of human diseases. In the present review, we focus on the inositol phosphatases, concentrating on their roles in membrane trafficking and the human diseases with which they have been associated.

  4. A critical evaluation of a specific radioimmunoassay for prostatic acid phosphatase

    SciTech Connect

    Goldenberg, S.L.; Silver, H.K.; Sullivan, L.D.; Morse, M.J.; Archibald, E.L.

    1982-11-01

    A radioimmunoassay (RIA) method for acid phosphatase detection was compared to a standard enzyme assay using sera from 210 normal volunteers and 285 patients with prostatic disease. Statistical and clinical comparisons were made between defined subgroups. All 55 normal females had RIA detectable serum acid phosphatase, implying that this assay cannot be entirely specific for enzyme of prostatic origin. Urinary catheterization did not affect acid phosphatase levels. In all stages of carcinoma there were more acid phosphatase elevations by the RIA method than enzyme method, but neither assay could differentiate intercapsular cancer from benign prostatic hyperplasia. A small number of patients with biopsy proven negative nodules had marginally elevated values, suggesting an obligation for closer follow-up. The RIA method may be superior for monitoring patients with more advanced malignancy. Additional practical advantages of the RIA include relative simplicity and elimination of the special serum handling required for the enzyme assay.

  5. Pediatric reference intervals for alkaline phosphatase.

    PubMed

    Zierk, Jakob; Arzideh, Farhad; Haeckel, Rainer; Cario, Holger; Frühwald, Michael C; Groß, Hans-Jürgen; Gscheidmeier, Thomas; Hoffmann, Reinhard; Krebs, Alexander; Lichtinghagen, Ralf; Neumann, Michael; Ruf, Hans-Georg; Steigerwald, Udo; Streichert, Thomas; Rascher, Wolfgang; Metzler, Markus; Rauh, Manfred

    2017-01-01

    Interpretation of alkaline phosphatase activity in children is challenging due to extensive changes with growth and puberty leading to distinct sex- and age-specific dynamics. Continuous percentile charts from birth to adulthood allow accurate consideration of these dynamics and seem reasonable for an analyte as closely linked to growth as alkaline phosphatase. However, the ethical and practical challenges unique to pediatric reference intervals have restricted the creation of such percentile charts, resulting in limitations when clinical decisions are based on alkaline phosphatase activity. We applied an indirect method to generate percentile charts for alkaline phosphatase activity using clinical laboratory data collected during the clinical care of patients. A total of 361,405 samples from 124,440 patients from six German tertiary care centers and one German laboratory service provider measured between January 2004 and June 2015 were analyzed. Measurement of alkaline phosphatase activity was performed on Roche Cobas analyzers using the IFCC's photometric method. We created percentile charts for alkaline phosphatase activity in girls and boys from birth to 18 years which can be used as reference intervals. Additionally, data tables of age- and sex-specific percentile values allow the incorporation of these results into laboratory information systems. The percentile charts provided enable the appropriate differential diagnosis of changes in alkaline phosphatase activity due to disease and changes due to physiological development. After local validation, integration of the provided percentile charts into result reporting facilitates precise assessment of alkaline phosphatase dynamics in pediatrics.

  6. HuPho: the human phosphatase portal.

    PubMed

    Liberti, Susanna; Sacco, Francesca; Calderone, Alberto; Perfetto, Livia; Iannuccelli, Marta; Panni, Simona; Santonico, Elena; Palma, Anita; Nardozza, Aurelio P; Castagnoli, Luisa; Cesareni, Gianni

    2013-01-01

    Phosphatases and kinases contribute to the regulation of protein phosphorylation homeostasis in the cell. Phosphorylation is a key post-translational modification underlying the regulation of many cellular processes. Thus, a comprehensive picture of phosphatase function and the identification of their target substrates would aid a systematic approach to a mechanistic description of cell signalling. Here we present a website designed to facilitate the retrieval of information about human protein phosphatases. To this end we developed a search engine to recover and integrate information annotated in several publicly available web resources. In addition we present a text-mining-assisted annotation effort aimed at extracting phosphatase related data reported in the scientific literature. The HuPho (human phosphatases) website can be accessed at http://hupho.uniroma2.it.

  7. Specificity of a protein phosphatase inhibitor from rabbit skeletal muscle.

    PubMed Central

    Cohen, P; Nimmo, G A; Antoniw, J F

    1977-01-01

    A hear-stable protein, which is a specific inhibitor of protein phosphatase-III, was purified 700-fold from skeletal muscle by a procedure that involved heat-treatment at 95 degrees C, chromatography on DEAE-cellulose and gel filtration on Sephadex G-100. The final step completely resolved the protein phosphatase inhibitor from the protein inhibitor of cyclic AMP-dependent protein kinase. The phosphorylase phosphatase, beta-phosphorylase kinase phosphatase, glycogen synthase phosphatase-1 and glycogen synthase phosphatase-2 activities of protein phosphatase-III [Antoniw, J. F., Nimmo, H. G., Yeaman, S. J. & Cohen, P.(1977) Biochem.J. 162, 423-433] were inhibited in a very similar manner by the protein phosphatase inhibitor and at least 95% inhibition was observed at high concentrations of inhibitor. The two forms of protein phosphatase-III, termed IIIA and IIIB, were equally susceptible to the protein phosphatase inhibitor. The protein phosphatase inhibitor was at least 200 times less effective in inhibiting the activity of protein phosphatase-I and protein phosphatase-II. The high degree of specificity of the inhibitor for protein phosphatase-III was used to show that 90% of the phosphorylase phosphatase and glycogen synthase phosphatase activities measured in muscle extracts are catalysed by protein phosphatase-III. Protein phosphatase-III was tightly associated with the protein-glycogen complex that can be isolated from skeletal muscle, whereas the protein phosphatase inhibitor and protein phosphatase-II were not. The results provide further evidence that the enzyme that catalyses the dephosphorylation of the alpha-subunit of phosphorylase kinase (protein phosphatase-II) and the enzyme that catalyses the dephosphorylation of the beta-subunit of phosphorylase kinase (protein phosphatase-III) are distinct. The results suggest that the protein phosphatase inhibitor may be a useful probe for differentiating different classes of protein phosphatases in mammalian

  8. Protein tyrosine phosphatases as potential therapeutic targets

    PubMed Central

    He, Rong-jun; Yu, Zhi-hong; Zhang, Ruo-yu; Zhang, Zhong-yin

    2014-01-01

    Protein tyrosine phosphorylation is a key regulatory process in virtually all aspects of cellular functions. Dysregulation of protein tyrosine phosphorylation is a major cause of human diseases, such as cancers, diabetes, autoimmune disorders, and neurological diseases. Indeed, protein tyrosine phosphorylation-mediated signaling events offer ample therapeutic targets, and drug discovery efforts to date have brought over two dozen kinase inhibitors to the clinic. Accordingly, protein tyrosine phosphatases (PTPs) are considered next-generation drug targets. For instance, PTP1B is a well-known targets of type 2 diabetes and obesity, and recent studies indicate that it is also a promising target for breast cancer. SHP2 is a bona-fide oncoprotein, mutations of which cause juvenile myelomonocytic leukemia, acute myeloid leukemia, and solid tumors. In addition, LYP is strongly associated with type 1 diabetes and many other autoimmune diseases. This review summarizes recent findings on several highly recognized PTP family drug targets, including PTP1B, Src homology phosphotyrosyl phosphatase 2(SHP2), lymphoid-specific tyrosine phosphatase (LYP), CD45, Fas associated phosphatase-1 (FAP-1), striatal enriched tyrosine phosphatases (STEP), mitogen-activated protein kinase/dual-specificity phosphatase 1 (MKP-1), phosphatases of regenerating liver-1 (PRL), low molecular weight PTPs (LMWPTP), and CDC25. Given that there are over 100 family members, we hope this review will serve as a road map for innovative drug discovery targeting PTPs. PMID:25220640

  9. Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase in rat-liver microsomes.

    PubMed

    Belocopitow, E; Boscoboinik, D

    1982-06-15

    Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase activities of a liver-cell microsomal preparation were solubilized by treatment with Triton X-100. The 100,000 X g supernatant was then passed through a column of Sepharose-4B--concanavalin A. Both enzyme activities were found in the percolate. This treatment eliminated inhibition by ATP and glucose 6-phosphate in both phosphatase activities. In each case the activities were inhibited by higher concentrations of enzyme preparation due to the presence of phospholipids. The inhibitory effects of either phosphatidylcholine or phosphatidylethanolamine were due to competition for detergent. On the other hand, the effect produced by phosphatidic acid appeared to be different, since it did not change the optimal concentration of Triton X-100 for the two enzymes. Dolichyl-phosphate phosphatase was strongly inhibited by both Pi and PPi, whereas dolichyl-diphosphate phosphatase was only slightly inhibited by Pi and not at all by PPi. Dolichyl-diphosphate phosphatase was more inhibited by divalent cations than dolichyl-phosphate phosphatase. The apparent Km of dolichyl-phosphate phosphatase for dolichyl phosphate was 0.15 mM. Dolichol also inhibited dolichyl-phosphate phosphatase, but it produced a stronger inhibition on dolichyl-diphosphate phosphatase. The inhibitory effect of dolichol was not entirely due to detergent competition.

  10. Missense substitutions reflecting regulatory control of transmitter phosphatase activity in two-component signalling.

    PubMed

    Huynh, TuAnh Ngoc; Noriega, Chris E; Stewart, Valley

    2013-05-01

    Negative control in two-component signal transduction results from sensor transmitter phosphatase activity for phospho-receiver dephosphorylation. A hypothetical mechanism for this reaction involves a catalytic residue in the H-box active-site region. However, a complete understanding of transmitter phosphatase regulation is hampered by the abundance of kinase-competent, phosphatase-defective missense substitutions (K(+) P(-) phenotype) outside of the active-site region. For the Escherichia coli NarX sensor, a model for the HisKA_3 sequence family, DHp domain K(+) P(-) mutants defined two classes. Interaction mutants mapped to the active site-distal base of the DHp helix 1, whereas conformation mutants were affected in the X-box region of helix 2. Thus, different types of perturbations can influence transmitter phosphatase activity indirectly. By comparison, K(+) P(-) substitutions in the HisKA sensors EnvZ and NtrB additionally map to a third region, at the active site-proximal top of the DHp helix 1, independently identified as important for DHp-CA domain interaction in this sensor class. Moreover, the NarX transmitter phosphatase activity was independent of nucleotides, in contrast to the activity for many HisKA family sensors. Therefore, distinctions involving both the DHp and the CA domains suggest functional diversity in the regulation of HisKA and HisKA_3 transmitter phosphatase activities.

  11. Evolution of alkaline phosphatases in primates.

    PubMed Central

    Goldstein, D J; Rogers, C; Harris, H

    1982-01-01

    Alkaline phosphatase [orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] in placenta, intestine, liver, kidney, bone, and lung from a variety of primate species has been characterized by quantitative inhibition, thermostability, and immunological studies. Characteristic human placental-type alkaline phosphatase occurs in placentas of great apes (chimpanzee and orangutan) but not in placentas of other primates, including gibbon. It is also present in trace amounts in human lung but not in lung or other tissues of various Old and New World monkeys. However, a distinctive alkaline phosphatase resembling it occurs in substantial amounts in lungs from Old World monkeys but not New World monkeys. It appears that duplication of alkaline phosphatase genes and mutations of genetic elements controlling their tissue expression have occurred relatively recently in mammalian evolution. Images PMID:6950431

  12. Multiple Functions of the Eya Phosphotyrosine Phosphatase

    PubMed Central

    2015-01-01

    Eyes absent (Eya), a protein conserved from plants to humans and best characterized as a transcriptional coactivator, is also the prototype for a novel class of eukaryotic aspartyl protein tyrosine phosphatases. This minireview discusses recent breakthroughs in elucidating the substrates and cellular events regulated by Eya's tyrosine phosphatase function and highlights some of the complexities, new questions, and surprises that have emerged from efforts to understand how Eya's unusual multifunctionality influences developmental regulation and signaling. PMID:26667035

  13. Analysis of Smad Phosphatase Activity In Vitro.

    PubMed

    Shen, Tao; Qin, Lan; Lin, Xia

    2016-01-01

    Phosphorylation of Smad1/5/8 at the C-terminal SXS motif by BMP type I receptors is one of the most critical events in BMP signaling. Conversely, protein phosphatases that dephosphorylate phospho-Smad1/5/8 can consequently prevent or terminate BMP signaling. PPM1H is an undercharacterized phosphatase in the PPM family. We recently demonstrated that PPM1H can dephosphorylate Smad1 in the cytoplasm and block BMP signaling responses in cellular assays. Here we describe in vitro method showing that PPM1H is a bona fide phosphatase for Smad1/5/8. PPM1H is produced as GST fusion protein in E. coli, and purified against glutathione sepharose beads. Bacterially purified recombinant PPM1H possesses phosphatase activity toward artificial substrate para-nitrophenyl phosphate (pNPP). Recombinant PPM1H also dephosphorylates immuno-purified phosphorylated Smad1 in test tubes. These direct in vitro phosphatase assays provide convincing evidence demonstrating the role of PPM1H as a specific phosphatase for P-Smad1.

  14. Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase

    DTIC Science & Technology

    2011-08-01

    polynucleotide kinase 3’-phosphatase17 71 CACGTGAACAGGGACACGCTA CACGTGTGAGACAGCCCTGAA CGGGAAGTCCACCTTTCTCAA CAAGCTGGTGATCTTCACCAA PPAP2A phosphatidic acid ...phosphatase type 2A8 97 AACCCTGTCTGTTTACTGTAA CTGACATTGCCAAGTATTCAA CATGCTGTTTGTGGCACTTTA CCGGGCAGAGACCATGTTTGA PPAP2B phosphatidic acid phosphatase...type 2B8 98 AGCGATCGTCCCGGAGAGCAA CAGCACAATTTCAGAAGAAAT CCGGATCTATTACCTGAAGAA CCGGGCACTTGCATACTCTTA PPAP2C phosphatidic acid phosphatase type 2C8 99

  15. Assessing the biological activity of the glucan phosphatase laforin

    PubMed Central

    Romá-Mateo, Carlos; Raththagala, Madushi; Gentry, Mathew S.; Sanz, Pascual

    2017-01-01

    Summary Glucan phosphatases are a recently discovered family of enzymes that dephosphorylate either starch or glycogen and are essential for proper starch metabolism in plants and glycogen metabolism in humans. Mutations in the gene encoding the only human glucan phosphatase, laforin, result in the fatal, neurodegenerative, epilepsy known as Lafora disease. Here, we describe phosphatase assays to assess both generic laforin phosphatase activity and laforin’s unique glycogen phosphatase activity. PMID:27514803

  16. Identification of the adipocyte acid phosphatase as a PAO-sensitive tyrosyl phosphatase.

    PubMed Central

    Shekels, L. L.; Smith, A. J.; Van Etten, R. L.; Bernlohr, D. A.

    1992-01-01

    We have partially purified an 18-kDa cytoplasmic protein from 3T3-L1 cells, which dephosphorylates pNPP and the phosphorylated adipocyte lipid binding protein (ALBP), and have identified it by virtue of kinetic and immunological criteria as an acid phosphatase (EC 3.1.3.2). The cytoplasmic acid phosphatase was inactivated by phenylarsine oxide (PAO) (Kinact = 10 microM), and the inactivation could be reversed by the dithiol, 2,3-dimercaptopropanol (Kreact = 23 microM), but not the monothiol, 2-mercaptoethanol. Cloning of the human adipocyte acid phosphatase revealed that two isoforms exist, termed HAAP alpha and HAAP beta (human adipocyte acid phosphatase), which are distinguished by a 34-amino acid isoform-specific domain. Sequence analysis shows HAAP alpha and HAAP beta share 74% and 90% identity with the bovine liver acid phosphatase, respectively, and 99% identity with both isoenzymes of the human red cell acid phosphatase but no sequence similarity to the protein tyrosine phosphatases (EC 3.1.3.48). HAAP beta has been cloned into Escherichia coli, expressed, and purified as a glutathione S-transferase fusion protein. Recombinant HAAP beta was shown to dephosphorylate pNPP and phosphoALBP and to be inactivated by PAO and inhibited by vanadate (Ki = 17 microM). These results describe the adipocyte acid phosphatase as a cytoplasmic enzyme containing conformationally vicinal cysteine residues with properties that suggest it may dephosphorylate tyrosyl phosphorylated cellular proteins. PMID:1304913

  17. Alkaline phosphatase and bone calcium parameters.

    PubMed

    Fauran-Clavel, M J; Oustrin, J

    1986-01-01

    Effects of cadmium, an alkaline phosphatase inhibitor, on the calcium content of rat bone were investigated in vivo by a radioisotopic method. Disturbance of bone metabolism is observed in both the superficial (delta) and slow exchanges (Ve), which are also significantly decreased. The crystallized calcium bone compartment (E) is also strongly affected. It appears that changes in the superficial calcium exchanges cause the observed decrease in the crystallized calcium mass. The slowing of osteogenesis is confirmed by the decrease of serum alkaline phosphatase activity. A statistical examination of the correlation coefficient reveals a close link (P less than 0.01) between serum alkaline phosphatase activity and the influx of superficial calcium (Vo+) and, as a result, the crystallized bone calcium parameters. These results show that cadmium can be used to study the relationship between alkaline phosphatase and calcification. The present observations allow us to consider the possibility that alkaline phosphatase may play a role in determining the calcium content of the crystallized phases in deep bone through its action on the tissue surface.

  18. The histidine phosphatase superfamily: structure and function.

    PubMed

    Rigden, Daniel J

    2008-01-15

    The histidine phosphatase superfamily is a large functionally diverse group of proteins. They share a conserved catalytic core centred on a histidine which becomes phosphorylated during the course of the reaction. Although the superfamily is overwhelmingly composed of phosphatases, the earliest known and arguably best-studied member is dPGM (cofactor-dependent phosphoglycerate mutase). The superfamily contains two branches sharing very limited sequence similarity: the first containing dPGM, fructose-2,6-bisphosphatase, PhoE, SixA, TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator], Sts-1 and many other activities, and the second, smaller, branch composed mainly of acid phosphatases and phytases. Human representatives of both branches are of considerable medical interest, and various parasites contain superfamily members whose inhibition might have therapeutic value. Additionally, several phosphatases, notably the phytases, have current or potential applications in agriculture. The present review aims to draw together what is known about structure and function in the superfamily. With the benefit of an expanding set of histidine phosphatase superfamily structures, a clearer picture of the conserved elements is obtained, along with, conversely, a view of the sometimes surprising variation in substrate-binding and proton donor residues across the superfamily. This analysis should contribute to correcting a history of over- and mis-annotation in the superfamily, but also suggests that structural knowledge, from models or experimental structures, in conjunction with experimental assays, will prove vital for the future description of function in the superfamily.

  19. Acid phosphatase/phosphotransferases from enteric bacteria.

    PubMed

    Mihara, Y; Utagawa, T; Yamada, H; Asano, Y

    2001-01-01

    We have investigated the enzymatic phosphorylation of nucleosides and found that Morganella morganii phoC acid phosphatase exhibits regioselective pyrophosphate (PP(i))-nucleoside phosphotransferase activity. In this study, we isolated genes encoding an acid phosphatase with regioselective phosphotransferase activity (AP/PTase) from Providencia stuartii, Enterobacter aerogenes, Escherichia blattae and Klebsiella planticola, and compared the primary structures and enzymatic characteristics of these enzymes with those of AP/PTase (PhoC acid phosphatase) from M. morganii. The enzymes were highly homologous in primary structure with M. morganii AP/PTase, and are classified as class A1 acid phosphatases. The synthesis of inosine-5'-monophosphate (5'-IMP) by E. coli overproducing each acid phosphatase was investigated. The P. stuartii enzyme, which is most closely related to the M. morganii enzyme, exhibited high 5'-IMP productivity, similar to the M. morganii enzyme. The 5'-IMP productivities of the E. aerogenes, E. blattae and K. planticola enzymes were inferior to those of the former two enzymes. This result underlines the importance of lower K(m) values for efficient nucleotide production. As these enzymes exhibited a very high degree of homology at the amino acid sequence level, it is likely that local sequence differences in the binding pocket are responsible for the differences in the nucleoside-PP(i) phosphotransferase reaction.

  20. Protein interaction network of the mammalian Hippo pathway reveals mechanisms of kinase-phosphatase interactions.

    PubMed

    Couzens, Amber L; Knight, James D R; Kean, Michelle J; Teo, Guoci; Weiss, Alexander; Dunham, Wade H; Lin, Zhen-Yuan; Bagshaw, Richard D; Sicheri, Frank; Pawson, Tony; Wrana, Jeffrey L; Choi, Hyungwon; Gingras, Anne-Claude

    2013-11-19

    The Hippo pathway regulates organ size and tissue homeostasis in response to multiple stimuli, including cell density and mechanotransduction. Pharmacological inhibition of phosphatases can also stimulate Hippo signaling in cell culture. We defined the Hippo protein-protein interaction network with and without inhibition of serine and threonine phosphatases by okadaic acid. We identified 749 protein interactions, including 599 previously unrecognized interactions, and demonstrated that several interactions with serine and threonine phosphatases were phosphorylation-dependent. Mutation of the T-loop of MST2 (mammalian STE20-like protein kinase 2), which prevented autophosphorylation, disrupted its association with STRIPAK (striatin-interacting phosphatase and kinase complex). Deletion of the amino-terminal forkhead-associated domain of SLMAP (sarcolemmal membrane-associated protein), a component of the STRIPAK complex, prevented its association with MST1 and MST2. Phosphatase inhibition produced temporally distinct changes in proteins that interacted with MOB1A and MOB1B (Mps one binder kinase activator-like 1A and 1B) and promoted interactions with upstream Hippo pathway proteins, such as MST1 and MST2, and with the trimeric protein phosphatase 6 complex (PP6). Mutation of three basic amino acids that are part of a phospho-serine- and phospho-threonine-binding domain in human MOB1B prevented its interaction with MST1 and PP6 in cells treated with okadaic acid. Collectively, our results indicated that changes in phosphorylation orchestrate interactions between kinases and phosphatases in Hippo signaling, providing a putative mechanism for pathway regulation.

  1. Structure-function analysis of the 3' phosphatase component of T4 polynucleotide kinase/phosphatase.

    PubMed

    Zhu, Hui; Smith, Paul; Wang, Li Kai; Shuman, Stewart

    2007-09-15

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  2. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  3. AKAP phosphatase complexes in the heart.

    PubMed

    Redden, John M; Dodge-Kafka, Kimberly L

    2011-10-01

    Directed protein phosphorylation is indisputably critical for a multitude of cellular processes. A growing body of research demonstrates A kinase anchoring proteins (AKAPs) to mediate a significant number of phosphorylation events in the heart. By acting as molecular tethers for the regulatory subunit of protein kinase A, AKAPs focus kinase activity onto specific substrate. In the time since their discovery, the AKAP model has evolved in appreciation of the broader role these scaffolds play in coordinating multiple signaling enzymes to efficiently regulate dynamic cellular processes. The focus of this review is on the emerging role of AKAPs in regulating the 3 main cardiac phosphatases: Protein Phosphatase 1 by AKAP18 and Yotiao, and Protein Phosphatases 2A and 2B by muscle specific A-kinase anchoring protein.

  4. A specific sucrose phosphatase from plant tissues

    PubMed Central

    Hawker, J. S.; Hatch, M. D.

    1966-01-01

    1. A phosphatase that hydrolyses sucrose phosphate (phosphorylated at the 6-position of fructose) was isolated from sugar-cane stem and carrot roots. With partially purified preparations fructose 6-phosphate, glucose 6-phosphate, fructose 1-phosphate, glucose 1-phosphate and fructose 1,6-diphosphate are hydrolysed at between 0 and 2% of the rate for sucrose phosphate. 2. The activity of the enzyme is increased fourfold by the addition of Mg2+ ions and inhibited by EDTA, fluoride, inorganic phosphate, pyrophosphate, Ca2+ and Mn2+ ions. Sucrose (50mm) reduces activity by 60%. 3. The enzyme exhibits maximum activity between pH6·4 and 6·7. The Michaelis constant for sucrose phosphate is between 0·13 and 0·17mm. 4. At least some of the specific phosphatase is associated with particles having the sedimentation properties of mitochondria. 5. A similar phosphatase appears to be present in several other plant species. PMID:4290548

  5. CDC25 phosphatases as potential human oncogenes.

    PubMed

    Galaktionov, K; Lee, A K; Eckstein, J; Draetta, G; Meckler, J; Loda, M; Beach, D

    1995-09-15

    Cyclin-dependent kinases (CDKs) are activated by CDC25 phosphatases, which remove inhibitory phosphate from tyrosine and threonine residues. In human cells, CDC25 proteins are encoded by a multigene family, consisting of CDC25A, CDC25B, and CDC25C. In rodent cells, human CDC25A or CDC25B but not CDC25C phosphatases cooperate with either Ha-RASG12V or loss of RB1 in oncogenic focus formation. Such transformants were highly aneuploid, grew in soft agar, and formed high-grade tumors in nude mice. Overexpression of CDC25B was detected in 32 percent of human primary breast cancers tested. The CDC25 phosphatases may contribute to the development of human cancer.

  6. A Porphyromonas gingivalis haloacid dehalogenase family phosphatase interacts with human phosphoproteins and is important for invasion.

    PubMed

    Tribble, Gena D; Mao, Song; James, Chloe E; Lamont, Richard J

    2006-07-18

    Haloacid dehalogenase (HAD) family phosphatases are widespread in prokaryotes and are generally involved in metabolic processes. Porphyromonas gingivalis, an invasive periodontal pathogen, secretes the HAD family phosphoserine phosphatase SerB653 when in contact with gingival epithelial cells. Here we characterize the structure and enzymatic activity of SerB653 and show that a SerB653 allelic replacement mutant of P. gingivalis is deficient in internalization and persistence in gingival epithelial cells. In contrast, mutation of a second HAD family serine phosphatase of P. gingivalis (SerB1170), or of a serine transporter, did not affect invasion. A pull-down assay identified GAPDH and heat-shock protein 90 as potential substrates for SerB653. Furthermore, exogenous phosphatase regulated microtubule dynamics in host cells. These data indicate that P. gingivalis has adapted a formerly metabolic enzyme to facilitate entry into host cells by modulating host cytoskeletal architecture. Our findings define a virulence-related role of a HAD family phosphatase and reveal an invasin of an important periodontal pathogen.

  7. The Glycosylphosphatidylinositol-Anchored Phosphatase from Spirodela oligorrhiza Is a Purple Acid Phosphatase1

    PubMed Central

    Nakazato, Hiroshi; Okamoto, Takashi; Nishikoori, Miwa; Washio, Kenji; Morita, Naoki; Haraguchi, Kensaku; Thompson, Guy A.; Okuyama, Hidetoshi

    1998-01-01

    We recently presented clear evidence that the major low-phosphate-inducible phosphatase of the duckweed Spirodela oligorrhiza is a glycosylphosphatidylinositol (GPI)-anchored protein, and, to our knowledge, is the first described from higher plants (N. Morita, H. Nakazato, H. Okuyama, Y. Kim, G.A. Thompson, Jr. [1996] Biochim Biophys Acta 1290: 53–62). In this report the purified 57-kD phosphatase is shown to be a purple metalloenzyme containing Fe and Mn atoms and having an absorption maximum at 556 nm. The phosphatase activity was only slightly inhibited by tartrate, as expected for a purple acid phosphatase (PAP). Furthermore, the protein cross-reacted with an anti-Arabidopsis PAP antibody on immunoblots. The N-terminal amino acid sequence of the phosphatase was very similar to those of Arabidopsis, red kidney bean (Phaseolus vulgaris), and soybean (Glycine max) PAP. Extracts of S. oligorrhiza plants incubated with the GPI-specific precursor [3H]ethanolamine were treated with antibodies raised against the purified S. oligorrhiza phosphatase. Radioactivity from the resulting immunoprecipitates was specifically associated with a 57-kD band on sodium dodecyl sulfate-polyacrylamide gels. These results, together with previous findings, strongly indicate that the GPI-anchored phosphatase of S. oligorrhiza is a PAP. PMID:9808746

  8. Isozymes of bovine intestinal alkaline phosphatase. Characterization and functional studies

    SciTech Connect

    Besman, M.J.A.

    1986-01-01

    The membrane-associated alkaline phosphatases of calf and adult bovine small intestines have been isolated to homogeneity by a novel method developed to purify large quantities of enzyme. Chromatofocusing revealed the existence of two isozymes in calf tissue while only one form was present in the adult. The three amphiphilic metallo protein dimers were characterized as to total amino acid and carbohydrate content, zinc stoichiometries and mode of carbohydrate linkage. The molecular relationship between the three enzymes was defined by tryptic peptide HPLC-mapping and N-terminal sequencing, and demonstrated the existence of two calf isozymes of unique primary sequence, only one of which is expressed in the adult animal. In the presence of protease inhibitors, two new, higher M/sub r/ species (66,000 and 62,000 daltons vs 60,000 daltons) of adult bovine alkaline phosphatase were demonstrated by electrophoresis of /sup 32/P/sub i/-labeled tissue, probing gels by autoradiography and Western blotting. The in vivo enzyme was isolated using a modified, rapid procedure; the two higher M/sub r/ species copurified.

  9. Molecular Evolution of Phosphoprotein Phosphatases in Drosophila

    PubMed Central

    Miskei, Márton; Ádám, Csaba; Kovács, László; Karányi, Zsolt; Dombrádi, Viktor

    2011-01-01

    Phosphoprotein phosphatases (PPP), these ancient and important regulatory enzymes are present in all eukaryotic organisms. Based on the genome sequences of 12 Drosophila species we traced the evolution of the PPP catalytic subunits and noted a substantial expansion of the gene family. We concluded that the 18–22 PPP genes of Drosophilidae were generated from a core set of 8 indispensable phosphatases that are present in most of the insects. Retropositons followed by tandem gene duplications extended the phosphatase repertoire, and sporadic gene losses contributed to the species specific variations in the PPP complement. During the course of these studies we identified 5, up till now uncharacterized phosphatase retrogenes: PpY+, PpD5+, PpD6+, Pp4+, and Pp6+ which are found only in some ancient Drosophila. We demonstrated that all of these new PPP genes exhibit a distinct male specific expression. In addition to the changes in gene numbers, the intron-exon structure and the chromosomal localization of several PPP genes was also altered during evolution. The G−C content of the coding regions decreased when a gene moved into the heterochromatic region of chromosome Y. Thus the PPP enzymes exemplify the various types of dynamic rearrangements that accompany the molecular evolution of a gene family in Drosophilidae. PMID:21789237

  10. Phosphatase activities analyzed by in vivo expressions.

    PubMed

    Schweighofer, Alois; Ayatollahi, Zahra; Meskiene, Irute

    2009-01-01

    Protein phosphatases act to reverse phosphorylation-related modifications induced by protein kinases. Type 2C protein phosphatases (PP2C) are monomeric Ser/Thr phosphatases that require a metal for their activity and are abundant in prokaryotes and eukaryotes. In plants, such as Medicago and Arabidopsis PP2Cs control several essential processes, including ABA signaling, development, and wound-induced mitogen-activated protein kinase (MAPK) pathways. In vitro assays with recombinant proteins and yeast two-hybrid systems usually provide initial information about putative PP2C substrates; however, these observations have to be verified in vivo. Therefore, a method for transient expression in isolated Arabidopsis suspension cell protoplasts was developed to assay PP2C action in living cells. This system has proven to be very useful in producing active enzymes and their substrates and in performing enzymatic reactions in vivo. Transient gene expression in isolated cells enabled assembly of functional protein kinase cascades and the creation of phosphorylated targets for PP2Cs. The method is based on the co-transformation and transient co-expression of different PP2C proteins with MAPK. It shows that epitope-tagged PP2C and MAPK proteins exhibit high enzymatic activities and produce substantial protein amounts easily monitored by Western blot analysis. Additionally, PP2C phosphatase activities can be directly tested in protein extracts from protoplasts, suggesting a possibility for analysis of activities of new PP2C family members.

  11. Phosphatase hydrolysis of organic phosphorus compounds

    USDA-ARS?s Scientific Manuscript database

    Phosphatases are diverse groups of enzymes that deserve special attention because of the significant roles they play in mineralizing organic phosphorus (P) into inorganic available form. For getting more insight on the enzymatically hydrolysis of organic P, in this work, we compared the catalytic pa...

  12. Assaying inositol and phosphoinositide phosphatase enzymes.

    PubMed

    Donahue, Janet L; Ercetin, Mustafa; Gillaspy, Glenda E

    2013-01-01

    One critical aspect of phosphoinositide signaling is the turnover of signaling molecules in the pathway. These signaling molecules include the phosphatidylinositol phosphates (PtdInsPs) and inositol phosphates (InsPs). The enzymes that catalyze the breakdown of these molecules are thus important potential regulators of signaling, and in many cases the activity of such enzymes needs to be measured and compared to other enzymes. PtdInsPs and InsPs are broken down by sequential dephosphorylation reactions which are catalyzed by a set of specific phosphatases. Many of the phosphatases can act on both PtdInsP and InsP substrates. The protocols described in this chapter detail activity assays that allow for the measurement of PtdInsP and InsP phosphatase activities in vitro starting with native or recombinant enzymes. Three different assays are described that have different equipment requirements and allow one to test a range of PtdInsP and InsP phosphatases that act on different substrates.

  13. Phosphatase activities as biosignatures of extant life

    NASA Astrophysics Data System (ADS)

    Kobayashi, K.; Itoh, Y.; Edazawa, Y.; Moroi, A.; Takano, Y.

    It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere high temperature hot springs and stratosphere Possible extraterrestrial biospheres in Mars Europa and Titan are being discussed Many biosignatures or biomarkers have been proposed to detect microbial activities in such extreme environments Phosphate esters are essential for the terrestrial life since they are constituents of nucleic acids and cell mebranes Thus all the terrestrial organisms have phosphatases that are enzymes catalyzing hydrolysis of phosphate esters We analyzed phosphatase activities in the samples obtained in extreme environments such as submarine hydrothermal systems and discussed whether they can be used as biosignatures for extant life Core samples and chimney samples were collected at the Suiyo Seamount Izu-Bonin Arc the Pacific Ocean in 2001 and 2002 and in South Mariana hydrothermal systems the Pacific Oceanas in 2003 both in a part of the Archaean Park Project Phosphatase activity in solid rock samples was measured spectrometrically by using 25 mM p-nitrophenyl phosphate pH 8 0 or pH 6 5 as a substrate as follows Pulverized samples were incuvated with substrate solution for an hour and then production rate of p-nitrophenol was calculated with absorbance at 410 nm Phosphatase activity in extracts was measured fluorometrically by using 4-methylumberyferryl phosphate as a substrate Concentration of amino acids and their enantiomeric ratio were determined by HPLC after HF digestion of the

  14. Characterization of human foetal intestinal alkaline phosphatase. Comparison with the isoenzymes from the adult intestine and human tumour cell lines.

    PubMed Central

    Behrens, C M; Enns, C A; Sussman, H H

    1983-01-01

    The molecular structure of human foetal intestinal alkaline phosphatase was defined by high-resolution two-dimensional polyacrylamide-gel electrophoresis and amino acid inhibition studies. Comparison was made with the adult form of intestinal alkaline phosphatase, as well as with alkaline phosphatases isolated from cultured foetal amnion cells (FL) and a human tumour cell line (KB). Two non-identical subunits were isolated from the foetal intestinal isoenzyme, one having same molecular weight and isoelectric point as placental alkaline phosphatase, and the other corresponding to a glycosylated subunit of the adult intestinal enzyme. The FL-cell and KB-cell alkaline phosphatases were also found to contain two subunits similar to those of the foetal intestinal isoenzyme. Characterization of neuraminidase digests of the non-placental subunit showed it to be indistinguishable from the subunits of the adult intestinal isoenzyme. This implies that no new phosphatase structural gene is involved in the transition from the expression of foetal to adult intestinal alkaline phosphatase, but that the molecular changes involve suppression of the placental subunit and loss of neuraminic acid from the non-placental subunit. Enzyme-inhibition studies demonstrated an intermediate response to the inhibitors tested for the foetal intestinal, FL-cell and KB-cell isoenzymes when compared with the placental, adult intestinal and liver forms. This result is consistent with the mixed-subunit structure observed for the former set of isoenzymes. In summary, this study has defined the molecular subunit structure of the foetal intestinal form of alkaline phosphatase and has demonstrated its expression in a human tumour cell line. Images Fig. 1. PMID:6882358

  15. The Zds proteins control entry into mitosis and target protein phosphatase 2A to the Cdc25 phosphatase

    PubMed Central

    Wicky, Sidonie; Tjandra, Hendri; Schieltz, David; Yates, John; Kellogg, Douglas R.

    2011-01-01

    The Wee1 kinase restrains entry into mitosis by phosphorylating and inhibiting cyclin-dependent kinase 1 (Cdk1). The Cdc25 phosphatase promotes entry into mitosis by removing Cdk1 inhibitory phosphorylation. Experiments in diverse systems have established that Wee1 and Cdc25 are regulated by protein phosphatase 2A (PP2A), but a full understanding of the function and regulation of PP2A in entry into mitosis has remained elusive. In budding yeast, entry into mitosis is controlled by a specific form of PP2A that is associated with the Cdc55 regulatory subunit (PP2ACdc55). We show here that related proteins called Zds1 and Zds2 form a tight stoichiometric complex with PP2ACdc55 and target its activity to Cdc25 but not to Wee1. Conditional inactivation of the Zds proteins revealed that their function is required primarily at entry into mitosis. In addition, Zds1 undergoes cell cycle–dependent changes in phosphorylation. Together, these observations define a role for the Zds proteins in controlling specific functions of PP2ACdc55 and suggest that upstream signals that regulate PP2ACdc55 may play an important role in controlling entry into mitosis. PMID:21119008

  16. Tyrosine phosphatase activity in mitochondria: presence of Shp-2 phosphatase in mitochondria.

    PubMed

    Salvi, M; Stringaro, A; Brunati, A M; Agostinelli, E; Arancia, G; Clari, G; Toninello, A

    2004-09-01

    Tyrosine phosphorylation by unidentified enzymes has been observed in mitochondria, with recent evidence indicating that non-receptorial tyrosine kinases belonging to the Src family, which represent key players in several transduction pathways, are constitutively present in mitochondria. The extent of protein phosphorylation reflects a coordination balance between the activities of specific kinases and phophatases. The present study demonstrates that purified rat brain mitochondria possess endogenous tyrosine phosphatase activity. Mitochondrial phosphatases were found to be capable of dephosphorylating different exogenous substrates, including paranitrophenylphosphate, (32)P-poly(Glu-Tyr)(4:1) and (32)P-angiotensin. These activities are strongly inhibited by peroxovanadate, a well-known inhibitor of tyrosine phosphatases, but not by inhibitors of alkali or Ser/Thr phosphatases, and mainly take place in the intermembrane space and outer mitochondrial membrane. Using a combination of approaches, we identified the tyrosine phosphatase Shp-2 in mitochondria. Shp-2 plays a crucial role in a number of intracellular signalling cascades and is probably involved in several human diseases. It thus represents the first tyrosine phosphatase shown to be present in mitochondria.

  17. [Leucocyte alkaline phosphatase in normal and pathological pregnancy (author's transl)].

    PubMed

    Stark, K H; Zaki, I; Sobolewski, K

    1981-01-01

    The activities of leucocyte alkaline phosphatase were determined in 511 patients with normal and pathological pregnancy. Mean values were compared and the enzyme followed up, and the conclusion was drawn that leucocyte alkaline phosphatase was no safe indicator of foetal condition. No direct relationship were found to exist between leucocyte alkaline phosphatase, total oestrogens, HSAP, HLAP, HPL, and oxytocinase.

  18. Interactions of Phosphatase and Tensin Homologue (PTEN) Proteins with Phosphatidylinositol Phosphates: Insights from Molecular Dynamics Simulations of PTEN and Voltage Sensitive Phosphatase

    PubMed Central

    2014-01-01

    The phosphatase and tensin homologue (PTEN) and the Ciona intestinalis voltage sensitive phosphatase (Ci-VSP) are both phosphatidylinositol phosphate (PIP) phosphatases that contain a C2 domain. PTEN is a tumor suppressor protein that acts as a phosphatase on PIP3 in mammalian cell membranes. It contains two principal domains: a phosphatase domain (PD) and a C2 domain. Despite detailed structural and functional characterization, less is known about its mechanism of interaction with PIP-containing lipid bilayers. Ci-VSP consists of an N-terminal transmembrane voltage sensor domain and a C-terminal PTEN domain, which in turn contains a PD and a C2 domain. The nature of the interaction of the PTEN domain of Ci-VSP with membranes has not been well established. We have used multiscale molecular dynamics simulations to define the interaction mechanisms of PTEN and of the Ci-VSP PTEN domains with PIP-containing lipid bilayers. Our results suggest a novel mechanism of association of the PTEN with such bilayers, in which an initial electrostatics-driven encounter of the protein and bilayer is followed by reorientation of the protein to optimize its interactions with PIP molecules in the membrane. Although a PIP3 molecule binds close to the active site of PTEN, our simulations suggest a further conformational change of the protein may be required for catalytically productive binding to occur. Ci-VSP interacted with membranes in an orientation comparable to that of PTEN but bound directly to PIP-containing membranes without a subsequent reorientation step. Again, PIP3 bound close to the active site of the Ci-VSP PD, but not in a catalytically productive manner. Interactions of Ci-VSP with the bilayer induced clustering of PIP molecules around the protein. PMID:24588644

  19. Interactions of phosphatase and tensin homologue (PTEN) proteins with phosphatidylinositol phosphates: insights from molecular dynamics simulations of PTEN and voltage sensitive phosphatase.

    PubMed

    Kalli, Antreas C; Devaney, Isabel; Sansom, Mark S P

    2014-03-25

    The phosphatase and tensin homologue (PTEN) and the Ciona intestinalis voltage sensitive phosphatase (Ci-VSP) are both phosphatidylinositol phosphate (PIP) phosphatases that contain a C2 domain. PTEN is a tumor suppressor protein that acts as a phosphatase on PIP3 in mammalian cell membranes. It contains two principal domains: a phosphatase domain (PD) and a C2 domain. Despite detailed structural and functional characterization, less is known about its mechanism of interaction with PIP-containing lipid bilayers. Ci-VSP consists of an N-terminal transmembrane voltage sensor domain and a C-terminal PTEN domain, which in turn contains a PD and a C2 domain. The nature of the interaction of the PTEN domain of Ci-VSP with membranes has not been well established. We have used multiscale molecular dynamics simulations to define the interaction mechanisms of PTEN and of the Ci-VSP PTEN domains with PIP-containing lipid bilayers. Our results suggest a novel mechanism of association of the PTEN with such bilayers, in which an initial electrostatics-driven encounter of the protein and bilayer is followed by reorientation of the protein to optimize its interactions with PIP molecules in the membrane. Although a PIP3 molecule binds close to the active site of PTEN, our simulations suggest a further conformational change of the protein may be required for catalytically productive binding to occur. Ci-VSP interacted with membranes in an orientation comparable to that of PTEN but bound directly to PIP-containing membranes without a subsequent reorientation step. Again, PIP3 bound close to the active site of the Ci-VSP PD, but not in a catalytically productive manner. Interactions of Ci-VSP with the bilayer induced clustering of PIP molecules around the protein.

  20. [ATPase and phosphatase activity of drone brood].

    PubMed

    Bodnarchuk, L I; Stakhman, O S

    2004-01-01

    Most researches on insect enzymes concern carbohydrate and nitrogenous exchange. Data on ATPase activity for larval material of drone brood are absent in the available literature. The drone brood is one of the least investigated apiproducts. Allowing for the important role of ATPase in the vital functions of the insect cells our work was aimed at the study of ATPase of the drone blood activity and that of alkaline and acid phosphatases. When studying liophylised preparations of the drone brood homogenate we have found out high activity of Mg2+, Na+, K+-, Ca2+- and Mg2+-ATPase and of alkaline and acid phosphatase, that is the possible explanation of the high-intensity power and plastic processes proceeding during growth and development of larvae.

  1. Assessment and kinetics of soil phosphatase in Brazilian Savanna systems.

    PubMed

    Ferreira, Adão S; Espíndola, Suéllen P; Campos, Maria Rita C

    2016-05-31

    The activity and kinetics of soil phosphatases are important indicators to evaluate soil quality in specific sites such as the Cerrado (Brazilian Savanna). This study aimed to determine the activity and kinetic parameters of soil phosphatase in Cerrado systems. Soil phosphatase activity was assessed in samples of native Cerrado (NC), no-tillage (NT), conventional tillage (CT) and pasture with Brachiaria brizantha (PBb) and evaluated with acetate buffer (AB), tris-HCl buffer (TB), modified universal buffer (MUB) and low MUB. The Michaelis-Menten equation and Eadie-Hofstee model were applied to obtain the kinetic parameters of soil phosphatase using different concentrations of p-nitrophenol phosphate (p-NPP). MUB showed the lowest soil phosphatase activity in all soils whereas AB in NC and NT presented the highest. Low MUB decreased interferences in the assessment of soil phosphatase activity when compared to MUB, suggesting that organic acids interfere on the soil phosphatase activity. In NC and NT, soil phosphatase activity performed with TB was similar to AB and low MUB. Km values from the Michaels-Menten equation were higher in NC than in NT, which indicate a lower affinity of phosphatase activity for the substrate in NC. Vmax values were also higher in NC than in NT. The Eadie-Hofstee model suggests that NC had more phosphatase isoforms than NT. The study showed that buffer type is of fundamental importance when assessing soil phosphatase activity in Cerrado soils.

  2. Evaluation of APHA and AOAC methods for phosphatase in cheese.

    PubMed

    Murthy, G K; Cox, S

    1988-01-01

    Varieties of market cheese were analyzed for alkaline phosphatase by the modified rapid colorimetric method of the American Public Health Association (APHA) and the official AOAC method, 16.304-16.306. In the APHA method, 5 g cheese (pH less than 7.0) is macerated with 2 mL 1:1 carbonate buffer, or 2 mL water (for cheese with pH greater than 7.0). Addition of 0.1 mL magnesium acetate (1 mg magnesium) to test portions of cheese extracts yielded reproducible and quantitative recovery of added phosphatase. In the AOAC method, macerating 0.5 g cheese with 1 mL borate buffer before adding milk phosphatase improved recovery among cheeses. Addition of magnesium ion increased phosphatase activity in some cheeses. Phosphatases in blue mold-ripened and Swiss cheeses were inactivated by heat faster than was milk phosphatase, yet milk phosphatase added to various soft cheeses was completely inactivated at 60 degrees C for 10 min. The lability of phosphatase was due to the heat-denaturing effect of NaCl present in finished cheeses. Some Mexican style soft cheeses contained both heat-labile and heat-stable phosphatases. These data suggest that the phosphatase test to differentiate milk and microbial phosphatases on the basis of repasteurization and analysis of cheese is no longer valid.

  3. Rhizobiales-like Phosphatase 2 from Arabidopsis thaliana Is a Novel Phospho-tyrosine-specific Phospho-protein Phosphatase (PPP) Family Protein Phosphatase*

    PubMed Central

    Uhrig, R. Glen; Labandera, Anne-Marie; Muhammad, Jamshed; Samuel, Marcus; Moorhead, Greg B.

    2016-01-01

    Cellular signaling through protein tyrosine phosphorylation is well established in mammalian cells. Although lacking the classic tyrosine kinases present in humans, plants have a tyrosine phospho-proteome that rivals human cells. Here we report a novel plant tyrosine phosphatase from Arabidopsis thaliana (AtRLPH2) that, surprisingly, has the sequence hallmarks of a phospho-serine/threonine phosphatase belonging to the PPP family. Rhizobiales/Rhodobacterales/Rhodospirillaceae-like phosphatases (RLPHs) are conserved in plants and several other eukaryotes, but not in animals. We demonstrate that AtRLPH2 is localized to the plant cell cytosol, is resistant to the classic serine/threonine phosphatase inhibitors okadaic acid and microcystin, but is inhibited by the tyrosine phosphatase inhibitor orthovanadate and is particularly sensitive to inhibition by the adenylates, ATP and ADP. AtRLPH2 displays remarkable selectivity toward tyrosine-phosphorylated peptides versus serine/threonine phospho-peptides and readily dephosphorylates a classic tyrosine phosphatase protein substrate, suggesting that in vivo it is a tyrosine phosphatase. To date, only one other tyrosine phosphatase is known in plants; thus AtRLPH2 represents one of the missing pieces in the plant tyrosine phosphatase repertoire and supports the concept of protein tyrosine phosphorylation as a key regulatory event in plants. PMID:26742850

  4. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  5. Role of Protein Tyrosine Phosphatases in Plants

    PubMed Central

    Shankar, Alka; Agrawal, Nisha; Sharma, Manisha; Pandey, Amita; Pandey, Girdhar K.

    2015-01-01

    Reversible protein phosphorylation is a crucial regulatory mechanism that controls many biological processes in eukaryotes. In plants, phosphorylation events primarily occur on serine (Ser) and threonine (Thr) residues, while in certain cases, it was also discovered on tyrosine (Tyr) residues. In contrary to plants, extensive reports on Tyr phosphorylation regulating a large numbers of biological processes exist in animals. Despite of such prodigious function in animals, Tyr phosphorylation is a least studied mechanism of protein regulation in plants. Recently, various chemical analytical procedures have strengthened the view that Tyr phosphorylation is equally prevalent in plants as in animals. However, regardless of Tyr phosphorylation events occuring in plants, no evidence could be found for the existence of gene encoding for Tyr phosphorylation i.e. the typical Tyr kinases. Various methodologies have suggested that plant responses to stress signals and developmental processes involved modifications in protein Tyr phosphorylation. Correspondingly, various reports have established the role of PTPs (Protein Tyrosine Phosphatases) in the dephosphorylation and inactivation of mitogen activated protein kinases (MAPKs) hence, in the regulation of MAPK signaling cascade. Besides this, many dual specificity protein phosphatases (DSPs) are also known to bind starch and regulate starch metabolism through reversible phosphorylation. Here, we are emphasizing the significant progress on protein Tyr phosphatases to understand the role of these enzymes in the regulation of post-translational modification in plant physiology and development. PMID:26962298

  6. Two potential fish glycerol-3-phosphate phosphatases.

    PubMed

    Raymond, James A

    2015-06-01

    Winter-acclimated rainbow smelt (Osmerus mordax Mitchill) produce high levels of glycerol as an antifreeze. A common pathway to glycerol involves the enzyme glycerol-3-phosphate phosphatase (GPP), but no GPP has yet been identified in fish or any other animal. Here, two phosphatases assembled from existing EST libraries (from winter-acclimated smelt and cold-acclimated smelt hepatocytes) were found to resemble a glycerol-associated phosphatase from a glycerol-producing alga, Dunaliella salina, and a recently discovered GPP from a bacterium, Mycobacterium tuberculosis. Recombinant proteins were generated and were found to have GPP activity on the order of a few μMol Pi/mg enzyme/min. The two enzymes have acidic pH optima (~5.5) similar to that previously determined for GPP activity in liver tissue, with about 1/3 of their peak activities at neutral pH. The two enzymes appear to account for the GPP activity of smelt liver, but due to their reduced activities at neutral pH, their contributions to glycerol production in vivo remain unclear. Similar enzymes may be active in a glycerol-producing insect, Dendroctonus ponderosae.

  7. Diabetes reversal by inhibition of the low-molecular-weight tyrosine phosphatase.

    PubMed

    Stanford, Stephanie M; Aleshin, Alexander E; Zhang, Vida; Ardecky, Robert J; Hedrick, Michael P; Zou, Jiwen; Ganji, Santhi R; Bliss, Matthew R; Yamamoto, Fusayo; Bobkov, Andrey A; Kiselar, Janna; Liu, Yingge; Cadwell, Gregory W; Khare, Shilpi; Yu, Jinghua; Barquilla, Antonio; Chung, Thomas D Y; Mustelin, Tomas; Schenk, Simon; Bankston, Laurie A; Liddington, Robert C; Pinkerton, Anthony B; Bottini, Nunzio

    2017-06-01

    Obesity-associated insulin resistance plays a central role in type 2 diabetes. As such, tyrosine phosphatases that dephosphorylate the insulin receptor (IR) are potential therapeutic targets. The low-molecular-weight protein tyrosine phosphatase (LMPTP) is a proposed IR phosphatase, yet its role in insulin signaling in vivo has not been defined. Here we show that global and liver-specific LMPTP deletion protects mice from high-fat diet-induced diabetes without affecting body weight. To examine the role of the catalytic activity of LMPTP, we developed a small-molecule inhibitor with a novel uncompetitive mechanism, a unique binding site at the opening of the catalytic pocket, and an exquisite selectivity over other phosphatases. This inhibitor is orally bioavailable, and it increases liver IR phosphorylation in vivo and reverses high-fat diet-induced diabetes. Our findings suggest that LMPTP is a key promoter of insulin resistance and that LMPTP inhibitors would be beneficial for treating type 2 diabetes.

  8. Primary structure of rat secretory acid phosphatase and comparison to other acid phosphatases.

    PubMed

    Roiko, K; Jänne, O A; Vihko, P

    1990-05-14

    Overlapping cDNA clones encoding rat prostatic acid phosphatase (rPAP) were isolated by using two human prostatic acid phosphatase (hPAP)-encoding cDNAs to screen rat prostatic cDNA libraries. The isolated cDNAs encompassed a total of 1626 nucleotides (nt), of which 1143 nt corresponded to the protein coding sequence encoding a mature polypeptide of 350 amino acids (aa) and a 31-aa long signal peptide-like sequence. The deduced Mr of the mature rPAP was 40,599. RNA blot analysis indicated the presence of three mRNA species (4.9, 2.3 and 1.5 kb in size) in the rat prostate. The deduced aa sequences of rPAP and hPAP show 75% identity, whereas the similarity between rPAP and human lysosomal acid phosphatase (hLAP) is only 45%. Furthermore, the sequence similarity between rPAP and rat lysosomal acid phosphatase (rLAP) is 46% at the aa level. Similar to hPAP, but unlike hLAP and rLAP, the rPAP sequence lacks a membrane-anchoring domain indicating the secretory character of this phosphatase. All six cysteines present in the overlapping areas of the mature rPAP, hPAP, rLAP and hLAP proteins are positionally conserved, suggesting that these residues are important for the tertiary structure of acid phosphatases (APs). The previously reported active site residues, two arginines and one histidine, are also conserved in these APs.

  9. Phosphoinositide phosphatases: just as important as the kinases.

    PubMed

    Dyson, Jennifer M; Fedele, Clare G; Davies, Elizabeth M; Becanovic, Jelena; Mitchell, Christina A

    2012-01-01

    Phosphoinositide phosphatases comprise several large enzyme families with over 35 mammalian enzymes identified to date that degrade many phosphoinositide signals. Growth factor or insulin stimulation activates the phosphoinositide 3-kinase that phosphorylates phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P(2)] to form phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P(3)], which is rapidly dephosphorylated either by PTEN (phosphatase and tensin homologue deleted on chromosome 10) to PtdIns(4,5)P(2), or by the 5-phosphatases (inositol polyphosphate 5-phosphatases), generating PtdIns(3,4)P(2). 5-phosphatases also hydrolyze PtdIns(4,5)P(2) forming PtdIns(4)P. Ten mammalian 5-phosphatases have been identified, which regulate hematopoietic cell proliferation, synaptic vesicle recycling, insulin signaling, and embryonic development. Two 5-phosphatase genes, OCRL and INPP5E are mutated in Lowe and Joubert syndrome respectively. SHIP [SH2 (Src homology 2)-domain inositol phosphatase] 2, and SKIP (skeletal muscle- and kidney-enriched inositol phosphatase) negatively regulate insulin signaling and glucose homeostasis. SHIP2 polymorphisms are associated with a predisposition to insulin resistance. SHIP1 controls hematopoietic cell proliferation and is mutated in some leukemias. The inositol polyphosphate 4-phosphatases, INPP4A and INPP4B degrade PtdIns(3,4)P(2) to PtdIns(3)P and regulate neuroexcitatory cell death, or act as a tumor suppressor in breast cancer respectively. The Sac phosphatases degrade multiple phosphoinositides, such as PtdIns(3)P, PtdIns(4)P, PtdIns(5)P and PtdIns(3,5)P(2) to form PtdIns. Mutation in the Sac phosphatase gene, FIG4, leads to a degenerative neuropathy. Therefore the phosphatases, like the lipid kinases, play major roles in regulating cellular functions and their mutation or altered expression leads to many human diseases.

  10. Defining needs, defining systems: a critical analysis.

    PubMed

    Dill, A

    1993-08-01

    This article examines the model of need assessment commonly used in social service programs for older adults. Whereas this model defines need as an individual attribute, remediable through programmatic intervention, an alternative formulation suggests that organizational imperatives shape the definition of client need while obscuring their own role in the production of this information. A case study and historical analysis assess the roots of this process and its consequences for clients, staff, and aging programs.

  11. Protein-tyrosine Phosphatase and Kinase Specificity in Regulation of SRC and Breast Tumor Kinase* ♦

    PubMed Central

    Fan, Gaofeng; Aleem, Saadat; Yang, Ming; Miller, W. Todd; Tonks, Nicholas K.

    2015-01-01

    Despite significant evidence to the contrary, the view that phosphatases are “nonspecific” still pervades the field. Systems biology approaches to defining how signal transduction pathways are integrated at the level of whole organisms also often downplay the contribution of phosphatases, defining them as “erasers” that serve merely to restore the system to its basal state. Here, we present a study that counteracts the idea of “nonspecific phosphatases.” We have characterized two structurally similar and functionally related kinases, BRK and SRC, which are regulated by combinations of activating autophosphorylation and inhibitory C-terminal sites of tyrosine phosphorylation. We demonstrated specificity at the level of the kinases in that SRMS phosphorylated the C terminus of BRK, but not SRC; in contrast, CSK is the kinase responsible for C-terminal phosphorylation of SRC, but not BRK. For the phosphatases, we observed that RNAi-mediated suppression of PTP1B resulted in opposing effects on the activity of BRK and SRC and have defined the mechanisms underlying this specificity. PTP1B inhibited BRK by directly dephosphorylating the Tyr-342 autophosphorylation site. In contrast, PTP1B potentiated SRC activity, but not by dephosphorylating SRC itself directly; instead, PTP1B regulated the interaction between CBP/PAG and CSK. SRC associated with, and phosphorylated, the transmembrane protein CBP/PAG at Tyr-317, resulting in CSK recruitment. We identified PAG as a substrate of PTP1B, and dephosphorylation abolished recruitment of the inhibitory kinase CSK. Overall, these findings illustrate how the combinatorial effects of PTKs and PTPs may be integrated to regulate signaling, with both classes of enzymes displaying exquisite specificity. PMID:25897081

  12. Protein-tyrosine Phosphatase and Kinase Specificity in Regulation of SRC and Breast Tumor Kinase.

    PubMed

    Fan, Gaofeng; Aleem, Saadat; Yang, Ming; Miller, W Todd; Tonks, Nicholas K

    2015-06-26

    Despite significant evidence to the contrary, the view that phosphatases are "nonspecific" still pervades the field. Systems biology approaches to defining how signal transduction pathways are integrated at the level of whole organisms also often downplay the contribution of phosphatases, defining them as "erasers" that serve merely to restore the system to its basal state. Here, we present a study that counteracts the idea of "nonspecific phosphatases." We have characterized two structurally similar and functionally related kinases, BRK and SRC, which are regulated by combinations of activating autophosphorylation and inhibitory C-terminal sites of tyrosine phosphorylation. We demonstrated specificity at the level of the kinases in that SRMS phosphorylated the C terminus of BRK, but not SRC; in contrast, CSK is the kinase responsible for C-terminal phosphorylation of SRC, but not BRK. For the phosphatases, we observed that RNAi-mediated suppression of PTP1B resulted in opposing effects on the activity of BRK and SRC and have defined the mechanisms underlying this specificity. PTP1B inhibited BRK by directly dephosphorylating the Tyr-342 autophosphorylation site. In contrast, PTP1B potentiated SRC activity, but not by dephosphorylating SRC itself directly; instead, PTP1B regulated the interaction between CBP/PAG and CSK. SRC associated with, and phosphorylated, the transmembrane protein CBP/PAG at Tyr-317, resulting in CSK recruitment. We identified PAG as a substrate of PTP1B, and dephosphorylation abolished recruitment of the inhibitory kinase CSK. Overall, these findings illustrate how the combinatorial effects of PTKs and PTPs may be integrated to regulate signaling, with both classes of enzymes displaying exquisite specificity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Carboxyarabinitol-1-P phosphatase of Phaseolus vulgaris

    SciTech Connect

    Kobza, J.; Moore, B.d.; Seemann, J.R. )

    1990-05-01

    The activity of carboxyarabinitol-1-P (CA1P) phosphatase was detected in clarified stromal extracts by the generation of {sup 14}C-carboxyarabinitol from {sup 14}C-CA1P. Carboxyribitol-1-P dependent activity was 3% of the CA1P dependent activity, indicating the enzyme was specific for CA1P. Inclusion of DTT in the assay was required for maximum velocity, but it appears that the enzyme is not regulated by thioredoxin in vivo. Activity o f the CA1P phosphatase was stimulated by RuBP, NADPH and FBP, though the latter two metabolites were required at nonphysiological concentrations in order to achieve significant stimulation. Contrary to a previous report on purified tobacco enzyme, ATP stimulated the CA1P phosphatase activity. In the presence of 1 mM RuBP or ATP, rates of 2 or 3 {mu}mol mg{sup {minus}1} Chl h{sup {minus}1}, respectively, were observed at 1 mM CA1P. These rates were 3-4 fold higher than the rate observed in the absence of effectors and are 2-4 times the in vivo rate of degradation of CA1P during dark/light transitions. The rates from bean were about 7 fold higher than rates reported for the enzyme from tobacco. Changes in the levels of ATP and RuBP associated with dark/light transitions could modulate the enzyme activity in vivo, but it remains to be established if this is the only mechanism for the required regulation of the enzyme.

  14. Auxiliary phosphatases in two-component signal transduction.

    PubMed

    Silversmith, Ruth E

    2010-04-01

    Signal termination in two-component systems occurs by loss of the phosphoryl group from the response regulator protein. This review explores our current understanding of the structures, catalytic mechanisms and means of regulation of the known families of phosphatases that catalyze response regulator dephosphorylation. The CheZ and CheC/CheX/FliY families, despite different overall structures, employ identical catalytic strategies using an amide side chain to orient a water molecule for in-line attack of the aspartyl phosphate. Spo0E phosphatases contain sequence and structural features that suggest a strategy similar to the chemotaxis phosphatases but the mechanism used by the Rap phosphatases is not yet elucidated. Identification of features shared by phosphatase families may aid in the identification of currently unrecognized classes of response regulator phosphatases. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Effect of Bacteria and Amoebae on Rhizosphere Phosphatase Activity

    PubMed Central

    Gould, W. Douglas; Coleman, David C.; Rubink, Amy J.

    1979-01-01

    The contributions of various components of soil microflora and microfauna to rhizosphere phosphatase activity were determined with hydroponic cultures. Three treatments were employed: (i) plants alone (Bouteloua gracilis (H.B.K.) Lag. ex Steud.) (ii) plants plus bacteria (Pseudomonas sp.), and (iii) plants plus bacteria plus amoebae (Acanthamoeba sp.). No alkaline phosphatase was detected, but an appreciable amount of acid phosphatase activity (120 to 500 nmol of p-nitrophenylphosphate hydrolyzed per h per plant) was found in the root culture solutions. The presence of bacteria or bacteria and amoebae increased the amount of acid phosphatase in solution, and properties of additional activity were identical to properties of plant acid phosphatase. The presence of bacteria or bacteria and amoebae increased both solution and root phosphatase activities at most initial phosphate concentrations. PMID:16345390

  16. Desialylated alkaline phosphatase: activation by 4-nitrophenol.

    PubMed

    Nayudu, P R

    1984-01-01

    Mouse ileal alkaline phosphatase is a sialyl enzyme (12-14 moles per mole of enzyme). When partially desialylated by treatment with neuraminidase, the enzyme loses most of its activity, associated with reduced apparent Vmax and Km. Part of that loss, however, is recovered as the product 4-nitrophenol's concentration builds up in the cuvette. Experimental results are presented to demonstrate that the activation is due to the binding of 4-nitrophenol as a ligand by the partially desialylated enzyme and that both the loss of activity by sialic acid removal and activation by ligand-binding are correlated with changes in protein conformation.

  17. Phosphatase specificity and pathway insulation in signaling networks.

    PubMed

    Rowland, Michael A; Harrison, Brian; Deeds, Eric J

    2015-02-17

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase's substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A's adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  18. Inorganic Phosphate as an Important Regulator of Phosphatases

    PubMed Central

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Meyer-Fernandes, José Roberto

    2011-01-01

    Cellular metabolism depends on the appropriate concentration of intracellular inorganic phosphate (Pi). Pi starvation-responsive genes appear to be involved in multiple metabolic pathways, implying a complex Pi regulation system in microorganisms and plants. A group of enzymes is required for absorption and maintenance of adequate phosphate levels, which is released from phosphate esters and anhydrides. The phosphatase system is particularly suited for the study of regulatory mechanisms because phosphatase activity is easily measured using specific methods and the difference between the repressed and derepressed levels of phosphatase activity is easily detected. This paper analyzes the protein phosphatase system induced during phosphate starvation in different organisms. PMID:21755037

  19. Regulated protein kinases and phosphatases in cell cycle decisions.

    PubMed

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2010-12-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle.

  20. Functional size of the thylakoid phosphatases determined by radiation inactivation.

    PubMed

    Hsu, L H; Tzeng, C M; Pan, R L

    1993-02-22

    Radiation inactivation technique was employed to determine the functional size of phosphatases from thylakoid membrane. The enzymatic activities of phosphatases decayed in a simple function with the increase of radiation dosage. D37 values of 18.8 +/- 2.4-14.1 +/- 1.5 Mrad were obtained, using phosphoserine, phosphothreonine, p-nitrophenol phosphate, and phospho-histone V-S, respectively, as substrates. The molecular masses of 48.2 +/- 6.3-61 +/- 5.7 kDa were yielded by target theory analysis. We thus speculate that the thylakoid alkaline phosphatase is probably a monomer while acid phosphatase is functionally a dimer in situ.

  1. Regulated protein kinases and phosphatases in cell cycle decisions

    PubMed Central

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2013-01-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle. PMID:20678910

  2. Parametrically defined differential equations

    NASA Astrophysics Data System (ADS)

    Polyanin, A. D.; Zhurov, A. I.

    2017-01-01

    The paper deals with nonlinear ordinary differential equations defined parametrically by two relations. It proposes techniques to reduce such equations, of the first or second order, to standard systems of ordinary differential equations. It obtains the general solution to some classes of nonlinear parametrically defined ODEs dependent on arbitrary functions. It outlines procedures for the numerical solution of the Cauchy problem for parametrically defined differential equations.

  3. Biology of tartrate-resistant acid phosphatase.

    PubMed

    Lamp, E C; Drexler, H G

    2000-11-01

    Tartrate-resistant acid phosphatase (TRAP) is a member of the ubiquitously expressed enzyme family of the acid phosphatases. Nearly 30 years ago, TRAP became known to hematologists as cytochemical marker enzyme of hairy cell leukemia. Physiologically, TRAP is primarily a cytochemical marker of macrophages, osteoclasts and dendritic cells. TRAP is localized intracellularly in the lysosomal compartment. Recent data suggest also secretion of TRAP by some cell types, in particular by osteoclasts. Human, mouse and rat TRAP are biochemically well characterized. While the complete genomic sequence of TRAP has been elucidated, only limited information on the genetic details of the gene and its regulation is available. It appears that the intracellular iron content is involved in the regulation of the enzyme. The physiological substrates for this enzyme have not been identified yet and consequently the functional role of TRAP remains completely unknown, though some hypotheses have been forwarded, e.g. involvement in bone resorption and iron homeostasis (transport, metabolism). Taken together, research on the biology of TRAP has been intensive and has led to considerable progress on a number of fronts, including the cloning of the gene. Further studies are, however, still required to determine the role of TRAP in vivo.

  4. Protein Phosphatases and Alzheimer’s Disease

    PubMed Central

    Braithwaite, Steven P.; Stock, Jeffry B.; Lombroso, Paul J.; Nairn, Angus C.

    2013-01-01

    Alzheimer’s Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. PMID:22340724

  5. The protein phosphatase 2A functions in the spindle position checkpoint by regulating the checkpoint kinase Kin4.

    PubMed

    Chan, Leon Y; Amon, Angelika

    2009-07-15

    In budding yeast, a surveillance mechanism known as the spindle position checkpoint (SPOC) ensures accurate genome partitioning. In the event of spindle misposition, the checkpoint delays exit from mitosis by restraining the activity of the mitotic exit network (MEN). To date, the only component of the checkpoint to be identified is the protein kinase Kin4. Furthermore, how the kinase is regulated by spindle position is not known. Here, we identify the protein phosphatase 2A (PP2A) in complex with the regulatory subunit Rts1 as a component of the SPOC. Loss of PP2A-Rts1 function abrogates the SPOC but not other mitotic checkpoints. We further show that the protein phosphatase functions upstream of Kin4, regulating the kinase's phosphorylation and localization during an unperturbed cell cycle and during SPOC activation, thus defining the phosphatase as a key regulator of SPOC function.

  6. The protein phosphatase 2A functions in the spindle position checkpoint by regulating the checkpoint kinase Kin4

    PubMed Central

    Chan, Leon Y.; Amon, Angelika

    2009-01-01

    In budding yeast, a surveillance mechanism known as the spindle position checkpoint (SPOC) ensures accurate genome partitioning. In the event of spindle misposition, the checkpoint delays exit from mitosis by restraining the activity of the mitotic exit network (MEN). To date, the only component of the checkpoint to be identified is the protein kinase Kin4. Furthermore, how the kinase is regulated by spindle position is not known. Here, we identify the protein phosphatase 2A (PP2A) in complex with the regulatory subunit Rts1 as a component of the SPOC. Loss of PP2A-Rts1 function abrogates the SPOC but not other mitotic checkpoints. We further show that the protein phosphatase functions upstream of Kin4, regulating the kinase's phosphorylation and localization during an unperturbed cell cycle and during SPOC activation, thus defining the phosphatase as a key regulator of SPOC function. PMID:19605686

  7. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue nonbinding phosphatase activities.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2001-04-01

    Phosphatases extracted from a human brain were resolved into two main groups, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue binding phosphatases were further separated into four different phosphatase activities, designated P1-P4, and described previously. In the present study we describe the affi-gel blue-nonbinding phosphatases which were separated into seven different phosphatase activities, designated P5-P11 by poly-(L-lysine)-agarose and aminohexyl Sepharose 4B chromatographies. These seven phosphatase activities were active toward nonprotein phosphoester. P7-P11 and to some extent P5 could also dephosphorylate a phosphoprotein. They displayed different enzyme kinetics. On the basis of activity peak, the apparent molecular mass as estimated by Sephadex G-200 column chromatography for P5 was 49 kDa; P6, 32 kDa; P7, 150 kDa; P8, 250 kDa; P9, 165 kDa; P10, 90 kDa and P11, 165 kDa. Immunoblot analysis indicated that P8-P11 may belong to PP2B family, whereas P7 may associate with PP2A. The phosphatases P7-P11 were found to be effective in the dephosphorylation of Alzheimer's disease abnormally hyperphosphorylated tau. The resulting dephosphorylated tau regained its activity in promoting the microtubule assembly, suggesting that P7-P11 might regulate the phosphorylation of tau protein in the brain.

  8. Phosphatase Specificity and Pathway Insulation in Signaling Networks

    PubMed Central

    Rowland, Michael A.; Harrison, Brian; Deeds, Eric J.

    2015-01-01

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase’s substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A’s adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  9. Violacein cytotoxicity on human blood lymphocytes and effect on phosphatases.

    PubMed

    Bromberg, N; Justo, G Z; Haun, M; Durán, N; Ferreira, C V

    2005-10-01

    Given the importance of protein phosphorylation in the context of cellular functions, abnormal protein phosphatase activity has been implicated in several diseases, including cancer. These critical roles of protein phosphatases qualify them as potential targets for the development of medicinal compounds that possess distinct modes of action such as violacein. In this work, studies with this natural indolic pigment at a concentration of 10.0 micromol L(-1) demonstrated a 20% activation of total protein phosphatase extracted from human lymphocytes. Although no alteration was observed on protein tyrosine phosphatase (CD45), 30% of inhibition was achieved in cytoplasmatic protein phosphatase activity after incubation with 10.0 micromol L(-1) violacein. Additionally, 5.0 micromol L(-1) of violacein inhibited by 50% the serum tartrate-resistant acid phosphatase activity. Violacein presented toxic effect on lymphocytes with IC50 values of 3 and 10 micromol L(-1) for protein content and protein phosphatase activity, respectively. These findings suggest an important role for protein phosphatases in the mechanisms controlling proliferation and cell death.

  10. Distinct phosphatase activity profiles in two strains of Trypanosoma cruzi.

    PubMed

    Morales-Neto, R; Hulshof, L; Ferreira, C V; Gadelha, F R

    2009-12-01

    Phosphorylation of parasite proteins plays a key role in the process of cell invasion by Trypanosoma cruzi, the etiologic agent of Chagas' disease. In this sense, characterization of parasite kinases and phosphatases could open new possibilities for the rational design of chemotherapeutic agents for the treatment of Chagas' disease. In this work, we analyzed phosphatase activities in T. cruzi homogenates from 2 strains belonging to different lineages and with different resistance to oxidative stress. Tulahuen 2 cells (Lineage I) showed higher phosphatase activities and specificity constants when compared to the Y strain (Lineage II). Tulahuen 2 had an optimum phosphatase activity at pH 4.0 and the Y strain at pH 7.0. In both cases, neutral–basic, but not acid, phosphatase activities were increased in the presence of Mg2+. Although calcium had an inhibitory effect at a pH of 7.0 and 8.0 in the Y strain, this inhibition was restricted to pH 8.0 in the other strain. Different substrates and acid phosphotyrosine and alkaline phosphatase inhibitors exhibited distinct effects on the phosphatase activity of both strains. Our results provide a better understanding of T. cruzi phosphatases and reinforce the notion of heterogeneity among T. cruzi populations.

  11. A remote CheZ orthologue retains phosphatase function.

    PubMed

    Lertsethtakarn, Paphavee; Ottemann, Karen M

    2010-07-01

    Aspartyl-phosphate phosphatases underlie the rapid responses of bacterial chemotaxis. One such phosphatase, CheZ, was originally proposed to be restricted to beta and gamma proteobacter, suggesting only a small subset of microbes relied on this protein. A putative CheZ phosphatase was identified genetically in the epsilon proteobacter Helicobacter pylori (Mol Micro 61:187). H. pylori utilizes a chemotaxis system consisting of CheAY, three CheVs, CheW, CheY(HP) and the putative CheZ to colonize the host stomach. Here we investigate whether this CheZ has phosphatase activity. We phosphorylated potential targets in vitro using either a phosphodonor or the CheAY kinase and [gamma-(32)P]-ATP, and found that H. pylori CheZ (CheZ(HP)) efficiently dephosphorylates CheY(HP) and CheAY and has additional weak activity on CheV2. We detected no phosphatase activity towards CheV1 or CheV3. Mutations corresponding to Escherichia coli CheZ active site residues or deletion of the C-terminal region inactivate CheZ(HP) phosphatase activity, suggesting the two CheZs function similarly. Bioinformatics analysis suggests that CheZ phosphatases are found in all proteobacteria classes, as well as classes Aquificae, Deferribacteres, Nitrospira and Sphingobacteria, demonstrating that CheZ phosphatases are broadly distributed within Gram-negative bacteria.

  12. Biogeochemical drivers of phosphatase activity in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Freitas, Joana; Duarte, Bernardo; Caçador, Isabel

    2014-10-01

    Although nitrogen has become a major concern for wetlands scientists dealing with eutrophication problems, phosphorous represents another key element, and consequently its biogeochemical cycling has a crucial role in eutrophication processes. Microbial communities are a central component in trophic dynamics and biogeochemical processes on coastal systems, since most of the processes in sediments are microbial-mediated due to enzymatic action, including the mineralization of organic phosphorus carried out by acid phosphatase activity. In the present work, the authors investigate the biogeochemical sediment drivers that control phosphatase activities. Authors also aim to assess biogeochemical factors' influence on the enzyme-mediated phosphorous cycling processes in salt marshes. Plant rhizosediments and bare sediments were collected and biogeochemical features, including phosphatase activities, inorganic and organic phosphorus contents, humic acids content and pH, were assessed. Acid phosphatase was found to give the highest contribution for total phosphatase activity among the three pH-isoforms present in salt marsh sediments, favored by acid pH in colonized sediments. Humic acids also appear to have an important role inhibiting phosphatase activity. A clear relation of phosphatase activity and inorganic phosphorous was also found. The data presented reinforces the role of phosphatase in phosphorous cycling.

  13. Characterization of DNA Substrate Binding to the Phosphatase Domain of the DNA Repair Enzyme Polynucleotide Kinase/Phosphatase.

    PubMed

    Havali-Shahriari, Zahra; Weinfeld, Michael; Glover, J N Mark

    2017-03-28

    Polynucleotide kinase/phosphatase (PNKP) is a DNA strand break repair enzyme that uses separate 5' kinase and 3' phosphatase active sites to convert damaged 5'-hydroxyl/3'-phosphate strand termini to ligatable 5'-phosphate/3'-hydroxyl ends. The phosphatase active site has received particular attention as a target of inhibition in cancer therapy development. The phosphatase domain dephosphorylates a range of single- and double-stranded substrates; however, structural studies have shown that the phosphatase catalytic cleft can bind only single-stranded substrates. Here we use a catalytically inactive but structurally intact phosphatase mutant to probe interactions between PNKP and a variety of single- and double-stranded DNA substrates using an electrophoretic mobility shift assay. This work indicates that the phosphatase domain binds 3'-phosphorylated single-stranded DNAs in a manner that is highly dependent on the presence of the 3'-phosphate. Double-stranded substrate binding, in contrast, is not as dependent on the 3'-phosphate. Experiments comparing blunt-end, 3'-overhanging, and frayed-end substrates indicate that the predicted loss of energy due to base pair disruption upon binding of the phosphatase active site is likely balanced by favorable interactions between the liberated complementary strand and PNKP. Comparison of the effects on substrate binding of mutations within the phosphatase active site cleft with mutations in surrounding positively charged surfaces suggests that the surrounding surfaces are important for binding to double-stranded substrates. We further show that while fluorescence polarization methods can detect specific binding of single-stranded DNAs with the phosphatase domain, this method does not detect specific interactions between the PNKP phosphatase and double-stranded substrates.

  14. Mutations responsible for 3-phosphoserine phosphatase deficiency.

    PubMed

    Veiga-da-Cunha, Maria; Collet, Jean-François; Prieur, Benoît; Jaeken, Jaak; Peeraer, Yves; Rabbijns, Anja; Van Schaftingen, Emile

    2004-02-01

    We report the identification of the mutations in the only known case of L-3-phosphoserine phosphatase deficiency, a recessively inherited condition. The two mutations correspond to the replacement of the semiconserved Asp32 residue by an asparagine and of the extremely conserved Met52 by a threonine. The effects of both mutations were studied on the human recombinant enzyme, expressed in Escherichia coli. Met52Thr almost abolished the enzymatic activity, whereas the Asp32Asn mutation caused a 50% decrease in Vmax. In addition, L-serine, which inhibits the conversion of [(14)C] phosphoserine to serine when catalysed by the wild-type enzyme, had a lesser inhibitory effect on the Asp32Asn mutant, indicating a reduction in the rate of phosphoenzyme hydrolysis. These modifications in the properties of the enzyme are consistent with the modification in the kinetic properties observed in fibroblasts from the patient.

  15. Inhibition of renal alkaline phosphatase by cimetidine.

    PubMed

    Minai-Tehrani, Dariush; Khodai, Somayeh; Aminnaseri, Somayeh; Minoui, Saeed; Sobhani-Damavadifar, Zahra; Alavi, Sana; Osmani, Raheleh; Ahmadi, Shiva

    2011-08-01

    Alkaline phosphatase (ALP) belongs to hydrolase group of enzymes. It is responsible for removing phosphate groups from many types of molecules, including nucleotides and proteins. Cimetidine (trade name Tagamet) is an antagonist of histamine H2-receptor that inhibits the production of gastric acid. Cimetidine is used for the treatment of gastrointestinal diseases. In this study the inhibitory effect of cimetidine on mouse renal ALP activity was investigated. Our results showed that cimetidine can inhibit ALP by uncompetitive inhibition. In the absence of inhibitor the V(max) and K(m) of the enzyme were found to be 13.7 mmol/mg prot.min and 0.25 mM, respectively. Both the Vmax and Km of the enzyme decreased with increasing cimetidine concentrations (0- 1.2 mM). The Ki and IC(50) of cimetidine were determined to be about 0.5 mM and 0.52 mM, respectively.

  16. Defining Overweight and Obesity

    MedlinePlus

    ... this? Submit Button Our Division About Us Nutrition Physical Activity Overweight & Obesity Healthy Weight Breastfeeding Micronutrient Malnutrition State and Local Programs Defining Adult Overweight and Obesity Recommend on Facebook ...

  17. Functional characterization of lysophosphatidic acid phosphatase from Arabidopsis thaliana.

    PubMed

    Reddy, Venky Sreedhar; Rao, D K Venkata; Rajasekharan, Ram

    2010-04-01

    Lysophosphatidic acid (LPA) acts as a signaling molecule that regulates diverse cellular processes and it can rapidly be metabolized by phosphatase and acyltransferase. LPA phosphatase gene has not been identified and characterized in plants so far. The BLAST search revealed that the At3g03520 is similar to phospholipase family, and distantly related to bacterial phosphatases. The conserved motif, (J)4XXXNXSFD, was identified in both At3g03520 like phospholipases and acid phosphatases. In silico expression analysis of At3g03520 revealed a high expression during phosphate starvation and abiotic stresses. This gene was overexpressed in Escherichia coli and shown to posses LPA specific phosphatase activity. These results suggest that this gene possibly plays a role in signal transduction and storage lipid synthesis.

  18. Phosphoglucan phosphatase function sheds light on starch degradation.

    PubMed

    Silver, Dylan M; Kötting, Oliver; Moorhead, Greg B G

    2014-07-01

    Phosphoglucan phosphatases are novel enzymes that remove phosphates from complex carbohydrates. In plants, these proteins are vital components in the remobilization of leaf starch at night. Breakdown of starch is initiated through reversible glucan phosphorylation to disrupt the semi-crystalline starch structure at the granule surface. The phosphoglucan phosphatases starch excess 4 (SEX4) and like-SEX4 2 (LSF2) dephosphorylate glucans to provide access for amylases that release maltose and glucose from starch. Another phosphatase, LSF1, is a putative inactive scaffold protein that may act as regulator of starch degradative enzymes at the granule surface. Absence of these phosphatases disrupts starch breakdown, resulting in plants accumulating excess starch. Here, we describe recent advances in understanding the biochemical and structural properties of each of these starch phosphatases.

  19. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  20. Intestinal alkaline phosphatase to treat necrotizing enterocolitis.

    PubMed

    Biesterveld, Ben E; Koehler, Shannon M; Heinzerling, Nathan P; Rentea, Rebecca M; Fredrich, Katherine; Welak, Scott R; Gourlay, David M

    2015-06-15

    Intestinal alkaline phosphatase (IAP) activity is decreased in necrotizing enterocolitis (NEC), and IAP supplementation prevents NEC development. It is not known if IAP given after NEC onset can reverse the course of the disease. We hypothesized that enteral IAP given after NEC induction would not reverse intestinal injury. NEC was induced in Sprague-Dawley pups by delivery preterm followed by formula feedings with lipopolysaccharide (LPS) and hypoxia exposure and continued up to 4 d. IAP was added to feeds on day 2 until being sacrificed on day 4. NEC severity was scored based on hematoxylin and eosin-stained terminal ileum sections, and AP activity was measured using a colorimetric assay. IAP and interleukin-6 expression were measured using real time polymerase chain reaction. NEC pups' alkaline phosphatase (AP) activity was decreased to 0.18 U/mg compared with controls of 0.57 U/mg (P < 0.01). Discontinuation of LPS and hypoxia after 2 d increased AP activity to 0.36 U/mg (P < 0.01). IAP supplementation in matched groups did not impact total AP activity or expression. Discontinuing LPS and hypoxia after NEC onset improved intestinal injury scores to 1.14 compared with continued stressors, score 2.25 (P < 0.01). IAP supplementation decreased interleukin-6 expression two-fold (P < 0.05), though did not reverse NEC intestinal damage (P = 0.5). This is the first work to demonstrate that removing the source of NEC improves intestinal damage and increases AP activity. When used as a rescue treatment, IAP decreased intestinal inflammation though did not impact injury making it likely that IAP is best used preventatively to those neonates at risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Functional interrelationships in the alkaline phosphatase superfamily: phosphodiesterase activity of Escherichia coli alkaline phosphatase.

    PubMed

    O'Brien, P J; Herschlag, D

    2001-05-15

    Escherichia coli alkaline phosphatase (AP) is a proficient phosphomonoesterase with two Zn(2+) ions in its active site. Sequence homology suggests a distant evolutionary relationship between AP and alkaline phosphodiesterase/nucleotide pyrophosphatase, with conservation of the catalytic metal ions. Furthermore, many other phosphodiesterases, although not evolutionarily related, have a similar active site configuration of divalent metal ions in their active sites. These observations led us to test whether AP could also catalyze the hydrolysis of phosphate diesters. The results described herein demonstrate that AP does have phosphodiesterase activity: the phosphatase and phosphodiesterase activities copurify over several steps; inorganic phosphate, a strong competitive inhibitor of AP, inhibits the phosphodiesterase and phosphatase activities with the same inhibition constant; a point mutation that weakens phosphate binding to AP correspondingly weakens phosphate inhibition of the phosphodiesterase activity; and mutation of active site residues substantially reduces both the mono- and diesterase activities. AP accelerates the rate of phosphate diester hydrolysis by 10(11)-fold relative to the rate of the uncatalyzed reaction [(k(cat)/K(m))/k(w)]. Although this rate enhancement is substantial, it is at least 10(6)-fold less than the rate enhancement for AP-catalyzed phosphate monoester hydrolysis. Mutational analysis suggests that common active site features contribute to hydrolysis of both phosphate monoesters and phosphate diesters. However, mutation of the active site arginine to serine, R166S, decreases the monoesterase activity but not the diesterase activity, suggesting that the interaction of this arginine with the nonbridging oxygen(s) of the phosphate monoester substrate provides a substantial amount of the preferential hydrolysis of phosphate monoesters. The observation of phosphodiesterase activity extends the previous observation that AP has a low level of

  2. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    SciTech Connect

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  3. Direct determination of phosphatase activity from physiological substrates in cells.

    PubMed

    Ren, Zhongyuan; Do, Le Duy; Bechkoff, Géraldine; Mebarek, Saida; Keloglu, Nermin; Ahamada, Saandia; Meena, Saurabh; Magne, David; Pikula, Slawomir; Wu, Yuqing; Buchet, René

    2015-01-01

    A direct and continuous approach to determine simultaneously protein and phosphate concentrations in cells and kinetics of phosphate release from physiological substrates by cells without any labeling has been developed. Among the enzymes having a phosphatase activity, tissue non-specific alkaline phosphatase (TNAP) performs indispensable, multiple functions in humans. It is expressed in numerous tissues with high levels detected in bones, liver and neurons. It is absolutely required for bone mineralization and also necessary for neurotransmitter synthesis. We provided the proof of concept that infrared spectroscopy is a reliable assay to determine a phosphatase activity in the osteoblasts. For the first time, an overall specific phosphatase activity in cells was determined in a single step by measuring simultaneously protein and substrate concentrations. We found specific activities in osteoblast like cells amounting to 116 ± 13 nmol min(-1) mg(-1) for PPi, to 56 ± 11 nmol min(-1) mg(-1) for AMP, to 79 ± 23 nmol min(-1) mg(-1) for beta-glycerophosphate and to 73 ± 15 nmol min(-1) mg(-1) for 1-alpha-D glucose phosphate. The assay was also effective to monitor phosphatase activity in primary osteoblasts and in matrix vesicles. The use of levamisole--a TNAP inhibitor--served to demonstrate that a part of the phosphatase activity originated from this enzyme. An IC50 value of 1.16 ± 0.03 mM was obtained for the inhibition of phosphatase activity of levamisole in osteoblast like cells. The infrared assay could be extended to determine any type of phosphatase activity in other cells. It may serve as a metabolomic tool to monitor an overall phosphatase activity including acid phosphatases or other related enzymes.

  4. Tea Contains Potent Inhibitors of Tyrosine Phosphatase PTP1B

    PubMed Central

    Ma, Junfeng; Li, Zhe; Xing, Shu; Ho, Wanting Tina; Fu, Xueqi; Zhao, Zhizhuang Joe

    2011-01-01

    Tea is widely consumed all over the world. Studies have demonstrated the role of tea in prevention and treatment of various chronic diseases including diabetes and obesity, but the underlying mechanism is unclear. PTP1B is a widely expressed tyrosine phosphatase which has been defined as a target for therapeutic drug development to treat diabetes and obesity. In screening for inhibitors of PTP1B, we found that aqueous extracts of teas exhibited potent PTP1B inhibitory effects with an IC50 value of 0.4 to 4 g dry tea leaves per liter of water. Black tea shows the strongest inhibition activities, followed by oolong and then by green tea. Biochemical fractionations demonstrated that the major effective components in tea corresponded to oxidized polyphenolic compounds. This was further verified by the fact that tea catechins became potent inhibitors of PTP1B upon oxidation catalyzed by tyrosinases. When applied to cultured cells, tea extracts induced tyrosine phosphorylation of cellular proteins. Our study suggests that some beneficial effects of tea may be attributed to the inhibition of PTP1B. PMID:21371422

  5. Protein-tyrosine phosphatase sigma is associated with ulcerative colitis.

    PubMed

    Muise, Aleixo M; Walters, Thomas; Wine, Eytan; Griffiths, Anne M; Turner, Dan; Duerr, Richard H; Regueiro, Miguel D; Ngan, Bo-Yee; Xu, Wei; Sherman, Philip M; Silverberg, Mark S; Rotin, Daniela

    2007-07-17

    Inflammatory bowel disease (IBD), a relatively common chronic debilitating intestinal illness, is composed of two broadly defined groups, Crohn's disease (CD) and ulcerative colitis (UC). Although several susceptibility genes for CD have been recently described, susceptibility genes exclusive for UC have not been forthcoming. Here, we show that receptor protein-tyrosine phosphatase sigma (PTPRS-encoding PTPsigma) knockout mice spontaneously develop mild colitis that becomes severe when challenged with two known inducers of colitis. We also demonstrate that E-cadherin and beta-catenin, two important adherens junction proteins involved in maintenance of barrier defense in the colon, act as colonic substrates for PTPsigma. Furthermore, we show that three SNPs (rs886936, rs17130, and rs8100586) that flank exon 8 in the human PTPRS gene are associated with UC. The presence of these SNPs is associated with novel splicing that removes the third immunoglobulin-like domain (exon 9) from the extracellular portion of PTPsigma, possibly altering dimerization or ligand recognition. We propose that polymorphisms in the human PTPRS gene lead to ulcerative colitis.

  6. A Hypothalamic Phosphatase Switch Coordinates Energy Expenditure with Feeding.

    PubMed

    Dodd, Garron T; Andrews, Zane B; Simonds, Stephanie E; Michael, Natalie J; DeVeer, Michael; Brüning, Jens C; Spanswick, David; Cowley, Michael A; Tiganis, Tony

    2017-08-01

    Beige adipocytes can interconvert between white and brown-like states and switch between energy storage versus expenditure. Here we report that beige adipocyte plasticity is important for feeding-associated changes in energy expenditure and is coordinated by the hypothalamus and the phosphatase TCPTP. A fasting-induced and glucocorticoid-mediated induction of TCPTP, inhibited insulin signaling in AgRP/NPY neurons, repressed the browning of white fat and decreased energy expenditure. Conversely feeding reduced hypothalamic TCPTP, to increase AgRP/NPY neuronal insulin signaling, white adipose tissue browning and energy expenditure. The feeding-induced repression of hypothalamic TCPTP was defective in obesity. Mice lacking TCPTP in AgRP/NPY neurons were resistant to diet-induced obesity and had increased beige fat activity and energy expenditure. The deletion of hypothalamic TCPTP in obesity restored feeding-induced browning and increased energy expenditure to promote weight loss. Our studies define a hypothalamic switch that coordinates energy expenditure with feeding for the maintenance of energy balance. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Different designs of kinase-phosphatase interactions and phosphatase sequestration shapes the robustness and signal flow in the MAPK cascade

    PubMed Central

    2012-01-01

    Background The three layer mitogen activated protein kinase (MAPK) signaling cascade exhibits different designs of interactions between its kinases and phosphatases. While the sequential interactions between the three kinases of the cascade are tightly preserved, the phosphatases of the cascade, such as MKP3 and PP2A, exhibit relatively diverse interactions with their substrate kinases. Additionally, the kinases of the MAPK cascade can also sequester their phosphatases. Thus, each topologically distinct interaction design of kinases and phosphatases could exhibit unique signal processing characteristics, and the presence of phosphatase sequestration may lead to further fine tuning of the propagated signal. Results We have built four architecturally distinct types of models of the MAPK cascade, each model with identical kinase-kinase interactions but unique kinases-phosphatases interactions. Our simulations unravelled that MAPK cascade’s robustness to external perturbations is a function of nature of interaction between its kinases and phosphatases. The cascade’s output robustness was enhanced when phosphatases were sequestrated by their target kinases. We uncovered a novel implicit/hidden negative feedback loop from the phosphatase MKP3 to its upstream kinase Raf-1, in a cascade resembling the B cell MAPK cascade. Notably, strength of the feedback loop was reciprocal to the strength of phosphatases’ sequestration and stronger sequestration abolished the feedback loop completely. An experimental method to verify the presence of the feedback loop is also proposed. We further showed, when the models were activated by transient signal, memory (total time taken by the cascade output to reach its unstimulated level after removal of signal) of a cascade was determined by the specific designs of interaction among its kinases and phosphatases. Conclusions Differences in interaction designs among the kinases and phosphatases can differentially shape the robustness and

  8. Defining Risk Drinking

    PubMed Central

    Dawson, Deborah A.

    2011-01-01

    Many efforts to prevent alcohol-related harm are aimed at reducing risk drinking. This article outlines the many conceptual and methodological challenges to defining risk drinking. It summarizes recent evidence regarding associations of various aspects of alcohol consumption with chronic and acute alcohol-related harms, including mortality, morbidity, injury, and alcohol use disorders, and summarizes the study designs most appropriate to defining risk thresholds for these types of harm. In addition, it presents an international overview of low-risk drinking guidelines from more than 20 countries, illustrating the wide range of interpretations of the scientific evidence related to risk drinking. This article also explores the impact of drink size on defining risk drinking and describes variation in what is considered to be a standard drink across populations. Actual and standard drink sizes differ in the United States, and this discrepancy affects definitions of risk drinking and prevention efforts. PMID:22330212

  9. Biomineralization of Uranium by PhoY Phosphatase Activity Aids Cell Survival in Caulobacter crescentus

    SciTech Connect

    Yung, M C; Jiao, Y

    2014-07-22

    Caulobacter crescentus is known to tolerate high levels of uranium [U(VI)], but its detoxification mechanism is poorly understood. Here we show that C. crescentus is able to facilitate U(VI) biomineralization through the formation of U-Pi precipitates via its native alkaline phosphatase activity. The U-Pi precipitates, deposited on the cell surface in the form of meta-autunite structures, have a lower U/Pi ratio than do chemically produced precipitates. The enzyme that is responsible for the phosphatase activity and thus the biomineralization process is identified as PhoY, a periplasmic alkaline phosphatase with broad substrate specificity. Furthermore, PhoY is shown to confer a survival advantage on C. crescentus toward U(VI) under both growth and nongrowth conditions. Results obtained in this study thus highlight U(VI) biomineralization as a resistance mechanism in microbes, which not only improves our understanding of bacterium-mineral interactions but also aids in defining potential ecological niches for metal-resistant bacteria.

  10. Biomineralization of Uranium by PhoY Phosphatase Activity Aids Cell Survival in Caulobacter crescentus

    PubMed Central

    Yung, Mimi C.

    2014-01-01

    Caulobacter crescentus is known to tolerate high levels of uranium [U(VI)], but its detoxification mechanism is poorly understood. Here we show that C. crescentus is able to facilitate U(VI) biomineralization through the formation of U-Pi precipitates via its native alkaline phosphatase activity. The U-Pi precipitates, deposited on the cell surface in the form of meta-autunite structures, have a lower U/Pi ratio than do chemically produced precipitates. The enzyme that is responsible for the phosphatase activity and thus the biomineralization process is identified as PhoY, a periplasmic alkaline phosphatase with broad substrate specificity. Furthermore, PhoY is shown to confer a survival advantage on C. crescentus toward U(VI) under both growth and nongrowth conditions. Results obtained in this study thus highlight U(VI) biomineralization as a resistance mechanism in microbes, which not only improves our understanding of bacterium-mineral interactions but also aids in defining potential ecological niches for metal-resistant bacteria. PMID:24878600

  11. Promiscuous sulfatase activity and thio-effects in a phosphodiesterase of the alkaline phosphatase superfamily.

    PubMed

    Lassila, Jonathan K; Herschlag, Daniel

    2008-12-02

    The nucleotide phosphodiesterase/pyrophosphatase from Xanthomonas axonopodis (NPP) is a structural and evolutionary relative of alkaline phosphatase that preferentially hydrolyzes phosphate diesters. With the goal of understanding how these two enzymes with nearly identical Zn(2+) bimetallo sites achieve high selectivity for hydrolysis of either phosphate monoesters or diesters, we have measured a promiscuous sulfatase activity in NPP. Sulfate esters are nearly isosteric with phosphate esters but carry less charge, offering a probe of electrostatic contributions to selectivity. NPP exhibits sulfatase activity with k(cat)/K(M) value of 2 x 10(-5) M(-1) s(-1), similar to the R166S mutant of alkaline phosphatase. We further report the effects of thio-substitution on phosphate monoester and diester reactions. Reactivities with these noncognate substrates illustrate a reduced dependence of NPP reactivity on the charge of the nonbridging oxygen situated between the Zn(2+) ions relative to that in alkaline phosphatase. This reduced charge dependence can explain about 10(2) of the 10(7)-fold differential catalytic proficiency for the most similar monoester and diester substrates in the two enzymes. The results further suggest that active site contacts to substrate oxygen atoms that do not contact the Zn(2+) ions may play an important role in defining the selectivity of the enzymes.

  12. Biomineralization of uranium by PhoY phosphatase activity aids cell survival in Caulobacter crescentus.

    PubMed

    Yung, Mimi C; Jiao, Yongqin

    2014-08-01

    Caulobacter crescentus is known to tolerate high levels of uranium [U(VI)], but its detoxification mechanism is poorly understood. Here we show that C. crescentus is able to facilitate U(VI) biomineralization through the formation of U-Pi precipitates via its native alkaline phosphatase activity. The U-Pi precipitates, deposited on the cell surface in the form of meta-autunite structures, have a lower U/Pi ratio than do chemically produced precipitates. The enzyme that is responsible for the phosphatase activity and thus the biomineralization process is identified as PhoY, a periplasmic alkaline phosphatase with broad substrate specificity. Furthermore, PhoY is shown to confer a survival advantage on C. crescentus toward U(VI) under both growth and nongrowth conditions. Results obtained in this study thus highlight U(VI) biomineralization as a resistance mechanism in microbes, which not only improves our understanding of bacterium-mineral interactions but also aids in defining potential ecological niches for metal-resistant bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Defining the Human Microbiome

    PubMed Central

    Ursell, Luke K; Metcalf, Jessica L; Parfrey, Laura Wegener; Knight, Rob

    2012-01-01

    Rapidly developing sequencing methods and analytical techniques are enhancing our ability to understand the human microbiome, and, indeed, how we define the microbiome and its constituents. In this review we highlight recent research that expands our ability to understand the human microbiome on different spatial and temporal scales, including daily timeseries datasets spanning months. Furthermore, we discuss emerging concepts related to defining operational taxonomic units, diversity indices, core versus transient microbiomes and the possibility of enterotypes. Additional advances in sequencing technology and in our understanding of the microbiome will provide exciting prospects for exploiting the microbiota for personalized medicine. PMID:22861806

  14. Giardia lamblia: Characterization of ecto-phosphatase activities.

    PubMed

    Amazonas, Juliana Natal; Cosentino-Gomes, Daniela; Werneck-Lacerda, Aline; Pinheiro, Ana Acácia de Sá; Lanfredi-Rangel, Adriana; De Souza, Wanderley; Meyer-Fernandes, José R

    2009-01-01

    Ecto-phosphatase activities of Giardia lamblia were characterized in intact cells, which are able to hydrolyze the artificial substrate p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 8.4+/-0.8 nmol p-NP/h/10(7) cells. The ecto-phosphatase activities were inhibited at high pH as well as by classical inhibitors of acid phosphatases, such as sodium fluoride and sodium molybdate and by inorganic phosphate, the final product of the reaction. Experiments using a classical inhibitor of phosphotyrosine phosphatase, sodium orthovanadate, also showed that the ecto-phosphatase activity was inhibited in a dose-dependent manner. Different phosphorylated amino acids were used as substrates for the G. lamblia ecto-phosphatase activities the highest rate of phosphate release was achieved using phosphotyrosine. Not only p-NPP hydrolysis but also phosphotyrosine hydrolysis was inhibited by sodium orthovanadate. Phosphotyrosine but not phospho-serine or phospho-threonine inhibited the p-nitrophenylphosphatase activity. We also observed a positive correlation between the ecto-phosphatase activity and the capacity to encystation of G. lamblia trophozoites.

  15. A bifunctional kinase-phosphatase in bacterial chemotaxis.

    PubMed

    Porter, Steven L; Roberts, Mark A J; Manning, Cerys S; Armitage, Judith P

    2008-11-25

    Phosphorylation-based signaling pathways employ dephosphorylation mechanisms for signal termination. Histidine to aspartate phosphosignaling in the two-component system that controls bacterial chemotaxis has been studied extensively. Rhodobacter sphaeroides has a complex chemosensory pathway with multiple homologues of the Escherichia coli chemosensory proteins, although it lacks homologues of known signal-terminating CheY-P phosphatases, such as CheZ, CheC, FliY or CheX. Here, we demonstrate that an unusual CheA homologue, CheA(3), is not only a phosphodonor for the principal CheY protein, CheY(6), but is also is a specific phosphatase for CheY(6)-P. This phosphatase activity accelerates CheY(6)-P dephosphorylation to a rate that is comparable with the measured stimulus response time of approximately 1 s. CheA(3) possesses only two of the five domains found in classical CheAs, the Hpt (P1) and regulatory (P5) domains, which are joined by a 794-amino acid sequence that is required for phosphatase activity. The P1 domain of CheA(3) is phosphorylated by CheA(4), and it subsequently acts as a phosphodonor for the response regulators. A CheA(3) mutant protein without the 794-amino acid region lacked phosphatase activity, retained phosphotransfer function, but did not support chemotaxis, suggesting that the phosphatase activity may be required for chemotaxis. Using a nested deletion approach, we showed that a 200-amino acid segment of CheA(3) is required for phosphatase activity. The phosphatase activity of previously identified nonhybrid histidine protein kinases depends on the dimerization and histidine phosphorylation (DHp) domains. However, CheA(3) lacks a DHp domain, suggesting that its phosphatase mechanism is different from that of other histidine protein kinases.

  16. Streptococcus pneumoniae phosphotyrosine phosphatase CpsB and alterations in capsule production resulting from changes in oxygen availability.

    PubMed

    Geno, K Aaron; Hauser, Jocelyn R; Gupta, Kanupriya; Yother, Janet

    2014-06-01

    Streptococcus pneumoniae produces a protective capsular polysaccharide whose production must be modulated for bacterial survival within various host niches. Capsule production is affected in part by a phosphoregulatory system comprised of CpsB, CpsC, and CpsD. Here, we found that growth of serotype 2 strain D39 under conditions of increased oxygen availability resulted in decreased capsule levels concurrent with an ∼5-fold increase in Cps2B-mediated phosphatase activity. The change in Cps2B phosphatase activity did not result from alterations in the levels of either the cps2B transcript or the Cps2B protein. Recombinant Cps2B expressed in Escherichia coli similarly exhibited increased phosphatase activity under conditions of high-oxygen growth. S. pneumoniae D39 derivatives with defined deletion or point mutations in cps2B demonstrated reduced phosphatase activity with corresponding increases in levels of Cps2D tyrosine phosphorylation. There was, however, no correlation between these phenotypes and the level of capsule production. During growth under reduced-oxygen conditions, the Cps2B protein was essential for parental levels of capsule, but phosphatase activity alone could be eliminated without an effect on capsule. Under increased-oxygen conditions, deletion of cps2B did not affect capsule levels. These results indicate that neither Cps2B phosphatase activity nor Cps2D phosphorylation levels per se are determinants of capsule levels, whereas the Cps2B protein is important for capsule production during growth under conditions of reduced but not enhanced oxygen availability. Roles for factors outside the capsule locus, possible interactions between capsule regulatory proteins, and links to other cellular processes are also suggested by the results described in this study.

  17. Streptococcus pneumoniae Phosphotyrosine Phosphatase CpsB and Alterations in Capsule Production Resulting from Changes in Oxygen Availability

    PubMed Central

    Geno, K. Aaron; Hauser, Jocelyn R.; Gupta, Kanupriya

    2014-01-01

    Streptococcus pneumoniae produces a protective capsular polysaccharide whose production must be modulated for bacterial survival within various host niches. Capsule production is affected in part by a phosphoregulatory system comprised of CpsB, CpsC, and CpsD. Here, we found that growth of serotype 2 strain D39 under conditions of increased oxygen availability resulted in decreased capsule levels concurrent with an ∼5-fold increase in Cps2B-mediated phosphatase activity. The change in Cps2B phosphatase activity did not result from alterations in the levels of either the cps2B transcript or the Cps2B protein. Recombinant Cps2B expressed in Escherichia coli similarly exhibited increased phosphatase activity under conditions of high-oxygen growth. S. pneumoniae D39 derivatives with defined deletion or point mutations in cps2B demonstrated reduced phosphatase activity with corresponding increases in levels of Cps2D tyrosine phosphorylation. There was, however, no correlation between these phenotypes and the level of capsule production. During growth under reduced-oxygen conditions, the Cps2B protein was essential for parental levels of capsule, but phosphatase activity alone could be eliminated without an effect on capsule. Under increased-oxygen conditions, deletion of cps2B did not affect capsule levels. These results indicate that neither Cps2B phosphatase activity nor Cps2D phosphorylation levels per se are determinants of capsule levels, whereas the Cps2B protein is important for capsule production during growth under conditions of reduced but not enhanced oxygen availability. Roles for factors outside the capsule locus, possible interactions between capsule regulatory proteins, and links to other cellular processes are also suggested by the results described in this study. PMID:24659769

  18. Transition Coordinators: Define Yourselves.

    ERIC Educational Resources Information Center

    Asselin, Susan B.; Todd-Allen, Mary; deFur, Sharon

    1998-01-01

    Describes a technique that was used successfully to identify the changing roles and responsibilities of special educators as transition coordinators. The Developing a Curriculum (DACUM) model uses people who are currently working in the occupation to define job responsibilities. The duties of a transition coordinator are identified. (CR)

  19. Defining Effective Teaching

    ERIC Educational Resources Information Center

    Layne, L.

    2012-01-01

    The author looks at the meaning of specific terminology commonly used in student surveys: "effective teaching." The research seeks to determine if there is a difference in how "effective teaching" is defined by those taking student surveys and those interpreting the results. To investigate this difference, a sample group of professors and students…

  20. Defining Mathematical Giftedness

    ERIC Educational Resources Information Center

    Parish, Linda

    2014-01-01

    This theoretical paper outlines the process of defining "mathematical giftedness" for a present study on how primary school teaching shapes the mindsets of children who are mathematically gifted. Mathematical giftedness is not a badge of honour or some special value attributed to a child who has achieved something exceptional.…

  1. On Defining Mass

    ERIC Educational Resources Information Center

    Hecht, Eugene

    2011-01-01

    Though central to any pedagogical development of physics, the concept of mass is still not well understood. Properly defining mass has proven to be far more daunting than contemporary textbooks would have us believe. And yet today the origin of mass is one of the most aggressively pursued areas of research in all of physics. Much of the excitement…

  2. Defining Supports Geometry

    ERIC Educational Resources Information Center

    Stephan, Michelle L.; McManus, George E.; Dickey, Ashley L.; Arb, Maxwell S.

    2012-01-01

    The process of developing definitions is underemphasized in most mathematics instruction. Investing time in constructing meaning is well worth the return in terms of the knowledge it imparts. In this article, the authors present a third approach to "defining," called "constructive." It involves modifying students' previous understanding of a term…

  3. On Defining Mass

    ERIC Educational Resources Information Center

    Hecht, Eugene

    2011-01-01

    Though central to any pedagogical development of physics, the concept of mass is still not well understood. Properly defining mass has proven to be far more daunting than contemporary textbooks would have us believe. And yet today the origin of mass is one of the most aggressively pursued areas of research in all of physics. Much of the excitement…

  4. Defining the Language Arts.

    ERIC Educational Resources Information Center

    Barth, Patte, Ed.

    1994-01-01

    This issue of "Basic Education" presents articles that discuss, respectively, defining the language arts, an agenda for English, the benefits of two languages, a new teacher (presently teaching English in a foreign country) looking ahead, and the Shaker Fellowships awarded by the school district in Shaker Heights, Ohio. Articles in the…

  5. Defined by Limitations

    ERIC Educational Resources Information Center

    Arriola, Sonya; Murphy, Katy

    2010-01-01

    Undocumented students are a population defined by limitations. Their lack of legal residency and any supporting paperwork (e.g., Social Security number, government issued identification) renders them essentially invisible to the American and state governments. They cannot legally work. In many states, they cannot legally drive. After the age of…

  6. Defining in Classroom Activities.

    ERIC Educational Resources Information Center

    Mariotti, Maria Alessandra; Fischbein, Efraim

    1997-01-01

    Discusses some aspects of the defining process in geometrical context in the reference frame of the theory of "figural concepts." Presents analysis of some examples taken from a teaching experiment at the sixth-grade level. Contains 30 references. (Author/ASK)

  7. Penicillin inhibitors of purple acid phosphatase.

    PubMed

    Faridoon; Hussein, Waleed M; Ul Islam, Nazar; Guddat, Luke W; Schenk, Gerhard; McGeary, Ross P

    2012-04-01

    Purple acid phosphatases (PAPs) are binuclear metallohydrolases that have a multitude of biological functions and are found in fungi, bacteria, plants and animals. In mammals, PAP activity is linked with bone resorption and over-expression can lead to bone disorders such as osteoporosis. PAP is therefore an attractive target for the development of drugs to treat this disease. A series of penicillin conjugates, in which 6-aminopenicillanic acid was acylated with aromatic acid chlorides, has been prepared and assayed against pig PAP. The binding mode of most of these conjugates is purely competitive, and some members of this class have potencies comparable to the best PAP inhibitors yet reported. The structurally related penicillin G was shown to be neither an inhibitor nor a substrate for pig PAP. Molecular modelling has been used to examine the binding modes of these compounds in the active site of the enzyme and to rationalise their activities. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  8. Universal phosphatase-coupled glycosyltransferase assay.

    PubMed

    Wu, Zhengliang L; Ethen, Cheryl M; Prather, Brittany; Machacek, Miranda; Jiang, Weiping

    2011-06-01

    A nonradioactive glycosyltransferase assay is described here. This method takes advantage of specific phosphatases that can be added into glycosyltransferase reactions to quantitatively release inorganic phosphate from the leaving groups of glycosyltransferase reactions. The released phosphate group is then detected using colorimetric malachite-based reagents. Because the amount of phosphate released is directly proportional to the sugar molecule transferred in a glycosyltransferase reaction, this method can be used to obtain accurate kinetic parameters of the glycosyltransferase. The assay can be performed in multiwell plates and quantitated by a plate reader, thus making it amenable to high-throughput screening. It has been successfully applied to all glycosyltransferases available to us, including glucosyltransferases, N-acetylglucosaminyltransferases, N-acetylgalactosyltransferases, galactosyltransferases, fucosyltransferases and sialyltransferases. As examples, we first assayed Clostridium difficile toxin B, a protein O-glucosyltransferase that specifically monoglucosylates and inactivates Rho family small GTPases; we then showed that human KTELC1, a homolog of Rumi from Drosophila, was able to hydrolyze UDP-Glc; and finally, we measured the kinetic parameters of human sialyltransferase ST6GAL1.

  9. Protein tyrosine phosphatases: structure-function relationships.

    PubMed

    Tabernero, Lydia; Aricescu, A Radu; Jones, E Yvonne; Szedlacsek, Stefan E

    2008-03-01

    Structural analysis of protein tyrosine phosphatases (PTPs) has expanded considerably in the last several years, producing more than 200 structures in this class of enzymes (from 35 different proteins and their complexes with ligands). The small-medium size of the catalytic domain of approximately 280 residues plus a very compact fold makes it amenable to cloning and overexpression in bacterial systems thus facilitating crystallographic analysis. The low molecular weight PTPs being even smaller, approximately 150 residues, are also perfect targets for NMR analysis. The availability of different structures and complexes of PTPs with substrates and inhibitors has provided a wealth of information with profound effects in the way we understand their biological functions. Developments in mammalian expression technology recently led to the first crystal structure of a receptor-like PTP extracellular region. Altogether, the PTP structural work significantly advanced our knowledge regarding the architecture, regulation and substrate specificity of these enzymes. In this review, we compile the most prominent structural traits that characterize PTPs and their complexes with ligands. We discuss how the data can be used to design further functional experiments and as a basis for drug design given that many PTPs are now considered strategic therapeutic targets for human diseases such as diabetes and cancer.

  10. Identification of human pulmonary alkaline phosphatase isoenzymes.

    PubMed

    Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F

    1997-04-01

    An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.

  11. Emerging Roles of Human Prostatic Acid Phosphatase

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2013-01-01

    Prostate cancer is one of the most prevalent non-skin related cancers. It is the second leading cause of cancer deaths among males in most Western countries. If prostate cancer is diagnosed in its early stages, there is a higher probability that it will be completely cured. Prostatic acid phosphatase (PAP) is a non-specific phosphomonoesterase synthesized in prostate epithelial cells and its level proportionally increases with prostate cancer progression. PAP was the biochemical diagnostic mainstay for prostate cancer until the introduction of prostate-specific antigen (PSA) which improved the detection of early-stage prostate cancer and largely displaced PAP. Recently, however, there is a renewed interest in PAP because of its usefulness in prognosticating intermediate to high-risk prostate cancers and its success in the immunotherapy of prostate cancer. Although PAP is believed to be a key regulator of prostate cell growth, its exact role in normal prostate as well as detailed molecular mechanism of PAP regulation is still unclear. Here, many different aspects of PAP in prostate cancer are revisited and its emerging roles in other environment are discussed. PMID:24009853

  12. Alkaline Phosphatase, an Unconventional Immune Protein.

    PubMed

    Rader, Bethany A

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer's disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont.

  13. Alkaline Phosphatase, an Unconventional Immune Protein

    PubMed Central

    Rader, Bethany A.

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer’s disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont. PMID:28824625

  14. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase.

    PubMed

    Cottrill, Michael A; Golovan, Serguei P; Phillips, John P; Forsberg, Cecil W

    2002-09-01

    When screening an Escherichia coli gene library for myo-inositol hexakisphosphate (InsP6) phosphatases (phytases), we discovered that the agp-encoded acid glucose-1-phosphatase also possesses this activity. Purified Agp hydrolyzes glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6 with pH optima, 6.5, 3.5, and 4.5, respectively, and was stable when incubated at pH values ranging from 3 to 10. Glucose-1-phosphate was hydrolyzed most efficiently at 55 degrees C. while InsP6 and p-nitrophenyl phosphate were hydrolyzed maximally at 60 degrees C. The Agp exhibited Km values of (0.39 mM, 13 mM, and 0.54 mM for the hydrolysis of glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6, respectively. High-pressure liquid chromatography (HPLC) analysis of inositol phosphate hydrolysis products of Agp demonstrated that the enzyme catalyzes the hydrolysis of phosphate from each of InsP6, D-Ins(1,2,3,4,5)P5, Ins(1,3,4,5,6)P5, and Ins(1,2,3,4,6)P5, producing D/L-Ins(1,2,4,5,6)P5. D-Ins(1,2,4,5)P4, D/L-Ins(1,4,5,6)P4 and D/L-Ins(1,2,4,6)P4, respectively. These data support the contention that Agp is a 3-phosphatase.

  15. Lily pollen alkaline phytase is a histidine phosphatase similar to mammalian multiple inositol polyphosphate phosphatase (MINPP).

    PubMed

    Mehta, Bakul Dhagat; Jog, Sonali P; Johnson, Steven C; Murthy, Pushpalatha P N

    2006-09-01

    Phytic acid is the most abundant inositol phosphate in cells; it constitutes 1-5% of the dry weight of cereal grains and legumes. Phytases are the primary enzymes responsible for the hydrolysis of phytic acid and thus play important roles in inositol phosphate metabolism. A novel alkaline phytase in lily pollen (LlALP) was recently purified in our laboratory. In this paper, we describe the cloning and characterization of LlALP cDNA from lily pollen. Two isoforms of alkaline phytase cDNAs, LlAlp1 and LlAlp2, which are 1467 and 1533 bp long and encode proteins of 487 and 511 amino acids, respectively, were identified. The deduced amino acid sequences contains the signature heptapeptide of histidine phosphatases, -RHGXRXP-, but shares < 25% identity to fungal histidine acid phytases. Phylogenetic analysis reveals that LlALP is most closely related to multiple inositol polyphosphate phosphatase (MINPP) from humans (25%) and rats (23%). mRNA corresponding to LlAlp1 and LlAlp2 were expressed in leaves, stem, petals and pollen grains. The expression profiles of LlAlp isoforms in anthers indicated that mRNA corresponding to both isoforms were present at all stages of flower development. The expression of LlAlp2 cDNA in Escherichia coli revealed the accumulation of the active enzyme in inclusion bodies and confirmed that the cDNA encodes an alkaline phytase. In summary, plant alkaline phytase is a member of the histidine phosphatase family that includes MINPP and exhibits properties distinct from bacterial and fungal phytases.

  16. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  17. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  18. Defining Dynamic Route Structure

    NASA Technical Reports Server (NTRS)

    Zelinski, Shannon; Jastrzebski, Michael

    2011-01-01

    This poster describes a method for defining route structure from flight tracks. Dynamically generated route structures could be useful in guiding dynamic airspace configuration and helping controllers retain situational awareness under dynamically changing traffic conditions. Individual merge and diverge intersections between pairs of flights are identified, clustered, and grouped into nodes of a route structure network. Links are placed between nodes to represent major traffic flows. A parametric analysis determined the algorithm input parameters producing route structures of current day flight plans that are closest to todays airway structure. These parameters are then used to define and analyze the dynamic route structure over the course of a day for current day flight paths. Route structures are also compared between current day flight paths and more user preferred paths such as great circle and weather avoidance routing.

  19. Defining the fascial system.

    PubMed

    Adstrum, Sue; Hedley, Gil; Schleip, Robert; Stecco, Carla; Yucesoy, Can A

    2017-01-01

    Fascia is a widely used yet indistinctly defined anatomical term that is concurrently applied to the description of soft collagenous connective tissue, distinct sections of membranous tissue, and a body pervading soft connective tissue system. Inconsistent use of this term is causing concern due to its potential to confuse technical communication about fascia in global, multiple discipline- and multiple profession-spanning discourse environments. The Fascia Research Society acted to address this issue by establishing a Fascia Nomenclature Committee (FNC) whose purpose was to clarify the terminology relating to fascia. This committee has since developed and defined the terms a fascia, and, more recently, the fascial system. This article reports on the FNC's proposed definition of the fascial system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. [To define internet addiction].

    PubMed

    Tonioni, Federico

    2013-01-01

    Internet addiction is a new behavioral disorder difficult to define, especially when referring to young teenagers who make great use of web-mediated relationships. It's necessary to separate the cases of overt dependency on those in which the abuse of internet seems to have a different value, offering the only way to achieve the possible relationship. Internet is mediating a new way of communicating and thinking, this may favor the onset of clinical phenomena intended to surprise.

  1. Defining and Diagnosing Sepsis.

    PubMed

    Scott, Michael C

    2017-02-01

    Sepsis is a heterogeneous clinical syndrome that encompasses infections of many different types and severity. Not surprisingly, it has confounded most attempts to apply a single definition, which has also limited the ability to develop a set of reliable diagnostic criteria. It is perhaps best defined as the different clinical syndromes produced by an immune response to infection that causes harm to the body beyond that of the local effects of the infection.

  2. Protein Phosphatases Involved in Regulating Mitosis: Facts and Hypotheses.

    PubMed

    Kim, Hyun-Soo; Fernandes, Gary; Lee, Chang-Woo

    2016-09-01

    Almost all eukaryotic proteins are subject to post-translational modifications during mitosis and cell cycle, and in particular, reversible phosphorylation being a key event. The recent use of high-throughput experimental analyses has revealed that more than 70% of all eukaryotic proteins are regulated by phosphorylation; however, the mechanism of dephosphorylation, counteracting phosphorylation, is relatively unknown. Recent discoveries have shown that many of the protein phosphatases are involved in the temporal and spatial control of mitotic events, such as mitotic entry, mitotic spindle assembly, chromosome architecture changes and cohesion, and mitotic exit. This implies that certain phosphatases are tightly regulated for timely dephosphorylation of key mitotic phosphoproteins and are essential for control of various mitotic processes. This review describes the physiological and pathological roles of mitotic phosphatases, as well as the versatile role of various protein phosphatases in several mitotic events.

  3. [Phosphatase activity of Bacillus subtilis IMV B-7023].

    PubMed

    Bulavenko, L V; Kurdysh, I K

    2005-01-01

    Phosphatase activity of two strains of bacteria - Bacillus subtilis IMV B-7023 and B. megaterium 12 is investigated. The phosphatase activity is found to reach 260 mkmol/g x hour for B. subtilis IMV B-7023 and 12-100 mkmol/g x hour for B. megaterium 12 at optimal temperature (55 degrees C) and pH (9.5-10.0). Synthesis of alkaline phosphatase is shown to reach its maximum values at the end of logarithmic phase of the culture growth. It is revealed that Mg2+, Ca2+ cations increase phosphotase activity of B. subtilis IMV B-7023, at the same time Cu2+, Mn2+, Zn2+ cations and inorganic phosphate decrease it. Dependence of the rate of phosphatase reaction of B. subtilis IMV B-7023 on substrate concentration is determined.

  4. Structure and Mechanism of the Phosphotyrosyl Phosphatase Activator

    SciTech Connect

    Chao,Y.; Xing, Y.; Chen, Y.; Xu, Y.; Lin, Z.; Li, Z.; Jeffrey, P.; Stock, J.; Shi, Y.

    2006-01-01

    Phosphotyrosyl phosphatase activator (PTPA), also known as PP2A phosphatase activator, is a conserved protein from yeast to human. Here we report the 1.9 {angstrom} crystal structure of human PTPA, which reveals a previously unreported fold consisting of three subdomains: core, lid, and linker. Structural analysis uncovers a highly conserved surface patch, which borders the three subdomains, and an associated deep pocket located between the core and the linker subdomains. The conserved surface patch and the deep pocket are responsible for binding to PP2A and ATP, respectively. PTPA and PP2A A-C dimer together constitute a composite ATPase. PTPA binding to PP2A results in a dramatic alteration of substrate specificity, with enhanced phosphotyrosine phosphatase activity and decreased phosphoserine phosphatase activity. This function of PTPA strictly depends on the composite ATPase activity. These observations reveal significant insights into the function and mechanism of PTPA and have important ramifications for understanding PP2A function.

  5. Cytoskeletal integrity in interphase cells requires protein phosphatase activity.

    PubMed Central

    Eriksson, J E; Brautigan, D L; Vallee, R; Olmsted, J; Fujiki, H; Goldman, R D

    1992-01-01

    Phosphorylation by protein kinases has been established as a key factor in the regulation of cytoskeletal structure. However, little is known about the role of protein phosphatases in cytoskeletal regulation. To assess the possible functions of protein phosphatases in this respect, we studied the effects of the phosphatase inhibitors calyculin A, okadaic acid, and dinophysistoxin 1 (35-methylokadaic acid) on BHK-21 fibroblasts. Within minutes of incubation with these inhibitors, changes are seen in the structural organization of intermediate filaments, followed by a loss of microtubules, as assayed by immunofluorescence. These changes in cytoskeletal structure are accompanied by a rapid and selective increase in vimentin phosphorylation on interphase-specific sites, and they are fully reversible after removal of calyculin A. The results indicate that there is a rapid phosphate turnover on cytoskeletal intermediate filaments and further suggest that protein phosphatases are essential for the maintenance and structural integrity of two major cytoskeletal components. Images PMID:1332069

  6. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  7. Phosphoinositide 5-phosphatases: How do they affect tumourigenesis?

    PubMed

    Miyazawa, Keiji

    2013-01-01

    The activity of biological molecules is often affected by their phosphorylation state. Regulatory phosphorylation operates as a binary switch and is usually controlled by counteracting kinases and phosphatases. However, phosphatidylinositol (PtdIns) has three phosphorylation sites on its inositol ring. The phosphorylation status of PtdIns is controlled by multiple kinases and phosphatases with distinct substrate specificities, serving as a 'lipid code' or 'phosphoinositide code'. Class I phosphoinositide 3-kinase (PI3K) converts PtdIns(4,5)P₂ to PtdIns(3,4,5)P₃, which plays a pivotal role in signals controlling glucose uptake, cytoskeletal reorganization, cell proliferation and apoptosis. PI3K is pro-oncogenic, whereas phosphoinositide phosphatases that degrade PtdIns(3,4,5)P₃ are not always anti-oncogenic. Recent studies have revealed the unique characteristics of phosphoinositide 5-phosphatases.

  8. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  9. Regulation of alkaline phosphatase expression in human choriocarcinoma cell lines.

    PubMed Central

    Hamilton, T A; Tin, A W; Sussman, H H

    1979-01-01

    The coincident expression of two structurally distinct isoenzymes of human alkaline phosphatase was demonstrated in two independently derived gestational choriocarcinoma cell lines. These proteins were shown to have enzymatic, antigenic, and physical-chemical properties resembling those of isoenzymes from term placenta and adult liver. The regulation of these isoenzymes has been studied during the exposure of both cell lines to 5-bromodeoxyuridine and dibutyryl cyclic AMP. The responses of the alkaline phosphatase isoenzymes to these agents have also been compared with the response of another protein phenotypic to placenta, the alpha subunit of chorionic gonadotropin. The results show that (i) the separate structural genes coding for placental and liver alkaline phosphatases are regulated in a noncoordinate fashion; (ii) both alkaline phosphatase genes respond independently of the alpha subunit; and (iii) the induction of the placental type isoenzyme occurs via at least two independent pathways. Images PMID:218197

  10. Type 2C Protein Phosphatases in Fungi ▿ †

    PubMed Central

    Ariño, Joaquín; Casamayor, Antonio; González, Asier

    2011-01-01

    Type 2C Ser/Thr phosphatases are a remarkable class of protein phosphatases, which are conserved in eukaryotes and involved in a large variety of functional processes. Unlike in other Ser/Thr phosphatases, the catalytic polypeptide is not usually associated with regulatory subunits, and functional specificity is achieved by encoding multiple isoforms. For fungi, most information comes from the study of type 2C protein phosphatase (PP2C) enzymes in Saccharomyces cerevisiae, where seven PP2C-encoding genes (PTC1 to -7) with diverse functions can be found. More recently, data on several Candida albicans PP2C proteins became available, suggesting that some of them can be involved in virulence. In this work we review the available literature on fungal PP2Cs and explore sequence databases to provide a comprehensive overview of these enzymes in fungi. PMID:21076010

  11. Moraxella catarrhalis synthesizes an autotransporter that is an acid phosphatase.

    PubMed

    Hoopman, Todd C; Wang, Wei; Brautigam, Chad A; Sedillo, Jennifer L; Reilly, Thomas J; Hansen, Eric J

    2008-02-01

    Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10(-10)) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation domain of conventional autotransporters. Cloning and expression of the M. catarrhalis mapA gene in Escherichia coli confirmed the presence of acid phosphatase activity in the MapA protein. The MapA protein was shown to be localized to the outer membrane of M. catarrhalis and was not detected either in the soluble cytoplasmic fraction from disrupted M. catarrhalis cells or in the spent culture supernatant fluid from M. catarrhalis. Use of the predicted MapA translocation domain in a fusion construct with the passenger domain from another predicted M. catarrhalis autotransporter confirmed the translocation ability of this MapA domain. Inactivation of the mapA gene in M. catarrhalis strain O35E reduced the acid phosphatase activity expressed by this organism, and this mutation could be complemented in trans with the wild-type mapA gene. Nucleotide sequence analysis of the mapA gene from six M. catarrhalis strains showed that this protein was highly conserved among strains of this pathogen. Site-directed mutagenesis of a critical histidine residue (H233A) in the predicted active site of the acid phosphatase domain in MapA eliminated acid phosphatase activity in the recombinant MapA protein. This is the first description of an autotransporter protein that expresses acid phosphatase activity.

  12. Leishmania amazonensis: characterization of an ecto-phosphatase activity.

    PubMed

    de Almeida-Amaral, Elmo Eduardo; Belmont-Firpo, Rodrigo; Vannier-Santos, Marcos André; Meyer-Fernandes, José Roberto

    2006-12-01

    We have characterized a phosphatase activity present on the external surface of Leishmania amazonensis, using intact living parasites. This enzyme hydrolyzes the substrate p-nitrophenylphosphate (p-NPP) at the rate of 25.70+/-1.17 nmol Pi x h(-1) x 10(-7)cells. The dependence on p-NPP concentration shows a normal Michaelis-Menten kinetics for this ecto-phosphatase activity present a V(max) of 31.93+/-3.04 nmol Pi x h(-1) x 10(-7)cells and apparent K(m) of 1.78+/-0.32 mM. Inorganic phosphate inhibited the ecto-phoshatase activity in a dose-dependent manner with the K(i) value of 2.60 mM. Experiments using classical inhibitor of acid phosphatase, such as ammonium molybdate, as well as inhibitors of phosphotyrosine phosphatase, such as sodium orthovanadate and [potassiumbisperoxo(1,10-phenanthroline)oxovanadate(V)] (bpV-PHEN), inhibited the ecto-phosphatase activity, with the K(i) values of 0.33 microM, 0.36 microM and 0.25 microM, respectively. Zinc chloride, another classical phosphotyrosine phosphatase inhibitor, also inhibited the ecto-phosphatase activity in a dose-dependent manner with K(i) 2.62 mM. Zinc inhibition was reversed by incubation with reduced glutathione (GSH) and cysteine, but not serine, showing that cysteine residues are important for enzymatic activity. Promastigote growth in a medium supplemented with 1mM sodium orthovanadate was completely inhibited as compared to the control medium. Taken together, these results suggest that L. amazonensis express a phosphohydrolase ectoenzyme with phosphotyrosine phosphatase activity.

  13. Atomic structure of DUSP26, a novel p53 phosphatase

    PubMed Central

    Lokareddy, Ravi Kumar; Bhardwaj, Anshul; Cingolani, Gino

    2013-01-01

    Regulation of p53 phosphorylation is critical to control its stability and biological activity. Dual Specificity Phosphatase 26 (DUSP26) is a brain phosphatase highly overexpressed in neuroblastoma, which has been implicated in dephosphorylating phospho-Ser20 and phospho-Ser37 in the p53 transactivation domain (TAD). In this paper, we report the 1.68Å crystal structure of a catalytically inactive mutant (Cys152Ser) of DUSP26 lacking the first N-terminal 60 residues (ΔN60-C/S-DUSP26). This structure reveals the architecture of a dual-specificity phosphatase domain related in structure to Vaccinia virus VH1. DUSP26 adopts a closed conformation of the protein tyrosine phosphatase (PTP)-binding loop, which results in an unusually shallow active site pocket and buried catalytic cysteine. A water molecule trapped inside the PTP-binding loop makes close contacts both with main chain and side chain atoms. The hydrodynamic radius (RH) of ΔN60-C/S-DUSP26 measured from velocity sedimentation analysis (RH ~22.7 Å) and gel filtration chromatography (RH ~21.0 Å) is consistent with a globular monomeric protein of ~18 kDa. Instead in crystal, ΔN60-C/S-DUSP26 is more elongated (RH ~37.9 Å), likely due to the extended conformation of C-terminal helix α9, which swings away from the phosphatase core to generate a highly basic surface. As in the case of the phosphatase MKP-4, we propose that a substrate-induced conformational change, possibly involving rearrangement of helix α9 with respect to the phosphatase core, allows DUSP26 to adopt a catalytically active conformation. The structural characterization of DUSP26 presented in this paper provides the first atomic insight into this disease-associated phosphatase. PMID:23298255

  14. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  15. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  16. OBSERVATIONS ON THE ACID PHOSPHATASES OF EUGLENA GRACILIS

    PubMed Central

    Blum, Jacob J.

    1965-01-01

    When a bleached strain of Euglena is maintained in a medium containing very low con centrations of phosphate, the acid phosphatase activity increases. The increase in acid phosphatase activity is prevented by Actinomycin D and by p-fluorophenylalanine (PFA), indicating that the increased activity is due to de novo synthesis of acid phosphatase. When phosphate is replenished, the acid phosphatase activity decreases to the level characteristic of uninduced cells before there is any appreciable cell division. When cell division resumes in the presence of PFA, the level of acid phosphatase activity remains approximately constant. This indicates that there are two different phosphatases: a constitutive enzyme, whose synthesis is insensitive to the presence of PFA, and an induced enzyme, whose synthesis is sensitive to PFA. These enzymes are not equally sensitive to changes in pH and in fluoride concentration, thus permitting them to be assayed individually in whole toluene-treated cells. Induced cells also acquire the ability to remove phosphate from the medium very rapidly. PMID:14326108

  17. The cytochemistry of tartrate-resistant acid phosphatase. Technical considerations.

    PubMed

    Janckila, A J; Li, C Y; Lam, K W; Yam, L T

    1978-07-01

    Cytochemical demonstration of tartrate-resistant acid phosphatase activity is essential for the diagnosis of leukemic reticuloendotheliosis. In order to perform this test correctly and to interpret the results propertly, it is necessary to understand the technical details of the cytochemical methods thoroughly. The method using naphthol--ASBI phosphoric acid--fast garnet GBC is recommended for this purpose, and factors crucial to the cytochemical study, such as fixation, substrate, coupler, pH and temperature of incubation buffer, counterstains, and mounting media are examined and discussed. Conventional methods for acid phosphatase in the presence and absence of L(+) tartaric acid are also critically examined. The naphthol--ASBI phosphoric acid--fast garnet GBC method is sensitive, technically simple and easily reproducible. Its reaction product is highly chromogenic and is most suitable for cytochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase activity in cytologic preparations. The naphthol--ASBI phosphoric acid--pararosaniline method is highly specific and is best for histochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase in tissue sections.

  18. Resolution and purification of three periplasmic phosphatases of Salmonella typhimurium.

    PubMed Central

    Kier, L D; Weppelman, R; Ames, B N

    1977-01-01

    A survey of Salmonella typhimurium enzymes possessing phosphatase or phosphodiesterase activity was made using several different growth conditions. These studies revealed the presence of three major enzymes, all of which were subsequently purified: a cyclic 2' ,3'-nucleotide phosphodiesterase (EC 3.1.4.d), an acid hexose phosphatase (EC 3.1.3.2), and a nonspecific acid phosphatase (EC 3.1.3.2). A fourth enzyme hydrolyzed bis-(p-nitrophenyl)phosphate but none of the other substrates tested. No evidence was found for the existence of an alkaline phosphatase (EC 3.1.3.1) or a specific 5'-nucleotidase (EC 3.1.3.5) in S. typhimurium LT2. All three phosphatases could be measured efficiently in intact cells, which suggested a periplasmic location; however, they were not readily released by osmotic shock procedures. The nonspecific acid phosphatase, which was purified to apparent homogeneity, yielded a single polypeptide band on both sodium dodecyl sulfate and acidic urea gel electrophoretic systems. Images PMID:192712

  19. Defining functional dyspepsia.

    PubMed

    Mearin, Fermín; Calleja, José Luis

    2011-12-01

    Dyspepsia and functional dyspepsia represent a highly significant public health issue. A good definition of dyspepsia is key for helping us to better approach symptoms, decision making, and therapy indications.During the last few years many attempts were made at establishing a definition of dyspepsia. Results were little successful on most occasions, and clear discrepancies arose on whether symptoms should be associated with digestion, which types of symptoms were to be included, which anatomic location should symptoms have, etc.The Rome III Committee defined dyspepsia as "a symptom or set of symptoms that most physicians consider to originate from the gastroduodenal area", including the following: postprandial heaviness, early satiety, and epigastric pain or burning. Two new entities were defined: a) food-induced dyspeptic symptoms (postprandial distress syndrome); and b) epigastric pain (epigastric pain syndrome). These and other definitions have shown both strengths and weaknesses. At times they have been much too complex, at times much too simple; furthermore, they have commonly erred on the side of being inaccurate and impractical. On the other hand, some (the most recent ones) are difficult to translate into the Spanish language. In a meeting of gastroenterologists with a special interest in digestive functional disorders, the various aspects of dyspepsia definition were discussed and put to the vote, and the following conclusions were arrived at: dyspepsia is defined as a set of symptoms, either related or unrelated to food ingestion, localized on the upper half of the abdomen. They include: a) epigastric discomfort (as a category of severity) or pain; b) postprandial heaviness; and c) early satiety. Associated complaints include: nausea, belching, bloating, and epigastric burn (heartburn). All these must be scored according to severity and frequency. Furthermore, psychological factors may be involved in the origin of functional dyspepsia. On the other hand

  20. Iron content and acid phosphatase activity in hepatic parenchymal lysosomes of patients with hemochromatosis before and after phlebotomy treatment

    SciTech Connect

    Cleton, M.I.; de Bruijn, W.C.; van Blokland, W.T.; Marx, J.J.; Roelofs, J.M.; Rademakers, L.H.

    1988-03-01

    Lysosomal structures in liver parenchymal cells of 3 patients with iron overload and of 3 subjects without iron-storage disorders were investigated. A combination of enzyme cytochemistry--with cerium as a captive ion to demonstrate lysosomal acid phosphatase activity--and electron probe X-ray microanalysis (EPMA) was used. We were able (1) to define and quantify lysosomal structures as lysosomes, siderosomes, or residual bodies, (2) to quantify the amount of iron and cerium simultaneously in these structures, and (3) to evaluate a possible relation between iron storage and enzyme activity. With histopathologically increased iron storage, the number of siderosomes had increased at the cost of lysosomes, with a corresponding increase in acid phosphatase activity in both organelles. In histopahtologically severe iron overload, however, acid phosphatase activity was low or not detectable and most of the iron was stored in residual bodies. After phlebotomy treatment, the number of siderosomes had decreased in favor of the lysosomes, approaching values obtained in control subjects, and acid phosphatase activity was present in all iron-containing structures. In this way a relationship between iron storage and enzyme activity was established. The iron content of the individual lysosomal structures per unit area had increased with histopathologically increased iron storage and had decreased after phlebotomy treatment. From this observation, it is concluded that the iron status of the patient is not only reflected by the amount of iron-containing hepatocytes but, as well, by the iron content lysosomal unit area.

  1. A Malachite Green-Based Assay to Assess Glucan Phosphatase Activity

    PubMed Central

    Sherwood, Amanda R.; Paasch, Bradley C.; Worby, Carolyn A.; Gentry, Matthew S.

    2012-01-01

    With the recent discovery of a unique class of dual-specificity phosphatases that dephosphorylate glucans, we report an in vitro assay tailored for the detection of phosphatase activity against phosphorylated glucans. We demonstrate that in contrast to a general phosphatase assay utilizing a synthetic substrate, only phosphatases that possess glucan phosphatase activity liberate phosphate from the phosphorylated glucan amylopectin using the described assay. This assay is simple and cost-effective, providing reproducible results that clearly establish the presence or absence of glucan phosphatase activity. The assay described will be a useful tool in characterizing emerging members of the glucan phosphatase family. PMID:23201267

  2. [Phosphatase activity in Amoeba proteus at pH 9.0].

    PubMed

    Sopina, V A

    2007-01-01

    In the free-living amoeba Amoeba proteus (strain B), after PAAG disk-electrophoresis of the homogenate supernatant, at using 1-naphthyl phosphate as a substrate and pH 9.0, three forms of phosphatase activity were revealed; they were arbitrarily called "fast", "intermediate", and "slow" phosphatases. The fast phosphatase has been established to be a fraction of lysosomal acid phosphatase that preserves some low activity at alkaline pH. The question as to which particular class the intermediate phosphatase belongs to has remained unanswered: it can be both acid phosphatase and protein tyrosine phosphatase (PTP). Based on data of inhibitor analysis, large substrate specificity, results of experiments with reactivation by Zn ions after inactivation with EDTA, other than in the fast and intermediate phosphatases localization in the amoeba cell, it is concluded that only slow phosphatase can be classified as alkaline phosphatase (EC 3.1.3.1).

  3. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue binding phosphatases.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2000-01-01

    Implication of protein phosphatases in Alzheimer disease led us to a systemic investigation of the identification of these enzyme activities in human brain. Human brain phosphatases eluted from DEAE-Sephacel with 0.22 M NaCl were resolved into two main groups by affi-gel blue chromatography, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue-binding phosphatases were further separated into four different phosphatases, designated P1, P2, P3, and P4 by calmodulin-Sepharose 4B and poly-(L-lysine)-agarose chromatographies. These four phosphatases exhibited activities towards nonprotein phosphoester and two of them, P1 and P4, could dephosphorylate phosphoproteins. The activities of the four phosphatases differed in pH optimum, divalent metal ion requirements, sensitivities to various inhibitors and substrate affinities. The apparent molecular masses as estimated by gel-filtration for P1, P2, P3, and P4 were 97, 45, 42, and 125 kDa, respectively. P1 is markedly similar to PP2B from bovine brain and rabbit skeletal muscle. P4 was labeled with anti-PP2A antibody and may represent a new subtype of PP2A. P1 and P4 were also effective in dephosphorylating Alzheimer disease abnormally hyperphosphorylated tau (AD P-tau). The resulting dephosphorylated AD P-tau had its activity restored in promoting assembly of microtubules in vitro. These results suggest that P1 and P4 might be involved in the regulation of phosphorylation of tau in human brain, especially in neurodegenerative conditions like Alzheimer's disease which are characterized by the abnormal hyperphosphorylation of this protein.

  4. Defining periodontal health

    PubMed Central

    2015-01-01

    Assessment of the periodontium has relied exclusively on a variety of physical measurements (e.g., attachment level, probing depth, bone loss, mobility, recession, degree of inflammation, etc.) in relation to various case definitions of periodontal disease. Periodontal health was often an afterthought and was simply defined as the absence of the signs and symptoms of a periodontal disease. Accordingly, these strict and sometimes disparate definitions of periodontal disease have resulted in an idealistic requirement of a pristine periodontium for periodontal health, which makes us all diseased in one way or another. Furthermore, the consequence of not having a realistic definition of health has resulted in potentially questionable recommendations. The aim of this manuscript was to assess the biological, environmental, sociological, economic, educational and psychological relationships that are germane to constructing a paradigm that defines periodontal health using a modified wellness model. The paradigm includes four cardinal characteristics, i.e., 1) a functional dentition, 2) the painless function of a dentition, 3) the stability of the periodontal attachment apparatus, and 4) the psychological and social well-being of the individual. Finally, strategies and policies that advocate periodontal health were appraised. I'm not sick but I'm not well, and it's a sin to live so well. Flagpole Sitta, Harvey Danger PMID:26390888

  5. Structural elucidation of the NADP(H) phosphatase activity of staphylococcal dual-specific IMPase/NADP(H) phosphatase.

    PubMed

    Bhattacharyya, Sudipta; Dutta, Anirudha; Dutta, Debajyoti; Ghosh, Ananta Kumar; Das, Amit Kumar

    2016-02-01

    NADP(H)/NAD(H) homeostasis has long been identified to play a pivotal role in the mitigation of reactive oxygen stress (ROS) in the intracellular milieu and is therefore critical for the progression and pathogenesis of many diseases. NAD(H) kinases and NADP(H) phosphatases are two key players in this pathway. Despite structural evidence demonstrating the existence and mode of action of NAD(H) kinases, the specific annotation and the mode of action of NADP(H) phosphatases remains obscure. Here, structural evidence supporting the alternative role of inositol monophosphatase (IMPase) as an NADP(H) phosphatase is reported. Crystal structures of staphylococcal dual-specific IMPase/NADP(H) phosphatase (SaIMPase-I) in complex with the substrates D-myo-inositol-1-phosphate and NADP(+) have been solved. The structure of the SaIMPase-I-Ca(2+)-NADP(+) ternary complex reveals the catalytic mode of action of NADP(H) phosphatase. Moreover, structures of SaIMPase-I-Ca(2+)-substrate complexes have reinforced the earlier proposal that the length of the active-site-distant helix α4 and its preceding loop are the predisposing factors for the promiscuous substrate specificity of SaIMPase-I. Altogether, the evidence presented suggests that IMPase-family enzymes with a shorter α4 helix could be potential candidates for previously unreported NADP(H) phosphatase activity.

  6. Defined contribution health benefits.

    PubMed

    Fronstin, P

    2001-03-01

    This Issue Brief discusses the emerging issue of "defined contribution" (DC) health benefits. The term "defined contribution" is used to describe a wide variety of approaches to the provision of health benefits, all of which have in common a shift in the responsibility for payment and selection of health care services from employers to employees. DC health benefits often are mentioned in the context of enabling employers to control their outlay for health benefits by avoiding increases in health care costs. DC health benefits may also shift responsibility for choosing a health plan and the associated risks of choosing a plan from employers to employees. There are three primary reasons why some employers currently are considering some sort of DC approach. First, they are once again looking for ways to keep their health care cost increases in line with overall inflation. Second, some employers are concerned that the public "backlash" against managed care will result in new legislation, regulations, and litigation that will further increase their health care costs if they do not distance themselves from health care decisions. Third, employers have modified not only most employee benefit plans, but labor market practices in general, by giving workers more choice, control, and flexibility. DC-type health benefits have existed as cafeteria plans since the 1980s. A cafeteria plan gives each employee the opportunity to determine the allocation of his or her total compensation (within employer-defined limits) among various employee benefits (primarily retirement or health). Most types of DC health benefits currently being discussed could be provided within the existing employment-based health insurance system, with or without the use of cafeteria plans. They could also allow employees to purchase health insurance directly from insurers, or they could drive new technologies and new forms of risk pooling through which health care services are provided and financed. DC health

  7. TAPERED DEFINING SLOT

    DOEpatents

    Pressey, F.W.

    1959-09-01

    An improvement is reported in the shape and formation of the slot or opening in the collimating slot member which forms part of an ion source of the type wherein a vapor of the material to be ionized is bombarded by electrons in a magnetic field to strike an arc-producing ionization. The defining slot is formed so as to have a substantial taper away from the cathode, causing the electron bombardment from the cathode to be dispersed over a greater area reducing its temperature and at the same time bringing the principal concentration of heat from the electron bombardment nearer the anode side of the slot, thus reducing deterioration and prolonging the life of the slot member during operation.

  8. Prostatic acid phosphatase degrades lysophosphatidic acid in seminal plasma.

    PubMed

    Tanaka, Masayuki; Kishi, Yasuhiro; Takanezawa, Yasukazu; Kakehi, Yoshiyuki; Aoki, Junken; Arai, Hiroyuki

    2004-07-30

    Lysophosphatidic acid (LPA) is a lipid mediator with multiple biological activities and is detected in various biological fluids, including human seminal plasma. Due to its cell proliferation stimulatory and anti-apoptotic activities, LPA has been implicated in the progression of some cancers such as ovarian cancer and prostate cancer. Here, we show that prostatic acid phosphatase, which is a non-specific phosphatase and which has been implicated in the progression of prostate cancer, inactivates LPA in human seminal plasma. Human seminal plasma contains both an LPA-synthetic enzyme, lysoPLD, which converts lysophospholipids to LPA and is responsible for LPA production in serum, and its major substrate, lysophosphatidylcholine. In serum, LPA accumulated during incubation at 37 degrees C. However, in seminal plasma, LPA did not accumulate. This discrepancy is explained by the presence of a strong LPA-degrading activity. Incubation of LPA with seminal plasma resulted in the disappearance of LPA and an accompanying accumulation of monoglyceride showing that LPA is degraded by phosphatase activity present in the seminal plasma. When seminal plasma was incubated in the presence of a phosphatase inhibitor, sodium orthovanadate, LPA accumulated, indicating that LPA is produced and degraded in the fluid. Biochemical characterization of the LPA-phosphatase activity identified two phosphatase activities in human seminal plasma. By Western blotting analysis in combination with several column chromatographies, the major activity was revealed to be identical to prostatic acid phosphatase. The present study demonstrates active LPA metabolism in seminal plasma and indicates the possible role of LPA signaling in male sexual organs including prostate cancer.

  9. Human pyridoxal phosphatase. Molecular cloning, functional expression, and tissue distribution.

    PubMed

    Jang, Young Min; Kim, Dae Won; Kang, Tae-Cheon; Won, Moo Ho; Baek, Nam-In; Moon, Byung Jo; Choi, Soo Young; Kwon, Oh-Shin

    2003-12-12

    Pyridoxal phosphatase catalyzes the dephosphorylation of pyridoxal 5'-phosphate (PLP) and pyridoxine 5'-phosphate. A human brain cDNA clone was identified to the PLP phosphatase on the basis of peptide sequences obtained previously. The cDNA predicts a 296-amino acid protein with a calculated Mr of 31698. The open reading frame is encoded by two exons located on human chromosome 22q12.3, and the exon-intron junction contains the GT/AG consensus splice site. In addition, a full-length mouse PLP phosphatase cDNA of 1978 bp was also isolated. Mouse enzyme encodes a protein of 292 amino acids with Mr of 31512, and it is localized on chromosome 15.E1. Human and mouse PLP phosphatase share 93% identity in protein sequence. A BLAST search revealed the existence of putative proteins in organism ranging from bacteria to mammals. Catalytically active human PLP phosphatase was expressed in Escherichia coli, and characteristics of the recombinant enzyme were similar to those of erythrocyte enzyme. The recombinant enzyme displayed Km and kcat values for pyridoxal of 2.5 microM and 1.52 s(-1), respectively. Human PLP phosphatase mRNA is differentially expressed in a tissue-specific manner. A single mRNA transcript of 2.1 kb was detected in all human tissues examined and was highly abundant in the brain. Obtaining the molecular properties for the human PLP phosphatase may provide new direction for investigating metabolic pathway involving vitamin B6.

  10. [Phosphatase activity in Amoeba proteus at low pH].

    PubMed

    Sopina, V A

    2009-01-01

    In free-living Amoeba proteus (strain B), three forms of tartrate-sensitive phosphatase were revealed using PAGE of the supernatant of ameba homogenates obtained with 1% Triton X-100 or distilled water and subsequent staining of gels with 2-naphthyl phosphate as substrate (pH 4.0). The form with the highest mobility in the ameba supernatant was sensitive to all tested phosphatase activity modulators. Two other forms with the lower mobilities were completely or significantly inactivated not only by sodium L-(+)-tartrate, but also by L-(+)-tartaric acid, sodium orthovanadate, ammonium molybdate, EDTA, EGTA, o-phospho-L-tyrosine, DL-dithiotreitol, H2O2, 2-mercaptoethanol, and ions of heavy metals - Fe2+, Fe3+, and Cu2+. Based on results of inhibitory analysis, lysosome location in the ameba cell, and wide substrate specificity of these two forms, it has been concluded that they belong to nonspecific acid phosphomonoesterases (AcP, EC 3.1.3.2). This AcP is suggested to have both phosphomonoesterase and phosphotyrosyl-protein phosphatase activitis. Two ecto-phosphatases were revealed in the culture medium, in which amebas were cultivated. One of them was inhibited by the same reagents as the ameba tartrate-sensitive AcP and seems to be the AcP released into the culture medium in the process of exocytosis of the content of food vacuoles. In the culture medium, apart from this AcP, another phosphatase was revealed, which was not inhibited by any tested inhibitors of AcP and alkaline phosphatase. It cannot be ruled out that this phosphatase belong to the ecto-ATPases found in many protists; however, its ability to hydrolyze ATP has not yet been proven.

  11. Serum alkaline phosphatase screening for vitamin D deficiency states.

    PubMed

    Shaheen, Shehla; Noor, Syed Shahid; Barakzai, Qamaruddin

    2012-07-01

    To determine whether serum vitamin D levels are correlated with serum levels of alkaline phosphatase or not. Cross-sectional, observational study. Multi-centre study, conducted at Liaquat National Hospital and Medical College, National Medical Centre and Medicare Hospital, Karachi, from January to October 2009. Patients attending the Orthopaedic OPDs with complaints of pain in different body regions and serum vitamin D3 levels of ² 30 ng/ml were included in the study. Patients with vitamin D deficiency were further categorized into mild deficiency or insufficiency (vit. D3 = 20-29 ng/ml), moderate deficiency (vit. D3 = 5 - 19 ng/ml) and severe deficiency forms (vit. D3 < 5 ng/ml). Pearson correlation was applied to test the correlation of serum alkaline phosphatase levels with serum vitamin D3 levels. P-value < 0.05 was considered to be significant. Out of 110 samples, 26 had mild (23%), 61 had moderate (55%) and 21 had severe (19.1%) vitamin D deficiencies. All of the patients in the three groups had alkaline phosphatase with in normal limits and the total mean value of the enzyme was 135.97 ± 68.141 U/L. The inter group comparison showed highest values of alkaline phosphatase in the moderate vitamin D deficiency group. The correlation coefficient of alkaline phosphatase and serum vitamin D3 levels was r =0.05 (p =0.593). Serum vitamin D3 levels may not be correlated with increased serum alkaline phosphatase levels. Therefore, alkaline phosphatase may not be used as a screening test to rule out vitamin D deficiency.

  12. Alkaline phosphatase revisited: hydrolysis of alkyl phosphates.

    PubMed

    O'Brien, Patrick J; Herschlag, Daniel

    2002-03-05

    Escherichia coli alkaline phosphatase (AP) is the prototypical two metal ion catalyst with two divalent zinc ions bound approximately 4 A apart in the active site. Studies spanning half a century have elucidated many structural and mechanistic features of this enzyme, rendering it an attractive model for investigating the potent catalytic power of bimetallic centers. Unfortunately, fundamental mechanistic features have been obscured by limitations with the standard assays. These assays generate concentrations of inorganic phosphate (P(i)) in excess of its inhibition constant (K(i) approximately 1 muM). This tight binding by P(i) has affected the majority of published kinetic constants. Furthermore, binding limits k(cat)/K(m) for reaction of p-nitrophenyl phosphate, the most commonly employed substrate. We describe a sensitive (32)P-based assay for hydrolysis of alkyl phosphates that avoids the complication of product inhibition. We have revisited basic mechanistic features of AP with these alkyl phosphate substrates. The results suggest that the chemical step for phosphorylation of the enzyme limits k(cat)/K(m). The pH-rate profile and additional results suggest that the serine nucleophile is active in its anionic form and has a pK(a) of < or = 5.5 in the free enzyme. An inactivating pK(a) of 8.0 is observed for binding of both substrates and inhibitors, and we suggest that this corresponds to ionization of a zinc-coordinated water molecule. Counter to previous suggestions, inorganic phosphate dianion appears to bind to the highly charged AP active site at least as strongly as the trianion. The dependence of k(cat)/K(m) on the pK(a) of the leaving group follows a Brønsted correlation with a slope of beta(lg) = -0.85 +/- 0.1, differing substantially from the previously reported value of -0.2 obtained from data with a less sensitive assay. This steep leaving group dependence is consistent with a largely dissociative transition state for AP-catalyzed hydrolysis of

  13. Glycerol-3-phosphatase of Corynebacterium glutamicum.

    PubMed

    Lindner, Steffen N; Meiswinkel, Tobias M; Panhorst, Maren; Youn, Jung-Won; Wiefel, Lars; Wendisch, Volker F

    2012-06-15

    Formation of glycerol as by-product of amino acid production by Corynebacterium glutamicum has been observed under certain conditions, but the enzyme(s) involved in its synthesis from glycerol-3-phosphate were not known. It was shown here that cg1700 encodes an enzyme active as a glycerol-3-phosphatase (GPP) hydrolyzing glycerol-3-phosphate to inorganic phosphate and glycerol. GPP was found to be active as a homodimer. The enzyme preferred conditions of neutral pH and requires Mg²⁺ or Mn²⁺ for its activity. GPP dephosphorylated both L- and D-glycerol-3-phosphate with a preference for the D-enantiomer. The maximal activity of GPP was estimated to be 31.1 and 1.7 U mg⁻¹ with K(M) values of 3.8 and 2.9 mM for DL- and L-glycerol-3-phosphate, respectively. For physiological analysis a gpp deletion mutant was constructed and shown to lack the ability to produce detectable glycerol concentrations. Vice versa, gpp overexpression increased glycerol accumulation during growth in fructose minimal medium. It has been demonstrated previously that intracellular accumulation of glycerol-3-phosphate is growth inhibitory as shown for a recombinant C. glutamicum strain overproducing glycerokinase and glycerol facilitator genes from E. coli in media containing glycerol. In this strain, overexpression of gpp restored growth in the presence of glycerol as intracellular glycerol-3-phosphate concentrations were reduced to wild-type levels. In C. glutamicum wild type, GPP was shown to be involved in utilization of DL-glycerol-3-phosphate as source of phosphorus, since growth with DL-glycerol-3-phosphate as sole phosphorus source was reduced in the gpp deletion strain whereas it was accelerated upon gpp overexpression. As GPP homologues were found to be encoded in the genomes of many other bacteria, the gpp homologues of Escherichia coli (b2293) and Bacillus subtilis (BSU09240, BSU34970) as well as gpp1 from the plant Arabidosis thaliana were overexpressed in E. coli MG1655 and

  14. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence.

    PubMed

    Keum, Dongil; Kruse, Martin; Kim, Dong-Il; Hille, Bertil; Suh, Byung-Chang

    2016-06-28

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  15. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence

    PubMed Central

    Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang

    2016-01-01

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  16. Crystal structure of rat intestinal alkaline phosphatase--role of crown domain in mammalian alkaline phosphatases.

    PubMed

    Ghosh, Kaushik; Mazumder Tagore, Debarati; Anumula, Rushith; Lakshmaiah, Basanth; Kumar, P P B S; Singaram, Senthuran; Matan, Thangavelu; Kallipatti, Sanjith; Selvam, Sabariya; Krishnamurthy, Prasad; Ramarao, Manjunath

    2013-11-01

    Intestinal alkaline phosphatases (IAPs) are involved in the cleavage of phosphate prodrugs to liberate the drug for absorption in the intestine. To facilitate in vitro characterization of phosphate prodrugs, we have cloned, expressed, purified and characterized IAPs from rat and cynomolgus monkey (rIAP and cIAP respectively) which are important pre-clinical species for drug metabolism studies. The recombinant rat and monkey enzymes expressed in Sf9 insect cells (IAP-Ic) were found to be glycosylated and active. Expression of rat IAP in Escherichia coli (rIAP-Ec) led to ~200-fold loss of activity that was partially recovered by the addition of external Zn(2+) and Mg(2+) ions. Crystal structures of rIAP-Ec and rIAP-Ic were determined and they provide rationale for the discrepancy in enzyme activities. Rat IAP-Ic retains its activity in presence of both Zn(2+) and Mg(2+) whereas activity of most other alkaline phosphatases (APs) including the cIAP was strongly inhibited by excess Zn(2+). Based on our crystal structure, we hypothesized the residue Q317 in rIAP, present within 7 Å of the Mg(2+) at M3, to be important for this difference in activity. The Q317H rIAP and H317Q cIAP mutants showed reversal in effect of Zn(2+), corroborating the hypothesis. Further analysis of the two structures indicated a close linkage between glycosylation and crown domain stability. A triple mutant of rIAP, where all the three putative N-linked glycosylation sites were mutated showed thermal instability and reduced activity.

  17. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  18. Defining the Anthropocene

    NASA Astrophysics Data System (ADS)

    Lewis, Simon; Maslin, Mark

    2016-04-01

    Time is divided by geologists according to marked shifts in Earth's state. Recent global environmental changes suggest that Earth may have entered a new human-dominated geological epoch, the Anthropocene. Should the Anthropocene - the idea that human activity is a force acting upon the Earth system in ways that mean that Earth will be altered for millions of years - be defined as a geological time-unit at the level of an Epoch? Here we appraise the data to assess such claims, first in terms of changes to the Earth system, with particular focus on very long-lived impacts, as Epochs typically last millions of years. Can Earth really be said to be in transition from one state to another? Secondly, we then consider the formal criteria used to define geological time-units and move forward through time examining whether currently available evidence passes typical geological time-unit evidence thresholds. We suggest two time periods likely fit the criteria (1) the aftermath of the interlinking of the Old and New Worlds, which moved species across continents and ocean basins worldwide, a geologically unprecedented and permanent change, which is also the globally synchronous coolest part of the Little Ice Age (in Earth system terms), and the beginning of global trade and a new socio-economic "world system" (in historical terms), marked as a golden spike by a temporary drop in atmospheric CO2, centred on 1610 CE; and (2) the aftermath of the Second World War, when many global environmental changes accelerated and novel long-lived materials were increasingly manufactured, known as the Great Acceleration (in Earth system terms) and the beginning of the Cold War (in historical terms), marked as a golden spike by the peak in radionuclide fallout in 1964. We finish by noting that the Anthropocene debate is politically loaded, thus transparency in the presentation of evidence is essential if a formal definition of the Anthropocene is to avoid becoming a debate about bias. The

  19. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  20. A conserved phosphatase cascade that regulates nuclear membrane biogenesis.

    PubMed

    Kim, Youngjun; Gentry, Matthew S; Harris, Thurl E; Wiley, Sandra E; Lawrence, John C; Dixon, Jack E

    2007-04-17

    A newly emerging family of phosphatases that are members of the haloacid dehalogenase superfamily contains the catalytic motif DXDX(T/V). A member of this DXDX(T/V) phosphatase family known as Dullard was recently shown to be a potential regulator of neural tube development in Xenopus [Satow R, Chan TC, Asashima M (2002) Biochem Biophys Res Commun 295:85-91]. Herein, we demonstrate that human Dullard and the yeast protein Nem1p perform similar functions in mammalian cells and yeast cells, respectively. In addition to similarity in primary sequence, Dullard and Nem1p possess similar domains and show similar substrate preferences, and both localize to the nuclear envelope. Additionally, we show that human Dullard can rescue the aberrant nuclear envelope morphology of nem1Delta yeast cells, functionally replacing Nem1p. Finally, Nem1p, has been shown to deposphorylate the yeast phosphatidic acid phosphatase Smp2p [Santos-Rosa H, Leung J, Grimsey N, Peak-Chew S, Siniossoglou S (2005) EMBO J 24:1931-1941], and we show that Dullard dephosphorylates the mammalian phospatidic acid phosphatase, lipin. Therefore, we propose that Dullard participates in a unique phosphatase cascade regulating nuclear membrane biogenesis, and that this cascade is conserved from yeast to mammals.

  1. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  2. Characteristics of plasmalemma alkaline phosphatase of rat mesenteric artery.

    PubMed

    Kwan, C Y

    1983-01-01

    General characteristics of alkaline phosphatase activity of the plasma membrane-enriched fraction isolated from rat mesenteric arteries were investigated. The vascular smooth muscle plasmalemma alkaline phosphatase is a metalloenzyme which is strongly inhibited by chelating agents and this inhibition can be completely overcome by addition of Mg2+ or Ca2+. Zn2+ only partially reactivates the enzyme in the presence of low concentrations of EDTA. The enzymatic hydrolysis of p-nitrophenyl phosphate, beta-glycerophosphate, alpha-glycerophosphate, or 3'-adenosine monophosphate showed an optimal activity in the alkaline region between pH 9 and 11. The alkaline phosphatase activity is distinctly different from the plasmalemma ATPase and 5'-nucleotidase activities with respect to their pH dependence, influence by added divalent metal ions and stability against heat inactivation. Vanadate ion, being structurally similar to the transition state analog of the phosphoryl group, potently inhibits alkaline phosphatase with an apparent Ki of 1.5 microM. The altered alkaline phosphatase activity of vascular smooth muscle in relation to its possible physiological function and pathophysiological manifestation associated with hypertensive disease are discussed.

  3. Domain-to-domain coupling in voltage-sensing phosphatase

    PubMed Central

    Sakata, Souhei; Matsuda, Makoto; Kawanabe, Akira; Okamura, Yasushi

    2017-01-01

    Voltage-sensing phosphatase (VSP) consists of a transmembrane voltage sensor and a cytoplasmic enzyme region. The enzyme region contains the phosphatase and C2 domains, is structurally similar to the tumor suppressor phosphatase PTEN, and catalyzes the dephosphorylation of phosphoinositides. The transmembrane voltage sensor is connected to the phosphatase through a short linker region, and phosphatase activity is induced upon membrane depolarization. Although the detailed molecular characteristics of the voltage sensor domain and the enzyme region have been revealed, little is known how these two regions are coupled. In addition, it is important to know whether mechanism for coupling between the voltage sensor domain and downstream effector function is shared among other voltage sensor domain-containing proteins. Recent studies in which specific amino acid sites were genetically labeled using a fluorescent unnatural amino acid have enabled detection of the local structural changes in the cytoplasmic region of Ciona intestinalis VSP that occur with a change in membrane potential. The results of those studies provide novel insight into how the enzyme activity of the cytoplasmic region of VSP is regulated by the voltage sensor domain. PMID:28744425

  4. New Functions of the Inositol Polyphosphate 5-Phosphatases in Cancer.

    PubMed

    Erneux, Christophe; Ghosh, Somadri; Ramos, Ana Raquel; Edimo, William's Elong

    2016-01-01

    Inositol polyphosphate 5-phosphatases act on inositol phosphates and phosphoinositides as substrates. They are 10 different isoenzymes and several splice variants in the human genome that are involved in a series of human pathologies such as the Lowe syndrome, the Joubert and MORM syndromes, breast cancer, glioblastoma, gastric cancer and several other type of cancers. Inositol 5-phosphatases can be amplified in human cancer cells, whereas the 3- and 4- phosphatase tumor suppressor PTEN and INPP4B, repectively are often repressed or deleted. The inositol 5-phosphatases are critically involved in a complex network of higly regulated phosphoinositides, affecting the lipid content of PI(3, 4, 5)P3, PI(4, 5)P2 and PI(3, 4)P2. This has an impact on the normal behavior of many intracellular target proteins e.g. protein kinase B (PKB/Akt) or actin binding proteins and final biological responses. The production of PI(3, 4P)2 by dephosphorylation of the substrate PI(3, 4, 5)P3 is particularly important as it produces a new signal messenger in the control of cell migration, invasion and endocytosis. New inhibitors/activators of inositol 5- phosphatases have recently been identified for the possible control of their activity in several human pathologies such as inflamation and cancer.

  5. Acid phosphatase activities during the germination of Glycine max seeds.

    PubMed

    dos Prazeres, Janaina Nicanuzia; Ferreira, Carmen Veríssima; Aoyama, Hiroshi

    2004-01-01

    In this paper, we describe a study concerning the determination of some characteristics of soybean seedlings and the detection of acid phosphatase activities towards different substrates during the germination. Enzyme activities with p-nitrophenylphosphate (pNPP) and inorganic pyrophosphate (PPi) as substrates were detected from the 5th and 7th days after germination, respectively. Acid phosphatase activities with tyrosine phosphate (TyrP), glucose-6-phosphate (G6P) and phosphoenol pyruvate (PEP) were also observed but to a lesser extent. Under the same conditions, no enzyme activity was detected with phytic acid (PhyAc) as substrate. The appearance of phosphatase activity was coincident with the decrease of inorganic phosphate content during germination; over the same period, the protein content increased up to the 5th day, decreased until the 8th day, and remained constant after this period. Relative to phosphatase activity in the cotyledons, the activities detected in the hypocotyl and roots were 82% and 38%, respectively. During storage the enzyme maintained about 63% of its activity for 3 months at 5 degrees C. The specificity constant (Vmax/Km) values for pNPP and PPi were 212 and 64 mu kat mM-1 mg-1, respectively. Amongst the substrates tested, PPi could be a potential physiological substrate for acid phosphatase during the germination of soybean seeds.

  6. [Granulocyte alkaline phosphatase--a biomarker of chronic benzene exposure].

    PubMed

    Khristeva, V; Meshkov, T

    1994-01-01

    In tracing the cellular population status in the peripheral blood of workers, exposed to benzene, was included and cytochemical determination of the alkaline phosphatase activity in leucocytes. This enzyme is accepted as marker of the neutrophilic granulocytes, as maturation of the cells and their antibacterial activity are parallel to the cytochemical activity of the enzyme. 78 workers from the coke-chemical production from state firm "Kremikovtsi" and 41 workers from the production "Benzene" and "Isopropylbenzene"--Oil Chemical Plant, Burgas are included. The benzene concentrations in the air of the working places in all productions are in the range of 5 to 50 mg/m3. For cytochemical determination of the alkaline phosphatase activity is used the method of L. Kaplow and phosphatase index was calculated. It was established that in 98.4% of all examined the alkaline phosphatase activity is inhibited to different rate, as from 46.5% [61 workers] it is zero. In considerably lower percentage of workers were established and other deviations: leucocytosis or leucopenia, neutropenia, increased percent of band neutrophils and toxic granules. The results of the investigation of the granulocyte population show that from all indices, the activity of granulocyte alkaline phosphatase demonstrates most convincing the early myelotoxic effect of benzene.

  7. The catalytic properties of alkaline phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Chukhrai, E. S.; Poltorak, O. M.

    2008-11-01

    A comparative study was performed to examine the catalytic properties of alkaline phosphatases from bacteria Escherichia coli and bovine and chicken intestines. The activity of enzyme dimers and tetramers was determined. The activity of the dimer was three or four times higher than that of the tetramer. The maximum activity and affinity for 4-nitrophenylphosphate was observed for the bacterial alkaline phosphatase ( K M = 1.7 × 10-5 M, V max = 1800 μmol/(min mg of protein) for dimers and V max = 420 μmol/(min mg of protein) for tetramers). The Michaelis constants were equal for two animal phosphatases in various buffer media (pH 8.5) ((3.5 ± 0.2) × 10-4 M). Five buffer systems were investigated: tris, carbonate, hepes, borate, and glycine buffers, and the lowest catalytic activity of alkaline phosphatases at equal pH was observed in the borate buffer (for enzyme from bovine intestine, V max = 80 μmol/(min mg of protein)). Cu2+ cations formed a complex with tris-(oxymethyl)-aminomethane ( tris-HCl buffer) and inhibited the intestine alkaline phosphatases by a noncompetitive mechanism.

  8. Thermal inactivation of alkali phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Tarasevich, B. N.; Chukhrai, E. S.; Poltorak, O. M.

    2009-02-01

    The thermal inactivation of alkali phosphatases from bacteria Escherichia coli (ECAP), bovine intestines (bovine IAP), and chicken intestines (chicken IAP) was studied in different buffer solutions and in the solid state. The conclusion was made that these enzymes had maximum stability in the solid state, and, in a carbonate buffer solution, their activity decreased most rapidly. It was found that the bacterial enzyme was more stable than animal phosphatases. It was noted that, for ECAP, four intermediate stages preceded the loss of enzyme activity, and, for bovine and chicken IAPs, three intermediate stages were observed. The activation energy of thermal inactivation of ECAP over the range 25-70°C was determined to be 80 kJ/mol; it corresponded to the dissociation of active dimers into inactive monomers. Higher activation energies (˜200 kJ/mol) observed at the initial stage of thermal inactivation of animal phosphatases resulted from the simultaneous loss of enzyme activity caused by dimer dissociation and denaturation. It was shown that the activation energy of denaturation of monomeric animal alkali phosphatases ranged from 330 to 380 kJ/mol depending on buffer media. It was concluded that the inactivation of solid samples of alkali phosphatases at 95°C was accompanied by an about twofold decrease in the content of β structures in protein molecules.

  9. A Novel Inositol Pyrophosphate Phosphatase in Saccharomyces cerevisiae

    PubMed Central

    Steidle, Elizabeth A.; Chong, Lucy S.; Wu, Mingxuan; Crooke, Elliott; Fiedler, Dorothea; Resnick, Adam C.; Rolfes, Ronda J.

    2016-01-01

    Inositol pyrophosphates are high energy signaling molecules involved in cellular processes, such as energetic metabolism, telomere maintenance, stress responses, and vesicle trafficking, and can mediate protein phosphorylation. Although the inositol kinases underlying inositol pyrophosphate biosynthesis are well characterized, the phosphatases that selectively regulate their cellular pools are not fully described. The diphosphoinositol phosphate phosphohydrolase enzymes of the Nudix protein family have been demonstrated to dephosphorylate inositol pyrophosphates; however, the Saccharomyces cerevisiae homolog Ddp1 prefers inorganic polyphosphate over inositol pyrophosphates. We identified a novel phosphatase of the recently discovered atypical dual specificity phosphatase family as a physiological inositol pyrophosphate phosphatase. Purified recombinant Siw14 hydrolyzes the β-phosphate from 5-diphosphoinositol pentakisphosphate (5PP-IP5 or IP7) in vitro. In vivo, siw14Δ yeast mutants possess increased IP7 levels, whereas heterologous SIW14 overexpression eliminates IP7 from cells. IP7 levels increased proportionately when siw14Δ was combined with ddp1Δ or vip1Δ, indicating independent activity by the enzymes encoded by these genes. We conclude that Siw14 is a physiological phosphatase that modulates inositol pyrophosphate metabolism by dephosphorylating the IP7 isoform 5PP-IP5 to IP6. PMID:26828065

  10. Acid phosphatase and lipid peroxidation in human cataractous lens epithelium.

    PubMed

    Vasavada, A R; Thampi, P; Yadav, S; Rawal, U M

    1993-12-01

    The anterior lens epithelial cells undergo a variety of degenerative and proliferative changes during cataract formation. Acid phosphatase is primarily responsible for tissue regeneration and tissue repair. The lipid hydroperoxides that are obtained by lipid peroxidation of polysaturated or unsaturated fatty acids bring about deterioration of biological membranes at cellular and tissue levels. Acid phosphatase and lipid peroxidation activities were studied on the lens epithelial cells of nuclear cataract, posterior subcapsular cataract, mature cataract, and mixed cataract. Of these, mature cataractous lens epithelium showed maximum activity for acid phosphatase (516.83 moles of p-nitrophenol released/g lens epithelium) and maximum levels of lipid peroxidation (86.29 O.D./min/g lens epithelium). In contrast, mixed cataractous lens epithelium showed minimum activity of acid phosphatase (222.61 moles of p-nitrophenol released/g lens epithelium) and minimum levels of lipid peroxidation (54.23 O.D./min/g lens epithelium). From our study, we correlated the maximum activity of acid phosphatase in mature cataractous lens epithelium with the increased areas of superimposed cells associated with the formation of mature cataract. Likewise, the maximum levels of lipid peroxidation in mature cataractous lens epithelium was correlated with increased permeability of the plasma membrane. Conversely, the minimum levels of lipid peroxidation in mixed cataractous lens epithelium makes us presume that factors other than lipid peroxidation may also account for the formation of mixed type of cataract.

  11. Studies on the catalytic mechanism of pig purple acid phosphatase.

    PubMed

    Wynne, C J; Hamilton, S E; Dionysius, D A; Beck, J L; de Jersey, J

    1995-05-10

    Several independent experiments failed to reveal any evidence in support of the involvement of a phosphoryl-enzyme intermediate in the catalytic mechanism of pig allantoic fluid purple acid phosphatase: (i) attempts to label enzyme with phosphate derived from [32P]p-nitrophenyl phosphate were unsuccessful; (ii) values of kcat for a series of phosphate derivative varied over a wide range, with the enzyme showing a marked preference for activated ester and anhydride substrates over those with a stable leaving group; (iii) burst titrations revealed a "burst" of p-nitrophenol from p-nitrophenyl phosphate only when the enzyme was added after the substrate, suggesting that this result was an artifact of the order of addition of reagents; (iv) transphosphorylation from p-nitrophenyl phosphate to acceptor alcohols could not be detected, even under conditions where a transphosphorylation to hydrolysis ratio as low as 0.015 could have been measured; (v) enzyme-catalyzed exchange of 180 between phosphate and water was demonstrated, although at a rate much slower than that observed for other phosphatases where the involvement of a phosphoryl-enzyme intermediate in the mechanism has been clearly established. The present results are compared with those obtained in similar studies on other phosphatases, particularly the highly homologous beef spleen purple acid phosphatase, and their implications for the catalytic mechanism of the purple acid phosphatases are discussed.

  12. Escherichia coli alkaline phosphatase. Kinetic studies with the tetrameric enzyme.

    PubMed

    Halford, S E; Schlesinger, M J; Gutfreund, H

    1972-03-01

    1. The stability of the tetrameric form of Escherichia coli alkaline phosphatase was examined by analytical ultracentrifugation. 2. The stopped-flow technique was used to study the hydrolysis of nitrophenyl phosphates by the alkaline phosphatase tetramer at pH7.5 and 8.3. In both cases transient product formation was observed before the steady state was attained. Both transients consisted of the liberation of 1mol of nitrophenol/2mol of enzyme subunits within the dead-time of the apparatus. The steady-state rates were identical with those observed with the dimer under the same conditions. 3. The binding of 2-hydroxy-5-nitrobenzyl phosphonate to the alkaline phosphatase tetramer was studied by the temperature-jump technique. The self-association of two dimers to form the tetramer is linked to a conformation change within the dimer. This accounts for the differences between the transient phases in the reactions of the dimer and the tetramer with substrate. 4. Addition of P(i) to the alkaline phosphatase tetramer caused it to dissociate into dimers. The tetramer is unable to bind this ligand. It is suggested that the tetramer undergoes a compulsory dissociation before the completion of its first turnover with substrate. 5. On the basis of these findings a mechanism is proposed for the involvement of the alkaline phosphatase tetramer in the physiology of E. coli.

  13. Elevated serum level of human alkaline phosphatase in obesity.

    PubMed

    Khan, Abdul Rehman; Awan, Fazli Rabbi; Najam, Syeda Sadia; Islam, Mehboob; Siddique, Tehmina; Zain, Maryam

    2015-11-01

    To investigate a correlation between serum alkaline phosphatase level and body mass index in human subjects. The comparative cross-sectional study was carried out at the National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan, from April 2012 to June 2013. Blood serum alkaline phosphatase levels were estimated and the subjects were divided into three sub-groups on the basis of their body mass. normal weight (<25kg/m2), overweight (25-27kg/m2) and obese (>27kg/m2) subjects. The serum samples were used for the estimation of clinically important biochemical parameters, using commercial kits on clinical chemistry analyser. Of the 197 subjects, 97(49%) were obese and 100(51%) were non-obese. The serum alkaline phosphatase level increased in obese (214±6.4 IU/L) compared to the non-obese subjects (184.5±5 IU/L). Furthermore, a significant linear relationship (r=0.3;p-0.0001) was found between serum alkaline phosphatase and body mass index. Other biochemical variables were not correlated to the body mass index. Over activity and higher amounts of alkaline phosphatase were linked to the development of obesity.

  14. Isonicotinohydrazones as inhibitors of alkaline phosphatase and ecto-5'-nucleotidase.

    PubMed

    Channar, Pervaiz Ali; Shah, Syed Jawad Ali; Hassan, Sidra; Nisa, Zaib Un; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen; Saeed, Aamer; Iqbal, Jamshed

    2017-03-01

    A series of isonicotinohydrazide derivatives was synthesized and tested against recombinant human and rat ecto-5'-nucleotidases (h-e5'NT and r-e5'NT) and alkaline phosphatase isozymes including both bovine tissue-non-specific alkaline phosphatase (b-TNAP) and tissue-specific calf intestinal alkaline phosphatase (c-IAP). These enzymes are implicated in vascular calcifications, hypophosphatasia, solid tumors, and cancers, such as colon, lung, breast, pancreas, and ovary. All tested compounds were active against both enzymes. The most potent inhibitor of h-e5'NT was derivative (E)-N'-(1-(3-(4-fluorophenyl)-5-phenyl-4,5-dihydro-1H-pyrazol-1-yl)ethylidene)isonicotinohydrazide (3j), whereas derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) exhibited significant inhibitory activity against r-e5'NT. In addition, the derivative (E)-N'-(4'-chlorobenzylidene)isonicotinohydrazide (3a) was most potent inhibitor against calf intestinal alkaline phosphatase and the derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) was found to be most potent inhibitor of bovine tissue-non-specific alkaline phosphatase. Furthermore, putative binding modes of potent compounds against e5'NT (human and rat e5'NT) and AP (including b-TNAP and c-IAP) were determined computationally. © 2016 John Wiley & Sons A/S.

  15. Defining hypercalciuria in nephrolithiasis

    PubMed Central

    Pak, Charles Y.C.; Sakhaee, Khashayar; Moe, Orson W.; Poindexter, John; Adams-Huet, Beverley

    2014-01-01

    The classic definition of hypercalciuria, an upper normal limit of 200 mg/day, is based on a constant diet restricted in calcium, sodium, and animal protein; however, random diet data challenge this. Here our retrospective study determined the validity of the classic definition of hypercalciuria by comparing data from 39 publications analyzing urinary calcium excretion on a constant restricted diet and testing whether hypercalciuria could be defined when extraneous dietary influences were controlled. These papers encompassed 300 non-stone-forming patients, 208 patients with absorptive hypercalciuria type I (presumed due to high intestinal calcium absorption), and 234 stone formers without absorptive hypercalciuria; all evaluated on a constant restricted diet. In non-stone formers, the mean urinary calcium was well below 200 mg/day, and the mean for all patients was 127±46 mg/day with an upper limit of 219 mg/day. In absorptive hypercalciuria type I, the mean urinary calcium significantly exceeded 200 mg/day in all studies with a combined mean of 259±55 mg/day. Receiver operating characteristic curve analysis showed the optimal cutoff point for urinary calcium excretion was 172 mg/day on a restricted diet, a value that approximates the traditional limit of 200 mg/day. Thus, on a restricted diet, a clear demarcation was seen between urinary calcium excretion of kidney stone formers with absorptive hypercalciuria type I and normal individuals. When dietary variables are controlled, the classic definition of hypercalciuria of nephrolithiasis appears valid. PMID:21775970

  16. Defining equity in health

    PubMed Central

    Braveman, P; Gruskin, S

    2003-01-01

    Study objective: To propose a definition of health equity to guide operationalisation and measurement, and to discuss the practical importance of clarity in defining this concept. Design: Conceptual discussion. Setting, Patients/Participants, and Main results: not applicable. Conclusions: For the purposes of measurement and operationalisation, equity in health is the absence of systematic disparities in health (or in the major social determinants of health) between groups with different levels of underlying social advantage/disadvantage—that is, wealth, power, or prestige. Inequities in health systematically put groups of people who are already socially disadvantaged (for example, by virtue of being poor, female, and/or members of a disenfranchised racial, ethnic, or religious group) at further disadvantage with respect to their health; health is essential to wellbeing and to overcoming other effects of social disadvantage. Equity is an ethical principle; it also is consonant with and closely related to human rights principles. The proposed definition of equity supports operationalisation of the right to the highest attainable standard of health as indicated by the health status of the most socially advantaged group. Assessing health equity requires comparing health and its social determinants between more and less advantaged social groups. These comparisons are essential to assess whether national and international policies are leading toward or away from greater social justice in health. PMID:12646539

  17. Defining Neonatal Sepsis

    PubMed Central

    Wynn, James L.

    2016-01-01

    Purpose of the review Although infection rates have modestly decreased in the neonatal intensive care unit (NICU) as a result of ongoing quality improvement measures, neonatal sepsis remains a frequent and devastating problem among hospitalized preterm neonates. Despite multiple attempts to address this unmet need, there have been minimal advances in clinical management, outcomes, and accuracy of diagnostic testing options over the last three decades. One strong contributor to a lack of medical progress is a variable case definition of disease. The inability to agree on a precise definition greatly reduces the likelihood of aligning findings from epidemiologists, clinicians, and researchers, which, in turn, severely hinders progress towards improving outcomes. Recent findings Pediatric consensus definitions for sepsis are not accurate in term infants and are not appropriate for preterm infants. In contrast to the defined multi-stage criteria for other devastating diseases encountered in the NICU (e.g., bronchopulmonary dysplasia), there is significant variability in the criteria used by investigators to substantiate the diagnosis of neonatal sepsis. Summary The lack of an accepted consensus definition for neonatal sepsis impedes our efforts towards improved diagnostic and prognostic options as well as accurate outcomes information for this vulnerable population. PMID:26766602

  18. Enzymatic study of tonsil tissue alkaline and acid phosphatase in children with recurrent tonsillitis and tonsil hypertrophy.

    PubMed

    Jesic, Snezana; Stojiljkovic, Ljuba; Stosic, Svetlana; Nesic, Vladimir; Milovanovic, Jovica; Jotic, Ana

    2010-01-01

    Indications for tonsillectomy in recurrent tonsillitis are defined according to the number of episodes of acute bacterial infections in a year. However, little is known about the tonsil immune competence status in patients presenting with recurrent tonsillitis with either hypertrophied or atrophied tonsils, or in patients presenting with obstructive sleep apnoea. In this study we examined the tonsil immune status in children with 3-5 acute recurrent infections a year and in children with obstructive sleep apnoea by comparing the activity of tonsil and adenoid tissue nonspecific alkaline and acid phosphatase. Specific activity of tonsil and adenoid tissue nonspecific alkaline and acid phosphatase was investigated in children who underwent tonsillectomy and adenoidectomy for recurrent infection (72 children) and for obstructive sleep apnoea (10 children). Tissue enzyme activities were measured using p-nitrophenylphosphate as a substrate. Tissue samples were examined by the haematoxylin-eosin histological technique. Statistical analyses were performed using SPSS v. 16 software. The tissue nonspecific alkaline phosphatase activity was similar in hypertrophied tonsils in the recurrent infection group and in the obstructive sleep apnoea group (3.437+/-1.226 and 3.978+/-0.762 U/mg of protein, respectively). The enzyme activity in both hypertrophied tonsil groups was significantly higher as compared to atrophied tonsils in the recurrent tonsillitis group, p=0.021 and p=0.006, respectively. The enzyme activity was significantly higher in the adenoids compared to the tonsils from all three groups. Contrary to this, no significant differences were noticed for tonsil and adenoid acid phosphatase activities among the groups. Similar acid phosphatase activity in all three groups implies that all three groups have preserved antigen presenting cell activity. In patients with hypertrophied tonsils similar tissue nonspecific alkaline phosphatase activity suggests preserved B cell

  19. Purple acid phosphatase in the walls of tobacco cells.

    PubMed

    Kaida, Rumi; Hayashi, Takahisa; Kaneko, Takako S

    2008-10-01

    Purple acid phosphatase isolated from the walls of tobacco cells appears to be a 220kDa homotetramer composed of 60kDa subunits, which is purple in color and which contains iron as its only metal ion. Although the phosphatase did not require dithiothreitol for activity and was not inhibited by phenylarsine oxide, the enzyme showed a higher catalytic efficiency (k(cat)/K(m)) for phosphotyrosine-containing peptides than for other substrates including p-nitrophenyl-phosphate and ATP. The phosphatase formed as a 120kDa dimer in the cytoplasm and as a 220kDa tetramer in the walls, where Brefeldin A blocked its secretion during wall regeneration. According to our double-immunofluorescence labeling results, the enzyme might be translocated through the Golgi apparatus to the walls at the interphase and to the cell plate during cytokinesis.

  20. Phosphatase Wip1 in Immunity: An Overview and Update

    PubMed Central

    Shen, Xiao-Fei; Zhao, Yang; Jiang, Jin-Peng; Guan, Wen-Xian; Du, Jun-Feng

    2017-01-01

    Wild-type p53-induced phosphatase 1 (Wip1) is a newly identified serine/threonine phosphatase, which belongs to the PP2C family. Due to its involvement in stress-induced networks and overexpression in human tumors, primary studies have mainly focused on the role of Wip1 in tumorigenesis. It now has also been implicated in regulating several other physiological processes such as organism aging and neurogenesis. Recent evidence highlights a new role of Wip1 in controlling immune response through regulating immune cell development and function, as well as through the interplay with inflammatory signaling pathways such NF-κB and p38 mitogen-activated protein kinase. In this short review, we will give an overview of Wip1 in immunity to better understand this important phosphatase. PMID:28144241

  1. Phosphoserine phosphatase deficiency in a patient with Williams syndrome.

    PubMed Central

    Jaeken, J; Detheux, M; Fryns, J P; Collet, J F; Alliet, P; Van Schaftingen, E

    1997-01-01

    Decreased serine levels were found in plasma and cerebrospinal fluid (CSF) of a boy with pre- and postnatal growth retardation, moderate psychomotor retardation, and facial dysmorphism suggestive of Williams syndrome. Fluorescence in situ hybridisation with an elastin gene probe indicated the presence of a submicroscopic 7q11.23 deletion, confirming this diagnosis. Further investigation showed that the phosphoserine phosphatase (EC 3.1.3.3.) activity in lymphoblasts and fibroblasts amounted to about 25% of normal values. Oral serine normalised the plasma and CSF levels of this amino acid and seemed to have some clinical effect. These data suggest that the elastin gene and the phosphoserine phosphatase gene might be closely linked. This seems to be the first report of phosphoserine phosphatase deficiency. PMID:9222972

  2. Inositol 5-phosphatases: insights from the Lowe syndrome protein OCRL.

    PubMed

    Pirruccello, Michelle; De Camilli, Pietro

    2012-04-01

    The precise regulation of phosphoinositide lipids in cellular membranes is crucial for cellular survival and function. Inositol 5-phosphatases have been implicated in a variety of disorders, including various cancers, obesity, type 2 diabetes, neurodegenerative diseases and rare genetic conditions. Despite the obvious impact on human health, relatively little structural and biochemical information is available for this family. Here, we review recent structural and mechanistic work on the 5-phosphatases with a focus on OCRL, whose loss of function results in oculocerebrorenal syndrome of Lowe and Dent 2 disease. Studies of OCRL emphasize how the actions of 5-phosphatases rely on both intrinsic and extrinsic membrane recognition properties for full catalytic function. Additionally, structural analysis of missense mutations in the catalytic domain of OCRL provides insight into the phenotypic heterogeneity observed in Lowe syndrome and Dent disease.

  3. [Interaction of two tumor suppressors: Phosphatase CTDSPL and Rb protein].

    PubMed

    Beniaminov, A D; Krasnov, G S; Dmitriev, A A; Puzanov, G A; Snopok, B A; Senchenko, V N; Kashuba, V I

    2016-01-01

    Earlier we established that CTDSPL gene encoding small carboxy-terminal domain serine phosphatase can be considered a classical tumor suppressor gene. Besides, transfection of tumor cell line MCF-7 with CTDSPL led to the content decrease of inactive phosphorylated form of another tumor suppressor, retinoblastoma protein (Rb), and subsequently to cell cycle arrest at the G1/S boundary. This result implied that small phosphatase CTDSPL is able to specifically dephosphorylate and activate Rb protein. In order to add some fuel to this hypothesis, in the present work we studied the interaction of two tumor suppressors CTDSPL and Rb in vitro. GST pool-down assay revealed that CTDSPL is able to precipitate Rb protein from MCF-7 cell extracts, while surface plasmon resonance technique showed that interaction of the two proteins is direct. Results of this study reassert that phosphatase CTDSPL and Rb could be involved in the common mechanism of cell cycle regulation.

  4. Applying a Targeted Label-free Approach using LC-MS AMT Tags to Evaluate Changes in Protein Phosphorylation Following Phosphatase Inhibition

    SciTech Connect

    Yang, Feng; Jaitly, Navdeep; Jayachandran, Hemalatha; Lou, Quanzhou; Monroe, Matthew E.; Du, Xiuxia; Gritsenko, Marina A.; Zhang, Rui; Anderson, David J.; Purvine, Samuel O.; Adkins, Joshua N.; Moore, Ronald J.; Mottaz, Heather M.; Ding, Shi-Jian; Lipton, Mary S.; Camp, David G.; Udseth, Harold R.; Smith, Richard D.; Rossie, Sandra S.

    2007-10-12

    To identify phosphoproteins regulated by the phosphoprotein phosphatase (PPP) family of S/T phosphatases, we performed a large-scale characterization of changes in protein phosphorylation on extracts from HeLa cells treated with or without calyculin A, a potent PPP enzyme inhibitor. A label-free comparative Phosphoproteomics approach using immobilized metal ion affinity chromatography and targeted tandem mass spectrometry was employed to discover and identify signatures based upon distinctive changes in abundance. Overall, 232 proteins were identified as either direct or indirect targets for PPP enzyme regulation. Most of the present identifications represent novel PPP enzyme targets at the level of both phosphorylation site and protein. These include phosphorylation sites within signaling proteins such as p120 Catenin, A Kinase Anchoring Protein 8, JunB, and Type II Phosphatidyl Inositol 4 Kinase. These data can be used to define underlying signaling pathways and events regulated by the PPP family of S/T phosphatases.

  5. Applying a targeted label-free approach using LC-MS AMT tags to evaluate changes in protein phosphorylation following phosphatase inhibition.

    PubMed

    Yang, Feng; Jaitly, Navdeep; Jayachandran, Hemalatha; Luo, Quanzhou; Monroe, Matthew E; Du, Xiuxia; Gritsenko, Marina A; Zhang, Rui; Anderson, David J; Purvine, Samuel O; Adkins, Joshua N; Moore, Ronald J; Mottaz, Heather M; Ding, Shi-Jian; Lipton, Mary S; Camp, David G; Udseth, Harold R; Smith, Richard D; Rossie, Sandra

    2007-11-01

    To identify phosphoproteins regulated by the phosphoprotein phosphatase (PPP) family of S/T phosphatases, we performed a large-scale characterization of changes in protein phosphorylation on extracts from HeLa cells treated with or without calyculin A, a potent PPP enzyme inhibitor. A label-free comparative phosphoproteomics approach using immobilized metal ion affinity chromatography and targeted tandem mass spectrometry was employed to discover and identify signatures based upon distinctive changes in abundance. Overall, 232 proteins were identified as either direct or indirect targets for PPP enzyme regulation. Most of the present identifications represent novel PPP enzyme targets at the level of both phosphorylation site and protein. These include phosphorylation sites within signaling proteins such as p120 Catenin, A Kinase Anchoring Protein 8, JunB, and Type II Phosphatidyl Inositol 4 Kinase. These data can be used to define underlying signaling pathways and events regulated by the PPP family of S/T phosphatases.

  6. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    SciTech Connect

    V Parashar; N Mirouze; D Dubnau; M Neiditch

    2011-12-31

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic 'switch' residue to an internal position when the {beta}4-{alpha}4 loop adopts an active-site proximal conformation.

  7. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    PubMed Central

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A.; Neiditch, Matthew B.

    2011-01-01

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic “switch” residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation. PMID:21346797

  8. Structural basis of response regulator dephosphorylation by Rap phosphatases.

    PubMed

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A; Neiditch, Matthew B

    2011-02-08

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic "switch" residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation.

  9. MDP-1: A novel eukaryotic magnesium-dependent phosphatase.

    PubMed

    Selengut, J D; Levine, R L

    2000-07-18

    We report here the purification, cloning, expression, and characterization of a novel phosphatase, MDP-1. In the course of investigating the reported acid phosphatase activity of carbonic anhydrase III preparations, several discrete phosphatases were discerned. One of these, a magnesium-dependent species of 18.6 kDa, was purified to homogeneity and yielded several peptide sequences from which the parent gene was identified by database searching. Although orthologous genes were identified in fungi and plants as well as mammalian species, there was no apparent homology to any known family of phosphatases. The enzyme was expressed in Escherichia coli with a fusion tag and purified by affinity methods. The recombinant enzyme showed magnesium-dependent acid phosphatase activity comparable to the originally isolated rabbit protein. The enzyme catalyzes the rapid hydrolysis of p-nitrophenyl phosphate, ribose-5-phosphate, and phosphotyrosine. The selectivity for phosphotyrosine over phosphoserine or phosphothreonine is considerable, but the enzyme did not show activity toward five phosphotyrosine-containing peptides. None of the various substrates assayed (including various nucleotide, sugar, amino acid and peptide phosphates, phosphoinositides, and phosphodiesters) exhibited K(M) values lower than 1 mM, and many showed negligible rates of hydrolysis. The enzyme is inhibited by vanadate and fluoride but not by azide, cyanide, calcium, lithium, or tartaric acid. Chemical labeling, refolding, dialysis, and mutagenesis experiments suggest that the enzymatic mechanism is not dependent on cysteine, histidine, or nonmagnesium metal ions. In recognition of these observations, the enzyme has been given the name magnesium-dependent phosphatase-1 (MDP-1).

  10. Phosphatase inhibitors with anti-angiogenic effect in vitro.

    PubMed

    Sylvest, Lene; Bendiksen, Christine Dam; Houen, Gunnar

    2010-01-01

    Levamisole has previously been identified as an inhibitor of angiogenesis in vitro and in vivo, but the mechanism behind the anti-angiogenic behavior has not yet been established. However, one known effect of levamisole is the inhibition of alkaline phosphatase, and this fact encouraged us to test other phosphatase inhibitors for their anti-angiogenic effects by using the same method as used to identify levamisole: an ELISA-based co-culture angiogenesis assay giving quantitative and qualitative results. Historically, intracellular phosphatases have been associated with the downregulation of signaling pathways, and kinases with their upregulation, but lately, the phospatases have also been coupled to positive signaling, which is why inhibition of phosphatases has become associated with anti-tumorigenic and anti-angiogenic effects. The results obtained in this work reveal several agents with anti-angiogenic potential and give a strong indication that phosphatase inhibition is linked to anti-angiogenic activity. An apparent disruption of endothelial tube formation was seen for seven of eight phosphatase inhibitors tested in the angiogenesis assay. By looking at the morphological results, it was seen that most of the inhibitors impaired proliferation and elongation of the endothelial cells, which still had a differentiated appearance. One inhibitor, PTP inhibitor IV, seemed to impair endothelial cell differentiation and induced the same morphology as when cells were treated with levamisole, although at a 200 times lower concentration than that of levamisole. Hence, our work points out compounds with a potential that may be of use in the search for new medical products for the treatment of malignant tumors, or other conditions where angiogenesis plays a central role.

  11. Phosphatase activity on the cell wall of Fonsecaea pedrosoi.

    PubMed

    Kneipp, L F; Palmeira, V F; Pinheiro, A A S; Alviano, C S; Rozental, S; Travassos, L R; Meyer-Fernandes, J R

    2003-12-01

    The activity of a phosphatase was characterized in intact mycelial forms of Fonsecaea pedrosoi, a pathogenic fungus that causes chromoblastomycosis. At pH 5.5, this fungus hydrolyzed p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 12.78 +/- 0.53 nmol p-NP per h per mg hyphal dry weight. The values of Vmax and apparent Km for p-NPP hydrolyses were measured as 17.89 +/- 0.92 nmol p-NP per h per mg hyphal dry weight and 1.57 +/- 0.26 mmol/l, respectively. This activity was inhibited at increased pH, a finding compatible with an acid phosphatase. The enzymatic activity was strongly inhibited by classical inhibitors of acid phosphatases such as sodium orthovanadate (Ki = 4.23 micromol/l), sodium molybdate (Ki = 7.53 micromol/l) and sodium fluoride (Ki = 126.78 micromol/l) in a dose-dependent manner. Levamizole (1 mmol/l) and sodium tartrate (10 mmol/l), had no effect on the enzyme activity. Cytochemical localization of the acid phosphatase showed electrondense cerium phosphate deposits on the cell wall, as visualized by transmission electron microscopy. Phosphatase activity in F. pedrosoi seems to be associated with parasitism, as sclerotic cells, which are the fungal forms mainly detected in chromoblastomycosis lesions, showed much higher activities than conidia and mycelia did. A strain of F. pedrosoi recently isolated from a human case of chromoblastomycosis also showed increased enzyme activity, suggesting that the expression of surface phosphatases may be stimulated by interaction with the host.

  12. Counter-regulatory phosphatases TNAP and NPP1 temporally regulate tooth root cementogenesis

    PubMed Central

    Zweifler, Laura E; Patel, Mudita K; Nociti, Francisco H; Wimer, Helen F; Millán, Jose L; Somerman, Martha J; Foster, Brian L

    2015-01-01

    Cementum is critical for anchoring the insertion of periodontal ligament fibers to the tooth root. Several aspects of cementogenesis remain unclear, including differences between acellular cementum and cellular cementum, and between cementum and bone. Biomineralization is regulated by the ratio of inorganic phosphate (Pi) to mineral inhibitor pyrophosphate (PPi), where local Pi and PPi concentrations are controlled by phosphatases including tissue-nonspecific alkaline phosphatase (TNAP) and ectonucleotide pyrophosphatase/phosphodiesterase 1 (NPP1). The focus of this study was to define the roles of these phosphatases in cementogenesis. TNAP was associated with earliest cementoblasts near forming acellular and cellular cementum. With loss of TNAP in the Alpl null mouse, acellular cementum was inhibited, while cellular cementum production increased, albeit as hypomineralized cementoid. In contrast, NPP1 was detected in cementoblasts after acellular cementum formation, and at low levels around cellular cementum. Loss of NPP1 in the Enpp1 null mouse increased acellular cementum, with little effect on cellular cementum. Developmental patterns were recapitulated in a mouse model for acellular cementum regeneration, with early TNAP expression and later NPP1 expression. In vitro, cementoblasts expressed Alpl gene/protein early, whereas Enpp1 gene/protein expression was significantly induced only under mineralization conditions. These patterns were confirmed in human teeth, including widespread TNAP, and NPP1 restricted to cementoblasts lining acellular cementum. These studies suggest that early TNAP expression creates a low PPi environment promoting acellular cementum initiation, while later NPP1 expression increases PPi, restricting acellular cementum apposition. Alterations in PPi have little effect on cellular cementum formation, though matrix mineralization is affected. PMID:25504209

  13. Molecular Mechanisms Underlying Cardiac Protein Phosphatase 2A Regulation in Heart*

    PubMed Central

    DeGrande, Sean T.; Little, Sean C.; Nixon, Derek J.; Wright, Patrick; Snyder, Jedidiah; Dun, Wen; Murphy, Nathaniel; Kilic, Ahmet; Higgins, Robert; Binkley, Philip F.; Boyden, Penelope A.; Carnes, Cynthia A.; Anderson, Mark E.; Hund, Thomas J.; Mohler, Peter J.

    2013-01-01

    Kinase/phosphatase balance governs cardiac excitability in health and disease. Although detailed mechanisms for cardiac kinase regulation are established, far less is known regarding cardiac protein phosphatase 2A (PP2A) regulation. This is largely due to the complexity of the PP2A holoenzyme structure (combinatorial assembly of three subunit enzyme from >17 subunit genes) and the inability to segregate “global” PP2A function from the activities of multiple “local” holoenzyme populations. Here we report that PP2A catalytic, regulatory, and scaffolding subunits are tightly regulated at transcriptional, translational, and post-translational levels to tune myocyte function at base line and in disease. We show that past global read-outs of cellular PP2A activity more appropriately represent the collective activity of numerous individual PP2A holoenzymes, each displaying a specific subcellular localization (dictated by select PP2A regulatory subunits) as well as local specific post-translational catalytic subunit methylation and phosphorylation events that regulate local and rapid holoenzyme assembly/disassembly (via leucine carboxymethyltransferase 1/phosphatase methylesterase 1 (LCMT-1/PME-1). We report that PP2A subunits are selectively regulated between human and animal models, across cardiac chambers, and even within specific cardiac cell types. Moreover, this regulation can be rapidly tuned in response to cellular activation. Finally, we report that global PP2A is altered in human and experimental models of heart disease, yet each pathology displays its own distinct molecular signature though specific PP2A subunit modulatory events. These new data provide an initial view into the signaling pathways that govern PP2A function in heart but also establish the first step in defining specific PP2A regulatory targets in health and disease. PMID:23204520

  14. Alkaline phosphatase predicts response in polycystic liver disease during somatostatin analogue therapy: a pooled analysis.

    PubMed

    Gevers, Tom J G; Nevens, Frederik; Torres, Vicente E; Hogan, Marie C; Drenth, Joost P H

    2016-04-01

    Somatostatin analogues reduce liver volumes in polycystic liver disease. However, patients show considerable variability in treatment responses. Our aim was to identify specific patient, disease or treatment characteristics that predict response in polycystic liver disease during somatostatin analogue therapy. We pooled the individual patient data of four trials that evaluated long-acting somatostatin analogues (120 mg lanreotide or 40 mg octreotide) for 6-12 months in polycystic liver disease patients. We performed uni- and multivariate linear regression analysis with preselected patient, disease and drug variables to identify independent predictors of response, defined as per cent change in liver or kidney volume (in ADPKD subgroup). All analyses were adjusted for baseline liver volume and centre. We included 153 polycystic liver disease patients (86% female, median liver volume 4974 ml) from three international centres, all treated with octreotide (n = 70) or lanreotide (n = 83). Mean reduction in liver volume was 4.4% (range -31.6 to +9.4%). Multivariate linear regression revealed that elevated baseline alkaline phosphatase was associated with increased liver volume reduction during therapy (-2.7%, 95% CI -5.1 to -0.2%, P = 0.04), independently of baseline liver volume. Somatostatin analogue type, underlying diagnosis and eGFR did not affect response. In our ADPKD subpopulation (n = 100), elevated alkaline phosphatase predicted liver volume reduction (-3.2%, P = 0.03) but did not predict kidney volume reduction (+0.1%, P = 0.97). Total gastro-intestinal symptom severity decreased with therapy in a subgroup analysis (n = 95; P < 0.001). Alkaline phosphatase is a liver-specific, independent predictor of response in polycystic liver disease during somatostatin analogue therapy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Phosphotyrosine as a substrate of acid and alkaline phosphatases.

    PubMed

    Apostoł, I; Kuciel, R; Wasylewska, E; Ostrowski, W S

    1985-01-01

    A new spectrophotometric method for following dephosphorylation of phosphotyrosine has been described. The absorption spectra of phosphotyrosine and tyrosine were plotted over the pH range from 3 to 9. The change in absorbance accompanying the conversion of phosphotyrosine to tyrosine was the greatest at 286 nm. The difference absorption coefficients were calculated for several pH values. Dephosphorylation of phosphotyrosine by acid phosphatases from human prostate gland, from wheat germ and potatoes obeys the Michaelis-Menten equation, whereas alkaline phosphatases calf intestine and E. coli are inhibited by excess of substrate.

  16. Effect of vanadium compounds on acid phosphatase activity.

    PubMed

    Vescina, C M; Sálice, V C; Cortizo, A M; Etcheverry, S B

    1996-01-01

    The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activity seems to depend on the geometry around the vanadium atom more than on the oxidation state. Our results indicate a correlation between the PTPase activity and the sensitivity to vanadate and vanadyl cation.

  17. Reduced expression of CD45 Protein-Tyrosine Phosphatase Pr

    DTIC Science & Technology

    2009-05-08

    complex ( MHC ) I (28-14-8), MHC II (M5/114.15.2), CD44 (IM7), and Ly6G (1A8). Cells (1 106) were resuspended in Fc block (anti CD16/CD32 antibody diluted...enzyme (supplemental Fig. 3). Themajority of the phosphatases tested in this panel belong to the class of protein-tyrosine phosphatases (SHP-1, SHP- 2 ...and Sina Bavari‡ 2 From the ‡United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland 21702-5011, §Target Structure

  18. Comparative studies of rat recombinant purple acid phosphatase and bone tartrate-resistant acid phosphatase.

    PubMed

    Ek-Rylander, B; Barkhem, T; Ljusberg, J; Ohman, L; Andersson, K K; Andersson, G

    1997-01-15

    The tartrate-resistant acid phosphatase (TRAP) of rat osteoclasts has been shown to exhibit high (85-94%) identity at the amino acid sequence level with the purple acid phosphatase (PAP) from bovine spleen and with pig uteroferrin. These iron-containing purple enzymes contain a binuclear iron centre, with a tyrosinate-to-Fe(III) charge-transfer transition responsible for the purple colour. In the present study, production of rat osteoclast TRAP could be achieved at a level of 4.3 mg/litre of medium using a baculovirus expression system. The enzyme was purified to apparent homogeneity using a combination of cation-exchange, hydrophobic-interaction, lectin-affinity and gel-permeation chromatography steps. The protein as isolated had a purple colour, a specific activity of 428 units/mg of protein and consisted of the single-chain form of molecular mass 34 kDa, with only trace amounts of proteolytically derived subunits. The recombinant enzyme had the ability to dephosphorylate bone matrix phosphoproteins, as previously shown for bone TRAP. Light absorption spectroscopy of the isolated purple enzyme showed a lambda max at 544 nm, which upon reduction with ascorbic acid changed to 515 nm, concomitant with the transition to a pink colour. EPR spectroscopic analysis of the reduced enzyme at 3.6 K revealed a typical mu-hydr(oxo)-bridged mixed-valent Fe(II)Fe(III) signal with g-values at 1.96, 1.74 and 1.60, proving that recombinant rat TRAP belongs to the family of PAPs. To validate the use of recombinant PAP in substituting for the rat bone counterpart in functional studies, various comparative studies were carried out. The enzyme isolated from bone exhibited a lower K(m) for p-nitrophenyl phosphate and was slightly more sensitive to PAP inhibitors such as molybdate, tungstate, arsenate and phosphate. In contrast with the recombinant enzyme, TRAP from bone was isolated predominantly as the proteolytically cleaved, two-subunit, form. Both the recombinant enzyme and rat

  19. Purinergic Receptor-mediated Rapid Depletion of Nuclear Phosphorylated Akt Depends on Pleckstrin Homology Domain Leucine-rich Repeat Phosphatase, Calcineurin, Protein Phosphatase 2A, and PTEN Phosphatases*

    PubMed Central

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-01-01

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3–5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21cip1 complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle. PMID:20605778

  20. Purinergic receptor-mediated rapid depletion of nuclear phosphorylated Akt depends on pleckstrin homology domain leucine-rich repeat phosphatase, calcineurin, protein phosphatase 2A, and PTEN phosphatases.

    PubMed

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-09-03

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3-5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21(cip1) complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle.

  1. The Escherichia coli pgpB gene encodes for a diacylglycerol pyrophosphate phosphatase activity.

    PubMed

    Dillon, D A; Wu, W I; Riedel, B; Wissing, J B; Dowhan, W; Carman, G M

    1996-11-29

    We provided genetic and biochemical evidence that supported the conclusion that the product of pgpB gene of Escherichia coli exhibited diacylglycerol pyrophosphate (DGPP) phosphatase activity. DGPP phosphatase activity was absent in pgpB mutant cells and was expressed at high levels in cells carrying the wild-type pgpB gene on a runaway replication plasmid. The pgpB mutant has been primarily characterized by a defect in phosphatidate (PA) phosphatase activity and also exhibits defects in lyso-PA phosphatase and phosphatidylglycerophosphate phosphatase activities. The defective PA phosphatase in the pgpB mutant was shown to be a Mg2+-independent PA phosphatase activity of the DGPP phosphatase enzyme. We characterized DGPP phosphatase activity in membranes from cells overproducing the pgpB gene product. DGPP phosphatase catalyzed the dephosphorylation of the beta phosphate of DGPP to form PA followed by the dephosphorylation of PA to form diacylglycerol. The specificity constant (Vmax/Km) for DGPP was 9.3-fold greater than that for PA. The pH optimum for the DGPP phosphatase reaction was 6. 5. Activity was independent of a divalent cation requirement, was potently inhibited by Mn2+ ions, and was insensitive to inhibition by N-ethylmaleimide. Pure DGPP phosphatase from Saccharomyces cerevisiae was shown to be similar to the E. coli DGPP phosphatase in its ability to utilize lyso-PA and phosphatidylglycerophosphate as substrates in vitro.

  2. Two membrane-associated tyrosine phosphatase homologs potentiate C. elegans AKT-1/PKB signaling.

    PubMed

    Hu, Patrick J; Xu, Jinling; Ruvkun, Gary

    2006-07-01

    Akt/protein kinase B (PKB) functions in conserved signaling cascades that regulate growth and metabolism. In humans, Akt/PKB is dysregulated in diabetes and cancer; in Caenorhabditis elegans, Akt/PKB functions in an insulin-like signaling pathway to regulate larval development. To identify molecules that modulate C. elegans Akt/PKB signaling, we performed a genetic screen for enhancers of the akt-1 mutant phenotype (eak). We report the analysis of three eak genes. eak-6 and eak-5/sdf-9 encode protein tyrosine phosphatase homologs; eak-4 encodes a novel protein with an N-myristoylation signal. All three genes are expressed primarily in the two endocrine XXX cells, and their predicted gene products localize to the plasma membrane. Genetic evidence indicates that these proteins function in parallel to AKT-1 to inhibit the FoxO transcription factor DAF-16. These results define two membrane-associated protein tyrosine phosphatase homologs that may potentiate C. elegans Akt/PKB signaling by cell autonomous and cell nonautonomous mechanisms. Similar molecules may modulate Akt/PKB signaling in human endocrine tissues.

  3. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Rémi; Balmant, Kelly; Ziemak, Michael J.; Shanklin, John; de Crécy-Lagard, Valérie; Fiehn, Oliver; Gregory, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexei; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in both prokaryotes and eukaryotes, but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), with subfamily II being split into stand-alone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metal-dependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  4. Characterization of MTMR3. an inositol lipid 3-phosphatase with novel substrate specificity.

    PubMed

    Walker, D M; Urbé, S; Dove, S K; Tenza, D; Raposo, G; Clague, M J

    2001-10-16

    Inositol lipids play key roles in many fundamental cellular processes that include growth, cell survival, motility, and membrane trafficking. Recent studies on the PTEN and Myotubularin proteins have underscored the importance of inositol lipid 3-phosphatases in cell function. Inactivating mutations in the genes encoding PTEN and Myotubularin are key steps in the progression of some cancers and in the onset of X-linked myotubular myopathy, respectively. Myotubularin-related protein 3 (MTMR3) shows extensive homology to Myotubularin, including the catalytic domain, but additionally possesses a C-terminal extension that includes a FYVE domain. We show that MTMR3 is an inositol lipid 3-phosphatase, with a so-far-unique substrate specificity. It is able to hydrolyze PtdIns3P and PtdIns3,5P2, both in vitro and when heterologously expressed in S. cerevisiae, and to thereby provide the first clearly defined route for the cellular production of PtdIns5P. Overexpression of a catalytically dead MTMR3 (C413S) in mammalian cells induces a striking formation of vacuolar compartments that enclose membranous structures that are highly concentrated in mutant proteins.

  5. A family of metal-dependent phosphatases implicated in metabolite damage-control

    DOE PAGES

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; ...

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed amore » novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.« less

  6. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Remi; Balmant, Kelly; Ziemak, Michael J.; de Crecy-Lagard, Valerie; Fiehn, Oliver; Gregory, III, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexie; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  7. Cdc14 phosphatases preferentially dephosphorylate a subset of cyclin-dependent kinase (Cdk) sites containing phosphoserine.

    PubMed

    Bremmer, Steven C; Hall, Hana; Martinez, Juan S; Eissler, Christie L; Hinrichsen, Thomas H; Rossie, Sandra; Parker, Laurie L; Hall, Mark C; Charbonneau, Harry

    2012-01-13

    Mitotic cell division is controlled by cyclin-dependent kinases (Cdks), which phosphorylate hundreds of protein substrates responsible for executing the division program. Cdk inactivation and reversal of Cdk-catalyzed phosphorylation are universal requirements for completing and exiting mitosis and resetting the cell cycle machinery. Mechanisms that define the timing and order of Cdk substrate dephosphorylation remain poorly understood. Cdc14 phosphatases have been implicated in Cdk inactivation and are thought to be generally specific for Cdk-type phosphorylation sites. We show that budding yeast Cdc14 possesses a strong and unusual preference for phosphoserine over phosphothreonine at Pro-directed sites in vitro. Using serine to threonine substitutions in the Cdk consensus sites of the Cdc14 substrate Acm1, we demonstrate that phosphoserine specificity exists in vivo. Furthermore, it appears to be a conserved property of all Cdc14 family phosphatases. An invariant active site residue was identified that sterically restricts phosphothreonine binding and is largely responsible for phosphoserine selectivity. Optimal Cdc14 substrates also possessed a basic residue at the +3 position relative to the phosphoserine, whereas substrates lacking this basic residue were not effectively hydrolyzed. The intrinsic selectivity of Cdc14 may help establish the order of Cdk substrate dephosphorylation during mitotic exit and contribute to roles in other cellular processes.

  8. Sensing and signaling of oxidative stress in chloroplasts by inactivation of the SAL1 phosphoadenosine phosphatase

    PubMed Central

    Mabbitt, Peter D.; Phua, Su Yin; Mueller, Jonathan W.; Nisar, Nazia; Gigolashvili, Tamara; Stroeher, Elke; Grassl, Julia; Arlt, Wiebke; Estavillo, Gonzalo M.; Jackson, Colin J.; Pogson, Barry J.

    2016-01-01

    Intracellular signaling during oxidative stress is complex, with organelle-to-nucleus retrograde communication pathways ill-defined or incomplete. Here we identify the 3′-phosphoadenosine 5′-phosphate (PAP) phosphatase SAL1 as a previously unidentified and conserved oxidative stress sensor in plant chloroplasts. Arabidopsis thaliana SAL1 (AtSAL1) senses changes in photosynthetic redox poise, hydrogen peroxide, and superoxide concentrations in chloroplasts via redox regulatory mechanisms. AtSAL1 phosphatase activity is suppressed by dimerization, intramolecular disulfide formation, and glutathionylation, allowing accumulation of its substrate, PAP, a chloroplast stress retrograde signal that regulates expression of plastid redox associated nuclear genes (PRANGs). This redox regulation of SAL1 for activation of chloroplast signaling is conserved in the plant kingdom, and the plant protein has evolved enhanced redox sensitivity compared with its yeast ortholog. Our results indicate that in addition to sulfur metabolism, SAL1 orthologs have evolved secondary functions in oxidative stress sensing in the plant kingdom. PMID:27432987

  9. Attenuated virulence of a Francisella mutant lacking the lipid A 4′-phosphatase

    PubMed Central

    Wang, Xiaoyuan; Ribeiro, Anthony A.; Guan, Ziqiang; Abraham, Soman N.; Raetz, Christian R. H.

    2007-01-01

    Francisella tularensis causes tularemia, a highly contagious disease of animals and humans, but the virulence features of F. tularensis are poorly defined. F. tularensis and the related mouse pathogen Francisella novicida synthesize unusual lipid A molecules lacking the 4′-monophosphate group typically found in the lipid A of Gram-negative bacteria. LpxF, a selective phosphatase located on the periplasmic surface of the inner membrane, removes the 4′-phosphate moiety in the late stages of F. novicida lipid A assembly. To evaluate the relevance of the 4′-phosphatase to pathogenesis, we constructed a deletion mutant of lpxF and compared its virulence with wild-type F. novicida. Intradermal injection of 106 wild-type but not 108 mutant F. novicida cells is lethal to mice. The rapid clearance of the lpxF mutant is associated with a stronger local cytokine response and a greater influx of neutrophils compared with wild-type. The F. novicida mutant was highly susceptible to the cationic antimicrobial peptide polymyxin. LpxF therefore represents a kind of virulence factor that confers a distinct lipid A phenotype, preventing Francisella from activating the host innate immune response and preventing the bactericidal actions of cationic peptides. Francisella lpxF mutants may be useful for immunization against tularemia. PMID:17360489

  10. Transformation of glucocorticoid receptors bound to the antagonist RU 486: Effects of alkaline phosphatase

    SciTech Connect

    Gruol, D.J.; Wolfe, K.A. )

    1990-08-28

    RU 486 is a synthetic steroid that binds avidly to glucocorticoid receptors without promoting their transformation into activated transcription factors. A significant part of this behavior has been shown to be due to a failure of the RU 486 bound receptor to be efficiently released from a larger (sedimenting at 8-9 S) multimeric complex containing the 90-kDa heat shock protein. The studies have found that in vitro at 15{degree}C the RU 486-receptor was slowly released from the 8-9S complex and converted into a DNA binding protein by a process that could be blocked by sodium fluoride. Moreover, this transition was significantly accelerated by treatment with alkaline phosphatase. High-resolution anion-exchange chromatography showed that the profile of receptor subspecies released from the 8-9S complex was different for the RU 486 bound receptor when compared to the receptor occupied by the agonist triamcinolone acetonide. Production of the earliest eluting receptor form (peak A) was inhibited with RU 486. Treatment of the Ru 486-receptor with alkaline phosphatase increased the formation of the peak A subspecies as well as the capacity of receptor to bind DNA-cellulose. Taken together, the results indicate that phosphorylation of the receptor or a tightly bound factor contributes to defining the capacity with which individual steroids can promote dissociation of the 8-9S complex and conversion of the glucocorticoid receptor into a DNA-binding protein.

  11. A family of metal-dependent phosphatases implicated in metabolite damage-control

    SciTech Connect

    Huang, Lili; Shanklin, John; Khusnutdinova, Anna; Nocek, Boguslaw; Brown, Greg; Xu, Xiaohui; Cui, Hong; Petit, Pierre; Flick, Robert; Zallot, Remi; Balmant, Kelly; Ziemak, Michael J.; de Crecy-Lagard, Valerie; Fiehn, Oliver; Gregory, III, Jesse F.; Joachimiak, Andrzej; Savchenko, Alexie; Yakunin, Alexander F.; Hanson, Andrew D.

    2016-06-20

    DUF89 family proteins occur widely in pro- and eukaryotes but their functions are unknown. Here we define three DUF89 subfamilies (I, II, and III), subfamily II being split into standalone proteins and proteins fused to pantothenate kinase (PanK). We demonstrated that DUF89 proteins have metaldependent phosphatase activity against reactive phosphoesters or their damaged forms, notably sugar phosphates (subfamilies II and III), phosphopantetheine and its S-sulfonate or sulfonate (subfamily II-PanK fusions), and nucleotides (subfamily I). Genetic and comparative genomic data strongly associated DUF89 genes with phosphoester metabolism. The crystal structure of the yeast (Saccharomyces cerevisiae) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89 proteins are previously unrecognized hydrolases whose characteristic in vivo function is to limit potentially harmful buildups of normal or damaged phosphometabolites.

  12. Two Membrane-Associated Tyrosine Phosphatase Homologs Potentiate C. elegans AKT-1/PKB Signaling

    PubMed Central

    Hu, Patrick J; Xu, Jinling; Ruvkun, Gary

    2006-01-01

    Akt/protein kinase B (PKB) functions in conserved signaling cascades that regulate growth and metabolism. In humans, Akt/PKB is dysregulated in diabetes and cancer; in Caenorhabditis elegans, Akt/PKB functions in an insulin-like signaling pathway to regulate larval development. To identify molecules that modulate C. elegans Akt/PKB signaling, we performed a genetic screen for enhancers of the akt-1 mutant phenotype (eak). We report the analysis of three eak genes. eak-6 and eak-5/sdf-9 encode protein tyrosine phosphatase homologs; eak-4 encodes a novel protein with an N-myristoylation signal. All three genes are expressed primarily in the two endocrine XXX cells, and their predicted gene products localize to the plasma membrane. Genetic evidence indicates that these proteins function in parallel to AKT-1 to inhibit the FoxO transcription factor DAF-16. These results define two membrane-associated protein tyrosine phosphatase homologs that may potentiate C. elegans Akt/PKB signaling by cell autonomous and cell nonautonomous mechanisms. Similar molecules may modulate Akt/PKB signaling in human endocrine tissues. PMID:16839187

  13. Characterization of Arabidopsis Acid Phosphatase Promoter and Regulation of Acid Phosphatase Expression

    PubMed Central

    Haran, Shoshan; Logendra, Sithes; Seskar, Mirjana; Bratanova, Margarita; Raskin, Ilya

    2000-01-01

    The expression and secretion of acid phosphatase (APase) was investigated in Indian mustard (Brassica juncea L. Czern.) plants using sensitive in vitro and activity gel assays. Phosphorus (P) starvation induced two APases in Indian mustard roots, only one of which was secreted. Northern-blot analysis indicated transcriptional regulation of APase expression. Polymerase chain reaction and Southern-blot analyses revealed two APase homologs in Indian mustard, whereas in Arabidopsis, only one APase homolog was detected. The Arabidopsis APase promoter region was cloned and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS expression was first evident in leaves of the P-starved Arabidopsis plants. In P-starved roots, the expression of GUS initiated in lateral root meristems followed by generalized expression throughout the root. GUS expression diminished with the addition of P to the medium. Expression of GFP in P-starved roots also initiated in the lateral root meristems and the recombinant GFP with the APase signal peptide was secreted by the roots into the medium. The APase promoter was specifically activated by low P levels. The removal of other essential elements or the addition of salicylic or jasmonic acids, known inducers of gene expression, did not activate the APase promoter. This novel APase promoter may be used as a plant-inducible gene expression system for the production of recombinant proteins and as a tool to study P metabolism in plants. PMID:11027712

  14. Methods to distinguish various types of protein phosphatase activity

    SciTech Connect

    Brautigan, D.L.; Shriner, C.L.

    1988-01-01

    To distinguish the action of protein Tyr(P) and protein Ser(P)/Thr(P) phosphatases on /sup 32/P-labeled phosphoproteins in subcellular fractions different inhibitors and activators are utilized. Comparison of the effects of added compounds provides a convenient, indirect method to characterize dephosphorylation reactions. Protein Tyr(P) phosphatases are specifically inhibited by micromolar Zn2+ or vanadate, and show maximal activity in the presence of EDTA. The other class of cellular phosphatases, specific for protein Ser(P) and Thr(P) residues, are inhibited by fluoride and EDTA. In this class of enzymes two major functional types can be distinguished: those sensitive to inhibition by the heat-stable protein inhibitor-2 and not stimulated by polycations, and those not sensitive to inhibition and stimulated by polycations. Preparation of /sup 32/P-labeled Tyr(P) and Ser(P) phosphoproteins also is presented for the direct measurement of phosphatase activities in preparations by the release of acid-soluble (/sup 32/P)phosphate.

  15. A human phospholipid phosphatase activated by a transmembrane control module.

    PubMed

    Halaszovich, Christian R; Leitner, Michael G; Mavrantoni, Angeliki; Le, Audrey; Frezza, Ludivine; Feuer, Anja; Schreiber, Daniela N; Villalba-Galea, Carlos A; Oliver, Dominik

    2012-11-01

    In voltage-sensitive phosphatases (VSPs), a transmembrane voltage sensor domain (VSD) controls an intracellular phosphoinositide phosphatase domain, thereby enabling immediate initiation of intracellular signals by membrane depolarization. The existence of such a mechanism in mammals has remained elusive, despite the presence of VSP-homologous proteins in mammalian cells, in particular in sperm precursor cells. Here we demonstrate activation of a human VSP (hVSP1/TPIP) by an intramolecular switch. By engineering a chimeric hVSP1 with enhanced plasma membrane targeting containing the VSD of a prototypic invertebrate VSP, we show that hVSP1 is a phosphoinositide-5-phosphatase whose predominant substrate is PI(4,5)P(2). In the chimera, enzymatic activity is controlled by membrane potential via hVSP1's endogenous phosphoinositide binding motif. These findings suggest that the endogenous VSD of hVSP1 is a control module that initiates signaling through the phosphatase domain and indicate a role for VSP-mediated phosphoinositide signaling in mammals.

  16. Effects of organic dairy manure amendment on soil phosphatase activities

    USDA-ARS?s Scientific Manuscript database

    Organic dairy production is increasing in the U.S. due to concerns over environmental, human, and animal health. It is well known that the application of livestock manure to soil can influence enzyme activities involved in nutrient cycling and soil fertility, such as soil phosphatases; however, orga...

  17. Okadaic acid: the archetypal serine/threonine protein phosphatase inhibitor.

    PubMed

    Dounay, A B; Forsyth, C J

    2002-11-01

    As the first recognized member of the "okadaic acid class" of phosphatase inhibitors, the marine natural product okadaic acid is perhaps the most well-known member of a diverse array of secondary metabolites that have emerged as valuable probes for studying the roles of various cellular protein serine/threonine phosphatases. This review provides a historical perspective on the role that okadaic acid has played in stimulating a broad spectrum of modern scientific research as a result of the natural product's ability to bind to and inhibit important classes of protein serine / threonine phosphatases. The relationships between the structure and biological activities of okadaic acid are briefly reviewed, as well as the structural information regarding the particular cellular receptors protein phosphatases 1 (PP1) and 2A. Laboratory syntheses of okadaic acid and its analogs are thoroughly reviewed. Finally, an interpretation of the critical contacts observed between okadaic acid and PP1 by X-ray crystallography is provided, and specific molecular recognition hypotheses that are testable via the synthesis and assay of non-natural analogs of okadaic acid are suggested.

  18. Structural and functional basis of protein phosphatase 5 substrate specificity.

    PubMed

    Oberoi, Jasmeen; Dunn, Diana M; Woodford, Mark R; Mariotti, Laura; Schulman, Jacqualyn; Bourboulia, Dimitra; Mollapour, Mehdi; Vaughan, Cara K

    2016-08-09

    The serine/threonine phosphatase protein phosphatase 5 (PP5) regulates hormone- and stress-induced cellular signaling by association with the molecular chaperone heat shock protein 90 (Hsp90). PP5-mediated dephosphorylation of the cochaperone Cdc37 is essential for activation of Hsp90-dependent kinases. However, the details of this mechanism remain unknown. We determined the crystal structure of a Cdc37 phosphomimetic peptide bound to the catalytic domain of PP5. The structure reveals PP5 utilization of conserved elements of phosphoprotein phosphatase (PPP) structure to bind substrate and provides a template for many PPP-substrate interactions. Our data show that, despite a highly conserved structure, elements of substrate specificity are determined within the phosphatase catalytic domain itself. Structure-based mutations in vivo reveal that PP5-mediated dephosphorylation is required for kinase and steroid hormone receptor release from the chaperone complex. Finally, our data show that hyper- or hypoactivity of PP5 mutants increases Hsp90 binding to its inhibitor, suggesting a mechanism to enhance the efficacy of Hsp90 inhibitors by regulation of PP5 activity in tumors.

  19. Purification and characterization of two wheat-embryo protein phosphatases.

    PubMed

    Polya, G M; Haritou, M

    1988-04-15

    Two protein phosphatases (enzymes I and II) were extensively purified from wheat embryo by a procedure involving chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, DEAE-Sephacel and Ultrogel AcA 44. Preparations of enzyme I (Mr 197,000) are heterogeneous. Preparations of enzyme II (Mr 35,000) contain only one major polypeptide (Mr 17,500), which exactly co-purifies with protein phosphatase II on gel filtration and is not present in preparations of enzyme I. However, this major polypeptide has been identified as calmodulin. Calmodulin and protein phosphatase II can be separated by further chromatography on phenyl-Sepharose CL-4B. Protein phosphatases I and II do not require Mg2+ or Ca2+ for activity. Both enzymes catalyse the dephosphorylation of phosphohistone H1 (phosphorylated by wheat-germ Ca2+-dependent protein kinase) and of phosphocasein (phosphorylated by wheat-germ Ca2+-independent casein kinase), but neither enzyme dephosphorylates a range of non-protein phosphomonoesters tested. Both enzymes are inhibited by Zn2+, Hg2+, vanadate, molybdate, F-, pyrophosphate and ATP.

  20. Anion and divalent cation activation of phosphoglycolate phosphatase from leaves.

    PubMed

    Husic, H D; Tolbert, N E

    1984-02-15

    Phosphoglycolate (P-glycolate) phosphatase was purified 223-fold from spinach leaves by (NH4)2SO4 fractionation, DEAE-cellulose chromatography, and Sephadex G-200 chromatography. The partially purified enzyme had a broad pH optimum between 5.6 and 8.0 and was specific for the hydrolysis of P-glycolate with a Km (P-glycolate) of 26 microM. The enzyme was activated by divalent cations including Mg2+, Co2+, Mn2+, and Zn2+, and by anions including Cl-, Br-, NO-3, and HCOO-. Neither anions nor divalent cations activated the enzyme without the other. The P-glycolate phosphatase activities from tobacco leaves or the green algae, Chlamydomonas reinhardtii, also required Mg2+ and were activated by chloride. In addition, the enzyme was allosterically inhibited by ribose 5-phosphate. The activation of P-glycolate phosphatase by both anions and divalent cations and the inhibition by ribose 5-phosphate may be involved in the in vivo regulation of P-glycolate phosphatase activity.

  1. Biocatalysis with Sol-Gel Encapsulated Acid Phosphatase

    ERIC Educational Resources Information Center

    Kulkarni, Suhasini; Tran, Vu; Ho, Maggie K.-M.; Phan, Chieu; Chin, Elizabeth; Wemmer, Zeke; Sommerhalter, Monika

    2010-01-01

    This experiment was performed in an upper-level undergraduate biochemistry laboratory course. Students learned how to immobilize an enzyme in a sol-gel matrix and how to perform and evaluate enzyme-activity measurements. The enzyme acid phosphatase (APase) from wheat germ was encapsulated in sol-gel beads that were prepared from the precursor…

  2. Phosphatase inhibitors activate normal and defective CFTR chloride channels.

    PubMed Central

    Becq, F; Jensen, T J; Chang, X B; Savoia, A; Rommens, J M; Tsui, L C; Buchwald, M; Riordan, J R; Hanrahan, J W

    1994-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is regulated by phosphorylation and dephosphorylation at multiple sites. Although activation by protein kinases has been studied in some detail, the dephosphorylation step has received little attention. This report examines the mechanisms responsible for the dephosphorylation and spontaneous deactivation ("rundown") of CFTR chloride channels excised from transfected Chinese hamster ovary (CHO) and human airway epithelial cells. We report that the alkaline phosphatase inhibitors bromotetramisole, 3-isobutyl-1-methylxanthine, theophylline, and vanadate slow the rundown of CFTR channel activity in excised membrane patches and reduce dephosphorylation of CFTR protein in isolated membranes. It was also found that in unstimulated cells, CFTR channels can be activated by exposure to phosphatase inhibitors alone. Most importantly, exposure of mammalian cells to phosphatase inhibitors alone activates CFTR channels that have disease-causing mutations, provided the mutant channels are present in the plasma membrane (R117H, G551D, and delta F508 after cooling). These results suggest that CFTR dephosphorylation is dynamic and that membrane-associated phosphatase activity may be a potential therapeutic target for the treatment of cystic fibrosis. Images PMID:7522329

  3. Yeast Acid Phosphatases and Phytases: Production, Characterization and Commercial Prospects

    NASA Astrophysics Data System (ADS)

    Kaur, Parvinder; Satyanarayana, T.

    The element phosphorus is critical to all life forms as it forms the basic component of nucleic acids and ATP and has a number of indispensable biochemical roles. Unlike C or N, the biogeochemical cycling of phosphorus is very slow, and thus making it the growth-limiting element in most soils and aquatic systems. Phosphohydrolases (e.g. acid phosphatases and phytases) are enzymes that break the C-O-P ester bonds and provide available inorganic phosphorus from various inassimilable organic forms of phosphorus like phytates. These enzymes are of significant value in effectively combating phosphorus pollution. Although phytases and acid phosphatases are produced by various plants, animals and micro organisms, microbial sources are more promising for the production on a commercial scale. Yeasts being the simplest eukaryotes are ideal candidates for phytase and phos-phatase research due to their mostly non-pathogenic and GRAS status. They have not, however, been utilized to their full potential. This chapter focuses attention on the present state of knowledge on the production, characterization and potential commercial prospects of yeast phytases and acid phosphatases.

  4. Biocatalysis with Sol-Gel Encapsulated Acid Phosphatase

    ERIC Educational Resources Information Center

    Kulkarni, Suhasini; Tran, Vu; Ho, Maggie K.-M.; Phan, Chieu; Chin, Elizabeth; Wemmer, Zeke; Sommerhalter, Monika

    2010-01-01

    This experiment was performed in an upper-level undergraduate biochemistry laboratory course. Students learned how to immobilize an enzyme in a sol-gel matrix and how to perform and evaluate enzyme-activity measurements. The enzyme acid phosphatase (APase) from wheat germ was encapsulated in sol-gel beads that were prepared from the precursor…

  5. Specificity profiling of protein phosphatases toward phosphoseryl and phosphothreonyl peptides.

    PubMed

    Xiao, Qing; Luechapanichkul, Rinrada; Zhai, Yujing; Pei, Dehua

    2013-07-03

    A combinatorial library method was developed to systematically profile the substrate specificity of protein phosphatases toward phosphoseryl (pS) and phosphothreonyl (pT) peptides. Application of this method and a previously reported phosphotyrosyl (pY) library screening technique to dual-specificity phosphatase (DUSP) VH1 of vaccinia virus revealed that VH1 is highly active toward both pS/pT and pY peptides. VH1 exhibits different and more stringent sequence specificity toward pS/pT than pY substrates. Unlike previously characterized protein tyrosine phosphatases (PTPs), the activity and specificity of VH1 are primarily determined by the amino acid residues C-terminal to the pS, pT, or pY residue. In contrast, the mammalian VH1-related (VHR) DUSP has intrinsically low catalytic activity toward pS and pT substrates, suggesting that its primary physiological function is to dephosphorylate pY residues in substrate proteins. This method is applicable to other DUSPs and protein-serine/threonine phosphatases, and the substrate specificity data will be useful for identifying the physiological substrates of these enzymes.

  6. Effect of Poultry Manure Amendment on Soil Phosphatase Activity

    USDA-ARS?s Scientific Manuscript database

    Animal manure has traditionally been used as a fertilizer source. Manure phosphorus (P) exists in many forms, not all of which are immediately available. Microbial and plant-derived phosphatases can mineralize some organic P forms. Increased understanding of effects of manure application on soil p...

  7. New form of acid phosphatase during lysosome biogenesis.

    PubMed Central

    Rao, G R; Aithal, H N; Toback, F G; Getz, G S

    1981-01-01

    Lysosome formation was induced in cells of the renal medulla by feeding rats on a K+-deficient diet. The role of the endoplasmic reticulum in the production of acid phosphatase, a typical lysosomal enzyme, was examined. Lysosomal and microsomal fractions were prepared for study by differential centrifugation of homogenates of renal papilla and inner stripe of red medulla. Acid phosphatase activity in the microsomal fraction was distinguished from the activity in the lysosomal fraction in normal tissue by differences in pH optima, tartrate inhibition, distribution of multiple forms after polyacrylamide-gel electrophoresis and detergent-sensitivity. During progressive K+ depletion, acid phosphatase activity in both microsomal and lysosomal fractions of the tissue increased 3-fold. In the lysosomes, K+ depletion was associated with the appearance of a new band of acid phosphatase. The neuraminidase-sensitivity of this band on polyacrylamide-gel electrophoresis indicated that the enzyme protein had been modified by the addition of sialic acid residues. K+ depletion also altered the lysosomal enzyme so that thiol compounds were able to stimulate its activity. Images Fig. 4. PMID:7326004

  8. Functional Diversity of Haloacid Dehalogenase Superfamily Phosphatases from Saccharomyces cerevisiae

    PubMed Central

    Kuznetsova, Ekaterina; Nocek, Boguslaw; Brown, Greg; Makarova, Kira S.; Flick, Robert; Wolf, Yuri I.; Khusnutdinova, Anna; Evdokimova, Elena; Jin, Ke; Tan, Kemin; Hanson, Andrew D.; Hasnain, Ghulam; Zallot, Rémi; de Crécy-Lagard, Valérie; Babu, Mohan; Savchenko, Alexei; Joachimiak, Andrzej; Edwards, Aled M.; Koonin, Eugene V.; Yakunin, Alexander F.

    2015-01-01

    The haloacid dehalogenase (HAD)-like enzymes comprise a large superfamily of phosphohydrolases present in all organisms. The Saccharomyces cerevisiae genome encodes at least 19 soluble HADs, including 10 uncharacterized proteins. Here, we biochemically characterized 13 yeast phosphatases from the HAD superfamily, which includes both specific and promiscuous enzymes active against various phosphorylated metabolites and peptides with several HADs implicated in detoxification of phosphorylated compounds and pseudouridine. The crystal structures of four yeast HADs provided insight into their active sites, whereas the structure of the YKR070W dimer in complex with substrate revealed a composite substrate-binding site. Although the S. cerevisiae and Escherichia coli HADs share low sequence similarities, the comparison of their substrate profiles revealed seven phosphatases with common preferred substrates. The cluster of secondary substrates supporting significant activity of both S. cerevisiae and E. coli HADs includes 28 common metabolites that appear to represent the pool of potential activities for the evolution of novel HAD phosphatases. Evolution of novel substrate specificities of HAD phosphatases shows no strict correlation with sequence divergence. Thus, evolution of the HAD superfamily combines the conservation of the overall substrate pool and the substrate profiles of some enzymes with remarkable biochemical and structural flexibility of other superfamily members. PMID:26071590

  9. Dephosphorylation of phosphopeptides by calcineurin (protein phosphatase 2B).

    PubMed

    Donella-Deana, A; Krinks, M H; Ruzzene, M; Klee, C; Pinna, L A

    1994-01-15

    38 (6-32 residues) enzymically phosphorylated synthetic peptides have been assayed as substrates for calcineurin, a Ca2+/calmodulin-dependent protein phosphatase (PP-2B) belonging to the family of Ser/Thr-specific enzymes but also active on phosphotyrosine residues. Many peptides reproduce, with suitable modifications, naturally occurring phosphoacceptor sites. While protein phosphatases 2A and 2C are also very active on short phosphopeptides, an extended N-terminal stretch appears to be a necessary, albeit not sufficient, condition for an optimal dephosphorylation, comparable to that of protein substrates, of both phosphoseryl and phosphotyrosyl peptides by calcineurin. This finding corroborates the view that higher-order structure is an important determinant for the substrate specificity of calcineurin. However, a number of shorter peptides are also appreciably dephosphorylated by this enzyme, their efficiency as substrates depending on local structural features. All the peptides that are appreciably dephosphorylated by calcineurin contain basic residue(s) on the N-terminal side. A basic residue located at position -3 relative to the phosphorylated residue plays a particularly relevant positive role in determining the dephosphorylation of short phosphopeptides. Acidic residue(s) adjacent to the C-terminal side of the phosphoamino acid are conversely powerful negative determinants, preventing the dephosphorylation of otherwise suitable peptide substrates. However, calcineurin displays an only moderate preference for phosphothreonyl peptides which are conversely strikingly preferred over their phosphoseryl counterparts by the other classes of Ser/Thr-specific protein phosphatases. Moreover calcineurin does not perceive as a strong negative determinant the motif Ser/Thr-Pro in peptides where this motif prevents dephosphorylation by the other classes of Ser/Thr protein phosphatases. Whenever tested on phosphotyrosyl peptides, calcineurin exhibits a specificity which

  10. Decryptification of Acid Phosphatase in Arthrospores of Geotrichum Species Treated with Dimethyl Sulfoxide and Acetone

    PubMed Central

    Cotter, David A.; Martel, Anita J.; MacDonald, Paul

    1975-01-01

    Decryptification of acid phosphatase in Geotrichum sp. arthrospores was accomplished using acetone or dimethyl sulfoxide treatment. Both dimethyl sulfoxide and acetone irreversibly destroyed the integrity of the spore membranes without solubilizing acid phosphatase. PMID:1167386

  11. Phosphatase acitivity as biosignatures in terrestrial extreme environments

    NASA Astrophysics Data System (ADS)

    Kawai, Jun; Nakamoto, Saki; Hara, Masashi; Obayashi, Yumiko; Kaneko, Takeo; Mita, Hajime; Yoshimura, Yoshitaka; Takano, Yoshinori; Kobayashi, Kensei

    Since phosphate esters are essential for the terrestrial life, phosphatase activity can be a can-didate for biosignatures of biological activity. It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere, high temperature hot springs and stratosphere. We analyzed phosphatase activities in the samples obtained in ex-treme environments such as submarine hydrothermal systems and Antarctica , and discussed whether they can be used as biosignatures for extant life. Core samples and chimney samples were collected at Tarama Knoll in Okinawa Trough in 2009, both in a part of the Archaean Park Project. Surface soil samples are obtained at the Sites 1-8 near Showa Base in Antarctica during the 47th Japan Antarctic exploration mission in 2005-6. Alkaline Phosphatase activ-ity in sea water and in soil was measured spectrometrically by using 25 mM p-nitrophenyl phosphate (pH 8.0) as a substrate. Phosphatase activities in extracts were measured fluoro-metrically by using 4-methylumberyferryl phosphate as a substrate. Concentration of amino acids and their enantiomeric ratios were also determined by HPLC . Significant enzymatic ac-tivities were revealed in both some of the hydrothermal sub-vent systems and Antarctica soils, which is crucial evidence of vigorous microbial oasis. It is consistent with the fact that large enantiomeric excess of L-form amino acids were found in the same core sequences. Optimum temperatures of ALP in the chimney, Antarctica soil and YNU campus soil were 353 K, 313 K, and 333 K, respectively. The present results suggested that phosphatase activities,, together with amino acids, can be used as possible biosignatures for extant life.

  12. Probing the origins of catalytic discrimination between phosphate and sulfate monoester hydrolysis: comparative analysis of alkaline phosphatase and protein tyrosine phosphatases.

    PubMed

    Andrews, Logan D; Zalatan, Jesse G; Herschlag, Daniel

    2014-11-04

    Catalytic promiscuity, the ability of enzymes to catalyze multiple reactions, provides an opportunity to gain a deeper understanding of the origins of catalysis and substrate specificity. Alkaline phosphatase (AP) catalyzes both phosphate and sulfate monoester hydrolysis reactions with a ∼10(10)-fold preference for phosphate monoester hydrolysis, despite the similarity between these reactions. The preponderance of formal positive charge in the AP active site, particularly from three divalent metal ions, was proposed to be responsible for this preference by providing stronger electrostatic interactions with the more negatively charged phosphoryl group versus the sulfuryl group. To test whether positively charged metal ions are required to achieve a high preference for the phosphate monoester hydrolysis reaction, the catalytic preference of three protein tyrosine phosphatases (PTPs), which do not contain metal ions, were measured. Their preferences ranged from 5 × 10(6) to 7 × 10(7), lower than that for AP but still substantial, indicating that metal ions and a high preponderance of formal positive charge within the active site are not required to achieve a strong catalytic preference for phosphate monoester over sulfate monoester hydrolysis. The observed ionic strength dependences of kcat/KM values for phosphate and sulfate monoester hydrolysis are steeper for the more highly charged phosphate ester with both AP and the PTP Stp1, following the dependence expected based on the charge difference of these two substrates. However, the dependences for AP were not greater than those of Stp1 and were rather shallow for both enzymes. These results suggest that overall electrostatics from formal positive charge within the active site is not the major driving force in distinguishing between these reactions and that substantial discrimination can be attained without metal ions. Thus, local properties of the active site, presumably including multiple positioned dipolar

  13. Formation and properties of organo-phosphatase complexes by abiotic and biotic polymerization of pyrogallol-phosphatase mixtures.

    PubMed

    Rao, Maria A; Del Gaudio, Stefania; Scelza, Rosalia; Gianfreda, Liliana

    2010-04-28

    In this paper, the catalytic efficacy of peroxidase and manganese oxide, both commonly present in soil, to catalyze the formation of pyrogallol-phosphatase complexes was compared. The influence of several factors (e.g., the concentration of pyrogallol, the amount of catalysts, the nature of manganese oxide, birnessite, or pyrolusite, the incubation time, and the pH) on the transformation of pyrogallol and the characteristics and properties of the pyrogallol-phosphatase interaction products were investigated. The pyrogallol transformation mediated by both catalysts was very fast and increased by increasing the catalyst concentration. The nature of the catalyst also influenced the size and the molecular mass of the formed complexes. When polymerization of pyrogallol occurred with high intensity, a loss of phosphatase activity occurred, and it strongly depended on the pH at which the process was carried out and the catalyst. In particular, with peroxidase, the phosphatase activity was much lower in either suspensions or supernatants and not measurable in the insoluble complexes as compared to that measured in the presence of manganese oxides.

  14. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling.

    PubMed Central

    Janssens, V; Goris, J

    2001-01-01

    Protein phosphatase 2A (PP2A) comprises a family of serine/threonine phosphatases, minimally containing a well conserved catalytic subunit, the activity of which is highly regulated. Regulation is accomplished mainly by members of a family of regulatory subunits, which determine the substrate specificity, (sub)cellular localization and catalytic activity of the PP2A holoenzymes. Moreover, the catalytic subunit is subject to two types of post-translational modification, phosphorylation and methylation, which are also thought to be important regulatory devices. The regulatory ability of PTPA (PTPase activator), originally identified as a protein stimulating the phosphotyrosine phosphatase activity of PP2A, will also be discussed, alongside the other regulatory inputs. The use of specific PP2A inhibitors and molecular genetics in yeast, Drosophila and mice has revealed roles for PP2A in cell cycle regulation, cell morphology and development. PP2A also plays a prominent role in the regulation of specific signal transduction cascades, as witnessed by its presence in a number of macromolecular signalling modules, where it is often found in association with other phosphatases and kinases. Additionally, PP2A interacts with a substantial number of other cellular and viral proteins, which are PP2A substrates, target PP2A to different subcellular compartments or affect enzyme activity. Finally, the de-regulation of PP2A in some specific pathologies will be touched upon. PMID:11171037

  15. Effects of proteolysis and reduction on phosphatase and ROS-generating activity of human tartrate-resistant acid phosphatase.

    PubMed

    Fagerlund, Katja M; Ylipahkala, Hannele; Tiitinen, Sari L; Janckila, Anthony J; Hamilton, Susan; Mäentausta, Olli; Väänänen, H Kalervo; Halleen, Jussi M

    2006-05-15

    Osteoclasts and macrophages express high amounts of tartrate-resistant acid phosphatase (TRACP), an enzyme with unknown biological function. TRACP contains a disulfide bond, a protease-sensitive loop peptide, and a redox-active iron that can catalyze formation of reactive oxygen species (ROS). We studied the effects of proteolytic cleavage by trypsin, reduction of the disulfide bond by beta-mercaptoethanol, and reduction of the redox-active iron by ascorbate on the phosphatase and ROS-generating activity of baculovirus-generated recombinant human TRACP. Ascorbate alone and trypsin in combination with beta-mercaptoethanol increased k(cat)/K(m) of the phosphatase activity seven- to ninefold. The pH-optimum was changed from 5.4-5.6 to 6.2-6.4 by ascorbate and trypsin cleavage. Trypsin cleavage increased k(cat)/K(m) of the ROS-generating activity 2.5-fold without affecting the pH-optimum (7.0). These results suggest that the protease-sensitive loop peptide, redox-active iron, and disulfide bond are important regulatory sites in TRACP, and that the phosphatase and ROS-generating activity are performed with different reaction mechanisms.

  16. Probing kinase and phosphatase activities of two-component systems in vivo with concentration-dependent phosphorylation profiling

    PubMed Central

    Gao, Rong; Stock, Ann M.

    2013-01-01

    Quantitative analyses of protein concentrations, modifications and activities in their native environments are playing an increasingly vital role in unraveling the general principles underlying signal transduction pathways. The prevalent bacterial two-component systems (TCSs) use a central phosphotransfer for signaling; however, in vivo characterization of the kinase and phosphatase activities of TCS proteins is often limited by traditional transcriptional reporter assays and complicated by simultaneous actions of multiple TCS activities. Here, we report a strategy that combines concentration-dependent phosphorylation profiling and mathematical modeling to characterize the cellular activities of the archetype Escherichia coli PhoR/PhoB system. Phosphorylation of the response regulator (RR) PhoB has been found to be dependent on the total concentrations of PhoB/PhoR and saturated at high concentrations. The relationship between RR phosphorylation and total concentrations has been defined by the modeling of the kinase and phosphatase reactions and quantified to derive the biochemical parameters of the PhoR/PhoB system in vivo. In a further test of this approach on a PhoB mutant, PhoBF20D, it proved highly effective in exploring the mechanistic differences of TCSs that are not revealed by traditional reporter assays. Measurement of biochemical parameters for PhoBF20D led to the discovery that a weaker interaction between the histidine sensor kinase and RR could result in a higher and nonrobust phosphorylation due to diminished phosphatase activities. PMID:23267085

  17. Detection of endogenous alkaline phosphatase activity in intact cells by flow cytometry using the fluorogenic ELF-97 phosphatase substrate

    NASA Technical Reports Server (NTRS)

    Telford, W. G.; Cox, W. G.; Stiner, D.; Singer, V. L.; Doty, S. B.

    1999-01-01

    BACKGROUND: The alkaline phosphatase (AP) substrate 2-(5'-chloro-2'-phosphoryloxyphenyl)-6-chloro-4-(3H)-quinazolinone (ELF((R))-97 for enzyme-labeled fluorescence) has been found useful for the histochemical detection of endogenous AP activity and AP-tagged proteins and oligonucleotide probes. In this study, we evaluated its effectiveness at detecting endogenous AP activity by flow cytometry. METHODS: The ELF-97 phosphatase substrate was used to detect endogenous AP activity in UMR-106 rat osteosarcoma cells and primary cultures of chick chondrocytes. Cells were labeled with the ELF-97 reagent and analyzed by flow cytometry using an argon ultraviolet (UV) laser. For comparison purposes, cells were also assayed for AP using a Fast Red Violet LB azo dye assay previously described for use in detecting AP activity by flow cytometry. RESULTS: The ELF-97 phosphatase substrate effectively detected endogenous AP activity in UMR-106 cells, with over 95% of the resulting fluorescent signal resulting from AP-specific activity (as determined by levamisole inhibition of AP activity). In contrast, less than 70% of the fluorescent signal from the Fast Red Violet LB (FRV) assay was AP-dependent, reflecting the high intrinsic fluorescence of the unreacted components. The ELF-97 phosphatase assay was also able to detect very low AP activity in chick chondrocytes that was undetectable by the azo dye method. CONCLUSIONS: The ELF-97 phosphatase assay was able to detect endogenous AP activity in fixed mammalian and avian cells by flow cytometry with superior sensitivity to previously described assays. This work also shows the applicability of ELF-97 to flow cytometry, supplementing its previously demonstrated histochemical applications. Copyright 1999 Wiley-Liss, Inc.

  18. Detection of endogenous alkaline phosphatase activity in intact cells by flow cytometry using the fluorogenic ELF-97 phosphatase substrate

    NASA Technical Reports Server (NTRS)

    Telford, W. G.; Cox, W. G.; Stiner, D.; Singer, V. L.; Doty, S. B.

    1999-01-01

    BACKGROUND: The alkaline phosphatase (AP) substrate 2-(5'-chloro-2'-phosphoryloxyphenyl)-6-chloro-4-(3H)-quinazolinone (ELF((R))-97 for enzyme-labeled fluorescence) has been found useful for the histochemical detection of endogenous AP activity and AP-tagged proteins and oligonucleotide probes. In this study, we evaluated its effectiveness at detecting endogenous AP activity by flow cytometry. METHODS: The ELF-97 phosphatase substrate was used to detect endogenous AP activity in UMR-106 rat osteosarcoma cells and primary cultures of chick chondrocytes. Cells were labeled with the ELF-97 reagent and analyzed by flow cytometry using an argon ultraviolet (UV) laser. For comparison purposes, cells were also assayed for AP using a Fast Red Violet LB azo dye assay previously described for use in detecting AP activity by flow cytometry. RESULTS: The ELF-97 phosphatase substrate effectively detected endogenous AP activity in UMR-106 cells, with over 95% of the resulting fluorescent signal resulting from AP-specific activity (as determined by levamisole inhibition of AP activity). In contrast, less than 70% of the fluorescent signal from the Fast Red Violet LB (FRV) assay was AP-dependent, reflecting the high intrinsic fluorescence of the unreacted components. The ELF-97 phosphatase assay was also able to detect very low AP activity in chick chondrocytes that was undetectable by the azo dye method. CONCLUSIONS: The ELF-97 phosphatase assay was able to detect endogenous AP activity in fixed mammalian and avian cells by flow cytometry with superior sensitivity to previously described assays. This work also shows the applicability of ELF-97 to flow cytometry, supplementing its previously demonstrated histochemical applications. Copyright 1999 Wiley-Liss, Inc.

  19. Mammalian inositol polyphosphate 5-phosphatase II can compensate for the absence of all three yeast Sac1-like-domain-containing 5-phosphatases.

    PubMed Central

    O'Malley, C J; McColl, B K; Kong, A M; Ellis, S L; Wijayaratnam, A P; Sambrook, J; Mitchell, C A

    2001-01-01

    Phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P(2)] plays a complex role in generating intracellular signalling molecules, and also in regulating actin-binding proteins, vesicular trafficking and vacuolar fusion. Four inositol polyphosphate 5-phosphatases (hereafter called 5-phosphatases) have been identified in Saccharomyces cerevisiae: Inp51p, Inp52p, Inp53p and Inp54p. Each enzyme contains a 5-phosphatase domain which hydrolyses PtdIns(4,5)P(2), forming PtdIns4P, while Inp52p and Inp53p also express a polyphosphoinositide phosphatase domain within the Sac1-like domain. Disruption of any two yeast 5-phosphatases containing a Sac1-like domain results in abnormalities in actin polymerization, plasma membrane, vacuolar morphology and bud-site selection. Triple null mutant 5-phosphatase strains are non-viable. To investigate the role of PtdIns(4,5)P(2) in mediating the phenotype of double and triple 5-phosphatase null mutant yeast, we determined whether a mammalian PtdIns(4,5)P(2) 5-phosphatase, 5-phosphatase II, which lacks polyphosphoinositide phosphatase activity, could correct the phenotype of triple 5-phosphatase null mutant yeast and restore cellular PtdIns(4,5)P(2) levels to near basal values. Mammalian 5-phosphatase II expressed under an inducible promoter corrected the growth, cell wall, vacuolar and actin polymerization defects of the triple 5-phosphatase null mutant yeast strains. Cellular PtdIns(4,5)P(2) levels in various 5-phosphatase double null mutant strains demonstrated significant accumulation (4.5-, 3- and 2-fold for Deltainp51Deltainp53, Deltainp51Deltainp52 and Deltainp52Deltainp53 double null mutants respectively), which was corrected significantly following 5-phosphatase II expression. Collectively, these studies demonstrate the functional and cellular consequences of PtdIns(4,5)P(2) accumulation and the evolutionary conservation of function between mammalian and yeast PtdIns(4,5)P(2) 5-phosphatases. PMID:11311145

  20. Repeated probing of Southwestern blots using alkaline phosphatase stripping.

    PubMed

    Jia, Yinshan; Jiang, Daifeng; Jarrett, Harry W

    2010-11-05

    Southwestern blotting is when a DNA sequence is used to probe DNA-binding proteins on an electrophoretic gel blot. It would be highly desirable to be able to probe a blot repeatedly with different DNA sequences. Alkaline phosphatase can remove 5'-phosphoryl groups from DNA and radiolabeled 5'-(32)P-DNA probes are commonly used in Southwestern blotting. Here is shown that once probed, the radioisotope signal on the blot can be effectively removed by brief digestion with alkaline phosphatase, and the blot can then be repeatedly probed at least six times with different DNA probes. This exceeds the repetitions possible with another commonly used method using SDS. The technique can be used with either one-dimensional or multi-dimensional Southwestern blots and does not have a large effect on the phosphorylation state of the blotted proteins. An alternative method using T4 polynucleotide kinase stripping is also introduced but was less well characterized.

  1. Purification and Characterization of Acid Phosphatase V from Aspergillus nidulans

    PubMed Central

    Harsanyi, Zsolt; Dorn, Gordon L.

    1972-01-01

    Acid phosphatase V of Aspergillus nidulans was purified by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzyme demonstrated a charge microheterogeneity on starch and acrylamide gel electrophoresis, but proved to be homogeneous on ultracentrifugation and gel filtration. Phosphatase V was found to be a classic acid orthophosphoric monoester phosphohydrolase, and it cleaved p-nitrophenylphosphate, glucose-6-phosphate, and uridine-5′-monophosphate at maximal rates. It was inhibited by fluoride, borate, and molybdate ions, and demonstrated end-product inhibition by inorganic phosphate. Metallic ions or cofactors were not required for activity. The molecular weight was estimated to be 100,000, the S20,w was calculated to be 4.1, and the pH optimum was found to be 6.1. Images PMID:4552990

  2. Translating protein phosphatase research into treatments for neurodegenerative diseases.

    PubMed

    Sundaram, Jeyapriya R; Lee, Irene C J; Shenolikar, Shirish

    2017-02-08

    Many of the major neurodegenerative disorders are characterized by the accumulation of intracellular protein aggregates in neurons and other cells in brain, suggesting that errors in protein quality control mechanisms associated with the aging process play a critical role in the onset and progression of disease. The increased understanding of the unfolded protein response (UPR) signaling network and, more specifically, the structure and function of eIF2α phosphatases has enabled the development or discovery of small molecule inhibitors that show great promise in restoring protein homeostasis and ameliorating neuronal damage and death. While this review focuses attention on one or more eIF2α phosphatases, the wide range of UPR proteins that are currently being explored as potential drug targets bodes well for the successful future development of therapies to preserve neuronal function and treat neurodegenerative disease. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  3. Myosin phosphatase Fine-tunes Zebrafish Motoneuron Position during Axonogenesis

    PubMed Central

    Granato, Michael

    2016-01-01

    During embryogenesis the spinal cord shifts position along the anterior-posterior axis relative to adjacent tissues. How motor neurons whose cell bodies are located in the spinal cord while their axons reside in adjacent tissues compensate for such tissue shift is not well understood. Using live cell imaging in zebrafish, we show that as motor axons exit from the spinal cord and extend through extracellular matrix produced by adjacent notochord cells, these cells shift several cell diameters caudally. Despite this pronounced shift, individual motoneuron cell bodies stay aligned with their extending axons. We find that this alignment requires myosin phosphatase activity within motoneurons, and that mutations in the myosin phosphatase subunit mypt1 increase myosin phosphorylation causing a displacement between motoneuron cell bodies and their axons. Thus, we demonstrate that spinal motoneurons fine-tune their position during axonogenesis and we identify the myosin II regulatory network as a key regulator. PMID:27855159

  4. Repeated probing of Southwestern blots using alkaline phosphatase stripping

    PubMed Central

    Jia, Yinshan; Jiang, Daifeng; Jarrett, Harry W.

    2010-01-01

    Southwestern blotting is when a DNA sequence is used to probe DNA-binding proteins on an electrophoretic gel blot. It would be highly desirable to be able to probe a blot repeatedly with different DNA sequences. Alkaline phosphatase can remove 5′-phosphoryl groups from DNA and radiolabeled 5′-32P-DNA probes are commonly used in Southwestern blotting. Here is shown that once probed, the radioisotope signal on the blot can be effectively removed by brief digestion with alkaline phosphatase, and the blot can then be repeatedly probed at least six times with different DNA probes. This exceeds the repetitions possible with another commonly used method using SDS. The technique can be used with either one-dimensional or multi-dimensional Southwestern blots and does not have a large effect on the phosphorylation state of the blotted proteins. An alternative method using T4 polynucleotide kinase stripping is also introduced but was less well characterized. PMID:20926088

  5. Radiation inactivation analysis of rat liver microsomal glucose 6-phosphatase

    SciTech Connect

    Ness, G.C.; Sample, C.E.; McCreery, M.J.; Sukalski, K.A.; Nordlie, R.C.

    1986-05-01

    Attempts to obtain the molecular weight of microsomal glucose-6-phosphatase based on solubilization and purification have yielded widely divergent results. Since radiation inactivation analysis can be used to obtain molecular weights of proteins within the native membrane environments, this technique was applied. Identical target sizes of about 70 kd for both glucose 6-phosphate phosphohydrolase and carbamyl phosphate:glucose phosphotransferase were observed. This value was unaffected by adding deoxycholate, which disrupts the microsomal membranes, to the microsomal suspensions prior to irradiation. The data suggest that the glucose 6-phosphate transport function and the glucose 6-phosphate phosphohydrolase activity of microsomal glucose 6-phosphatase either residue on a single polypeptide or on two covalently linked polypeptides.

  6. Hybrids of chemical derivatives of Escherichia coli alkaline phosphatase.

    PubMed

    Meighen, E; Yue, R

    1975-12-15

    The activities of hybrid dimers of alkaline phosphatase containing two chemically modified subunits have been investigated. One hybrid species was prepared by dissociation and reconstitution of a mixture of two variants produced by chemical modification of the native enzyme with succinic anhydride and tetranitromethane, respectively. The succinyl-nitrotyrosyl hybrid was separated from the other members of the hybrid set by DEAE-Sephadex chromatography and then converted to a succinyl-aminotyrosyl hybrid by reduction of the modified tyrosine residues with sodium dithionite. A comparison of the activities of these two hybrids with the activities of the succinyl, nitrotyrosyl and aminotyrosyl derivatives has shown that either the subunits of alkaline phosphatase function independently or if the subunits turnover alternately in a reciprocating mechanism, then the intrinsic activity of each subunit must be strongly dependent on its partner subunit.

  7. Cytochemical localization of acid phosphatase in Leishmania mexicana amazonensis.

    PubMed

    Pimenta, P F; De Souza, W

    1986-01-01

    Acid phosphatase was cytochemically detected at the ultrastructural level in infective and non-infective promastigotes and in amastigotes of the parasitic protozoan Leishmania mexicana amazonensis. Cerium chloride was used as the capture agent of the phosphate liberated during the hydrolysis of the substrate (Na-beta-glycerophosphate). Reaction product, indicative of enzyme activity, was seen in the outer face of the plasma membrane of many, but not all, infective and noninfective promastigote forms. No reaction product was seen in the plasma membrane of amastigote forms. Reaction product was seen in the endoplasmic reticulum, in the Golgi complex, in vesicles located close to the flagellar pocket and in cytoplasmic structures which may represent lysosomes. No reaction product was seen when the substrate was omitted from or sodium fluoride was added to the incubation medium. The possible role played by the acid phosphatase present in the plasma membrane of Leishmania parasites is discussed.

  8. Detection of bacterial phosphatase activity by means of an original and simple test.

    PubMed Central

    Satta, G; Grazi, G; Varaldo, P E; Fontana, R

    1979-01-01

    A new test for the detection of bacterial phosphatase activity has been devised. The test is performed using agar media containing both methyl green (MG) and phenolphthalein diphosphate (PDP); in these media phosphatase-producing strains grow deep-green-stained colonies whereas non-producing strains do not. A total of 739 different strains were tested, including 593 staphylococci, 95 micrococci, 11 streptococci, 10 corynebacteria, 14 enterobacteria, and 16 candidae. All strains found phosphatase-positive according to the conventional phosphatase test displayed deep-green-stained colonies on MG-PDP media, whereas all phosphatase-negative strains showed unstained colonies on the same media. The main advantages of the present phosphatase test as compared with other conventional ones are that it is more simple to perform, it can reveal the phosphatase activity of colonies grown in deep agar, and can be incorporated into commercial multitest kits. PMID:87403

  9. Cytochemical characterization of yolk granule acid phosphatase during early development of the oyster Crassostrea gigas (Thunberg)

    NASA Astrophysics Data System (ADS)

    Wang, Yiyan; Sun, Hushan; Wang, Yanjie; Yan, Dongchun; Wang, Lei

    2015-03-01

    In this study, a cytochemical method and transmission electron microscopy was used to examine acid phosphatase activities of yolk granules throughout the early developmental stages of the Pacific oyster Crassostrea gigas. This study aimed to investigate the dynamic change of yolk granule acid phosphatase, and the mechanisms underlying its involvement in yolk degradation during the early developmental stages of molluscs. Three types of yolk granules (YGI, YGII, and YGIII) that differed in electron density and acid phosphatase reaction were identified in early cleavage, morula, blastula, gastrula, trochophore, and veliger stages. The morphological heterogeneities of the yolk granules were related to acid phosphatase activity and degrees of yolk degradation, indicating the association of acid phosphatase with yolk degradation in embryos and larvae of molluscs. Fusion of yolk granules was observed during embryogenesis and larval development of C. gigas. The fusion of YGI (free of acid phosphatase reaction) with YGII (rich in acid phosphatase reaction) could be the way by which yolk degradation is triggered.

  10. Human HAD phosphatases: structure, mechanism, and roles in health and disease.

    PubMed

    Seifried, Annegrit; Schultz, Jörg; Gohla, Antje

    2013-01-01

    Phosphatases of the haloacid dehalogenase (HAD) superfamily of hydrolases are an ancient and very large class of enzymes that have evolved to dephosphorylate a wide range of low- and high molecular weight substrates with often exquisite specificities. HAD phosphatases constitute approximately one-fifth of all human phosphatase catalytic subunits. While the overall sequence similarity between HAD phosphatases is generally very low, family members can be identified based on the presence of a characteristic Rossmann-like fold and the active site sequence DxDx(V/T). HAD phosphatases employ an aspartate residue as a nucleophile in a magnesium-dependent phosphoaspartyl transferase reaction. Although there is genetic evidence demonstrating a causal involvement of some HAD phosphatases in diseases such as cancer, cardiovascular, metabolic and neurological disorders, the physiological roles of many of these enzymes are still poorly understood. In this review, we discuss the structure and evolution of human HAD phosphatases, and summarize their known functions in health and disease.

  11. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2014-08-01

    We observed that LNCaP cells under steroid-depleted condition had ~4.3 fold decreased cell growth as compared to the cells grown in regular ...with ceramide decreased their growth (~34%) in regular media, whereas in steroid-deprived media, ceramide treatment showed even more potent effect...androgen independent) under regular or steroid-reduced conditions. Our immu- noblot and in vitro phosphatase activity data show that both the

  12. Targeting the Reversibly Oxidized Protein Tyrosine Phosphatase Superfamily

    PubMed Central

    Boivin, Benoit; Yang, Ming; Tonks, Nicholas K.

    2010-01-01

    Controlled production of reactive oxygen species leads to reversible oxidation of protein tyrosine phosphatases (PTPs) and has emerged as an important tier of regulation over phosphorylation-dependent signal transduction. We present a modified cysteinyl-labeling assay that detects reversible oxidation of members of each of the different PTP subclasses. Here, we describe the methods for enriching reversibly oxidized PTPs from complex protein extracts, illustrating the procedure in IMR90 fibroblasts. PMID:20807953

  13. Membrane interaction and functional plasticity of inositol polyphosphate 5-phosphatases.

    PubMed

    Braun, Werner; Schein, Catherine H

    2014-05-06

    In this issue of Structure, Trésaugues and colleagues determined the interaction of membrane-bound phosphoinositides with three clinically significant human inositol polyphosphate 5-phosphatases (I5Ps). A comparison to the structures determined with soluble substrates revealed differences in the binding mode and suggested how the I5Ps and apurinic endonuclease (APE1) activities evolved from the same metal-binding active center.

  14. Impact of ionic aluminium on extracellular phosphatases in acidified lakes.

    PubMed

    Bittl, T; Vrba, J; Nedoma, J; Kopácek, J

    2001-09-01

    We studied direct inhibiting effects of aluminium (Al) on extracellular phosphatases produced by the plankton of acidified lakes in the Bohemian Forest. In laboratory experiments we tested the effect of different Al concentrations (0-1000 microg l(-1)) on kinetic parameters of acid phosphatases (pH optimum approximately 5.0) at pH between 4.5 and 5.2. We observed a significant reduction of an apparent substrate affinity at Al concentrations between 300 and 1000 microg l(-1) at pH 4.5 and 4.8 (but not at 5.2). In contrast, maximum acid phosphatase activity (AcPA) remained unchanged. Such behaviour of saturation kinetics is compatible with the assumption that ionic Al acts as a competitive inhibitor of acid phosphatases. To decide whether the observed Al effects could be explained alternatively by complexation of Al with substrate, we tested statistically the best fits of data with both possible models (competitive versus complexation). Experimental results supported the competitive hypothesis rather than the complexation model suggested originally by some authors. Furthermore, we tested the Al effect within a wide range of pH from 4.0 to 6.0. For pH values < 5.2, the results of an Al-pH matrix experiment gave a more detailed picture: the higher the Al concentration, the wider the pH range in which Al could negatively affect AcPA. The ecological ramifications of this effect were evaluated in the context of field AcPA data on three strongly acidified lakes.

  15. Hypervalent Organochalcogenanes as Inhibitors of Protein Tyrosine Phosphatases

    PubMed Central

    Piovan, Leandro; Wu, Li; Zhang, Zhong-Yin; Andrade, Leandro H.

    2011-01-01

    A series of organochalcogenanes was synthesized and evaluated as protein tyrosine phosphatases (PTPs) inhibitors. The results indicate that organochalcogenanes inactivate the PTPs in a time- and concentration-dependent fashion, most likely through covalent modification of the active site sulfur-moiety by the chalcogen atom. Consequently, organochalcogenanes represent a new class of mechanism-based probes to modulate the PTP-mediated cellular processes. PMID:21240419

  16. phoD Alkaline Phosphatase Gene Diversity in Soil

    PubMed Central

    Kertesz, Michael A.; Bünemann, Else K.

    2015-01-01

    Phosphatase enzymes are responsible for much of the recycling of organic phosphorus in soils. The PhoD alkaline phosphatase takes part in this process by hydrolyzing a range of organic phosphoesters. We analyzed the taxonomic and environmental distribution of phoD genes using whole-genome and metagenome databases. phoD alkaline phosphatase was found to be spread across 20 bacterial phyla and was ubiquitous in the environment, with the greatest abundance in soil. To study the great diversity of phoD, we developed a new set of primers which targets phoD genes in soil. The primer set was validated by 454 sequencing of six soils collected from two continents with different climates and soil properties and was compared to previously published primers. Up to 685 different phoD operational taxonomic units were found in each soil, which was 7 times higher than with previously published primers. The new primers amplified sequences belonging to 13 phyla, including 71 families. The most prevalent phoD genes identified in these soils were affiliated with the orders Actinomycetales (13 to 35%), Bacillales (1 to 29%), Gloeobacterales (1 to 18%), Rhizobiales (18 to 27%), and Pseudomonadales (0 to 22%). The primers also amplified phoD genes from additional orders, including Burkholderiales, Caulobacterales, Deinococcales, Planctomycetales, and Xanthomonadales, which represented the major differences in phoD composition between samples, highlighting the singularity of each community. Additionally, the phoD bacterial community structure was strongly related to soil pH, which varied between 4.2 and 6.8. These primers reveal the diversity of phoD in soil and represent a valuable tool for the study of phoD alkaline phosphatase in environmental samples. PMID:26253682

  17. Low serum alkaline phosphatase activity in Kikuchi-Fujimoto disease

    PubMed Central

    Inamo, Yasuji

    2017-01-01

    Abstract Various laboratory findings are helpful in making a diagnosis of Kikuchi-Fujimoto disease (KFD); however, they are not specific. We found decreased serum alkaline phosphatase (SAP) activity in children with KFD. The levels of SAP fell in the acute phase and recovered during convalescence. We conclude that low SAP activity is a characteristic of KFD and may be an auxiliary diagnostic marker for the disease. PMID:28248884

  18. The phosphatase calcineurin regulates pathological TDP-43 phosphorylation.

    PubMed

    Liachko, Nicole F; Saxton, Aleen D; McMillan, Pamela J; Strovas, Timothy J; Currey, Heather N; Taylor, Laura M; Wheeler, Jeanna M; Oblak, Adrian L; Ghetti, Bernardino; Montine, Thomas J; Keene, C Dirk; Raskind, Murray A; Bird, Thomas D; Kraemer, Brian C

    2016-10-01

    Detergent insoluble inclusions of TDP-43 protein are hallmarks of the neuropathology in over 90 % of amyotrophic lateral sclerosis (ALS) cases and approximately half of frontotemporal dementia (FTLD-TDP) cases. In TDP-43 proteinopathy disorders, lesions containing aggregated TDP-43 protein are extensively post-translationally modified, with phosphorylated TDP-43 (pTDP) being the most consistent and robust marker of pathological TDP-43 deposition. Abnormally phosphorylated TDP-43 has been hypothesized to mediate TDP-43 toxicity in many neurodegenerative disease models. To date, several different kinases have been implicated in the genesis of pTDP, but no phosphatases have been shown to reverse pathological TDP-43 phosphorylation. We have identified the phosphatase calcineurin as an enzyme binding to and catalyzing the removal of pathological C-terminal phosphorylation of TDP-43 in vitro. In C. elegans models of TDP-43 proteinopathy, genetic elimination of calcineurin results in accumulation of excess pTDP, exacerbated motor dysfunction, and accelerated neurodegenerative changes. In cultured human cells, treatment with FK506 (tacrolimus), a calcineurin inhibitor, results in accumulation of pTDP species. Lastly, calcineurin co-localizes with pTDP in degenerating areas of the central nervous system in subjects with FTLD-TDP and ALS. Taken together, these findings suggest calcineurin acts on pTDP as a phosphatase in neurons. Furthermore, patient treatment with calcineurin inhibitors may have unappreciated adverse neuropathological consequences.

  19. Phosphoregulators: Protein Kinases and Protein Phosphatases of Mouse

    PubMed Central

    Forrest, Alistair R.R.; Ravasi, Timothy; Taylor, Darrin; Huber, Thomas; Hume, David A.; Grimmond, Sean

    2003-01-01

    With the completion of the human and mouse genome sequences, the task now turns to identifying their encoded transcripts and assigning gene function. In this study, we have undertaken a computational approach to identify and classify all of the protein kinases and phosphatases present in the mouse gene complement. A nonredundant set of these sequences was produced by mining Ensembl gene predictions and publicly available cDNA sequences with a panel of InterPro domains. This approach identified 561 candidate protein kinases and 162 candidate protein phosphatases. This cohort was then analyzed using TribeMCL protein sequence similarity clustering followed by CLUSTALV alignment and hierarchical tree generation. This approach allowed us to (1) distinguish between true members of the protein kinase and phosphatase families and enzymes of related biochemistry, (2) determine the structure of the families, and (3) suggest functions for previously uncharacterized members. The classifications obtained by this approach were in good agreement with previous schemes and allowed us to demonstrate domain associations with a number of clusters. Finally, we comment on the complementary nature of cDNA and genome-based gene detection and the impact of the FANTOM2 transcriptome project. PMID:12819143

  20. PTPL1: a large phosphatase with a split personality.

    PubMed

    Abaan, Ogan D; Toretsky, Jeffrey A

    2008-06-01

    Protein tyrosine phosphatase, PTPL1, (also known as PTPN13, FAP-1, PTP-BAS, PTP1E) is a non-receptor type PTP and, at 270 kDa, is the largest phosphatase within this group. In addition to the well-conserved PTP domain, PTPL1 contains at least 7 putative macromolecular interaction domains. This structural complexity indicates that PTPL1 may modulate diverse cellular functions, perhaps exerting both positive and negative effects. In accordance with this idea, while certain studies suggest that PTPL1 can act as a tumor-promoting gene other experimental studies have suggested that PTPL1 may function as a tumor suppressor. The role of PTPL1 in the cancer cell is therefore likely to be both complex and context dependent with possible roles including the modulation of growth, stress-response, and cytoskeletal remodeling pathways. Understanding the nature of molecular complexes containing PTPL1, its interaction partners, substrates, regulation and subcellular localization are key to unraveling the complex personality of this protein phosphatase.

  1. Crystallization of recombinant Haemophilus influenzaee (P4) acid phosphatase

    SciTech Connect

    Ou, Zhonghui; Felts, Richard L.; Reilly, Thomas J.; Nix, Jay C.; Tanner, John J.

    2006-05-01

    Lipoprotein e (P4) is a class C acid phosphatase and a potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. Haemophilus influenzae infects the upper respiratory tract of humans and can cause infections of the middle ear, sinuses and bronchi. The virulence of the pathogen is thought to involve a group of surface-localized macromolecular components that mediate interactions at the host–pathogen interface. One of these components is lipoprotein e (P4), which is a class C acid phosphatase and a potential vaccine candidate for nontypeable H. influenzae infections. This paper reports the crystallization of recombinant e (P4) and the acquisition of a 1.7 Å resolution native X-ray diffraction data set. The space group is P4{sub 2}2{sub 1}2, with unit-cell parameters a = 65.6, c = 101.4 Å, one protein molecule per asymmetric unit and 37% solvent content. This is the first report of the crystallization of a class C acid phosphatase.

  2. Acid Phosphatase Development during Ripening of Avocado 1

    PubMed Central

    Sacher, Joseph A.

    1975-01-01

    The activity and subcellular distribution of acid phosphatase were assayed during ethylene-induced ripening of whole fruit or thick slices of avocado (Persea americana Mill. var. Fuerte and Hass). The activity increased up to 30-fold during ripening in both the supernatant fraction and the Triton X-100 extract of the precipitate of a 30,000g centrifugation of tissue homogenates from whole fruit or slices ripening in moist air. Enzyme activity in the residual precipitate after Triton extraction remained constant. The development of acid phosphatase in thick slices ripened in moist air was similar to that in intact fruit, except that enzyme development and ripening were accelerated about 24 hours in the slices. The increase in enzyme activity that occurs in slices ripening in moist air was inhibited when tissue sections were infiltrated with solutions, by aspiration for 2 minutes or by soaking for 2 hours, anytime 22 hours or more after addition of ethylene. This inhibition was independent of the presence or absence of cycloheximide or sucrose (0.3-0.5m). However, the large decline in enzyme activity in the presence of cycloheximide, as compared with the controls, indicated that synthesis of acid phosphatase was occurring at all stages of ripening. PMID:16659087

  3. The role of phosphatases in the initiation of skeletal mineralization.

    PubMed

    Millán, José Luis

    2013-10-01

    Endochondral ossification is a carefully orchestrated process mediated by promoters and inhibitors of mineralization. Phosphatases are implicated, but their identities and functions remain unclear. Mutations in the tissue-nonspecific alkaline phosphatase (TNAP) gene cause hypophosphatasia, a heritable form of rickets and osteomalacia, caused by an arrest in the propagation of hydroxyapatite (HA) crystals onto the collagenous extracellular matrix due to accumulation of extracellular inorganic pyrophosphate (PPi), a physiological TNAP substrate and a potent calcification inhibitor. However, TNAP knockout (Alpl(-/-)) mice are born with a mineralized skeleton and have HA crystals in their chondrocyte- and osteoblast-derived matrix vesicles (MVs). We have shown that PHOSPHO1, a soluble phosphatase with specificity for two molecules present in MVs, phosphoethanolamine and phosphocholine, is responsible for initiating HA crystal formation inside MVs and that PHOSPHO1 and TNAP have nonredundant functional roles during endochondral ossification. Double ablation of PHOSPHO1 and TNAP function leads to the complete absence of skeletal mineralization and perinatal lethality, despite normal systemic phosphate and calcium levels. This strongly suggests that the Pi needed for initiation of MV-mediated mineralization is produced locally in the perivesicular space. As both TNAP and nucleoside pyrophosphohydrolase-1 (NPP1) behave as potent ATPases and pyrophosphatases in the MV compartment, our current model of the mechanisms of skeletal mineralization implicate intravesicular PHOSPHO1 function and Pi influx into MVs in the initiation of mineralization and the functions of TNAP and NPP1 in the extravesicular progression of mineralization.

  4. Isolation of Lysophosphatidic Acid Phosphatase from Developing Peanut Cotyledons1

    PubMed Central

    Shekar, Sunil; Tumaney, Ajay W.; Rao, T.J.V. Sreenivasa; Rajasekharan, Ram

    2002-01-01

    The soluble fraction of immature peanut (Arachis hypogaea) was capable of dephosphorylating [3H]lysophosphatidic acid (LPA) to generate monoacylglycerol (MAG). The enzyme responsible for the generation of MAG, LPA phosphatase, has been identified in plants and purified by successive chromatography separations on octyl-Sepharose, Blue Sepharose, Superdex-75, and heparin-agarose to apparent homogeneity from developing peanuts. This enzyme was purified 5,048-fold to a final specific activity of 858 nmol min−1 mg−1. The enzyme has a native molecular mass of approximately 39 kD determined by gel filtration and migrates as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis with a subunit molecular mass of 39 ± 1.5 kD. The Km values for oleoyl-, stearoyl-, and palmitoyl-sn-glycerol-3-phosphate were determined to be 28.6, 39.3, and 47.9 μm, respectively. The LPA phosphatase was specific to LPA and did not utilize any other substrate such as glycerol-3-phosphate, phosphatidic acid, or p-nitrophenylphosphate. The enzyme activity was stimulated by the low concentrations of detergents such as Triton X-100 and octylglucoside. Cations had no effect on the enzyme activity. Fatty acids, sphingosine, and sphingomyelin at low concentrations stimulated the enzyme activity. The identification of LPA phosphatase in plants demonstrates the existence of MAG biosynthetic machinery in plants. PMID:11891254

  5. Phosphatidate Phosphatase, a Key Regulator of Lipid Homeostasis

    PubMed Central

    Pascual, Florencia; Carman, George M.

    2012-01-01

    Yeast Pah1p phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol. PAP plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The cellular amounts of these lipid intermediates influence the synthesis of triacylglycerol and the pathways by which membrane phospholipids are synthesized. Physiological functions affected by PAP activity include phospholipid synthesis gene expression, nuclear/endoplasmic reticulum membrane growth, lipid droplet formation, and vacuole homeostasis and fusion. Yeast lacking Pah1p PAP activity are acutely sensitive to fatty acid-induced toxicity and exhibit respiratory deficiency. PAP is distinguished in its cellular location, catalytic mechanism, and physiological functions from Dpp1p and Lpp1p lipid phosphate phosphatases that utilize a variety of substrates that include phosphatidate. Phosphorylation/dephosphorylation is a major mechanism by which Pah1p PAP activity is regulated. Pah1p is phosphorylated by cytosolic-associated Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A and is dephosphorylated by the endoplasmic reticulum-associated Nem1p-Spo7p phosphatase. The dephosphorylation of Pah1p stimulates PAP activity and facilitates the association with the membrane/phosphatidate allowing for its reaction and triacylglycerol synthesis. PMID:22910056

  6. Phosphatidate phosphatase regulates membrane phospholipid synthesis via phosphatidylserine synthase.

    PubMed

    Carman, George M; Han, Gil-Soo

    2017-08-16

    The yeast Saccharomyces cerevisiae serves as a model eukaryote to elucidate the regulation of lipid metabolism. In exponentially growing yeast, a diverse set of membrane lipids are synthesized from the precursor phosphatidate via the liponucleotide intermediate CDP-diacylglycerol. As cells exhaust nutrients and progress into the stationary phase, phosphatidate is channeled via diacylglycerol to the synthesis of triacylglycerol. The CHO1-encoded phosphatidylserine synthase, which catalyzes the committed step in membrane phospholipid synthesis via CDP-diacylglycerol, and the PAH1-encoded phosphatidate phosphatase, which catalyzes the committed step in triacylglycerol synthesis are regulated throughout cell growth by genetic and biochemical mechanisms to control the balanced synthesis of membrane phospholipids and triacylglycerol. The loss of phosphatidate phosphatase activity (e.g., pah1Δ mutation) increases the level of phosphatidate and its conversion to membrane phospholipids by inducing Cho1 expression and phosphatidylserine synthase activity. The regulation of the CHO1 expression is mediated through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. Consequently, phosphatidate phosphatase activity regulates phospholipid synthesis through the transcriptional regulation of the phosphatidylserine synthase enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Crosstalk between kinases, phosphatases and miRNAs in cancer.

    PubMed

    Abrantes, Júlia L F; Tornatore, Thaís F; Pelizzaro-Rocha, Karin J; de Jesus, Marcelo B; Cartaxo, Rodrigo T; Milani, Renato; Ferreira-Halder, Carmen V

    2014-12-01

    Reversible phosphorylation of proteins, performed by kinases and phosphatases, is the major post translational protein modification in eukaryotic cells. This intracellular event represents a critical regulatory mechanism of several signaling pathways and can be related to a vast array of diseases, including cancer. Cancer research has produced increasing evidence that kinase and phosphatase activity can be compromised by mutations and also by miRNA silencing, performed by small non-coding and endogenously produced RNA molecules that lead to translational repression. miRNAs are believed to target about one-third of human mRNAs while a single miRNA may target about 200 transcripts simultaneously. Regulation of the phosphorylation balance by miRNAs has been a topic of intense research over the last years, spanning topics going as far as cancer aggressiveness and chemotherapy resistance. By addressing recent studies that have shown miRNA expression patterns as phenotypic signatures of cancers and how miRNA influence cellular processes such as apoptosis, cell cycle control, angiogenesis, inflammation and DNA repair, we discuss how kinases, phosphatases and miRNAs cooperatively act in cancer biology.

  8. An alkaline phosphatase reporter for use in Clostridium difficile.

    PubMed

    Edwards, Adrianne N; Pascual, Ricardo A; Childress, Kevin O; Nawrocki, Kathryn L; Woods, Emily C; McBride, Shonna M

    2015-04-01

    Clostridium difficile is an anaerobic, Gram-positive pathogen that causes severe gastrointestinal disease in humans and other mammals. C. difficile is notoriously difficult to work with and, until recently, few tools were available for genetic manipulation and molecular analyses. Despite the recent advances in the field, there is no simple or cost-effective technique for measuring gene transcription in C. difficile other than direct transcriptional analyses (e.g., quantitative real-time PCR and RNA-seq), which are time-consuming, expensive and difficult to scale-up. We describe the development of an in vivo reporter assay that can provide qualitative and quantitative measurements of C. difficile gene expression. Using the Enterococcus faecalis alkaline phosphatase gene, phoZ, we measured expression of C. difficile genes using a colorimetric alkaline phosphatase assay. We show that inducible alkaline phosphatase activity correlates directly with native gene expression. The ability to analyze gene expression using a standard reporter is an important and critically needed tool to study gene regulation and design genetic screens for C. difficile and other anaerobic clostridia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. In vitro enzymatic assays of protein tyrosine phosphatase 1B.

    PubMed

    Lubben, T; Clampit, J; Stashko, M; Trevillyan, J; Jirousek, M R

    2001-08-01

    Many hormone or growth factor receptors signal via the activation of protein-tyrosine kinases and phosphatases. Alteration of the phosphorylation state of tyrosine residues in certain proteins can directly regulate enzyme activity or cause formation of protein complexes necessary for transducing intracellular signals. Genetic and biochemical evidence also implicates protein-tyrosine phosphatases in several disease processes, including negative regulation of insulin receptor signaling at the level of the insulin receptor and perhaps in signaling at the IRS-1 level. The expression of protein tyrosine phosphatase-1B (PTP1B) is elevated in muscle and adipose tissue in insulin-resistant states both in man and rodents suggesting that PTP1B may play a role in the insulin-resistant state associated with diabetes and obesity. As described in this unit, PTP1B activity can be determined with the small molecule substrate, p-nitrophenyl phosphate (pNPP), in which the cleavage of the phosphate results in production of p-nitrophenol (pNP) and an increase in absorbance at 405 nm. Alternatively, PTP1B activity can be measured as described using model phosphotyrosyl-containing peptide substrates in which the release of free phosphate from the peptide is determined using a malachite green colorimetric assay.

  10. Calcitonin releases acid phosphatase from rat ventral prostate explants.

    PubMed

    Latif, A; Nakhla, A M

    1994-01-01

    Inclusion of salmon calcitonin in the culture medium of rat ventral prostate explants diminished l-tartarate-sensitive acid phosphatase activity in the tissues with a concomitant increment of the enzyme activity in the medium. The effect of the hormone was dose-dependent for a dose range of 10(-12)-10(-6) M. Acid phosphatase activity in prostate explants decreased from 38.6 +/- 3.5 to 20.5 +/- 2.8, whereas it increased from 0.60 +/- 0.15 to 2.80 +/- 0.40 nmol p-nitrophenol liberated/mg protein/30 min in the culture medium. Tissues exposed to 10(-6) M salmon calcitonin had higher acetylcholinesterase activity (8.8 +/- 0.7) than non-exposed ones (6.2 +/- 0.5 mumol substrate hydrolyzed/g tissue/min). These results suggest that locally produced calcitonin causes a release for prostatic acid phosphatase from prostate tissues possibly through its interaction with the cholinergic system.

  11. Physiological aspects of alkaline phosphatase in selected cyanobacteria.

    PubMed

    Doonan, B B; Jensen, T E

    1980-01-01

    The alkaline phosphatase of Plectonema boryanum shows a considerable increase in activity following placement of the cells in a phosphate free medium. Five days of phosphate starvation result in a 14-fold increase of alkaline phosphatase activity. Growth in the presence of inhibitors of transcription and translation indicate that the synthesis of the enzyme is de novo. Orthophosphate causes an immediate inhibition of enzyme activity. Enzyme was extracted from P. boryanum with lysozyme or polymyxin B treatment in order to make comparative studies of cell bound and cell free enzyme. Of several enzyme specific inhibitors tested, mercuric chloride was the most effective. Temperature studies showed that the cell bound enzyme was most active at 40 degrees C while the cell free enzyme was most active at 70 degrees C. The pH optimum was 9 for the cell free enzyme, and 8.8 for the cell bound. The enzyme was tested to determine if it could hydrolyse a number of different organic compounds. It hydrolysed p-nitrophenol phosphate 100%, fructose-6-phosphate 45%, beta-glycerol phosphate 25% and other compounds to a lesser degree. Of seventeen other Cyanobacteria tested for alkaline phosphatase, all were positive, and of these eleven were inducible for the enzyme. Ten of the isolates released some of the enzyme into the culture medium. Michaelis constants for the enzyme were also determined.

  12. Radiation inactivation analysis of rat liver microsomal glucose-6-phosphatase

    SciTech Connect

    Ness, G.C.; Sukalski, K.A.; Sample, C.E.; Pendleton, L.C.; McCreery, M.J.; Nordlie, R.C.

    1989-05-05

    Radiation inactivation analysis was utilized to estimate the sizes of the units catalyzing the various activities of hepatic microsomal glucose-6-phosphatase. This technique revealed that the target molecular weights for mannose-6-P phosphohydrolase, glucose-6-P phosphohydrolase, and carbamyl-P:glucose phosphotransferase activities were all about Mr 75,000. These results are consistent with the widely held view that all of these activities are catalyzed by the same protein or proteins. Certain observations indicate that the molecular organization of microsomal glucose-6-phosphatase is better described by the conformational hypothesis which envisions the enzyme as a single covalent structure rather than by the substrate transport model which requires the participation of several physically separate polypeptides. These include the findings: (1) that the target sizes for glucose-6-P phosphohydrolase and carbamyl-P:glucose phosphotransferase activities were not larger than that for mannose-6-P phosphohydrolase in intact microsomes and (2) that the target size for glucose-6-P phosphohydrolase in disrupted microsomes was not less than that observed in intact microsomes. These findings are most consistent with a model for glucose-6-phosphatase of a single polypeptide or a disulfide-linked dimer which spans the endoplasmic reticulum with the various activities of this multifunctional enzyme residing in distinct protein domains.

  13. Centromeric binding and activity of Protein Phosphatase 4

    PubMed Central

    Lipinszki, Zoltan; Lefevre, Stephane; Savoian, Matthew S.; Singleton, Martin R.; Glover, David M.; Przewloka, Marcin R.

    2015-01-01

    The cell division cycle requires tight coupling between protein phosphorylation and dephosphorylation. However, understanding the cell cycle roles of multimeric protein phosphatases has been limited by the lack of knowledge of how their diverse regulatory subunits target highly conserved catalytic subunits to their sites of action. Phosphoprotein phosphatase 4 (PP4) has been recently shown to participate in the regulation of cell cycle progression. We now find that the EVH1 domain of the regulatory subunit 3 of Drosophila PP4, Falafel (Flfl), directly interacts with the centromeric protein C (CENP-C). Unlike other EVH1 domains that interact with proline-rich ligands, the crystal structure of the Flfl amino-terminal EVH1 domain bound to a CENP-C peptide reveals a new target-recognition mode for the phosphatase subunit. We also show that binding of Flfl to CENP-C is required to bring PP4 activity to centromeres to maintain CENP-C and attached core kinetochore proteins at chromosomes during mitosis. PMID:25562660

  14. The role of serine/threonine protein phosphatases in exocytosis.

    PubMed Central

    Sim, Alistair T R; Baldwin, Monique L; Rostas, John A P; Holst, Jeff; Ludowyke, Russell I

    2003-01-01

    Modulation of exocytosis is integral to the regulation of cellular signalling, and a variety of disorders (such as epilepsy, hypertension, diabetes and asthma) are closely associated with pathological modulation of exocytosis. Emerging evidence points to protein phosphatases as key regulators of exocytosis in many cells and, therefore, as potential targets for the design of novel therapies to treat these diseases. Diverse yet exquisite regulatory mechanisms have evolved to direct the specificity of these enzymes in controlling particular cell processes, and functionally driven studies have demonstrated differential regulation of exocytosis by individual protein phosphatases. This Review discusses the evidence for the regulation of exocytosis by protein phosphatases in three major secretory systems, (1) mast cells, in which the regulation of exocytosis of inflammatory mediators plays a major role in the respiratory response to antigens, (2) insulin-secreting cells in which regulation of exocytosis is essential for metabolic control, and (3) neurons, in which regulation of exocytosis is perhaps the most complex and is essential for effective neurotransmission. PMID:12749763

  15. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase

    DOE PAGES

    Story, Sandra; Brigmon, Robin L.

    2016-12-19

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soilmore » resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5 mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. Finally, these results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications.« less

  16. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase.

    PubMed

    Story, Sandra; Brigmon, Robin L

    2017-03-01

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soil resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. These results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications. Copyright © 2016. Published by Elsevier Inc.

  17. Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase

    SciTech Connect

    Story, Sandra; Brigmon, Robin L.

    2016-12-19

    Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soil resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5 mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. Finally, these results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications.

  18. Combination of alkaline phosphatase anti-alkaline phosphatase (APAAP)- and avidin-biotin-alkaline phosphatase complex (ABAP)-techniques for amplification of immunocytochemical staining of human testicular tissue.

    PubMed

    Davidoff, M S; Schulze, W; Holstein, A F

    1991-01-01

    An amplification procedure was developed for the visualization of antigens in human testis using monoclonal antibodies against desmin and vimentin. The technique combines the high sensitive and specific APAAP- and ABAP-methods. Depending on the quality of the antibodies used and the processing of the material prior to the immunocytochemical staining the amplification technique may be applied either as a single APAAP and ABAP- or as a double APAAP and ABAP-combination. Especially after the double amplification reaction a distinct increase of the staining intensity of the vimentin- (in Sertoli cells, myofibroblasts of the lamina propria, and fibroblasts of the interstitium) and desmin- (in myofibroblasts of the lamina propria and smooth muscle cells of the blood vessels) like immunoreactivity was observed. If different diazonium salts were used for the visualization of the alkaline phosphatase activity (e.g. Fast Red TR Salt, Fast Blue BB Salt) desmin- and vimentin-like immunoreactivity can be demonstrated in the same tissue section in a double sequential staining approach. For double staining, the alkaline phosphatase technique may be combined successfully with a technique or a combination that uses peroxidase as a marker.

  19. Clarifying and Defining Library Services.

    ERIC Educational Resources Information Center

    Shubert, Joseph F., Ed.; Josey, E. J., Ed.

    1991-01-01

    This issue presents articles which, in some way, help to clarify and define library services. It is hoped that this clarification in library service will serve to secure the resources libraries need to serve the people of New York. The following articles are presented: (1) Introduction: "Clarifying and Defining Library Services" (Joseph…

  20. Acid phosphatase role in chickpea/maize intercropping.

    PubMed

    Li, S M; Li, L; Zhang, F S; Tang, C

    2004-08-01

    Organic P comprises 30-80 % of the total P in most agricultural soils. It has been proven that chickpea facilitates P uptake from an organic P source by intercropped wheat. In this study, acid phosphatase excreted from chickpea roots is quantified and the contribution of acid phosphatase to the facilitation of P uptake by intercropped maize receiving phytate is examined. For the first experiment using hydroponics, maize (Zea mays 'Zhongdan No. 2') and chickpea (Cicer arietinum 'Sona') were grown in either the same or separate containers, and P was supplied as phytate, KH2PO4 at 0.25 mmol P L(-1), or not at all. The second experiment involved soil culture with three types of root separation between the two species: (1) plastic sheet, (2) nylon mesh, and (3) no barrier. Maize plants were grown in one compartment and chickpea in the other. Phosphorus was supplied as phytate, Ca(H2PO4)2 at 50 mg P kg(-1), or no P added. In the hydroponics study, the total P uptake by intercropped maize supplied with phytate was 2.1-fold greater than when it was grown as a monoculture. In the soil experiment, when supplied with phytate, total P uptake by maize with mesh barrier and without root barrier was 2.2 and 1.5 times, respectively, as much as that with solid barrier. In both experiments, roots of both maize and chickpea supplied with phytate and no P secreted more acid phosphatase than those with KH2PO4 or Ca(H2PO4)2. However, average acid phosphatase activity of chickpea roots supplied with phytate was 2-3-fold as much as maize. Soil acid phosphatase activity in the rhizosphere of chickpea was also significantly higher than maize regardless of P sources. Chickpea can mobilize organic P in both hydroponic and soil cultures, leading to an interspecific facilitation in utilization of organic P in maize/chickpea intercropping.

  1. Proteomic analysis of protein phosphatase Z1 from Candida albicans.

    PubMed

    Márkus, Bernadett; Szabó, Krisztina; Pfliegler, Walter P; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Csősz, Éva; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for Ca

  2. Purification and characterization of a low-molecular-weight acid phosphatase--a phosphotyrosyl-protein phosphatase from bovine heart.

    PubMed

    Zhang, Z Y; Van Etten, R L

    1990-10-01

    A low-molecular-weight acid phosphatase that is representative of a group recently shown to be phosphotyrosyl protein phosphatases was purified to homogeneity from bovine heart. The enzyme was a monomer with a molecular mass of 18 kDa and had an isoelectric point of 7.0. The absorption coefficient, E1% 1cm was 9.65 at 280 nm. The enzyme had pH optima of 5.3 and 6.0 with the substrates p-nitrophenyl phosphate and tyrosine phosphate, respectively. When measured at pH 5 and 37 degrees C, the enzyme had specific activities of 114 and 86 mumol min-1 mg-1 for p-nitrophenyl phosphate and tyrosine O-phosphate, respectively, while the Km values were 0.38 and 14 mM. The enzyme was highly specific for aryl monophosphate esters and showed little or no activity toward aliphatic phosphate esters, with the remarkable exception of flavin mononucleotide (FMN) and certain of its structural analogs. As shown by 31P NMR data, the activity toward FMN was due to the hydrolysis of one of the eight components present in the (commercial) sample. Both molybdate and vanadate were potent inhibitors, with inhibition constants of 37 and 29 microM, respectively; tartrate and fluoride had little effect on enzymatic activity. A two-stage reversible denaturation of the enzyme by guanidine HCl was observed with midpoints of 0.25 and 1.75 M, respectively. The amino acid composition was homologous to the low-molecular-weight acid phosphatases from other tissue. The enzyme showed immunological cross-reactivity against low-molecular-weight human liver acid phosphatase. There were 7 or 8 accessible cysteines on the monomeric protein and at least one was essential for enzyme activity. The enzyme also had phosphotransferase activity, for example transferring phosphate from p-nitrophenyl phosphate to a wide variety of alcohol acceptors.

  3. Identification of a non-purple tartrate-resistant acid phosphatase: an evolutionary link to Ser/Thr protein phosphatases?

    PubMed Central

    Hadler, Kieran S; Huber, Thomas; Cassady, A Ian; Weber, Jane; Robinson, Jodie; Burrows, Allan; Kelly, Gregory; Guddat, Luke W; Hume, David A; Schenk, Gerhard; Flanagan, Jack U

    2008-01-01

    Background Tartrate-resistant acid phosphatases (TRAcPs), also known as purple acid phosphatases (PAPs), are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. The human enzyme is a major histochemical marker for the diagnosis of bone-related diseases. TRAcPs can occur as a small form possessing only the ~35 kDa catalytic domain, or a larger ~55 kDa form possessing both a catalytic domain and an additional N-terminal domain of unknown function. Due to its role in bone resorption the 35 kDa TRAcP has become a promising target for the development of anti-osteoporotic chemotherapeutics. Findings A new human gene product encoding a metallohydrolase distantly related to the ~55 kDa plant TRAcP was identified and characterised. The gene product is found in a number of animal species, and is present in all tissues sampled by the RIKEN mouse transcriptome project. Construction of a homology model illustrated that six of the seven metal-coordinating ligands in the active site are identical to that observed in the TRAcP family. However, the tyrosine ligand associated with the charge transfer transition and purple color of TRAcPs is replaced by a histidine. Conlusion The gene product identified here may represent an evolutionary link between TRAcPs and Ser/Thr protein phosphatases. Its biological function is currently unknown but is unlikely to be associated with bone metabolism. PMID:18771593

  4. Identification of a non-purple tartrate-resistant acid phosphatase: an evolutionary link to Ser/Thr protein phosphatases?

    PubMed

    Hadler, Kieran S; Huber, Thomas; Cassady, A Ian; Weber, Jane; Robinson, Jodie; Burrows, Allan; Kelly, Gregory; Guddat, Luke W; Hume, David A; Schenk, Gerhard; Flanagan, Jack U

    2008-09-04

    Tartrate-resistant acid phosphatases (TRAcPs), also known as purple acid phosphatases (PAPs), are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. The human enzyme is a major histochemical marker for the diagnosis of bone-related diseases. TRAcPs can occur as a small form possessing only the ~35 kDa catalytic domain, or a larger ~55 kDa form possessing both a catalytic domain and an additional N-terminal domain of unknown function. Due to its role in bone resorption the 35 kDa TRAcP has become a promising target for the development of anti-osteoporotic chemotherapeutics. A new human gene product encoding a metallohydrolase distantly related to the ~55 kDa plant TRAcP was identified and characterised. The gene product is found in a number of animal species, and is present in all tissues sampled by the RIKEN mouse transcriptome project. Construction of a homology model illustrated that six of the seven metal-coordinating ligands in the active site are identical to that observed in the TRAcP family. However, the tyrosine ligand associated with the charge transfer transition and purple color of TRAcPs is replaced by a histidine. The gene product identified here may represent an evolutionary link between TRAcPs and Ser/Thr protein phosphatases. Its biological function is currently unknown but is unlikely to be associated with bone metabolism.

  5. Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation.

    PubMed

    Yabe, Ryotaro; Miura, Akane; Usui, Tatsuya; Mudrak, Ingrid; Ogris, Egon; Ohama, Takashi; Sato, Koichi

    2015-01-01

    Protein phosphatase 2A (PP2A) is a conserved essential enzyme that is implicated as a tumor suppressor based on its central role in phosphorylation-dependent signaling pathways. Protein phosphatase methyl esterase (PME-1) catalyzes specifically the demethylation of the C-terminal Leu309 residue of PP2A catalytic subunit (PP2Ac). It has been shown that PME-1 affects the activity of PP2A by demethylating PP2Ac, but also by directly binding to the phosphatase active site, suggesting loss of PME-1 in cells would enhance PP2A activity. However, here we show that PME-1 knockout mouse embryonic fibroblasts (MEFs) exhibit lower PP2A activity than wild type MEFs. Loss of PME-1 enhanced poly-ubiquitination of PP2Ac and shortened the half-life of PP2Ac protein resulting in reduced PP2Ac levels. Chemical inhibition of PME-1 and rescue experiments with wild type and mutated PME-1 revealed methyl-esterase activity was necessary to maintain PP2Ac protein levels. Our data demonstrate that PME-1 methyl-esterase activity protects PP2Ac from ubiquitin/proteasome degradation.

  6. Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor.

    PubMed

    Sakata, Souhei; Okamura, Yasushi

    2014-03-01

    The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor.

  7. Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor

    PubMed Central

    Sakata, Souhei; Okamura, Yasushi

    2014-01-01

    The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor. PMID:24277865

  8. Tyrosine phosphatases as key regulators of StAR induction and cholesterol transport: SHP2 as a potential tyrosine phosphatase involved in steroid synthesis.

    PubMed

    Cooke, Mariana; Mele, Pablo; Maloberti, Paula; Duarte, Alejandra; Poderoso, Cecilia; Orlando, Ulises; Paz, Cristina; Cornejo Maciel, Fabiana; Podestá, Ernesto J

    2011-04-10

    The phospho-dephosphorylation of intermediate proteins is a key event in the regulation of steroid biosynthesis. In this regard, it is well accepted that steroidogenic hormones act through the activation of serine/threonine (Ser/Thr) protein kinases. Although many cellular processes can be regulated by a crosstalk between different kinases and phosphatases, the relationship of Ser/Thr phosphorylation and tyrosine (Tyr)-dephosphorylation is a recently explored field in the regulation of steroid synthesis. Indeed in steroidogenic cells, one of the targets of hormone-induced Ser/Thr phosphorylation is a protein tyrosine phosphatase. Whereas protein tyrosine phosphatases were initially regarded as household enzymes with constitutive activity, dephosphorylating all the substrates they encountered, evidence is now accumulating that protein tyrosine phosphatases are tightly regulated by various mechanisms. Here, we will describe the role of protein tyrosine phosphatases in the regulation of steroid biosynthesis, relating them to steroidogenic acute regulatory protein, arachidonic acid metabolism and mitochondrial rearrangement.

  9. Structural basis for the glucan phosphatase activity of Starch Excess4

    SciTech Connect

    Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.; Meekins, David A.; Guo, Hou-Fu; Kim, Youngjun; Gentry, Matthew S.

    2010-11-12

    Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structure of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.

  10. Gallium nitrate inhibits alkaline phosphatase activity in a differentiating mesenchymal cell culture.

    PubMed

    Boskey, A L; Ziecheck, W; Guidon, P; Doty, S B

    1993-02-01

    The effect of gallium nitrate on alkaline phosphatase activity in a differentiating chick limb-bud mesenchymal cell culture was monitored in order to gain insight into the observation that rachitic rats treated with gallium nitrate failed to show the expected increase in serum alkaline phosphatase activity. Cultures maintained in media containing 15 microM gallium nitrate showed drastically decreased alkaline phosphatase activities in the absence of significant alterations in total protein synthesis and DNA content. However, addition of 15 microM gallium nitrate to cultures 18 h before assay for alkaline phosphatase activity had little effect. At the light microscopic and electron microscopic level, gallium-treated cultures differed morphologically from gallium-free cultures: with gallium present, there were fewer hypertrophic chondrocytes and cartilage nodules were flatter and further apart. Because of altered morphology, staining with an antibody against chick cartilage alkaline phosphatase appeared less extensive; however, all nodules stained equivalently relative to gallium-free controls. Histochemical staining for alkaline phosphatase activity was negative in gallium-treated cultures, demonstrating that the alkaline phosphatase protein present was not active. The defective alkaline phosphatase activity in cultures maintained in the presence of gallium was also evidenced when cultures were supplemented with the alkaline phosphatase substrate, beta-glycerophosphate (beta GP). The data presented suggest that gallium inhibits alkaline phosphatase activity in this culture system and that gallium causes alterations in the differentiation of mesenchymal cells into hypertrophic chondrocytes.

  11. Characterization of a tyrosine phosphatase activity in the oogenesis of Periplaneta americana.

    PubMed

    Oliveira, D M P; Machado, E A

    2006-09-01

    In this work, phosphatase activity was characterized in the ovary and the haemolymph of Periplaneta americana. The optimum pH for these activities was 4.0, and a temperature of 44 degrees C was ideal for the maximal enzyme activity. The phosphatase activities were inhibited by NaF, sodium tartrate, Pi, sodium orthovanadate, and ammonium molybdate. The ovarian phosphatase activity at pH 4.0 was almost exclusive against phosphotyrosine, with little or no effect on the residues of phosphoserine or phosphothreonine. These results indicate that this phosphatase activity is due to the presence of an acid tyrosine phosphatase. The phosphatase activities of acid extracts from P. americana ovaries (OEX) and an acid extract from P. americana haemolymph (HEX) were analyzed in non-denaturant gel electrophoresis using an analog substrate beta-naphtyl phosphate. The gel revealed two bands with phosphatase activity in the ovary and one band in the haemolymph; these bands were excised and submitted to a 10% SDS-PAGE showing a single 70-kDa polypeptide in both samples. Histochemistry of the ovary with alpha-naphtyl phosphate for localization of acid phosphatase activity showed mainly labeling associated to the oocyte peripheral vesicles, basal lamina, and between follicle cells. Electron microscopy analysis showed that acid phosphatase was localized in small peripheral vesicles in the oocyte, but not inside yolk granules. The possible role of this phosphatase during oogenesis and embryogenesis is also discussed in this article.

  12. Glycerol-3-phosphate phosphatase/PGP: Role in intermediate metabolism and target for cardiometabolic diseases.

    PubMed

    Possik, Elite; Madiraju, S R Murthy; Prentki, Marc

    2017-08-04

    Metabolic diseases, including obesity, type 2 diabetes, and metabolic syndrome arise because of disturbances in glucose and fat metabolism, which impact associated physiological events such as insulin secretion and action, fat storage and oxidation. Even though, decades of research has contributed to our current understanding of the components involved in glucose and fat metabolism and their regulation, that led to the development of many therapeutics, there are still many unanswered questions. Glycerol-3-phosphate (Gro3P), which is formed during glycolysis, is at the intersection of glucose and fat metabolism, and the availability of this metabolite can regulate energy and intermediary metabolism in mammalian cells. During the course of evolution, mammalian cells are assumed to have lost the capacity to directly hydrolyze Gro3P to glycerol, until the recent discovery from our laboratory showing that a previously known mammalian enzyme, phosphoglycolate phosphatase (PGP), can function as Gro3P phosphatase (G3PP) and regulate this metabolite levels. Emerging evidence indicates that G3PP/PGP is an evolutionarily conserved "multi-tasking" enzyme that belongs to the superfamily of haloacid dehalogenase-like phosphatase enzymes, and is capable of hydrolyzing Gro3P, an abundant physiologically relevant substrate, as well as other metabolites including 2-phosphoglycolate, 4-phospherythronate and 2-phospholactate, which are present in much smaller amounts in cells, under normal conditions. G3PP, by regulating Gro3P levels, plays a critical role in intermediary metabolism, including glycolysis, glucose oxidation, cellular redox and ATP production, gluconeogenesis, esterification of fatty acids towards glycerolipid synthesis and fatty acid oxidation. Because of G3PP's ability to regulate energy and intermediary metabolism as well as physiological functions such as insulin secretion, hepatic glucose production, and fat synthesis, storage and oxidation, the pathophysiological

  13. The Problem of Defining Intelligence.

    ERIC Educational Resources Information Center

    Lubar, David

    1981-01-01

    The major philosophical issues surrounding the concept of intelligence are reviewed with respect to the problems surrounding the process of defining and developing artificial intelligence (AI) in computers. Various current definitions and problems with these definitions are presented. (MP)

  14. Crack-Defined Electronic Nanogaps.

    PubMed

    Dubois, Valentin; Niklaus, Frank; Stemme, Göran

    2016-03-16

    Achieving near-atomic-scale electronic nanogaps in a reliable and scalable manner will facilitate fundamental advances in molecular detection, plasmonics, and nanoelectronics. Here, a method is shown for realizing crack-defined nanogaps separating TiN electrodes, allowing parallel and scalable fabrication of arrays of sub-10 nm electronic nanogaps featuring individually defined gap widths. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The composition and function of the striatin-interacting phosphatases and kinases (STRIPAK) complex in fungi.

    PubMed

    Kück, Ulrich; Beier, Anna M; Teichert, Ines

    2016-05-01

    The striatin-interacting phosphatases and kinases (STRIPAK) complex is a highly conserved eukaryotic protein complex that was recently described for diverse animal and fungal species. Here, we summarize our current knowledge about the composition and function of the STRIPAK complex from the ascomycete Sordaria macrospora, which we discovered by investigating sexually sterile mutants (pro), having a defect in fruiting body development. Mass spectrometry and yeast two-hybrid analysis defined core subunits of the STRIPAK complex, which have structural homologs in animal and other fungal organisms. These subunits (and their mammalian homologs) are PRO11 (striatin), PRO22 (STRIP1/2), SmMOB3 (Mob3), PRO45 (SLMAP), and PP2AA, the structural, and PP2Ac, the catalytic subunits of protein phosphatase 2A (PP2A). Beside fruiting body formation, the STRIPAK complex controls vegetative growth and hyphal fusion in S. macrospora. Although the contribution of single subunits to diverse cellular and developmental processes is not yet fully understood, functional analysis has already shown that mammalian homologs are able to substitute the function of distinct fungal STRIPAK subunits. This underscores the view that fungal model organisms serve as useful tools to get a molecular insight into cellular and developmental processes of eukaryotes in general. Future work will unravel the precise localization of single subunits within the cell and decipher their STRIPAK-related and STRIPAK-independent functions. Finally, evidence is accumulating that there is a crosstalk between STRIPAK and various signaling pathways, suggesting that eukaryotic development is dependent on STRIPAK signaling. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. c-Jun controls the efficiency of MAP kinase signaling by transcriptional repression of MAP kinase phosphatases

    SciTech Connect

    Sprowles, Amy; Wu Yimi; Kung, H.-J.; Wisdom, Ron . E-mail: ronald.wisdom@ucdmc.ucdavis.edu

    2005-08-15

    The mammalian JNK signaling pathway regulates the transcriptional response of cells to environmental stress, including UV irradiation. This signaling pathway is composed of a classical MAP kinase cascade; activation results in phosphorylation of the transcription factor substrates c-Jun and ATF2, and leads to changes in gene expression. The defining components of this pathway are conserved in the fission yeast S. pombe, where the genetic studies have shown that the ability of the JNK homolog Spc1 to be activated in response to UV irradiation is dependent on the presence of the transcription factor substrate Atf1. We have used genetic analysis to define the role of c-Jun in activation of the mammalian JNK signaling pathway. Our results show that optimal activation of JNK requires the presence of its transcription factor substrate c-Jun. Mutational analysis shows that the ability of c-Jun to support efficient activation of JNK requires the ability of Jun to bind DNA, suggesting a transcriptional mechanism. Consistent with this, we show that c-Jun represses the expression of several MAP kinase phosphatases. In the absence of c-Jun, the increased expression of MAP kinase phosphatases leads to impaired activation of the ERK, JNK, and p38 MAP kinases after pathway activation. The results show that one function of c-Jun is to regulate the efficiency of signaling by the ERK, p38, and JNK MAP kinases, a function that is likely to affect cellular responses to many different stimuli.

  17. Mutational analysis of a Ser/Thr phosphatase. Identification of residues important in phosphoesterase substrate binding and catalysis.

    PubMed

    Zhuo, S; Clemens, J C; Stone, R L; Dixon, J E

    1994-10-21

    The Ser/Thr phosphoprotein phosphatases (PPases) display similarities in amino acid sequence and biochemical properties. Most members of this family require transition metal ions for activity. The smallest family member, the bacteriophage lambda PPase (lambda-PPase), has been successfully overexpressed in Escherichia coli, purified, and characterized (Zhuo, S., Clemens, J.C., Hakes, D.J., Barford, D., and Dixon, J. E. (1993) J. Biol. Chem. 268, 17754-17761). Site-directed mutagenesis has now been employed to define amino acid residues in lambda-PPase required for metal ion binding and catalysis. Conservative amino acid substitutions at residues Asp20, His22, Asp49, His76, and Glu77 affected lambda-PPase catalysis and metal ion binding, whereas substitutions at residues Arg53 and Arg73 affected catalysis and substrate binding. Each of these residues is invariant in all phosphoprotein phosphatases, suggesting that these residues may play important roles in binding and catalysis in all of the PPases. Computer-assisted sequence alignment further revealed that lambda-PPase residues Asp20, His22, Asp49, His76, Arg53, and Arg73 lie within three larger regions of PPase sequence identity with the consensus sequence (DXH-(approximately 25)-GDXXD-(approximately 25)-GNHD/E). This motif can be found in a wide variety of phosphoesterases unrelated to the PPases and defines structural and catalytic features utilized by a diverse group of enzymes for the hydrolysis of phosphate esters.

  18. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    SciTech Connect

    Robert J. Martinez; Melanie J. Beazley; Samuel M. Webb; Martial Taillefert; and Patricia A. Sobecky

    2007-04-19

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO4 3- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 μM dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  19. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function

    PubMed Central

    Bharadwaj, Rajnish; Cunningham, Kathleen M.; Zhang, Ke; Lloyd, Thomas E.

    2016-01-01

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS. PMID:26662798

  20. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    SciTech Connect

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-10

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is approx. 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing approx. 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 ..mu..M, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of approx. 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH/sub 2/ groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with (..gamma..-/sup 32/P)ATP leads to the incorporation of 0.33 mole /sup 33/P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed.

  1. Characterization of the protein tyrosine phosphatase PRL from Entamoeba histolytica.

    PubMed

    Ramírez-Tapia, Ana Lilia; Baylón-Pacheco, Lidia; Espíritu-Gordillo, Patricia; Rosales-Encina, José Luis

    2015-12-01

    Protein tyrosine phosphatase of regenerating liver (PRL) is a group of phosphatases that has not been broadly studied in protozoan parasites. In humans, PRLs are involved in metastatic cancer, the promotion of cell migration and invasion. PTPs have been increasingly recognized as important effectors of host-pathogen interactions. We characterized the only putative protein tyrosine phosphatase PRL (PTP EhPRL) in the eukaryotic human intestinal parasite Entamoeba histolytica. Here, we reported that the EhPRL protein possessed the classical HCX5R catalytic motif of PTPs and the CAAX box characteristic of the PRL family and exhibited 31-32% homology with the three human PRL isoforms. In amebae, the protein was expressed at low but detectable levels. The recombinant protein (rEhPRL) had enzymatic activity with the 3-o-methyl fluorescein phosphate (OMFP) substrate; this enzymatic activity was inhibited by the PTP inhibitor o-vanadate. Using immunofluorescence we showed that native EhPRL was localized to the cytoplasm and plasma membrane. When the trophozoites interacted with collagen, EhPRL relocalized over time to vesicle-like structures. Interaction with fibronectin increased the presence of the enzyme in the cytoplasm. Using RT-PCR, we demonstrated that EhPRL mRNA expression was upregulated when the trophozoites interacted with collagen but not with fibronectin. Trophozoites recovered from amoebic liver abscesses showed higher EhPRL mRNA expression levels than normal trophozoites. These results strongly suggest that EhPRL may play an important role in the biology and adaptive response of the parasite to the host environment during amoebic liver abscess development, thereby participating in the pathogenic mechanism.

  2. FIG4 regulates lysosome membrane homeostasis independent of phosphatase function.

    PubMed

    Bharadwaj, Rajnish; Cunningham, Kathleen M; Zhang, Ke; Lloyd, Thomas E

    2016-02-15

    FIG4 is a phosphoinositide phosphatase that is mutated in several diseases including Charcot-Marie-Tooth Disease 4J (CMT4J) and Yunis-Varon syndrome (YVS). To investigate the mechanism of disease pathogenesis, we generated Drosophila models of FIG4-related diseases. Fig4 null mutant animals are viable but exhibit marked enlargement of the lysosomal compartment in muscle cells and neurons, accompanied by an age-related decline in flight ability. Transgenic animals expressing Drosophila Fig4 missense mutations corresponding to human pathogenic mutations can partially rescue lysosomal expansion phenotypes, consistent with these mutations causing decreased FIG4 function. Interestingly, Fig4 mutations predicted to inactivate FIG4 phosphatase activity rescue lysosome expansion phenotypes, and mutations in the phosphoinositide (3) phosphate kinase Fab1 that performs the reverse enzymatic reaction also causes a lysosome expansion phenotype. Since FIG4 and FAB1 are present together in the same biochemical complex, these data are consistent with a model in which FIG4 serves a phosphatase-independent biosynthetic function that is essential for lysosomal membrane homeostasis. Lysosomal phenotypes are suppressed by genetic inhibition of Rab7 or the HOPS complex, demonstrating that FIG4 functions after endosome-to-lysosome fusion. Furthermore, disruption of the retromer complex, implicated in recycling from the lysosome to Golgi, does not lead to similar phenotypes as Fig4, suggesting that the lysosomal defects are not due to compromised retromer-mediated recycling of endolysosomal membranes. These data show that FIG4 plays a critical noncatalytic function in maintaining lysosomal membrane homeostasis, and that this function is disrupted by mutations that cause CMT4J and YVS.

  3. Osseous plate alkaline phosphatase is anchored by GPI.

    PubMed

    Pizauro, J M; Ciancaglini, P; Leone, F A

    1994-02-01

    Alkaline phosphatase activity was released up to 100% from the membrane by using 0.1 U of phosphatidylinositol-specific phospholipase C from B. thuringiensis. The M(r) of solubilized enzyme was 145,000 by Sephacryl S-300 gel filtration and 66,000 by SDS-PAGE, suggesting a dimeric structure. Solubilization of the membrane-bound enzyme with phospholipase C did not destroy its ability to hydrolyze p-nitrophenyl phosphate (PNPP) (264.3 mumol min-1 mg-1),ATP (42.0 mumol min-1 mg-1) and pyrophosphate (28.4 mumol min-1 mg-1). The hydrolysis of ATP and PNPP by solubilized enzyme exhibited "Michaelian" kinetics with K0.5 = 70 and 979 microM, respectively. For pyrophosphate, K0.5 was 128 microM and site-site interactions were observed (n = 1.4). Magnesium ions were stimulatory (Kd = 1.5 mM) but zinc ions were powerful non-competitive inhibitors (Kd = 6.2 microM) of solubilized enzyme. Treatment of solubilized alkaline phosphatase with Chellex 100 reduced the original PNPPase activity to 5%. Cobalt (K0.5 = 10.1 microM), magnesium (K0.5 = 29.5 microM) and manganese ions (K0.5 = 5 microM) restored the activity of the apoenzyme with positive cooperativity, suggesting that phosphatidylinositol-specific phospholipase C-solubilized alkaline phosphatase is a metalloenzyme. The stimulation of the apoenzyme by calcium ions (K0.5 = 653 microM) was lower than that observed for the other ions (26%) and exhibited site-site interactions (n = 0.7). Zinc ions had no effect on the apoenzyme of the solubilized enzyme.

  4. PEST family phosphatases in immunity, autoimmunity, and autoinflammatory disorders.

    PubMed

    Veillette, André; Rhee, Inmoo; Souza, Cleiton Martins; Davidson, Dominique

    2009-03-01

    The proline-, glutamic acid-, serine- and threonine-rich (PEST) family of protein tyrosine phosphatases (PTPs) includes proline-enriched phosphatase (PEP)/lymphoid tyrosine phosphatase (LYP), PTP-PEST, and PTP-hematopoietic stem cell fraction (HSCF). PEP/LYP is a potent inhibitor of T-cell activation, principally by suppressing the activity of Src family protein tyrosine kinases (PTKs). This function seems to be dependent, at least in part, on the ability of PEP to bind C-terminal Src kinase (Csk), a PTK also involved in inactivating Src kinases. Interestingly, a polymorphism of LYP in humans (R620W) is a significant risk factor for autoimmune diseases including type 1 diabetes, rheumatoid arthritis, and lupus. The R620W mutation may be a 'gain-of-function' mutation. In non-hematopoietic cells, PTP-PEST is a critical regulator of adhesion and migration. This effect correlates with the aptitude of PTP-PEST to dephosphorylate cytoskeletal proteins such as Cas, focal adhesion associated-kinase (FAK), Pyk2, and PSTPIP. While not established, a similar function may also exist in immune cells. Additionally, overexpression studies provided an indication that PTP-PEST may be a negative regulator of lymphocyte activation. Interestingly, mutations in a PTP-PEST- and PTP-HSCF-interacting protein, PSTPIP1, were identified in humans with pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome and familial recurrent arthritis, two autoinflammatory diseases. These mutations abrogate the ability of PSTPIP1 to bind PTP-PEST and PTP-HSCF, suggesting that these two PTPs may be negative regulators of inflammation.

  5. Identification and bioinformatics comparison of two novel phosphatases in monoecious and gynoecious cucumber lines

    NASA Astrophysics Data System (ADS)

    Pawełkowicz, Magdalena E.; Wojcieszek, Michał; Osipowski, Paweł; Krzywkowski, Tomasz; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Two Arabidopsis thaliana genes from the PP2C family of protein phosphatases (AtABI1 and AtABI2) were used to find orthologous genes in the Cucumis sativus L. cv. Borszczagowski (cucumber) genome. Cucumber has been used as a model plant for sex expression studies because although it has been defined as a monoecious species, numerous genotypes are known to produce only female, only male, or hermaphroditic flowers. We identified two new orthologous genes of AtABI1 and AtABI2 in the cucumber genome and named them CsABI1 and CsABI2. To determine the relationships between the regulation of CsABI1 and CsABI2 and flower morphogenesis in cucumber, we performed various computational analyses to define the structure of the genes, and to predict regulatory elements and protein motifs in their sequences. We also performed an expression analysis to identify differences in the expression levels of CsABI1 and CsABI2 in vegetative and generative tissues (leaf, shoot apex, and flower buds) of monoecious (B10) and gynoecious (2gg) cucumber lines. We found that the expressions of CsABI1 and CsABI2 differed in male and female floral buds, and correlated these findings with the abscisic acid signaling pathways in male and female flowers.

  6. Assay of phosphotyrosyl protein phosphatase using synthetic peptide 1142-1153 of the insulin receptor.

    PubMed

    King, M J; Sale, G J

    1988-09-12

    Synthetic peptide 1142-1153 of the insulin receptor was phosphorylated on tyrosine by the insulin receptor and found to be a potent substrate for dephosphorylation by rat liver particulate and soluble phosphotyrosyl protein phosphatases. Apparent Km values were approximately 5 microM. Vm values (nmol phosphate removed/min per mg protein) were 0.62 (particulate) and 0.2 (soluble). This corresponds to 80% of total activity being membrane-associated, indicating that membrane-bound phosphatases are important receptor phosphatases. The phosphatase activities were distinct from acid and alkaline phosphatase. In conclusion peptide 1142-1153 provides a useful tool for the further study and characterization of phosphotyrosyl protein phosphatases.

  7. Fluorescence spectroscopy measures yeast PAH1-encoded phosphatidate phosphatase interaction with liposome membranes

    PubMed Central

    Xu, Zhi; Su, Wen-Min; Carman, George M.

    2012-01-01

    Phosphatidate (PA) phosphatase, the enzyme that catalyzes the penultimate step in triacylglycerol synthesis, is a cytosolic enzyme that must associate with the membrane where its substrate PA resides. Fluorescence spectroscopy was used to measure the interaction of yeast PAH1-encoded PA phosphatase with model liposome membranes. PA phosphatase contains five tryptophan residues and exhibited inherit fluorescence that increased upon interaction with phosphatidylcholine liposomes. The interaction was enhanced by inclusion of other phospholipids and especially the substrate PA. Interaction was dependent on both the concentration of phosphatidylcholine-PA liposomes as well as the surface concentration of PA in liposomes. Mg2+ ions, which were required for catalysis, did not affect PA phosphatase interaction with phosphatidylcholine-PA liposomes. PA phosphatase was a substrate for protein kinase A, protein kinase C, and casein kinase II, and these phosphorylations decreased PA phosphatase interaction with phosphatidylcholine-PA liposome membranes. PMID:22180632

  8. Probable levetiracetam-related serum alkaline phosphatase elevation

    PubMed Central

    2012-01-01

    Background Levetiracetam (LEV) is an antiepileptic drug with a favorable tolerability and safety profile with little or no effect on liver function. Case presentation Here, we reported an epileptic pediatric patient who developed a significant elevation in serum alkaline phosphatase level (ALP) during LEV monotherapy. Moreover, the serum ALP level was surprisingly decreased to normal after LEV discontinuation. The Naranjo Adverse Drug Reaction Probability Scale score was 6, indicating firstly LEV was a probable cause for the increased serum ALP. Conclusions Cautious usage and concerns of the LEV-associated potential ALP elevation should be considered when levetiracetam is prescribed to epilepsy patients, especially pediatric patients. PMID:22994584

  9. Inhibition of purple acid phosphatase with alpha-alkoxynaphthylmethylphosphonic acids.

    PubMed

    McGeary, Ross P; Vella, Peter; Mak, Jeffrey Y W; Guddat, Luke W; Schenk, Gerhard

    2009-01-01

    Purple acid phosphatases (PAPs) are binuclear hydrolases that catalyse the hydrolysis of a range of phosphorylated substrates. Human PAP is a major histochemical marker for the diagnosis of osteoporosis. In patients suffering from this disorder, PAP activity contributes to increased bone resorption and, therefore, human PAP is a key target for the development of anti-osteoporotic drugs. This manuscript describes the design and synthesis of derivatives of 1-naphthylmethylphosphonic acids as inhibitors of PAP. The K(i) values of these compounds are as low as 4 microM, the lowest reported to date for a PAP inhibitor.

  10. A description of alkaline phosphatases from marine organisms

    NASA Astrophysics Data System (ADS)

    Tian, Jiyuan; Jia, Hongbing; Yu, Juan

    2016-07-01

    Alkaline phosphatases (APs) are non-specific phosphohydrolases, and they are widely used in clinical diagnostics and biological studies. APs are widespread in nature and exhibit different structural formulations. Based on the diversity of biogenetic sources, APs exhibit temperature-propensity traits, and they are classified as psychrophilic, mesophilic, and thermophilic. In this article, the characteristics of psychrophilic APs from marine organisms were described, accompanied by a simple description of APs from other organisms. This review will facilitate better utilization of marine APs in the biotechnology field.

  11. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    SciTech Connect

    Martinez, Robert J.; Beazley, Melanie J.; Wilson, Jarad J.; Taillefert, Martial; Sobecky, Patricia A.

    2005-04-05

    The overall goal of this project is to examine the role of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO{sub 4}{sup 3-}. During this phase of the project we have been conducting assays to determine the effects of pH, inorganic anions and organic ligands on U(VI) mineral formation and precipitation when FRC bacterial isolates were grown in simulated groundwater medium. The molecular characterization of FRC isolates has also been undertaken during this phase of the project. Analysis of a subset of gram-positive FRC isolates cultured from FRC soils (Areas 1, 2 and 3) and background sediments have indicated a higher percentage of isolates exhibiting phosphatase phenotypes (i.e., in particular those surmised to be PO{sub 4}{sup 3-}-irrepressible) relative to isolates from the reference site. A high percentage of strains that exhibited such putatively PO{sub 4}{sup 3-}-irrepressible phosphatase phenotypes were also resistant to the heavy metals lead and cadmium. Previous work on FRC strains, including Arthrobacter, Bacillus and Rahnella spp., has demonstrated differences in tolerance to U(VI) toxicity (200 {micro}M) in the absence of organophosphate substrates. For example, Arthrobacter spp. exhibited the greatest tolerance to U(VI) while the Rahnella spp. have been shown to facilitate the precipitation of U(VI) from solution and the Bacillus spp. demonstrate the greatest sensitivity to acidic conditions and high concentrations of U(VI). PCR-based detection of FRC strains are being conducted to determine if non-specific acid phosphatases of the known molecular classes [i.e., classes A, B and C] are present in these FRC isolates. Additionally, these

  12. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2012-06-01

    immunoblot and malachite green based assay, respectively. We observe that LNCaP- shPPP2CA cells have low PP2ACα expression (Figure 1A) and activity...regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 2001;353:417-39. (6) Jennbacken K, Gustavsson H...cancer cells - - - shPPP2CA. Expression and activity of catalytic subunit of PP2A (PP2ACα) was determined by immunoblot and melachite green - based

  13. Targeting Protein Tyrosine Phosphatases for Anticancer Drug Discovery

    PubMed Central

    Scott, Latanya. M.; Lawrence, Harshani. R.; Sebti, Saïd. M.; Lawrence, Nicholas. J.; Wu, Jie.

    2010-01-01

    Protein tyrosine phosphatases (PTPs) are a diverse family of enzymes encoded by 107 genes in the human genome. Together with protein tyrosine kinases (PTKs), PTPs regulate various cellular activities essential for the initiation and maintenance of malignant phenotypes. While PTK inhibitors are now used routinely for cancer treatment, the PTP inhibitor development field is still in the discovery phase. In this article, the suitability of targeting PTPs for novel anticancer drug discovery is discussed. Examples are presented for PTPs that have been targeted for anticancer drug discovery as well as potential new PTP targets for novel anticancer drug discovery. PMID:20337577

  14. Protein Phosphatase 2A Signaling in Human Prostate Cancer

    DTIC Science & Technology

    2011-06-01

    been shown to be involved in androgen-independent growth of human prostate cancer cells (Carson et al., 1999; Grethe and Porn -Ares, 2006; Murillo et... Porn -Ares MI. (2006). p38 MAPK regulates phosphorylation of Bad via PP2A- dependent suppression of the MEK1/2-ERK1/2 survival pathway in TNF-alpha...threonine phosphatases implicated in cell growth and sig- nalling. Biochem J 2001;353:417–39. 15. Grethe S, Porn -Ares MI. p38 MAPK regulates

  15. Evans Blue and other dyes as protein tyrosine phosphatase inhibitors.

    PubMed

    Shrestha, Suja; Shim, Yi Sup; Kim, Ki Chul; Lee, Keun-Hyeung; Cho, Hyeongjin

    2004-04-19

    Commonly used dyes including Evans Blue and Trypan Blue were examined for their inhibitory activities against protein tyrosine phosphatases (PTPases), all of them showed inhibition of PTPases with different potencies. Of the 13 dyes tested, four exhibited IC(50) value of less than 10 microM, Evans Blue lowest IC(50) of 1.3 microM against PTP1B. Care must be taken in the use of dyes for clinical or biochemical experiments to avoid unwanted side effects. Some of the low molecular weight dyes might be useful as lead compounds for the development of potent and selective PTPase inhibitors.

  16. Regulation of TGF-β Signaling by Protein Phosphatases

    PubMed Central

    Liu, Ting; Feng, Xin-Hua

    2011-01-01

    Tight regulation of TGF-β superfamily signaling is important for normal cellular functions and tissue homeostasis. Since TGF-β superfamily signaling pathways are activated by a short phosphorylation cascade, from receptor phosphorylation to subsequent phosphorylation and activation of downstream signal transducer R-Smads, reversible phosphorylation serves as a critical step to assure the proper TGF-β signaling. This article will review the current progress on the understanding of dynamic phosphorylation in TGF-β signaling and the essential role of protein phosphatases in this process. PMID:20704570

  17. Simplified preparation of a phosphatase inhibitor and further studies of its action.

    PubMed

    Coburn, S P; Schaltenbrand, W E

    1978-05-01

    1-Pyrrolidinecarbothioic acid (2-pyridylmethylene) hydrazide chelates Zn2+ but not Mg2+. This compound is about twice as effective as EDTA for inhibiting alkaline phosphatase from calf mucosa, and approx. 1000-fold more effective than EDTA for inhibiting acid phosphatase from wheat germ. The compound did not inhibit pyridoxine kinase activity in human leucocytes at the highest concentration tested (33 micron). Therefore it may be a useful tool for either examining or eliminating the effects of phosphatases in complex enzyme systems.

  18. Key role of succinate dehydrogenase in insulin-induced inactivation of protein tyrosine phosphatases.

    PubMed

    Pomytkin, I A; Kolesova, O E

    2002-06-01

    We studied the role of mitochondria in insulin-induced inactivation of protein tyrosine phosphatases in the liver. The mitochondrial respiratory chain is an insulin-sensitive source of H(2)O(2)that acts as a physiological inhibitor of protein tyrosine phosphatases. Succinate dehydrogenase plays a key role in insulin-stimulated generation of H(2)O(2)and inactivation of liver protein tyrosine phosphatases.

  19. Defining the states of consciousness.

    PubMed

    Tassi, P; Muzet, A

    2001-03-01

    Consciousness remains an elusive concept due to the difficulty to define what has been regarded for many years as a subjective experience, therefore irrelevant for scientific study. Recent development in this field of research has allowed to provide some new insight to a possible way to define consciousness. Going through the extensive literature in this domain, several perspectives are proposed to define this concept. (1) Consciousness and Attention may not reflect the same process. (2) Consciousness during wake and sleep may not involve the same mechanisms. (3) Besides physiological states of consciousness, human beings can experience modified states of consciousness either by self-training (transcendental meditation, hypnosis, etc.) or by drug intake (hallucinogens, anaesthetics, etc.). Altogether, we address the question of a more precise terminology, given the theoretical weight words can convey. To this respect, we propose different definitions for concepts like consciousness, vigilance, arousal and alertness as candidates to separate functional entities.

  20. Structural basis for the divergence of substrate specificity and biological function within HAD phosphatases in lipopolysaccharide and sialic acid biosynthesis.

    PubMed

    Daughtry, Kelly D; Huang, Hua; Malashkevich, Vladimir; Patskovsky, Yury; Liu, Weifeng; Ramagopal, Udupi; Sauder, J Michael; Burley, Stephen K; Almo, Steven C; Dunaway-Mariano, Debra; Allen, Karen N

    2013-08-13

    The haloacid dehalogenase enzyme superfamily (HADSF) is largely composed of phosphatases that have been particularly successful at adaptating to novel biological functions relative to members of other phosphatase families. Herein, we examine the structural basis for the divergence of function in two bacterial homologues: 2-keto-3-deoxy-d-manno-octulosonate 8-phosphate phosphohydrolase (KDO8P phosphatase, KDO8PP) and 2-keto-3-deoxy-9-O-phosphonononic acid phosphohydrolase (KDN9P phosphatase, KDN9PP). KDO8PP and KDN9PP catalyze the final step in KDO and KDN synthesis, respectively, prior to transfer to CMP to form the activated sugar nucleotide. KDO8PP and KDN9PP orthologs derived from an evolutionarily diverse collection of bacterial species were subjected to steady-state kinetic analysis to determine their specificities toward catalyzed KDO8P and KDN9P hydrolysis. Although each enzyme was more active with its biological substrate, the degree of selectivity (as defined by the ratio of kcat/Km for KDO8P vs KDN9P) varied significantly. High-resolution X-ray structure determination of Haemophilus influenzae KDO8PP bound to KDO/VO3(-) and Bacteriodes thetaiotaomicron KDN9PP bound to KDN/VO3(-) revealed the substrate-binding residues. The structures of the KDO8PP and KDN9PP orthologs were also determined to reveal the differences in their active-site structures that underlie the variation in substrate preference. Bioinformatic analysis was carried out to define the sequence divergence among KDN9PP and KDO8PP orthologs. The KDN9PP orthologs were found to exist as single-domain proteins or fused with the pathway nucleotidyl transferases; the fusion of KDO8PP with the transferase is rare. The KDO8PP and KDN9PP orthologs share a stringently conserved Arg residue that forms a salt bridge with the substrate carboxylate group. The split of the KDN9PP lineage from the KDO8PP orthologs is easily tracked by the acquisition of a Glu/Lys pair that supports KDN9P binding. Moreover

  1. The pgpA and pgpB genes of Escherichia coli are not essential: evidence for a third phosphatidylglycerophosphate phosphatase.

    PubMed Central

    Funk, C R; Zimniak, L; Dowhan, W

    1992-01-01

    To further define the genes and gene products responsible for the in vivo conversion of phosphatidylglycerophosphate to phosphatidylglycerol in Escherichia coli, we disrupted two genes (pgpA and pgpB) which had previously been shown to encode gene products which carried out this reaction in vitro (T. Icho and C. R. H. Raetz, J. Bacteriol. 153:722-730, 1983). Strains with either gene or both genes disrupted had the same properties as the original mutants isolated with mutations in these genes, i.e., reduced in vitro phospholipid phosphatase activities, normal growth properties, and an increase in the level of phosphatidylglycerophosphate (1.6% versus less than 0.1% in wild-type strains). These results demonstrate that these genes are not required for either normal cell growth or the biosynthesis of phosphatidylglycerol in vivo. In addition, the total phosphatidylglycerophosphate phosphatase activity in the doubly disrupted mutant was reduced by only 50%, which indicates that there is at least one other gene that encodes such an activity and thus accounts for the lack of a dramatic effect on the biosynthesis of anionic phospholipids in these mutant strains. The phosphatidic acid and lysophosphatidic acid phosphatase activities of the pgpB gene product were also significantly reduced in gene-interrupted mutants, but the detection of residual phosphatase activities in these mutants indicated that additional genes encoding such phosphatases exist. The lack of a significant phenotype resulting from disruption of the pgpA and pgpB genes indicates that these genes may be required only for nonessential cell function and leaves the biosynthesis of phosphatidylglycerophosphate as the only step in E. coli phospholipid biosynthesis for which a gene locus has not been identified. Images PMID:1309518

  2. Trypanosoma rangeli: differential expression of ecto-phosphatase activities in response to inorganic phosphate starvation.

    PubMed

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Fonseca-de-Souza, André L; Rocha-Ferreira, Juliana; Meyer-Fernandes, José Roberto

    2010-04-01

    In this work, we showed that living cells of Trypanosoma rangeli express different ecto-phosphatase activities in response to different inorganic phosphate (Pi) concentrations in the culture medium. The ecto-phosphatase activity from T. rangeli grown at low-Pi concentration was inhibited by the increase of the pH, while the ecto-phosphatase of the cells grown at high Pi concentration was not modulated by the change of the pH of the medium. Okadaic acid inhibited only the ecto-phosphatase activity from cells grown at low-Pi concentration but not the ecto-phosphatase activity from cells grown at high-Pi concentration. Accordingly, phosphatase activity from T. rangeli grown at low Pi concentration was able to hydrolyze P-serine and P-threonine at high rate but not P-tyrosine. The phosphatase activity from T. rangeli grown at high-Pi concentration was able to hydrolyze P-serine, P-threonine and P-tyrosine with the same rate. The addition of anterior midgut homogenate of Rhodnius prolixus on the epimastigotes suspension inhibited the enzyme activity of T. rangeli grown at low-Pi concentration. On the other hand, anterior midgut homogenate had no effect in the ecto-phosphatase of T. rangeli maintained at high-Pi concentration. Altogether, the results described here indicate that ecto-phosphatase activities hydrolyzing phosphorylated compounds present in the extracellular medium of T. rangeli are regulated by the external Pi concentration.

  3. Alkaline Phosphatase Assay for Freshwater Sediments: Application to Perturbed Sediment Systems

    PubMed Central

    Sayler, Gary S.; Puziss, Marla; Silver, Martin

    1979-01-01

    The p-nitrophenyl phosphate hydrolysis-phosphatase assay was modified for use in freshwater sediment. Laboratory studies indicated that the recovery of purified alkaline phosphatase activity was 100% efficient in sterile freshwater sediments when optimized incubation and sonication conditions were used. Field studies of diverse freshwater sediments demonstrated the potential use of this assay for determining stream perturbation. Significant correlations between phosphatase and total viable cell counts, as well as adenosine triphosphate biomass, suggested that alkaline phosphatase activity has utility as an indicator of microbial population density and biomass in freshwater sediments. PMID:16345464

  4. Phosphatase of Chlamydomonas reinhardi: biochemical and cytochemical approach with specific mutants.

    PubMed Central

    Matagne, R F; Loppes, R; Deltour, R

    1976-01-01

    The unicellular alga Chlamydomonas reinhardi produces two constitutive acid phosphatases and three depressible phosphatases (a neutral and two alkaline ones) that can utilize napthyl phosphate as a substrate. Specific mutants depressible phosphatase were used to investigate biochemical properties and the cytochemical localization of these enzymes. The two constitutive phosphatases show similar pH optima (about 5.0) and Km values (2 x 10(-3) to 3.3 x 10(-3) M) but differ in their heat sensitivity and affinity for glycerophosphate. Images PMID:4437

  5. Effect of aluminum phosphate on alkaline phosphatase activity of polyurethane foam immobilized cyanobacteria.

    PubMed

    Ramalingam, N; Prasanna, B Gowtham

    2006-09-01

    The impact of insoluble phosphorus such as aluminum and rock phosphate on alkaline phosphatase activity of polyurethane foam immobilized cyanobacteria was assessed. Polyurethane foam immobilized Nodularia recorded the highest alkaline phosphatase activity of 9.04 (m. mol p-nitrophenol released h(-1) mg(-1) protein) in vitro. A higher concentration of aluminum phosphate was recorded a 25% reduction in alkaline phosphatase activity, ammonia content, and available phosphorus in culture filtrate of polyurethane foam immobilized cyanobacteria. In general, immobilized cyanobacteria exhibited a higher alkaline phosphatase activity in rock phosphate than aluminum phosphate.

  6. Characterization of the 2',3' cyclic phosphodiesterase activities of Clostridium thermocellum polynucleotide kinase-phosphatase and bacteriophage lambda phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2007-01-01

    Clostridium thermocellum polynucleotide kinase-phosphatase (CthPnkp) catalyzes 5' and 3' end-healing reactions that prepare broken RNA termini for sealing by RNA ligase. The central phosphatase domain of CthPnkp belongs to the dinuclear metallophosphoesterase superfamily exemplified by bacteriophage lambda phosphatase (lambda-Pase). CthPnkp is a Ni(2+)/Mn(2+)-dependent phosphodiesterase-monoesterase, active on nucleotide and non-nucleotide substrates, that can be transformed toward narrower metal and substrate specificities via mutations of the active site. Here we characterize the Mn(2+)-dependent 2',3' cyclic nucleotide phosphodiesterase activity of CthPnkp, the reaction most relevant to RNA repair pathways. We find that CthPnkp prefers a 2',3' cyclic phosphate to a 3',5' cyclic phosphate. A single H189D mutation imposes strict specificity for a 2',3' cyclic phosphate, which is cleaved to form a single 2'-NMP product. Analysis of the cyclic phosphodiesterase activities of mutated CthPnkp enzymes illuminates the active site and the structural features that affect substrate affinity and k(cat). We also characterize a previously unrecognized phosphodiesterase activity of lambda-Pase, which catalyzes hydrolysis of bis-p-nitrophenyl phosphate. lambda-Pase also has cyclic phosphodiesterase activity with nucleoside 2',3' cyclic phosphates, which it hydrolyzes to yield a mixture of 2'-NMP and 3'-NMP products. We discuss our results in light of available structural and functional data for other phosphodiesterase members of the binuclear metallophosphoesterase family and draw inferences about how differences in active site composition influence catalytic repertoire.

  7. Catalytic and substrate promiscuity: distinct multiple chemistries catalysed by the phosphatase domain of receptor protein tyrosine phosphatase.

    PubMed

    Srinivasan, Bharath; Marks, Hanna; Mitra, Sreyoshi; Smalley, David M; Skolnick, Jeffrey

    2016-07-15

    The presence of latent activities in enzymes is posited to underlie the natural evolution of new catalytic functions. However, the prevalence and extent of such substrate and catalytic ambiguity in evolved enzymes is difficult to address experimentally given the order-of-magnitude difference in the activities for native and, sometimes, promiscuous substrate/s. Further, such latent functions are of special interest when the activities concerned do not fall into the domain of substrate promiscuity. In the present study, we show a special case of such latent enzyme activity by demonstrating the presence of two mechanistically distinct reactions catalysed by the catalytic domain of receptor protein tyrosine phosphatase isoform δ (PTPRδ). The primary catalytic activity involves the hydrolysis of a phosphomonoester bond (C─O─P) with high catalytic efficiency, whereas the secondary activity is the hydrolysis of a glycosidic bond (C─O─C) with poorer catalytic efficiency. This enzyme also displays substrate promiscuity by hydrolysing diester bonds while being highly discriminative for its monoester substrates. To confirm these activities, we also demonstrated their presence on the catalytic domain of protein tyrosine phosphatase Ω (PTPRΩ), a homologue of PTPRδ. Studies on the rate, metal-ion dependence, pH dependence and inhibition of the respective activities showed that they are markedly different. This is the first study that demonstrates a novel sugar hydrolase and diesterase activity for the phosphatase domain (PD) of PTPRδ and PTPRΩ. This work has significant implications for both understanding the evolution of enzymatic activity and the possible physiological role of this new chemistry. Our findings suggest that the genome might harbour a wealth of such alternative latent enzyme activities in the same protein domain that renders our knowledge of metabolic networks incomplete. © 2016 The Author(s). published by Portland Press Limited on behalf of the

  8. Specific Immunoassays for Placental Alkaline Phosphatase As a Tumor Marker

    PubMed Central

    Stinghen, Sérvio T.; Moura, Juliana F.; Zancanella, Patrícia; Rodrigues, Giovanna A.; Pianovski, Mara A.; Lalli, Enzo; Arnold, Dodie L.; Minozzo, João C.; Callefe, Luis G.; Ribeiro, Raul C.; Figueiredo, Bonald C.

    2006-01-01

    Human placental (hPLAP) and germ cell (PLAP-like) alkaline phosphatases are polymorphic and heat-stable enzymes. This study was designed to develop specific immunoassays for quantifying hPLAP and PLAP-like enzyme activity (EA) in sera of cancer patients, pregnant women, or smokers. Polyclonal sheep anti-hPLAP antibodies were purified by affinity chromatography with whole hPLAP protein (ICA-PLAP assay) or a synthetic peptide (aa 57–71) of hPLAP (ICA-PEP assay); the working range was 0.1–11 U/L and cutoff value was 0.2 U/L EA for nonsmokers. The intra- and interassay coefficients of variation were 3.7%–6.5% (ICA-PLAP assay) and 9.0%–9.9% (ICA-PEP assay). An insignificant cross-reactivity was noted for high levels of unheated intestinal alkaline phosphatase in ICA-PEP assay. A positive correlation between the regression of tumor size and EA was noted in a child with embryonal carcinoma. It can be concluded that ICA-PEP assay is more specific than ICA-PLAP, which is still useful to detect other PLAP/PLAP-like phenotypes. PMID:17489017

  9. Dual Specificity Phosphatase 5 Is Essential for T Cell Survival

    PubMed Central

    Schauder, David M.; Cossette, Stephanie M.; Bordas, Michelle; Cui, Weiguo; Ramchandran, Ramani

    2016-01-01

    The mitogen-activated protein kinase (MAPK) pathway regulates many key cellular processes such as differentiation, apoptosis, and survival. The final proteins in this pathway, ERK1/2, are regulated by dual specificity phosphatase 5 (DUSP5). DUSP5 is a nuclear, inducible phosphatase with high affinity and fidelity for ERK1/2. By regulating the final step in the MAPK signaling cascade, DUSP5 exerts strong regulatory control over a central cellular pathway. Like other DUSPs, DUSP5 plays an important role in immune function. In this study, we have utilized new knockout mouse reagents to explore its function further. We demonstrate that global loss of DUSP5 does not result in any gross phenotypic changes. However, loss of DUSP5 affects memory/effector CD8+ T cell populations in response to acute viral infection. Specifically, Dusp5-/- mice have decreased proportions of short-lived effector cells (SLECs) and increased proportions of memory precursor effector cells (MPECs) in response to infection. Further, we show that this phenotype is T cell intrinsic; a bone marrow chimera model restricting loss of DUSP5 to the CD8+ T cell compartment displays a similar phenotype. Dusp5-/- T cells also display increased proliferation, increased apoptosis, and altered metabolic profiles, suggesting that DUSP5 is a pro-survival protein in T cells. PMID:27936095

  10. Therapeutic Potential of Targeting the Oncogenic SHP2 Phosphatase

    PubMed Central

    2015-01-01

    The Src homology 2 domain containing protein tyrosine phosphatase-2 (SHP2) is an oncogenic phosphatase associated with various kinds of leukemia and solid tumors. Thus, there is substantial interest in developing SHP2 inhibitors as potential anticancer and antileukemia agents. Using a structure-guided and fragment-based library approach, we identified a novel hydroxyindole carboxylic acid-based SHP2 inhibitor 11a-1, with an IC50 value of 200 nM and greater than 5-fold selectivity against 20 mammalian PTPs. Structural and modeling studies reveal that the hydroxyindole carboxylic acid anchors the inhibitor to the SHP2 active site, while interactions of the oxalamide linker and the phenylthiophene tail with residues in the β5–β6 loop contribute to 11a-1’s binding potency and selectivity. Evidence suggests that 11a-1 specifically attenuates the SHP2-dependent signaling inside the cell. Moreover, 11a-1 blocks growth factor mediated Erk1/2 and Akt activation and exhibits excellent antiproliferative activity in lung cancer and breast cancer as well as leukemia cell lines. PMID:25003231

  11. Spatial control of protein phosphatase 2A (de)methylation

    SciTech Connect

    Longin, Sari; Zwaenepoel, Karen; Martens, Ellen; Louis, Justin V.; Rondelez, Evelien; Goris, Jozef; Janssens, Veerle

    2008-01-01

    Reversible methylation of the protein phosphatase 2A catalytic subunit (PP2A{sub C}) is an important regulatory mechanism playing a crucial role in the selective recruitment of regulatory B subunits. Here, we investigated the subcellular localization of leucine carboxyl methyltransferase (LCMT1) and protein phosphatase methylesterase (PME-1), the two enzymes catalyzing this process. The results show that PME-1 is predominantly localized in the nucleus and harbors a functional nuclear localization signal, whereas LCMT1 is underrepresented in the nucleus and mainly localizes to the cytoplasm, Golgi region and late endosomes. Indirect immunofluorescence with methylation-sensitive anti-PP2A{sub C} antibodies revealed a good correlation with the methylation status of PP2A{sub C}, demethylated PP2A{sub C} being substantially nuclear. Throughout mitosis, demethylated PP2A{sub C} is associated with the mitotic spindle and during cytokinesis with the cleavage furrow. Overexpression of PME-1, but not of an inactive mutant, results in increased demethylation of PP2A{sub C} in the nucleus, whereas overexpression of a cytoplasmic PME-1 mutant lacking the NLS results in increased demethylation in the cytoplasm-in all cases, however, without any obvious functional consequences. PME-1 associates with an inactive PP2A population, regardless of its esterase activity or localization. We propose that stabilization of this inactive, nuclear PP2A pool is a major in vivo function of PME-1.

  12. Mammalian intestinal alkaline phosphatase acts as highly active exopolyphosphatase.

    PubMed

    Lorenz, B; Schröder, H C

    2001-06-11

    Recent results revealed that inorganic polyphosphates (polyP), being energy-rich linear polymers of orthophosphate residues known from bacteria and yeast, also exist in higher eukaryotes. However, the enzymatic basis of their metabolism especially in mammalian cells is still uncertain. Here we demonstrate for the first time that alkaline phosphatase from calf intestine (CIAP) is able to cleave polyP molecules up to a chain length of about 800. The enzyme acts as an exopolyphosphatase degrading polyP in a processive manner. The pH optimum is in the alkaline range. Divalent cations are not required for catalytic activity but inhibit the degradation of polyP. The rate of hydrolysis of short-chain polyP by CIAP is comparable to that of the standard alkaline phosphatase (AP) substrate p-nitrophenyl phosphate. The specific activity of the enzyme decreases with increasing chain length of the polymer both in the alkaline and in the neutral pH range. The K(m) of the enzyme also decreases with increasing chain length. The mammalian tissue non-specific isoform of AP was not able to hydrolyze polyP under the conditions applied while the placental-type AP and the bacterial (Escherichia coli) AP displayed polyP-degrading activity.

  13. Plant species richness increases phosphatase activities in an experimental grassland

    NASA Astrophysics Data System (ADS)

    Hacker, Nina; Wilcke, Wolfgang; Oelmann, Yvonne

    2014-05-01

    Plant species richness has been shown to increase aboveground nutrient uptake requiring the mobilization of soil nutrient pools. For phosphorus (P) the underlying mechanisms for increased P release in soil under highly diverse grassland mixtures remain obscure because aboveground P storage and concentrations of inorganic and organic P in soil solution and differently reactive soil P pools are unrelated (Oelmann et al. 2011). The need of plants and soil microorganisms for P can increase the exudation of enzymes hydrolyzing organically bound P (phosphatases) which might represent an important release mechanism of inorganic P in a competitive environment such as highly diverse grassland mixtures. Our objectives were to test the effects of i) plant functional groups (legumes, grasses, non-leguminous tall and small herbs), and of (ii) plant species richness on microbial P (Pmic) and phosphatase activities in soil. In autumn 2013, we measured Pmic and alkaline phosphomonoesterase and phosphodiesterase activities in soil of 80 grassland mixtures comprising different community compositions and species richness (1, 2, 4, 8, 16, 60) in the Jena Experiment. In general, Pmic and enzyme activities were correlated (r = 0.59 and 0.46 for phosphomonoesterase and phosphodiesterase activities, respectively; p

  14. Evolution of the metazoan protein phosphatase 2C superfamily.

    PubMed

    Stern, Adi; Privman, Eyal; Rasis, Michal; Lavi, Sara; Pupko, Tal

    2007-01-01

    Members of the protein phosphatase 2C (PP2C) superfamily are Mg(2+)/Mn(2+)-dependent serine/threonine phosphatases, which are essential for regulation of cell cycle and stress signaling pathways in cells. In this study, a comprehensive genomic analysis of all available metazoan PP2C sequences was conducted. The phylogeny of PP2C was reconstructed, revealing the existence of 15 vertebrate families which arose following a series of gene duplication events. Relative dating of these duplications showed that they occurred in two active periods: before the divergence of bilaterians and before vertebrate diversification. PP2C families which duplicated during the first period take part in different signaling pathways, whereas PP2C families which diverged in the second period display tissue expression differences yet participate in similar signaling pathways. These differences were found to involve variation of expression in tissues which show higher complexity in vertebrates, such as skeletal muscle and the nervous system. Further analysis was performed with the aim of identifying the functional domains of PP2C. The conservation pattern across the entire PP2C superfamily revealed an extensive domain of more than 50 amino acids which is highly conserved throughout all PP2C members. Several insertion or deletion events were found which may have led to the specialization of each PP2C family.

  15. Inhibition of a protein tyrosine phosphatase using mesoporous oxides.

    PubMed

    Kapoor, S; Girish, T S; Mandal, S S; Gopal, B; Bhattacharyya, A J

    2010-03-11

    The feasibility of utilizing mesoporous matrices of alumina and silica for the inhibition of enzymatic activity is presented here. These studies were performed on a protein tyrosine phosphatase by the name chick retinal tyrosine phosphotase-2 (CRYP-2), a protein that is identical in sequence to the human glomerular epithelial protein-1 and involved in hepatic carcinoma. The inhibition of CRYP-2 is of tremendous therapeutic importance. Inhibition of catalytic activity was examined using the sustained delivery of p-nitrocatechol sulfate (pNCS) from bare and amine functionalized mesoporous silica (MCM-48) and mesoporous alumina (Al(2)O(3)). Among the various mesoporous matrices employed, amine functionalized MCM-48 exhibited the best release of pNCS and also inhibition of CRYP-2. The maximum speed of reaction v(max) (=160 +/- 10 micromol/mnt/mg) and inhibition constant K(i) (=85.0 +/- 5.0 micromol) estimated using a competitive inhibition model were found to be very similar to inhibition activities of protein tyrosine phosphatases using other methods.

  16. Perspective: Tyrosine phosphatases as novel targets for antiplatelet therapy.

    PubMed

    Tautz, Lutz; Senis, Yotis A; Oury, Cécile; Rahmouni, Souad

    2015-06-15

    Arterial thrombosis is the primary cause of most cases of myocardial infarction and stroke, the leading causes of death in the developed world. Platelets, highly specialized cells of the circulatory system, are key contributors to thrombotic events. Antiplatelet drugs, which prevent platelets from aggregating, have been very effective in reducing the mortality and morbidity of these conditions. However, approved antiplatelet therapies have adverse side effects, most notably the increased risk of bleeding. Moreover, there remains a considerable incidence of arterial thrombosis in a subset of patients receiving currently available drugs. Thus, there is a pressing medical need for novel antiplatelet agents with a more favorable safety profile and less patient resistance. The discovery of novel antiplatelet targets is the matter of intense ongoing research. Recent findings demonstrate the potential of targeting key signaling molecules, including kinases and phosphatases, to prevent platelet activation and aggregation. Here, we offer perspectives to targeting members of the protein tyrosine phosphatase (PTP) superfamily, a major class of enzymes in signal transduction. We give an overview of previously identified PTPs in platelet signaling, and discuss their potential as antiplatelet drug targets. We also introduce VHR (DUSP3), a PTP that we recently identified as a major player in platelet biology and thrombosis. We review our data on genetic deletion as well as pharmacological inhibition of VHR, providing proof-of-principle for a novel and potentially safer VHR-based antiplatelet therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Intestinal alkaline phosphatase: novel functions and protective effects.

    PubMed

    Lallès, Jean-Paul

    2014-02-01

    Important protective roles of intestinal alkaline phosphatase (IAP)--including regulation of intestinal surface pH, absorption of lipids, detoxification of free nucleotides and bacterial lipopolysaccharide, attenuation of intestinal inflammation, and possible modulation of the gut microbiota--have been reviewed recently. IAP is modulated by numerous nutritional factors. The present review highlights new findings on the properties of IAP and extends the list of its protective functions. Critical assessment of data suggests that some IAP properties are a direct result of dephosphorylation of proinflammatory moieties, while others (e.g., gut barrier protection and microbiota shaping) may be secondary to IAP-mediated downregulation of inflammation. IAP and tissue-nonspecific alkaline phosphatase isoforms characterize the small intestine and the colon, respectively. Gastrointestinal administration of exogenous IAP ameliorates gut inflammation and favors gut tissue regeneration, whereas enteral and systemic IAP administration attenuates systemic inflammation only. Finally, the IAP gene family has a strong evolutionary link to food-driven changes in gastrointestinal tract anatomy and microbiota composition. Therefore, stimulation of IAP activity by dietary intervention is a goal for preserving gut homeostasis and health by minimizing low-grade inflammation. © 2013 International Life Sciences Institute.

  18. Regulation of FcεRI signaling by lipid phosphatases.

    PubMed

    Kuhny, Marcel; Zorn, Carolin N; Huber, Michael

    2014-01-01

    Mast cells (MCs) are tissue-resident sentinels of hematopoietic origin that play a prominent role in allergic diseases. They express the high-affinity receptor for IgE (FcεRI), which when cross-linked by multivalent antigens triggers the release of preformed mediators, generation of arachidonic acid metabolites, and the synthesis of cytokines and chemokines. Stimulation of the FcεRI with increasing antigen concentrations follows a characteristic bell-shaped dose-responses curve. At high antigen concentrations, the so-called supra-optimal conditions, repression of FcεRI-induced responses is facilitated by activation and incorporation of negative signaling regulators. In this context, the SH2-containing inositol-5'-phosphatase, SHIP1, has been demonstrated to be of particular importance. SHIP1 with its catalytic and multiple protein interaction sites provides several layers of control for FcεRI signaling. Regulation of SHIP1 function occurs on various levels, e.g., protein expression, receptor and membrane recruitment, competition for protein-protein interaction sites, and activating modifications enhancing the phosphatase function. Apart from FcεRI-mediated signaling, SHIP1 can be activated by diverse unrelated receptor systems indicating its involvement in the regulation of antigen-dependent cellular responses by autocrine feedback mechanisms or tissue-specific and/or (patho-) physiologically determined factors. Thus, pharmacologic engagement of SHIP1 may represent a beneficial strategy for patients suffering from acute or chronic inflammation or allergies.

  19. Activity of alkaline phosphatase adsorbed and grafted on "polydopamine" films.

    PubMed

    Ball, Vincent

    2014-09-01

    The oxidation of dopamine in slightly basic solutions and in the presence of oxygen as an oxidant allows for the deposition of dopamine-eumelanin ("polydopamine") films on almost all kinds of materials allowing for an easy secondary functionalization. Molecules carrying nucleophilic groups like thiols and amines can be easily grafted on those films. Herein we show that alkaline phosphatase (ALP), as a model enzyme, adsorbs to "polydopamine" films and part of the adsorbed enzyme is rapidly desorbed in contact with Tris buffer. However a significant part of the enzyme remains irreversibly adsorbed and keeps some enzymatic activity for at least 2 weeks whereas ALP adsorbed on quartz slides is rapidly and quantitatively deactivated. In addition we estimated the Michaelis constant Km of the enzyme irreversibly bound to the "polydopamine" film. The Michaelis constant, and hence the affinity constant between paranitrophenol phosphate and ALP are almost identical between the enzyme bound on the film and the free enzyme in solution. Complementarily, it was found that "polydopamine" films display some phosphatase like catalytic activity. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Possible functions of alkaline phosphatase in dental mineralization: cadmium effects.

    PubMed

    Wöltgens, J H; Lyaruu, D M; Bervoets, T J

    1991-06-01

    In mineralizing dental tissues the non-specific alkaline phosphatase, using paranitrophenylphosphate (p-NPP) as substrate, is also capable of splitting inorganic pyrophosphate (PPi). In contrast to the p-NPP-ase part of the enzyme, the PPi-ase part requires Zn2+ as a cofactor for its hydrolytic activity. The PPi-ase activity of the enzyme can be inhibited by cadmium ions (Cd2+), perhaps by replacing Zn2+ from the active site of the enzyme molecule. In addition to splitting PPi, the PPi-ase part of the enzyme may also be involved in the phosphorylation process of yet undetermined organic macromolecules. Cd2+ inhibits this phosphorylation process. Inhibition of the PPi-ase activity can also be accomplished by ascorbic acid known for its capacity to complex bivalent cations. Ascorbic acid may accordingly also remove Zn2+ from the active site of the PPi-ase. It is suggested that in developing dental tissues alkaline phosphatase is not only associated with the transport of phosphate ions towards the mineralization front, but is also involved in the phosphorylation of organic macromolecules, a process activated the PPi-ase part of the enzyme.

  1. Characterization of Schistosome Tegumental Alkaline Phosphatase (SmAP)

    PubMed Central

    Bhardwaj, Rita; Skelly, Patrick J.

    2011-01-01

    Schistosomes are parasitic platyhelminths that currently infect over 200 million people globally. The parasites can live for years in a putatively hostile environment - the blood of vertebrates. We have hypothesized that the unusual schistosome tegument (outer-covering) plays a role in protecting parasites in the blood; by impeding host immunological signaling pathways we suggest that tegumental molecules help create an immunologically privileged environment for schistosomes. In this work, we clone and characterize a schistosome alkaline phosphatase (SmAP), a predicted ∼60 kDa glycoprotein that has high sequence conservation with members of the alkaline phosphatase protein family. The SmAP gene is most highly expressed in intravascular parasite life stages. Using immunofluorescence and immuno-electron microscopy, we confirm that SmAP is expressed at the host/parasite interface and in internal tissues. The ability of living parasites to cleave exogenous adenosine monophosphate (AMP) and generate adenosine is very largely abolished when SmAP gene expression is suppressed following RNAi treatment targeting the gene. These results lend support to the hypothesis that schistosome surface enzymes such as SmAP could dampen host immune responses against the parasites by generating immunosuppressants such as adenosine to promote their survival. This notion does not rule out other potential functions for the adenosine generated e.g. in parasite nutrition. PMID:21483710

  2. New functional aspects of the atypical protein tyrosine phosphatase VHZ.

    PubMed

    Kuznetsov, Vyacheslav I; Hengge, Alvan C

    2013-11-12

    LDP3 (VHZ) is the smallest classical protein tyrosine phosphatase (PTP) known to date and was originally misclassified as an atypical dual-specificity phosphatase. Kinetic isotope effects with steady-state and pre-steady-state kinetics of VHZ and mutants with p-nitrophenol phosphate have revealed several unusual properties. VHZ is significantly more active than previously reported but remains one of the least active PTPs. Highly unusual for a PTP, VHZ possesses two acidic residues (E134 and D65) in the active site. D65 occupies the position corresponding to the typical general acid in the PTP family. However, VHZ primarily utilizes E134 as the general acid, with D65 taking over this role when E134 is mutated. This unusual behavior is facilitated by two coexisting, but unequally populated, substrate binding modes. Unlike most classical PTPs, VHZ exhibits phosphotransferase activity. Despite the presence of the Q-loop that normally prevents alcoholysis of the phosphoenzyme intermediate in other classical PTPs, VHZ readily phosphorylates ethylene glycol. Although mutations of Q-loop residues affect this phosphotransferase activity, mutations on the IPD loop that contains the general acid exert more control over this process. A single P68V substitution on this loop completely abolishes phosphotransferase activity. The ability of native VHZ to catalyze transphosphorylation may lead to an imbalance of intracellular phosphorylation, which could explain the correlation of its overexpression with several types of cancer.

  3. S100 Proteins Modulate Protein Phosphatase 5 Function

    PubMed Central

    Yamaguchi, Fuminori; Umeda, Yoshinori; Shimamoto, Seiko; Tsuchiya, Mitsumasa; Tokumitsu, Hiroshi; Tokuda, Masaaki; Kobayashi, Ryoji

    2012-01-01

    PP5 is a unique member of serine/threonine phosphatases comprising a regulatory tetratricopeptide repeat (TPR) domain and functions in signaling pathways that control many cellular responses. We reported previously that Ca2+/S100 proteins directly associate with several TPR-containing proteins and lead to dissociate the interactions of TPR proteins with their client proteins. Here, we identified protein phosphatase 5 (PP5) as a novel target of S100 proteins. In vitro binding studies demonstrated that S100A1, S100A2, S100A6, and S100B proteins specifically interact with PP5-TPR and inhibited the PP5-Hsp90 interaction. In addition, the S100 proteins activate PP5 by using a synthetic phosphopeptide and a physiological protein substrate, Tau. Overexpression of S100A1 in COS-7 cells induced dephosphorylation of Tau. However, S100A1 and permanently active S100P inhibited the apoptosis signal-regulating kinase 1 (ASK1) and PP5 interaction, resulting the inhibition of dephosphorylation of phospho-ASK1 by PP5. The association of the S100 proteins with PP5 provides a Ca2+-dependent regulatory mechanism for the phosphorylation status of intracellular proteins through the regulation of PP5 enzymatic activity or PP5-client protein interaction. PMID:22399290

  4. Protein kinase and phosphatase activities of thylakoid membranes

    SciTech Connect

    Michel, H.; Shaw, E.K.; Bennett, J.

    1987-01-01

    Dephosphorylation of the 25 and 27 kDa light-harvesting Chl a/b proteins (LHCII) of the thylakoid membranes is catalyzed by a phosphatase which differs from previously reported thylakoid-bound phosphatases in having an alkaline pH optimum (9.0) and a requirement for Mg/sup 2 +/ ions. Dephosphorylation of the 8.3 kDa psb H gene product requires a Mg/sup 2 +/ ion concentration more than 200 fold higher than that for dephosphorylation of LHC II. The 8.3 kDa and 27 kDa proteins appear to be phosphorylated by two distinct kinases, which differ in substrate specificity and sensitivity to inhibitors. The plastoquinone antagonist 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB) inhibits phosphorylation of the 27 kDa LHC II much more readily than phosphorylation of the 8.3 kDa protein. A similar pattern of inhibition is seen for two synthetic oligopeptides (MRKSATTKKAVC and ATQTLESSSRC) which are analogs of the phosphorylation sites of the two proteins. Possible modes of action of DBMIB are discussed. 45 refs., 7 figs., 3 tabs.

  5. Detailed Structural Characterization of Unbound Protein Phosphatase 1 Inhibitors

    PubMed Central

    Dancheck, Barbara; Nairn, Angus C.; Peti, Wolfgang

    2009-01-01

    Protein Phosphatase 1 (PP1) is an essential and ubiquitous serine/threonine protein phosphatase that is regulated by more than 100 known inhibitor and targeting proteins. It is currently unclear how protein inhibitors distinctly and specifically regulate PP1 to enable rapid responses to cellular alterations. We demonstrate that two PP1 inhibitors, I-2 and DARPP-32, belong to the class of intrinsically unstructured proteins (IUPs). We show that both inhibitors have distinct preferences for transient local and long range structure. These preferences are likely their structural signature for their interaction with PP1. Furthermore, we show that upon phosphorylation of Thr34 in DARPP-32, which turns DARPP-32 into a potent inhibitor of PP1, neither local nor long range structure of DARPP-32 is altered. Therefore, our data suggests a role for these transient 3-dimensional topologies in binding mechanisms that enable extensive contacts with PP1's invariant surfaces. Together, these interactions enable potent and selective inhibition of PP1. PMID:18954090

  6. Protein Phosphatase 1α Interacting Proteins in the Human Brain

    PubMed Central

    Esteves, Sara L.C.; Domingues, Sara C.; da Cruz e Silva, Odete A.B.; da Cruz e Silva, Edgar F.

    2012-01-01

    Abstract Protein Phosphatase 1 (PP1) is a major serine/threonine-phosphatase whose activity is dependent on its binding to regulatory subunits known as PP1 interacting proteins (PIPs), responsible for targeting PP1 to a specific cellular location, specifying its substrate or regulating its action. Today, more than 200 PIPs have been described involving PP1 in panoply of cellular mechanisms. Moreover, several PIPs have been identified that are tissue and event specific. In addition, the diversity of PP1/PIP complexes can further be achieved by the existence of several PP1 isoforms that can bind preferentially to a certain PIP. Thus, PP1/PIP complexes are highly specific for a particular function in the cell, and as such, they are excellent pharmacological targets. Hence, an in-depth survey was taken to identify specific PP1α PIPs in human brain by a high-throughput Yeast Two-Hybrid approach. Sixty-six proteins were recognized to bind PP1α, 39 being novel PIPs. A large protein interaction databases search was also performed to integrate with the results of the PP1α Human Brain Yeast Two-Hybrid and a total of 246 interactions were retrieved. PMID:22321011

  7. Defining "Folklore" in the Classroom.

    ERIC Educational Resources Information Center

    Falke, Anne

    Folklore, a body of traditional beliefs of a people conveyed orally or by means of custom, is very much alive, involves all people, and is not the study of popular culture. In studying folklore, the principal tasks of the folklorist have been defined as determining definition, classification, source (the folk), origin (who composed folklore),…

  8. Defining and Measuring Psychomotor Performance

    ERIC Educational Resources Information Center

    Autio, Ossi

    2007-01-01

    Psychomotor performance is fundamental to human existence. It is important in many real world activities and nowadays psychomotor tests are used in several fields of industry, army, and medical sciences in employee selection. This article tries to define psychomotor activity by introducing some psychomotor theories. Furthermore the…

  9. Defined by Word and Space

    ERIC Educational Resources Information Center

    Brisco, Nicole D.

    2010-01-01

    In the author's art class, she found that many of her students in an intro art class have some technical skill, but lack the ability to think conceptually. Her goal was to create an innovative project that combined design, painting, and sculpture into a compact unit that asked students how they define themselves. In the process of answering this…

  10. Defined by Word and Space

    ERIC Educational Resources Information Center

    Brisco, Nicole D.

    2010-01-01

    In the author's art class, she found that many of her students in an intro art class have some technical skill, but lack the ability to think conceptually. Her goal was to create an innovative project that combined design, painting, and sculpture into a compact unit that asked students how they define themselves. In the process of answering this…

  11. Defining and Differentiating the Makerspace

    ERIC Educational Resources Information Center

    Dousay, Tonia A.

    2017-01-01

    Many resources now punctuate the maker movement landscape. However, some schools and communities still struggle to understand this burgeoning movement. How do we define these spaces and differentiate them from previous labs and shops? Through a multidimensional framework, stakeholders should consider how the structure, access, staffing, and tools…

  12. A new monoclonal antibody detects downregulation of protein tyrosine phosphatase receptor type γ in chronic myeloid leukemia patients.

    PubMed

    Vezzalini, Marzia; Mafficini, Andrea; Tomasello, Luisa; Lorenzetto, Erika; Moratti, Elisabetta; Fiorini, Zeno; Holyoake, Tessa L; Pellicano, Francesca; Krampera, Mauro; Tecchio, Cristina; Yassin, Mohamed; Al-Dewik, Nader; Ismail, Mohamed A; Al Sayab, Ali; Monne, Maria; Sorio, Claudio

    2017-06-21

    Protein tyrosine phosphatase receptor gamma (PTPRG) is a ubiquitously expressed member of the protein tyrosine phosphatase family known to act as a tumor suppressor gene in many different neoplasms with mechanisms of inactivation including mutations and methylation of CpG islands in the promoter region. Although a critical role in human hematopoiesis and an oncosuppressor role in chronic myeloid leukemia (CML) have been reported, only one polyclonal antibody (named chPTPRG) has been described as capable of recognizing the native antigen of this phosphatase by flow cytometry. Protein biomarkers of CML have not yet found applications in the clinic, and in this study, we have analyzed a group of newly diagnosed CML patients before and after treatment. The aim of this work was to characterize and exploit a newly developed murine monoclonal antibody specific for the PTPRG extracellular domain (named TPγ B9-2) to better define PTPRG protein downregulation in CML patients. TPγ B9-2 specifically recognizes PTPRG (both human and murine) by flow cytometry, western blotting, immunoprecipitation, and immunohistochemistry. Co-localization experiments performed with both anti-PTPRG antibodies identified the presence of isoforms and confirmed protein downregulation at diagnosis in the Philadelphia-positive myeloid lineage (including CD34(+)/CD38(bright/dim) cells). After effective tyrosine kinase inhibitor (TKI) treatment, its expression recovered in tandem with the return of Philadelphia-negative hematopoiesis. Of note, PTPRG mRNA levels remain unchanged in tyrosine kinase inhibitors (TKI) non-responder patients, confirming that downregulation selectively occurs in primary CML cells. The availability of this unique antibody permits its evaluation for clinical application including the support for diagnosis and follow-up of these disorders. Evaluation of PTPRG as a potential therapeutic target is also facilitated by the availability of a specific reagent capable to specifically

  13. Alkaline Phosphatase, Soluble Extracellular Adenine Nucleotides, and Adenosine Production after Infant Cardiopulmonary Bypass.

    PubMed

    Davidson, Jesse A; Urban, Tracy; Tong, Suhong; Twite, Mark; Woodruff, Alan; Wischmeyer, Paul E; Klawitter, Jelena

    2016-01-01

    Decreased alkaline phosphatase activity after infant cardiac surgery is associated with increased post-operative cardiovascular support requirements. In adults undergoing coronary artery bypass grafting, alkaline phosphatase infusion may reduce inflammation. Mechanisms underlying these effects have not been explored but may include decreased conversion of extracellular adenine nucleotides to adenosine. 1) Evaluate the association between alkaline phosphatase activity and serum conversion of adenosine monophosphate to adenosine after infant cardiac surgery; 2) assess if inhibition/supplementation of serum alkaline phosphatase modulates this conversion. Pre/post-bypass serum samples were obtained from 75 infants <4 months of age. Serum conversion of 13C5-adenosine monophosphate to 13C5-adenosine was assessed with/without selective inhibition of alkaline phosphatase and CD73. Low and high concentration 13C5-adenosine monophosphate (simulating normal/stress concentrations) were used. Effects of alkaline phosphatase supplementation on adenosine monophosphate clearance were also assessed. Changes in serum alkaline phosphatase activity were strongly correlated with changes in 13C5-adenosine production with or without CD73 inhibition (r = 0.83; p<0.0001). Serum with low alkaline phosphatase activity (≤80 U/L) generated significantly less 13C5-adenosine, particularly in the presence of high concentration 13C5-adenosine monophosphate (10.4μmol/L vs 12.9μmol/L; p = 0.0004). Inhibition of alkaline phosphatase led to a marked decrease in 13C5-adenosine production (11.9μmol/L vs 2.7μmol/L; p<0.0001). Supplementation with physiologic dose human tissue non-specific alkaline phosphatase or high dose bovine intestinal alkaline phosphatase doubled 13C5-adenosine monophosphate conversion to 13C5-adenosine (p<0.0001). Alkaline phosphatase represents the primary serum ectonucleotidase after infant cardiac surgery and low post-operative alkaline phosphatase activity leads to

  14. The TriTryp phosphatome: analysis of the protein phosphatase catalytic domains.

    PubMed

    Brenchley, Rachel; Tariq, Humera; McElhinney, Helen; Szöor, Balázs; Huxley-Jones, Julie; Stevens, Robert; Matthews, Keith; Tabernero, Lydia

    2007-11-26

    The genomes of the three parasitic protozoa Trypanosoma cruzi, Trypanosoma brucei and Leishmania major are the main subject of this study. These parasites are responsible for devastating human diseases known as Chagas disease, African sleeping sickness and cutaneous Leishmaniasis, respectively, that affect millions of people in the developing world. The prevalence of these neglected diseases results from a combination of poverty, inadequate prevention and difficult treatment. Protein phosphorylation is an important mechanism of controlling the development of these kinetoplastids. With the aim to further our knowledge of the biology of these organisms we present a characterisation of the phosphatase complement (phosphatome) of the three parasites. An ontology-based scan of the three genomes was used to identify 86 phosphatase catalytic domains in T. cruzi, 78 in T. brucei, and 88 in L. major. We found interesting differences with other eukaryotic genomes, such as the low proportion of tyrosine phosphatases and the expansion of the serine/threonine phosphatase family. Additionally, a large number of atypical protein phosphatases were identified in these species, representing more than one third of the total phosphatase complement. Most of the atypical phosphatases belong to the dual-specificity phosphatase (DSP) family and show considerable divergence from classic DSPs in both the domain organisation and sequence features. The analysis of the phosphatome of the three kinetoplastids indicates that they possess orthologues to many of the phosphatases reported in other eukaryotes, including humans. However, novel domain architectures and unusual combinations of accessory domains, suggest distinct functional roles for several of the kinetoplastid phosphatases, which await further experimental exploration. These distinct traits may be exploited in the selection of suitable new targets for drug development to prevent transmission and spread of the diseases, taking

  15. Molecular enzymology underlying regulation of protein phosphatase-1 by natural toxins.

    PubMed

    Holmes, C F B; Maynes, J T; Perreault, K R; Dawson, J F; James, M N G

    2002-11-01

    The protein serine/threonine phosphatases constitute a unique class of enzymes that are critical for cell regulation, as they must counteract the activities of thousands of protein kinases in human cells. Uncontrolled inhibition of phosphatase activity by toxic inhibitors can lead to widespread catastrophic effects. Over the past decade, a number of natural product toxins have been identified that specifically and potently inhibit protein phosphatase-1 and 2A. Amongst these are the cyanobacteria-derived cyclic heptapeptide microcystin-LR and the polyether fatty acid okadaic acid from dinoflagellate sources. The molecular mechanism underlying potent inhibition of protein phosphatase-1 by these toxins is becoming clear through insights gathered from diverse sources. These include: 1. Comparison of structure-activity relationships amongst the different classes of toxins. 2. Delineation of the structural differences between protein phosphatase-1 and 2A that account for their differing sensitivity to toxins, particularly okadaic acid and microcystin-LR. 3. Determination of the crystal structure of protein phosphatase-1 with microcystin-LR, okadaic acid and calyculin bound. 4. Site-specific mutagenesis and biochemical analysis of protein phosphatase-1 mutants. Taken together, these data point to a common binding site on protein phosphatase-1 for okadaic acid, microcystin-LR and the calyculins. However, careful analysis of these data suggest that each toxin binds to the common binding site in a subtly different way, relying on distinct structural interactions such as hydrophobic binding, hydrogen bonding and electrostatic interactions to different degrees. The insights derived from studying the molecular enzymology of protein phosphatase-1 may help explain the different sensitivities of other structurally conserved protein serine/theonine phosphatases to toxin inhibition. Furthermore, studies on the binding of structurally diverse toxins at the active site of protein

  16. Insulin receptor kinase-independent signaling via tyrosine phosphorylation of phosphatase PHLPP1.

    PubMed

    Zhang, Manchao; Riedel, Heimo

    2009-05-01

    Most insulin responses correlate well with insulin receptor (IR) Tyr kinase activation; however, critical exceptions to this concept have been presented. Specific IR mutants and stimulatory IR antibodies demonstrate a lack of correlation between IR kinase activity and specific insulin responses in numerous independent studies. IR conformation changes in response to insulin observed with various IR antibodies define an IR kinase-independent signal that alters the C-terminus. IR-related receptors in lower eukaryotes that lack a Tyr kinase point to an alternative mechanism of IR signaling earlier in evolution. However, the implied IR kinase-independent signaling mechanism remained obscure at the molecular level. Here we begin to define the molecular basis of an IR-dependent but IR kinase-independent insulin signal that is equally transmitted by a kinase-inactive mutant IR. This insulin signal results in Tyr phosphorylation and catalytic activation of phosphatase PHLPP1 via a PI 3-kinase-independent, wortmannin-insensitive signaling pathway. Dimerized SH2B1/PSM is a critical activator of the IR kinase and the resulting established insulin signal. In contrast it is an inhibitor of the IR kinase-independent insulin signal and disruption of SH2B1/PSM dimer binding to IR potentiates this signal. Dephosphorylation of Akt2 by PHLPP1 provides an alternative, SH2B1/PSM-regulated insulin-signaling pathway from IR to Akt2 of opposite polarity and distinct from the established PI 3-kinase-dependent signaling pathway via IRS proteins. In combination, both pathways should allow the opposing regulation of Akt2 activity at two phosphorylation sites to specifically define the insulin signal in the background of interfering Akt-regulating signals, such as those controlling cell proliferation and survival.

  17. Structural and mechanistic characterization of L-histidinol phosphate phosphatase from the polymerase and histidinol phosphatase family of proteins.

    PubMed

    Ghodge, Swapnil V; Fedorov, Alexander A; Fedorov, Elena V; Hillerich, Brandan; Seidel, Ronald; Almo, Steven C; Raushel, Frank M

    2013-02-12

    L-Histidinol phosphate phosphatase (HPP) catalyzes the hydrolysis of L-histidinol phosphate to L-histidinol and inorganic phosphate, the penultimate step in the biosynthesis of L-histidine. HPP from the polymerase and histidinol phosphatase (PHP) family of proteins possesses a trinuclear active site and a distorted (β/α)(7)-barrel protein fold. This group of enzymes is closely related to the amidohydrolase superfamily of enzymes. The mechanism of phosphomonoester bond hydrolysis by the PHP family of HPP enzymes was addressed. Recombinant HPP from Lactococcus lactis subsp. lactis that was expressed in Escherichia coli contained a mixture of iron and zinc in the active site and had a catalytic efficiency of ~10(3) M(-1) s(-1). Expression of the protein under iron-free conditions resulted in the production of an enzyme with a 2 order of magnitude improvement in catalytic efficiency and a mixture of zinc and manganese in the active site. Solvent isotope and viscosity effects demonstrated that proton transfer steps and product dissociation steps are not rate-limiting. X-ray structures of HPP were determined with sulfate, L-histidinol phosphate, and a complex of L-histidinol and arsenate bound in the active site. These crystal structures and the catalytic properties of variants were used to identify the structural elements required for catalysis and substrate recognition by the HPP family of enzymes within the amidohydrolase superfamily.

  18. Kinetic mechanism of the Zn-dependent aryl-phosphatase activity of myo-inositol-1-phosphatase.

    PubMed

    Caselli, Anna; Casolaro, Mario; Ranaldi, Francesco; Manao, Giampaolo; Camici, Guido; Giachetti, Eugenio

    2007-02-01

    Myo-inositol-1-phosphatase (EC 3.1.3.25) is able to hydrolyze myo-inositol-1-phosphate in the presence of Mg(2+) ions at neutral pH, and also p-nitrophenyl phosphate in the presence of Zn(2+)-ions at acidic pH. This enzyme plays a role in phosphatidylinositol cell signalling and is a putative target of lithium therapy in manic depression. We elucidate here the kinetic mechanism of the Zn-dependent activity of myo-inositol-1-phosphatase. As part of this analysis it was necessary to determine the basicity constants of p-nitrophenyl phosphate and the stability constant of its metal-complex in the presence of zinc chloride. We find that the Zn-dependent reaction may be described either by a rapid-equilibrium random mechanism or an ordered steady-state mechanism in which the substrate binds to the free enzyme prior to the metal ion. In both models the Zn-substrate complex acts as a high affinity inhibitor, yielding a dead-end species through its binding to the enzyme-Zn-substrate in rapid-equilibrium or to the enzyme-phosphate complexes in a steady-state model. Phosphate is a competitive inhibitor of the enzyme with respect to the substrate and an uncompetitive inhibitor with respect to zinc ions.

  19. Structure and chromosomal localization of the human gene of the phosphotyrosyl phosphatase activator (PTPA) of protein phosphatase 2A

    SciTech Connect

    Van Hoof, C.; Cayla, X.; Merlevede, W.; Goris, J.

    1995-07-20

    The PTPA gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. PTPA, cloned from human genomic libraries, is encoded by one single-copy gene, composed of 10 exons and 9 introns with a total length of about 60 kb. The transcription start site was determined, and the 5{prime} flanking sequence was analyzed for its potential as a promotor. This region lacks a TATA sequence in the appropriate position relative to the transcription start, is very GC-rich, and contains upstream of the transcription start four Sp1 sites, a feature common to many TATA-less promotors. Based on the homology with DNA binding consensus sequences of transcription factors, we identified in this promotor region several putative DNA binding sites for transcription factors, such as NF-{kappa}B, Myb, Ets-1, Myc, and ATF. Transfection experiments with a construct containing the PTPA promotor region inserted 5{prime} of a luciferase reporter gene revealed that the 5{prime} flanking sequence of the PTPA gene indeed displayed promotor activity that seems to be cell-line dependent. By fluorescence in situ hybridization and G-banding, the PTPA gene was localized to the 9q34 region. The PTPA gene is positioned centromeric of c-abl in a region embracing several genes implicated in oncogenesis. 28 refs., 8 figs., 1 tab.

  20. Mechanistic aspects of the low-molecular-weight phosphatase activity of the calmodulin-activated phosphatase, calcineurin.

    PubMed

    Martin, B L; Graves, D J

    1986-11-05

    Product and substrate analogs have been employed as inhibitors of the low-molecular-weight phosphatase activity of calcineurin, a calmodulin-activated protein phosphatase. Product inhibition kinetics demonstrate that both products, para-nitrophenol and inorganic phosphate, inhibit para-nitrophenyl phosphate hydrolysis in a competitive manner. Inorganic phosphate is a linear competitive inhibitor, whereas the inhibition by para-nitrophenol is more complex. An analog of para-nitrophenol, pentafluorophenol, was found to be a linear competitive inhibitor. These patterns indicate a rapid equilibrium random kinetic mechanism for calcineurin. This mechanism suggests that calcineurin does not generate a phosphoryl enzyme during its catalytic reaction. Application of sulfate analogs indicates that binding of substrate occurs via the phosphoryl moiety. It is suggested that binding is a function of the affinity of ligand for the metal ion involved in calcineurin action. The dependence of the kinetic parameters of calcineurin upon pH was examined to provide information concerning the role of protonation in the activity and specificity of calcineurin. Log (VM) versus pH data for two low-molecular-weight substrates, para-nitrophenyl phosphate and tyrosine-O-phosphate, reveal a pKa value for the enzyme-substrate complex. Analysis of log (VM/KM) data yields a pKa value for the free enzyme of 8.0. Protonation of the phenolic leaving group during hydrolysis is not the rate-limiting step in calcineurin catalysis.

  1. High sequence homology between protein tyrosine acid phosphatase from boar seminal vesicles and human prostatic acid phosphatase.

    PubMed

    Wysocki, Paweł; Płucienniczak, Grazyna; Strzezek, Jerzy

    2009-01-01

    Boar seminal vesicle protein tyrosine acid phosphatase (PTAP) and human prostatic acid phosphatase (PAP) show high affinity for protein phosphotyrosine residues. The physico-chemical and kinetic properties of the boar and human enzymes are different. The main objective of this study was to establish the nucleotide sequence of cDNA encoding boar PTAP and compare it with that of human PAP cDNA. Also, the amino-acid sequence of boar PTAP was compared with the sequence of human PAP. PTAP was isolated from boar seminal vesicle fluid and sequenced. cDNA to boar seminal vesicle RNA was synthesized, amplified by PCR, cloned in E. coli and sequenced. The obtained N-terminal amino-acid sequence of boar PTAP showed 92% identity with the N-terminal amino-acid sequence of human PAP. The determined sequence of a 354 bp nucleotide fragment (GenBank accession number: GQ184596) showed 90% identity with the corresponding sequence of human PAP. On the basis of this sequence a 118 amino acid fragment of boar PTAP was predicted. This fragment showed 89% identity with the corresponding fragment of human PAP and had a similar hydropathy profile. The compared sequences differ in terms of their isoelectric points and amino-acid composition. This may explain the differences in substrate specificity and inhibitor resistance of boar PTAP and human PAP.

  2. Dolichyl phosphate phosphatase in rat liver microsomes. Avoidance of the use of detergent in testing the effect of phospholipids on dolichyl phosphate phosphatase.

    PubMed

    Boscoboinik, D O; Morera, S; Belocopitow, E

    1984-06-06

    A system was developed for testing the effect of phospholipids on dolichyl phosphate phosphatase, a membrane-associated enzyme. This enzyme was solubilized, delipidated, stabilized and concentrated in such a way that minimal quantities of Triton X-100 were carried by enzyme extracts to the incubation mixture. Its substrate, dolichyl phosphate, could be kept in aqueous medium as suspended particles without addition of detergent. When dolichyl phosphate phosphatase was assayed using the substrate in this detergent-free form, values for Km, pH optimum and temperature optimum were different from those obtained with detergent-solubilized substrate. This assay of dolichyl phosphate phosphatase almost free of detergent allowed testing of the effect of specific phospholipids on enzyme activity with minimal interference produced by endogenous phospholipids or exogenous detergent. Sphingomyelin, phosphatidylethanolamine or phosphatidylcholine (zwitterionic phospholipids) acted as activators, whereas phosphatidic acid and phosphatidylinositol, negatively-charged phospholipids, were inhibitors of dolichyl phosphate phosphatase.

  3. Defining Our National Cyberspace Boundaries

    DTIC Science & Technology

    2010-02-17

    invention of the World Wide Web in 19 1989, the Internet Corporation for Assigned Names and Numbers ( ICANN ) (the international organization that...anonymity in cyberspace could be accomplished through the issuing of IP addresses as the Internet transitions from IPv4 to IPv6. ICANN should issue...agreement (MOA) between the U.S. Department of Commerce and ICANN . This new MOA should define which blocks of IP addresses will be used for entities

  4. How to define green adjuvants.

    PubMed

    Beck, Bert; Steurbaut, Walter; Spanoghe, Pieter

    2012-08-01

    The concept 'green adjuvants' is difficult to define. This paper formulates an answer based on two approaches. Starting from the Organisation for Economic Cooperation and Development (OECD) definition for green chemistry, production-based and environmental-impact-based definitions for green adjuvants are proposed. According to the production-based approach, adjuvants are defined as green if they are manufactured using renewable raw materials as much as possible while making efficient use of energy, preferably renewable energy. According to the environmental impact approach, adjuvants are defined as green (1) if they have a low human and environmental impact, (2) if they do not increase active ingredient environmental mobility and/or toxicity to humans and non-target organisms, (3) if they do not increase the exposure to these active substances and (4) if they lower the impact of formulated pesticides by enhancing the performance of active ingredients, thus potentially lowering the required dosage of active ingredients. Based on both approaches, a tentative definition for 'green adjuvants' is given, and future research and legislation directions are set out.

  5. How do people define moderation?

    PubMed

    vanDellen, Michelle R; Isherwood, Jennifer C; Delose, Julie E

    2016-06-01

    Eating in moderation is considered to be sound and practical advice for weight maintenance or prevention of weight gain. However, the concept of moderation is ambiguous, and the effect of moderation messages on consumption has yet to be empirically examined. The present manuscript examines how people define moderate consumption. We expected that people would define moderate consumption in ways that justified their current or desired consumption rather than view moderation as an objective standard. In Studies 1 and 2, moderate consumption was perceived to involve greater quantities of an unhealthy food (chocolate chip cookies, gummy candies) than perceptions of how much one should consume. In Study 3, participants generally perceived themselves to eat in moderation and defined moderate consumption as greater than their personal consumption. Furthermore, definitions of moderate consumption were related to personal consumption behaviors. Results suggest that the endorsement of moderation messages allows for a wide range of interpretations of moderate consumption. Thus, we conclude that moderation messages are unlikely to be effective messages for helping people maintain or lose weight. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. What Defines the "Kingdom" Fungi?

    PubMed

    Richards, Thomas A; Leonard, Guy; Wideman, Jeremy G

    2017-06-01

    The application of environmental DNA techniques and increased genome sequencing of microbial diversity, combined with detailed study of cellular characters, has consistently led to the reexamination of our understanding of the tree of life. This has challenged many of the definitions of taxonomic groups, especially higher taxonomic ranks such as eukaryotic kingdoms. The Fungi is an example of a kingdom which, together with the features that define it and the taxa that are grouped within it, has been in a continual state of flux. In this article we aim to summarize multiple lines of data pertinent to understanding the early evolution and definition of the Fungi. These include ongoing cellular and genomic comparisons that, we will argue, have generally undermined all attempts to identify a synapomorphic trait that defines the Fungi. This article will also summarize ongoing work focusing on taxon discovery, combined with phylogenomic analysis, which has identified novel groups that lie proximate/adjacent to the fungal clade-wherever the boundary that defines the Fungi may be. Our hope is that, by summarizing these data in the form of a discussion, we can illustrate the ongoing efforts to understand what drove the evolutionary diversification of fungi.

  7. Protein phosphatase 2A dysfunction in Alzheimer’s disease

    PubMed Central

    Sontag, Jean-Marie; Sontag, Estelle

    2014-01-01

    Protein phosphatase 2A (PP2A) is a large family of enzymes that account for the majority of brain Ser/Thr phosphatase activity. While PP2A enzymes collectively modulate most cellular processes, sophisticated regulatory mechanisms are ultimately responsible for ensuring isoform-specific substrate specificity. Of particular interest to the Alzheimer’s disease (AD) field, alterations in PP2A regulators and PP2A catalytic activity, subunit expression, methylation and/or phosphorylation, have been reported in AD-affected brain regions. “PP2A” dysfunction has been linked to tau hyperphosphorylation, amyloidogenesis and synaptic deficits that are pathological hallmarks of this neurodegenerative disorder. Deregulation of PP2A enzymes also affects the activity of many Ser/Thr protein kinases implicated in AD. This review will more specifically discuss the role of the PP2A/Bα holoenzyme and PP2A methylation in AD pathogenesis. The PP2A/Bα isoform binds to tau and is the primary tau phosphatase. Its deregulation correlates with increased tau phosphorylation in vivo and in AD. Disruption of PP2A/Bα-tau protein interactions likely contribute to tau deregulation in AD. Significantly, alterations in one-carbon metabolism that impair PP2A methylation are associated with increased risk for sporadic AD, and enhanced AD-like pathology in animal models. Experimental studies have linked deregulation of PP2A methylation with down-regulation of PP2A/Bα, enhanced phosphorylation of tau and amyloid precursor protein, tau mislocalization, microtubule destabilization and neuritic defects. While it remains unclear what are the primary events that underlie “PP2A” dysfunction in AD, deregulation of PP2A enzymes definitely affects key players in the pathogenic process. As such, there is growing interest in developing PP2A-centric therapies for AD, but this may be a daunting task without a better understanding of the regulation and function of specific PP2A enzymes. PMID:24653673

  8. 3' Phosphatase activity toward phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] by voltage-sensing phosphatase (VSP).

    PubMed

    Kurokawa, Tatsuki; Takasuga, Shunsuke; Sakata, Souhei; Yamaguchi, Shinji; Horie, Shigeo; Homma, Koichi J; Sasaki, Takehiko; Okamura, Yasushi

    2012-06-19

    Voltage-sensing phosphatases (VSPs) consist of a voltage-sensor domain and a cytoplasmic region with remarkable sequence similarity to phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor phosphatase. VSPs dephosphorylate the 5' position of the inositol ring of both phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P(3)] and phosphatidylinositol 4,5-bisphosphate [PI(4,5)P(2)] upon voltage depolarization. However, it is unclear whether VSPs also have 3' phosphatase activity. To gain insights into this question, we performed in vitro assays of phosphatase activities of Ciona intestinalis VSP (Ci-VSP) and transmembrane phosphatase with tensin homology (TPTE) and PTEN homologous inositol lipid phosphatase (TPIP; one human ortholog of VSP) with radiolabeled PI(3,4,5)P(3). TLC assay showed that the 3' phosphate of PI(3,4,5)P(3) was not dephosphorylated, whereas that of phosphatidylinositol 3,4-bisphosphate [PI(3,4)P(2)] was removed by VSPs. Monitoring of PI(3,4)P(2) levels with the pleckstrin homology (PH) domain from tandem PH domain-containing protein (TAPP1) fused with GFP (PH(TAPP1)-GFP) by confocal microscopy in amphibian oocytes showed an increase of fluorescence intensity during depolarization to 0 mV, consistent with 5' phosphatase activity of VSP toward PI(3,4,5)P(3). However, depolarization to 60 mV showed a transient increase of GFP fluorescence followed by a decrease, indicating that, after PI(3,4,5)P(3) is dephosphorylated at the 5' position, PI(3,4)P(2) is then dephosphorylated at the 3' position. These results suggest that substrate specificity of the VSP changes with membrane potential.

  9. Yeast Nem1-Spo7 Protein Phosphatase Activity on Pah1 Phosphatidate Phosphatase Is Specific for the Pho85-Pho80 Protein Kinase Phosphorylation Sites*

    PubMed Central

    Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2014-01-01

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg2+ ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s−1 and 81 nm, 0.11 s−1 and 127 nm, 0.10 s−1 and 46 nm, and 0.02 s−1 and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. PMID:25359770

  10. Yeast Nem1-Spo7 protein phosphatase activity on Pah1 phosphatidate phosphatase is specific for the Pho85-Pho80 protein kinase phosphorylation sites.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2014-12-12

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg(2+) ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s(-1) and 81 nm, 0.11 s(-1) and 127 nm, 0.10 s(-1) and 46 nm, and 0.02 s(-1) and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Protein phosphatase-1 modulates the function of Pax-6, a transcription factor controlling brain and eye development.

    PubMed

    Yan, Qin; Liu, Wen-Bin; Qin, Jichao; Liu, Jinping; Chen, He-Ge; Huang, Xiaoqin; Chen, Lili; Sun, Shuming; Deng, Mi; Gong, Lili; Li, Yong; Zhang, Lan; Liu, Yan; Feng, Hao; Xiao, Yamei; Liu, Yun; Li, David W-C

    2007-05-11

    Pax-6 is an evolutionarily conserved transcription factor and acts high up in the regulatory hierarchy controlling eye and brain development in humans, mice, zebrafish, and Drosophila. Previous studies have shown that Pax-6 is a phosphoprotein, and its phosphorylation by ERK, p38, and homeodomain-interacting protein kinase 2 greatly enhances its transactivation activity. However, the protein phosphatases responsible for the dephosphorylation of Pax-6 remain unknown. Here, we present both in vitro and in vivo evidence to show that protein serine/threonine phosphatase-1 is a major phosphatase that directly dephosphorylates Pax-6. First, purified protein phosphatase-1 directly dephosphorylates Pax-6 in vitro. Second, immunoprecipitation-linked Western blot revealed that both protein phosphatase-1alpha and protein phosphatase-1beta interact with Pax-6. Third, overexpression of protein phosphatase-1 in human lens epithelial cells leads to dephosphorylation of Pax-6. Finally, inhibition of protein phosphatase-1 activity by calyculin A or knockdown of protein phosphatase-1alpha and protein phosphatase-1beta by RNA interference leads to enhanced phosphorylation of Pax-6. Moreover, our results also demonstrate that dephosphorylation of Pax-6 by protein phosphatase-1 significantly modulates its function in regulating expression of both exogenous and endogenous genes. These results demonstrate that protein phosphatase 1 acts as a major phosphatase to dephosphorylate Pax-6 and modulate its function.

  12. Stimulation of phosphatidylglycerolphosphate phosphatase activity by unsaturated fatty acids in rat heart.

    PubMed

    Cao, S G; Hatch, G M

    1994-07-01

    Phosphatidylglycerolphosphate (PGP) synthase and PGP phosphatase catalyze the sequential synthesis of phosphatidylglycerol from cytidine-5'-diphosphate 1,2-diacyl-sn-glycerol (CDP-DG) and glycerol-3-phosphate. PGP synthase and PGP phosphatase activities were characterized in rat heart mitochondrial fractions, and the effect of fatty acids on the activity of these enzymes was determined. PGP synthase was observed to be a heat labile enzyme that exhibited apparent Km values for CDP-PG and glycerol-3-phosphate of 46 and 20 microM, respectively. The addition of exogenous oleic acid to the assay mixture did not affect PGP synthase activity. PGP phosphatase was observed to be a heat labile enzyme, and addition of oleic acid to the assay mixture caused a concentration-dependent stimulation of PGP phosphatase activity. Maximum stimulation (1.9-fold) of enzyme activity was observed in the presence of 0.5 mM oleic acid, but the stimulation was slightly attenuated by the presence of albumin in the assay. The presence of oleic acid in the assay mixture caused the inactivation of PGP phosphatase activity to be retarded at 55 degrees C. Stimulation of PGP phosphatase activity was also observed with arachidonic acid, whereas taurocholic, stearic and palmitic acids did not significantly affect PGP phosphatase activity. The activity of mitochondrial phosphatidic acid phosphohydrolase was not affected by inclusion of oleic acid in the incubation mixture. We postulate that unsaturated fatty acids stimulate PGP phosphatase activity in rat heart.

  13. Alkaline phosphatase-polyresorcinol complex: characterization and application to seed coating.

    PubMed

    Pilar, María C; Ortega, Natividad; Perez-Mateos, Manuel; Busto, María D

    2009-03-11

    An alkaline phosphatase (EC 3.1.3.1) from Escherichia coli ATCC27257 was immobilized by copolymerization with resorcinol. The phosphatase-polyresorcinol complex synthesized retained about 74% of the original enzymatic activity. The pH and temperature profile of the immobilized and free enzyme revealed a similar behavior. Kinetic parameters were determined: K(m) and K(i) values were 2.44 and 0.423 mM, respectively, for the phosphatase-polyresorcinol complex and 1.07 and 0.069 mM, respectively, for free phosphatase. The thermal and storage stabilities of the immobilized phosphatase were higher than those of the native one. On addition to soil, free enzyme was completely inactivated in 4 days, whereas the phosphatase-polyresorcinol complex was comparatively stable. Barley seed coated with the immobilized enzyme exhibited higher rhizosphere phosphatase activity. Under pot culture conditions, an increase in the soil inorganic phosphorus was detected when the seed was encapsulated with the phosphatase-polyresorcinol complex, and a positive influence on biomass and inorganic phosphorus concentration of shoot was observed.

  14. Identification and molecular modeling of a novel, plant-like, human purple acid phosphatase.

    PubMed

    Flanagan, J U; Cassady, A I; Schenk, G; Guddat, L W; Hume, D A

    2006-08-01

    Purple acid phosphatases are a family of binuclear metallohydrolases that have been identified in plants, animals and fungi. Only one isoform of approximately 35 kDa has been isolated from animals, where it is associated with bone resorption and microbial killing through its phosphatase activity, and hydroxyl radical production, respectively. Using the sensitive PSI-BLAST search method, sequences representing new purple acid phosphatase-like proteins have been identified in mammals, insects and nematodes. These new putative isoforms are closely related to the approximately 55 kDa purple acid phosphatase characterized from plants. Secondary structure prediction of the new human isoform further confirms its similarity to a purple acid phosphatase from the red kidney bean. A structural model for the human enzyme was constructed based on the red kidney bean purple acid phosphatase structure. This model shows that the catalytic centre observed in other purple acid phosphatases is also present in this new isoform. These observations suggest that the sequences identified in this study represent a novel subfamily of plant-like purple acid phosphatases in animals and humans.

  15. Acute chlordane toxicity on the serum alkaline phosphatase activity of Meriones hurrianae Jerdon.

    PubMed

    Karel, A K

    1976-02-01

    Different acute doses of chlordane enhance the serum alkaline phosphatase activity in Indian desert gerbils. The damage to parenchymal cells of liver, and hepatic microsomal enzyme induction as a result of chlordane treatment are discussed as the possible reasons for the increase in serum alkaline phosphatase activity.

  16. Discovery of protein phosphatase inhibitor classes by biology-oriented synthesis

    PubMed Central

    Nören-Müller, Andrea; Reis-Corrêa, Ivan; Prinz, Heino; Rosenbaum, Claudia; Saxena, Krishna; Schwalbe, Harald J.; Vestweber, Dietmar; Cagna, Guiseppe; Schunk, Stefan; Schwarz, Oliver; Schiewe, Hajo; Waldmann, Herbert

    2006-01-01

    Protein phosphatases have very recently emerged as important targets for chemical biology and medicinal chemistry research, and new phosphatase inhibitor classes are in high demand. The underlying frameworks of natural products represent the evolutionarily selected fractions of chemical space explored by nature so far and meet the criteria of relevance to nature and biological prevalidation most crucial to inhibitor development. We refer to synthesis efforts and compound collection development based on these criteria as biology-oriented synthesis. For the discovery of phosphatase inhibitor classes by means of this approach, four natural product-derived or -inspired medium-sized compound collections were synthesized and investigated for inhibition of the tyrosine phosphatases VE-PTP, Shp-2, PTP1B, MptpA, and MptpB and the dual-specificity phosphatases Cdc25A and VHR. The screen yielded four unprecedented and selective phosphatase inhibitor classes for four phosphatases with high hit rates. For VE-PTP and MptpB the first inhibitors were discovered. These results demonstrate that biology-oriented synthesis is an efficient approach to the discovery of new compound classes for medicinal chemistry and chemical biology research that opens up new opportunities for the study of phosphatases, which may lead to the development of new drug candidates. PMID:16809424

  17. The Role of Bacterial Protein Tyrosine Phosphatases in the Regulation of the Biosynthesis of Secreted Polysaccharides

    PubMed Central

    Morona, Renato

    2014-01-01

    Abstract Significance: Tyrosine phosphorylation and associated protein tyrosine phosphatases are gaining prominence as critical mechanisms in the regulation of fundamental processes in a wide variety of bacteria. In particular, these phosphatases have been associated with the control of the biosynthesis of capsular polysaccharides and extracellular polysaccharides, critically important virulence factors for bacteria. Recent Advances: Deletion and overexpression of the phosphatases result in altered polysaccharide biosynthesis in a range of bacteria. The recent structures of associated auto-phosphorylating tyrosine kinases have suggested that the phosphatases may be critical for the cycling of the kinases between monomers and higher order oligomers. Critical Issues: Additional substrates of the phosphatases apart from cognate kinases are currently being identified. These are likely to be critical to our understanding of the mechanism by which polysaccharide biosynthesis is regulated. Future Directions: Ultimately, these protein tyrosine phosphatases are an attractive target for the development of novel antimicrobials. This is particularly the case for the polymerase and histidinol phosphatase family, which is predominantly found in bacteria. Furthermore, the determination of bacterial tyrosine phosphoproteomes will likely help to uncover the fundamental roles, mechanism, and critical importance of these phosphatases in a wide range of bacteria. Antioxid. Redox Signal. 20, 2274–2289. PMID:24295407

  18. Sac2/INPP5F is an inositol 4-phosphatase that functions in the endocytic pathway.

    PubMed

    Nakatsu, Fubito; Messa, Mirko; Nández, Ramiro; Czapla, Heather; Zou, Yixiao; Strittmatter, Stephen M; De Camilli, Pietro

    2015-04-13

    The recruitment of inositol phosphatases to endocytic membranes mediates dephosphorylation of PI(4,5)P2, a phosphoinositide concentrated in the plasma membrane, and prevents its accumulation on endosomes. The importance of the conversion of PI(4,5)P2 to PtdIns during endocytosis is demonstrated by the presence of both a 5-phosphatase and a 4-phosphatase (Sac domain) module in the synaptojanins, endocytic PI(4,5)P2 phosphatases conserved from yeast to humans and the only PI(4,5)P2 phosphatases in yeast. OCRL, another 5-phosphatase that couples endocytosis to PI(4,5)P2 dephosphorylation, lacks a Sac domain. Here we show that Sac2/INPP5F is a PI4P phosphatase that colocalizes with OCRL on endocytic membranes, including vesicles formed by clathrin-mediated endocytosis, macropinosomes, and Rab5 endosomes. An OCRL-Sac2/INPP5F interaction could be demonstrated by coimmunoprecipitation and was potentiated by Rab5, whose activity is required to recruit Sac2/INPP5F to endosomes. Sac2/INPP5F and OCRL may cooperate in the sequential dephosphorylation of PI(4,5)P2 at the 5 and 4 position of inositol in a partnership that mimics that of the two phosphatase modules of synaptojanin.

  19. Investigational inhibitors of PTP4A3 phosphatase as antineoplastic agents.

    PubMed

    Sharlow, Elizabeth R; Wipf, Peter; McQueeney, Kelley E; Bakan, Ahmet; Lazo, John S

    2014-05-01

    Protein tyrosine (Tyr) phosphatases have been implicated in many diseases, most notably in cancer. While there are a significant number of clinically approved inhibitors of protein Tyr kinases, there are no drugs specifically targeting protein Tyr phosphatases in clinical use despite the attractiveness of the molecular target. This review examines the investigational challenges in identifying Tyr phosphatase inhibitors using the oncogenic phosphatase PTP4A3 as a prototype. The article includes a review of the structure, functionality and validation of PTP4A3 as a cancer target. It also provides an evaluation of existing small molecule and antibody inhibitors and provides new computational guidance for potentially more potent small molecule inhibitors. Tyr phosphatases, like PTP4A3, represent high value but ignored molecular targets for the treatment of cancer and other diseases. Although phosphatases are challenging targets, it seems likely that drug-like inhibitors of this important enzyme family would complement the growing number of protein Tyr kinase inhibitors. Animal models are beginning to provide validation for PTP4A3 as a molecular target for cancer progression and metastasis. The authors posit that greater efforts should be directed towards identifying Tyr phosphatase inhibitors for lead optimization and tool compounds to assist in interrogating and validating phosphatase involvement in physiological and pathological processes.

  20. Preparative resolution of D,L-threonine catalyzed by immobilized phosphatase.

    PubMed

    Scollar, M P; Sigal, G; Klibanov, A M

    1985-03-01

    Hydrolysis of L- and D-O-phosphothreonines catalyzed by four different phosphatases, alkaline phosphatases from calf intestine and E. coli and acid phosphatases from wheat germ and potato, has been kinetically studied. Alkaline phosphatases were found to have comparable reactivities towards the optical isomers. On the other hand, both acid phosphatases displayed a marked stereoselectivity, hydrolyzing the L-ester much faster than its D counterpart. Wheat germ acid phosphatase was the most stereoselective enzyme: V(L)/V(D) = 24 and K(m,L)/K(m,D) = 0.17. This enzyme was immobilized (in k-carrageenan gel, followed by crosslinking with glutaraldehyde) and used for the preparative resolution of D,L-threonine: the latter was first chemically O-phosphorylated and then asymmetrically hydrolyzed by the immobilized phosphatase. As a result, gram quantities of L-threonine of high optical purity and O-phospho-D-threonine were prepared. Immobilized wheat germ phosphatase has been tested for the resolution of other racemic alcohols: serine, 2-amino-1-butanol, 1-amino-2-propanol, 2-octanol, and menthol. In all those cases, the enzyme was either not sufficiently stereoselective or too slow for preparative resolutions.

  1. Enhancing Potato System Sustainability: Crop Rotation Impacts on Soil Phosphatase Activity

    USDA-ARS?s Scientific Manuscript database

    Potato is a species with a low efficiency of acquiring soil P. Rotation crops may potentially influence P uptake by potato by increasing soil organic acids, phosphatase activity, and microbial biomass. However, this kind of information is very limited. We measured the activities of acid phosphatase,...

  2. Fluorescence labelling of phosphatase activity in digestive glands of carnivorous plants.

    PubMed

    Płachno, B J; Adamec, L; Lichtscheidl, I K; Peroutka, M; Adlassnig, W; Vrba, J

    2006-11-01

    A new ELF (enzyme labelled fluorescence) assay was applied to detect phosphatase activity in glandular structures of 47 carnivorous plant species, especially Lentibulariaceae, in order to understand their digestive activities. We address the following questions: (1) Are phosphatases produced by the plants and/or by inhabitants of the traps? (2) Which type of hairs/glands is involved in the production of phosphatases? (3) Is this phosphatase production a common feature among carnivorous plants or is it restricted to evolutionarily advanced species? Our results showed activity of the phosphatases in glandular structures of the majority of the plants tested, both from the greenhouse and from sterile culture. In addition, extracellular phosphatases can also be produced by trap inhabitants. In Utricularia, activity of phosphatase was detected in internal glands of 27 species from both primitive and advanced sections and different ecological groups. Further positive reactions were found in Genlisea, Pinguicula, Aldrovanda, Dionaea, Drosera, Drosophyllum, Nepenthes, and Cephalotus. In Utricularia and Genlisea, enzymatic secretion was independent of stimulation by prey. Byblis and Roridula are usually considered as "proto-carnivores", lacking digestive enzymes. However, we found high activity of phosphatases in both species. Thus, they should be classified as true carnivores. We suggest that the inflorescence of Byblis and some Pinguicula species might also be an additional "carnivorous organ", which can trap a prey, digest it, and finally absorb available nutrients.

  3. Spatial Patterns of Alkaline Phosphatase Expression within Bacterial Colonies and Biofilms in Response to Phosphate Starvation

    PubMed Central

    Huang, Ching-Tsan; Xu, Karen D.; McFeters, Gordon A.; Stewart, Philip S.

    1998-01-01

    The expression of alkaline phosphatase in response to phosphate starvation was shown to be spatially and temporally heterogeneous in bacterial biofilms and colonies. A commercial alkaline phosphatase substrate that generates a fluorescent, insoluble product was used in conjunction with frozen sectioning techniques to visualize spatial patterns of enzyme expression in both Klebsiella pneumoniae and Pseudomonas aeruginosa biofilms. Some of the expression patterns observed revealed alkaline phosphatase activity at the boundary of the biofilm opposite the place where the staining substrate was delivered, indicating that the enzyme substrate penetrated the biofilm fully. Alkaline phosphatase accumulated linearly with time in K. pneumoniae colonies transferred from high-phosphate medium to low-phosphate medium up to specific activities of 50 μmol per min per mg of protein after 24 h. In K. pneumoniae biofilms and colonies, alkaline phosphatase was initially expressed in the region of the biofilm immediately adjacent to the carbon and energy source (glucose). In time, the region of alkaline phosphatase expression expanded inward until it spanned most, but not all, of the biofilm or colony depth. In contrast, expression of alkaline phosphatase in P. aeruginosa biofilms occurred in a thin, sharply delineated band at the biofilm-bulk fluid interface. In this case, the band of activity never occupied more than approximately one-sixth of the biofilm. These results are consistent with the working hypothesis that alkaline phosphatase expression patterns are primarily controlled by the local availability of either the carbon and energy source or the electron acceptor. PMID:9546188

  4. Cloning and characterization of the NapA acid phosphatase/phosphotransferase of Morganella morganii: identification of a new family of bacterial acid-phosphatase-encoding genes.

    PubMed

    Thaller, M C; Lombardi, G; Berlutti, F; Schippa, S; Rossolini, G M

    1995-01-01

    The gene encoding a minor phosphate-irrepressible acid phosphatase (named NapA) of Morganella morganii was cloned and sequenced, and its product characterized. NapA is a secreted acid phosphatase composed of four 27 kDa polypeptide subunits. The enzyme is active on several organic phosphate monoesters but not on diesters, and is also endowed with transphosphorylating activity from organic phosphoric acid esters to nucleosides and other compounds with free hydroxyl groups. Its activity is inhibited by EDTA, inorganic phosphate, nucleosides and Ca2+, but not by fluoride or tartrate, and is enhanced by Mg2+, Co2+ and Zn2+. At the sequence level, the NapA enzyme did not show similarities to any other sequenced bacterial phosphatases. However, a search for homologous genes in sequence databases allowed identification of two open reading frames located within sequenced regions of the Escherichia coli and Proteus mirabilis genomes respectively, encoding proteins of unknown function which are highly homologous to the Morganella enzyme. Moreover, the properties of the NapA enzyme are very similar to those reported for the periplasmic nonspecific acid phosphatase II of Salmonella typhimurium (for which no sequence data are available). These data point to the existence of a new family of bacterial acid phosphatases, which we propose designating class B bacterial acid phosphatases.

  5. Direct electrochemistry of porcine purple acid phosphatase (uteroferrin).

    PubMed

    Bernhardt, Paul V; Schenk, Gerhard; Wilson, Gregory J

    2004-08-17

    Cyclic voltammetry of the non-heme diiron enzyme porcine purple acid phosphatase (uteroferrin, Uf) has been reported for the first time. Totally reversible one-electron oxidation responses (FeIII-FeII --> FeII-FeIII) are seen both in the absence and in the presence of weak competitive inhibitors phosphate and arsenate, and dissociation constants of these oxoanion complexes formed with uteroferrin in its oxidized state (Uf(o)) have been determined. The effect of pH on the redox potentials has been investigated in the range 3 < pH < 6.5, enabling acid dissociation constants for Uf(o) and its phosphate and arsenate complexes to be calculated.

  6. The influence of complexing pharmaceutical compositions on alkaline phosphatase

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Chukhrai, E. S.; Stepina, N. D.; Novikova, N. N.; Yur'eva, E. A.

    2011-06-01

    It is established that the pharmaceutical compositions xydiphon, medifon, succimer, and EDTA, which are used as complexing agents for accelerating the excretion of heavy metals from human organism, at certain concentrations inhibit enzyme alkaline phosphatase (AP). It is concluded that xydiphon and EDTA have a noticeable effect on AP activity at concentrations over 0.01 mM; medifon and succimer, at concentrations of over 0.3-0.5 mM. The enzyme's inhibition constants and type of inhibition are determined. Xydiphon is found to manifest the highest affinity to AP ( K I = 0.35 mM). It is shown by kinetic analysis that dissociative chemoinactivation of the enzyme takes place under the action of complexing agents. The corresponding kinetic parameters are calculated.

  7. Polynucleotide Kinase-Phosphatase (PNKP) Mutations and Neurologic Disease

    PubMed Central

    Dumitrache, Lavinia C.; McKinnon, Peter J.

    2016-01-01

    A variety of human neurologic diseases are caused by inherited defects in DNA repair. In many cases, these syndromes almost exclusively impact the nervous system, underscoring the critical requirement for genome stability in this tissue. A striking example of this is defective enzymatic activity of polynucleotide kinase-phosphatase (PNKP), leading to microcephaly or neurodegeneration. Notably, the broad neural impact of mutations in PNKP can result in markedly different disease entities, even when the inherited mutation is the same. For example microcephaly with seizures (MCSZ) results from various hypomorphic PNKP mutations, as does ataxia with oculomotor apraxia 4 (AOA4). Thus, other contributing factors influence the neural phenotype when PNKP is disabled. Here we consider the role for PNKP in maintaining brain function and how perturbation in its activity can account for the varied pathology of neurodegeneration or microcephaly present in MCSZ and AOA4 respectively. PMID:27125728

  8. Purification and characterization of Ulva pertusa Kjellm alkaline phosphatase.

    PubMed

    Yang, Dong; Wang, Jingyun; Bao, Yongming; An, Lijia

    2003-05-01

    The activity of alkaline phosphatase (ALP, EC 3.1.3.1.) was found in seaweeds, including five kinds of green alga, eighteen kinds of red alga, and six kinds of brown alga, collected from the seaside of Dalian in China. The enzyme was purified 1230-fold from Ulva pertusa Kjellm. It had a specific activity of 48.6 U/mg protein and was proven to be homogeneous by SDS-PAGE with a subunit molecular mass of 19.5 kDa. The activity of ALP peaked at pH9.8, and was completely inhibited by DTT and partly by NBS. The Michaelis-Menten constant Km and the maximum reaction velocity Vmax, at pH 9.8 and 37 degrees C were 0.950 mM and 5.00 microM/min, respectively.

  9. Dephosphorylation of bovine casein by milk alkaline phosphatase.

    PubMed

    Lorient, D; Linden, G

    1976-02-01

    The pH of optimum activity of alkaline phosphatase from cow's milk depended on the substrate, being 10-1 for rho-nitrophenylphosphate, 8-6 for phosphoserine, 8-0 for phosvitin and 6-8 for casein. Individual casein components were dephosphorylated more rapidly than mixtures of alphas- and beta-caseins or of alphas-, beta-and kappa-caseins and micellar casein. Mixtures of 2 components involving kappa-casein were more readily dephosphorylated than alphas- and beta-casein mixtures. At pH 6-8, lactose, whey proteins and phosphate ions had an inhibitory effect. beta-Lactoglobulin had an inhibitory effect only when the pH of the reaction was lower than the optimum pH value of the enzyme. Mg2+ and Zn2+ were not inhibitory. The optimum conditions for dephosphorylation of casein are described.

  10. Hysteresis on heating and cooling of E. coli alkaline phosphatase.

    PubMed

    Uto, Innocent S; Brewer, John M

    2008-01-01

    Measurements of [theta](222) of E. coli phosphatase on heating from 20 degrees to 90 degrees and subsequent cooling to 20 degrees shows a gradual increase in [theta](222) on heating, while cooling shows a symmetric transition centered at 45 degrees . Reheating and cooling shows the same phenomenon. Enzyme heated and cooled once is fully active. The activity of the enzyme depends on its storage conditions (buffer and pH for example), but such changes are least to some extent reversible, especially by heating in different solvents. We conclude the enzyme exists in several forms which are in slow equilibrium with each other, so that the enzyme responds slowly when heated and hence is not at equilibrium during heating/cooling experiments.

  11. Characterization of cationic acid phosphatase isozyme from rat liver mitochondria.

    PubMed

    Fujimoto, S; Murakami, K; Hosoda, T; Yamamoto, Y; Watanabe, K; Morinaka, Y; Ohara, A

    1992-05-01

    Acid phosphatase isozyme was highly purified from rat liver mitochondrial fraction. The enzyme showed an isoelectric point value of above 9.5 on isoelectric focusing, and the apparent molecular weight was estimated to be 32000 by Sephadex G-100 gel filtration or 16000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme catalyzed the hydrolysis of adenosine 5'-triphosphate, adenosine 5'-diphosphate, thiamine pyrophosphate, inorganic pyrophosphate, and phosphoprotein such as casein and phosvitin, but not of several phosphomonoesters, except for p-nitrophenyl phosphate and o-phosphotyrosine. The enzyme was not inhibited by L-(+)-tartrate, and was significantly activated by Fe2+ and reducing agents such as ascorbic acid, L-cysteine,and dithiothreitol. The enzyme was found to be distributed in various rat tissues including liver, spleen, kidney, small intestine, lung, stomach, brain and heart, but not in skeletal muscle.

  12. Roles of phosphatidate phosphatase enzymes in lipid metabolism

    PubMed Central

    Carman, George M.; Han, Gil-Soo

    2006-01-01

    Phosphatidate phosphatase (PAP) enzymes catalyze the dephosphorylation of phosphatidate, yielding diacylglycerol and inorganic phosphate. In eukaryotic cells, PAP activity has a central role in the synthesis of phospholipids and triacylglycerol through its product diacylglycerol, and it also generates and/or degrades lipid-signaling molecules that are related to phosphatidate. There are two types of PAP enzyme, Mg2+ dependent (PAP1) and Mg2+ independent (PAP2), but only genes encoding PAP2 enzymes had been identified until recently, when a gene (PAH1) encoding a PAP1 enzyme was found in Saccharomyces cerevisiae. This discovery has revealed a molecular function of the mammalian protein lipin, a deficiency of which causes lipodystrophy in mice. With molecular information now available for both types of PAP, the specific roles of these enzymes in lipid metabolism are being clarified. PMID:17079146

  13. Covalent Docking Predicts Substrates for Haloalkanoate Dehalogenase Superfamily Phosphatases

    PubMed Central

    2015-01-01

    Enzyme function prediction remains an important open problem. Though structure-based modeling, such as metabolite docking, can identify substrates of some enzymes, it is ill-suited to reactions that progress through a covalent intermediate. Here we investigated the ability of covalent docking to identify substrates that pass through such a covalent intermediate, focusing particularly on the haloalkanoate dehalogenase superfamily. In retrospective assessments, covalent docking recapitulated substrate binding modes of known cocrystal structures and identified experimental substrates from a set of putative phosphorylated metabolites. In comparison, noncovalent docking of high-energy intermediates yielded nonproductive poses. In prospective predictions against seven enzymes, a substrate was identified for five. For one of those cases, a covalent docking prediction, confirmed by empirical screening, and combined with genomic context analysis, suggested the identity of the enzyme that catalyzes the orphan phosphatase reaction in the riboflavin biosynthetic pathway of Bacteroides. PMID:25513739

  14. A bacterial tyrosine phosphatase inhibits plant pattern recognition receptor activation.

    PubMed

    Macho, Alberto P; Schwessinger, Benjamin; Ntoukakis, Vardis; Brutus, Alexandre; Segonzac, Cécile; Roy, Sonali; Kadota, Yasuhiro; Oh, Man-Ho; Sklenar, Jan; Derbyshire, Paul; Lozano-Durán, Rosa; Malinovsky, Frederikke Gro; Monaghan, Jacqueline; Menke, Frank L; Huber, Steven C; He, Sheng Yang; Zipfel, Cyril

    2014-03-28

    Innate immunity relies on the perception of pathogen-associated molecular patterns (PAMPs) by pattern-recognition receptors (PRRs) located on the host cell's surface. Many plant PRRs are kinases. Here, we report that the Arabidopsis receptor kinase EF-TU RECEPTOR (EFR), which perceives the elf18 peptide derived from bacterial elongation factor Tu, is activated upon ligand binding by phosphorylation on its tyrosine residues. Phosphorylation of a single tyrosine residue, Y836, is required for activation of EFR and downstream immunity to the phytopathogenic bacterium Pseudomonas syringae. A tyrosine phosphatase, HopAO1, secreted by P. syringae, reduces EFR phosphorylation and prevents subsequent immune responses. Thus, host and pathogen compete to take control of PRR tyrosine phosphorylation used to initiate antibacterial immunity.

  15. How it all started: tau and protein phosphatase 2A.

    PubMed

    Liu, Chang; Götz, Jürgen

    2013-01-01

    This review is dedicated to Inge Grundke-Iqbal who laid the foundations of the tau field, by isolating tau from the Alzheimer's disease (AD) brain, discovering that tau is hyperphosphorylated, and proving a critical role of protein phosphatase 2A (PP2A) and its endogenous inhibitor I2PP2A in this process. This memorial starts with a few personal notes, and then covers how subcellular fractionation helped in isolating tau. We review in detail the role of PP2A and its endogenous inhibitor in tau phosphorylation. We discuss the role that methylation and phosphorylation have in regulating PP2A activity. We add what we have contributed to understanding the role of tau and PP2A in AD using PP2A transgenic and knockout models, and conclude by addressing two underexplored areas in tau research: tau's non-canonical functions and the role distinct tau isoforms have in a physiological context.

  16. A chemical relaxation study of human prostatic acid phosphatase.

    PubMed

    Shear, D B; Kustin, K

    1968-01-01

    Chemical relaxation methods and a dilution technique were applied to the study of the hydrolysis of p-nitrophenyl phosphate by human prostatic acid phosphatase. Although the reaction mechanism was not elucidated, rate constants and equilibrium constants were obtained for the reaction of enzyme and p-nitrophenol to form a complex. A slow, 2-sec relaxation effect which showed no concentration dependence was observed in various reaction mixtures, including some lacking the substrate and products of the hydrolytic reaction. The conclusion drawn is that there are two forms of the prostatic enzyme, which are normally in equilibrium with each other, but which undergo a relatively slow interconversion when this equilibrium is perturbed. A preliminary calculation indicates that these forms are present in the equilibrium ratio of 2:1.

  17. Intestinal alkaline phosphatase prevents metabolic syndrome in mice.

    PubMed

    Kaliannan, Kanakaraju; Hamarneh, Sulaiman R; Economopoulos, Konstantinos P; Nasrin Alam, Sayeda; Moaven, Omeed; Patel, Palak; Malo, Nondita S; Ray, Madhury; Abtahi, Seyed M; Muhammad, Nur; Raychowdhury, Atri; Teshager, Abeba; Mohamed, Mussa M Rafat; Moss, Angela K; Ahmed, Rizwan; Hakimian, Shahrad; Narisawa, Sonoko; Millán, José Luis; Hohmann, Elizabeth; Warren, H Shaw; Bhan, Atul K; Malo, Madhu S; Hodin, Richard A

    2013-04-23

    Metabolic syndrome comprises a cluster of related disorders that includes obesity, glucose intolerance, insulin resistance, dyslipidemia, and fatty liver. Recently, gut-derived chronic endotoxemia has been identified as a primary mediator for triggering the low-grade inflammation responsible for the development of metabolic syndrome. In the present study we examined the role of the small intestinal brush-border enzyme, intestinal alkaline phosphatase (IAP), in preventing a high-fat-diet-induced metabolic syndrome in mice. We found that both endogenous and orally supplemented IAP inhibits absorption of endotoxin (lipopolysaccharides) that occurs with dietary fat, and oral IAP supplementation prevents as well as reverses metabolic syndrome. Furthermore, IAP supplementation improves the lipid profile in mice fed a standard, low-fat chow diet. These results point to a potentially unique therapy against metabolic syndrome in at-risk humans.

  18. Establishing Quantitative Standards for Residual Alkaline Phosphatase in Pasteurized Milk

    PubMed Central

    Chon, Jung-Whan; Kim, Hyunsook; Kim, Kwang-Yup

    2016-01-01

    The alkaline phosphatase (ALP) assay is a rapid and convenient method for verifying milk pasteurization. Since colorimetric ALP assays rely on subjective visual assessments, their results are especially unreliable near the detection limits. In this study, we attempted to establish quantitative criteria for residual ALP in milk by using a more objective method based on spectrophotometric measurements. Raw milk was heat-treated for 0, 10, 20, 30, and 40 min and then subjected to ALP assays. The quantitative criteria for residual ALP in the milk was determined as 2 μg phenol/mL of milk, which is just above the ALP value of milk samples heat-treated for 30 min. These newly proposed methodology and criteria could facilitate the microbiological quality control of milk. PMID:27194927

  19. [Cellular components and placental alkaline phosphatase in Trypanosoma cruzi infection ].

    PubMed

    Sartori, Maria José; Mezzano, Luciana; Lin, Susana; Repossi, Gastón; Fabro, Sofía P

    2005-01-01

    Trypanosoma cruzi induces changes in the protein pattern of human placenta syncytiotrophoblast. Placental alkaline phosphatase (PLAP) is a glycoenzyme anchored to the membrane by a glycosyl-phosphatidylinositol molecule. PLAP activity and its presence was altered by the parasite in cultures of human placental villi and HEp2 cells with T.cruzi. The cells treated before the cultures with agents which affect PILAP or glycosyl-phosphatidylinositol (antibodies, PL-C, genistein, lithium) presented less parasitic invasion than the control ones. It was also observed a modification in the pattern of actine filaments of the host cells infected. We concluded that PLAP would participate in the process of T. cruzi invasion into placental syncitiotrophoblast cells, by a mechanism that involves hydrolysis of the glycosyl-phosphatidylinositol molecules, the activation of tyrosine kinase proteins, the increase of cytosolic calcium and the rearrangement of actine filaments of the host cells.

  20. Superresolution imaging of the cytoplasmic phosphatase PTPN22 links integrin-mediated T cell adhesion with autoimmunity.

    PubMed

    Burn, Garth L; Cornish, Georgina H; Potrzebowska, Katarzyna; Samuelsson, Malin; Griffié, Juliette; Minoughan, Sophie; Yates, Mark; Ashdown, George; Pernodet, Nicolas; Morrison, Vicky L; Sanchez-Blanco, Cristina; Purvis, Harriet; Clarke, Fiona; Brownlie, Rebecca J; Vyse, Timothy J; Zamoyska, Rose; Owen, Dylan M; Svensson, Lena M; Cope, Andrew P

    2016-10-04

    Integrins are heterodimeric transmembrane proteins that play a fundamental role in the migration of leukocytes to sites of infection or injury. We found that protein tyrosine phosphatase nonreceptor type 22 (PTPN22) inhibits signaling by the integrin lymphocyte function-associated antigen-1 (LFA-1) in effector T cells. PTPN22 colocalized with its substrates at the leading edge of cells migrating on surfaces coated with the LFA-1 ligand intercellular adhesion molecule-1 (ICAM-1). Knockout or knockdown of PTPN22 or expression of the autoimmune disease-associated PTPN22-R620W variant resulted in the enhanced phosphorylation of signaling molecules downstream of integrins. Superresolution imaging revealed that PTPN22-R620 (wild-type PTPN22) was present as large clusters in unstimulated T cells and that these disaggregated upon stimulation of LFA-1, enabling increased association of PTPN22 with its binding partners at the leading edge. The failure of PTPN22-R620W molecules to be retained at the leading edge led to increased LFA-1 clustering and integrin-mediated cell adhesion. Our data define a previously uncharacterized mechanism for fine-tuning integrin signaling in T cells, as well as a paradigm of autoimmunity in humans in which disease susceptibility is underpinned by inherited phosphatase mutations that perturb integrin function.

  1. C-terminal domain (CTD) phosphatase links Rho GTPase signaling to Pol II CTD phosphorylation in Arabidopsis and yeast.

    PubMed

    Zhang, Bo; Yang, Guohua; Chen, Yu; Zhao, Yihong; Gao, Peng; Liu, Bo; Wang, Haiyang; Zheng, Zhi-Liang

    2016-12-13

    Rho GTPases, including the Rho, Cdc42, Rac, and ROP subfamilies, act as pivotal signaling switches in various growth and developmental processes. Compared with the well-defined role of cytoskeletal organization in Rho signaling, much less is known regarding transcriptional regulation. In a mutant screen for phenotypic enhancers of transgenic Arabidopsis plants expressing a constitutively active form of ROP2 (designated CA1-1), we identified RNA polymerase II (Pol II) C-terminal domain (CTD) phosphatase-like 1 (CPL1) as a transcriptional regulator of ROP2 signaling. We show that ROP2 activation inhibits CPL1 activity by promoting its degradation, leading to an increase in CTD Ser5 and Ser2 phosphorylation. We also observed similar modulation of CTD phosphorylation by yeast Cdc42 GTPase and enhanced degradation of the yeast CTD phosphatase Fcp1 by activated ROP2 signaling. Taken together, our results suggest that modulation of the Pol II CTD code by Rho GTPase signaling represents an evolutionarily conserved mechanism in both unicellular and multicellular eukaryotes.

  2. The neural receptor protein tyrosine phosphatase DPTP69D is required during periods of axon outgrowth in Drosophila.

    PubMed Central

    Desai, Chand; Purdy, Joy

    2003-01-01

    We have isolated and characterized a series of 18 chemically induced alleles of Ptp69D ranging in strength from viable to worse than null, which represent unique tools for probing the structure, function, and signaling pathway of DPTP69D. Three alleles are strongly temperature sensitive and were used to define the developmental periods requiring DPTP69D function; adult health requires DPTP69D during the mid- to late-pupal stage, eclosion requires DPTP69D during the early to mid-larval stage, and larval survival requires DPTP69D during embryogenesis. Mutations predicted to abolish the phosphatase activity of the membrane proximal D1 domain severely reduce but do not abolish DPTP69D function. Six alleles appear null; only 20% of null homozygotes pupate and <5% eclose, only to fall into the food and drown. One allele, Ptp69D(7), confers axon and viability defects more severe than those of the null phenotype. Sequence analysis predicts that Ptp69D(7) encodes a mutant protein that may bind but not release substrate. Like mutations in the protein tyrosine phosphatase gene Dlar, strong Ptp69D alleles cause the ISNb nerve to bypass its muscle targets. Genetic analysis reveals that the bypass defect in Dlar and Ptp69D mutants is dependent upon DPTP99A function, consistent with the hypothesis that DPTP69D and DLAR both counteract DPTP99A, allowing ISNb axons to enter their target muscle field. PMID:12807778

  3. The involvement of glucose-6-phosphatase in mucilage secretion by root cap cells of Zea mays

    NASA Technical Reports Server (NTRS)

    Moore, R.; McClelen, C. E.

    1985-01-01

    In order to determine the involvement of glucose-6-phosphatase in mucilage secretion by root cap cells, we have cytochemically localized the enzyme in columella and peripheral cells of root caps of Zea mays. Glucose-6-phosphatase is associated with the plasmalemma and cell wall of columella cells. As columella cells differentiate into peripheral cells and begin to produce and secrete mucilage, glucose-6-phosphatase staining intensifies and becomes associated with the mucilage and, to a lesser extent, the cell wall. Cells being sloughed from the cap are characterized by glucose-6-phosphatase staining being associated with the vacuole and plasmalemma. These changes in enzyme localization during cellular differentiation in root caps suggest that glucose-6-phosphatase is involved in the production and/or secretion of mucilage by peripheral cells of Z. mays.

  4. ERK1/2 is dephosphorylated by a novel phosphatase--CacyBP/SIP.

    PubMed

    Kilanczyk, Ewa; Filipek, Slawomir; Filipek, Anna

    2011-01-07

    Recently, we have reported that the CacyBP/SIP protein binds ERK1/2 (Kilanczyk et al., BBRC, 2009). In this work we show that CacyBP/SIP exhibits a phosphatase activity toward ERK1/2 kinases while its E217K mutant does not. The K(m) and V(max) values established for a standard phosphatase substrate, p-NPP, are 16.9±3.6 mM and 4.3±0.4 μmol/min, respectively. The CacyBP/SIP phosphatase activity is decreased by okadaic acid (IC(50)=45 nM). Our experimental results are supported by a theoretical analysis which revealed important sequence similarities between CacyBP/SIP and the phosphatase-like proteins as well as certain MAP kinase phosphatases.

  5. Regulation and expression of type V (tartrate-resistant) acid phosphatase in human mononuclear phagocytes.

    PubMed

    Bevilacqua, M A; Lord, D K; Cross, N C; Whitaker, K B; Moss, D W; Cox, T M

    1991-02-01

    Human type V (tartrate-resistant) acid phosphatase belongs to a unique group of iron-binding proteins that includes uteroferrin and other purple phosphatases. The enzyme is normally restricted to osteoclasts and certain phagocytic cells but its rôle is unknown. We show that phosphatase mRNA is abundant in cells of monohistiocytic phenotype and that enzyme expression in cultured human monocyte-derived macrophages is depressed by gamma-interferon and bacterial lipopolysaccharide, agents that promote functional differentiation in these cells. In contrast, phorbol ester, which stimulates intracellular calcium-mediated events, greatly enhances type V phosphatase expression and mRNA abundance. Lymphokine and phorbol ester-modulated expression of type V acid phosphatase expression thus represents a model system for investigating proliferative responses that are specific to cells of the mononuclear macrophage system.

  6. Phosphatidic acid phosphatase and phospholipdase A activities in plasma membranes from fusing muscle cells.

    PubMed

    Kent, C; Vagelos, P R

    1976-06-17

    Plasma membrane from fusing embryonic muscle cells were assayed for phospholipase A activity to determine if this enzyme plays a role in cell fusion. The membranes were assayed under a variety of conditions with phosphatidylcholine as the substrate and no phospholipase A activity was found. The plasma membranes did contain a phosphatidic acid phosphatase which was optimally active in the presence of Triton X-100 and glycerol. The enzyme activity was constant from pH 5.2 to 7.0, and did not require divalent cations. Over 97% of the phosphatidic acid phosphatase activity was in the particulate fraction. The subcellular distribution of the phosphatidic acid phosphatase was the same as the distributions of the plasma membrane markers, (Na+ + k+)-ATPase and the acetylcholine receptor, which indicates that this phosphatase is located exclusively in the plasma membranes. There was no detectable difference in the phosphatidic acid phosphatase activities of plasma membranes from fusing and non-fusing cells.

  7. Vanadate monomers and dimers both inhibit the human prostatic acid phosphatase.

    PubMed

    Crans, D C; Simone, C M; Saha, A K; Glew, R H

    1989-11-30

    A combination of enzyme kinetics and 51V NMR spectroscopy was used to identify the species of vanadate that inhibits acid phosphatases. Monomeric vanadate was shown to inhibit wheat germ and potato acid phosphatases. At pH 5.5, the vanadate dimer inhibits the human prostatic acid phosphatase whereas at pH 7.0 it is the vanadate monomer that inhibits this enzyme. The pH-dependent shift in the affinity of the prostatic phosphatase for vanadate is presumably due to deprotonation of an amino acid side chain in or near the binding site resulting in a conformational change in the protein. pH may be a subtle effector of the insulin-like vanadate activity in biological systems and may explain some of the differences in selectivity observed with the protein phosphatases.

  8. Alkaline phosphatase levels in patients with coronary heart disease saliva and its relation with periodontal status

    NASA Astrophysics Data System (ADS)

    Yunita, Dina Suci; Masulili, Sri Lelyati C.; Tadjoedin, Fatimah M.; Radi, Basuni

    2017-02-01

    Coronary heart disease (CHD) is a disease that causes narrowing of the coronary arteries. Currently, there is a hypothesis regarding periodontal infection that increases risk for heart disease. Alkaline phosphatase (ALP) as a marker of inflammation will increase in atherosclerosis and periodontal disease. The objective of this research is analyzing the relationship between the levels of alkaline phosphatase in saliva with periodontal status in patients with CHD and non CHD. Here, saliva of 104 subjects were taken, each 1 ml, and levels of Alkaline Phosphatase was analyzed using Abbott ci4100 architect. We found that no significant difference of Alkaline Phosphatase levels in saliva between CHD patients and non CHD. Therefore, it can be concluded that Alkaline Phosphatase levels in patients with CHD saliva was higher than non CHD and no association between ALP levels with periodontal status.

  9. Ultrastructural phosphatase histochemistry of submandibular and parotid salivary glands of man.

    PubMed

    Harrison, J D; Auger, D W; Badir, M S

    1988-02-01

    Thiamine pyrophosphatase was demonstrated in the Golgi complex and acid phosphatase in the GERL of acinar cells of submandibular and parotid glands and were previously demonstrated in cells of intercalary ducts. Thiamine pyrophosphatase was also demonstrated in the Golgi complex of cells of striated and excretory ducts and myoepithelial cells. Acid phosphatase was also demonstrated in lysosomes. Alkaline phosphatase was rarely demonstrated light microscopically at luminal surfaces of striated and excretory ducts and electron microscopically in luminal vesicles in cells of striated ducts. The demonstration of the phosphatases in Golgi complexes and GERLs indicates that investigations on these structures in experimental animals are relevant to human salivary glands and supports the opinion that ductal cells as well as acinar cells secrete organic material. The presence of alkaline phosphatase at luminal surfaces of striated and excretory ducts suggests that resorption as well as secretion may occur in them.

  10. Function-Based Metagenomic Library Screening and Heterologous Expression Strategy for Genes Encoding Phosphatase Activity.

    PubMed

    Villamizar, Genis A Castillo; Nacke, Heiko; Daniel, Rolf

    2017-01-01

    The release of phosphate from inorganic and organic phosphorus compounds can be mediated enzymatically. Phosphate-releasing enzymes, comprising acid and alkaline phosphatases, are recognized as useful biocatalysts in applications such as plant and animal nutrition, bioremediation and diagnostic analysis. Metagenomic approaches provide access to novel phosphatase-encoding genes. Here, we describe a function-based screening approach for rapid identification of genes conferring phosphatase activity from small-insert and large-insert metagenomic libraries derived from various environments. This approach bears the potential for discovery of entirely novel phosphatase families or subfamilies and members of known enzyme classes hydrolyzing phosphomonoester bonds such as phytases. In addition, we provide a strategy for efficient heterologous phosphatase gene expression.

  11. Mycobacterium tuberculosis-secreted phosphatases: from pathogenesis to targets for TB drug development.

    PubMed

    Wong, Dennis; Chao, Joseph D; Av-Gay, Yossef

    2013-02-01

    Mycobacterium tuberculosis (Mtb) infects human alveolar macrophages and relies on the inhibition of phagosome acidification and maturation. This is, in part, dependent on the disruption of host signaling networks within the macrophage. In recent years, Mtb-secreted protein- and lipid-phosphatases protein-tyrosine phosphatase A (PtpA), PtpB, and secreted acid phosphatase M (SapM) have been shown to contribute to Mtb pathogenicity. Here, we review the current knowledge on PtpA, PtpB, and SapM focusing on their ability to interfere with host functions. We further explore how these phosphatase-dependent host-pathogen interactions can be targeted for novel tuberculosis (TB) drug discovery and examine the ongoing development of inhibitors against these phosphatases. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. The involvement of glucose-6-phosphatase in mucilage secretion by root cap cells of Zea mays

    NASA Technical Reports Server (NTRS)

    Moore, R.; McClelen, C. E.

    1985-01-01

    In order to determine the involvement of glucose-6-phosphatase in mucilage secretion by root cap cells, we have cytochemically localized the enzyme in columella and peripheral cells of root caps of Zea mays. Glucose-6-phosphatase is associated with the plasmalemma and cell wall of columella cells. As columella cells differentiate into peripheral cells and begin to produce and secrete mucilage, glucose-6-phosphatase staining intensifies and becomes associated with the mucilage and, to a lesser extent, the cell wall. Cells being sloughed from the cap are characterized by glucose-6-phosphatase staining being associated with the vacuole and plasmalemma. These changes in enzyme localization during cellular differentiation in root caps suggest that glucose-6-phosphatase is involved in the production and/or secretion of mucilage by peripheral cells of Z. mays.

  13. Neuronal Shp2 tyrosine phosphatase controls energy balance and metabolism

    PubMed Central

    Zhang, Eric E.; Chapeau, Emilie; Hagihara, Kazuki; Feng, Gen-Sheng

    2004-01-01

    Shp2, a Src homology 2-containing tyrosine phosphatase, has been implicated in a variety of growth factor or cytokine signaling pathways. However, it is conceivable that this enzyme acts predominantly in one pathway versus the others in a cell, depending on the cellular context. To determine the putative functions of Shp2 in the adult brain, we selectively deleted Shp2 in postmitotic forebrain neurons by crossing CaMKIIα-Cre transgenic mice with a conditional Shp2 mutant (Shp2flox) strain. Surprisingly, a prominent phenotype of the mutant (CaMKIIα-Cre:Shp2flox/flox or CaSKO) mice was the development of early-onset obesity, with increased serum levels of leptin, insulin, glucose, and triglycerides. The mutant mice were not hyperphagic but developed enlarged and steatotic liver. Consistent with previous in vitro data, we found that Shp2 down-regulates Jak2/Stat3 (signal transducer and activator of transcription 3) activation by leptin in the hypothalamus. However, Jak2/Stat3 down-regulation is offset by a dominant Shp2 promotion of the leptin-stimulated Erk pathway, leading to induction rather than suppression of leptin resistance upon Shp2 deletion in the brain. Collectively, these results suggest that a primary function of Shp2 in postmitotic forebrain neurons is to control energy balance and metabolism, and that this phosphatase is a critical signaling component of leptin receptor ObRb in the hypothalamus. Shp2 shows potential as a neuronal target for pharmaceutical sensitization of obese patients to leptin action. PMID:15520383

  14. Preparation and biophysical characterization of recombinant Pseudomonas aeruginosa phosphorylcholine phosphatase.

    PubMed

    Beassoni, Paola R; Berti, Federico Pérez de; Otero, Lisandro H; Risso, Valeria A; Ferreyra, Raul G; Lisa, Angela T; Domenech, Carlos E; Ermácora, Mario R

    2010-06-01

    Pseudomonas aeruginosa infections constitute a widespread health problem with high economical and social impact, and the phosphorylcholine phosphatase (PchP) of this bacterium is a potential target for antimicrobial treatment. However, drug design requires high-resolution structural information and detailed biophysical knowledge not available for PchP. An obstacle in the study of PchP is that current methods for its expression and purification are suboptimal and allowed only a preliminary kinetic characterization of the enzyme. Herein, we describe a new procedure for the efficient preparation of recombinant PchP overexpressed in Escherichia coli. The enzyme is purified from urea solubilized inclusion bodies and refolded by dialysis. The product of PchP refolding is a mixture of native PchP and a kinetically-trapped, alternatively-folded aggregate that is very slowly converted into the native state. The properly folded and fully active enzyme is isolated from the refolding mixture by size-exclusion chromatography. PchP prepared by the new procedure was subjected to chemical and biophysical characterization, and its basic optical, hydrodynamic, metal-binding, and catalytic properties are reported. The unfolding of the enzyme was also investigated, and its thermal stability was determined. The obtained information should help to compare PchP with other phosphatases and to obtain a better understanding of its catalytic mechanism. In addition, preliminary trials showed that PchP prepared by the new protocol is suitable for crystallization, opening the way for high-resolution studies of the enzyme structure.

  15. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells

    PubMed Central

    Abbasian, Nima; Burton, James O.; Herbert, Karl E.; Tregunna, Barbara-Emily; Brown, Jeremy R.; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J.; Goodall, Alison H.

    2015-01-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  16. Protein Phosphatase-1 Regulates Expression of Neuregulin-1

    PubMed Central

    Ammosova, Tatiana; Washington, Kareem; Rotimi, Jamie; Kumari, Namita; Smith, Kahli A.; Niu, Xiaomei; Jerebtsova, Marina; Nekhai, Sergei

    2016-01-01

    Protein phosphatase 1 (PP1), a cellular serine/threonine phosphatase, is targeted to cellular promoters by its major regulatory subunits, PP1 nuclear targeting subunit, nuclear inhibitor of PP1 (NIPP1) and RepoMan. PP1 is also targeted to RNA polymerase II (RNAPII) by NIPP1 where it can dephosphorylate RNAPII and cycle-dependent kinase 9 (CDK9). Here, we show that treatment of cells with a small molecule activator of PP1 increases the abundance of a neuregulin-1 (NRG-1)-derived peptide. NRG-1 mRNA and protein levels were increased in the cells stably or transiently expressing mutant NIPP1 (mNIPP1) that does not bind PP1, but not in the cells expressing NIPP1. Expression of mNIPP1 also activated the NRG-1 promoter in an NF-κB-dependent manner. Analysis of extracts from mNIPP1 expressing cells by glycerol gradient centrifugation showed a redistribution of PP1 and CDK9 between large and small molecular weight complexes, and increased CDK9 Thr-186 phosphorylation. This correlated with the increased CDK9 activity. Further, RNAPII co-precipitated with mNIPP1, and phosphorylation of RNAPII C-terminal domain (CTD) Ser-2 residues was greater in cells expressing mNIPP1. In mNIPP1 expressing cells, okadaic acid, a cell-permeable inhibitor of PP1, did not increase Ser-2 CTD phosphorylation inhibited by flavopiridol, in contrast to the NIPP1 expressing cells, suggesting that PP1 was no longer involved in RNAPII dephosphorylation. Finally, media conditioned with mNIPP1 cells induced the proliferation of wild type 84-31 cells, consistent with a role of neuregulin-1 as a growth promoting factor. Our study indicates that deregulation of PP1/NIPP1 holoenzyme activates NRG-1 expression through RNAPII and CDK9 phosphorylation in a NF-κB dependent manner. PMID:27918433

  17. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification.

    PubMed

    Chicote, Javier U; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins.

  18. A novel phosphatase upregulated in Akp3 knockout mice.

    PubMed

    Narisawa, Sonoko; Hoylaerts, Marc F; Doctor, Kutbuddin S; Fukuda, Michiko N; Alpers, David H; Millán, José Luis

    2007-11-01

    Reexamination of the Akp3(-/-) mouse intestine showed that, despite the lack of intestinal alkaline phosphatase (IAP), the Akp3(-/-) gut still had considerable alkaline phosphatase (AP) activity in the duodenum and ileum. This activity is due to the expression of a novel murine Akp6 gene that encodes an IAP isozyme expressed in the gut in a global manner (gIAP) as opposed to duodenum-specific IAP (dIAP) isozyme encoded by the Akp3 gene. Phylogenetically, gIAP is similar to the rat IAP I isozyme. Kinetically, gIAP displays a 5.7-fold reduction in catalytic rate constant (k(cat)) and a 30% drop in K(m), leading to a 4-fold reduction k(cat)/K(m) compared with dIAP, and these changes in enzymatic properties can all be attributed to a crucial R317Q substitution. Western and Northern blot analyses document the expression of Akp6 in the gut, from the duodenum to the ileum, and it is upregulated in the jejunum and ileum of Akp3(-/-) mice. Developmentally, Akp3 expression is turned on during postnatal days 13-15 and exclusively in the duodenum, whereas Akp6 and Akp5 are expressed from birth throughout the gut with enhanced expression at weaning. Posttranslational modifications of gIAP have a pronounced effect on its catalytic properties. Given the low catalytic efficiency of gIAP, its upregulation during fat feeding, its sequence similarity with rat IAP I, and the fact that rat IAP I has been implicated in the upregulation of surfactant-like particles during fat intake, it appears likely that gIAP may have a role in mediating the accelerated fatty acid intake observed in Akp3(-/-) mice fed a high-fat diet.

  19. Mannitol metabolism in brown algae involves a new phosphatase family.

    PubMed

    Groisillier, Agnès; Shao, Zhanru; Michel, Gurvan; Goulitquer, Sophie; Bonin, Patricia; Krahulec, Stefan; Nidetzky, Bernd; Duan, Delin; Boyen, Catherine; Tonon, Thierry

    2014-02-01

    Brown algae belong to a phylogenetic lineage distantly related to green plants and animals, and are found predominantly in the intertidal zone, a harsh and frequently changing environment. Because of their unique evolutionary history and of their habitat, brown algae feature several peculiarities in their metabolism. One of these is the mannitol cycle, which plays a central role in their physiology, as mannitol acts as carbon storage, osmoprotectant, and antioxidant. This polyol is derived directly from the photoassimilate fructose-6-phosphate via the action of a mannitol-1-phosphate dehydrogenase and a mannitol-1-phosphatase (M1Pase). Genome analysis of the brown algal model Ectocarpus siliculosus allowed identification of genes potentially involved in the mannitol cycle. Among these, two genes coding for haloacid dehalogenase (HAD)-like enzymes were suggested to correspond to M1Pase activity, and thus were named EsM1Pase1 and EsM1Pase2, respectively. To test this hypothesis, both genes were expressed in Escherichia coli. Recombinant EsM1Pase2 was shown to hydrolyse the phosphate group from mannitol-1-phosphate to produce mannitol but was not active on the hexose monophosphates tested. Gene expression analysis showed that transcription of both E. siliculosus genes was under the influence of the diurnal cycle. Sequence analysis and three-dimensional homology modelling indicated that EsM1Pases, and their orthologues in Prasinophytes, should be seen as founding members of a new family of phosphatase with original substrate specificity within the HAD superfamily of proteins. This is the first report describing the characterization of a gene encoding M1Pase activity in photosynthetic organisms.

  20. Characterization of the human LPIN1-encoded phosphatidate phosphatase isoforms.

    PubMed

    Han, Gil-Soo; Carman, George M

    2010-05-07

    The human LPIN1 gene encodes the protein lipin 1, which possesses phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase; EC 3.1.3.4) activity (Han, G.-S., Wu, W.-I., and Carman, G. M. (2006) J. Biol. Chem. 281, 9210-9218). In this work, we characterized human lipin 1 alpha, beta, and gamma isoforms that were expressed in Escherichia coli and purified to near homogeneity. PA phosphatase activities of the alpha, beta, and gamma isoforms were dependent on Mg(2+) or Mn(2+) ions at pH 7.5 at 37 degrees C. The activities were inhibited by concentrations of Mg(2+) and Mn(2+) above their optimums and by Ca(2+), Zn(2+), N-ethylmaleimide, propranolol, and the sphingoid bases sphingosine and sphinganine. The activities were thermally labile at temperatures above 40 degrees C. The alpha, beta, and gamma activities followed saturation kinetics with respect to the molar concentration of PA (K(m) values of 0.35, 0.24, and 0.11 mm, respectively) but followed positive cooperative (Hill number approximately 2) kinetics with respect to the surface concentration of PA (K(m) values of 4.2, 4.5, and 4.3 mol %, respectively) in Triton X-100/PA-mixed micelles. The turnover numbers (k(cat)) for the alpha, beta, and gamma isoforms were 68.8 + or - 3.5, 42.8 + or - 2.5, and 5.7 + or - 0.2 s(-1), respectively, whereas their energy of activation values were 14.2, 15.5, and 18.5 kcal/mol, respectively. The isoform activities were dependent on PA as a substrate and required at least one unsaturated fatty acyl moiety for maximum activity.

  1. Characterization of the Human LPIN1-encoded Phosphatidate Phosphatase Isoforms*

    PubMed Central

    Han, Gil-Soo; Carman, George M.

    2010-01-01

    The human LPIN1 gene encodes the protein lipin 1, which possesses phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase; EC 3.1.3.4) activity (Han, G.-S., Wu, W.-I., and Carman, G. M. (2006) J. Biol. Chem. 281, 9210–9218). In this work, we characterized human lipin 1 α, β, and γ isoforms that were expressed in Escherichia coli and purified to near homogeneity. PA phosphatase activities of the α, β, and γ isoforms were dependent on Mg2+ or Mn2+ ions at pH 7.5 at 37 °C. The activities were inhibited by concentrations of Mg2+ and Mn2+ above their optimums and by Ca2+, Zn2+, N-ethylmaleimide, propranolol, and the sphingoid bases sphingosine and sphinganine. The activities were thermally labile at temperatures above 40 °C. The α, β, and γ activities followed saturation kinetics with respect to the molar concentration of PA (Km values of 0.35, 0.24, and 0.11 mm, respectively) but followed positive cooperative (Hill number ∼2) kinetics with respect to the surface concentration of PA (Km values of 4.2, 4.5, and 4.3 mol %, respectively) in Triton X-100/PA-mixed micelles. The turnover numbers (kcat) for the α, β, and γ isoforms were 68.8 ± 3.5, 42.8 ± 2.5, and 5.7 ± 0.2 s−1, respectively, whereas their energy of activation values were 14.2, 15.5, and 18.5 kcal/mol, respectively. The isoform activities were dependent on PA as a substrate and required at least one unsaturated fatty acyl moiety for maximum activity. PMID:20231281

  2. Infrequent methylation of the DUSP6 phosphatase in endometrial cancer

    PubMed Central

    Chiappinelli, Katherine B.; Rimel, B. J.; Massad, L. Stewart; Goodfellow, Paul J.

    2010-01-01

    Objective Dual-specificity phosphatase six (DUSP6, MKP3, or PYST1) dephosphorylates phosphotyrosine and phosphothreonine residues on ERK-2 (MAPK1) to inactivate the ERK-2 kinase. DUSP6 is a critical regulator of the ERK signaling cascade and has been implicated as a tumor suppressor. DNA methylation in the first intron of DUSP6 abrogates expression in a subset of pancreatic cancers. We sought to determine whether DUSP6 was similarly silenced by methylation in endometrial cancer, a tumor type in which there is frequent activation of the ERK pathway. Methods 109 endometrial cancers were analyzed for DUSP6 methylation using combined bisulfite restriction analysis (COBRA). The cohort included 70 primary endometrioid endometrial cancers, 21 primary endometrial tumors of adverse histological types, and 18 endometrial cancer cell lines. Primary tumors, cell lines, and normal endometrial tissues were analyzed for DUSP6 mRNA levels using quantitative RT-PCR and pERK levels by Western blots and/ or immunohistochemistry. Results Methylation of the first intron of the DUSP6 gene was seen in 1/91 primary endometrial cancers investigated. The methylated tumor was also methylated at the more 5′ regulatory region of DUSP6. Q-RT-PCR revealed that DUSP6 transcript levels varied widely in primary endometrial tumors. DUSP6 mRNA levels did not correlate with pERK status in primary tumors, consistent with the existence of negative feedback loops activated by pERK that result in transcription of DUSP6. Conclusion DUSP6 methylation is a rare event in endometrial cancer. Silencing of the DUSP6 phosphatase is unlikely to contribute to constitutive activation of the ERK kinase cascade in endometrial cancer. PMID:20638106

  3. Infrequent methylation of the DUSP6 phosphatase in endometrial cancer.

    PubMed

    Chiappinelli, Katherine B; Rimel, B J; Massad, L Stewart; Goodfellow, Paul J

    2010-10-01

    Dual-specificity phosphatase six (DUSP6, MKP3, or PYST1) dephosphorylates phosphotyrosine and phosphothreonine residues on ERK-2 (MAPK1) to inactivate the ERK-2 kinase. DUSP6 is a critical regulator of the ERK signaling cascade and has been implicated as a tumor suppressor. DNA methylation in the first intron of DUSP6 abrogates expression in a subset of pancreatic cancers. We sought to determine whether DUSP6 was similarly silenced by methylation in endometrial cancer, a tumor type in which there is frequent activation of the ERK pathway. One hundred and nine endometrial cancers were analyzed for DUSP6 methylation using combined bisulfite restriction analysis (COBRA). The cohort included 70 primary endometrioid endometrial cancers, 21 primary endometrial tumors of adverse histological types, and 18 endometrial cancer cell lines. Primary tumors, cell lines, and normal endometrial tissues were analyzed for DUSP6 mRNA levels using quantitative RT-PCR and pERK levels by Western blots and/or immunohistochemistry. Methylation of the first intron of the DUSP6 gene was seen in 1/91 primary endometrial cancers investigated. The methylated tumor was also methylated at the more 5' regulatory region of DUSP6. Q-RT-PCR revealed that DUSP6 transcript levels varied widely in primary endometrial tumors. DUSP6 mRNA levels did not correlate with pERK status in primary tumors, consistent with the existence of negative feedback loops activated by pERK that result in transcription of DUSP6. DUSP6 methylation is a rare event in endometrial cancer. Silencing of the DUSP6 phosphatase is unlikely to contribute to constitutive activation of the ERK kinase cascade in endometrial cancer. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Redox regulation of protein tyrosine phosphatase activity by hydroxyl radical.

    PubMed

    Meng, Fan-Guo; Zhang, Zhong-Yin

    2013-01-01

    Substantial evidence suggests that transient production of reactive oxygen species (ROS) such as hydrogen peroxide (H(2)O(2)) is an important signaling event triggered by the activation of various cell surface receptors. Major targets of H(2)O(2) include protein tyrosine phosphatases (PTPs). Oxidation of the active site Cys by H(2)O(2) abrogates PTP catalytic activity, thereby potentially furnishing a mechanism to ensure optimal tyrosine phosphorylation in response to a variety of physiological stimuli. Unfortunately, H(2)O(2) is poorly reactive in chemical terms and the second order rate constants for the H(2)O(2)-mediated PTP inactivation are ~10M(-1)s(-1), which is too slow to be compatible with the transient signaling events occurring at the physiological concentrations of H(2)O(2). We find that hydroxyl radical is produced from H(2)O(2) solutions in the absence of metal chelating agent by the Fenton reaction. We show that the hydroxyl radical is capable of inactivating the PTPs and the inactivation is active site directed, through oxidation of the catalytic Cys to sulfenic acid, which can be reduced by low molecular weight thiols. We also show that hydroxyl radical is a kinetically more efficient oxidant than H(2)O(2) for inactivating the PTPs. The second-order rate constants for the hydroxyl radical-mediated PTP inactivation are at least 2-3 orders of magnitude higher than those mediated by H(2)O(2) under the same conditions. Thus, hydroxyl radical generated in vivo may serve as a more physiologically relevant oxidizing agent for PTP inactivation. This article is part of a Special Issue entitled: Chemistry and mechanism of phosphatases, diesterases and triesterases.

  5. Identification and enzymatic characterization of acid phosphatase from Burkholderia gladioli

    PubMed Central

    2014-01-01

    Background The genus Burkholderia is widespread in diverse ecological niches, the majority of known species are soil bacteria that exhibit different types of non-pathogenic interactions with plants. Burkholderia species are versatile organisms that solubilize insoluble minerals through the production of organic acids, which increase the availability of nutrients for the plant. Therefore these bacteria are promising candidates for biotechnological applications. Results Burkholderia sp. (R 3.25 isolate) was isolated from agricultural soil in Ponta Grossa-PR-Brazil and identified through analysis of the 16S rDNA as a strain classified as Burkholderia gladioli. The expression of membrane-bound acid phosphatase (MBAcP) was strictly regulated with optimal expression at a concentration of phosphorus 5 mM. The apparent optimum pH for the hydrolysis of p-nitrophenylphosphate (PNPP) was 6.0. The hydrolysis of PNPP by the enzyme exhibited a hyperbolic relationship with increasing concentration of substrate and no inhibition by excess of substrate was observed. Kinetic data revealed that the hydrolysis of PNPP exhibited cooperative kinetics with n = 1.3, Vm = 113.5 U/mg and K0.5 = 65 μM. The PNPPase activity was inhibited by vanadate, p-hydroxymercuribenzoate, arsenate and phosphate, however the activity was not inhibited by calcium, levamisole, sodium tartrate, EDTA, zinc, magnesium, cobalt, ouabain, oligomycin or pantoprazol. Conclusion The synthesis of membrane-bound non-specific acid phosphatase, strictly regulated by phosphate, and its properties suggest that this bacterium has a potential biotechnological application to solubilize phosphate in soils with low levels of this element, for specific crops. PMID:24713147

  6. Phosphotyrosine phosphatase R3 receptors: Origin, evolution and structural diversification

    PubMed Central

    Chicote, Javier U.; DeSalle, Rob; García-España, Antonio

    2017-01-01

    Subtype R3 phosphotyrosine phosphatase receptors (R3 RPTPs) are single-spanning membrane proteins characterized by a unique modular composition of extracellular fibronectin repeats and a single cytoplasmatic protein tyrosine phosphatase (PTP) domain. Vertebrate R3 RPTPs consist of five members: PTPRB, PTPRJ, PTPRH and PTPRO, which dephosphorylate tyrosine residues, and PTPRQ, which dephosphorylates phophoinositides. R3 RPTPs are considered novel therapeutic targets in several pathologies such as ear diseases, nephrotic syndromes and cancer. R3 RPTP vertebrate receptors, as well as their known invertebrate counterparts from animal models: PTP52F, PTP10D and PTP4e from the fruitfly Drosophila melanogaster and F44G4.8/DEP-1 from the nematode Caenorhabditis elegans, participate in the regulation of cellular activities including cell growth and differentiation. Despite sharing structural and functional properties, the evolutionary relationships between vertebrate and invertebrate R3 RPTPs are not fully understood. Here we gathered R3 RPTPs from organisms covering a broad evolutionary distance, annotated their structure and analyzed their phylogenetic relationships. We show that R3 RPTPs (i) have probably originated in the common ancestor of animals (metazoans), (ii) are variants of a single ancestral gene in protostomes (arthropods, annelids and nematodes); (iii) a likely duplication of this ancestral gene in invertebrate deuterostomes (echinodermes, hemichordates and tunicates) generated the precursors of PTPRQ and PTPRB genes, and (iv) R3 RPTP groups are monophyletic in vertebrates and have specific conserved structural characteristics. These findings could have implications for the interpretation of past studies and provide a framework for future studies and functional analysis of this important family of proteins. PMID:28257417

  7. Rac GTPase signaling through the PP5 protein phosphatase

    PubMed Central

    Gentile, Saverio; Darden, Thomas; Erxleben, Christian; Romeo, Charles; Russo, Angela; Martin, Negin; Rossie, Sandra; Armstrong, David L.

    2006-01-01

    We have investigated the Rac-dependent mechanism of KCNH2 channel stimulation by thyroid hormone in a rat pituitary cell line, GH4C1, with the patch-clamp technique. Here we present physiological evidence for the protein serine/threonine phosphatase, PP5, as an effector of Rac GTPase signaling. We also propose and test a specific molecular mechanism for PP5 stimulation by Rac-GTP. Inhibition of PP5 with the microbial toxin, okadaic acid, blocked channel stimulation by thyroid hormone and by Rac, but signaling was restored by expression of a toxin-insensitive mutant of PP5, Y451A, which we engineered. PP5 is unique among protein phosphatases in that it contains an N-terminal regulatory domain with three tetratricopeptide repeats (TPR) that inhibit its activity. Expression of the TPR domain coupled to GFP blocked channel stimulation by the thyroid hormone. We also show that the published structures of the PP5 TPR domain and the TPR domain of p67, the Rac-binding subunit of NADPH oxidase, superimpose over 92 α carbons. Mutation of the PP5 TPR domain at two predicted contact points with Rac-GTP prevents the TPR domain from functioning as a dominant negative and blocks the ability of Y451A to rescue signaling in the presence of okadaic acid. PP5 stimulation by Rac provides a unique molecular mechanism for the antagonism of Rho-dependent signaling through protein kinases in many cellular processes, including metastasis, immune cell chemotaxis, and neuronal development. PMID:16549782

  8. Patient Self-Defined Goals.

    PubMed

    Schellinger, Sandra Ellen; Anderson, Eric Worden; Frazer, Monica Schmitz; Cain, Cindy Lynn

    2017-01-01

    This research, a descriptive qualitative analysis of self-defined serious illness goals, expands the knowledge of what goals are important beyond the physical-making existing disease-specific guidelines more holistic. Integration of goals of care discussions and documentation is standard for quality palliative care but not consistently executed into general and specialty practice. Over 14 months, lay health-care workers (care guides) provided monthly supportive visits for 160 patients with advanced heart failure, cancer, and dementia expected to die in 2 to 3 years. Care guides explored what was most important to patients and documented their self-defined goals on a medical record flow sheet. Using definitions of an expanded set of whole-person domains adapted from the National Consensus Project (NCP) Clinical Practice Guidelines for Quality Palliative Care, 999 goals and their associated plans were deductively coded and examined. Four themes were identified-medical, nonmedical, multiple, and global. Forty percent of goals were coded into the medical domain; 40% were coded to nonmedical domains-social (9%), ethical (7%), family (6%), financial/legal (5%), psychological (5%), housing (3%), legacy/bereavement (3%), spiritual (1%), and end-of-life care (1%). Sixteen percent of the goals were complex and reflected a mix of medical and nonmedical domains, "multiple" goals. The remaining goals (4%) were too global to attribute to an NCP domain. Self-defined serious illness goals express experiences beyond physical health and extend into all aspects of whole person. It is feasible to elicit and record serious illness goals. This approach to goals can support meaningful person-centered care, decision-making, and planning that accords with individual preferences of late life.

  9. "Prostatic acid phosphatase?" A comparison of acid phosphatase activities in epithelial cells, granulocytes, monocytes, lymphocytes, and platelets purified by velocity sedimentation in isokinetic gradients of Ficoll in tissue culture medium.

    PubMed Central

    Helms, S. R.; Brattain, M. G.; Pretlow, T. G.; Kreisberg, J. I.

    1977-01-01

    Numerous investigators have found several substrates and inhibitors to be particularly suited for the demonstration of acid phosphatase of prostatic origin. There has been much controversy over the specificity or lack of specificity of several substrates and inhibitors. We have investigated acid phosphatase activities obtained from several kinds of purified cells. None of the substrates or inhibitors which we studied permitted us to discriminate "prostatic" acid phosphatase from acid phosphatase activities obtained from other kinds of cells. PMID:560800

  10. Defining and Achieving Decisive Victory

    DTIC Science & Technology

    2002-04-01

    developing a long-term strategy. In this process, nothing is more important than defining victory. In this monograph, Dr. Colin Gray, one of the world’s...Dr. Gray has written 17 books , most recently Modern Strategy (1999). In 2002 he will publish Strategy for Chaos: RMA Theory and the Evidence of...aims.4 But on the first page of Book One, Chapter 1, Clausewitz insists that “War is thus an act of force to compel our enemy to do our will.”5 He rams

  11. Substrate analysis of Arabidopsis PP2C-type protein phosphatases.

    PubMed

    Umbrasaite, Julija; Schweighofer, Alois; Meskiene, Irute

    2011-01-01

    Protein phosphorylation by protein kinases can be reversed by the action of protein phosphatases. In plants, the Ser/Thr-specific phosphatases dominate among the protein phosphatase families with the type 2C protein phosphatases (PP2Cs) being the most abundant among them. PP2Cs are monomeric enzymes that require metal cations for their activity and are insensitive to known phosphatase inhibitors. PP2Cs were shown to counteract the mitogen-activated protein kinase (MAP kinase/MAPK) activities in plants and to regulate developmental and stress signaling pathways. Studies of PP2C activities can be performed in vitro using recombinant proteins. The potential substrates of PP2Cs can be tested for dephosphorylation by the phosphatase in vitro. We have found that the stress-induced PP2Cs from alfalfa and Arabidopsis interact with stress-activated MAPKs in yeast two-hybrid (Y2H) screens. Consequently, recombinant MAPKs were employed as substrates for dephosphorylation by selected PP2Cs from different family clusters. The members of the PP2C phosphatase family demonstrated specificity toward the substrate already in vitro, supporting the notion that protein phosphatases are specific enzymes. The PP2C from Arabidopsis thaliana cluster B, Arabidopsis PP2C-type phosphatase (AP2C1), and its homolog from Medicago sativa, Medicago PP2C-type phosphatase (MP2C), were able to dephosphorylate and inactivate MAPKs, whereas the ABSCISIC ACID (ABA)-INSENSITIVE 2 (ABI2) and HOMOLOGY TO ABI1 (HAB1) PP2Cs from the distinct Arabidopsis cluster A were not able to do so. The method described here can be used for the determination of PP2C protein activity and for studying the effect of mutations introduced into their catalytic domains.

  12. Alkaline, acid, and neutral phosphatase activities are induced during development in Myxococcus xanthus.

    PubMed

    Weinberg, R A; Zusman, D R

    1990-05-01

    One of the signals that has been reported to be important in stimulating fruiting body formation of Myxococcus xanthus is starvation for phosphate. We therefore chose to study phosphatase activity during M. xanthus development. Many phosphatases can cleave the substrate p-nitrophenol phosphate. Using this substrate in buffers at various pHs, we obtained a profile of phosphatase activities during development and germination of M. xanthus. These experiments indicated that there are five patterns of phosphatase activity in M. xanthus: two vegetative and three developmental. The two uniquely vegetative activities have pH optima at 7.2 and 8.5. Both require magnesium and both are inhibited by the reducing agent dithiothreitol. The developmental (spores) patterns of activity have pH optima of 5.2, 7.2, and 8.5. All three activities are Mg independent. Only the alkaline phosphatase activity is inhibited by dithiothreitol. The acid phosphatase activity is induced very early in development, within the first 2 to 4 h. Both the neutral and alkaline phosphatase Mg-independent activities are induced much later, about the time that myxospores become evident (24 to 30 h). The three activities are greatly diminished upon germination; however, the kinetics of loss differ for all three. The acid phosphatase activity declines very rapidly, the neutral activity begins to decline only after spores begin to convert to rods, and the alkaline phosphatase activity remains high until the time the cells begin to divide. All three developmental activities were measured in the developmental signalling mutants carrying asg, csg, and dsg. The pattern of expression obtained in the mutants was consistent with that of other developmentally regulated genes which exhibit similar patterns of expression during development. The ease with which phosphatases can be assayed should make the activities described in this report useful biochemical markers of stages of both fruiting body formation and

  13. Hemoglobin, alkalic phosphatase, and C-reactive protein predict the outcome in patients with liposarcoma.

    PubMed

    Panotopoulos, Joannis; Posch, Florian; Alici, Benjamin; Funovics, Philipp; Stihsen, Christoph; Amann, Gabriele; Brodowicz, Thomas; Windhager, Reinhard; Ay, Cihan

    2015-05-01

    Data on prognostic biomarkers in soft tissue sarcomas are scarce. The aim of the study was to define prognostic markers in patients with a liposarcoma, a subtype of sarcoma derived from adipose tissue. We restrospectively reviewed 85 patients with liposarcoma treated at our department from May 1994 to October 2011. Kaplan-Meier curves, uni-, and multivariable Cox proportional hazard models and competing risk analysis were performed to evaluate the association between putative biomarkers with disease-specific and overall survival. We observed a significant association between both alkalic phosphatase (ALP; subhazard ratio [SHR] per 1 unit increase: 1.35; 95%CI 1.10-1.65; p = 0.005) and C-reactive protein (CRP; SHR per 1 mg/dl increase: 2,57; 95%CI 1.36-4,86; p = 0.004) with disease-specific survival. Hemoglobin (Hb) (HR per 1 g/dl increase: 065; 95%CI 0.48-0.87; p = 0.003) was associated with overall survival. These associations prevailed after multivariable adjustment for AJCC tumor stage. This study identifies CRP and ALP as novel independent predictors of disease-specific survival in patients with liposarcoma. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  14. Intestinal Alkaline Phosphatase Prevents Antibiotic-Induced Susceptibility to Enteric Pathogens

    PubMed Central

    Alam, Sayeda Nasrin; Yammine, Halim; Moaven, Omeed; Ahmed, Rizwan; Moss, Angela K.; Biswas, Brishti; Muhammad, Nur; Biswas, Rakesh; Raychowdhury, Atri; Kaliannan, Kanakaraju; Ghosh, Sathi; Ray, Madhury; Hamarneh, Sulaiman; Barua, Soumik; Malo, Nondita S.; Bhan, Atul K.; Malo, Madhu S.; Hodin, Richard A.

    2013-01-01

    Objective To determine the efficacy of oral supplementation of the gut enzyme intestinal alkaline phosphatase (IAP) in preventing antibiotic-associated infections from Salmonella enterica serovar Typhimurium (S. Typhimurium) and Clostridium difficile. Summary background data The intestinal microbiota plays a pivotal role in human health and well-being. Antibiotics inherently cause dysbiosis, an imbalance in the number and composition of intestinal commensal bacteria, which leads to susceptibility to opportunistic bacterial infections. Previously, we have shown that IAP preserves the normal homeostasis of intestinal microbiota and that oral supplementation with calf IAP (cIAP) rapidly restores the normal gut flora. We hypothesized that oral IAP supplementation would protect against antibiotic-associated bacterial infections. Methods C57BL/6 mice were treated with antibiotic(s) +/− cIAP in the drinking water followed by oral gavage of S. Typhimurium or C. difficile. Mice were observed for clinical conditions and mortality. After a defined period of time mice were sacrificed and investigated for hematological, inflammatory and histological changes. Results We observed that oral supplementation with cIAP during antibiotic treatment protects mice from infections with S. Typhimurium as well as C. difficile. Animals given IAP maintained their weight, had reduced clinical severity and gut inflammation, and improved survival. Conclusion Oral IAP supplementation protected mice from antibiotic-associated bacterial infections. We postulate that oral IAP supplementation could represent a novel therapy to protect against antibiotic-associated diarrhea (AAD), C. difficile-associated disease (CDAD), and other enteric infections in humans. PMID:23598380

  15. Use of intein-mediated phosphoprotein arrays to study substrate specificity of protein phosphatases.

    PubMed

    Kochinyan, Samvel; Sun, Luo; Ghosh, Inca; Barshevsky, Tanya; Xu, Jie; Xu, Ming-Qun

    2007-01-01

    Synthetic peptides incorporating various chemical moieties, for example, phosphate groups, are convenient tools for investigating protein modification enzymes, such as protein phosphatases (PPs). However, short peptides are sometimes poor substrates, and their binding to commonly used matrices is unpredictable and variable. In general, protein substrates for PPs are superior for enzymatic assays, binding to various matrices, and Western blot analysis. The preparation and characterization of phosphoproteins, however can be difficult and technically demanding. In this study, the intein-mediated protein ligation (IPL) technique was used to readily generate phosphorylated protein substrates by ligating a synthetic phosphopeptide to an intein-generated carrier protein (CP) possessing a carboxyl-terminal thioester with a one-to-one stoichiometry. The ligated phosphoprotein (LPP) substrate was treated with a PP and subsequently subjected to array or Western blot analysis with a phospho-specific antibody. This approach is highly effective in producing arrays of protein substrates containing phosphorylated amino acid residues and has been applied for screening of PPs with specificity toward phosphorylated tyrosine, serine, or threonine residues, resulting in an approximately 240-fold increase in sensitivity in dot blot analysis compared with the use of synthetic peptides. The IPL technique overcomes the disadvantages of current methods and is a versatile system for the facile production of protein substrates containing well-defined structural motifs for the study of protein modification enzymes.

  16. SCP phosphatases suppress renal cell carcinoma by stabilizing PML and inhibiting mTOR/HIF signaling.

    PubMed

    Lin, Yu-Ching; Lu, Li-Ting; Chen, Hsin-Yi; Duan, Xueyan; Lin, Xia; Feng, Xin-Hua; Tang, Ming-Jer; Chen, Ruey-Hwa

    2014-12-01

    The tumor-suppressor protein promyelocytic leukemia (PML) is aberrantly degraded in multiple types of human cancers through mechanisms that are incompletely understood. Here, we show that the phosphatase SCP1 and its isoforms SCP2/3 dephosphorylate PML at S518, thereby blocking PML ubiquitination and degradation mediated by the prolyl isomerase Pin1 and the ubiquitin ligase KLHL20. Clinically, SCP1 and SCP3 are downregulated in clear cell renal cell carcinoma (ccRCC) and these events correlated with PMLS518 phosphorylation, PML turnover, and high-grade tumors. Restoring SCP1-mediated PML stabilization not only inhibited malignant features of ccRCC, including proliferation, migration, invasion, tumor growth, and tumor angiogenesis, but also suppressed the mTOR-HIF pathway. Furthermore, blocking PML degradation in ccRCC by SCP1 overexpression or Pin1 inhibition enhanced the tumor-suppressive effects of the mTOR inhibitor temsirolimus. Taken together, our results define a novel pathway of PML degradation in ccRCC that involves SCP downregulation, revealing contributions of this pathway to ccRCC progression and offering a mechanistic rationale for combination therapies that jointly target PML degradation and mTOR inhibition for ccRCC treatment.

  17. Ki67 antigen contributes to the timely accumulation of protein phosphatase 1γ on anaphase chromosomes.

    PubMed

    Takagi, Masatoshi; Nishiyama, Yuko; Taguchi, Atsuko; Imamoto, Naoko

    2014-08-15

    Ki67 is a protein widely used as cell-proliferation marker, with its cellular functions being hardly unveiled. In this paper, we present the direct interaction between Ki67 and PP1γ, a protein phosphatase showing characteristic accumulation on anaphase chromosomes via the canonical PP1-binding motif within Ki67. In cells depleted of Ki67, PP1γ is targeted to anaphase chromosomes less efficiently. Additionally, overexpression of Ki67, but not a mutant form without the ability to bind PP1γ, induced ectopic localization of PP1γ οn metaphase chromosomes. These observations demonstrate that Ki67 is one factor that defines the cellular behavior of PP1γ in anaphase. To explore the specific roles of the subset of PP1γ recruited on chromosome via its interaction with Ki67 (PP1γ-Ki67), endogenous Ki67 was replaced with a Ki67 mutant deficient in its ability to interact with PP1γ. Although no obvious defects in the progression of mitosis were observed, the timing of dephosphorylation of the mutant Ki67 in anaphase was delayed, indicating that Ki67 itself is one of the substrates of PP1γ-Ki67.

  18. The phosphatase SHP2 regulates the spacing effect for long-term memory induction.

    PubMed

    Pagani, Mario R; Oishi, Kimihiko; Gelb, Bruce D; Zhong, Yi

    2009-10-02

    A property of long-term memory (LTM) induction is the requirement for repeated training sessions spaced over time. This augmentation of memory formation with spaced resting intervals is called the spacing effect. We now show that in Drosophila, the duration of resting intervals required for inducing LTM is regulated by activity levels of the protein tyrosine phosphatase corkscrew (CSW). Overexpression of wild-type CSW in mushroom body neurons shortens the inter-trial interval required for LTM induction, whereas overexpression of constitutively active CSW proteins prolongs these resting intervals. These gain-of-function csw mutations are associated with a clinical condition of mental retardation. Biochemical analysis reveals that LTM-inducing training regimens generate repetitive waves of CSW-dependent MAPK activation, the length of which appears to define the duration of the resting interval. Constitutively active CSW proteins prolong the resting interval by altering the MAPK inactivation cycle. We thus provide insight into the molecular basis of the spacing effect.

  19. cdc25+ encodes a protein phosphatase that dephosphorylates p34cdc2.

    PubMed Central

    Lee, M S; Ogg, S; Xu, M; Parker, L L; Donoghue, D J; Maller, J L; Piwnica-Worms, H

    1992-01-01

    To determine how the human cdc25 gene product acts to regulate p34cdc2 at the G2 to M transition, we have overproduced the full-length protein (cdc25Hs) as well as several deletion mutants in bacteria as glutathione-S-transferase fusion proteins. The wild-type cdc25Hs gene product was synthesized as an 80-kDa fusion protein (p80GST-cdc25) and was judged to be functional by several criteria: recombinant p80GST-cdc25 induced meiotic maturation of Xenopus oocytes in the presence of cycloheximide; p80GST-cdc25 activated histone H1 kinase activity upon addition to extracts prepared from Xenopus oocytes; p80GST-cdc25 activated p34cdc2/cyclin B complexes (prematuration promoting factor) in immune complex kinase assays performed in vitro; p80GST-cdc25 stimulated the tyrosine dephosphorylation of p34cdc2/cyclin complexes isolated from Xenopus oocyte extracts as well as from overproducing insect cells; and p80GST-cdc25 hydrolyzed p-nitrophenylphosphate. In addition, deletion analysis defined a functional domain residing within the carboxy-terminus of the cdc25Hs protein. Taken together, these results suggest that the cdc25Hs protein is itself a phosphatase and that it may function directly in the tyrosine dephosphorylation and activation of p34cdc2 at the G2 to M transition. Images PMID:1312880

  20. Phosphoenolpyruvate Carboxykinase and Glucose-6-phosphatase Are Required for Steroidogenesis in Testicular Leydig Cells*

    PubMed Central

    Ahn, Seung Won; Gang, Gil-Tae; Tadi, Surendar; Nedumaran, Balachandar; Kim, Yong Deuk; Park, Ji Hoon; Kweon, Gi Ryang; Koo, Seung-Hoi; Lee, Keesook; Ahn, Ryun-Sup; Yim, Yong-Hyeon; Lee, Chul-Ho; Harris, Robert A.; Choi, Hueng-Sik

    2012-01-01

    Cyclic AMP (cAMP) induces steroidogenic enzyme gene expression and stimulates testosterone production in Leydig cells. Phosphoenolpyruvate carboxykinase (PEPCK) is expressed in Leydig cells, but its role has not been defined. In this study, we found that PEPCK and glucose-6-phosphatase (Glc-6-Pase) are increased significantly following cAMP treatment of mouse Leydig cells. Moreover, cAMP treatment increased recruitment of the cAMP-response element-binding transcription factor and decreased recruitment of the corepressor DAX-1 on the pepck promoter. Furthermore, cAMP induced an increase in ATP that correlated with a decrease in phospho-AMP-activated protein kinase (AMPK). In contrast, knockdown or inhibition of PEPCK decreased ATP and increased phospho-AMPK. Treatment with an AMPK activator or overexpression of the constitutively active form of AMPK inhibited cAMP-induced steroidogenic enzyme promoter activities and gene expression. Liver receptor homolog-1 (LRH-1) was involved in cAMP-induced steroidogenic enzyme gene expression but was inhibited by AMPK activation in Leydig cells. Additionally, inhibition or knockdown of PEPCK and Glc-6-Pase decreased cAMP-mediated induction of steroidogenic enzyme gene expression and steroidogenesis. Finally, pubertal mouse (8-week-old) testes and human chorionic gonadotropin-induced prepubertal mouse testes showed increased PEPCK and Glc-6-Pase gene expression. Taken together, these results suggest that induction of PEPCK and Glc-6-Pase by cAMP plays an important role in Leydig cell steroidogenesis. PMID:23074219

  1. Defining the fundamentals of care.

    PubMed

    Kitson, Alison; Conroy, Tiffany; Wengstrom, Yvonne; Profetto-McGrath, Joanne; Robertson-Malt, Suzi

    2010-08-01

    A three-stage process is being undertaken to investigate the fundamentals of care. Stage One (reported here) involves the use of a met a-narrative review methodology to undertake a thematic analysis, categorization and synthesis of selected contents extracted from seminal texts relating to nursing practice. Stage Two will involve a search for evidence to inform the fundamentals of care and a refinement of the review method. Stage Three will extend the reviews of the elements defined as fundamentals of care. This introductory paper covers the following aspects: the conceptual basis upon which nursing care is delivered; how the fundamentals of care have been defined in the literature and in practice; an argument that physiological aspects of care, self-care elements and aspects of the environment of care are central to the conceptual refinement of the term fundamentals of care; and that efforts to systematize such information will enhance overall care delivery through improvements in patient safety and quality initiatives in health systems.

  2. Defining life: the virus viewpoint.

    PubMed

    Forterre, Patrick

    2010-04-01

    Are viruses alive? Until very recently, answering this question was often negative and viruses were not considered in discussions on the origin and definition of life. This situation is rapidly changing, following several discoveries that have modified our vision of viruses. It has been recognized that viruses have played (and still play) a major innovative role in the evolution of cellular organisms. New definitions of viruses have been proposed and their position in the universal tree of life is actively discussed. Viruses are no more confused with their virions, but can be viewed as complex living entities that transform the infected cell into a novel organism-the virus-producing virions. I suggest here to define life (an historical process) as the mode of existence of ribosome encoding organisms (cells) and capsid encoding organisms (viruses) and their ancestors. I propose to define an organism as an ensemble of integrated organs (molecular or cellular) producing individuals evolving through natural selection. The origin of life on our planet would correspond to the establishment of the first organism corresponding to this definition.

  3. Catalytic and substrate promiscuity: Distinct multiple chemistries catalyzed by the phosphatase domain of receptor protein tyrosine phosphatase

    PubMed Central

    Srinivasan, Bharath; Marks, Hanna; Mitra, Sreyoshi; Smalley, David M.; Skolnick, Jeffrey

    2016-01-01

    The presence of latent activities in enzymes is posited to underlie the natural evolution of new catalytic functions. However, the prevalence and extent of such substrate and catalytic ambiguity in evolved enzymes is difficult to address experimentally given the order-of-magnitude difference in the activities for native and, sometimes, promiscuous substrate/s. Further, such latent functions are of special interest when the activities concerned do not fall into the domain of substrate promiscuity. Here, we show a special case of such latent enzyme activity by demonstrating the presence of two mechanistically distinct reactions catalyzed by the catalytic domain of receptor protein tyrosine phosphatase isoform delta (PTPRδ). The primary catalytic activity involves the hydrolysis of a phosphomonoester bond (C-O-P) with high catalytic efficiency, while the secondary activity is the hydrolysis of a glycosidic bond (C-O-C) with poorer catalytic efficiency. This enzyme also displays substrate promiscuity by hydrolyzing diester bonds while being highly discriminative for its monoester substrates. To confirm these activities, we also demonstrated their presence on the catalytic domain of PTPRΩ, a homologue of PTPRδ. Studies on the rate, metal-ion dependence, pH dependence and inhibition of the respective activities showed that they are markedly different. This is the first study that demonstrates a novel sugar hydrolase and diesterase activity for the phosphatase domain of PTPRδ and PTPRΩ. This work has significant implications for both understanding the evolution of enzymatic activity and the possible physiological role of this new chemistry. Our findings suggest that the genome might harbor a wealth of such alternative latent enzyme activities in the same protein domain that renders our knowledge of metabolic networks incomplete. PMID:27208174

  4. Defining Life: Synthesis and Conclusions

    NASA Astrophysics Data System (ADS)

    Gayon, Jean

    2010-04-01

    The first part of the paper offers philosophical landmarks on the general issue of defining life. §1 defends that the recognition of “life” has always been and remains primarily an intuitive process, for the scientist as for the layperson. However we should not expect, then, to be able to draw a definition from this original experience, because our cognitive apparatus has not been primarily designed for this. §2 is about definitions in general. Two kinds of definition should be carefully distinguished: lexical definitions (based upon current uses of a word), and stipulative or legislative definitions, which deliberately assign a meaning to a word, for the purpose of clarifying scientific or philosophical arguments. The present volume provides examples of these two kinds of definitions. §3 examines three traditional philosophical definitions of life, all of which have been elaborated prior to the emergence of biology as a specific scientific discipline: life as animation (Aristotle), life as mechanism, and life as organization (Kant). All three concepts constitute a common heritage that structures in depth a good deal of our cultural intuitions and vocabulary any time we try to think about “life”. The present volume offers examples of these three concepts in contemporary scientific discourse. The second part of the paper proposes a synthesis of the major debates developed in this volume. Three major questions have been discussed. A first issue (§4) is whether we should define life or not, and why. Most authors are skeptical about the possibility of defining life in a strong way, although all admit that criteria are useful in contexts such as exobiology, artificial life and the origins of life. §5 examines the possible kinds of definitions of life presented in the volume. Those authors who have explicitly defended that a definition of life is needed, can be classified into two categories. The first category (or standard view) refers to two conditions

  5. Defining life: synthesis and conclusions.

    PubMed

    Gayon, Jean

    2010-04-01

    The first part of the paper offers philosophical landmarks on the general issue of defining life. Section 1 defends that the recognition of "life" has always been and remains primarily an intuitive process, for the scientist as for the layperson. However we should not expect, then, to be able to draw a definition from this original experience, because our cognitive apparatus has not been primarily designed for this. Section 2 is about definitions in general. Two kinds of definition should be carefully distinguished: lexical definitions (based upon current uses of a word), and stipulative or legislative definitions, which deliberately assign a meaning to a word, for the purpose of clarifying scientific or philosophical arguments. The present volume provides examples of these two kinds of definitions. Section 3 examines three traditional philosophical definitions of life, all of which have been elaborated prior to the emergence of biology as a specific scientific discipline: life as animation (Aristotle), life as mechanism, and life as organization (Kant). All three concepts constitute a common heritage that structures in depth a good deal of our cultural intuitions and vocabulary any time we try to think about "life". The present volume offers examples of these three concepts in contemporary scientific discourse. The second part of the paper proposes a synthesis of the major debates developed in this volume. Three major questions have been discussed. A first issue (Section 4) is whether we should define life or not, and why. Most authors are skeptical about the possibility of defining life in a strong way, although all admit that criteria are useful in contexts such as exobiology, artificial life and the origins of life. Section 5 examines the possible kinds of definitions of life presented in the volume. Those authors who have explicitly defended that a definition of life is needed, can be classified into two categories. The first category (or standard view) refers

  6. Defining motility in the Staphylococci.

    PubMed

    Pollitt, Eric J G; Diggle, Stephen P

    2017-08-01

    The ability of bacteria to move is critical for their survival in diverse environments and multiple ways have evolved to achieve this. Two forms of motility have recently been described for Staphylococcus aureus, an organism previously considered to be non-motile. One form is called spreading, which is a type of sliding motility and the second form involves comet formation, which has many observable characteristics associated with gliding motility. Darting motility has also been observed in Staphylococcus epidermidis. This review describes how motility is defined and how we distinguish between passive and active motility. We discuss the characteristics of the various forms of Staphylococci motility, the molecular mechanisms involved and the potential future research directions.

  7. Defining biocultural approaches to conservation.

    PubMed

    Gavin, Michael C; McCarter, Joe; Mead, Aroha; Berkes, Fikret; Stepp, John Richard; Peterson, Debora; Tang, Ruifei

    2015-03-01

    We contend that biocultural approaches to conservation can achieve effective and just conservation outcomes while addressing erosion of both cultural and biological diversity. Here, we propose a set of guidelines for the adoption of biocultural approaches to conservation. First, we draw lessons from work on biocultural diversity and heritage, social-ecological systems theory, integrated conservation and development, co-management, and community-based conservation to define biocultural approaches to conservation. Second, we describe eight principles that characterize such approaches. Third, we discuss reasons for adopting biocultural approaches and challenges. If used well, biocultural approaches to conservation can be a powerful tool for reducing the global loss of both biological and cultural diversity.

  8. Energy Velocity Defined by Brillouin

    NASA Astrophysics Data System (ADS)

    Hosono, Hiroyuki; Hosono, Toshio

    The physical meaning of the energy velocity in lossy Lorentz media is clarified. First, two expressions for the energy velocity, one by Brillouin and another by Diener, are examined. We show that, while Diener's is disqualified, Brillouin's is acceptable as energy velocity. Secondly, we show that the signal velocity defined by Brillouin and Baerwald is exactly identical with the Brillouin's energy velocity. Thirdly, by using triangle-modulated harmonic wave, we show that the superluminal group velocity plays its role as a revelator only after the arrival of the signal traveling at the subluminal energy velocity. In short, nothing moves at the group velocity, and every frequency component of a signal propagates at its own energy velocity.

  9. Defining groundwater age: Chapter 3

    USGS Publications Warehouse

    Torgersen, T.; Purtschert, R.; Phillips, F.M.; Plummer, L.N.; Sanford, W.E.; Suckow, A.

    2013-01-01

    This book investigates applications of selected chemical and isotopic substances that can be used to recognize and interpret age information pertaining to ‘old’ groundwater (defined as water that was recharged on a timescale from approximately 1000 to more than 1 000 000 a). However, as discussed below, only estimates of the ‘age’ of water extracted from wells can be inferred. These groundwater age estimates are interpreted from measured concentrations of chemical and isotopic substances in the groundwater. Even then, there are many complicating factors, as discussed in this book. In spite of these limitations, much can be learned about the physics of groundwater flow and about the temporal aspects of groundwater systems from age interpretations of measured concentrations of environmental tracers in groundwater systems. This chapter puts the concept of ‘age’ into context, including its meaning and interpretation, and attempts to provide a unifying usage for the rest of the book.

  10. Hamiltonians defined by biorthogonal sets

    NASA Astrophysics Data System (ADS)

    Bagarello, Fabio; Bellomonte, Giorgia

    2017-04-01

    In some recent papers, studies on biorthogonal Riesz bases have found renewed motivation because of their connection with pseudo-Hermitian quantum mechanics, which deals with physical systems described by Hamiltonians that are not self-adjoint but may still have real point spectra. Also, their eigenvectors may form Riesz, not necessarily orthonormal, bases for the Hilbert space in which the model is defined. Those Riesz bases allow a decomposition of the Hamiltonian, as already discussed in some previous papers. However, in many physical models, one has to deal not with orthonormal bases or with Riesz bases, but just with biorthogonal sets. Here, we consider the more general concept of G -quasi basis, and we show a series of conditions under which a definition of non-self-adjoint Hamiltonian with purely point real spectra is still possible.

  11. Miniature EVA Software Defined Radio

    NASA Technical Reports Server (NTRS)

    Pozhidaev, Aleksey

    2012-01-01

    As NASA embarks u