Science.gov

Sample records for 2-macroglobulin alpha 2m

  1. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  2. Characterization of alpha-2-macroglobulin from groupers.

    PubMed

    Chuang, Wen-Hsiao; Lee, Kuo-Kau; Liu, Ping-Chung

    2013-08-01

    Alpha-2-macroglobulin (α-2-M) is a protease inhibitor broadly present in the plasma of vertebrates and invertebrates, and is an important non-specific humoral factor in defence system of the animals. This study conducted the immuno-analysis and mass spectrometric analysis methods to investigate the characteristics of the protease inhibitor, α-2-M, among groupers and related species. Rabbit antiserum to the purified α-2-M of Epinephelus coioides was used in different immunological methods to determine the immune cross-reactions of the α-2-M in samples. Plasma of Epinephelus bruneus, Epinephelus fuscoguttatus, Epinephelus lanceolatus, and Epinephelus quoyanus exhibited high protease inhibitory activities by BAPNA-trypsin assay. To purify the α-2-M protein, plasma protein of grouper E. coioides was first precipitated by using PEG 6000, then Blue Sepharose 6 Fast Flow, DEAE Sephacel, Con A Separose 4B and Phenyl Sepharose High Performance columns were used on FPLC system for purification. The molecular mass of grouper plasma α-2-M was determined as a 180 kDa protein on non-reduced SDS-PAGE. In addition, it was determined as 97 and 80 kDa protein on reduced SDS-PAGE. Enzymatic and chemical deglycosylation of glycogen revealed that the contents of glycogen in 97 and 80 kDa subunits were 12.4% and 15%, respectively, and were all belonging to N-linked type. Only one precipitation arc was visualized in all plasma of Epinephelus spp. using the rabbit antiserum to the purified α-2-M of E. coioides, on crossed immunoelectrophoresis (CIE) gels. The plasma of Epinephelus spp. and seawater fish species showed stronger responses than freshwater fish species while that of other animal species showed no response by dot-blot assay. One single band was detected on Native PAGE-Western blotting assay, one single 180 kDa band was detected on non-reduced SDS-PAGE-Western blotting, and four bands (80, 97, 160, 250 kDa) were detected on reduced SDS-PAGE when various grouper plasma

  3. Quantification of functional and inactivated alpha 2-macroglobulin in sepsis.

    PubMed

    Abbink, J J; Nuijens, J H; Eerenberg, A J; Huijbregts, C C; Strack van Schijndel, R J; Thijs, L G; Hack, C E

    1991-01-23

    Alpha 2-macroglobulin (alpha 2 M) in vitro inhibits numerous proteinases that are generated during inflammatory reactions and therefore, probably plays an important role in diseases such as sepsis. To monitor the state of alpha 2 M in sepsis, we developed novel assays for functional and inactive alpha 2M. Functional alpha 2M in plasma was measured by quantitating the binding of alpha 2M to solid-phase trypsin. Inactive alpha 2M (i alpha 2M) was assessed with a monoclonal antibody, mcAb M1, that specifically reacts with a neodeterminant exposed on i alpha 2M. This mcAb in combination with chromogenic substrates was used to detect alpha 2M-proteinase complexes. Functional alpha 2M was reduced in plasma from 48 patients with clinical sepsis compared to healthy controls (p less than 0.0001). Levels of functional alpha 2M on admission and the lowest levels encountered in 23 patients with shock were lower than in 25 normotensive patients (p = 0.023 and p = 0.009, respectively). Increased levels of i alpha 2M (greater than 30 nM) at least on one occasion were found in only 4 of the 48 patients, being not different in hypotensive compared with normotensive patients, and not in patients who died compared with those who survived. Levels of functional alpha 2M correlated significantly with levels of factor XII and prekallikrein suggesting that decreases in alpha 2M at least in part were due to contact activation. Indeed, in two patients with increased i alpha 2M, complexes between alpha 2M and kallikrein were demonstrated in addition to plasmin- and thrombin-alpha 2M complexes.

  4. Cultured human monocytes synthesize and secrete alpha2-macroglobulin

    PubMed Central

    1977-01-01

    alpha2-Macroglobulin levels in the supernates of cultures of different subpopulations of human peripheral blood mononuclear leukocytes were assayed by a radioimmunoassay. Unfractionated mononuclear leukocytes produced greater amounts of the macroglobulin (4.0 vs. 0.8 ng/10(6) cells) than did subpopulations enriched in T or B+T lymphocytes, by passage through nylon wool or cotton wool columns, respectively. Still higher concentrations of alpha2-macroglobulin (40 ng/10(6) cells) were measured in the supernates of glass-adherent mononuclear leukocyte cultures. These results suggest that cells of monocyte-macrophage lineage are mainly, if not exclusively, responsible for the appearance of alpha2- macroglobulin in the supernate of human peripheral blood leukocyte cultures. The de novo synthesis and release of alpha2- macroglobulin by cultured monocytes was demonstrated by immunoprecipitation of radioactivity from supernates of 32S-methionine- labeled glass-adherent cells. Antiserum against purified alpha2- macroglobulin was used in both Ouchterlony double diffusion and double antibody precipitation tests. SDS-polyacrylamide gel electrophoresis of immunoprecipitates showed that most of the radioactivity comigrated with authentic alpha2-macroglobulin subunit at about 160,000 daltons. PMID:68095

  5. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... the alpha-2-macroglobulin (a serum protein) in plasma. Measurement of alpha-2-macroglobulin may aid...

  6. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5620 Alpha-2-macroglobulin immunological test system. (a) Identification. An alpha-2-macroglobulin... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha-2-macroglobulin immunological test...

  7. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5620 Alpha-2-macroglobulin immunological test system. (a) Identification. An alpha-2-macroglobulin... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha-2-macroglobulin immunological test...

  8. Synthesis of alpha 2-macroglobulin in rat hepatocytes and in a cell-free system.

    PubMed

    Andus, T; Gross, V; Tran-Thi, T A; Heinrich, P C

    1983-01-10

    The biosynthesis and secretion of alpha 2-macroglobulin was studied in rat hepatocyte primary cultures. After immunoprecipitation of alpha 2-macroglobulin from a cell homogenate and the hepatocyte medium, two forms of alpha 2-macroglobulin with app. Mr of 176000 and 182000, respectively, were identified. A precursor-product relationship for the two alpha 2-macroglobulin forms was demonstrated by a pulse-chase experiment. The cellular form of alpha 2-macroglobulin could be deglycosylated by endoglucosaminidase H, whereas the medium form of alpha 2-macroglobulin remained unaffected. On the other hand, only the medium form of alpha 2-macroglobulin was found to be susceptible to neuraminidase. In vitro translation of rat liver poly(A)+ RNA resulted in a translation product of an app. Mr of 162000. PMID:6186524

  9. Binding of receptor-recognized forms of alpha2-macroglobulin to the alpha2-macroglobulin signaling receptor activates phosphatidylinositol 3-kinase.

    PubMed

    Misra, U K; Pizzo, S V

    1998-05-29

    Ligation of the alpha2-macroglobulin (alpha2M) signaling receptor by receptor-recognized forms of alpha2M (alpha2M*) initiates mitogenesis secondary to increased intracellular Ca2+. We report here that ligation of the alpha2M signaling receptor also causes a 1. 5-2.5-fold increase in wortmannin-sensitive phosphatidylinositol 3-kinase (PI3K) activity as measured by the quantitation of phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 formation was alpha2M* concentration-dependent with a maximal response at approximately 50 pM ligand concentration. The peak formation of PIP3 occurred at 10 min of incubation. The alpha2M receptor binding fragment mutant K1370R which binds to the alpha2M signaling receptor activating the signaling cascade, increased PIP3 formation by 2-fold. The mutant K1374A, which binds very poorly to the alpha2M signaling receptor, did not cause any increase in PIP3 formation. alpha2M*-induced DNA synthesis was inhibited by wortmannin. 1, 2Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acetoxymethylester a chelator of intracellular Ca2+, drastically reduced alpha2M*-induced increases in PIP3 formation. We conclude that PI3K is involved in alpha2M*-induced mitogenesis in macrophages and intracellular Ca2+ plays a role in PI3K activation. PMID:9593670

  10. Cultured Ito cells of rat liver express the alpha 2-macroglobulin gene.

    PubMed

    Andus, T; Ramadori, G; Heinrich, P C; Knittel, T; Meyer zum Büschenfelde, K H

    1987-11-01

    Ito cells were isolated from rat liver and kept in culture for up to 13 days. The capability of the Ito cells to synthesize alpha 2-macroglobulin was analyzed at different times after isolation and by pulse-chase experiments. Newly synthesized alpha 2-macroglobulin was determined by immunoprecipitation followed by sodium dodecyl sulfate/polyacrylamide gel electrophoresis and fluorography. alpha 2-Macroglobulin synthesis was hardly detectable in Ito cells and their media 3 days after plating. However, 5-11 days after the isolation of the cells, increasing amounts of alpha 2-macroglobulin were synthesized. The results of pulse-chase experiments performed on day 7 showed that radioactively labeled alpha 2-macroglobulin decreased in the intracellular compartment and increased in the culture medium. alpha 2-Macroglobulin was identified by immunoprecipitation and sodium dodecyl sulfate/polyacrylamide gel electrophoresis under reducing and non-reducing conditions. Furthermore, when unlabeled alpha 2-macroglobulin was added during the immunoprecipitation, a competition was observed. Incubation of pancreatic elastase with culture medium of rat Ito cells or rat hepatocytes led to the same cleavage products as found with alpha 2-macroglobulin. alpha 2-Macroglobulin-specific mRNA could be demonstrated by Northern blot analysis of total RNA extracted from rat Ito cells. Under the conditions where alpha 2-macroglobulin was synthesized in Ito cells, no synthesis of alpha 1-macroglobulin, alpha 1-inhibitor 3, alpha 1-proteinase inhibitor, alpha 1-acid glycoprotein, alpha 1-acute-phase globulin (T-kininogen) and albumin could be demonstrated. It is concluded that alpha 2-macroglobulin is a true secretory protein of rat Ito cells in culture. This could be of importance for collagen metabolism in liver diseases. PMID:2444437

  11. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5620 Alpha-2-macroglobulin...

  12. Evolution of alpha 2-macroglobulin. The demonstration in a variety of vertebrate species of a protein resembling human alpha 2-macroglobulin.

    PubMed Central

    Starkey, P M; Barrett, A J

    1982-01-01

    Plasma or serum samples from a large number of vertebrate species were screened for the presence of a papain-binding protein resembling human alph a 2-macroglobulin (alpha 2M). The screening method depended on the unique property of alpha 2M of binding proteinases in such a way that the enzyme retains partial activity against low-molecular-weight substrates. A papain-binding protein was detected in serum from members of all the major vertebrate taxa. In mammals, birds, reptiles and amphibians the protein had an Mr similar to that of human alpha 2M (725 000), but in fish, including dipnoans, actinopterygians, elasmobranchs and cyclostomes, the papain-binding protein was of Mr about 360 000. Of the invertebrate species tested, all of which were arthropods, two were negative, but the horseshoe crab, an arachnid, did possess a papain-binding protein, although this was heterogeneous in electrophoresis and differed from alpha 2M in resisting inactivation by methylamine. From the results, and a detailed study of the properties of the fish papain-binding protein described in an accompanying paper [Starkey, Fletcher & Barrett (1982) Biochem. J. 205, 97-104], it seems that alpha 2M first appeared in an ancestor of all modern vertebrates as a protein of Mr 360 000 and that the larger macroglobulin (Mr 725 000) first appeared in an ancestor of the tetrapods. Images Fig. 1. PMID:6181778

  13. Alpha-2-Macroglobulin Is Acutely Sensitive to Freezing and Lyophilization: Implications for Structural and Functional Studies.

    PubMed

    Wyatt, Amy R; Kumita, Janet R; Farrawell, Natalie E; Dobson, Christopher M; Wilson, Mark R

    2015-01-01

    Alpha-2-macroglobulin is an abundant secreted protein that is of particular interest because of its diverse ligand binding profile and multifunctional nature, which includes roles as a protease inhibitor and as a molecular chaperone. The activities of alpha-2-macroglobulin are typically dependent on whether its conformation is native or transformed (i.e. adopts a more compact conformation after interactions with proteases or small nucleophiles), and are also influenced by dissociation of the native alpha-2-macroglobulin tetramer into stable dimers. Alpha-2-macroglobulin is predominately present as the native tetramer in vivo; once purified from human blood plasma, however, alpha-2-macroglobulin can undergo a number of conformational changes during storage, including transformation, aggregation or dissociation. We demonstrate that, particularly in the presence of sodium chloride or amine containing compounds, freezing and/or lyophilization of alpha-2-macroglobulin induces conformational changes with functional consequences. These conformational changes in alpha-2-macroglobulin are not always detected by standard native polyacrylamide gel electrophoresis, but can be measured using bisANS fluorescence assays. Increased surface hydrophobicity of alpha-2-macroglobulin, as assessed by bisANS fluorescence measurements, is accompanied by (i) reduced trypsin binding activity, (ii) increased chaperone activity, and (iii) increased binding to the surfaces of SH-SY5Y neurons, in part, via lipoprotein receptors. We show that sucrose (but not glycine) effectively protects native alpha-2-macroglobulin from denaturation during freezing and/or lyophilization, thereby providing a reproducible method for the handling and long-term storage of this protein. PMID:26103636

  14. Predominant role of neutrophils in the inactivation of alpha 2-macroglobulin in arthritic joints.

    PubMed

    Abbink, J J; Kamp, A M; Nieuwenhuys, E J; Nuijens, J H; Swaak, A J; Hack, C E

    1991-09-01

    We studied the state of alpha 2-macroglobulin (alpha 2M), an important inhibitor of cartilage-degrading proteinases, in relation to activation of neutrophils in 82 patients with several types of arthritis, including 52 with rheumatoid arthritis and 11 with osteoarthritis. Levels of total inactive alpha 2M (i alpha 2M), which comprises alpha 2M complexed to proteinases and alpha 2M inactivated by oxidation or hydrolysis, were measured with a monoclonal antibody specific for i alpha 2M. In addition, levels of alpha 2M complexed to proteinases were quantitated with specific assays. Neutrophil activation was assessed by measuring elastase-alpha 1-antitrypsin complexes and lactoferrin. In 83% of the 82 patients tested, the synovial fluid (SF) to plasma ratio of i alpha 2M exceeded 1, indicating an intraarticular generation. Levels of i alpha 2M significantly correlated with neutrophil numbers (P less than 0.0005) and with levels of elastase-alpha 1-antitrypsin complexes and of lactoferrin (P less than 0.00001 for both). Moreover, part of i alpha 2M consisted of alpha 2M complexed to elastase-like and chymotrypsin-like proteinases, presumably, neutrophil elastase and cathepsin G, respectively. However, the amount of i alpha 2M was approximately 10-fold larger than the amount complexed to these proteinases. In vitro inactivation of alpha 2M by activated neutrophils was only partly inhibitable by eglin C, a specific inhibitor of both elastase and cathepsin G. Release of reactive oxygen species was presumably responsible for the additional inactivation of alpha 2M, because eglin C completely abolished the inactivation of alpha 2M by cell-free supernatant of activated neutrophils. Thus, our results suggest a predominant role of neutrophils in the inactivation of alpha 2M in the SF of patients with inflammatory joint diseases. However, this inactivation could be explained only in part by the release of neutrophilic proteinases. We propose that the inactivation of alpha 2M in

  15. Differential transcription of multiple forms of alpha-2-macroglobulin in carp (Cyprinus carpio) infected with parasites.

    PubMed

    Onara, Dalia F; Forlenza, Maria; Gonzalez, Santiago F; Rakus, Krzysztof Ł; Pilarczyk, Andrzej; Irnazarow, Ilgiz; Wiegertjes, Geert F

    2008-01-01

    Alpha-2-macroglobulin (a2M) is a non-specific protease inhibitor involved in host defense mechanisms, inhibiting both endogenous and exogenous proteases. It is unique among the plasma anti-proteases with respect to the diversity of proteases that it can inactivate. Carp a2M consists of an alpha and beta chain of which the first includes the bioactive regions. Previously, three a2M alpha chain sequences were reported for East-Asian common carp. We studied a2M alpha chain variability in European common carp and report the cloning of a fourth a2M alpha chain with distinct sequence diversity in the bait region. The role of a2M in the immune response to parasites was studied in the liver of carp infected with Trypanoplasma borreli or with Ichthyophthirius multifiliis. Quantitative gene transcription analysis showed a differential regulation of the four isoforms, most clearly seen in infections with I. multifiliis. A2M3 was the only a2M isoform with a highly upregulated transcription during infection, suggesting that this particular isoform is of foremost biological importance.

  16. Serum alpha 2-macroglobulin in haemodialysis patients: baseline and kinetic studies.

    PubMed

    Argilés, A; Kerr, P G; Mourad, G; Mion, C M; Atkins, R C

    1993-01-01

    The pathogenesis of dialysis related amyloidosis remains unresolved despite the identification of beta 2-microglobulin (beta 2M) as the major protein constituent, as well as other proteins being present in the deposits. Among the latter we have assessed the serum concentrations of alpha 2-macroglobulin (alpha 2M) both in the baseline stage and during the haemodialysis (HD) procedure. We have also assessed the influence of the membrane on alpha 2M kinetics. Fifteen HD patients with histologically proven dialysis-related amyloidosis (DRA group) and 15 HD patients clinically and radiologically considered dialysis-related amyloidosis free (control group) were included in the baseline study. Blood was sampled the day before the second dialysis of the week and alpha 2M, beta 2M and alpha 1 antitrypsin were determined along with the routine biological analysis of these patients. Serum alpha 2M was greater in dialysis-related amyloidosis than in control patients (t = 2.35; P < 0.026). Serum beta 2M was similar in both groups. The serum alpha 2M and beta 2M correlated in patients with dialysis-related amyloidosis (r = 0.64; P < 0.01), while no correlation was found in controls (r = 0.17; NS). Stepwise analysis taking the presence of dialysis-related amyloidosis as the dependent variable retained the serum alpha 2M concentration as the first variable in the model (F = 4.4; partial r = 0.38; P < 0.046).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7505905

  17. The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.

    PubMed Central

    Barrett, A J; Brown, M A; Sayers, C A

    1979-01-01

    alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not

  18. Alpha-2-macroglobulin functions as an inhibitor of fibrinolytic, clotting, and neutrophilic proteinases in sepsis: studies using a baboon model.

    PubMed

    de Boer, J P; Creasey, A A; Chang, A; Abbink, J J; Roem, D; Eerenberg, A J; Hack, C E; Taylor, F B

    1993-12-01

    Alpha-2-macroglobulin (alpha 2M) may function as a proteinase inhibitor in vivo. Levels of this protein are decreased in sepsis, but the reason these levels are low is unknown. Therefore, we analyzed the behavior of alpha 2M in a baboon model for sepsis. Upon challenge with a lethal (4 baboons) or a sublethal (10 baboons) dose of Escherichia coli, levels of inactivated alpha 2M (i alpha 2M) steadily increased, the changes being more pronounced in the animals that received the lethal dose. The rise in i alpha 2M significantly correlated with the increase of thrombin-antithrombin III, plasmin-alpha 2-antiplasmin, and, to a lesser extent, with that of elastase-alpha 1-antitrypsin complexes, raising the question of involvement of fibrinolytic, clotting, and neutrophilic proteinases in the inactivation of alpha 2M. Experiments with chromogenic substrates confirmed that thrombin, plasmin, elastase, and cathepsin G indeed had formed complexes with alpha 2M. Changes in alpha 2M similar to those observed in the animals that received E. coli occurred in baboons challenged with Staphylococcus aureus, indicating that alpha 2M formed complexes with the proteinases just mentioned in gram-positive sepsis as well. We conclude that alpha 2M in this baboon model for sepsis is inactivated by formation of complexes with proteinases, derived from activated neutrophils and from fibrinolytic and coagulation cascades. We suggest that similar mechanisms may account for the decreased alpha 2M levels in clinical sepsis.

  19. Alpha-2-macroglobulin functions as an inhibitor of fibrinolytic, clotting, and neutrophilic proteinases in sepsis: studies using a baboon model.

    PubMed Central

    de Boer, J P; Creasey, A A; Chang, A; Abbink, J J; Roem, D; Eerenberg, A J; Hack, C E; Taylor, F B

    1993-01-01

    Alpha-2-macroglobulin (alpha 2M) may function as a proteinase inhibitor in vivo. Levels of this protein are decreased in sepsis, but the reason these levels are low is unknown. Therefore, we analyzed the behavior of alpha 2M in a baboon model for sepsis. Upon challenge with a lethal (4 baboons) or a sublethal (10 baboons) dose of Escherichia coli, levels of inactivated alpha 2M (i alpha 2M) steadily increased, the changes being more pronounced in the animals that received the lethal dose. The rise in i alpha 2M significantly correlated with the increase of thrombin-antithrombin III, plasmin-alpha 2-antiplasmin, and, to a lesser extent, with that of elastase-alpha 1-antitrypsin complexes, raising the question of involvement of fibrinolytic, clotting, and neutrophilic proteinases in the inactivation of alpha 2M. Experiments with chromogenic substrates confirmed that thrombin, plasmin, elastase, and cathepsin G indeed had formed complexes with alpha 2M. Changes in alpha 2M similar to those observed in the animals that received E. coli occurred in baboons challenged with Staphylococcus aureus, indicating that alpha 2M formed complexes with the proteinases just mentioned in gram-positive sepsis as well. We conclude that alpha 2M in this baboon model for sepsis is inactivated by formation of complexes with proteinases, derived from activated neutrophils and from fibrinolytic and coagulation cascades. We suggest that similar mechanisms may account for the decreased alpha 2M levels in clinical sepsis. PMID:7693593

  20. Identification of a new alpha-2-macroglobulin: Multi-spectroscopic and isothermal titration calorimetry study.

    PubMed

    Rehman, Ahmed Abdur; Ahsan, Haseeb; Khan, Fahim Halim

    2016-02-01

    A α2M homologue was isolated from sheep (Ovis aries) blood plasma, using a simple two-step procedure, ammonium sulphate fractionation and gel filtration chromatography. Sheep α2M was found to be a large tetrameric glycoprotein of 630 kDa with monomeric subunit of 133 kDa each. Each subunit of sheep α2M was found to be made up of two fragments of 102 and 31 kDa respectively. The proteinase inhibitor from sheep was found to have Stokes radius of 79Ǻ, which makes it much more compact than its human homologue. It entraps only 1 mol of trypsin per mole of inhibitor, like its caprine counterpart. The use of isothermal titration calorimetry has become gold standard for exploring thermodynamics of binding interactions. In this study, binding interaction of trypsin with alpha-2-macroglobulin is studied using ITC. The thermodynamic signatures--enthalpy change (ΔH), entropy change (ΔS) and Gibb's free energy change (ΔG), along with number of binding sites (N) and affinity constant (K) are explored for α2M-trypsin binding for the first time for any known α2M molecule. The thermodynamics of proteinase-antiproteinase association suggests that trypsin-α2M interaction is enthalpy driven event.

  1. The elimination of alpha 2-macroglobulin complexes from the arthritic joint. An experimental study in dogs.

    PubMed

    Ekerot, L; Ohlsson, K

    1982-01-01

    The polyvalent protease inhibitor, alpha 2-macroglobulin, may counteract a protease-mediated rheumatoid joint destruction. The elimination of the complexed inhibitor from joints was analysed in inflamed and noninflamed conditions of the knee joints in dogs. The arthritis was immunologically induced. The fate of intra-articularly injected radioactive alpha 2-macroglobulin complexes was studied by external measurements, analyses of blood, lymph and urine, and by autoradiographic and immunohistologic methods. The results indicate that the elimination of complexes was accelerated by inflammation and joint movements with a half-life shorter than 2 hours in acute arthritis. In addition to absorption into the synovial membrane and degradation in macrophage-like cells, the process of clearance included elimination of complexes via the blood and the lymph capillaries of the joint and subsequent degradation in cells belonging to the reticuloendothelial system in the lymph nodes and the liver. The degradation products were excreted in increasing amounts in the urine. Referring to the earlier recognized high degree of saturation of synovial fluid alpha 2-macroglobulin in rheumatoid arthritis, the finding of a rapid articular clearance of alpha 2-macroglobulin complexes suggests a pronounced release of endoproteases under clinical conditions. PMID:6186018

  2. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... the diagnosis of blood-clotting or clot lysis disorders. (b) Classification. Class II...

  3. BKCa channel regulates calcium oscillations induced by alpha-2-macroglobulin in human myometrial smooth muscle cells.

    PubMed

    Wakle-Prabagaran, Monali; Lorca, Ramón A; Ma, Xiaofeng; Stamnes, Susan J; Amazu, Chinwendu; Hsiao, Jordy J; Karch, Celeste M; Hyrc, Krzysztof L; Wright, Michael E; England, Sarah K

    2016-04-19

    The large-conductance, voltage-gated, calcium (Ca(2+))-activated potassium channel (BKCa) plays an important role in regulating Ca(2+)signaling and is implicated in the maintenance of uterine quiescence during pregnancy. We used immunopurification and mass spectrometry to identify proteins that interact with BKCain myometrium samples from term pregnant (≥37 wk gestation) women. From this screen, we identified alpha-2-macroglobulin2M). We then used immunoprecipitation followed by immunoblot and the proximity ligation assay to confirm the interaction between BKCaand both α2M and its receptor, low-density lipoprotein receptor-related protein 1 (LRP1), in cultured primary human myometrial smooth muscle cells (hMSMCs). Single-channel electrophysiological recordings in the cell-attached configuration demonstrated that activated α2M2M*) increased the open probability of BKCain an oscillatory pattern in hMSMCs. Furthermore, α2M* caused intracellular levels of Ca(2+)to oscillate in oxytocin-primed hMSMCs. The initiation of oscillations required an interaction between α2M* and LRP1. By using Ca(2+)-free medium and inhibitors of various Ca(2+)signaling pathways, we demonstrated that the oscillations required entry of extracellular Ca(2+)through store-operated Ca(2+)channels. Finally, we found that the specific BKCablocker paxilline inhibited the oscillations, whereas the channel opener NS11021 increased the rate of these oscillations. These data demonstrate that α2M* and LRP1 modulate the BKCachannel in human myometrium and that BKCaand its immunomodulatory interacting partners regulate Ca(2+)dynamics in hMSMCs during pregnancy. PMID:27044074

  4. Degradation of the human proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin by Bacteroides gingivalis.

    PubMed Central

    Carlsson, J; Herrmann, B F; Höfling, J F; Sundqvist, G K

    1984-01-01

    Various strains of black-pigmented Bacteroides species were grown on horse blood agar and suspended in human serum. After various times of incubation the effect of the bacteria on the serum was evaluated by polyacrylamide gel electrophoresis and "rocket" immunoelectrophoresis. The formation of trichloroacetic acid-soluble material in the suspensions and the capacity of the treated sera to inhibit the activity of trypsin were also determined. The two tested strains of Bacteroides gingivalis (W83, H185) degraded most serum proteins, including the plasma proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin. They did not, however, degrade alpha-1-antichymotrypsin. Bacteroides intermedius NCTC 9336, Bacteroides asaccharolyticus NCTC 9337, and an asaccharolytic oral strain different from B. gingivalis (BN11a-f) did not degrade the plasma proteinase inhibitors. These strains were, however, able to inactivate the capacity of serum to inhibit the activity of trypsin. Images PMID:6198282

  5. [Uniform method for determining the alpha 1-antitrypsin and alpha 2-macroglobulin activity in human blood serum (plasma)].

    PubMed

    Nartikova, V F; Paskhina, T S

    1979-01-01

    A modified spectrophotometric method is developed for simultaneous estimation of alpha 1-antitrypsin and alpha 2-macroglobulin in human blood serum (plasma); the method is based on dissimilar interaction of these inhibitors with trypsin in the systems with a low molecular substrate N-alpha-benzoyl-l-arginine ethyl ester. alpha 1-Antitrypsin was estimated by inhibition of the arginine esterase activity of trypsin in a mixture containing human blood serum diluted 50-fold. alpha 2-Macroglobulin was estimated by maintained arginine esterase activity of the trypsin-alpha 2-macroglobulin complex, formed after interaction of an excess of trypsin with blood serum, diluted 10-fold and after subsequent inactivation of free, unbound with alpha 2-macroglobulin, trypsin by treatment with the soy bean inhibitor of trypsin. alpha 1-Antitrypsin and alpha 2-macrog-obulin were estimated by means of the method described in blood serum of healthy persons and in patients with burns or with carcinoma of pancreas. The method enables to estimate two main inhibitors of blood plasma proteinases in a small volume of blood serum (0.1 ml) very rapidly and specifically using commercially available substrate; the method might be recommended for routine clinical analysis.

  6. Inhibition of mutalysin II, a metalloproteinase from bushmaster snake venom by human alpha2-macroglobulin and rabbit immunoglobulin.

    PubMed

    Souza, C T; Moura, M B; Magalhaes, A; Heneine, L G; Olortegui, C C; Diniz, C R; Sanchez, E F

    2001-09-01

    Mutalysin II is a 22.5-kDa zinc endopeptidase isolated from Lachesis muta muta snake venom. In order to determine whether the inhibitors human alpha2-macroglobulin (alpha2-M) and rabbit antibody to mutalysin II share a common mechanism, we have investigated the inhibition of mutalysin II by these two different glycoproteins. The proteolytic activity of mutalysin II with dimethylcasein as substrate was completely inhibited by human alpha2-M and by a purified rabbit antibody to mutalysin II. The protection of fibrin(ogen) digestion by alpha2-M was slightly better than the protection offered by the antibody. In addition, the purified antibody reacted only with the metalloproteinase in bushmaster venom, as demonstrated by immunodiffusion. SDS-PAGE analysis of reduced samples showed that the interaction of mutalysin II with alpha2-M resulted in the formation of high molecular complex ( approximately 180000) and M(r) 90000 fragments generated by the venom enzyme. Also, fragments at 85 and 23 kDa were detected under non-reducing conditions after incubation of rabbit immunoglobulin with enzyme. Proteolysis of dimethylcasein as substrate revealed that the stoichiometry of inhibition was 1.0 mol of human alpha2-M and 1.5 mol of rabbit IgG antimutalysin II per mole of enzyme. Furthermore, dimethylcasein hydrolysis indicated that several viperid snake venoms, including Bothrops atrox, B. alternatus and Trimeresurus flavoviridis cross-reacted with the specific rabbit antibody to varying degrees. PMID:11544086

  7. Alpha2-macroglobulin from an Atlantic shrimp: biochemical characterization, sub-cellular localization and gene expression upon fungal challenge.

    PubMed

    Perazzolo, Luciane Maria; Bachère, Evelyne; Rosa, Rafael Diego; Goncalves, Priscila; Andreatta, Edemar Roberto; Daffre, Sirlei; Barracco, Margherita Anna

    2011-12-01

    In this study, we report on the isolation and characterization of an alpha2-macroglobulin2M) from the plasma of the pink shrimp Farfantepenaeus paulensis, its sub-cellular localization and transcriptional changes after infection by fungi. The molecular mass of the α2M was estimated at 389 kDa by gel filtration and 197 kDa by SDS-PAGE, under reducing conditions, suggesting that α2M from F. paulensis consists of two identical sub-units, covalently linked by disulphide bonds. The N-terminal amino acid sequence of the α2M from F. paulensis was very similar to those of other penaeid shrimps, crayfish and lobster (70-90% identity) and to a less extent with that of freshwater prawn (40% identity). A monoclonal antibody raised against the Marsupenaeus japonicus α2M made it possible to demonstrate that α2M of F. paulensis is stored in the vesicles of the shrimp granular hemocytes (through immunogold assay). Quantitative real-time PCR (qPCR) analysis showed that α2M mRNA transcripts significantly increased 24 h after an experimental infection with the shrimp pathogen Fusarium solani and it returned to the basal levels at 48 h post-injection. This is the first report on a α2M characterization in an Atlantic penaeid species and its expression profile upon a fungal infection. PMID:21888978

  8. Alpha2-macroglobulin from an Atlantic shrimp: biochemical characterization, sub-cellular localization and gene expression upon fungal challenge.

    PubMed

    Perazzolo, Luciane Maria; Bachère, Evelyne; Rosa, Rafael Diego; Goncalves, Priscila; Andreatta, Edemar Roberto; Daffre, Sirlei; Barracco, Margherita Anna

    2011-12-01

    In this study, we report on the isolation and characterization of an alpha2-macroglobulin2M) from the plasma of the pink shrimp Farfantepenaeus paulensis, its sub-cellular localization and transcriptional changes after infection by fungi. The molecular mass of the α2M was estimated at 389 kDa by gel filtration and 197 kDa by SDS-PAGE, under reducing conditions, suggesting that α2M from F. paulensis consists of two identical sub-units, covalently linked by disulphide bonds. The N-terminal amino acid sequence of the α2M from F. paulensis was very similar to those of other penaeid shrimps, crayfish and lobster (70-90% identity) and to a less extent with that of freshwater prawn (40% identity). A monoclonal antibody raised against the Marsupenaeus japonicus α2M made it possible to demonstrate that α2M of F. paulensis is stored in the vesicles of the shrimp granular hemocytes (through immunogold assay). Quantitative real-time PCR (qPCR) analysis showed that α2M mRNA transcripts significantly increased 24 h after an experimental infection with the shrimp pathogen Fusarium solani and it returned to the basal levels at 48 h post-injection. This is the first report on a α2M characterization in an Atlantic penaeid species and its expression profile upon a fungal infection.

  9. Discovery, structural characterization and functional analysis of alpha-2-macroglobulin, a novel immune-related molecule from Holothuria atra.

    PubMed

    Qian, Jing; Ren, Chunhua; Xia, Jianjun; Chen, Ting; Yu, Zonghe; Hu, Chaoqun

    2016-07-10

    The non-specific protease inhibitor alpha-2-macroglobulin (A2M) is a key macromolecular glycoprotein that involved in host immune defense against pathogens in vertebrates and invertebrates. However, no research regarding A2M has been developed in echinoderms to date. In this study, the full-length cDNA of A2M was cloned from the sea cucumber (Holothuria atra), which is a tropical species widely distributed along the coasts of the South China Sea and designated HaA2M. HaA2M possesses all three conserved functional domains of known A2M proteins, including the bait region domain, thioester domain and receptor-binding domain. Compared to fish and shrimp A2Ms, the histidine residue from the catalytical regions is well conserved in HaA2M. HaA2M mRNA was predominantly expressed in coelomocytes and, to a lesser extent, in the body wall, intestine and respiratory tree. A2M activity was detected in the coelomic fluids of H. atra. The mRNA expression and activity levels were investigated in the major immune tissues and coelomic fluids of H. atra after challenge with inactivated Vibrio alginolyticus or polyriboinosinic polyribocytidylic acid [Poly (I: C)]. RNA interference (RNAi)-mediated knockdown of HaA2M resulted in a significant reduction of HaA2M gene transcript level (86%). RNAi-mediated silencing of HaA2M gene significantly decreased the A2M activity (38%) and increased the number of viable bacteria (2.8-fold) in the coelomic fluids of H. atra infected by V. alginolyticus. Our study, as a whole, supplied the evidences for HaA2M as an immune-relevant molecule and it might have multiple functions in the innate immune system of H. atra. PMID:27033585

  10. Discovery, structural characterization and functional analysis of alpha-2-macroglobulin, a novel immune-related molecule from Holothuria atra.

    PubMed

    Qian, Jing; Ren, Chunhua; Xia, Jianjun; Chen, Ting; Yu, Zonghe; Hu, Chaoqun

    2016-07-10

    The non-specific protease inhibitor alpha-2-macroglobulin (A2M) is a key macromolecular glycoprotein that involved in host immune defense against pathogens in vertebrates and invertebrates. However, no research regarding A2M has been developed in echinoderms to date. In this study, the full-length cDNA of A2M was cloned from the sea cucumber (Holothuria atra), which is a tropical species widely distributed along the coasts of the South China Sea and designated HaA2M. HaA2M possesses all three conserved functional domains of known A2M proteins, including the bait region domain, thioester domain and receptor-binding domain. Compared to fish and shrimp A2Ms, the histidine residue from the catalytical regions is well conserved in HaA2M. HaA2M mRNA was predominantly expressed in coelomocytes and, to a lesser extent, in the body wall, intestine and respiratory tree. A2M activity was detected in the coelomic fluids of H. atra. The mRNA expression and activity levels were investigated in the major immune tissues and coelomic fluids of H. atra after challenge with inactivated Vibrio alginolyticus or polyriboinosinic polyribocytidylic acid [Poly (I: C)]. RNA interference (RNAi)-mediated knockdown of HaA2M resulted in a significant reduction of HaA2M gene transcript level (86%). RNAi-mediated silencing of HaA2M gene significantly decreased the A2M activity (38%) and increased the number of viable bacteria (2.8-fold) in the coelomic fluids of H. atra infected by V. alginolyticus. Our study, as a whole, supplied the evidences for HaA2M as an immune-relevant molecule and it might have multiple functions in the innate immune system of H. atra.

  11. An alpha-2 macroglobulin in the pearl oyster Pinctada fucata: Characterization and function in hemocyte phagocytosis of Vibrio alginolyticus.

    PubMed

    Wang, Zhongliang; Wang, Bei; Chen, Gang; Lu, Yishan; Jian, Jichang; Wu, Zaohe

    2016-08-01

    Alpha-2 macroglobulin2M) is a ubiquitous protease inhibitor and considered to be an evolutionarily conserved constituent of innate host defence system. Here, an α2M gene (designated as Pfα2M) was obtained from the pearl oyster Pinctada fucata by RT-PCR, PCR walking and rapid amplification of cDNA ends (RACE). The Pfα2M cDNA consists of 6394 bp with an open reading frame (ORF) of 5745 bp encoding a protein of 1914 amino acids with a 19 residues signal peptide. Pfα2M sequence contains three putative functional domains, including a bait region, a thiol ester domain and a receptor-binding domain. Phylogenetic analysis revealed that Pfα2M is closely related to the α2Ms from other molluscs. Pfα2M was expressed in all tested tissues including digestive gland, gill, adductor muscle, mantle and foot, while the highest expression was found in hemocytes. Following challenge with Vibrio alginolyticus, Pfα2M expression in hemocytes was significantly up-regulated at 2 h and then returned to the original level at 48 h. Knockdown of Pfα2M by RNA interference significantly reduced the phagocytosis of V. alginolyticus by hemocytes in vivo, and similar results were obtained upon chemical inactivation of the reactive thioester bond in Pfα2M by methylamine treatment. Taken together, it is suggested that Pfα2M is an immune-relevant molecule and involved in phagocytosis of V. alginolyticus by P. fucata hemocytes, and the function of Pfα2M in phagocytosis is dependent on the active thioester bond. PMID:27346151

  12. An alpha-2 macroglobulin in the pearl oyster Pinctada fucata: Characterization and function in hemocyte phagocytosis of Vibrio alginolyticus.

    PubMed

    Wang, Zhongliang; Wang, Bei; Chen, Gang; Lu, Yishan; Jian, Jichang; Wu, Zaohe

    2016-08-01

    Alpha-2 macroglobulin2M) is a ubiquitous protease inhibitor and considered to be an evolutionarily conserved constituent of innate host defence system. Here, an α2M gene (designated as Pfα2M) was obtained from the pearl oyster Pinctada fucata by RT-PCR, PCR walking and rapid amplification of cDNA ends (RACE). The Pfα2M cDNA consists of 6394 bp with an open reading frame (ORF) of 5745 bp encoding a protein of 1914 amino acids with a 19 residues signal peptide. Pfα2M sequence contains three putative functional domains, including a bait region, a thiol ester domain and a receptor-binding domain. Phylogenetic analysis revealed that Pfα2M is closely related to the α2Ms from other molluscs. Pfα2M was expressed in all tested tissues including digestive gland, gill, adductor muscle, mantle and foot, while the highest expression was found in hemocytes. Following challenge with Vibrio alginolyticus, Pfα2M expression in hemocytes was significantly up-regulated at 2 h and then returned to the original level at 48 h. Knockdown of Pfα2M by RNA interference significantly reduced the phagocytosis of V. alginolyticus by hemocytes in vivo, and similar results were obtained upon chemical inactivation of the reactive thioester bond in Pfα2M by methylamine treatment. Taken together, it is suggested that Pfα2M is an immune-relevant molecule and involved in phagocytosis of V. alginolyticus by P. fucata hemocytes, and the function of Pfα2M in phagocytosis is dependent on the active thioester bond.

  13. Ultrastructural antibody localization of alpha2-macroglobulin in membrane-limited vesicles in cultured cells.

    PubMed Central

    Willingham, M C; Yamada, S S; Pastan, I

    1978-01-01

    We have been developing a procedure for localizing intracellular antigens in cultured cells, by using peroxidase-labeled antibodies, that allows good morphologic preservation. Although useful, our previous technique did not preserve the morphology of membranes, and the location of the peroxidase reaction product was difficult to establish. In this paper, we report major improvements on the basic technique that markedly enhance the quality of localization and of morphology. Saponin is used to permeabilize membranes without destroying their morphology. The amount of reaction product is enhanced with a peroxidase-antiperoxidase label. The clarity of morphologic detail and contrast of reaction product density are increased by using postsectioning staining with the osmium/thiocarbohydrazide/osmium and uranyl acetate/lead citrate procedures. We have applied this technique to the ultrastructural localization of alpha2-macroglobulin and demonstrated that it is localized in membrane-limited vesicles. We have also used this method to improve the preservation of structures for localization by fluorescence microscopy. Images PMID:81488

  14. Alpha-2-macroglobulin loaded microcapsules enhance human leukocyte functions and innate immune response.

    PubMed

    Federici Canova, Donata; Pavlov, Anton M; Norling, Lucy V; Gobbetti, Thomas; Brunelleschi, Sandra; Le Fauder, Pauline; Cenac, Nicolas; Sukhorukov, Gleb B; Perretti, Mauro

    2015-11-10

    Synthetic microstructures can be engineered to deliver bioactive compounds impacting on their pharmacokinetics and pharmacodynamics. Herein, we applied dextran-based layer-by-layer (LbL) microcapsules to deliver alpha-2-macroglobulin (α2MG), a protein with modulatory properties in inflammation. Extending recent observations made with dextran-microcapsules loaded with α2MG in experimental sepsis, we focused on the physical and chemical characteristics of these microstructures and determined their biology on rodent and human cells. We report an efficient encapsulation of α2MG into microcapsules, which enhanced i) human leukocyte recruitment to inflamed endothelium and ii) human macrophage phagocytosis: in both settings microcapsules were more effective than soluble α2MG or empty microcapsules (devoid of active protein). Translation of these findings revealed that intravenous administration of α2MG-microcapsules (but not empty microcapsules) promoted neutrophil migration into peritoneal exudates and augmented macrophage phagocytic functions, the latter response being associated with alteration of bioactive lipid mediators as assessed by mass spectrometry. The present study indicates that microencapsulation can be an effective strategy to harness the complex biology of α2MG with enhancing outcomes on fundamental processes of the innate immune response paving the way to potential future development in the control of sepsis. PMID:26385167

  15. Alpha-2-macroglobulin loaded microcapsules enhance human leukocyte functions and innate immune response

    PubMed Central

    Canova, Donata Federici; Pavlov, Anton M.; Norling, Lucy V.; Gobbetti, Thomas; Brunelleschi, Sandra; Le Fauder, Pauline; Cenac, Nicolas; Sukhorukov, Gleb B.; Perretti, Mauro

    2015-01-01

    Synthetic microstructures can be engineered to deliver bioactive compounds impacting on their pharmacokinetics and pharmacodynamics. Herein, we applied dextran-based layer-by-layer (LbL) microcapsules to deliver alpha-2-macroglobulin (α2MG), a protein with modulatory properties in inflammation. Extending recent observations made with dextran-microcapsules loaded with α2MG in experimental sepsis, we focused on the physical and chemical characteristics of these microstructures and determined their biology on rodent and human cells. We report an efficient encapsulation of α2MG into microcapsules, which enhanced i) human leukocyte recruitment to inflamed endothelium and ii) human macrophage phagocytosis: in both settings microcapsules were more effective than soluble α2MG or empty microcapsules (devoid of active protein). Translation of these findings revealed that intravenous administration of α2MG-microcapsules (but not empty microcapsules) promoted neutrophil migration into peritoneal exudates and augmented macrophage phagocytic functions, the latter response being associated with alteration of bioactive lipid mediators as assessed by mass spectrometry. The present study indicates that microencapsulation can be an effective strategy to harness the complex biology of α2MG with enhancing outcomes on fundamental processes of the innate immune response paving the way to potential future development in the control of sepsis. PMID:26385167

  16. Copper is taken up efficiently from albumin and alpha2-macroglobulin by cultured human cells by more than one mechanism.

    PubMed

    Moriya, Mizue; Ho, Yi-Hsuan; Grana, Anne; Nguyen, Linh; Alvarez, Arrissa; Jamil, Rita; Ackland, M Leigh; Michalczyk, Agnes; Hamer, Pia; Ramos, Danny; Kim, Stephen; Mercer, Julian F B; Linder, Maria C

    2008-09-01

    Ionic copper entering blood plasma binds tightly to albumin and the macroglobulin transcuprein. It then goes primarily to the liver and kidney except in lactation, where a large portion goes directly to the mammary gland. Little is known about how this copper is taken up from these plasma proteins. To examine this, the kinetics of uptake from purified human albumin and alpha(2)-macroglobulin, and the effects of inhibitors, were measured using human hepatic (HepG2) and mammary epithelial (PMC42) cell lines. At physiological concentrations (3-6 muM), both cell types took up copper from these proteins independently and at rates similar to each other and to those for Cu-dihistidine or Cu-nitrilotriacetate (NTA). Uptakes from alpha(2)-macroglobulin indicated a single saturable system in each cell type, but with different kinetics, and 65-80% inhibition by Ag(I) in HepG2 cells but not PMC42 cells. Uptake kinetics for Cu-albumin were more complex and also differed with cell type (as was the case for Cu-histidine and NTA), and there was little or no inhibition by Ag(I). High Fe(II) concentrations (100-500 microM) inhibited copper uptake from albumin by 20-30% in both cell types and that from alpha(2)-macroglobulin by 0-30%, and there was no inhibition of the latter by Mn(II) or Zn(II). We conclude that the proteins mainly responsible for the plasma-exchangeable copper pool deliver the metal to mammalian cells efficiently and by several different mechanisms. alpha(2)-Macroglobulin delivers it primarily to copper transporter 1 in hepatic cells but not mammary epithelial cells, and additional as-yet-unidentified copper transporters or systems for uptake from these proteins remain to be identified.

  17. The interleukin 1 alpha, interleukin 1 beta, interleukin 6 and alpha-2-macroglobulin serum levels in patients with early or late onset Alzheimer's disease, mild cognitive impairment or Parkinson's disease.

    PubMed

    Dursun, Erdinç; Gezen-Ak, Duygu; Hanağası, Haşmet; Bilgiç, Başar; Lohmann, Ebba; Ertan, Sibel; Atasoy, İrem L; Alaylıoğlu, Merve; Araz, Ömür Selin; Önal, Burak; Gündüz, Ayşegül; Apaydın, Hülya; Kızıltan, Güneş; Ulutin, Turgut; Gürvit, Hakan; Yılmazer, Selma

    2015-06-15

    Alzheimer's disease (EOAD, LOAD), mild cognitive impairment (MCI), Parkinson's disease (PD) and healthy controls were included to determine the serum interleukin-1s (IL-1α, IL-1β), IL-6 and alpha-2-macroglobulin2M) levels using ELISA. IL-6 might be a significant contributor to the inflammatory response in LOAD. The MCI data indicate that IL-1s, α2M and BDNF are somehow related, and this relationship might allow MCI patients to be more similar to the healthy controls. A correlation analysis of multiple biomarkers in different neurodegenerative disorders might be more useful than determining the levels of a single cytokine in a single disorder.

  18. Anti-lymphoproliferative activity of alpha-2-macroglobulin in the plasma of hibernating 13-lined ground squirrels and woodchucks.

    PubMed

    Sieckmann, Donna G; Jaffe, Howard; Golech, Susanne; Cai, DeCheng; Hallenbeck, John M; McCarron, Richard M

    2014-09-15

    Plasma from hibernating (HIB) woodchucks (Marmota monax) or 13-lined ground squirrels (Ictidomys tridecemlineatus) suppressed (3)H-thymidine uptake in mouse spleen cell cultures stimulated with Concanavalin A (ConA); plasma from non-hibernating animals were only slightly inhibitory. Maximum inhibition occurred when HIB plasma was added to the cultures prior to ConA. After HPLC size exclusion chromatography of the HIB ground squirrel plasma, a single fraction (fraction-14) demonstrated inhibitory activity. Assay of fraction-14 from 8 HIB squirrels showed inhibition ranging from 13 to 95%; inhibition was correlated to the time the squirrels were exposed to cold prior to hibernation. Western blot analysis showed the factor to be a large molecular weight protein (>300 kDa), and mass spectrometry identified sequences that were 100% homologous with alpha-2-macroglobulin from humans and other species. These findings indicate a hibernation-related protein that may be responsible for immune system down regulation.

  19. Interaction of human tissue plasminogen activator (t-PA) with pregnancy zone protein: a comparative study with t-PA-alpha2-macroglobulin interaction.

    PubMed

    Sánchez, M C; Chiabrando, G A; Guglielmone, H A; Bonacci, G R; Rabinovich, G A; Vides, M A

    1998-08-01

    Human pregnancy zone protein (PZP) is a major pregnancy-associated plasma protein strongly related to alpha2-macroglobulin (alpha2-M). Interactions of tissue plasminogen activator (t-PA) with PZP and alpha2-M were both investigated in vitro and the complexes were analyzed by polyacrylamide gel electrophoresis (PAGE). The results demonstrated that PZP-t-PA complex formation was evident within 1 h of incubation, whereas alpha2-M-t-PA complexes were formed after 18 h. Conclusions were supported by the following evidence: (i) PZP and alpha2-M complexes revealed changes of the mobility rate in non-denaturing PAGE, similar to those observed with alpha-Ms-chymotrypsin; (ii) both PZP and alpha2-M formed complexes of molecular size >360 kDa by SDS-PAGE, in accordance with the covalent binding of t-PA, which was previously reported for other proteinases; and (iii) PZP underwent a specific cleavage of the bait region with appearence of fragments of 85-90 kDa as judged by reducing SDS-PAGE. In contrast, the proteolytic attack on alpha2-M was found to occur more slowly, requiring several hours of incubation with t-PA for generation of an appreciable amount of fragments of 85-90 kDa. The appearance of free SH-groups of alpha-Ms was further investigated by titration with 5, 5'-dithiobis(2-nitrobenzoic acid). The maximal level of SH-groups raised was 3.9 mol/mol of PZP and 3.5 mol/mol of alpha2-M, indicating approximately one SH-group for each 180-kDa subunit. Finally, t-PA activity in PZP-t-PA complex was evaluated by measuring the hydrolysis of the chromogenic substrate Flavigen t-PA. Our results revealed that prolongation of the incubation period of this complex increased t-PA-mediated hydrolysis of Flavigen t-PA until a plateau was reached, approximately between 60 and 120 min. The present study suggests that PZP, by binding to t-PA, may contribute to the control of the activity of proteinases derived from fibrinolytic systems.

  20. Role of zinc and alpha2 macroglobulin on thymic endocrine activity and on peripheral immune efficiency (natural killer activity and interleukin 2) in cervical carcinoma.

    PubMed

    Mocchegiani, E; Ciavattini, A; Santarelli, L; Tibaldi, A; Muzzioli, M; Bonazzi, P; Giacconi, R; Fabris, N; Garzetti, G G

    1999-01-01

    Decreased natural killer (NK) activity as well as interleukin 2 (IL-2) are risk factors for the progression of cervical carcinoma. NK activity and IL-2 may be thymus controlled. Plasma levels of active thymulin, a zinc-dependent thymic hormone (ZnFTS), are reduced in cancer because of the low peripheral zinc bioavailability. Zinc and thymulin are relevant for normal immune functions. Alpha2-macroglobulin is an inhibitor of matrix metalloproteases (MMPs) against invasive tumour proliferation. Because alpha2-macroglobulin has a binding affinity (Kd) for zinc that is higher than does thymulin, it may play a key role in immune efficiency in cancer. Plasma samples of 22 patients (age range 35-60 years) with locally advanced squamous cervical carcinoma and with FIGO stage Ib2-IIb were examined. They showed reduced active thymulin, decreased NK activity and IL-2 production, increased soluble IL-2 receptor (sIL-2R) and augmented alpha2-macroglobulin in the circulation, whereas plasma zinc levels were within the normal range for age. Significant positive correlations were found between zinc or active thymulin and alpha2-macroglobulin (r = 0.75, P < 0.01, r = 0.78, P < 0.01, respectively) in cancer patients. In vitro zinc increases IL-2 production from peripheral blood mononuclear cells (PBMCs) of cancer patients. These data suggest that an increase in alpha2-macroglobulin, which competes with thymulin for zinc binding, may be involved in causing a thymulin deficit with a consequent decrease of IL-2 and NK cytotoxicity. Thus, physiological zinc treatment in cervical carcinoma maybe restores impaired central and peripheral immune efficiency.

  1. Human plasma alpha 2-macroglobulin promotes in vitro oxidative stress cracking of Pellethane 2363-80A: in vivo and in vitro correlations.

    PubMed

    Zhao, Q H; McNally, A K; Rubin, K R; Renier, M; Wu, Y; Rose-Caprara, V; Anderson, J M; Hiltner, A; Urbanski, P; Stokes, K

    1993-03-01

    It is hypothesized in this study that the phenomenon of environmental stress cracking (ESC) in polyetherurethane is caused by a synergistic action of biological components in the body fluids, oxidative agents, and stress. An in vitro system is designed to mimic the in vivo system; human plasma contains certain biological components that can act as a stress cracking promoter, while H2O2 (Co) solution provides an oxidative reaction comparable to that observed in the respiratory burst of adherent macrophages and foreign-body giant cells. It is demonstrated that the phenomenon of in vivo stress cracking in Pellethane 2363-80A is duplicated by an in vitro system that involves a pretreatment of prestressed specimens with human plasma at 37 degrees C for 7 days followed by oxidation in 10% hydrogen peroxide with 0.10M cobalt chloride at 50 degrees C for 10 days. The pretreatment with plasma has a synergistic effect with the oxidation by H2O2 (Co) treatment to produce ESC. A plasma component responsible for promoting stress cracking in Pellethane polyurethane is identified to be alpha 2-macroglobulin (alpha 2M). PMID:7689567

  2. Lectin-based protein microarray analysis of differences in serum alpha-2-macroglobulin glycosylation between patients with colorectal cancer and persons without cancer.

    PubMed

    Šunderić, Miloš; Šedivá, Alena; Robajac, Dragana; Miljuš, Goran; Gemeiner, Peter; Nedić, Olgica; Katrlík, Jaroslav

    2016-07-01

    Glycosylation is co- and posttranslational modifications affecting proteins. The glycopattern changes are associated with changes in biological function and are involved in many diseases including cancer. We present the lectin-based protein microarray method enabling determination of differences in protein glycosylation. The method involves isolation of targeted protein from samples by immunoprecipitation, spotting of protein from multiple samples into arrays on a microarray slide, incubation with set of biotinylated lectins, the reaction with fluorescent conjugate of streptavidin, and detection of fluorescent intensities by microarray scanner. Lectin-based protein microarray was applied in investigation of differences in alpha-2-macroglobulin2M) glycosylation isolated from sera samples of healthy persons and patients with colorectal cancer (CC). From 14 lectins used in analysis, statistically significant differences (Student's t-test, P < 0.05) between two groups of samples (persons without cancer and CC patients) were found for 5 of them. α2M molecules isolated from sera of CC patients have higher content of α2,6 sialic acid, N-acetylglucosamine and mannose residues, and tri-/tetraantennary complex type high-mannose N-glycans. A novel lectin-based protein microarray developed and described can serve as a suitable analytical technique for sensitive, simple, fast, and high-throughput determination of differences in protein glycosylation isolated from serum or other samples.

  3. Analysis of Alpha-2 Macroglobulin from the Long-Lived and Cancer-Resistant Naked Mole-Rat and Human Plasma

    PubMed Central

    Thieme, René; Kurz, Susanne; Kolb, Marlen; Debebe, Tewodros; Holtze, Susanne; Morhart, Michaela; Huse, Klaus; Szafranski, Karol; Platzer, Matthias; Hildebrandt, Thomas B.; Birkenmeier, Gerd

    2015-01-01

    Background The naked mole-rat (NMR) is a long-lived and cancer resistant species. Identification of potential anti-cancer and age related mechanisms is of great interest and makes this species eminent to investigate anti-cancer strategies and understand aging mechanisms. Since it is known that the NMR expresses higher liver mRNA-levels of alpha 2-macroglobulin than mice, nothing is known about its structure, functionality or expression level in the NMR compared to the human A2M. Results Here we show a comprehensive analysis of NMR- and human plasma-A2M, showing a different prediction in glycosylation of NMR-A2M, which results in a higher molecular weight compared to human A2M. Additionally, we found a higher concentration of A2M (8.3±0.44 mg/mL vs. and 4.4±0.20 mg/mL) and a lower total plasma protein content (38.7±1.79 mg/mL vs. 61.7±3.20 mg/mL) in NMR compared to human. NMR-A2M can be transformed by methylamine and trypsin resulting in a conformational change similar to human A2M. NMR-A2M is detectable by a polyclonal antibody against human A2M. Determination of tryptic and anti-tryptic activity of NMR and human plasma revealed a higher anti-tryptic activity of the NMR plasma. On the other hand, less proteolytic activity was found in NMR plasma compared to human plasma. Conclusion We found transformed NMR-A2M binding to its specific receptor LRP1. We could demonstrate lower protein expression of LRP1 in the NMR liver tissue compared to human but higher expression of A2M. This was accompanied by a higher EpCAM protein expression as central adhesion molecule in cancer progression. NMR-plasma was capable to increase the adhesion in human fibroblast in vitro most probably by increasing CD29 protein expression. This is the first report, demonstrating similarities as well as distinct differences between A2M in NMR and human plasma. This might be directly linked to the intriguing phenotype of the NMR and suggests that A2M might probably play an important role in anti

  4. Binding of transforming growth factor-beta (TGF-beta) to pregnancy zone protein (PZP). Comparison to the TGF-beta-alpha 2-macroglobulin interaction.

    PubMed

    Philip, A; Bostedt, L; Stigbrand, T; O'Connor-McCourt, M D

    1994-04-15

    Pregnancy zone protein (PZP) is quantitatively the most important pregnancy-associated plasma protein and it has strong similarity to alpha 2-macroglobulin. Since alpha 2-macroglobulin is a binding protein for transforming growth factors-beta (TGF-beta), it was of interest to test whether the related protein, PZP, also binds to these growth-regulatory proteins. Using affinity-labelling methods, we demonstrate that PZP binds both TGF-beta 1 and TGF-beta 2 and that the binding characteristics are similar to those of the TGF-beta-alpha 2-macroglobulin interaction. TGF-beta 2 and TGF-beta 1 bind to PZP in a predominantly noncovalent manner in vitro. TGF-beta 1 and TGF-beta 2 bind to both the dimeric and tetrameric forms of PZP. Our studies also indicate that PZP binds TGF-beta 2 with higher affinity than TGF-beta 1. Finally, we demonstrate that PZP inhibits the binding of TGF-beta 1 and TGF-beta 2 to their cell surface receptors. The increased level of PZP during pregnancy may affect the action of TGF-beta by regulating the distribution, clearance and/or general availability of TGF-beta. The preferential binding of TGF-beta 2 over TGF-beta 1 by PZP implies that PZP may differentially regulate the action of TGF-beta 1 and TGF-beta 2.

  5. alpha-2 Macroglobulin receptor/Ldl receptor-related protein(Lrp)- dependent internalization of the urokinase receptor

    PubMed Central

    1995-01-01

    The GPI-anchored urokinase plasminogen activator receptor (uPAR) does not internalize free urokinase (uPA). On the contrary, uPAR-bound complexes of uPA with its serpin inhibitors PAI-1 (plasminogen activator inhibitor type-1) or PN-1 (protease nexin-1) are readily internalized in several cell types. Here we address the question whether uPAR is internalized as well upon binding of uPA-serpin complexes. Both LB6 clone 19 cells, a mouse cell line transfected with the human uPAR cDNA, and the human U937 monocytic cell line, express in addition to uPAR also the endocytic alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein (LRP/alpha 2-MR) which is required to internalize uPAR-bound uPA-PAI-1 and uPA-PN-1 complexes. Downregulation of cell surface uPAR molecules in U937 cells was detected by cytofluorimetric analysis after uPA-PAI-1 and uPA-PN-1 incubation for 30 min at 37 degrees C; this effect was blocked by preincubation with the ligand of LRP/alpha 2-MR, RAP (LRP/alpha 2-MR- associated protein), known to block the binding of the uPA complexes to LRP/alpha 2-. MR. Downregulation correlated in time with the intracellular appearance of uPAR as assessed by confocal microscopy and immuno-electron microscopy. After 30 min incubation with uPA-PAI-1 or uPA-PN-1 (but not with free uPA), confocal microscopy showed that uPAR staining in permeabilized LB6 clone 19 cells moved from a mostly surface associated to a largely perinuclear position. This effect was inhibited by the LRP/alpha 2-MR RAP. Perinuclear uPAR did not represent newly synthesized nor a preexisting intracellular pool of uPAR, since this fluorescence pattern was not modified by treatment with the protein synthesis inhibitor cycloheximide, and since in LB6 clone 19 cells all of uPAR was expressed on the cell surface. Immuno-electron microscopy confirmed the plasma membrane to intracellular translocation of uPAR, and its dependence on LRP/alpha 2-MR in LB6 clone 19 cells only after

  6. The low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a receptor for connective tissue growth factor.

    PubMed

    Segarini, P R; Nesbitt, J E; Li, D; Hays, L G; Yates, J R; Carmichael, D F

    2001-11-01

    Connective tissue growth factor (CTGF) expression is regulated by transforming growth factor-beta (TGF-beta) and strong up-regulation occurs during wound healing; in situ hybridization data indicate that there are high levels of CTGF expression in fibrotic lesions. Recently the binding parameters of CTGF to both high and lower affinity cell surface binding components have been characterized. Affinity cross-linking and SDS-polyacrylamide gel electrophoresis analysis demonstrated the binding of CTGF to a cell surface protein with a mass of approximately 620 kDa. We report here the purification of this protein by affinity chromatography on CTGF coupled to Sepharose and sequence information obtained by mass spectroscopy. The binding protein was identified as the multiligand receptor, low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor (LRP). The identification of LRP as a receptor for CTGF was validated by several studies: 1) binding competition with many ligands that bind to LRP, including receptor-associated protein; 2) immunoprecipitation of CTGF-receptor complex with LRP antibodies; and 3) cells that are genetically deficient for LRP were unable to bind CTGF. Last, CTGF is rapidly internalized and degraded and this process is LRP-dependent. In summary, our data indicate that LRP is a receptor for CTGF, and may play an important role in mediating CTGF biology.

  7. Human sputum cathepsin B degrades proteoglycan, is inhibited by alpha 2-macroglobulin and is modulated by neutrophil elastase cleavage of cathepsin B precursor and cystatin C.

    PubMed Central

    Buttle, D J; Abrahamson, M; Burnett, D; Mort, J S; Barrett, A J; Dando, P M; Hill, S L

    1991-01-01

    The high-Mr alkali-stable form of cathepsin B was purified from purulent human sputum. It was shown to solubilize proteoglycan monomer entrapped in polyacrylamide at a rate comparable with that of human lysosomal cathepsin B. Like the enzyme from lysosomes, sputum cathepsin B was bound by human alpha 2-macroglobulin, which inhibited its action on proteoglycan. Cystatin C in purulent sputum was shown to be the N-terminally truncated form generated by neutrophil elastase cleavage, and sputum cathepsin B was only weakly inhibited by recombinant cystatin C that had been cleaved by neutrophil elastase in vitro. Addition of neutrophil elastase to mucoid sputum led to a 5-fold increase in cathepsin B activity concomitant with a lowering in Mr of the cysteine proteinase from 40,000 to 37,000, i.e. the size of the active enzyme purified from purulent sputum. It is concluded that the high-Mr form of cathepsin B present in purulent sputum is a functional proteinase, unlike similar forms of the enzyme secreted by mammary gland in organ culture. The activity of cathepsin B in sputum is modulated by neutrophil elastase, by a combination of inhibitor inactivation and zymogen activation. Images Fig. 3. Fig. 4. Fig. 5. PMID:1710889

  8. Multiple, diverse senile plaque-associated proteins are ligands of an apolipoprotein E receptor, the alpha 2-macroglobulin receptor/low-density-lipoprotein receptor-related protein.

    PubMed

    Rebeck, G W; Harr, S D; Strickland, D K; Hyman, B T

    1995-02-01

    Both apolipoprotein E and its receptor, the low-density-lipoprotein receptor-related protein (LRP), are associated with senile plaques in Alzheimer's disease. We examined the relationship of other LRP-related molecules to senile plaques. LRP is a multifunctional receptor that binds and rapidly internalizes at least seven ligands: apolipoprotein E, activated alpha 2-macroglobulin, tissue and urokinase-type plasminogen activators, plasminogen activator inhibitor-1, lipoprotein lipase, and lactoferrin. Using immunohistochemistry, we showed that all of these ligands, representing a diverse group of otherwise apparently unrelated proteins, accumulate on senile plaques. We also studied expression of the receptor-associated protein, a physiological inhibitor of LRP, in the hippocampal formation from normal subjects and Alzheimer's disease patients. Receptor-associated protein colocalizes with LRP on neuronal soma, but not on neuronal processes or reactive astrocytes. It is not present on senile plaques. These results suggest that senile plaque-associated LRP can bind its ligands, but clearance of these compounds may be impaired in the vicinity of senile plaques.

  9. Peroxisome proliferator-activated receptor alpha (PPARalpha) agonists down-regulate alpha2-macroglobulin expression by a PPARalpha-dependent mechanism.

    EPA Science Inventory

    Peroxisome proliferator-activated receptor alpha (PPARα) regulates transcription of genes involved both in lipid and glucose metabolism as well as inflammation. Fibrates are PPARα ligands used to normalize lipid and glucose parameters and exert anti-inflammatory effects. Fibrates...

  10. Upregulation of capsule enables Streptococcus pyogenes to evade immune recognition by antigen-specific antibodies directed to the G-related alpha2-macroglobulin-binding protein GRAB located on the bacterial surface.

    PubMed

    Dinkla, Katrin; Sastalla, Inka; Godehardt, Antonia W; Janze, Nina; Chhatwal, Gursharan S; Rohde, Manfred; Medina, Eva

    2007-07-01

    One of the major problems associated with the development of a vaccine against Streptococcus pyogenes is the ability of this pathogen to escape recognition by antibodies directed against conserved surface-associated determinants and to establish infection in the setting of an acquired immune response. Identification of the mechanism(s) used by S. pyogenes to avoid recognition by antigen-specific antibodies and escape killing in blood was the focus of this study. We showed here that S. pyogenes was capable of surviving in human blood containing high levels of antibodies directed against the G-related alpha2-macroglobulin-binding protein GRAB, a highly conserved bacterial surface protein. S. pyogenes upregulated the hyaluronic acid capsule production during incubation with human blood, suggesting that the capsule may structurally minimize antibody access to protein GRAB. This hypothesis was confirmed by the ability of anti-GRAB antibodies to promote opsonophagocytosis of a capsule-deficient mutant of S. pyogenes but not of the encapsulated wild-type strain. Capsule upregulation and protection of S. pyogenes from opsonophagocytosis in the presence of anti-GRAB antibodies was also observed in a murine model of streptococcal infection. Thus, masking of surface immunogenic determinants by the hyaluronic acid capsule may constitute a novel mechanism of S. pyogenes for evasion of antigen-specific antibodies.

  11. Inactivation of α2-Macroglobulin by Activated Human Polymorphonuclear Leukocytes

    PubMed Central

    Croisier, J.-L.; Camus, G.; Brumioul, D.; Mathy-Hartert, M.; Sondag, D.; Deby, C.; Lamy, M.

    1994-01-01

    The proteolytic activity of trypsin releases the dye Remazol Brilliant Blue from its high molecular weight substrate, the skin powder (Hide Powder Azure, Sigma), with an increase in absorbance at 595 nm. Active α2- macroglobulin (80 μg/ml) totally inhibits the proteolytic activity of trypsin (14 μg/ml) by trapping this protease. But after a 20 min incubation of α2-macroglobulin at 37°C with 2 × 106 human polymorphonuclear leukocytes activated by N-formyl-L-methionyl-L-leucyl-L-phenylalanine (10−7 M) and cytochalasin B (10−8 M), 100% of trypsin activity was recovered, indicating a total inactivation of α2-macroglobuHn. Incubation with granulocyte myeloperoxidase also inactivates α2-macroglobulin. Hypochlorous acid, a by-product of myeloperoxidase activity, at a concentration of 10−7 M also inactivates α2-macroglobulin, which indicates that an important cause of α2-macroglobulin inactivation by activated polymorphonuclear leukocytes could be the activity of myeloperoxidase. PMID:18472929

  12. Molecular cloning of α-2-macroglobulin from hemocytes of common periwinkle Littorina littorea.

    PubMed

    Borisova, Elena A; Gorbushin, Alexander M

    2014-08-01

    We report the sequence of the proteinase inhibitor with a wide inhibition spectrum, α-2-macroglobulin2M), belonging to the thioester superfamily of proteins. This is the first α2M sequence from coenogastropod prosobranch snails. The full-length cDNA was cloned by RACE method, spans 7897 bp and contains an open reading frame of 5460 bp. The ORF encodes a protein of 1819 amino acids. The deduced mature protein contains 1795 amino acids with a molecular weight of 200 kDa and isoelectric point of 5.00. Littorina littorea α2M bears 4 conserved α2M domains and one internal thioester. Phylogenetic analysis showed that the sequence forms well supported cluster with Mollusca species and other representatives of Lophotrochozoa. PMID:24830774

  13. Structural and functional insights into Escherichia coli α2-macroglobulin endopeptidase snap-trap inhibition

    PubMed Central

    Garcia-Ferrer, Irene; Arêde, Pedro; Gómez-Blanco, Josué; Luque, Daniel; Duquerroy, Stephane; Castón, José R.; Goulas, Theodoros; Gomis-Rüth, F. Xavier

    2015-01-01

    The survival of commensal bacteria requires them to evade host peptidases. Gram-negative bacteria from the human gut microbiome encode a relative of the human endopeptidase inhibitor, α2-macroglobulin2M). Escherichia coli α2M (ECAM) is a ∼180-kDa multidomain membrane-anchored pan-peptidase inhibitor, which is cleaved by host endopeptidases in an accessible bait region. Structural studies by electron microscopy and crystallography reveal that this cleavage causes major structural rearrangement of more than half the 13-domain structure from a native to a compact induced form. It also exposes a reactive thioester bond, which covalently traps the peptidase. Subsequently, peptidase-laden ECAM is shed from the membrane and may dimerize. Trapped peptidases are still active except against very large substrates, so inhibition potentially prevents damage of large cell envelope components, but not host digestion. Mechanistically, these results document a novel monomeric “snap trap.” PMID:26100869

  14. Structural and functional insights into Escherichia coli α2-macroglobulin endopeptidase snap-trap inhibition.

    PubMed

    Garcia-Ferrer, Irene; Arêde, Pedro; Gómez-Blanco, Josué; Luque, Daniel; Duquerroy, Stephane; Castón, José R; Goulas, Theodoros; Gomis-Rüth, F Xavier

    2015-07-01

    The survival of commensal bacteria requires them to evade host peptidases. Gram-negative bacteria from the human gut microbiome encode a relative of the human endopeptidase inhibitor, α2-macroglobulin2M). Escherichia coli α2M (ECAM) is a ∼ 180-kDa multidomain membrane-anchored pan-peptidase inhibitor, which is cleaved by host endopeptidases in an accessible bait region. Structural studies by electron microscopy and crystallography reveal that this cleavage causes major structural rearrangement of more than half the 13-domain structure from a native to a compact induced form. It also exposes a reactive thioester bond, which covalently traps the peptidase. Subsequently, peptidase-laden ECAM is shed from the membrane and may dimerize. Trapped peptidases are still active except against very large substrates, so inhibition potentially prevents damage of large cell envelope components, but not host digestion. Mechanistically, these results document a novel monomeric "snap trap."

  15. Human α2-macroglobulin is composed of multiple domains, as predicted by homology with complement component C3

    PubMed Central

    Doan, Ninh; Gettins, Peter G. W.

    2007-01-01

    Human α2M2-macroglobulin) and the complement components C3 and C4 are thiol ester-containing proteins that evolved from the same ancestral gene. The recent structure determination of human C3 has allowed a detailed prediction of the location of domains within human α2M to be made. We describe here the expression and characterization of three α2M domains predicted to be involved in the stabilization of the thiol ester in native α2M and in its activation upon bait region proteolysis. The three newly expressed domains are MG2 (macroglobulin domain 2), TED (thiol ester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domain. Together with the previously characterized RBD (receptor-binding domain), they represent approx. 42% of the α2M polypeptide. Their expression as folded domains strongly supports the predicted domain organization of α2M. An X-ray crystal structure of MG2 shows it to have a fibronectin type-3 fold analogous to MG1–MG8 of C3. TED is, as predicted, an α-helical domain. CUB is a spliced domain composed of two stretches of polypeptide that flank TED in the primary structure. In intact C3 TED interacts with RBD, where it is in direct contact with the thiol ester, and with MG2 and CUB on opposite, flanking sides. In contrast, these α2M domains, as isolated species, show negligible interaction with one another, suggesting that the native conformation of α2M, and the consequent thiol ester-stabilizing domain–domain interactions, result from additional restraints imposed by the physical linkage of these domains or by additional domains in the protein. PMID:17608619

  16. Activated α2-Macroglobulin Binding to Human Prostate Cancer Cells Triggers Insulin-like Responses

    PubMed Central

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-01-01

    Ligation of cell surface GRP78 by activated α2-macroglobulin2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2–3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2–3-fold increase in lipogenesis as determined by 6-[14C]glucose or 1-[14C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [14CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  17. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment.

    PubMed

    Fyfe, Cameron D; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W; Cogdell, Richard J; Wall, Daniel M; Burchmore, Richard J S; Byron, Olwyn; Walker, Daniel

    2015-07-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  18. Hepcidin Bound to α2-Macroglobulin Reduces Ferroportin-1 Expression and Enhances Its Activity at Reducing Serum Iron Levels

    PubMed Central

    Huang, Michael Li-Hsuan; Austin, Christopher J. D.; Sari, Marie-Agnès; Suryo Rahmanto, Yohan; Ponka, Prem; Vyoral, Daniel; Richardson, Des R.

    2013-01-01

    Hepcidin regulates iron metabolism by down-regulating ferroportin-1 (Fpn1). We demonstrated that hepcidin is complexed to the blood transport protein, α2-macroglobulin2M) (Peslova, G., Petrak, J., Kuzelova, K., Hrdy, I., Halada, P., Kuchel, P. W., Soe-Lin, S., Ponka, P., Sutak, R., Becker, E., Huang, M. L., Suryo Rahmanto, Y., Richardson, D. R., and Vyoral, D. (2009) Blood 113, 6225–6236). However, nothing is known about the mechanism of hepcidin binding to α2M or the effects of the α2M·hepcidin complex in vivo. We show that decreased Fpn1 expression can be mediated by hepcidin bound to native α2M and also, for the first time, hepcidin bound to methylamine-activated α2M2M-MA). Passage of high molecular weight α2M·hepcidin or α2M-MA·hepcidin complexes (≈725 kDa) through a Sephadex G-25 size exclusion column retained their ability to decrease Fpn1 expression. Further studies using ultrafiltration indicated that hepcidin binding to α2M and α2M-MA was labile, resulting in some release from the protein, and this may explain its urinary excretion. To determine whether α2M-MA·hepcidin is delivered to cells via the α2M receptor (Lrp1), we assessed α2M uptake and Fpn1 expression in Lrp1−/− and Lrp1+/+ cells. Interestingly, α2M·hepcidin or α2M-MA·hepcidin demonstrated similar activities at decreasing Fpn1 expression in Lrp1−/− and Lrp1+/+ cells, indicating that Lrp1 is not essential for Fpn1 regulation. In vivo, hepcidin bound to α2M or α2M-MA did not affect plasma clearance of α2M2M-MA. However, serum iron levels were reduced to a significantly greater extent in mice treated with α2M·hepcidin or α2M-MA·hepcidin relative to unbound hepcidin. This effect could be mediated by the ability of α2M or α2M-MA to retard kidney filtration of bound hepcidin, increasing its half-life. A model is proposed that suggests that unlike proteases, which are irreversibly bound to activated α2M, hepcidin remains labile and available to down

  19. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  20. α-2-Macroglobulin in Saliva Is Associated with Glycemic Control in Patients with Type 2 Diabetes Mellitus

    PubMed Central

    Aitken, Juan Pablo; Ortiz, Carolina; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Baeza, Mauricio; Beltran, Caroll

    2015-01-01

    Background. Subjects with type 2 diabetes mellitus (DM2) require an adequate glycemic control to avoid diabetic complications. Currently, saliva biomarkers are used as a diagnostic tool and can be indicative of the degree of progression and control of various diseases. Several studies indicate that α-2-macroglobulin levels are elevated in diabetic patients. Methods. 120 subjects with DM2 were enrolled and classified into two groups according to their glycemic control (percentage of glycated hemoglobin-A1c (HbA1c), <7% adequate glycemic control group; >7% inadequate glycemic control group). The relationship between α-2-macroglobulin levels from saliva samples and HbA1c was subsequently evaluated. Results. We found a positive correlation between α-2-macroglobulin and HbA1c (r = 0.778 and P < 0.0001). Area under the receivers operating characteristic (ROC) curve of α-2-macroglobulin indicated a positive discrimination threshold of α-2-macroglobulin (AUC = 0.903, CI 95%: 0.847–0.959, P < 0.0001) to diagnose glycemic control. Conclusions. Our data strongly suggest that the level of saliva α-2-macroglobulin is an indicator for the degree of glycemic control in diabetic patients and represents a promising alternative method to evaluate this parameter. PMID:25821337

  1. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  2. Purification of α2-macroglobulin from Cohn Fraction IV by immobilized metal affinity chromatography: A promising method for the better utilization of plasma.

    PubMed

    Huangfu, Chaoji; Ma, Yuyuan; Lv, Maomin; Jia, Junting; Zhao, Xiong; Zhang, Jingang

    2016-07-01

    As an abundant plasma protein, α2-macroglobulin2-M) participates widely in physiological and pathological activities including coagulation regulation, antitumor activities, and regulation of cytokines. It also presents a therapeutic potential for radiation injury. A two-step isolation method for the purification of α2-M from Cohn Fraction IV is described. This process includes a salting-out method and immobilized metal affinity chromatography. The LC-ESI-MS/MS analysis and a comparison of the amino acid composition demonstrated that the final product was α2-M. The final protein, with a purity of approximately 95% and a yield of nearly 45%, was obtained from Cohn Fraction IV regardless of plasma haptoglobin type, although all but type 1-1 have previously been considered unfavorable for α2-M preparation. The effects of temperature, pH, and methylamine on α2-M activity were evaluated to avoid activity loss during preparation and preservation. The results suggested that α2-M activity could be readily inactivated at temperatures above 50°C, at pH levels above 9.0 or below 4.0, or in the presence of methylamine. Cohn Fraction IV is usually discarded as a biological waste product in the human serum albumin production process; because the simple process developed in this study is relatively inexpensive, the preparation of α2-M from Cohn Fraction IV may better utilize human plasma, a valuable resource. PMID:27214605

  3. Inhibition of Aeromonas sobria serine protease (ASP) by α2-macroglobulin.

    PubMed

    Murakami, Yoji; Wada, Yoshihiro; Kobayashi, Hidetomo; Irie, Atsushi; Hasegawa, Makoto; Yamanaka, Hiroyasu; Okamoto, Keinosuke; Eto, Masatoshi; Imamura, Takahisa

    2012-10-01

    ASP is a serine protease secreted by Aeromonas sobria. ASP cleaves various plasma proteins, which is associated with onset of sepsis complications, such as shock and blood coagulation disorder. To investigate a host defense mechanism against this virulence factor, we examined the plasma for ASP inhibitor(s). Human plasma inhibited ASP activity for azocasein, which was almost completely abolished by treating plasma with methylamine, which inactivates α2-macroglobulin (α2-MG). The ASP-inhibitor complex in ASP-added plasma was not detected by immunoblotting using anti-ASP antibody; however, using gel filtration of the plasma ASP activity for an oligopeptide, the ASP substrate was eluted in the void fraction (Mw>200 000), suggesting ASP trapping by α2-MG. Indeed, human α2-MG inhibited ASP azocaseinolytic activity in a dose-dependent manner, rapidly forming a complex with the ASP. Fibrinogen degradation by ASP was completely inhibited in the presence of α2-MG. α1-Protease inhibitor, antithrombin, and α2-plasmin inhibitor neither inhibited ASP activity nor formed a complex with ASP. Surprisingly, ASP degraded these plasma serine protease inhibitors. Thus, α2-MG is the major ASP inhibitor in the human plasma and can limit ASP virulence activities in A. sobria infection sites. However, as shown by fluorescence correlation spectroscopy, slow ASP inhibition by α2-MG in plasma may indicate insufficient ASP control in vivo.

  4. α2-Macroglobulin Can Crosslink Multiple Plasmodium falciparum Erythrocyte Membrane Protein 1 (PfEMP1) Molecules and May Facilitate Adhesion of Parasitized Erythrocytes.

    PubMed

    Stevenson, Liz; Laursen, Erik; Cowan, Graeme J; Bandoh, Betty; Barfod, Lea; Cavanagh, David R; Andersen, Gregers R; Hviid, Lars

    2015-07-01

    Rosetting, the adhesion of Plasmodium falciparum-infected erythrocytes to uninfected erythrocytes, involves clonal variants of the parasite protein P. falciparum erythrocyte membrane protein 1 (PfEMP1) and soluble serum factors. While rosetting is a well-known phenotypic marker of parasites associated with severe malaria, the reason for this association remains unclear, as do the molecular details of the interaction between the infected erythrocyte (IE) and the adhering erythrocytes. Here, we identify for the first time a single serum factor, the abundant serum protease inhibitor α2-macroglobulin2M), which is both required and sufficient for rosetting mediated by the PfEMP1 protein HB3VAR06 and some other rosette-mediating PfEMP1 proteins. We map the α2M binding site to the C terminal end of HB3VAR06, and demonstrate that α2M can bind at least four HB3VAR06 proteins, plausibly augmenting their combined avidity for host receptors. IgM has previously been identified as a rosette-facilitating soluble factor that acts in a similar way, but it cannot induce rosetting on its own. This is in contrast to α2M and probably due to the more limited cross-linking potential of IgM. Nevertheless, we show that IgM works synergistically with α2M and markedly lowers the concentration of α2M required for rosetting. Finally, HB3VAR06+ IEs share the capacity to bind α2M with subsets of genotypically distinct P. falciparum isolates forming rosettes in vitro and of patient parasite isolates ex vivo. Together, our results are evidence that P. falciparum parasites exploit α2M (and IgM) to expand the repertoire of host receptors available for PfEMP1-mediated IE adhesion, such as the erythrocyte carbohydrate moieties that lead to formation of rosettes. It is likely that this mechanism also affects IE adhesion to receptors on vascular endothelium. The study opens opportunities for broad-ranging immunological interventions targeting the α2M--(and IgM-) binding domains of PfEMP1

  5. Analysis of serum β-amyloid peptides, α2-macroglobulin, complement factor H, and clusterin levels in APP/PS1 transgenic mice during progression of Alzheimer's disease.

    PubMed

    Wang, Dejiang; Di, Xiangjun; Fu, Lu; Li, Yingnan; Han, Xiao; Wu, Hui; Cai, Linjun; Meng, Xiangyu; Jiang, Chunlai; Kong, Wei; Su, Weiheng

    2016-10-19

    As a progressive age-related neurodegenerative disorder, Alzheimer's disease (AD) is a global health concern. Despite the availability of psychological testing, neuroimaging, genetic testing, and biochemical assays of cerebrospinal fluid, convenient and accurate blood biomarkers for the prediction, diagnosis, and preclinical studies of AD are still lacking. The present study aims to longitudinally evaluate the feasibility of β-amyloid proteins, α2-macroglobulin (α-2M), complement factor H (CFH), and clusterin as blood biomarkers of AD. Using APP/PS1 transgenic and wild-type mice, cognitive impairment and amyloid plaque counts in the brain were evaluated over a range of ages using the Morris water maze test and immunohistochemistry methods, respectively. Serum Aβ40, Aβ42, α-2M, CFH, and clusterin levels were measured by enzyme-linked immunosorbent assay and correlated with progression of AD. APP/PS1 transgenic mice presented progressive AD characteristics at the ages of 3, 6, 9, and 12 months. Serum Aβ42 levels and Aβ42/Aβ40 ratios increased significantly in transgenic 3- and 6-month-old mice compared with controls. Serum CFH levels decreased significantly in 3- and 6-month-old transgenic mice compared with controls. Meanwhile, serum clusterin levels increased significantly in 12-month-old transgenic mice compared with controls. The α-2M level was not significantly different between transgenic and wild-type mice. The APP/PS1 transgenic mouse is a model of familial AD. The present study indicated that the serum Aβ42 level, Aβ42/Aβ40 ratio, and CFH level are potential biomarkers in preclinical and early stages of AD, whereas serum clusterin level is a potential biomarker in the late stage of AD. PMID:27541273

  6. 17{alpha}-Estradiol arrests cell cycle progression at G{sub 2}/M and induces apoptotic cell death in human acute leukemia Jurkat T cells

    SciTech Connect

    Jun, Do Youn; Park, Hae Sun; Kim, Jun Seok; Kim, Jong Sik; Park, Wan; Song, Bang Ho; Kim, Hee-Sook; Taub, Dennis; Kim, Young Ho

    2008-09-15

    A pharmacological dose (2.5-10 {mu}M) of 17{alpha}-estradiol (17{alpha}-E{sub 2}) exerted a cytotoxic effect on human leukemias Jurkat T and U937 cells, which was not suppressed by the estrogen receptor (ER) antagonist ICI 182,780. Along with cytotoxicity in Jurkat T cells, several apoptotic events including mitochondrial cytochrome c release, activation of caspase-9, -3, and -8, PARP degradation, and DNA fragmentation were induced. The cytotoxicity of 17{alpha}-E{sub 2} was not blocked by the anti-Fas neutralizing antibody ZB-4. While undergoing apoptosis, there was a remarkable accumulation of G{sub 2}/M cells with the upregulatoin of cdc2 kinase activity, which was reflected in the Thr56 phosphorylation of Bcl-2. Dephosphorylation at Tyr15 and phosphorylation at Thr161 of cdc2, and significant increase in the cyclin B1 level were underlying factors for the cdc2 kinase activation. Whereas the 17{alpha}-E{sub 2}-induced apoptosis was completely abrogated by overexpression of Bcl-2 or by pretreatment with the pan-caspase inhibitor z-VAD-fmk, the accumulation of G{sub 2}/M cells significantly increased. The caspase-8 inhibitor z-IETD-fmk failed to influence 17{alpha}-E{sub 2}-mediated caspase-9 activation, but it markedly reduced caspase-3 activation and PARP degradation with the suppression of apoptosis, indicating the contribution of caspase-8; not as an upstream event of the mitochondrial cytochrome c release, but to caspase-3 activation. In the presence of hydroxyurea, which blocked the cell cycle progression at the G{sub 1}/S boundary, 17{alpha}-E{sub 2} failed to induce the G{sub 2}/M arrest as well as apoptosis. These results demonstrate that the cytotoxicity of 17{alpha}-E{sub 2} toward Jurkat T cells is attributable to apoptosis mainly induced in G{sub 2}/M-arrested cells, in an ER-independent manner, via a mitochondria-dependent caspase pathway regulated by Bcl-2.

  7. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  8. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  9. Role of zinc and α2macroglobulin on thymic endocrine activity and on peripheral immune efficiency (natural killer activity and interleukin 2) in cervical carcinoma

    PubMed Central

    Mocchegiani, E; Ciavattini, A; Santarelli, L; Tibaldi, A; Muzzioli, M; Bonazzi, P; Giacconi, R; Fabris, N; Garzetti, G G

    1999-01-01

    Decreased natural killer (NK) activity as well as interleukin 2 (IL-2) are risk factors for the progression of cervical carcinoma. NK activity and IL-2 may be thymus controlled. Plasma levels of active thymulin, a zinc-dependent thymic hormone (ZnFTS), are reduced in cancer because of the low peripheral zinc bioavailability. Zinc and thymulin are relevant for normal immune functions. α2-Macroglobulin is an inhibitor of matrix metalloproteases (MMPs) against invasive tumour proliferation. Because α2-macroglobulin has a binding affinity (Kd) for zinc that is higher than does thymulin, it may play a key role in immune efficiency in cancer. Plasma samples of 22 patients (age range 35–60 years) with locally advanced squamous cervical carcinoma and with FIGO stage Ib2–IIb were examined. They showed reduced active thymulin, decreased NK activity and IL-2 production, increased soluble IL-2 receptor (sIL-2R) and augmented α2-macroglobulin in the circulation, whereas plasma zinc levels were within the normal range for age. Significant positive correlations were found between zinc or active thymulin and α2-macroglobulin (r = 0.75, P< 0.01, r = 0.78, P< 0.01, respectively) in cancer patients. In vitro zinc increases IL-2 production from peripheral blood mononuclear cells (PBMCs) of cancer patients. These data suggest that an increase in α2-macroglobulin, which competes with thymulin for zinc binding, may be involved in causing a thymulin deficit with a consequent decrease of IL-2 and NK cytotoxicity. Thus, physiological zinc treatment in cervical carcinoma maybe restores impaired central and peripheral immune efficiency. © 1999 Cancer Research Campaign PMID:9888464

  10. Mouse alpha-macroglobulin. Structure, function and a molecular model.

    PubMed Central

    Hudson, N W; Kehoe, J M; Koo, P H

    1987-01-01

    Mouse alpha-macroglobulin (M-AMG) is believed to be a functional homologue of human alpha 2-macroglobulin (h-alpha 2M). The subunit composition, the tryptic cleavage pattern before and after methylamine incorporation and the two-dimensional tryptic-peptide mapping, however, indicate that these two proteins are structurally distinct. M-AMG is composed of two major types of polypeptides (Mr 163,000 and 35,000) together with a minor polypeptide (Mr 185,000), whereas h-alpha 2M has only one type of polypeptide (Mr 185,000). After incorporation of methylamine, there is no change in the normal tryptic-cleavage pattern of M-AMG; however, tryptic cleavage of h-alpha 2M is severely retarded [Hudson & Koo (1982) Biochim. Biophys. Acta 704, 290-303]. The N-terminal sequence of the 163,000-Mr polypeptide of M-AMG shows sequence homology with the N-terminal sequence of h-alpha 2M. The amino acid compositions of M-AMG and its two major polypeptide chains are compared. Thermal fragmentation studies show that the 163,000-Mr polypeptide is broken down into 125,000-Mr and 29,000-Mr fragments. Trypsin-binding studies show that M-AMG can bind two molecules of trypsin/molecule. Inactivations of the trypsin-binding property of M-AMG and h-alpha 2M with methylamine show similar kinetics of inhibition at 4 degrees C. A structural model of M-AMG is proposed, based on accumulated data. Images Fig. 3. PMID:2449173

  11. New member of the trefoil factor family of proteins is an alpha-macroglobulin protease inhibitor.

    PubMed

    Thøgersen, Ida B; Hammes, Stephen R; Rubenstein, David S; Pizzo, Salvatore V; Valnickova, Zuzana; Enghild, Jan J

    2002-07-29

    The amino acid sequence of the monomeric alpha-macroglobulin (alphaM) from the American bullfrog, Rana catesbiana, was determined. The mature protein consisted of 1469 amino acid residues and shared sequence identity with other members of the alphaM family of protein. The central portion of the frog monomeric alphaM contained Cys residues positioned analogously to the Cys residues in human alpha(2)-macroglobulin (alpha(2)M), known to be involved in disulfide bridges. Additionally, the frog monomeric alphaM contained six Cys residues in a approximately 60 residue COOH-terminal extension not present in previously characterized alphaMs. The spacing of the Cys residues and the overall sequence identity of this COOH-terminal extension were consistent with a trefoil motif. This is the first time a member of the trefoil factor family has been identified in the circulatory system. The "bait region" was located between Arg(675)-Lys(685) and contained mainly basic amino acid residues. The COOH-terminal receptor-binding domain was not exposed prior to proteolysis of this highly susceptible region. The proximity of the receptor-binding and trefoil domains implied that the trefoil domain is similarly concealed before bait region cleavage. PMID:12147353

  12. A formal power series expansion-regularization approach for Lévy stable distributions: the symmetric case with \\alpha =2/M (M positive integer)

    NASA Astrophysics Data System (ADS)

    Crisanto-Neto, J. C.; da Luz, M. G. E.; Raposo, E. P.; Viswanathan, G. M.

    2016-09-01

    In practice, the Lévy α-stable distribution is usually expressed in terms of the Fourier integral of its characteristic function. Indeed, known closed form expressions are relatively scarce given the huge parameters space: 0\\lt α ≤slant 2 ({{L\\'{e}vy}} {{index}}), -1≤slant β ≤slant 1 ({{skewness}}),σ \\gt 0 ({{scale}}), and -∞ \\lt μ \\lt ∞ ({{shift}}). Hence, systematic efforts have been made towards the development of proper methods for analytically solving the mentioned integral. As a further contribution in this direction, here we propose a new way to tackle the problem. We consider an approach in which one first solves the Fourier integral through a formal (thus not necessarily convergent) series representation. Then, one uses (if necessary) a pertinent sum-regularization procedure to the resulting divergent series, so as to obtain an exact formula for the distribution, which is amenable to direct numerical calculations. As a concrete study, we address the centered, symmetric, unshifted and unscaled distribution (β =0, μ =0, σ =1), with α ={α }M=2/M, M=1,2,3\\ldots . Conceivably, the present protocol could be applied to other sets of parameter values.

  13. A formal power series expansion–regularization approach for Lévy stable distributions: the symmetric case with \\alpha =2/M (M positive integer)

    NASA Astrophysics Data System (ADS)

    Crisanto-Neto, J. C.; da Luz, M. G. E.; Raposo, E. P.; Viswanathan, G. M.

    2016-09-01

    In practice, the Lévy α-stable distribution is usually expressed in terms of the Fourier integral of its characteristic function. Indeed, known closed form expressions are relatively scarce given the huge parameters space: 0\\lt α ≤slant 2 ({{L\\'{e}vy}} {{index}}), -1≤slant β ≤slant 1 ({{skewness}}),σ \\gt 0 ({{scale}}), and -∞ \\lt μ \\lt ∞ ({{shift}}). Hence, systematic efforts have been made towards the development of proper methods for analytically solving the mentioned integral. As a further contribution in this direction, here we propose a new way to tackle the problem. We consider an approach in which one first solves the Fourier integral through a formal (thus not necessarily convergent) series representation. Then, one uses (if necessary) a pertinent sum-regularization procedure to the resulting divergent series, so as to obtain an exact formula for the distribution, which is amenable to direct numerical calculations. As a concrete study, we address the centered, symmetric, unshifted and unscaled distribution (β =0, μ =0, σ =1), with α ={α }M=2/M, M=1,2,3\\ldots . Conceivably, the present protocol could be applied to other sets of parameter values.

  14. Effects of a recombinant complement component C3b functional fragment α2MR (α2-macroglobulin receptor) additive on the immune response of juvenile orange-spotted grouper (Epinephelus coioides) after the exposure to cold shock challenge.

    PubMed

    Luo, Sheng-Wei; Cai, Luo; Qi, Zeng-Hua; Wang, Cong; Liu, Yuan; Wang, Wei-Na

    2015-08-01

    The effects of Ec-α2MR (Epinephelus coiodes-α2-macroglobulin receptor) on growth performance, enzymatic activity, respiratory burst, MDA level, total antioxidant capacity, DPPH radical scavenging percentage and immune-related gene expressions of the juvenile orange-spotted grouper were evaluated. The commercial diet supplemented with α2MR additive was used to feed the orange-spotted grouper for six weeks. Although a slight increase was observed in the specific growth rate, survival rate and weight gain, no significance was observed among different group. After the feeding trial, the groupers were exposed to cold stress. Respiratory burst activity and MDA level decreased significantly in α2MR additive group by comparing with the control and additive control group, while a sharp increase of ACP activity, ALP activity, total antioxidant capacity and DPPH radial scavenging percentage was observed in α2MR additive group. qRT-PCR analyses confirmed that the up-regulated mRNA expressions of C3, TNF1, TNF2, IL-6, CTL, LysC, SOD1 and SOD2 were observed in α2MR additive group at 20 °C. These results showed that α2MR additive may moderate the immune response in grouper following cold shock challenge. PMID:25917969

  15. Effects of a recombinant complement component C3b functional fragment α2MR (α2-macroglobulin receptor) additive on the immune response of juvenile orange-spotted grouper (Epinephelus coioides) after the exposure to cold shock challenge.

    PubMed

    Luo, Sheng-Wei; Cai, Luo; Qi, Zeng-Hua; Wang, Cong; Liu, Yuan; Wang, Wei-Na

    2015-08-01

    The effects of Ec-α2MR (Epinephelus coiodes-α2-macroglobulin receptor) on growth performance, enzymatic activity, respiratory burst, MDA level, total antioxidant capacity, DPPH radical scavenging percentage and immune-related gene expressions of the juvenile orange-spotted grouper were evaluated. The commercial diet supplemented with α2MR additive was used to feed the orange-spotted grouper for six weeks. Although a slight increase was observed in the specific growth rate, survival rate and weight gain, no significance was observed among different group. After the feeding trial, the groupers were exposed to cold stress. Respiratory burst activity and MDA level decreased significantly in α2MR additive group by comparing with the control and additive control group, while a sharp increase of ACP activity, ALP activity, total antioxidant capacity and DPPH radial scavenging percentage was observed in α2MR additive group. qRT-PCR analyses confirmed that the up-regulated mRNA expressions of C3, TNF1, TNF2, IL-6, CTL, LysC, SOD1 and SOD2 were observed in α2MR additive group at 20 °C. These results showed that α2MR additive may moderate the immune response in grouper following cold shock challenge.

  16. Alpha-santalol, a chemopreventive agent against skin cancer, causes G2/M cell cycle arrest in both p53-mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells

    PubMed Central

    2010-01-01

    Background α-Santalol, an active component of sandalwood oil, has shown chemopreventive effects on skin cancer in different murine models. However, effects of α-santalol on cell cycle have not been studied. Thus, the objective of this study was to investigate effects of α-santalol on cell cycle progression in both p53 mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells to elucidate the mechanism(s) of action. Methods MTT assay was used to determine cell viability in A431 cells and UACC-62; fluorescence-activated cell sorting (FACS) analysis of propidium iodide staining was used for determining cell cycle distribution in A431 cells and UACC-62 cells; immunoblotting was used for determining the expression of various proteins and protein complexes involved in the cell cycle progression; siRNA were used to knockdown of p21 or p53 in A431 and UACC-62 cells and immunofluorescence microscopy was used to investigate microtubules in UACC-62 cells. Results α-Santalol at 50-100 μM decreased cell viability from 24 h treatment and α-santalol at 50 μM-75 μM induced G2/M phase cell cycle arrest from 6 h treatment in both A431 and UACC-62 cells. α-Santalol altered expressions of cell cycle proteins such as cyclin A, cyclin B1, Cdc2, Cdc25c, p-Cdc25c and Cdk2. All of these proteins are critical for G2/M transition. α-Santalol treatment up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells; whereas, α-santalol treatment increased expressions of wild-type p53 in UACC-62 cells. Knockdown of p21 in A431 cells, knockdown of p21 and p53 in UACC-62 cells did not affect cell cycle arrest caused by α-santalol. Furthermore, α-santalol caused depolymerization of microtubules similar to vinblastine in UACC-62 cells. Conclusions This study for the first time identifies effects of α-santalol in G2/M phase arrest and describes detailed mechanisms of G2/M phase arrest by this agent, which might be

  17. Plasma energy balance in the L-2M stellarator

    SciTech Connect

    Fedyanin, O. I.; Akulina, D. K.; Batanov, G. M.; Berezhetskii, M. S.; Vasil'kov, D. G.; Vafin, I. Yu.; Voronov, G. S.; Voronova, E. V.; Gladkov, G. A.; Grebenshchikov, S. E.; Kovrizhnykh, L. M.; Larionova, N. F.; Letunov, A. A.; Logvinenko, V. P.; Malykh, N. I.; Meshcheryakov, A. I.; Nechaev, Yu. I.; Sarksyan, K. A.; Skvortsova, N. N.; Shchepetov, S. V.

    2007-10-15

    Results are presented from studies of the effect of the discharge parameters (in particular, plasma density and heating power) and the characteristics of the magnetic configuration (e.g., rotational transform) on the confinement of a low-pressure plasma during electron-cyclotron resonance heating in the L-2M stellarator. An analysis shows that the plasma energy in the steady-state phase of a discharge is fairly well described by the product of power functions of the plasma density, heating power, and rotational transform: W = W{sub 0} n{sub e}{sup {alpha}{sub n}P{alpha}{sub p}{iota}{alpha}{sub {iota}}}. The energy scalings constructed in terms of the parameters in the initial stage of free plasma decay and those in the steady-state phase are close to one another. The dynamic analysis of the plasma energy decay is now under way.

  18. Present and Future of M2M

    NASA Astrophysics Data System (ADS)

    Ono, Satoru; Watanabe, Takashi

    In recent years, the rapid progress in the development of hardware and software technologies enables tiny and low cost information devices hereinafter referred to as Machine to be widely available. M2M (Machine to Machine) has been of much attention where many tiny machines are connected to each other through networks with minimal human intervention to provide smooth and intelligent management. M2M is a promising core technology providing timely, flexible, efficient and comprehensive service at low cost. M2M has wide variety of applications including energy management system, environmental monitoring system, intelligent transport system, industrial automation system and other applications. M2M consists of terminals and networks that connect them. In this paper, we mainly focus on M2M networking and mention the future direction of the technology.

  19. Taming the 1.2 m Telescope

    NASA Astrophysics Data System (ADS)

    Griffin, S.; Edwards, M.; Greenwald, D.; Kono, D.; Liang, D.; Lohnes, K.; Wright, V.; Spillar, E.

    2013-09-01

    Achievable residual jitter on the 1.2 m telescope at MSSS shown in Figure 1 has historically been limited to 10-20 arc-sec. peak in moderate wind conditions due to the combination of the dynamics associated with the twin telescopes on the common declination axis shaft, and the related control system behavior. Figure 1 1.2 m Telescope The lightly damped, low frequency fundamental vibration mode shape of the telescopes rotating out of phase on the common declination axis shaft severely degraded the performance of the prior controllers. This vibration mode is easily excited by external forces such as wind loading and internal torque commands from the mount control system. The relatively poor historic performance was due to a combination of the low error rejection of external disturbances, and the controller exciting the mode. A radical new approach has been implemented that has resulted in a decrease of jitter to less than 1 arcsec under most conditions. The new approach includes minor hardware modifications to provide active damping with accelerometers as feedback sensors. This architecture has allowed a bandwidth increase of almost an order of magnitude and eliminated the large amplitude motions at the mode natural frequency, resulting in much improved pointing and jitter performance. A representative comparison of historical versus new architecture performance is shown in Figure 2 for the declination axis.

  20. Development of 2 m×2 m size glass RPCs for INO

    NASA Astrophysics Data System (ADS)

    Bhuyan, M.; Datar, V. M.; Kalmani, S. D.; Lahamge, S. M.; Mohammed, S.; Mondal, N. K.; Nagaraj, P.; Redij, A.; Samuel, D.; Saraf, M. N.; Satyanarayana, B.; Shinde, R. R.; Verma, P.

    2012-01-01

    The India-based Neutrino Observatory (INO) collaboration is planning to build a massive 50 kt magnetised iron calorimeter (ICAL) detector to study atmospheric neutrinos and to precisely determine the neutrino oscillation parameters. About 30,000 2 m×2 m size glass Resistive Plate Chambers (RPCs) will be used as active detector elements in ICAL. Starting with a small 30 cm ×30 cm size RPCs, we have now succeeded in developing full size 2 m ×2 m RPCs. The fabrication procedures used for these large size RPCs as well as their performance will be discussed in this paper. We will also present some preliminary results from our studies on SF6 based gas mixtures on the RPC operation and characteristics.

  1. Kinetics of the reaction HO2 + NO2 + M yields HO2NO2 + M

    NASA Technical Reports Server (NTRS)

    Sander, S. P.; Peterson, M. E.

    1984-01-01

    The flash photolysis/ultraviolet absorption technique was used to measure the rate constants for the reaction HO2 + NO2 + M yields HO2NO2 + M over the pressure range 50-700 torr and temperature range 229-362 K using He, O2, and N2 as diluent gases. The data were fit to the expression derived by Troe (1979) and co-workers for describing the pressure and temperature dependence of reactions in the falloff region. By combining these data with recent measurements of the rate constant for HO2NO2 thermal decomposition values of 73.8 + or - 2 eu for the standard entropy and -12.6 + or - kcal/mol for the standard enthalpy of formation of HO2NO2 were obtained. A significant enhancement in the rate constant was observed when water vapor was added to the system.

  2. Identification of monomeric alpha-macroglobulin proteinase inhibitors in birds, reptiles, amphibians and mammals, and purification and characterization of a monomeric alpha-macroglobulin proteinase inhibitor from the American bullfrog Rana catesbeiana.

    PubMed Central

    Rubenstein, D S; Thøgersen, I B; Pizzo, S V; Enghild, J J

    1993-01-01

    The alpha-macroglobulins are classified as broad-spectrum inhibitors because of their ability to entrap proteinases of different specificities and catalytic class. Tetrameric and dimeric alpha-macroglobulins have been identified in a wide variety of organisms including those as primitive as the mollusc Octopus vulgaris; however, monomeric alpha-macroglobulin proteinase inhibitors have been previously identified only in rodents. The monomeric alpha-macroglobulin proteinase inhibitors are believed to be analogous to the evolutionary precursor of the multimeric members of this family exemplified by the tetrameric human alpha 2-macroglobulin. Until now, monomeric alpha-macroglobulin proteinase inhibitors have only been identified in rodents and have therefore been considered an evolutionary anomaly. However, in this report we have utilized several sensitive assays to screen various plasmas and sera for the presence of monomeric alpha-macroglobulins, and our results suggest that monomeric alpha-macroglobulin proteinase inhibitors are present in organisms belonging to the avian, reptilian, amphibian and mammalian classes of the chordate phylum. This indicates that these proteins are more widespread than previously recognized and that their presence in rodents is not an anomaly. To demonstrate further that the identified proteins were indeed monomeric alpha-macroglobulin proteinase inhibitors, we purified the monomeric alpha-macroglobulin from the American bullfrog Rana catesbeiana. We conclude that this protein is a monomer of 180 kDa on the basis of its behaviour on (i) pore-limit gel electrophoresis, (ii) non-reducing and reducing SDS/PAGE and (iii) gel-filtration chromatography. In addition, we demonstrate that this protein is an alpha-macroglobulin proteinase inhibitor by virtue of (i) its ability to inhibit proteinases of different catalytic class, (ii) the presence of a putative internal beta-cysteinyl-gamma-glutamyl thioester and (iii) an inhibitory mechanism

  3. Identification of monomeric alpha-macroglobulin proteinase inhibitors in birds, reptiles, amphibians and mammals, and purification and characterization of a monomeric alpha-macroglobulin proteinase inhibitor from the American bullfrog Rana catesbeiana.

    PubMed

    Rubenstein, D S; Thøgersen, I B; Pizzo, S V; Enghild, J J

    1993-02-15

    The alpha-macroglobulins are classified as broad-spectrum inhibitors because of their ability to entrap proteinases of different specificities and catalytic class. Tetrameric and dimeric alpha-macroglobulins have been identified in a wide variety of organisms including those as primitive as the mollusc Octopus vulgaris; however, monomeric alpha-macroglobulin proteinase inhibitors have been previously identified only in rodents. The monomeric alpha-macroglobulin proteinase inhibitors are believed to be analogous to the evolutionary precursor of the multimeric members of this family exemplified by the tetrameric human alpha 2-macroglobulin. Until now, monomeric alpha-macroglobulin proteinase inhibitors have only been identified in rodents and have therefore been considered an evolutionary anomaly. However, in this report we have utilized several sensitive assays to screen various plasmas and sera for the presence of monomeric alpha-macroglobulins, and our results suggest that monomeric alpha-macroglobulin proteinase inhibitors are present in organisms belonging to the avian, reptilian, amphibian and mammalian classes of the chordate phylum. This indicates that these proteins are more widespread than previously recognized and that their presence in rodents is not an anomaly. To demonstrate further that the identified proteins were indeed monomeric alpha-macroglobulin proteinase inhibitors, we purified the monomeric alpha-macroglobulin from the American bullfrog Rana catesbeiana. We conclude that this protein is a monomer of 180 kDa on the basis of its behaviour on (i) pore-limit gel electrophoresis, (ii) non-reducing and reducing SDS/PAGE and (iii) gel-filtration chromatography. In addition, we demonstrate that this protein is an alpha-macroglobulin proteinase inhibitor by virtue of (i) its ability to inhibit proteinases of different catalytic class, (ii) the presence of a putative internal beta-cysteinyl-gamma-glutamyl thioester and (iii) an inhibitory mechanism

  4. Ultrasound assisted ambient temperature synthesis of ternary oxide AgMO{sub 2} (M=Fe, Ga)

    SciTech Connect

    Nagarajan, R.; Tomar, Nobel

    2009-06-15

    The application of ultrasound for the synthesis of ternary oxide AgMO{sub 2} (M=Fe, Ga) was investigated. Crystalline alpha-AgFeO{sub 2} was obtained from the alkaline solutions of silver and iron hydroxides by sonication for 40 minutes. alpha-AgFeO{sub 2} was found to absorb optical radiation in the 300-600 nm range as shown by diffuse reflectance spectroscopy. The Raman spectrum of alpha-AgFeO{sub 2} exhibited two bands at 345 and 638 cm{sup -1}. When beta-NaFeO{sub 2} was sonicated with aqueous silver nitrate solution for 60 minutes, beta-AgFeO{sub 2} possessing orthorhombic structure was obtained as the ion-exchanged product. The Raman spectrum of beta-AgFeO{sub 2} showed four strong bands at 295, 432, 630 and 690 cm{sup -1}. Sonication of beta-NaGaO{sub 2} with aqueous silver nitrate solution for 60 minutes resulted in olive green colored, alpha-AgGaO{sub 2}. The diffuse reflectance spectrum and the EDX analysis confirmed that the ion-exchange through sonication was complete. The Raman spectrum of alpha-AgGaO{sub 2} had weak bands at 471 and 650 cm{sup -1}. - Graphical abstract: The application of ultrasound in the formation of alpha and beta-forms of AgMO{sub 2} (M=Fe, Ga) has been demonstrated.

  5. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  6. [Serum beta 2 microglobulin (beta 2M) following renal transplantation].

    PubMed

    Pacheco-Silva, A; Nishida, S K; Silva, M S; Ramos, O L; Azjen, H; Pereira, A B

    1994-01-01

    Although there was an important improvement in graft and patient survival the last 10 years, graft rejection continues to be a major barrier to the success of renal transplantation. Identification of a laboratory test that could help to diagnose graft rejection would facilitate the management of renal transplanted patients. PURPOSE--To evaluate the utility of monitoring serum beta 2M in recently transplanted patients. METHODS--We daily determined serum beta 2M levels in 20 receptors of renal grafts (10 from living related and 10 from cadaveric donors) and compared them to their clinical and laboratory evolution. RESULTS--Eight patients who presented immediate good renal function following grafting and did not have rejection had a mean serum beta 2M of 3.7 mg/L on the 4th day post transplant. The sensitivity of the test for the diagnosis of acute rejection was 87.5%, but the specificity was only 46%. Patients who presented acute tubular necrosis (ATN) without rejection had a progressive decrease in their serum levels of beta 2M, while their serum creatinine changed as they were dialyzed. In contrast, patients with ATN and concomitance of acute rejection or CSA nephrotoxicity presented elevated beta 2M and creatinine serum levels. CONCLUSION--Daily monitoring of serum beta 2M does not improve the ability to diagnose acute rejection in patients with good renal function. However, serum beta 2M levels seemed to be useful in diagnosing acute rejection or CSA nephrotoxicity in patients with ATN.

  7. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  8. [Serum beta 2 microglobulin (beta 2M) following renal transplantation].

    PubMed

    Pacheco-Silva, A; Nishida, S K; Silva, M S; Ramos, O L; Azjen, H; Pereira, A B

    1994-01-01

    Although there was an important improvement in graft and patient survival the last 10 years, graft rejection continues to be a major barrier to the success of renal transplantation. Identification of a laboratory test that could help to diagnose graft rejection would facilitate the management of renal transplanted patients. PURPOSE--To evaluate the utility of monitoring serum beta 2M in recently transplanted patients. METHODS--We daily determined serum beta 2M levels in 20 receptors of renal grafts (10 from living related and 10 from cadaveric donors) and compared them to their clinical and laboratory evolution. RESULTS--Eight patients who presented immediate good renal function following grafting and did not have rejection had a mean serum beta 2M of 3.7 mg/L on the 4th day post transplant. The sensitivity of the test for the diagnosis of acute rejection was 87.5%, but the specificity was only 46%. Patients who presented acute tubular necrosis (ATN) without rejection had a progressive decrease in their serum levels of beta 2M, while their serum creatinine changed as they were dialyzed. In contrast, patients with ATN and concomitance of acute rejection or CSA nephrotoxicity presented elevated beta 2M and creatinine serum levels. CONCLUSION--Daily monitoring of serum beta 2M does not improve the ability to diagnose acute rejection in patients with good renal function. However, serum beta 2M levels seemed to be useful in diagnosing acute rejection or CSA nephrotoxicity in patients with ATN. PMID:7787867

  9. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  10. CH2M Hill cleared in tunnel explosion case

    SciTech Connect

    Krizan, W.G.; Bradford, H.; Schriener, J.

    1993-09-06

    One of the most critical issues in industry is whether architects and engineers should be held responsible for construction safety on jobsites. The Occupational Safety and Health Administration says yes under certain conditions. But the Occupational Safety and Health Review Commission has overturned one application of that view on appeal in a controversial case. It involves a unit of Denver-based CH2M Hill Cos.'s role as program manager for the Milwaukee Metropolitan Sewerage District (MMSD) on its $2.2-billion water pollution abatement program. On May 5, 1989, OSHA cited CH2M Hill Central Inc. for 46 willful safety violations in connection with a 1988 methane tunnel explosion that killed three supervisors of contractor S.A. Healy Co., Chicago, Healy was charged with 68 violations. Healy encountered methane while boring CT-7, a two-mile crosstown tunnel. It evacuated the site, but didn't follow the evacuation plan. It failed to shut down all nonessential equipment and the supervisors returned after waiting only 17 minutes instead of the one hour minimum. CH2M Hill's citations and proposed $460,000 fine for violating OSHA's construction standards were for having 45 pieces of unapproved electrical equipment in the tunnel and improper ventilation equipment. CH2M Hill claimed the standards did not apply to it because the firm did not engage in construction work, exercise substantial supervision over the construction work performed by the contractor or create or control the hazardous condition.

  11. The ASTRI SST-2M prototype: camera design

    NASA Astrophysics Data System (ADS)

    De Caprio, V.; Belluso, M.; Bonanno, G.; Canestrari, R.; Cascone, E.; Catalano, O.; La Rosa, G.; Pareschi, G.; Rodeghiero, G.; Sottile, G.

    2013-09-01

    ASTRI is an Flagship Project led by the Italian National Institute of Astrophysics, INAF, strictly linked to the development of the ambitious Cherenkov Telescope Array, CTA. Primary goal of the ASTRI project is the design, production, installation and calibration of an end-to-end Small Size Telescope prototype, devoted to the investigation of the highest gamma-ray energy band, from a fraction of TeV up to 100 TeV and beyond. The telescope, named ASTRI SST-2M, is mainly characterized by an optical system in dual-mirror configuration and by a modular camera at the curved focal surface composed of a matrix of Silicon Photo-Multipliers photo-sensors. In this paper we present an overview of the mechanical, thermal and electrical concept design of the camera and of the related technological solutions adopted for the ASTRI SST-2M prototype.

  12. Magnetic configuration flexibility of snowflake divertor for HL-2M [Analysis of snowflake divertor configurations for HL-2M

    SciTech Connect

    Zheng, G. Y.; Xu, X. Q.; Ryutov, D. D.; Pan, Y. D.; Xia, T. Y.

    2014-07-09

    HL-2M (Li, 2013 [1]) is a tokamak device that is under construction. Based on the magnetic coils design of HL-2M, four kinds of divertor configurations are calculated by CORSICA code (Pearlstein et al., 2001 [2]) with the same main plasma parameters, which are standard divertor, exact snowflake divertor, snowflake-plus divertor and snowflake-minus divertor configurations. The potential properties of these divertors are analyzed and presented in this paper: low poloidal field area around X-point, connection length from outside mid-plane to the primary X-point, target plate design and magnetic field shear. The results show that the snowflake configurations not only can reduce the heat load at divertor target plates, but also may improve the magneto-hydrodynamic stability by stronger magnetic shear at the edge. Furthermore, a new divertor configuration, named “tripod divertor”, is designed by adjusting the positions of the two X-points according to plasma parameters and magnetic coils current of HL-2M.

  13. Magnetic configuration flexibility of snowflake divertor for HL-2M [Analysis of snowflake divertor configurations for HL-2M

    DOE PAGES

    Zheng, G. Y.; Xu, X. Q.; Ryutov, D. D.; Pan, Y. D.; Xia, T. Y.

    2014-07-09

    HL-2M (Li, 2013 [1]) is a tokamak device that is under construction. Based on the magnetic coils design of HL-2M, four kinds of divertor configurations are calculated by CORSICA code (Pearlstein et al., 2001 [2]) with the same main plasma parameters, which are standard divertor, exact snowflake divertor, snowflake-plus divertor and snowflake-minus divertor configurations. The potential properties of these divertors are analyzed and presented in this paper: low poloidal field area around X-point, connection length from outside mid-plane to the primary X-point, target plate design and magnetic field shear. The results show that the snowflake configurations not only can reducemore » the heat load at divertor target plates, but also may improve the magneto-hydrodynamic stability by stronger magnetic shear at the edge. Furthermore, a new divertor configuration, named “tripod divertor”, is designed by adjusting the positions of the two X-points according to plasma parameters and magnetic coils current of HL-2M.« less

  14. Remote control of 2.2-m telescope from Garching

    NASA Astrophysics Data System (ADS)

    Raffi, G.; Ziebell, M.

    1986-06-01

    A successful Remote Control (RC) test of the 2.2-m La Silla telescope was performed with CCD detectors during the March 23-29, 1986 period from Garching via a telephone link operated at 9600 baud. Telephone communication and analog image and video frame transmission, in addition to digital data transmission, were possible using a manual switching procedure. Transmission times for a full CCD frame took about 10 minutes, with 7-minute data transfer times for images, and 2.5-minute times for spectroscopic data.

  15. Fatigue crack propagation in carburized X-2M steel

    NASA Astrophysics Data System (ADS)

    Averbach, B. L.; Lou, Bingzhe; Pearson, P. K.; Fairchild, R. E.; Bamberger, E. N.

    1985-07-01

    The growth rates of fatigue cracks propagating through the case and into the core have been studied for carburized X-2M steel (0.14 C, 4.91 Cr, 1.31 Mo, 1.34 W, 0.42 V). Fatigue cracks were propagated at constant stress intensities, ΔK, and also at a constant cyclic peak load, and the crack growth rates were observed to pass through a minimum value as the crack traversed the carburized case. The reduction in the crack propagation rates is ascribed to the compressive stresses which were developed in the case, and a pinched clothespin model is used to make an approximate calculation of the effects of internal stress on the crack propagation rates. We define an effective stress intensity, Ke = Ka + Ki, where Ka is the applied stress intensity, Ki = σid{i/1/2}, σi is the internal stress, and di is a characteristic distance associated with the depth of the internal stress field. In our work, a value of di = 11 mm (0.43 inch) fits the data quite well. A good combination of resistance to fatigue crack propagation in the case and fracture toughness in the core can be achieved in carburized X-2M steel, suggesting that this material will be useful in heavy duty gears and in aircraft gas turbine mainshaft bearings operating under high hoop stresses.

  16. Global magnetohydrodynamic instabilities in the L-2M stellarator

    SciTech Connect

    Mikhailov, M. I.; Shchepetov, S. V.; Nührenberg, C.; Nührenberg, J.

    2015-12-15

    Analysis of global magnetohydrodynamic (MHD) instabilities in the L-2M stellarator (Prokhorov General Physics Institute, Russian Academy of Sciences) is presented. The properties of free-boundary equilibria states are outlined, the stability conditions for small-scale modes are briefly discussed, and the number of trapped particles is estimated. All the magnetic configurations under study are stable against ballooning modes. It is shown that global ideal internal MHD modes can be found reliably only in Mercier unstable plasmas. In plasma that is stable with respect to the Mercier criterion, global unstable modes that are localized in the vicinity of the free plasma boundary and are not associated with any rational magnetic surface inside the plasma (the so-called peeling modes) can be found. The radial structure of all perturbations under study is almost entirely determined by the poloidal coupling of harmonics. The results of calculations are compared with the available experimental data.

  17. Direct drive targets for the megajoule facility UFL-2M

    NASA Astrophysics Data System (ADS)

    Rozanov, V. B.; Gus'kov, S. Yu; Vergunova, G. A.; Demchenko, N. N.; Stepanov, R. V.; Doskoch, I. Ya; Yakhin, R. A.; Zmitrenko, N. V.

    2016-03-01

    Development of direct drive target schemes for the megajoule facility is a topical problem of up-to-date inertial fusion physics. The choice of possible schemes and solutions depends essentially on the irradiation conditions. The installations both running (NIF) and under construction (LMJ) are destined to the 3ω irradiation in PDD (polar direct drive) configuration. The UFL-2M installation that is under construction is based on 2ω irradiation and a symmetrical scheme of direct drive target irradiation. Under these conditions possible schemes for direct drive targets demonstrating the ignition and the achievement of gain G=10÷20 are considered in this report. At the same time, the possibilities are analyzed for the target compression and ignition with a reliability reserve at the conditions that can deviate from the standard ones, and if our understanding of the physics of the processes is not completely adequate to the physics of the real processes.

  18. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  19. Particle Shape and Composition of NU-LHT-2M

    NASA Technical Reports Server (NTRS)

    Rickman, D. L.; Lowers, H.

    2012-01-01

    Particle shapes of the lunar regolith simulant NU-LHT-2M were analyzed by scanning electron microscope of polished sections. These data provide shape, size, and composition information on a particle by particle basis. 5,193 particles were measured, divided into four sized fractions: less than 200 mesh, 200-100 mesh, 100-35 mesh, and greater than 35 mesh. 99.2% of all particles were monominerallic. Minor size versus composition effects were noted in minor and trace mineralogy. The two metrics used are aspect ratio and Heywood factor, plotted as normalized frequency distributions. Shape versus composition effects were noted for glass and possibly chlorite. To aid in analysis, the measured shape distributions are compared to data for ellipses and rectangles. Several other simple geometric shapes are also investigated as to how they plot in aspect ratio versus Heywood factor space. The bulk of the data previously reported, which were acquired in a plane of projection, are between the ellipse and rectangle lines. In contrast, these data, which were acquired in a plane of section, clearly show that a significant number of particles have concave hulls in this view. Appendices cover details of measurement error, use of geometric shapes for comparative analysis, and a logic for comparing data from plane of projection and plane of section measurements.

  20. The TSU 2-m Automatic Spectroscopic Telescope: Capabilities and Experience

    NASA Astrophysics Data System (ADS)

    Eaton, J. A.

    2003-05-01

    Tennessee State University has recently completed a 2-m automatic spectroscopic telescope for high-dispersion spectroscopy. The telescope has an alt-azimuth mount supported on oil pads. The dedicated fiber-coupled spectrograph has a basic resolution of roughly R=30,000 (echelle mode), with ancillary modes of about R=1000 and R=70,000 (echelle with slit). The telescope's program is dedicated to understanding the chromospheres and evolution of cool stars, particularly giants and supergiants. To date (7 March), the telescope has proven its ability to acquire and track stars to at least 9th magnitude over a span of many months and has obtained a few spectra in automatic operation. Four computers running linux control the operation of this instrument and are linked by ethernet communications. We have developed a scheduling algorithm similar to the ATIS rules and incorporated it into a reliable simulator (as well as into the telescope controls), we have written a quality-control program to parse logfiles from the telescope and identify problems, and we are now beginning limited scientific operations. You may find more information about this telescope at our web site, http://astro.tsuniv.edu.

  1. Two VLT 8.2-m Unit Telescopes in Action

    NASA Astrophysics Data System (ADS)

    1999-04-01

    Visitors at ANTU - Astronomical Images from KUEYEN The VLT Control Room at the Paranal Observatory is becoming a busy place indeed. From here, two specialist teams of ESO astronomers and engineers now operate two VLT 8.2-m Unit Telescopes in parallel, ANTU and KUEYEN (formerly UT1 and UT2, for more information about the naming and the pronunciation, see ESO Press Release 06/99 ). Regular science observations have just started with the first of these giant telescopes, while impressive astronomical images are being obtained with the second. The work is hard, but the mood in the control room is good. Insiders claim that there have even been occasions on which the groups have had a friendly "competition" about which telescope makes the "best" images! The ANTU-team has worked with the FORS multi-mode instrument , their colleagues at KUEYEN use the VLT Test Camera for the ongoing tests of this new telescope. While the first is a highly developed astronomical instrument with a large-field CCD imager (6.8 x 6.8 arcmin 2 in the normal mode; 3.4 x 3.4 arcmin 2 in the high-resolution mode), the other is a less complex CCD camera with a smaller field (1.5 x 1.5 arcmin 2 ), suited to verify the optical performance of the telescope. As these images demonstrate, the performance of the second VLT Unit Telescope is steadily improving and it may not be too long before its optical quality will approach that of the first. First KUEYEN photos of stars and galaxies We present here some of the first astronomical images, taken with the second telescope, KUEYEN, in late March and early April 1999. They reflect the current status of the optical, electronic and mechanical systems, still in the process of being tuned. As expected, the experience gained from ANTU last year has turned out to be invaluable and has allowed good progress during this extremely delicate process. ESO PR Photo 19a/99 ESO PR Photo 19a/99 [Preview - JPEG: 400 x 433 pix - 160k] [Normal - JPEG: 800 x 866 pix - 457k] [High

  2. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  3. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  4. Two VLT 8.2-m Unit Telescopes in Action

    NASA Astrophysics Data System (ADS)

    1999-04-01

    Visitors at ANTU - Astronomical Images from KUEYEN The VLT Control Room at the Paranal Observatory is becoming a busy place indeed. From here, two specialist teams of ESO astronomers and engineers now operate two VLT 8.2-m Unit Telescopes in parallel, ANTU and KUEYEN (formerly UT1 and UT2, for more information about the naming and the pronunciation, see ESO Press Release 06/99 ). Regular science observations have just started with the first of these giant telescopes, while impressive astronomical images are being obtained with the second. The work is hard, but the mood in the control room is good. Insiders claim that there have even been occasions on which the groups have had a friendly "competition" about which telescope makes the "best" images! The ANTU-team has worked with the FORS multi-mode instrument , their colleagues at KUEYEN use the VLT Test Camera for the ongoing tests of this new telescope. While the first is a highly developed astronomical instrument with a large-field CCD imager (6.8 x 6.8 arcmin 2 in the normal mode; 3.4 x 3.4 arcmin 2 in the high-resolution mode), the other is a less complex CCD camera with a smaller field (1.5 x 1.5 arcmin 2 ), suited to verify the optical performance of the telescope. As these images demonstrate, the performance of the second VLT Unit Telescope is steadily improving and it may not be too long before its optical quality will approach that of the first. First KUEYEN photos of stars and galaxies We present here some of the first astronomical images, taken with the second telescope, KUEYEN, in late March and early April 1999. They reflect the current status of the optical, electronic and mechanical systems, still in the process of being tuned. As expected, the experience gained from ANTU last year has turned out to be invaluable and has allowed good progress during this extremely delicate process. ESO PR Photo 19a/99 ESO PR Photo 19a/99 [Preview - JPEG: 400 x 433 pix - 160k] [Normal - JPEG: 800 x 866 pix - 457k] [High

  5. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  6. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  7. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  8. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  9. An explanation of the preferential formation of less stable isomers in three-body reactions - Cl + NO2 + M; ClO + NO2 + M

    NASA Technical Reports Server (NTRS)

    Chang, J. S.; Baldwin, A. C.; Golden, D. M.

    1979-01-01

    A realistic assessment of the potential depletion of stratospheric ozone due to manmade emissions requires a knowledge of the sources and sinks of the potential threat. The reactions ClO + NO2 + M yield products and Cl + NO2 + M yield products are of interest because they represent possible sink mechanism for both odd chlorine and odd nitrogen species. In this paper, the Troe method (1977) is used to calculate the low-pressure limit rate constants of the above three-body reactions. The result for the Cl + NO2 + M reaction is found to be in excellent agreement with the experimental finding of Niki et al. (1978), where both nitryl chloride and chlorine nitrate are products of the cited reaction. An explanation is proposed to account for apparent discrepancy between the measured rate constants for ClO + NO2 + M in the forward and reverse directions. Stratospheric implications are also discussed.

  10. Inhibition of microsomal lipid peroxidation by alpha-tocopherol and alpha-tocopherol acetate.

    PubMed

    Gonzalez Flecha, B S; Repetto, M; Evelson, P; Boveris, A

    1991-08-01

    1. The antioxidant effects of alpha-tocopherol and alpha-tocopherol acetate were assayed for the (a) oxygen uptake, (b) chemiluminescence and (c) malondialdehyde formation, of tert-butyl hydroperoxide-supplemented rat liver microsomes. 2. Oxygen uptake was inhibited 60% by both alpha-tocopherol and alpha-tocopherol acetate with the half-maximal effect at 5 nmol tocopherol/mg protein. Chemiluminescence and malondialdehyde formation were equally inhibited 35% by both tocopherols with half-maximal effects at 2 nmol tocopherol/mg protein. 3. The rate of O2 uptake by tocopherol-supplemented microsomes was dependent on O2 concentration. A 60% inhibition by 5 nmol tocopherol/mg protein at 0.2 mM O2 is decreased to 5% inhibition at 0.6 mM O2. 4. The inhibition of O2 uptake, chemiluminescence and malondialdehyde formation indicate that both alpha-tocopherol and alpha-tocopherol acetate have similar effects as free radical traps in the hydrophobic domain of biomembranes. The different inhibition observed at different O2 concentrations indicate competition between vitamin E and O2 by unoxygenated lipid radicals.

  11. Antigenic properties of human and animal bloodstains studied by enzyme-linked immunosorbent assay (ELISA) using various antisera against specific plasma proteins.

    PubMed

    Tsutsumi, H; Htay, H H; Sato, K; Katsumata, Y

    1987-01-01

    Antigenic properties of bloodstains of human and non-human primates as well as other animal bloodstains were investigated by the inhibition ELISA using commercially available anti-human albumin (Alb), alpha 2-macroglobulin (alpha 2-M), fibrinogen, transferrin, and immunoglobulin G. In general, chimpanzee bloodstains showed strong cross-reactions with these antisera, and the extent of the cross-reactions of other animal bloodstains decreased largely with the phylogenic order, i.e., agile gibbon (ape), Old World monkeys (Japanese monkey and hamadryas baboon), New World monkeys (night monkey and tufted capuchin monkey), prosimians (grand galago and ring-tailed lemur) and other animals (rat, cattle, swine, goat, dog, cat, and chicken). Among these antisera, anti-human alpha 2-M showed the weakest cross-reaction with chimpanzee bloodstains, and anti-human Alb showed next. PMID:2448970

  12. On resolving 2M - 1 narrow-band signals with an M sensor uniform linear array

    NASA Technical Reports Server (NTRS)

    Williams, Douglas B.; Johnson, Don H.

    1992-01-01

    Length 2M real signal vectors are used to address the problem of determining the maximum number of narrow-band signals whose parameters can be estimated with a linear array of M equally spaced sensors. It is shown that 2M of these real vectors are linearly independent with probability one, and, thus in the presence of additive white noise, the parameters of 2M - 1 signals can be estimated. An algorithm for determining directions and amplitudes is presented.

  13. Trends in M2M Application Services Based on a Smart Phone

    NASA Astrophysics Data System (ADS)

    Ahn, Jae Young; Song, Jae-Gu; Hwang, Dae-Joon; Kim, Seoksoo

    M2M, which stands for communications between machines, offers various services today thanks to advanced communication networks and sensor systems. Also, a powerful terminal such as a smart phone provides sufficient physical environments, not requiring a special device for the services. However, the smart phone M2M environment involves various complex technologies, and there have been no clear policies or standards for the technology. This study, therefore, analyzes the current status of M2M service introduction and the trends in M2M application services using a smart phone.

  14. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  15. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  16. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  17. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  18. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  19. A Study on M2M-based System for Hygienic Meteorology Service

    NASA Astrophysics Data System (ADS)

    Song, Jae-Gu; Ahn, Jae Young; Kim, Seoksoo

    M2M proposes a standardized communications technology between network and devices. This study has designed an M2M-based system to smoothly deliver information between devices which were required to provide hygienic meteorology services. Especially, an efficient plan for service provision has been studied, by classifying the types of information at each stage of user, EM, SM, HSM and SPM.

  20. Endocytic activity of Sertoli cells grown in bicameral culture chambers

    SciTech Connect

    Dai, R.X.; Djakiew, D.; Dym, M.

    1987-07-01

    Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding /sup 125/I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived.

  1. [Identification of C(2)M interacting proteins by yeast two-hybrid screening].

    PubMed

    Shanshan, Yue; Laixin, Xia

    2015-11-01

    The synaptonemal complex (SC) is a huge structure which assembles between the homologous chromosomes during meiotic prophase I. Drosophila germ cell-specific nucleoprotein C(2)M clustering at chromosomes can induce SC formation. To further study the molecular function and mechanism of C(2)M in meiosis, we constructed a bait vector for C(2)M and used the yeast two-hybrid system to identify C(2)M interacting proteins. Forty interacting proteins were obtained, including many DNA and histone binding proteins, ATP synthases and transcription factors. Gene silencing assays in Drosophila showed that two genes, wech and Psf1, may delay the disappearance of SC. These results indicate that Wech and Psf1 may form a complex with C(2)M to participate in the formation or stabilization of the SC complex.

  2. Cigarette Smoking and Tryptophan Hydroxylase 2 mRNA in the Dorsal Raphe Nucleus in Suicides

    PubMed Central

    Bach, Helene; Arango, Victoria; Kassir, Suham A.; Dwork, Andrew J.; Mann, J. John; Underwood, Mark D.

    2016-01-01

    Cigarette smoking is associated with suicide and mood disorders and stimulates serotonin release. Tryptophan hydroxylase (TPH2) synthesizes serotonin and is over-expressed in suicides. We determined whether smoking is associated with TPH2 mRNA in suicides and controls. TPH2 mRNA was measured postmortem in the dorsal raphe nucleus (DRN) of controls (N=26, 17 nonsmokers and nine smokers) and suicides (N=23, 5 nonsmokers and 18 smokers). Psychiatric history was obtained by psychological autopsy. TPH2 mRNA was greater in suicide nonsmokers than suicide smokers, control smokers and control nonsmokers (p=0.006). There was more TPH2 mRNA throughout the DRN. Smoking interferes with the TPH2 mRNA increase observed in suicide nonsmokers. The absence of altered TPH2 expression in non-suicide smokers suggests no pharmacological effect of smoking. PMID:26954509

  3. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  4. COX-2 mRNA expression in esophageal squamous cell carcinoma (ESCC) and effect by NSAID.

    PubMed

    Liu, X; Li, P; Zhang, S-T; You, H; Jia, J-D; Yu, Z-L

    2008-01-01

    To investigate cyclooxygenase-2 (COX-2) mRNA expression in human esophageal squamous cell carcinoma and the effect of a non-steroidal anti-inflammatory drug (NSAID) on it, in order to explore the mechanism of COX-2 in esophageal squamous cell carcinoma (ESCC) carcinogenesis and the ability of NSAID to prevent or treat ESCC. Frozen specimens of human ESCC and adjacent normal esophageal squamous epithelium pairs (n = 22) were examined for COX-2 mRNA expression by reverse-transcription polymerase chain reaction (RT-PCR). After incubation with aspirin (a non-selective COX inhibitor) or Nimesulide (a selective COX-2 inhibitor), the proliferation status of two human esophageal squamous cancer cell lines, EC-9706 and EC-109, was quantified by 3-(4,5-dimethyl-thiazol-2yl)-2,5-diphenyltetrazolium bromide assay. The expression of COX-2 mRNA in these cells was detected by RT-PCR. COX-2 mRNA was expressed in 12 of 22 (54.5%) ESCC tissue samples, but it was undetectable in all the specimens of adjacent normal esophageal squamous epithelium COX-2 mRNA expression. Both aspirin (5-20 mmol/L) and Nimesulide (0.1-0.8 mmol/L) inhibited EC-9706 cell line proliferation and suppressed its COX-2 mRNA expression dose-dependently. However, only aspirin (5-20 mmol/L) could inhibit proliferation in the EC-109 cell line and suppress COX-2 mRNA expression. Nimesulide (0.1-0.8 mmol/L) could neither inhibit EC-109 cell growth nor suppress COX-2 mRNA expression. COX-2 mRNA expression is a frequent phenomenon in human ESCC tissue samples and plays an important role in the carcinogenesis of ESCC. NSAID may be useful in the chemoprevention and therapy of human ESCC and its effects are likely to be mediated by modulating COX-2 activity.

  5. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  6. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  7. Surface Meteorological Station - ARL 2m, ancillary flux, Boardman - Raw Data

    DOE Data Explorer

    Clawson, Kirk

    2016-10-25

    These data contain measurements from a four-component net radiometer, as well as 2-m temperature, pressure, and relative humidity (RH). In addition, soil moisture and temperature measurements and soil heat fluxes are included.

  8. Surface Meteorological Station - ARL 2m, ancillary flux, Prineville - Raw Data

    DOE Data Explorer

    Clawson, Kirk

    2016-10-25

    These data contain measurements from a 4-component net radiometer, as well as 2m temperature, pressure and RH. Also measurements of soil moisture and temperature and soil heat fluxes are found herein.

  9. Braiding statistics and classification of two-dimensional charge-2 m superconductors

    NASA Astrophysics Data System (ADS)

    Wang, Chenjie

    2016-08-01

    We study braiding statistics between quasiparticles and vortices in two-dimensional charge-2 m (in units of e ) superconductors that are coupled to a Z2 m dynamical gauge field, where m is any positive integer. We show that there exist 16 m types of braiding statistics when m is odd, but only 4 m types when m is even. Based on the braiding statistics, we obtain a classification of topological phases of charge-2 m superconductors—or formally speaking, a classification of symmetry-protected topological phases, as well as invertible topological phases, of two-dimensional gapped fermions with Z2m f symmetry. Interestingly, we find that there is no nontrivial fermionic symmetry-protected topological phase with Z4f symmetry.

  10. 113. JOB NO. 1347K, SHEET 2M, 1929, FORD MOTOR COMPANY; ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    113. JOB NO. 1347-K, SHEET 2M, 1929, FORD MOTOR COMPANY; BOILER HOUSE ASSEMBLY PLANT; SECTIONS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  11. Idaho National Laboratory Technology to Market (T2M) Final Report

    SciTech Connect

    Wright, Christopher Todd; Bush, Jason William; Gentle, Jake Paul; Hill, Porter Jack; Myers, Kurt Steven; Williams, Christopher Luke

    2016-01-01

    The objective of this project is to establish a tiered Technology to Market (T2M) curriculum for basic researchers to project leads to measure the effect of technology transfer skills on project success and impact. The plan will train five researchers in basic technology transfer principles where success will be measured by assessing improvements in T2M skills and knowledge after the training is complete, likely using before and after surveys.

  12. Evaluation of Z-(R,R)-IQNP for the potential imaging of m2 mAChR rich regions of the brain and heart.

    PubMed

    McPherson, D W; Greenbaum, M; Luo, H; Beets, A L; Knapp, F F

    2000-01-01

    Alterations in the function or density of the m2 muscarinic (mAChR) subtype have been postulated to play an important role in various dementias such as Alzheimer's disease. The ability to image and quantify the m2 mAChR subtype is of importance for a better understanding of the m2 subtype function in various dementias. Z-(R)-1-Azabicyclo[2.2.2]oct-3-y (R)-alpha-hydroxy-alpha-(1-iodo-1-propen-3-yl)-alpha-phenylacetate (Z-(R,R)-IQNP) has demonstrated significant uptake in cerebral regions that contain a high concentration of m2 mAChR subtype in addition to heart tissue. The present study was undertaken to determine if the uptake of Z-(R,R)-IQNP in these regions is a receptor mediated process and to identify the radiospecies responsible for binding at the receptor site. A blocking study demonstrated cerebral and cardiac levels of activity were significantly reduced by pretreatment (2-3 mg/kg) of (R)-3-quinuclidinyl benzilate, dexetimide and scopolamine, established muscarinic antagonists. A direct comparison of the cerebral and cardiac uptake of [I-125]-Z-(R,R)-IQNP and [I-131]-E-(R,R)-IQNP (high uptake in ml, m4 rich mAChR cerebral regions) demonstrated Z-(R,R)-IQNP localized to a higher degree in cerebral and cardiac regions containing a high concentration of the m2 mAChR subtype as directly compared to E-(R,R)-IQNP. In addition, a study utilizing [I-123]-Z-(R,R)-IQNP, [I-131]-iododexetimide and [I-125]-R-3-quinuclidinyl S-4-iodobenzilate, Z-(R,R)-IQNP demonstrated significantly higher uptake and longer residence time in those regions which contain a high concentration of the m2 receptor subtype. Folch extraction of global brain and heart tissue at various times post injection of [I-125]-Z-(R,R)-IQNP demonstrated that approximately 80% of the activity was extracted in the lipid soluble fraction and identified as the parent ligand by TLC and HPLC analysis. These results demonstrate Z-(R,R)-IQNP has significant uptake, long residence time and high stability in

  13. UCP2 mRNA expression is dependent on glucose metabolism in pancreatic islets

    SciTech Connect

    Dalgaard, Louise T.

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer UCP2 mRNA levels are decreased in islets of Langerhans from glucokinase deficient mice. Black-Right-Pointing-Pointer UCP2 mRNA up-regulation by glucose is dependent on glucokinase. Black-Right-Pointing-Pointer Absence of UCP2 increases GSIS of glucokinase heterozygous pancreatic islets. Black-Right-Pointing-Pointer This may protect glucokinase deficient mice from hyperglycemic damages. -- Abstract: Uncoupling Protein 2 (UCP2) is expressed in the pancreatic {beta}-cell, where it partially uncouples the mitochondrial proton gradient, decreasing both ATP-production and glucose-stimulated insulin secretion (GSIS). Increased glucose levels up-regulate UCP2 mRNA and protein levels, but the mechanism for UCP2 up-regulation in response to increased glucose is unknown. The aim was to examine the effects of glucokinase (GK) deficiency on UCP2 mRNA levels and to characterize the interaction between UCP2 and GK with regard to glucose-stimulated insulin secretion in pancreatic islets. UCP2 mRNA expression was reduced in GK+/- islets and GK heterozygosity prevented glucose-induced up-regulation of islet UCP2 mRNA. In contrast to UCP2 protein function UCP2 mRNA regulation was not dependent on superoxide generation, but rather on products of glucose metabolism, because MnTBAP, a superoxide dismutase mimetic, did not prevent the glucose-induced up-regulation of UCP2. Glucose-stimulated insulin secretion was increased in UCP2-/- and GK+/- islets compared with GK+/- islets and UCP2 deficiency improved glucose tolerance of GK+/- mice. Accordingly, UCP2 deficiency increased ATP-levels of GK+/- mice. Thus, the compensatory down-regulation of UCP2 is involved in preserving the insulin secretory capacity of GK mutant mice and might also be implicated in limiting disease progression in MODY2 patients.

  14. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  15. Wireless Access Control with Smart Antenna for M2M Communications

    NASA Astrophysics Data System (ADS)

    Sakamoto, Hiroshi; Bandai, Masaki; Watanabe, Takashi

    Machine to machine (M2M) is a promising technology to achieve an ubiquitous environment by uniting machines and machines over the Internet. The network used for M2M consists of core network and access network. This paper discusses effective controls of the wireless access network for M2M. Among typical examples of the wireless access network for M2M is a wireless sensor network (WSN). WSN for M2M may require energy efficiency, high reliability and throughput. For these requirements, in this paper, we propose a scheme to build a hierarchical sensor network using smart antenna. The proposed scheme uses omni-directional antennas together with smart antennas. Since smart antennas can extend communications distance, the proposed scheme enables reduction of number of hops to reduce the traffic load on relay nodes. As a result, the energy consumption, data collection ratio and throughput can be improved. We implement the proposed scheme on a real testbed. The testbed uses UNAGI as smart antenna nodes and Mica Mote as sensor nodes. In addition to the fundamental evaluation on the testbed, we simulate large-scale sensor networks. The results show the effectiveness of the proposed hierarchical sensor network with smart antennas.

  16. Viscum album-Mediated COX-2 Inhibition Implicates Destabilization of COX-2 mRNA

    PubMed Central

    Saha, Chaitrali; Hegde, Pushpa; Friboulet, Alain; Bayry, Jagadeesh; Kaveri, Srinivas V.

    2015-01-01

    Extensive use of Viscum album (VA) preparations in the complementary therapy of cancer and in several other human pathologies has led to an increasing number of cellular and molecular approaches to explore the mechanisms of action of VA. We have recently demonstrated that, VA preparations exert a potent anti-inflammatory effect by selectively down-regulating the COX-2-mediated cytokine-induced secretion of prostaglandin E2 (PGE2), one of the important molecular signatures of inflammatory reactions. In this study, we observed a significant down-regulation of COX-2 protein expression in VA-treated A549 cells however COX-2 mRNA levels were unaltered. Therefore, we hypothesized that VA induces destabilisation of COX-2 mRNA, thereby depleting the available functional COX-2 mRNA for the protein synthesis and for the subsequent secretion of PGE2. To address this question, we analyzed the molecular degradation of COX-2 protein and its corresponding mRNA in A549 cell line. Using cyclohexamide pulse chase experiment, we demonstrate that, COX-2 protein degradation is not affected by the treatment with VA whereas experiments on transcriptional blockade with actinomycin D, revealed a marked reduction in the half life of COX-2 mRNA due to its rapid degradation in the cells treated with VA compared to that in IL-1β-stimulated cells. These results thus demonstrate that VA-mediated inhibition of PGE2 implicates destabilization of COX-2 mRNA. PMID:25664986

  17. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  18. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  19. The alpha(2) integrin subunit-deficient mouse: a multifaceted phenotype including defects of branching morphogenesis and hemostasis.

    PubMed

    Chen, Jianchun; Diacovo, Thomas G; Grenache, David G; Santoro, Samuel A; Zutter, Mary M

    2002-07-01

    The alpha(2)beta(1) integrin is a collagen/laminin receptor expressed on platelets, endothelial cells, fibroblasts, and epithelial cells. To define the role of the alpha(2)beta(1) integrin in vivo, we created a genetically engineered mouse in which expression of the alpha(2)beta(1) integrin was completely eliminated. Mice deficient in the alpha(2)beta(1) integrin are viable, fertile, and develop normally with no excess lethality of homozygotes. Both alpha(2)beta(1)-integrin protein and alpha(2) mRNA were undetectable in the alpha(2)-null mice. Gross and histological evaluation of the heart, lungs, kidneys, gastrointestinal tract, pancreas, skin, and reproductive tracts revealed no abnormalities. However, quantitative analysis of mammary gland branching morphogenesis demonstrated that branching complexity is markedly diminished in the alpha(2)-deficient animals. Studies in the alpha(2)-deficient animals do not support the proposed roles for the alpha(2)beta(1) integrin on fibroblasts and keratinocytes in wound healing. When compared to platelets from wild-type littermates, platelets from alpha(2)-null mice failed to adhere to type I collagen under either static or shear-stress conditions. Although platelets from alpha(2)-deficient animals aggregated in response to collagen, they did so with prolonged lag time and lessened intensity. The alpha(2)beta(1) integrin-null mouse thus exhibits diverse, sometimes subtle, phenotypes consistent with the widespread pattern of alpha(2)beta(1) integrin expression. PMID:12107118

  20. Dietary NiCl2 causes G2/M cell cycle arrest in the broiler's kidney

    PubMed Central

    Guo, Hongrui; Cui, Hengmin; Peng, Xi; Fang, Jing; Zuo, Zhicai; Deng, Junliang; Wang, Xun; Wu, Bangyuan; Chen, Kejie; Deng, Jie

    2015-01-01

    Here we showed that dietary NiCl2 in excess of 300 mg/kg caused the G2/M cell cycle arrest and the reduction of cell proportion at S phase. The G2/M cell cycle arrest was accompanied by up-regulation of phosphorylated ataxia telangiectasia mutated (p-ATM), p53, p-Chk1, p-Chk2, p21 protein expression and ATM, p53, p21, Chk1, Chk2 mRNA expression, and down-regulation of p-cdc25C, cdc2, cyclinB and proliferating cell nuclear antigen (PCNA) protein expression and the cdc25, cdc2, cyclinB, PCNA mRNA expression. PMID:26440151

  1. Apigenin inhibits pancreatic cancer cell proliferation through G2/M cell cycle arrest

    PubMed Central

    Ujiki, Michael B; Ding, Xian-Zhong; Salabat, M Reza; Bentrem, David J; Golkar, Laleh; Milam, Ben; Talamonti, Mark S; Bell, Richard H; Iwamura, Takeshi; Adrian, Thomas E

    2006-01-01

    Background Many chemotherapeutic agents have been used to treat pancreatic cancer without success. Apigenin, a naturally occurring flavonoid, has been shown to inhibit growth in some cancer cell lines but has not been studied in pancreatic cancer. We hypothesized that apigenin would inhibit pancreatic cancer cell growth in vitro. Results Apigenin caused both time- and concentration-dependent inhibition of DNA synthesis and cell proliferation in four pancreatic cancer cell lines. Apigenin induced G2/M phase cell cycle arrest. Apigenin reduced levels of cyclin A, cyclin B, phosphorylated forms of cdc2 and cdc25, which are all proteins required for G2/M transition. Conclusion Apigenin inhibits growth of pancreatic cancer cells through suppression of cyclin B-associated cdc2 activity and G2/M arrest, and may be a valuable drug for the treatment or prevention of pancreatic cancer. PMID:17196098

  2. DRG2 Regulates G2/M Progression via the Cyclin B1-Cdk1 Complex

    PubMed Central

    Jang, Soo Hwa; Kim, Ah-Ram; Park, Neung-Hwa; Park, Jeong Woo; Han, In-Seob

    2016-01-01

    Developmentally regulated GTP-binding protein 2 (DRG2) plays an important role in cell growth. Here we explored the linkage between DRG2 and G2/M phase checkpoint function in cell cycle progression. We observed that knockdown of DRG2 in HeLa cells affected growth in a wound-healing assay, and tumorigenicity in nude mice xenografts. Flow cytometry assays and [3H] incorporation assays indicated that G2/M phase arrest was responsible for the decreased proliferation of these cells. Knockdown of DRG2 elicited down-regulation of the major mitotic promoting factor, the cyclin B1/Cdk1 complex, but up-regulation of the cell cycle arresting proteins, Wee1, Myt1, and p21. These findings identify a novel role of DRG2 in G2/M progression. PMID:27669826

  3. DRG2 Regulates G2/M Progression via the Cyclin B1-Cdk1 Complex.

    PubMed

    Jang, Soo Hwa; Kim, Ah-Ram; Park, Neung-Hwa; Park, Jeong Woo; Han, In-Seob

    2016-09-01

    Developmentally regulated GTP-binding protein 2 (DRG2) plays an important role in cell growth. Here we explored the linkage between DRG2 and G2/M phase checkpoint function in cell cycle progression. We observed that knockdown of DRG2 in HeLa cells affected growth in a wound-healing assay, and tumorigenicity in nude mice xenografts. Flow cytometry assays and [(3)H] incorporation assays indicated that G2/M phase arrest was responsible for the decreased proliferation of these cells. Knockdown of DRG2 elicited down-regulation of the major mitotic promoting factor, the cyclin B1/Cdk1 complex, but up-regulation of the cell cycle arresting proteins, Wee1, Myt1, and p21. These findings identify a novel role of DRG2 in G2/M progression. PMID:27669826

  4. [The permeability of the hemato-encephalic barrier and the proteolytic potential of the cerebrospinal fluid in severe craniocerebral trauma].

    PubMed

    Churliaev, Iu A; Nikiforova, N V; Lutsik, A A; Kuksinskiĭ, V A; Lykova, O F; Martynenkov, V Ia; Karpenko, V S

    1999-01-01

    To study blood-brain barrier permeability and proteolytic changes in in patients with severe brain injury and to evaluate their impact on its course and outcome, the concentrations of albumin, plasminogen (plasmin), alpha 2-macroglobulin, alpha 2-antiplasmin, and alpha 1-antitrypsin were examined in 58 victims by enzyme immunoassay. The control group comprised 20 patients examined for lumbar discal hernia. The studies indicate that early severe brain injury showed blood-brain barrier dysfunction whose severity can be detected by the spinal fluid levels of albumin, plasminogen, and alpha 2-macroglobulin. Proteolytic changes in spinal fluid are determined by its albumin, plasminogen (plasmin), alpha 2-macroglobulin, alpha 2-antiplasmin, and alpha 1-antitrypsin concentrations and affect the development of secondary brain lesion and they are of practical value. PMID:10696680

  5. Weak-value thermostat with 0.2 mK precision.

    PubMed

    Egan, Patrick; Stone, Jack A

    2012-12-01

    A new laser-based thermostat sensitive to 0.2 mK at room temperature is reported. The method utilizes a fluid-filled prism and interferometric weak-value amplification to sense nanoradian deviations of a laser beam: due to the high thermo-optic coefficient of the fluid (colorless fluorocarbon), the deviation angle through the prism is sensitive to temperature. We estimate the daily stability of our device to be 0.2 mK, which is limited by drifts in the apparatus, and the narrow 20 mK capture range is the price paid for the weak measurement.

  6. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  7. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  8. Syntheses and structural characterization of non-centrosymmetric Na2M2M'S6 (M, M‧=Ga, In, Si, Ge, Sn, Zn, Cd) sulfides

    NASA Astrophysics Data System (ADS)

    Yohannan, Jinu P.; Vidyasagar, Kanamaluru

    2016-06-01

    Seven new non-centrosymmetric Na2M2M'S6 sulfides, namely, Na2Sn2ZnS6(1), Na2Ga2GeS6(2), Na2Ga2SnS6(3-α), Na2Ga2SnS6(3-β), Na2Ge2ZnS6(4), Na2Ge2CdS6(5), Na2In2SiS6(6) and Na2In2GeS6(7), were synthesized by high temperature solid state reactions and structurally characterized by single crystal X-ray diffraction. They crystallize in non-centrosymmetric Fdd2 and Cc space groups and their three-dimensional [M2M‧S6]2-framework structures consist of MS4 and M‧S4 tetrahedra corner-connected to one another in either orderly or disordered fashion. Sodium ions reside in the tunnels of the anionic framework. Compounds 1, 2 and 3-α have the structure of known Li2Ga2GeS6, whereas compounds 6 and 7 are isostructural with known Li2In2GeS6 compound. Isostructural compounds 4 and 5 represent a new structural variant. Compounds 3-α and its new monoclinic structural variant 3-β have disordered structural framework. All of them are wide band gap semiconductors. Na2Ga2GeS6(2), Na2Ga2SnS6(3), Na2Ge2ZnS6(4) and Na2In2GeS6(7) compounds are found to be second-harmonic generation (SHG) active. Compounds 1, 2 and 3-α melt congruently.

  9. A survey on M2M systems for mHealth: a wireless communications perspective.

    PubMed

    Kartsakli, Elli; Lalos, Aris S; Antonopoulos, Angelos; Tennina, Stefano; Renzo, Marco Di; Alonso, Luis; Verikoukis, Christos

    2014-09-26

    In the new era of connectivity, marked by the explosive number of wireless electronic devices and the need for smart and pervasive applications, Machine-to-Machine (M2M) communications are an emerging technology that enables the seamless device interconnection without the need of human interaction. The use of M2M technology can bring to life a wide range of mHealth applications, with considerable benefits for both patients and healthcare providers. Many technological challenges have to be met, however, to ensure the widespread adoption of mHealth solutions in the future. In this context, we aim to provide a comprehensive survey on M2M systems for mHealth applications from a wireless communication perspective. An end-to-end holistic approach is adopted, focusing on different communication aspects of the M2M architecture. Hence, we first provide a systematic review ofWireless Body Area Networks (WBANs), which constitute the enabling technology at the patient's side, and then discuss end-to-end solutions that involve the design and implementation of practical mHealth applications. We close the survey by identifying challenges and open research issues, thus paving the way for future research opportunities.

  10. CH2M Hill Hanford Group Inc (CHG) Information Resource Management (IRM) Strategic Plan

    SciTech Connect

    NELSON, R.L.

    2000-06-06

    The CH2M HILL Hanford Group, Inc. (CHG), Information Resource Management Strategic Plan is the top-level planning document for applying information and information resource management to achieve the CHG mission for the management of the River Protection Project waste tank farm.

  11. Numb contributes to renal fibrosis by promoting tubular epithelial cell cycle arrest at G2/M

    PubMed Central

    Zhu, Fengxin; Liu, Wei; Li, Tang; Wan, Jiao; Tian, Jianwei; Zhou, Zhanmei; Li, Hao; Liu, Youhua; Hou, Fan Fan; Nie, Jing

    2016-01-01

    Numb is a multifunctional protein involved in diverse cellular processes. However, the function of Numb in kidney remains unclear. Here, we reported that Numb is expressed in renal tubules and glomeruli in normal adult kidney. Numb expression was upregulated in fibrotic kidneys induced by unilateral ureteral obstruction (UUO) in mice as well as in human fibrotic kidney tissues. Numb overexpression in cultured proximal tubular cells increased the G2/M cell population and upregulated the expression of TGF-β1 and CTGF. Whereas, proximal tubule Numb knockout (PEPCK-Numb-KO) mice showed reduced G2/M arrest, decreased expression of TGF-β1 and CTGF, and attenuated fibrotic lesions due to either UUO or unilateral ischemia reperfusion nephropathy. Inhibiting p53 activity by pifithrin-β dramatically mitigated Numb-induced G2/M arrest, indicating that Numb potentiates G2/M arrest via stabilizing p53 protein. Together, these data suggest that Numb is a potential target for anti-fibrosis therapy. PMID:27016419

  12. LTE-advanced random access mechanism for M2M communication: A review

    NASA Astrophysics Data System (ADS)

    Mustafa, Rashid; Sarowa, Sandeep; Jaglan, Reena Rathee; Khan, Mohammad Junaid; Agrawal, Sunil

    2016-03-01

    Machine Type Communications (MTC) enables one or more self-sufficient machines to communicate directly with one another without human interference. MTC applications include smart grid, security, e-Health and intelligent automation system. To support huge numbers of MTC devices, one of the challenging issues is to provide a competent way for numerous access in the network and to minimize network overload. In this article, the different control mechanisms for overload random access are reviewed to avoid congestion caused by random access channel (RACH) of MTC devices. However, past and present wireless technologies have been engineered for Human-to-Human (H2H) communications, in particular, for transmission of voice. Consequently the Long Term Evolution (LTE) -Advanced is expected to play a central role in communicating Machine to Machine (M2M) and are very optimistic about H2H communications. Distinct and unique characteristics of M2M communications create new challenges from those in H2H communications. In this article, we investigate the impact of massive M2M terminals attempting random access to LTE-Advanced all at once. We discuss and review the solutions to alleviate the overload problem by Third Generation Partnership Project (3GPP). As a result, we evaluate and compare these solutions that can effectively eliminate the congestion on the random access channel for M2M communications without affecting H2H communications.

  13. A Survey on M2M Systems for mHealth: A Wireless Communications Perspective

    PubMed Central

    Kartsakli, Elli; Lalos, Aris S.; Antonopoulos, Angelos; Tennina, Stefano; Di Renzo, Marco; Alonso, Luis; Verikoukis, Christos

    2014-01-01

    In the new era of connectivity, marked by the explosive number of wireless electronic devices and the need for smart and pervasive applications, Machine-to-Machine (M2M) communications are an emerging technology that enables the seamless device interconnection without the need of human interaction. The use of M2M technology can bring to life a wide range of mHealth applications, with considerable benefits for both patients and healthcare providers. Many technological challenges have to be met, however, to ensure the widespread adoption of mHealth solutions in the future. In this context, we aim to provide a comprehensive survey on M2M systems for mHealth applications from a wireless communication perspective. An end-to-end holistic approach is adopted, focusing on different communication aspects of the M2M architecture. Hence, we first provide a systematic review of Wireless Body Area Networks (WBANs), which constitute the enabling technology at the patient's side, and then discuss end-to-end solutions that involve the design and implementation of practical mHealth applications. We close the survey by identifying challenges and open research issues, thus paving the way for future research opportunities. PMID:25264958

  14. NFBD1/MDC1 participates in the regulation of G2/M transition in mammalian cells

    SciTech Connect

    Bu, Youquan; Suenaga, Yusuke; Okoshi, Rintaro; Sang, Meixiang; Kubo, Natsumi; Song, Fangzhou; Nakagawara, Akira; Ozaki, Toshinori

    2010-06-25

    NFBD1/MDC1 is a large nuclear protein involved in the early cellular response to DNA damage. Upon DNA damage, NFBD1 has an ability to facilitate the efficient DNA repair. In the present study, we have found that, in addition to DNA damage response, NFBD1 plays a critical role in the regulation of G2/M transition. Expression study using synchronized HeLa cells demonstrated that, like the mitotic kinase Plk1, NFBD1 expression level is maximal in G2/M-phase of the cell cycle. siRNA-mediated knockdown of NFBD1 resulted in G2/M arrest as well as simultaneous apoptosis in association with a significant increase in the amounts of {gamma}H2AX and pro-apoptotic p73. Since a remarkable down-regulation of mitotic phospho-histone H3 was detectable in NFBD1-knocked down cells, it is likely that knocking down of NFBD1 inhibits G2/M transition. Taken together, our present findings suggest that NFBD1 has a pivotal role in the regulation of proper mitotic entry.

  15. Heterocyclic aminoparthenolide derivatives modulate G(2)-M cell cycle progression during Xenopus oocyte maturation.

    PubMed

    Janganati, Venumadhav; Penthala, Narsimha Reddy; Cragle, Chad E; MacNicol, Angus M; Crooks, Peter A

    2014-04-15

    Aminoparthenolide derivatives have been prepared by reaction of parthenolide with various heterocyclic amines to afford corresponding Michael addition products. These novel compounds were evaluated for their modulatory effects on Xenopus oocyte maturation. Two compounds, 6e and 6f, were identified that promote G2-M cell cycle progression.

  16. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  17. The Basis of Generalized Equation E = Ac2M, its Application in Various Physical Phenomena

    NASA Astrophysics Data System (ADS)

    Sharma, Ajay

    2007-08-01

    The basis of generalized equation E = Ac2M, its application in various physical phenomena. Complete paper (in pdf) at www.ajayonline.us Einstein's (Sep. 1905) derivation theorizes that when light energy (L) is emanated by luminous body then its mass diminishes as m =L/c2 and this equation is speculative origin (without proof) of E = c2m. This derivation is true under special conditions only, not in general. Einstein's derivation L = mc2 involves four variables e.g. magnitude of energy of light waves, number of light waves, angle at which light waves are emitted and velocity of observer, v. Einstein derived L = mc2 choosing special values of variables. If general values of variables are considered then Einstein's derivation predicts that as body emits light energy, then its mass must increase, which is inconsistent result. Alternate equation E = Ac2M has been suggested, which implies that energy emitted on annihilation of mass (or vice versa) can be equal, less and more than predicted by E = mc2. E = c2m is yet unconfirmed in the most abundant chemical re actions. The total kinetic energy of fission fragments of U235 or Pu239 is found experimentally 20-60 MeV less than Q-value predicted by mc2, it is explainable with E = Ac2M with value of A less than one. Energy emitted by Gamma Ray Bursts (most energetic event after Big Bang) in duration 0.1-100s, is 10^45J, can be explained with help of E = Ac2M. The mass of particle Ds (2317) discovered at SLAC, have mass lower than current estimates; it can be explained with value of A more than one. E = Ac2M, explains that mass of universe 10^55kg was created from dwindling amount of energy (10-50 J or less) i.e. expceptionally-2 small and A is 1.11 10-122 J or less. This perception implies gravitational energy is another form of mass (like other energies) and has been originated simultaneously with mass.

  18. Investigations on the heat flux and impurity for the HL-2M divertor

    NASA Astrophysics Data System (ADS)

    Zheng, G. Y.; Cai, L. Z.; Duan, X. R.; Xu, X. Q.; Ryutov, D. D.; Cai, L. J.; Liu, X.; Li, J. X.; Pan, Y. D.

    2016-12-01

    The controllability of the heat load and impurity in the divertor is very important, which could be one of the critical problems to be solved in order to ensure the success for a steady state tokamak. HL-2M has the advantage of the poloidal field (PF) coils placed inside the demountable toroidal field (TF) coils and close to the main plasma. As a result, it is possible to make highly accurate configuration control of the advanced divertor for HL-2M. The divertor target geometry of HL-2M has been designed to be compatible with different divertor configurations to study the divertor physics and support the high performance plasma operations. In this paper, the heat loads and impurities with different divertor configurations, including the standard X-point divertor, the snowflake-minus divertor and two tripod divertor configurations for HL-2M, are investigated by numerical simulations with the SOLPS5.0 code under the current design of the HL-2M divertor geometry. The plasmas with different conditions, such as the low discharge parameters with {{I}\\text{p}}   =  0.5 MA at the first stage of HL-2M and the high parameters with {{I}\\text{p}}   =  2.0 MA during the normal operations, are simulated. The heat load profiles and the impurity distributions are obtained, and the control of the peak heat load and the effect of impurity on the core plasma are discussed. The compatibility of different divertor configurations for HL-2M is also evaluated. It is seen that the excellent compatibility of different divertor configurations with the current divertor geometry has been verified. The results show that the snowflake-minus divertor and the tripod divertor with {{d}x}=30 \\text{cm} present good performance in terms of the heat load profiles and the impurity distributions under different conditions, which may not have a big effect on the core plasma. In addition, it is possible to optimize the distance between the two X-points, {{d}x} , to achieve a better

  19. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  20. Avian reovirus nonstructural protein p17-induced G(2)/M cell cycle arrest and host cellular protein translation shutoff involve activation of p53-dependent pathways.

    PubMed

    Chulu, Julius L C; Huang, Wei R; Wang, L; Shih, Wen L; Liu, Hung J

    2010-08-01

    The effects of avian reovirus (ARV) p17 protein on cell cycle progression and host cellular protein translation were studied. ARV infection and ARV p17 transfection resulted in the accumulation of infected and/or transfected cells in the G(2)/M phase of the cell cycle. The accumulation of cells in the G(2)/M phase was accompanied by upregulation and phosphorylation of the G(2)/M-phase proteins ATM, p53, p21(cip1/waf1), Cdc2, cyclin B1, Chk1, Chk2, and Cdc25C, suggesting that p17 induces a G(2)/M cell cycle arrest through activation of the ATM/p53/p21(cip1/waf1)/Cdc2/cyclin B1 and ATM/Chk1/Chk2/Cdc25C pathways. The G(2)/M cell cycle arrest resulted in increased virus replication. In the present study, we also provide evidence demonstrating that p17 protein is responsible for ARV-induced host cellular protein translation shutoff. Increased phosphorylation levels of the eukaryotic translation elongation factor 2 (eEF2) and initiation factor eIF2alpha and reduced phosphorylation levels of the eukaryotic translation initiation factors eIF4E, eIF4B, and eIF4G, as well as 4E-BP1 and Mnk-1 in p17-transfected cells, demonstrated that ARV p17 suppresses translation initiation factors and translation elongation factors to induce host cellular protein translation shutoff. Inhibition of mTOR by rapamycin resulted in a decrease in the levels of phosphorylated 4E-BP1, eIF4B, and eIF4G and an increase in the levels eEF2 but did not affect ARV replication, suggesting that ARV replication was not hindered by inhibition of cap-dependent translation. Taken together, our data indicate that ARV p17-induced G(2)/M arrest and host cellular translation shutoff resulted in increased ARV replication.

  1. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  2. A four-straight-line model for the proteinase-binding characteristics of human blood serum.

    PubMed Central

    Topping, R M; Seilman, S

    1979-01-01

    Kinetic evaluation of the capacity of human blood serum to form complexes with bovine trypsin generated partition profiles that may be approximated by a series of four intersecting straight lines. Such profiles are suggested to reflect the binding of trypsin to alpha 2-macroglobulin in a kinetically preferred mode (alpha-sites), followed by a subsidiary mode (beta-sites) and finally to alpha 1-antitrypsin. The form of the profile, in addition to revealing a hitherto unreported proteinase-binding capability of alpha 2-macroglobulin (beta-sites), also indicates that saturation of alpha-sites corresponds to a molar binding ratio of alpha 2-macroglobulin/trypsin of 1:2. Finally the profile provides, for certain pathological states, a clinically valuable characteristic. PMID:435247

  3. The Octahedral Sheet of Metamorphic 2M 1-Phengites: a Combined EMPA And AXANES Study

    SciTech Connect

    Cibin, G.; Cinque, G.; Marcelli, A.; Mottana, A.; Sassi, R.

    2009-05-12

    Two types of metamorphic phengites are known: one is linked to high pressure and is 3T; the other is 2M{sub 1}, and its composition is linked to rock-compositional constraints. This work investigates the octahedral sheet crystal-chemical differences between the two phengite types. Seven dioctahedral micas were studied: (1) one 3T phengite from an ultrahigh-pressure metagranitoid in the Dora Maira massif, Italy (P {approx} 4.3 GPa, T {approx} 730 C); (2) five 2M{sub 1} phengites from medium-P orthogneisses in the Eastern Alps metamorphic basement, Italy (P {le} 0.7 GPa, T {approx} 500-600 C); and (3) one 2M{sub 1} ferroan muscovite from pegmatite in Antarctica (P {le} 0.2 GPa, T {approx}500 C). All micas display significant extents of celadonite substitution. In particular, the 2M{sub 1}-phengite formulae (calculated on the basis of 11 O) have 0.68 < {sup IV}Al < 0.82 atoms per formula unit (apfu); octahedral atoms are dominated by Al (1.6-1.8 apfu), with minor and variable Fe (0.20-0.35 apfu) and Mg (0.05-0.17 apfu), and very minor Ti, Mn, and Cr. Total octahedral occupancies are slightly above 2.00 apfu, i.e., there seems to be partial occupancy of the third M site. For all micas, we recorded XAFS spectra on mosaics of carefully separated flakes oriented flat on a plastic support that could be rotated so as to account for the polarization of the synchrotron radiation beam, and we processed them on the basis of the AXANES theory. Spectra show angle-dependent absorption variations for Al and Fe, which can be deconvoluted and fitted by dichroic effects. Pre-edges consistently show most Fe to be Fe{sup 3+} and little angle-dependent intensity variations. The 2M{sub 1}-ferroan muscovite from Antarctica displays the same AXANES behavior as 2M{sub 1}-phengites. By contrast, the ultrahigh-pressure 3T-phengite from Dora Maira (having {sup IV}Al = 0.42 apfu, and Al and Mg as the dominant octahedral constituents) has XAFS spectra that differ significantly. Not only is the

  4. Clearance and binding of radiolabeled glycoproteins by cells of the murine mononuclear phagocyte system

    SciTech Connect

    Imber, M.J.

    1982-01-01

    The clearance and binding of radiolabeled lactoferrin and fast ..cap alpha../sub 2/-macroglobulin were studied. Both glycoproteins cleared rapidly following intravenous injection in mice, and both bound specifically to discrete receptors on murine peritoneal macrophages. The simultaneous presence of excess, unlabeled ligands specific for receptors recognizing terminal fucose, mannose, N-acetylglucosamine or galactose residues did not inhibit the clearance or binding of either lactoferrin or fast-..cap alpha../sub 2/M. The clearance and binding of enzymatically defucosylated lactoferrin was indistinguishable from native lactoferrin, indicating that terminal ..cap alpha..(1-3)-linked fucose on lactoferrin is not necessary for receptor recognition. The clearance and binding of two fast -..cap alpha../sub 2/M forms, ..cap alpha../sub 2/M-trypsin and ..cap alpha../sub 2/M-MeNH/sub 2/ cross compete with each other. Saturation binding studies indicated that the total binding of mannosyl -BSA, fusocyl-BSA, and N-acetylglucosaminyl-BSA to macrophages activated by BCG was approximately 15% of the levels observed with inflammatory macrophages elicited by thioglycollate broth. Cross-competition binding studies demonstrated a common surface receptor mediated binding of all three neoglycoprotein ligands and was identical to the receptor on mononuclear phagocytes that binds mannosyl- and N-acetylglucosaminyl-terminated glycoproteins. These results suggest that difference between discrete states of macrophage function may be correlated with selective changes in levels of the surface receptor for mannose-containing glycoproteins.

  5. VLSI architectures for computing multiplications and inverses in GF(2-m)

    NASA Technical Reports Server (NTRS)

    Wang, C. C.; Truong, T. K.; Shao, H. M.; Deutsch, L. J.; Omura, J. K.; Reed, I. S.

    1983-01-01

    Finite field arithmetic logic is central in the implementation of Reed-Solomon coders and in some cryptographic algorithms. There is a need for good multiplication and inversion algorithms that are easily realized on VLSI chips. Massey and Omura recently developed a new multiplication algorithm for Galois fields based on a normal basis representation. A pipeline structure is developed to realize the Massey-Omura multiplier in the finite field GF(2m). With the simple squaring property of the normal-basis representation used together with this multiplier, a pipeline architecture is also developed for computing inverse elements in GF(2m). The designs developed for the Massey-Omura multiplier and the computation of inverse elements are regular, simple, expandable and, therefore, naturally suitable for VLSI implementation.

  6. VLSI architectures for computing multiplications and inverses in GF(2m)

    NASA Technical Reports Server (NTRS)

    Wang, C. C.; Truong, T. K.; Shao, H. M.; Deutsch, L. J.; Omura, J. K.

    1985-01-01

    Finite field arithmetic logic is central in the implementation of Reed-Solomon coders and in some cryptographic algorithms. There is a need for good multiplication and inversion algorithms that are easily realized on VLSI chips. Massey and Omura recently developed a new multiplication algorithm for Galois fields based on a normal basis representation. A pipeline structure is developed to realize the Massey-Omura multiplier in the finite field GF(2m). With the simple squaring property of the normal-basis representation used together with this multiplier, a pipeline architecture is also developed for computing inverse elements in GF(2m). The designs developed for the Massey-Omura multiplier and the computation of inverse elements are regular, simple, expandable and, therefore, naturally suitable for VLSI implementation.

  7. THE WHITE DWARF COMPANION OF A 2 M{sub sun} NEUTRON STAR

    SciTech Connect

    Bhalerao, Varun B.; Kulkarni, S. R.

    2011-08-10

    We report the optical discovery of the companion to the 2 M{sub sun} millisecond pulsar PSR J1614-2230. The optical colors show that the 0.5 M{sub sun} companion is a 2.2 Gyr old He-CO white dwarf. We infer that M-dot during the accretion phase is <10{sup -2} M-dot{sub edd}. We show that the pulsar was born with a spin close to its current value, well below the rebirth line. The spin-down parameters, the mass of the pulsar, and the age of the system challenge the simple recycling model for the formation of millisecond pulsars.

  8. The Construction of M2M System with Sensor Networks Using Digital Plethysmograph Sensor

    NASA Astrophysics Data System (ADS)

    Segawa, Norihisa; Asakawa, Kazuhisa; Takahashi, Yoshitsugu; Yamada, Tomoko; Togashi, Atsushi; Sawamoto, Jun

    In recent years, the research of sensor networks advances and it is expected to be used in a wide variety of fields such as traceability system of products, environmental monitoring, health care, etc. We develop a M2M system with the sensor network technology for collection and analysis of the state of health and feedback of advices for better physical activity without human intervention. The system detects abnormality from pulse wave data from pulse wave sensor attached to the user. In this paper, we construct M2M sensor network system with continuous monitoring of arterial pulse wave and an advice generation function based on pr-installed rules, then we evaluate the usefulness of the system through experiment.

  9. Cell Cycle Arrest by a Natural Product via G2/M Checkpoint

    PubMed Central

    2005-01-01

    CKBM is a natural product that exhibits a novel anti-tumor activity through the induction of cell cycle arrest and apoptosis. We have investigated its effects on cell cycle regulation using a gastric cancer cell line, AGS. The effects of CKBM on cell proliferation, cell cycle regulation and apoptosis were analyzed using BrdU (5-bromo-2'-deoxyuridine) cell proliferation assay and flow cytometric analysis, respectively. Specific cellular protein expressions were measured using Western blot analysis. Flow cytometric analysis indicated that CKBM induced G2/M cell cycle arrest and apoptosis, whereas differential protein expressions of p21, p53 and 14-3-3σ (stratifin) using Western blot analysis were enhanced. The differential expressions of p21, p53 and 14-3-3σ in AGS cancer cells after CKBM treatment may play critical roles in the G2/M cell cycle arrest that blocks cell proliferation and induces apoptosis. PMID:15968342

  10. A new antitumor arabinopyranoside from Laurencia majuscula induces G2/M cell cycle arrest.

    PubMed

    Du, Bin; Zhong, Xueyun; Liao, Xiaojian; Xu, Wenjie; Zhou, Xulong; Xu, Shihai

    2010-10-01

    A new arabinopyranoside was isolated from the alga Laurencia majuscula (Harvey) Lucas, collected from the Xisha Islands in the South China Sea. Its structure was elucidated as hexadecyl-1-O-α-L-arabinopyranoside by spectroscopic analysis. It was found that arabinopyranoside had significant antitumor activity in LOVO and Bel-7402 cell lines. Flow cytometric analysis showed that arabinopyranoside arrested the cell cycle in the G2/M phase. Western blotting demonstrated that the protein expression of CDK1 and cyclin A related to the G2/M phase decreased markedly with arabinopyranoside treatment, with slight changes in cyclin B1 expression. Taken together, the findings identify a potential new antitumor therapeutic arabinopyranoside isolated from red alga Laurencia majuscula.

  11. 25. Perimeter acquisition radar building room #2M4, (mezzanine), power supply ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. Perimeter acquisition radar building room #2M4, (mezzanine), power supply room; computer power supply on left and water flow on right. This room is directly below data processing area (room #318). Sign on right reads: High purity water digital rack - Stanley R. Mickelsen Safeguard Complex, Perimeter Acquisition Radar Building, Limited Access Area, between Limited Access Patrol Road & Service Road A, Nekoma, Cavalier County, ND

  12. Operation of the University of Hawaii 2.2M Telescope on Mauna Kea

    NASA Technical Reports Server (NTRS)

    McLaren, Robert A.

    1999-01-01

    This paper presents a final report from March 1, 1997-February 28, 1999 on the Operation of the University of Hawaii 2.2M Telescope on Mauna Kea. The topics include: 1) Telescope and Instrumentation (Newsletter and Documentation, Scheduling Periods); and 2) Scientific Highlights (The Outer Solar System-Trans-Neptunian Objects and the Kuiper Belt, Comet Hale-Bopp, Near-Earth Asteroids, Asteroid Families, and Galileo Mission Support).

  13. Industry 4.0, M2m, Iot&S - All Equal?

    NASA Astrophysics Data System (ADS)

    Dobrin, Carmen

    2014-11-01

    Similarity between Industry 4.0, M2M, IOT&S. Advantages and disadvantages obtained using this three important methods. Decreasing costs while components are getting smaller and smaller in a world with better networking. Influence of business management applications integrated in smart factory logistic. The most important impacts in merging virtual and real production world, with the improvement of best processes having the same goal: creating value by open innovation

  14. LiMO{sub 2} (M=Mn, Fe, and Co): Energetics, polymorphism and phase transformation

    SciTech Connect

    Wang Miaojun; Navrotsky, Alexandra . E-mail: anavrotsky@ucdavis.edu

    2005-04-15

    LiMO{sub 2} materials (M=Mn, Fe, and Co) with different structures were synthesized and their enthalpies of formation from oxides (Li{sub 2}O and M{sub 2}O{sub 3}, M=Mn and Fe), or from oxides (Li{sub 2}O and CoO) plus oxygen at 25{sup o}C were determined by high-temperature oxide melt solution calorimetry. The relative stability of the polymorphs of the compound LiMO{sub 2} was established based on their enthalpies of formation. Phase transformations in LiFeO{sub 2} were investigated by differential scanning calorimetry and high-temperature oxide melt solution calorimetry. The phase transition enthalpies at 25{sup o}C for {beta}->{alpha}, {gamma}->{beta}, and {gamma}->{alpha} are 4.9+/-0.7, 4.3+/-0.8 and 9.2+/-0.9kJ/mol, respectively. Thus the {gamma} phase (ordered cations) is the stable form of LiFeO{sub 2} at room temperature, the {alpha} phase (disordered cations) is stable at high temperature and the {beta} phase may have a stability field at intermediate temperatures.

  15. NPM phosphorylation stimulates Cdk1, overrides G2/M checkpoint and increases leukemic blasts in mice.

    PubMed

    Du, Wei; Zhou, Yun; Pike, Suzette; Pang, Qishen

    2010-02-01

    An elevated level of nucleophosmin (NPM) is often found in actively proliferative cells including human tumors. To identify the regulatory role for NPM phosphorylation in proliferation and cell cycle control, a series of mutants targeting the consensus cyclin-dependent kinase (CDK) phosphorylation sites was created to mimic or abrogate either single-site or multi-site phosphorylation. Simultaneous inactivation of two CDK phosphorylation sites at Ser10 and Ser70 (NPM-AA) induced G(2)/M cell cycle arrest, phosphorylation of Cdk1 at Tyr15 (Cdc2(Tyr15)) and increased cytoplasmic accumulation of Cdc25C. Strikingly, stress-induced Cdk1(Tyr15) and Cdc25C sequestration was suppressed by expression of a phosphomimetic NPM mutant created on the same CDK sites (S10E/S70E, NPM-EE). Further analysis revealed that phosphorylation of NPM at both Ser10 and Ser70 was required for proper interaction between Cdk1 and Cdc25C. Moreover, NPM-EE directly bound to Cdc25C and prevented phosphorylation of Cdc25C at Ser216 during mitosis. Finally, NPM-EE overrided stress-induced G(2)/M arrest and increased leukemia blasts in a NOD/SCID xenograft model. Thus, these findings reveal a novel function of NPM on regulation of cell cycle progression, in which phosphorylation of NPM controls cell cycle progression at G(2)/M transition through modulation of Cdk1 and Cdc25C activities.

  16. RESTful M2M gateway for remote wireless monitoring for district central heating networks.

    PubMed

    Cheng, Bo; Wei, Zesan

    2014-11-27

    In recent years, the increased interest in energy conservation and environmental protection, combined with the development of modern communication and computer technology, has resulted in the replacement of distributed heating by central heating in urban areas. This paper proposes a Representational State Transfer (REST) Machine-to-Machine (M2M) gateway for wireless remote monitoring for a district central heating network. In particular, we focus on the resource-oriented RESTful M2M gateway architecture, and present an uniform devices abstraction approach based on Open Service Gateway Initiative (OSGi) technology, and implement the resource mapping mechanism between resource address mapping mechanism between RESTful resources and the physical sensor devices, and present the buffer queue combined with polling method to implement the data scheduling and Quality of Service (QoS) guarantee, and also give the RESTful M2M gateway open service Application Programming Interface (API) set. The performance has been measured and analyzed. Finally, the conclusions and future work are presented.

  17. RESTful M2M Gateway for Remote Wireless Monitoring for District Central Heating Networks

    PubMed Central

    Cheng, Bo; Wei, Zesan

    2014-01-01

    In recent years, the increased interest in energy conservation and environmental protection, combined with the development of modern communication and computer technology, has resulted in the replacement of distributed heating by central heating in urban areas. This paper proposes a Representational State Transfer (REST) Machine-to-Machine (M2M) gateway for wireless remote monitoring for a district central heating network. In particular, we focus on the resource-oriented RESTful M2M gateway architecture, and present an uniform devices abstraction approach based on Open Service Gateway Initiative (OSGi) technology, and implement the resource mapping mechanism between resource address mapping mechanism between RESTful resources and the physical sensor devices, and present the buffer queue combined with polling method to implement the data scheduling and Quality of Service (QoS) guarantee, and also give the RESTful M2M gateway open service Application Programming Interface (API) set. The performance has been measured and analyzed. Finally, the conclusions and future work are presented. PMID:25436650

  18. Dynamic RACH Partition for Massive Access of Differentiated M2M Services.

    PubMed

    Du, Qinghe; Li, Wanyu; Liu, Lingjia; Ren, Pinyi; Wang, Yichen; Sun, Li

    2016-01-01

    In machine-to-machine (M2M) networks, a key challenge is to overcome the overload problem caused by random access requests from massive machine-type communication (MTC) devices. When differentiated services coexist, such as delay-sensitive and delay-tolerant services, the problem becomes more complicated and challenging. This is because delay-sensitive services often use more aggressive policies, and thus, delay-tolerant services get much fewer chances to access the network. To conquer the problem, we propose an efficient mechanism for massive access control over differentiated M2M services, including delay-sensitive and delay-tolerant services. Specifically, based on the traffic loads of the two types of services, the proposed scheme dynamically partitions and allocates the random access channel (RACH) resource to each type of services. The RACH partition strategy is thoroughly optimized to increase the access performances of M2M networks. Analyses and simulation demonstrate the effectiveness of our design. The proposed scheme can outperform the baseline access class barring (ACB) scheme, which ignores service types in access control, in terms of access success probability and the average access delay. PMID:27043568

  19. RESTful M2M gateway for remote wireless monitoring for district central heating networks.

    PubMed

    Cheng, Bo; Wei, Zesan

    2014-01-01

    In recent years, the increased interest in energy conservation and environmental protection, combined with the development of modern communication and computer technology, has resulted in the replacement of distributed heating by central heating in urban areas. This paper proposes a Representational State Transfer (REST) Machine-to-Machine (M2M) gateway for wireless remote monitoring for a district central heating network. In particular, we focus on the resource-oriented RESTful M2M gateway architecture, and present an uniform devices abstraction approach based on Open Service Gateway Initiative (OSGi) technology, and implement the resource mapping mechanism between resource address mapping mechanism between RESTful resources and the physical sensor devices, and present the buffer queue combined with polling method to implement the data scheduling and Quality of Service (QoS) guarantee, and also give the RESTful M2M gateway open service Application Programming Interface (API) set. The performance has been measured and analyzed. Finally, the conclusions and future work are presented. PMID:25436650

  20. The ASTRI SST-2M prototype for the Cherenkov Telescope Array: primary mirror characterization by deflectometry

    NASA Astrophysics Data System (ADS)

    Sironi, Giorgia; Canestrari, Rodolfo

    2015-09-01

    In 2014 the ASTRI Collaboration, led by the Italian National Institute for Astrophysics, has constructed an end-to-end prototype of a dual-mirror imaging air Cherenkov telescope, proposed for the small size class of telescopes for the Cherenkov Telescope Array. The prototype, named ASTRI SST-2M, has been installed at the observing station located at Serra La Nave (Italy). In this project the Brera Astronomical Observatory was responsible for the production and the testing of the primary mirror. The ASTRI SST-2M telescope's primary mirror has an aperture of ~ 4 m, a polynomial design, and consists of 18 individual hexagonal facets. These characteristics require the production and testing of panels with a typical size of ~1 m vertex-to-vertex and with an aspheric component of up to several millimetres. The mirror segments were produced assembling a sandwich of thin glass foils bent at room temperature to reach the desired shape. For the characterization of the mirrors we developed an ad-hoc deflectometry facility that works as an inverse Ronchi test in combination with a ray-tracing code. In this contribution we report the results of the deflectometric measurements performed on the primary mirror segments of the ASTRI SST-2M dual mirror telescope. The expected point spread function and the contributions to the degradation of the image quality are studied.

  1. Dynamic RACH Partition for Massive Access of Differentiated M2M Services.

    PubMed

    Du, Qinghe; Li, Wanyu; Liu, Lingjia; Ren, Pinyi; Wang, Yichen; Sun, Li

    2016-03-30

    In machine-to-machine (M2M) networks, a key challenge is to overcome the overload problem caused by random access requests from massive machine-type communication (MTC) devices. When differentiated services coexist, such as delay-sensitive and delay-tolerant services, the problem becomes more complicated and challenging. This is because delay-sensitive services often use more aggressive policies, and thus, delay-tolerant services get much fewer chances to access the network. To conquer the problem, we propose an efficient mechanism for massive access control over differentiated M2M services, including delay-sensitive and delay-tolerant services. Specifically, based on the traffic loads of the two types of services, the proposed scheme dynamically partitions and allocates the random access channel (RACH) resource to each type of services. The RACH partition strategy is thoroughly optimized to increase the access performances of M2M networks. Analyses and simulation demonstrate the effectiveness of our design. The proposed scheme can outperform the baseline access class barring (ACB) scheme, which ignores service types in access control, in terms of access success probability and the average access delay.

  2. Cosmological parameters from the comparison of peculiar velocities with predictions from the 2M++ density field

    NASA Astrophysics Data System (ADS)

    Hudson, Michael J.; Carrick, Jonathan; Turnbull, Stephen J.; Lavaux, Guilhem

    2016-10-01

    Using redshifts from the 2M++ redshift compilation, we reconstruct the density of galaxies within 200 h -1 Mpc, and compare the predicted peculiar velocities Tully-Fisher and SNe peculiar velocities. The comparison yields a best-fit value of β ≡ Ωm 0.55/b* = 0.431 +/- 0.021, suggesting Ωm 0.55σ8,lin = 0.401 +/- 0.024, in good agreement with other probes. The predicted peculiar velocity of the Local Group from sources within the 2M++ volume is 540 +/- 40 km s-1, towards l = 268° +/- 4°, b = 38° +/- 6°, which is misaligned by only 10° with the Cosmic Microwave Background dipole. To account for sources outside the 2M++ volume, we fit simultaneously for β* and an external bulk flow in our analysis. The external bulk flow has a velocity of 159 +/- 23 km s-1 towards l = 304° +/- 11°, b6° +/- 13°.

  3. Dynamic RACH Partition for Massive Access of Differentiated M2M Services

    PubMed Central

    Du, Qinghe; Li, Wanyu; Liu, Lingjia; Ren, Pinyi; Wang, Yichen; Sun, Li

    2016-01-01

    In machine-to-machine (M2M) networks, a key challenge is to overcome the overload problem caused by random access requests from massive machine-type communication (MTC) devices. When differentiated services coexist, such as delay-sensitive and delay-tolerant services, the problem becomes more complicated and challenging. This is because delay-sensitive services often use more aggressive policies, and thus, delay-tolerant services get much fewer chances to access the network. To conquer the problem, we propose an efficient mechanism for massive access control over differentiated M2M services, including delay-sensitive and delay-tolerant services. Specifically, based on the traffic loads of the two types of services, the proposed scheme dynamically partitions and allocates the random access channel (RACH) resource to each type of services. The RACH partition strategy is thoroughly optimized to increase the access performances of M2M networks. Analyses and simulation demonstrate the effectiveness of our design. The proposed scheme can outperform the baseline access class barring (ACB) scheme, which ignores service types in access control, in terms of access success probability and the average access delay. PMID:27043568

  4. A New Home for NEAT on the 1.2m/B37 at AMOS

    NASA Astrophysics Data System (ADS)

    Talent, D. L.; Maeda, R.; Walton, S.; Hsu, Y.; Cameron, B.; Kervin, P.

    2000-05-01

    The NASA/JPL Near Earth Asteroid Tracking (NEAT) Program was in operation using the Maui GEODSS as its observing platform for about three years starting in late 1995 and continuing into 1998. In October of 1998 the NASA/AFSPC Near Earth Object Working Group (NEOWG) recommended that the NASA/JPL NEAT program be moved to the AMOS 1.2m/B37 telescope. This paper describes the technical efforts that were required to facilitate the move. The task requirements specified that the modified 1.2m/B37 system be capable of producing a field of view (FOV) greater than or equal to 1.4 deg. X 1.4 deg. at the NEAT camera focal plane. Further, it was specified that no modifications be made to the 1.2m/B37 mirror or the NASA/JPL camera. Thus, activity focused on the development of suitable focal reduction optics (FRO). A new headring and spider, based on the original design, were also built to receive the NEAT FRO and the NASA/JPL camera. Operation of the NEAT system, for asteroid search and discovery, will be autonomous and remotely directed from NASA/JPL. Finally, the potential for use of the NEAT system as regards the satellite metric mission will also be presented.

  5. New home for NEAT on the 1.2m/B37 at AMOS

    NASA Astrophysics Data System (ADS)

    Talent, David L.; Maeda, Riki; Walton, Steve R.; Sydney, Paul F.; Hsu, Yuling; Cameron, Bruce A.; Kervin, Paul W.; Helin, Eleanor F.; Pravdo, Steven H.; Lawrence, Kenneth; Rabinowitz, David

    2000-10-01

    The NASA/JPL Near Earth Asteroid Tracking (NEAT) Program was in operation using the Maui GEODSS as its observing platform for about three years starting in late 1995 and continuing into 1998. In October of 1998 the NASA/AFSPC Near Earth Object Working Group (NEOWG) recommended that the NASA/JPL NEAT program be moved to the AMOS 1.2 m/B37 telescope. This paper describes the technical efforts that were required to facilitate the move. The task requirements specified that the modified 1.2 m/B37 system be capable of producing a field of view (FOV) greater than or equal to 1.4 degrees X 1.4 degrees at the NEAT camera focal plane. Further, it was specified that no modifications be made to the 1.2 m/B37 mirror or the NASA/JPL camera. Thus, activity focused on the development of suitable focal reduction optics (FRO). A new headring and spider, based on the original design, were also built to receive the NEAT FRO and the NASA/JPL camera. Operation of the NEAT system, for asteroid search and discovery, will be autonomous and remotely directed from NASA/JPL. Finally, the potential for use of the NEAT system as regards the satellite metric mission will also be presented.

  6. The camera of the ASTRI SST-2M prototype for the Cherenkov Telescope Array

    NASA Astrophysics Data System (ADS)

    Catalano, Osvaldo; Maccarone, Maria C.; Gargano, Carmelo; La Rosa, Giovanni; Segreto, Alberto; Sottile, Giuseppe; De Caprio, Vincenzo; Russo, Francesco; Capalbi, Milvia; Sangiorgi, Pierluca; Bonanno, Giovanni; Grillo, Alessandro; Garozzo, Salvatore; Marano, Davide; Billotta, Sergio; Romeo, Giuseppe; Stringhetti, Luca; Fiorini, Mauro; La Palombara, Nicola; Incorvaia, Salvatore; Toso, Giorgio; Impiombato, Domenico; Giarrusso, Salvatore

    2014-07-01

    In the context of the Cherenkov Telescope Array observatory project, the ASTRI SST-2M end-to-end prototype telescope, entirely supported by the Italian National Institute of Astrophysics, is designed to detect cosmic primary gamma ray energies from few TeV up to hundreds of TeV. The ASTRI SST-2M prototype camera is part of the challenging synergy of novel optical design, camera sensors, front-end electronics and telescope structure design. The camera is devoted to imaging and recording the Cherenkov images of air showers induced by primary particles into the Earth's atmosphere. In order to match the energy range mentioned above, the camera must be able to trigger events within a few tens of nanoseconds with high detection efficiency. This is obtained by combining silicon photo-multiplier sensors and suitable front-end electronics. Due to the characteristic imprint of the Cherenkov image that is a function of the shower core distance, the signal dynamic range of the pixels and consequently of the front-end electronics must span three orders of magnitude (1:1000 photo-electrons). These and many other features of the ASTRI SST-2M prototype camera will be reported in this contribution together with a complete overview of the mechanical and thermodynamic camera system.

  7. Actinobacillus actinomycetemcomitans toxin induces both cell cycle arrest in the G2/M phase and apoptosis.

    PubMed

    Ohguchi, M; Ishisaki, A; Okahashi, N; Koide, M; Koseki, T; Yamato, K; Noguchi, T; Nishihara, T

    1998-12-01

    We found that the culture supernatant of the periodontopathic bacterium Actinobacillus actinomycetemcomitans had a cytotoxic effect on several cell lines. In this study, we purified the toxin from the culture supernatant of A. actinomycetemcomitans Y4 by a four-step procedure: ammonium sulfate precipitation, POROS HQ/M column chromatography, polymyxin B matrix column chromatography, and Mono-Q column chromatography. The purified toxin gave two major bands of protein with molecular masses of 80 and 85 kDa upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The mechanism of cell death of the B-cell hybridoma cell line HS-72 was examined by observing changes in nuclear morphology, an increase in the proportion of fragmented DNA, and the typical ladder pattern of degraded chromosomal DNA, indicating the induction of apoptosis. Overexpression of human Bcl-2 suppressed apoptosis in HS-72 cells, indicating that the toxin from A. actinomycetemcomitans induces apoptosis by a Bcl-2-inhibitable mechanism. Flow cytometric analysis revealed that the toxin caused cell cycle arrest in the G2/M phase and apoptosis in HS-72 cells. In addition, aurintricarboxylic acid, a DNA endonuclease inhibitor, markedly decreased the percentage of apoptotic cells but had no effect on cell cycle arrest in the G2/M phase. Taken together, these findings suggest that the toxin from A. actinomycetemcomitans could mediate the development of periodontal diseases through cell cycle arrest in the G2/M phase and apoptosis in B lymphocytes of periodontal tissue. PMID:9826381

  8. S2M: A Stochastic Simulation Model of Poliovirus Genetic State Transition

    PubMed Central

    Ecale Zhou, Carol L.

    2016-01-01

    Modeling the molecular mechanisms that govern genetic variation can be useful in understanding the dynamics that drive genetic state transition in quasispecies viruses. For example, there is considerable interest in understanding how the relatively benign vaccine strains of poliovirus eventually revert to forms that confer neurovirulence and cause disease (ie, vaccine-derived poliovirus). This report describes a stochastic simulation model, S2M, which can be used to generate hypothetical outcomes based on known mechanisms of genetic diversity. S2M begins with predefined genotypes based on the Sabin-1 and Mahoney wild-type sequences, constructs a set of independent cell-based populations, and performs in-cell replication and cell-to-cell infection cycles while quantifying genetic changes that track the transition from Sabin-1 toward Mahoney. Realism is incorporated into the model by assigning defaults for variables that constrain mechanisms of genetic variability based roughly on metrics reported in the literature, yet these values can be modified at the command line in order to generate hypothetical outcomes driven by these parameters. To demonstrate the utility of S2M, simulations were performed to examine the effects of the rates of replication error and recombination and the presence or absence of defective interfering particles, upon reaching the end states of Mahoney resemblance (semblance of a vaccine-derived state), neurovirulence, genome fitness, and cloud diversity. Simulations provide insight into how modeled biological features may drive hypothetical outcomes, independently or in combination, in ways that are not always intuitively obvious. PMID:27385911

  9. Signature of the Superatom to Superhalogen Behavior of Aun(BO2)m clusters

    NASA Astrophysics Data System (ADS)

    Kandalam, Anil; Gotz, Matthias; Willis, Mary; Gantefor, Gerd; Jena, Puru

    2010-03-01

    We report the discovery of a new class of clusters consisting of Aun(BO2)m which formed during the oxygenation of gold clusters when boron nitride was used as insulation in the pulsed arc cluster ion source (PACIS). Using DFT based calculations, we trace the origin of these species to be due to the unusual stability of the BO2 moiety as well as shed light on their formation process. PES measurements and the corresponding DFT calculations further reveal some rather remarkable properties of Aun(BO2)m clusters such as large HOMO-LUMO gaps in the range of 3.00 eV -- 3.95 eV and electron affinities substantially larger than that of F, the most electronegative element in the periodic table. In addition, some of the most predominant features of the electronic structure of the bare Au clusters, namely odd-even alternation in the electron affinity, are preserved in the Aun(BO2) species. The synergy between theory and experiment illustrates that Aun(BO2)m clusters, behave as superatoms and superhalogens, opening the door for the synthesis of a new class of cluster-assembled materials.

  10. Characterization of the 5' and 3' untranslated regions in murine mdm2 mRNAs.

    PubMed

    Mendrysa, S M; McElwee, M K; Perry, M E

    2001-02-01

    The murine double minute 2 (mdm2) gene is essential for embryogenesis in mice that express the p53 tumor suppressor protein. Mdm2 levels must be regulated tightly because overexpression of mdm2 contributes to tumorigenesis. We investigated whether the 5' and 3' untranslated regions (UTRs) of murine mdm2 affect the expression of MDM2 proteins. Induction of mdm2 expression by p53 results in synthesis of an mdm2 mRNA with a short 5' UTR. The long 5' UTR increases internal initiation of translation of a minor MDM2 protein, p76(MDM2), without affecting the efficiency of translation of the full-length p90(MDM2). We discovered two alternative 3' untranslated regions in murine mdm2 mRNA expressed in the testis. The longer 3' UTR contains a consensus instability element, but mdm2 mRNAs containing the long and short 3' UTRs have comparable half-lives. The 3' UTRs do not affect either initiation codon use or translation efficiency. Thus, the murine 5' UTR, but not the 3'UTR, influences the ratio of the two MDM2 proteins but neither UTR affects MDM2 abundance significantly.

  11. Elimination of protease-inhibitor complexes from the arthritic joint.

    PubMed

    Ekerot, L; Ohlsson, K; Necking, L

    1985-01-01

    In the rheumatic joint, destructive proteolytic enzymes are released and counteracted by complexation to the predominant inhibitors alpha 2-macroglobulin and alpha 1-antitrypsin. The articular elimination of these complexes is thought to be of decisive importance in the protease-inhibitor interplay influencing the inhibitory capacity of the synovial fluid. Protease-alpha 2-macroglobulin complexes showed an intraarticular half-life shorter than 2 hours in arthritis and were eliminated by various routes including phagocytosis in cells of the synovial membrane and in regional lymph nodes, in addition to haematogenous resorption and uptake in the liver. The phagocytosed complexes were degraded to low-molecular-weight metabolites excretable in the urine. The articular elimination of elastase-alpha 1-antitrypsin complexes seemed to be an equivalent process, but an additional intrasynovial dissociation of the complexes was also indicated. Thus the intraarticularly released elastase seemed to be bound and eliminated in complex with alpha 2-macroglobulin. PMID:2414244

  12. [Expressions of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 in chronic myeloid leukemia cells].

    PubMed

    Wang, Wei-Liang; Shen, Ti; Hui, Yu-Rong; Gu, Xi-Chun; Li, Rong-Sheng

    2006-06-01

    This study was aimed to explore the expression of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 in bcr/abl fusion gene positive CML cells, and to study the effects of P210(bcr/abl) fusion protein tyrosine kinase on expression of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 mRNAs in chronic myeloid leukemia cells. The expression levels of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 mRNA were detected by semi-quantitative RT-PCR in bcr/abl negative cells, bcr/abl positive cells, and P210(bcr/abl)-Rb-C-Box positive cells. The results showed that MIP-1alpha and CCR-1 mRNAs were expressed in bcr/abl negative cells, but not in positive cells. Both MCP-1 and CCR-2 mRNA cannot be detected in both bcr/abl positive and negative cells. After inhibiting P210(bcr/abl) tyrosine kinase activity by Rb-C-Box, expressions of MIP-1alpha and CCR-1 mRNAs were restored to normal (similar to P210(bcr/abl) negative cells). It is concluded that P210(bcr/abl) fusion protein inhibits the expression of MIP-1alpha and CCR-1 in chronic myeloid leukemia cells, but does not inhibit MCP-1 and CCR-2 mRNA expressions in these leukemia cells.

  13. [Expressions of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 in chronic myeloid leukemia cells].

    PubMed

    Wang, Wei-Liang; Shen, Ti; Hui, Yu-Rong; Gu, Xi-Chun; Li, Rong-Sheng

    2006-06-01

    This study was aimed to explore the expression of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 in bcr/abl fusion gene positive CML cells, and to study the effects of P210(bcr/abl) fusion protein tyrosine kinase on expression of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 mRNAs in chronic myeloid leukemia cells. The expression levels of MIP-1alpha, MCP-1 and their receptors CCR-1, CCR-2 mRNA were detected by semi-quantitative RT-PCR in bcr/abl negative cells, bcr/abl positive cells, and P210(bcr/abl)-Rb-C-Box positive cells. The results showed that MIP-1alpha and CCR-1 mRNAs were expressed in bcr/abl negative cells, but not in positive cells. Both MCP-1 and CCR-2 mRNA cannot be detected in both bcr/abl positive and negative cells. After inhibiting P210(bcr/abl) tyrosine kinase activity by Rb-C-Box, expressions of MIP-1alpha and CCR-1 mRNAs were restored to normal (similar to P210(bcr/abl) negative cells). It is concluded that P210(bcr/abl) fusion protein inhibits the expression of MIP-1alpha and CCR-1 in chronic myeloid leukemia cells, but does not inhibit MCP-1 and CCR-2 mRNA expressions in these leukemia cells. PMID:16800914

  14. Serum elastase and its inhibitors in the blood of heavily burnt patients.

    PubMed

    Miskulin, M; Moati, F; Robert, A M; Robert, L; Monteil, R; Guilbaud, J

    1978-09-01

    Serum elastase and its inhibitors were determined in the sera of heavily burnt patients. Serum elastase levels were elevated at two to eight days after a severe burn-accident and returned towards normal values from the 10th day on. Both alpha1-antitrypsin and alpha2-macroglobulin levels were also elevated in the sera of heavily burnt patients. alpha1-Antitrypsin showed a parallel evolution to the elastase level but alpha2-macroglobulin followed a somewhat different time curve. Plasminogen and antithrombin were not elevated significantly. It is suggested that serum elastase may play a role in tissue degradation in burnt patients.

  15. Inhibitory effect of isoamericanol A from Jatropha curcas seeds on the growth of MCF-7 human breast cancer cell line by G2/M cell cycle arrest.

    PubMed

    Katagi, Ayako; Sui, Li; Kamitori, Kazuyo; Suzuki, Toshisada; Katayama, Takeshi; Hossain, Akram; Noguchi, Chisato; Dong, Youyi; Yamaguchi, Fuminori; Tokuda, Masaaki

    2016-01-01

    Although various parts of J. curcas (Jatropha curcas L., Euphorbiaceae) have long been used as traditional folk medicines for their antiviral, analgesic, and/or antidotal efficacies, we are the first to investigate the role of anti-carcinogenicity of isoamericanol A (IAA) from the seed extract. Our results showed that IAA is capable of inhibiting cell proliferation in a dose-dependent manner on the human cancer cell lines of MCF-7, MDA-MB231, HuH-7, and HeLa. Flow cytometry analysis showed IAA significantly induces cell cycle arrest at G2/M on MCF-7 cells. At both protein and mRNA levels examined by western blot and real-time PCR, the results revealed increased expression of BTG2 (B-cell translocation gene 2), p21 (p21(WAF1/CIPI) ), and GADD45A (growth arrest and DNA-damage-inducible, alpha) after IAA treatment, but inversed expression in CDK1 (cyclin-dependent kinase 1) and cyclins B1 and B2. All these effects contribute to G2/M cell cycle arrest. Furthermore, these results coincide with the changes in molecular expressions determined by DNA-microarray analysis. Our findings indicate that IAA has an inhibitory effect on cell proliferation of MCF-7 through cell cycle arrest, giving it great potential as a future therapeutic reagent for cancers. PMID:27441238

  16. Cell-cycle-dependent changes in ceramide levels preceding retinoblastoma protein dephosphorylation in G2/M.

    PubMed Central

    Lee, J Y; Leonhardt, L G; Obeid, L M

    1998-01-01

    Ceramide functions as a growth-inhibitory lipid-signalling molecule and might have a role in mediating the effects of extracellular agents on cell growth, differentiation and senescence. Here we investigate the roles of ceramide in cell cycle progression. With the use of the model of serum withdrawal, we were able to synchronize Wi-38 human diploid fibroblasts at different stages of cell cycle. Serum stimulation resulted in G0 to G1/S progression as determined by flow cytometric analysis and [3H]thymidine incorporation. Analyses of endogenous ceramide levels demonstrated that ceramide levels remained relatively constant on serum stimulation, indicating that ceramide might not be critical during G1/S transition. Treating exponentially growing Wi-38 human diploid fibroblasts with nocodazole led to cell cycle arrest at the G2/M phase of the cell cycle; 2 h after the removal of nocodazole, retinoblastoma (Rb) protein became dephosphorylated and the cells exited from G2/M and moved to the G1 phase of the new cycle. When cells were released from G2/M block by nocodazole, and before Rb protein dephosphorylation, endogenous ceramide levels transiently increased up to 2-fold at 0.5 h after the removal of nocodazole. Fumonisin B1, an inhibitor of ceramide synthase, inhibited the elevation of ceramide levels. Desipramine and SR33557, both acid sphingomyelinase inhibitors, did not have an appreciable effect on the elevation of ceramide levels. Furthermore, fumonisin B1 inhibited Rb protein dephosphorylation induced by endogenous ceramide but not by exogenous ceramide. These results demonstrate for the first time changes in ceramide during cell cycle progression and suggest that ceramide synthesized de novo might function as an endogenous modulator of Rb protein and cell cycle progression. PMID:9716505

  17. Towards Efficient Mobile M2M Communications: Survey and Open Challenges

    PubMed Central

    Pereira, Carlos; Aguiar, Ana

    2014-01-01

    Machine-to-Machine (M2M) communications enable networked devices and services to exchange information and perform actions seamlessly without the need for human intervention. They are viewed as a key enabler of the Internet of Things (IoT) and ubiquitous applications, like mobile healthcare, telemetry, or intelligent transport systems. We survey existing work on mobile M2M communications, we identify open challenges that have a direct impact on performance and resource usage efficiency, especially the impact on energy efficiency, and we review techniques to improve communications. We review the ETSI standard and application protocols, and draw considerations on the impact of their use in constrained mobile devices. Nowadays, smartphones are equipped with a wide range of embedded sensors, with varied local and wide area connectivity capabilities, and thus they offer a unique opportunity to serve as mobile gateways for other more constrained devices with local connectivity. At the same time, they can gather context data about users and environment from the embedded sensors. These capabilities may be crucial for mobile M2M applications. Finally, in this paper, we consider a scenario where smartphones are used as gateways that collect and aggregate data from sensors in a cellular network. We conclude that, in order for their use to the feasible in terms of a normal depletion time of a smartphone's battery, it is a good advice to maximize the collection of data necessary to be transmitted from nearby sensors, and maximize the intervals between transmissions. More research is required to devise energy efficient transmission methods that enable the use of smartphones as mobile gateways. PMID:25333291

  18. Towards efficient mobile M2M communications: survey and open challenges.

    PubMed

    Pereira, Carlos; Aguiar, Ana

    2014-10-20

    Machine-to-Machine (M2M) communications enable networked devices and services to exchange information and perform actions seamlessly without the need for human intervention. They are viewed as a key enabler of the Internet of Things (IoT) and ubiquitous applications, like mobile healthcare, telemetry, or intelligent transport systems. We survey existing work on mobile M2M communications, we identify open challenges that have a direct impact on performance and resource usage efficiency, especially the impact on energy efficiency, and we review techniques to improve communications. We review the ETSI standard and application protocols, and draw considerations on the impact of their use in constrained mobile devices. Nowadays, smartphones are equipped with a wide range of embedded sensors, with varied local and wide area connectivity capabilities, and thus they offer a unique opportunity to serve as mobile gateways for other more constrained devices with local connectivity. At the same time, they can gather context data about users and environment from the embedded sensors. These capabilities may be crucial for mobile M2M applications. Finally, in this paper, we consider a scenario where smartphones are used as gateways that collect and aggregate data from sensors in a cellular network. We conclude that, in order for their use to the feasible in terms of a normal depletion time of a smartphone's battery, it is a good advice to maximize the collection of data necessary to be transmitted from nearby sensors, and maximize the intervals between transmissions. More research is required to devise energy efficient transmission methods that enable the use of smartphones as mobile gateways.

  19. The mini-array of ASTRI SST-2M telescopes, precursors for the Cherenkov Telescope Array

    NASA Astrophysics Data System (ADS)

    Pareschi, Giovanni; Bonnoli, Giacomo; Vercellone, Stefano; ASTRI Collaboration; CTA Consortium

    2016-05-01

    In the framework of the Cherenkov Telescope Array (CTA) Observatory, the Italian National Institute of Astrophysics (INAF) has recently inaugurated in Sicily (Italy), at the Serra La Nave astronomical site on the slopes of Mount Etna, a large field of view (FoV, ~ 9.6°) dual-mirror prototype (ASTRI SST-2M) of the CTA small size class of telescopes (SST). The CTA plans to install about 70 SST in the southern site to allow the study of the gamma rays from a few TeV up to hundreds of TeV. The ASTRI SST-2M telescope prototype has been developed following an end-to-end approach, since it includes the entire system of structure, mirrors optics (primary and secondary mirrors), camera, and control/acquisition software. A remarkable performance improvement could come from the operation of the ASTRI mini-array, led by INAF in synergy with the Universidade de Sao Paulo (Brazil) and the North-West University (South Africa). The ASTRI mini-array will be composed of nine ASTRI SST-2M units and it is proposed as a precursor and initial seed of the CTA to be installed at the final CTA southern site. Apart from the assessment of a number of technological aspects related to the CTA, the ASTRI mini-array will, if compared for instance to H.E.S.S., extend the point source sensitivity up to ~ 100 TeV, also improving it above 5-10 TeV. Moreover, the unprecedented width of the FoV, with its homogeneous acceptance and angular resolution, will significantly contribute to the achievement of original results during the early CTA science phase.

  20. Maternally inherited npm2 mRNA is crucial for egg developmental competence in zebrafish.

    PubMed

    Bouleau, Aurélien; Desvignes, Thomas; Traverso, Juan Martin; Nguyen, Thaovi; Chesnel, Franck; Fauvel, Christian; Bobe, Julien

    2014-08-01

    The molecular mechanisms underlying and determining egg developmental competence remain poorly understood in vertebrates. Nucleoplasmin (Npm2) is one of the few known maternal effect genes in mammals, but this maternal effect has never been demonstrated in nonmammalian species. A link between developmental competence and the abundance of npm2 maternal mRNA in the egg was previously established using a teleost fish model for egg quality. The importance of maternal npm2 mRNA for egg developmental competence remains unknown in any vertebrate species. In the present study, we aimed to characterize the contribution of npm2 maternal mRNA to early developmental success in zebrafish using a knockdown strategy. We report here the oocyte-specific expression of npm2 and maternal inheritance of npm2 mRNA in zebrafish eggs. The knockdown of the protein translated from this maternal mRNA results in developmental arrest before the onset of epiboly and subsequent embryonic death, a phenotype also observed in embryos lacking zygotic transcription. Npm2 knockdown also results in impaired transcription of the first-wave zygotic genes. Our results show that npm2 is also a maternal effect gene in a nonmammalian vertebrate species and that maternally inherited npm2 mRNA is crucial for egg developmental competence. We also show that de novo protein synthesis from npm2 maternal mRNA is critical for developmental success beyond the blastula stage and required for zygotic genome activation. Finally, our results suggest that npm2 maternal mRNA is an important molecular factor of egg quality in fish and possibly in all vertebrates.

  1. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  2. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  3. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  4. Results on E+ E- to Hadrons Cross Sections from VEPP-2M and BaBar

    SciTech Connect

    Solodov, E.; /Novosibirsk, IYF

    2011-11-22

    In 1992-2000, data on e{sup +}e{sup -} annihilation into hadrons were collected in the energy range 0.36 < {radical}s < 1.4 GeV with the CMD-2 and SND detectors at the VEPP-2M collider in Novosibirsk. The results of the R(s) measurements in these experiments are presented. The radiative return program at BaBar also allows to study low energy e{sup +}e{sup -} annihilation and overview of the results are presented in this paper.

  5. R h2M o3N : Noncentrosymmetric s -wave superconductor

    NASA Astrophysics Data System (ADS)

    Wei, Wensen; Zhao, G. J.; Kim, D. R.; Jin, Chiming; Zhang, J. L.; Ling, Langsheng; Zhang, Lei; Du, Haifeng; Chen, T. Y.; Zang, Jiadong; Tian, Mingliang; Chien, C. L.; Zhang, Yuheng

    2016-09-01

    R h2M o3N , with a noncentrosymmetric β -manganese structure, has been found to be superconducting with critical temperature Tc≈4.3 K . Magnetic field dependence of resistivity, magnetization, and specific heat measurements show that its upper critical field of μ0Hc2 *˜7.41 T comes close to, but does not exceed, the Pauli paramagnetic limit and that the 2 Δ /kBTc value of about 3.62 is in accordance with a conventional s -wave superconductor. Andreev reflection spectroscopy measurements using both normal metal and half-metal show conclusively s -wave pairing with an isotropic gap.

  6. Chlorine nitrate - The sole product of the ClO + NO2 + M recombination

    NASA Technical Reports Server (NTRS)

    Margitan, J. J.

    1983-01-01

    A laser operating at 266 nm is used to photolyze the product of the ClO + NO2 + M reaction, and the yield of Cl atoms, measured by resonance fluorescence, is found to be identical with that from equivalent concentrations of ClONO2. This is interpreted as a strong indication that no other isomers are formed in the recombination reaction. Evidence for isomers is surveyed, and the apparent forward-and-reverse-rate constant discrepancy is explained as a probable uncertainty in the thermochemistry.

  7. The r-step Fibonacci-Hurwitz sequences in the binary polyhedral group <2, m, 2>

    NASA Astrophysics Data System (ADS)

    Deveci, Ömür; Ćiçekci, Deniz

    2016-04-01

    In [1], Deveci et al. defined the r-step Fibonacci-Hurwitz sequences from the Hurwitz matrices obtained from the characteristic polynomial of the k-step Fibonacci sequence. Also, they extended the r-step Fibonacci-Hurwitz sequences to groups. In this work, we obtain the periods of the r-step Fibonacci-Hurwitz sequences in the binary polyhedral group <2, m, 2> for generating triple {x, y, z} and generating pair {y, z} by the aid of the periods of the r-step Fibonacci-Hurwitz sequences according to modulo m.

  8. Credit WCT. Original 2A" x 2M" color negative is housed ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Credit WCT. Original 2-A" x 2-M" color negative is housed in the JPL Photography Laboratory, Pasadena, California. Photo shows John Morrow in charge of milling operations on coupons ("dogbones") of propellant on an Index milling machine. Coupons were milled to precise dimensions for tensile tests. Note that two sprinkler heads have been placed in very close proximity to the milling table for fire suppression purposes (JPL negative no. JPL-10283AC, 27 January 1989) - Jet Propulsion Laboratory Edwards Facility, Preparation Building, Edwards Air Force Base, Boron, Kern County, CA

  9. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  10. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  11. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  12. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  13. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  14. Coagulopathy following major liver resection: the effect of rBPI21 and the role of decreased synthesis of regulating proteins by the liver.

    PubMed

    Meijer, C; Wiezer, M J; Hack, C E; Boelens, P G; Wedel, N I; Meijer, S; Nijveldt, R J; Statius Muller, M G; Wiggers, T; Zoetmulder, F A; Borel Rinkes, I H; Cuesta, M A; Gouma, D J; van de Velde, C J; Tilanus, H W; Scotté, M; Thijs, L G; van Leeuwen, P A

    2001-04-01

    This prospective study investigated the role of reduced hepatic synthesis of regulating proteins in coagulopathy after partial hepatectomy (PH) compared with major abdominal surgery (MAS) without involvement of the liver. Furthermore, we studied the effect of rBPI21, an endotoxin-neutralizing agent, on coagulopathy after PH was studied. Compared with MAS, PH resulted in significantly elevated levels of thrombin-antithrombin-III and plasmin-alpha2-antiplasmin complexes. Levels of antithrombin-3, alpha2-antiplasmin, fibrinogen, plasminogen, alpha2-macroglobulin (alpha2-M), and C1-inhibitor remained lower following PH. Treatment with rBPI21 led to significantly lower levels of tissue-type plasminogen activator (t-PA). Post-operative disseminated intravascular coagulation (DIC) was associated with significantly higher bilirubin and t-PA plasma levels and significantly lower levels of alpha2-M. This study indicates that PH induced hepatic failure results in decreased synthesis of hepatic regulating plasma proteins and subsequent activation of coagulation and fibrinolysis. Prevention of t-PA release by rBPI21 may have important clinical implications. Decreased availability of alpha2-M may be a factor in post-operative DIC.

  15. Reprogramming the Dynamin 2 mRNA by Spliceosome-mediated RNA Trans-splicing.

    PubMed

    Trochet, Delphine; Prudhon, Bernard; Jollet, Arnaud; Lorain, Stéphanie; Bitoun, Marc

    2016-01-01

    Dynamin 2 (DNM2) is a large GTPase, ubiquitously expressed, involved in membrane trafficking and regulation of actin and microtubule cytoskeletons. DNM2 mutations cause autosomal dominant centronuclear myopathy which is a rare congenital myopathy characterized by skeletal muscle weakness and histopathological features including nuclear centralization in absence of regeneration. No curative treatment is currently available for the DNM2-related autosomal dominant centronuclear myopathy. In order to develop therapeutic strategy, we evaluated here the potential of Spliceosome-Mediated RNA Trans-splicing technology to reprogram the Dnm2-mRNA in vitro and in vivo in mice. We show that classical 3'-trans-splicing strategy cannot be considered as accurate therapeutic strategy regarding toxicity of the pre-trans-splicing molecules leading to low rate of trans-splicing in vivo. Thus, we tested alternative strategies devoted to prevent this toxicity and enhance frequency of trans-splicing events. We succeeded to overcome the toxicity through a 5'-trans-splicing strategy which also allows detection of trans-splicing events at mRNA and protein levels in vitro and in vivo. These results suggest that the Spliceosome-Mediated RNA Trans-splicing strategy may be used to reprogram mutated Dnm2-mRNA but highlight the potential toxicity linked to the molecular tools which have to be carefully investigated during preclinical development. PMID:27623444

  16. The fuzzy S2 structure of M2-M5 systems in ABJM membrane theories

    NASA Astrophysics Data System (ADS)

    Nastase, Horatiu; Papageorgakis, Constantinos; Ramgoolam, Sanjaye

    2009-05-01

    We analyse the fluctuations of the ground-state/funnel solutions proposed to describe M2-M5 systems in the level-k mass-deformed/pure Chern-Simons-matter ABJM theory of multiple membranes. We show that in the large N limit the fluctuations approach the space of functions on the 2-sphere rather than the naively expected 3-sphere. This is a novel realisation of the fuzzy 2-sphere in the context of Matrix Theories, which uses bifundamental instead of adjoint scalars. Starting from the multiple M2-brane action, a U(1) Yang-Mills theory on Bbb R2,1 × S2 is recovered at large N, which is consistent with a single D4-brane interpretation in Type IIA string theory. This is as expected at large k, where the semiclassical analysis is valid. Several aspects of the fluctuation analysis, the ground-state/funnel solutions and the mass-deformed/pure ABJM equations can be understood in terms of a discrete noncommutative realisation of the Hopf fibration. We discuss the implications for the possibility of finding an M2-brane worldvolume derivation of the classical S3 geometry of the M2-M5 system. Using a rewriting of the equations of the SO(4)-covariant fuzzy 3-sphere construction, we also directly compare this fuzzy 3-sphere against the ABJM ground-state/funnel solutions and show them to be different.

  17. The conceptual design of interferometer/polarimeter system on HL-2M

    NASA Astrophysics Data System (ADS)

    Zhou, Y.; Wang, H. X.; Li, Y. G.; Li, Y.; Chen, W. J.; Yi, J.; Deng, Z. C.

    2016-11-01

    HL-2M is a new medium-sized tokamak with major radius of 1.78 m, minor radius of 0.65 m, and aspect ratio of 2.8 and will be finished soon. In the conceptual design, a double-pass, horizontal view, multi-channel far-infrared (FIR) laser interferometer/polarimeter system (at 432 μm) is proposed to simultaneously measure the phase change and the Faraday rotation for density and current profile reconstruction. A vertical CO2 dispersion interferometer system (with wavelength of 10.6 μm and 5.3 μm) is designed to measure the line density, which will mainly be used for density feedback. The performance of the system is expected to meet the requirement of the measurements on HL-2M, with phase accuracy ˜0.1°, time resolution ˜1 μs, spatial resolution ˜7.2 cm, and density measurement range of 1 × 10 18-1 ×1021 m-3.

  18. IEEE802.15.6 NB portable BAN clinic and M2M international standardization.

    PubMed

    Kuroda, Masahiro; Nohara, Yasunobu

    2013-01-01

    The increase of non communicable diseases (NCDs) will change the direction of health services to emphasize the role of preventive medicine in healthcare services. The first short-range medical body are network (BAN) standard IEEE802.15.6 is expected to be used for secure and user-friendly sensor devices for portable medical equipment. A BAN is an enabler for uploading medical data to a backend system for remote diagnoses and treatment. Machine-to-Machine (M2M) infrastructure is also a key technology for providing flexible and affordable services extending electronic health record (EHR) systems. This paper proposes a BAN-based portable clinic that collects health-check data from user-friendly medical devices and sensors and sends the data to a local backend server, and it evaluates the clinic in fields of actual usage. We discuss issues experienced from actual deployment of the system and focus on integrating it into upcoming healthcare M2M infrastructure to achieve affordable and dependable clinic services. We explain the components and workflow of the clinic and the system model. The system is set up at a temporary health center and has a network link to a remote medical help center. The paper concludes with our plan to introduce our system to contribute to internationally standardized preventive medicine. PMID:24110023

  19. IEEE802.15.6 NB portable BAN clinic and M2M international standardization.

    PubMed

    Kuroda, Masahiro; Nohara, Yasunobu

    2013-01-01

    The increase of non communicable diseases (NCDs) will change the direction of health services to emphasize the role of preventive medicine in healthcare services. The first short-range medical body are network (BAN) standard IEEE802.15.6 is expected to be used for secure and user-friendly sensor devices for portable medical equipment. A BAN is an enabler for uploading medical data to a backend system for remote diagnoses and treatment. Machine-to-Machine (M2M) infrastructure is also a key technology for providing flexible and affordable services extending electronic health record (EHR) systems. This paper proposes a BAN-based portable clinic that collects health-check data from user-friendly medical devices and sensors and sends the data to a local backend server, and it evaluates the clinic in fields of actual usage. We discuss issues experienced from actual deployment of the system and focus on integrating it into upcoming healthcare M2M infrastructure to achieve affordable and dependable clinic services. We explain the components and workflow of the clinic and the system model. The system is set up at a temporary health center and has a network link to a remote medical help center. The paper concludes with our plan to introduce our system to contribute to internationally standardized preventive medicine.

  20. Machine to machine (M2M) technology in demand responsive commercial buildings

    SciTech Connect

    Watson, David S.; Piette, Mary Ann; Sezgen, Osman; Motegi, Naoya; ten Hope, Laurie

    2004-08-01

    Machine to Machine (M2M) is a term used to describe the technologies that enable computers, embedded processors, smart sensors, actuators and mobile devices to communicate with one another, take measurements and make decisions--often without human intervention. M2M technology was applied to five commercial buildings in a test. The goal was to reduce electric demand when a remote price signal rose above a predetermine price. In this system, a variable price signal was generated from a single source on the Internet and distributed using the meta-language, XML (Extensible Markup Language). Each of five commercial building sites monitored the common price signal and automatically shed site-specific electric loads when the price increased above predetermined thresholds. Other than price signal scheduling, which was set up in advance by the project researchers, the system was designed to operate without human intervention during the two-week test period. Although the buildings responded to the same price signal, the communication infrastructures used at each building were substantially different. This study provides an overview of the technologies used at each building site, the price generator/server, and each link in between. Network architecture, security, data visualization and site-specific system features are characterized. The results of the test are discussed, including: functionality at each site, measurement and verification techniques, and feedback from energy managers and building operators. Lessons learned from the test and potential implications for widespread rollout are provided.

  1. Utilizing G2/M retention effect to enhance tumor accumulation of active targeting nanoparticles

    PubMed Central

    Hu, Guanlian; Cun, Xingli; Ruan, Shaobo; Shi, Kairong; Wang, Yang; Kuang, Qifang; Hu, Chuan; Xiao, Wei; He, Qin; Gao, Huile

    2016-01-01

    In recent years, active targeting strategies by ligand modification have emerged to enhance tumor accumulation of NP, but their clinical application was strictly restricted due to the complex preparation procedures, poor stability and serious toxicity. An effective and clinical translational strategy is required to satisfy the current problems. Interestingly, the internalization of NP is intimately related with cell cycle and the expression of receptors is not only related with cancer types but also cell cycle progression. So the cellular uptake of ligand modified NP may be related with cell cycle. However, few investigations were reported about the relationship between cell cycle and the internalization of ligand modified NP. Herein, cellular uptake of folic acid (FA) modified NP after utilizing chemotherapeutic to retain the tumor cells in G2/M phase was studied and a novel strategy was designed to enhance the active targeting effect. In our study, docetaxel (DTX) notably synchronized cells in G2/M phase and pretreatment with DTX highly improved in vitro and in vivo tumor cell targeting effect of FA decorated NP (FANP). Since FA was a most common used tumor active targeting ligand, we believe that this strategy possesses broader prospects in clinical application for its simplicity and effectiveness. PMID:27273770

  2. Middle infrared radiation induces G2/M cell cycle arrest in A549 lung cancer cells.

    PubMed

    Chang, Hsin-Yi; Shih, Meng-Her; Huang, Hsuan-Cheng; Tsai, Shang-Ru; Juan, Hsueh-Fen; Lee, Si-Chen

    2013-01-01

    There were studies investigating the effects of broadband infrared radiation (IR) on cancer cell, while the influences of middle-infrared radiation (MIR) are still unknown. In this study, a MIR emitter with emission wavelength band in the 3-5 µm region was developed to irradiate A549 lung adenocarcinoma cells. It was found that MIR exposure inhibited cell proliferation and induced morphological changes by altering the cellular distribution of cytoskeletal components. Using quantitative PCR, we found that MIR promoted the expression levels of ATM (ataxia telangiectasia mutated), ATR (ataxia-telangiectasia and Rad3-related and Rad3-related), TP53 (tumor protein p53), p21 (CDKN1A, cyclin-dependent kinase inhibitor 1A) and GADD45 (growth arrest and DNA-damage inducible), but decreased the expression levels of cyclin B coding genes, CCNB1 and CCNB2, as well as CDK1 (Cyclin-dependent kinase 1). The reduction of protein expression levels of CDC25C, cyclin B1 and the phosphorylation of CDK1 at Thr-161 altogether suggest G(2)/M arrest occurred in A549 cells by MIR. DNA repair foci formation of DNA double-strand breaks (DSB) marker γ-H2AX and sensor 53BP1 was induced by MIR treatment, it implies the MIR induced G(2)/M cell cycle arrest resulted from DSB. This study illustrates a potential role for the use of MIR in lung cancer therapy by initiating DSB and blocking cell cycle progression.

  3. HERSCHEL/HIFI OBSERVATIONS OF HYDROGEN FLUORIDE TOWARD SAGITTARIUS B2(M)

    SciTech Connect

    Monje, R. R.; Emprechtinger, M.; Phillips, T. G.; Lis, D. C.; Goldsmith, P. F.; Bergin, E. A.; Bell, T. A.; Neufeld, D. A.; Sonnentrucker, P.

    2011-06-10

    Herschel/HIFI observations have revealed the presence of widespread absorption by hydrogen fluoride (HF) J = 1-0 rotational transition, toward a number of Galactic sources. We present observations of HF J = 1-0 toward the high-mass star-forming region Sagittarius B2(M). The spectrum obtained shows a complex pattern of absorption, with numerous features covering a wide range of local standard of rest velocities (-130 to 100 km {sup -1}). An analysis of this absorption yields HF abundances relative to H{sub 2} of {approx}1.3 x 10{sup -8}, in most velocity intervals. This result is in good agreement with estimates from chemical models, which predict that HF should be the main reservoir of gas-phase fluorine under a wide variety of interstellar conditions. Interestingly, we also find velocity intervals in which the HF spectrum shows strong absorption features that are not present, or are very weak, in spectra of other molecules, such as {sup 13}CO (1-0) and CS (2-1). HF absorption reveals components of diffuse clouds with small extinction that can be studied for the first time. Another interesting observation is that water is significantly more abundant than hydrogen fluoride over a wide range of velocities toward Sagittarius B2(M), in contrast to the remarkably constant H{sub 2}O/HF abundance ratio with average value close to unity measured toward other Galactic sources.

  4. Reprogramming the Dynamin 2 mRNA by Spliceosome-mediated RNA Trans-splicing

    PubMed Central

    Trochet, Delphine; Prudhon, Bernard; Jollet, Arnaud; Lorain, Stéphanie; Bitoun, Marc

    2016-01-01

    Dynamin 2 (DNM2) is a large GTPase, ubiquitously expressed, involved in membrane trafficking and regulation of actin and microtubule cytoskeletons. DNM2 mutations cause autosomal dominant centronuclear myopathy which is a rare congenital myopathy characterized by skeletal muscle weakness and histopathological features including nuclear centralization in absence of regeneration. No curative treatment is currently available for the DNM2-related autosomal dominant centronuclear myopathy. In order to develop therapeutic strategy, we evaluated here the potential of Spliceosome-Mediated RNA Trans-splicing technology to reprogram the Dnm2-mRNA in vitro and in vivo in mice. We show that classical 3′-trans-splicing strategy cannot be considered as accurate therapeutic strategy regarding toxicity of the pre-trans-splicing molecules leading to low rate of trans-splicing in vivo. Thus, we tested alternative strategies devoted to prevent this toxicity and enhance frequency of trans-splicing events. We succeeded to overcome the toxicity through a 5′-trans-splicing strategy which also allows detection of trans-splicing events at mRNA and protein levels in vitro and in vivo. These results suggest that the Spliceosome-Mediated RNA Trans-splicing strategy may be used to reprogram mutated Dnm2-mRNA but highlight the potential toxicity linked to the molecular tools which have to be carefully investigated during preclinical development. PMID:27623444

  5. Nucleoplasmic Mobilization of Nucleostemin Stabilizes MDM2 and Promotes G2/M Progression and Cell Survival

    PubMed Central

    Meng, Lingjun; Lin, Tao; Tsai, Robert Y.L.

    2016-01-01

    Summary Nucleolar disassembly occurs during mitosis and nucleolar stress, releasing several MDM2-interactive proteins residing in the nucleolus that share the common activity of p53 stabilization. Here, we demonstrated that mobilization of nucleostemin (NS), a cancer and stem cell-enriched nucleolar protein, plays the opposite role by stabilizing MDM2 and suppressing p53 functions. Our results showed that NS increases the protein stability and nucleoplasmic retention of MDM2, and competes with L23 for MDM2 binding. These activities are significantly elevated when NS is released into the nucleoplasm by mutations that abolish its nucleolar localization or by chemotherapeutic agents that disassemble the nucleoli. NS depletion decreases MDM2 protein, increases the transcriptional activities without changing the protein level of p53, and triggers G2/M arrest and cell death in U2OS but not in H1299 cells. This work reveals that nucleoplasmic relocation of NS during nucleolar disassembly safeguards the G2/M transit and survival of continuously dividing cells by MDM2 stabilization and p53 inhibition. PMID:19033382

  6. Commissioning of the first Precessions 1.2-m CNC polishing machines for large optics

    NASA Astrophysics Data System (ADS)

    Walker, D. D.; Beaucamp, A. T. H.; Doubrovski, V.; Dunn, C.; Evans, R.; Freeman, R.; McCavana, G.; Morton, R.; Riley, D.; Simms, J.; Yu, G.; Wei, X.

    2006-08-01

    This paper reports on the commissioning of the first of Zeeko's "IRP1200" 1.2m capacity 7-axis automated CNC polishing machines. These combo machines now support five different removal regimes, which are described. The machines differ substantially from Zeeko's more familiar 200mm machines on which we have focused before, in terms of overall architecture and detailed design. Large and small optics place different demands on part-fixturing, tooling, machine speeds and accelerations, metrology, slurry-handling, part-loading and access etc. These have had a profound effect on the development-path from 200 to 1.2m machines. Moreover, an advance in the kinematic design has extended the allowable range of surface slope-angles from typically 30° up to a hemisphere. The paper presents results from the pass-off trials, the first fluid-jet experiment, and the development of tooling to address a requirement to smooth a part with a local defect.

  7. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  8. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  9. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  10. Speciation of [Cp*(2)M(2)O(5)] in polar and donor solvents.

    PubMed

    Sözen-Aktaş, Pelin; Del Rosal, Iker; Manoury, Eric; Demirhan, Funda; Lledós, Agustí; Poli, Rinaldo

    2013-03-18

    The speciation of compounds [Cp*2 M2 O5 ] (M=Mo, W; Cp*=pentamethylcyclopentadienyl) in different protic and aprotic polar solvents (methanol, dimethyl sulfoxide, acetone, acetonitrile), in the presence of variable amounts of water or acid/base, has been investigated by (1) H NMR spectrometry and electrical conductivity. Specific hypotheses suggested by the experimental results have been further probed by DFT calculations. The solvent (S)-assisted ionic dissociation to generate [Cp*MO2 (S)](+) and [Cp*MO3 ](-) takes place extensively for both metals only in water/methanol mixtures. Equilibrium amounts of the neutral hydroxido species [Cp*MO2 (OH)] are generated in the presence of water, with the relative amount increasing in the order MeCN≈acetone2 M2 O5 ] into [Et3 NH](+) [Cp*MO3 ](-) , for which the presence of a NH⋅⋅⋅OM interaction is revealed by (1) H NMR spectroscopy in comparison with the sodium salts, Na(+) [Cp*MO3 ](-) . These are fully dissociated in DMSO and MeOH, but display a slow equilibrium between free ions and the ion pair in MeCN and acetone. Only one resonance is observed for mixtures of [Cp*MO3 ](-) and [Cp*MO2 (OH)] because of a rapid self-exchange. In the presence of extensive ionic dissociation, only one resonance is observed for mixtures of the cationic [Cp*MO2 (S)](+) product and the residual undissociated [Cp*2 M2 O5 ] because of a rapid associative exchange via the trinuclear [Cp*3 M3 O7 ](+) intermediate. In neat methanol, complex [Cp*2 W2 O5 ] reacts to yield extensive amounts of a new species, formulated as the mononuclear methoxido complex [Cp*WO2 (OMe)] on the basis of the DFT study. An equivalent product is not observed for the Mo system. The addition of increasing amounts of water results in the rapid decrease of this product in favor of [Cp*2 W2 O5 ] and [Cp*WO2 (OH)].

  11. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  12. Active optics system of the ASTRI SST-2M prototype for the Cherenkov Telescope Array

    NASA Astrophysics Data System (ADS)

    Gardiol, Daniele; Capobianco, Gerardo; Fantinel, Daniela; Giro, Enrico; Lessio, Luigi; Loreggia, Davide; Rodeghiero, Gabriele; Russo, Federico; Volpicelli, Antonio C.

    2014-07-01

    ASTRI (Astrofisica con Specchi a Tecnologia Replicante Italiana) SST-2M is an end-to-end prototype of Small Size class of Telescope for the Cherenkov Telescope Array. It will apply a dual mirror configuration to Imaging Atmospheric Cherenkov Telescopes. The 18 segments composing the primary mirror (diameter 4.3 m) are equipped with an active optics system enabling optical re-alignment during telescope slew. The secondary mirror (diameter 1.8 m) can be moved along three degrees of freedom to perform focus and tilt corrections. We describe the kinematic model used to predict the system performance as well as the hardware and software design solution that will be implemented for optics control.

  13. Holographic cosmology from a system of M2-M5 branes

    NASA Astrophysics Data System (ADS)

    Sepehri, Alireza; Faizal, Mir; Setare, Mohammad Reza; Ali, Ahmed Farag

    2016-05-01

    In this paper, we analyze the holographic cosmology using a M2-M5 brane configuration. In this configuration, a M2-brane will be placed in between a M5-brane and an anti-M5-brane. The M2-brane will act as a channel for energy to flow from an anti-M5-brane to a M5-brane, and this will increase the degrees of freedom on the M5-brane causing inflation. The inflation will end when the M5-brane and anti-M5-brane get separated. However, at a later stage the distance between the M5-brane and the anti-M5-bran can reduce and this will cause the formation of tachyonic states. These tachyonic states will again open a bridge between the M5-branes and the anti-M5-branes, which will cause further acceleration of the universe.

  14. WARM DUSTY DEBRIS DISKS AND DISTANT COMPANION STARS: V488 PER AND 2M1337

    SciTech Connect

    Zuckerman, B.

    2015-01-10

    A possible connection between the presence of large quantities of warm (T ≥ 200 K) circumstellar dust at youthful stars and the existence of wide-separation companion stars has been noted in the literature. Here we point out the existence of a distant companion star to V488 Per, a K-type member of the α Persei cluster with the largest known fractional excess infrared luminosity (∼16%) of any main sequence star. We also report the presence of a distant companion to the previously recognized warm dust star 2M1337. With these discoveries the existence of a cause and effect relationship between a distant companion and large quantities of warm dust in orbit around youthful stars now seems compelling.

  15. The design and analysis of 2m telescope's K Mirror system

    NASA Astrophysics Data System (ADS)

    Guo, Peng; Zhang, Jingxu; Yang, Fei; Zhang, Yan

    2014-09-01

    During the alt-azimuth telescope tracking, due to the frame structure of tracking support and relative movement of each mirror in Coude optical path, image plane is rotating. To eliminate the effects of image rotation for imaging and subsequent image processing, dove prism or K mirror are generally used. A set of K mirror system designed for 2m telescope. Affected by various errors in the alignment process, the rotating axis K, the optical axis of the K mirror, and the optical axis of the telescope's optical system can't be fully coincide. This causes the track optical axis drawn on the image is not a point, but a Pascal's limacon. The impact caused by the various sources of error were analyzed in this paper and simulation results have important guiding significance for the alignment error distribution.

  16. Change in Edge Fluctuations Synchronized with Heat Pulse in the JFT-2M Tokamak

    NASA Astrophysics Data System (ADS)

    Nagashima, Yoshihiko; Itoh, Kimitaka; Itoh, Sanae-I.; Fujisawa, Akihide; Hoshino, Katsumichi

    2016-06-01

    The change in edge fluctuations synchronized with a heat pulse during Sawtooth oscillation has been investigated in the JFT-2M tokamak using a reciprocating Langmuir probe. Data window of a heat pulse is segmented into a number of time frames, and time traces of auto-power spectra at each frame are calculated. Conditional averaging over a number of heat pulse events in a single discharge is performed in order to reduce the variance of the fluctuation spectra. At each heat pulse event, a reduction in the geodesic acoustic mode fluctuation power and an increase in the turbulence fluctuation power are observed. The change in the fluctuation powers suggests that the edge heat pulse during Sawtooth instability could affect the edge turbulence structure.

  17. Unmasking the masked Universe: the 2M++ catalogue through Bayesian eyes

    NASA Astrophysics Data System (ADS)

    Lavaux, Guilhem; Jasche, Jens

    2016-01-01

    This work describes a full Bayesian analysis of the Nearby Universe as traced by galaxies of the 2M++ survey. The analysis is run in two sequential steps. The first step self-consistently derives the luminosity-dependent galaxy biases, the power spectrum of matter fluctuations and matter density fields within a Gaussian statistic approximation. The second step makes a detailed analysis of the three-dimensional large-scale structures, assuming a fixed bias model and a fixed cosmology. This second step allows for the reconstruction of both the final density field and the initial conditions at z = 1000 assuming a fixed bias model. From these, we derive fields that self-consistently extrapolate the observed large-scale structures. We give two examples of these extrapolation and their utility for the detection of structures: the visibility of the Sloan Great Wall, and the detection and characterization of the Local Void using DIVA, a Lagrangian based technique to classify structures.

  18. Cloning of murine IL-22 receptor alpha 2 and comparison with its human counterpart.

    PubMed

    Weiss, B; Wolk, K; Grünberg, B H; Volk, H-D; Sterry, W; Asadullah, K; Sabat, R

    2004-08-01

    We have identified the mouse and rat homologs of human interleukin-22 receptor alpha 2 (IL-22R alpha 2) and compared the localization, structure, and expression of the encoding murine and human genes. The mouse IL-22R alpha 2-encoding gene is located on chromosome 10A3 between, like in human, the genes for interferon-gamma R1 and IL-20R1. It spans a region of approximately 10 kb therefore being three times shorter than the human gene. Although the overall gene structure in both species is similar, the mouse gene lacks a counterpart to the third coding exon of the human gene known to be alternatively spliced. Like in human, mouse and rat IL-22R alpha 2 exist only as soluble receptors as deduced from the lack of transmembrane and intracellular domains encoding sequences. Quantitative expression analyses showed, analogically to the human system, a limited tissue distribution of mouse IL-22R alpha 2 mRNA. Differential modulation of IL-22R alpha 2 mRNA expression was observed upon systemic inflammation in mice in spleen, thymus, and lymph node.

  19. The 3.2m all SiC Telescope for SPICA

    NASA Astrophysics Data System (ADS)

    Castel, Didier; Sein, Emmanuel; Lopez, Sebastien; Nakagawa, Takao; Bougoin, Michel

    2012-09-01

    Placed on the Sun-Earth L2 Lagrange point, SPICA will operate in the 5 to 210 μm wavelength range. Astrium has been contracted by ESA/ JAXA to update the study of the SPICA telescope from a 3.5 m design (compatible to the Japanese HIIB launcher) to a 3.2 m design (compatible to the HII-A with the short 5S fairing): despite a similar fairing diameter, the shorter length of the fairing envelope results in a reduction of the M1-M2 distance and an associated diameter reduction of M1. Maximization of the M1-M2 distance within the constraints is important to maintain a reasonable polishing criteria of the main reflector. Therefore the M2 assembly sizing and the back focal length become main parameters for the telescope optical design. The main constraints are driven by the telescope requirements such as focal length, maximizing the diameter of M1 (3.2 m) and, M1 f-number (critical for the manufacturing aspects). The WFE must be below 350 nm rms, and operational temperature below 6K. . The main issues addressed in this paper are: - an improved telescope design based on the Astrium background in Silicon Carbide technology which has been tried-an-tested for mirrors and structural parts on several space projects, including HERSCHEL and Gaia (brazing, polishing, assembling, iso-static mountings). - performances which are taking advantage of the SiC properties ,such as homogeneity of the single-phase material inside the structure, and structural stability from ambient to the operational temperature range. Our study shows that the SiC telescope design can fulfil all the mechanical and optical requirements for SPICA. - the verification and optical tests definition which will be key elements in the qualification of the telescope to be incorporated in the logic of the satellite verification activity to be conducted in Japan.

  20. Elevated tph2 mRNA Expression in a Rat Model of Chronic Anxiety

    PubMed Central

    Donner, Nina C.; Johnson, Philip L.; Fitz, Stephanie D.; Kellen, Karen E.; Shekhar, Anantha; Lowry, Christopher A.

    2015-01-01

    Background Allelic variations in TPH2, the gene encoding tryptophan hydroxylase 2, the rate-limiting enzyme for brain serotonin (5-HT) biosynthesis, may be genetic predictors of panic disorder and panic responses to panicogenic challenges in healthy volunteers. To test the hypothesis that tph2 mRNA is altered in chronic anxiety states, we measured tph2 expression in an established rat model of panic disorder. Methods We implanted 16 adult, male rats with bilateral guide cannulae and then primed them with daily injections of the corticotropin-releasing factor (CRF) receptor agonist, urocortin 1 (UCN1, 6 fmoles/100 nl per side, n = 8) or vehicle (n = 8) into the basolateral amygdaloid complex (BL) for 5 consecutive days. Anxiety-like behavior was assessed, 24 hr prior to and 48 hr following priming, in the social interaction (SI) test. A third group (n = 7) served as undisturbed home cage controls. All rats were killed 3 days after the last intra-BL injection to analyze tph2 and slc6a4 (gene encoding the serotonin transporter, SERT) mRNA expression in the dorsal raphe nucleus (DR), the main source of serotonergic projections to anxiety-related brain regions, using in situ hybridization histochemistry. Results UCN1 priming increased anxiety-related behavior in the SI test compared to vehicle-injected controls and elevated tph2, but not slc6a4, mRNA expression in DR subregions, including the ventrolateral DR/ventrolateral periaqueductal gray (DRVL/VLPAG), a subregion previously implicated in control of panic-related physiologic responses. Tph2 mRNA expression in the DRVL/VLPAG was correlated with increased anxiety-related behavior. Conclusion Our data support the hypothesis that chronic anxiety states are associated with dysregulated tph2 expression. PMID:22511363

  1. Inhibition of NF-{kappa}B1 and NF-{kappa}B2 activation in prostate cancer cells treated with antibody against the carboxyl terminal domain of GRP78: Effect of p53 upregulation

    SciTech Connect

    Misra, U.K.; Kaczowka, S.; Pizzo, S.V.

    2010-02-19

    Ligation of cancer cell surface GRP78 by activated {alpha}{sub 2}-macroglobulin ({alpha}{sub 2}M{sup *}) triggers pro-proliferative and anti-apoptotic signaling pathways. Cancer patients who develop autoantibodies to the {alpha}{sub 2}M{sup *} binding site in GRP78 have a poor prognosis since these antibodies are receptor agonists. The NF-{kappa}B family of transcription factors induces expression of genes affecting cell growth and differentiation. NF-{kappa}B1 plays a major regulatory role in controlling innate immunity and inflammation, whereas NF-{kappa}B2 plays a greater role in cancer cell proliferation. Here we report that treatment of prostate cancer cells with antibody directed against the carboxyl terminal domain of GRP78 inhibits {alpha}{sub 2}M{sup *}-induced activation of NF-{kappa}B2 by {approx}50% while exerting a lesser effect of {approx}20% on NF-{kappa}B1 activation. Treatment of these cells nearly abolished {alpha}{sub 2}M{sup *}-induced activation of IKK{alpha} involved in the activation of NF-{kappa}B2. This antibody also suppressed {alpha}{sub 2}M{sup *}-induced phosphorylation of IKK{alpha}, IKK{alpha}/{beta}, I{kappa}B{alpha}, and I{kappa}B{beta} as well as levels of NIK. Antibody treatment of cancer cells elevated pro-apoptotic p21WAF and p27kip while reducing cyclin D1 levels. These studies demonstrate that antibody directed against the carboxyl terminal domain of GRP78 inhibits the pro-proliferative NF-{kappa}B signaling cascade in cancer cells.

  2. hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA

    SciTech Connect

    Lee, Dong-Hyoung; Lim, Mi-Hyun; Youn, Dong-Ye; Jung, Seung Eun; Ahn, Young Soo; Tsujimoto, Yoshihide; Lee, Jeong-Hwa

    2009-05-08

    We previously reported that the CA-repeat sequence in the 3'-untranslated region (3'UTR) of bcl-2 mRNA is involved in the decay of bcl-2 mRNA. However, the trans-acting factor for the CA element in bcl-2 mRNA remains unidentified. The heterogeneous nuclear ribonucleoprotein L (hnRNP L), an intron splicing factor, has been reported to bind to CA repeats and CA clusters in the 3'UTR of several genes. We reported herein that the CA repeats of bcl-2 mRNA have the potential to form a distinct ribonuclear protein complex in cytoplasmic extracts of MCF-7 cells, as evidenced by RNA electrophoretic mobility shift assays (REMSA). A super-shift assay using the hnRNP L antibody completely shifted the complex. Immunoprecipitation with the hnRNP L antibody and MCF-7 cells followed by RT-PCR revealed that hnRNP L interacts with endogenous bcl-2 mRNA in vivo. Furthermore, the suppression of hnRNP L in MCF-7 cells by the transfection of siRNA for hnRNP L resulted in a delay in the degradation of RNA transcripts including CA repeats of bcl-2 mRNA in vitro, suggesting that the interaction between hnRNPL and CA repeats of bcl-2 mRNA participates in destabilizing bcl-2 mRNA.

  3. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  4. Construction of bioactive chimeric MHC class I tetramer by expression and purification of human-murine chimeric MHC heavy chain and beta(2)m as a fusion protein in Escherichia coli.

    PubMed

    Ren, Ding; Wang, Fang; He, Xiaowen; Jiang, Lei; Li, Dean; Ying, He; Sun, Shuhan

    2006-12-01

    Major histocompatibility (MHC) class I tetramers are used in the quantitative analysis of epitope peptide-specific CD8+ T-cells. An MHC class I tetramer was composed of 4 MHC class I complexes and a fluorescently labeled streptavidin (SA) molecule. Each MHC class I complex consists of an MHC heavy chain, a beta(2)-microglobulin (beta(2)m) molecule and a synthetic epitope peptide. In most previous studies, an MHC class I complex was formed in the refolding buffer with an expressed MHC heavy chain molecule and beta(2)m, respectively. This procedure inevitably resulted in the disadvantages of forming unwanted multimers and self-refolding products, and the purification of each kind of monomer was time-consuming. In the present study, the genes of a human/murine chimeric MHC heavy chain (HLA-A2 alpha1, HLA-A2 alpha2 and MHC-H2D alpha3) and beta(2)m were tandem-cloned into plasmid pET17b and expressed as a fusion protein. The recombinant fusion protein was refolded with each of the three HLA-A2 restricted peptides (HBc18-27 FLPSDFFPSI, HBx52-60 HLSLRGLPV, and HBx92-100 VLHKRTLGL) and thus three chimeric MHC class I complexes were obtained. Biotinylation was performed, and its level of efficiency was observed via a band-shift assay in non-reducing polyacrylamide gel electrophoresis (PAGE). Such chimeric MHC class I tetramers showed a sensitive binding activity in monitoring HLA/A2 restrictive cytotoxic T lymphocytes (CTLs) in immunized HLA/A*0201 transgenic mice. PMID:17046278

  5. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  6. [Expression of PEPT2 mRNA in lung tissue of rats with pulmonary fibrosis].

    PubMed

    Li, Li; Wang, Dianhua; Zhang, Xuan; Song, Xin; Ma, Xiaobiao; Hu, Zaoxiu

    2013-10-20

    背景与目的 肺纤维化是肺癌放化疗后的常见病理改变,是阻碍药物转运到肺部的关键因素之一,肽转运载体已经成为合理设计肽和肽类药物的靶标,本研究旨在探讨肽转运载体2(peptide transporter 2, PEPT2)mRNA在肺纤维化大鼠肺组织中的表达。方法 健康SD大鼠50只,随机分为5组。博莱霉素(bleomycin, BLM)7 d、14 d、28 d组:气管内一次性滴入博莱霉素溶液复制肺纤维化大鼠模型,分别于给药后7 d、14 d和28 d放血处死;生理盐水组滴入等量生理盐水,于14 d放血处死;正常组不做任何处理。各组取肺组织,光镜观察组织病理变化;检测样本羟脯氨酸含量;半定量RT-PCR检测肺组织PEPT2 mRNA表达。结果 BLM 7 d组大鼠肺组织呈急性炎症性改变,无纤维增生;BLM 14 d组和28 d组大鼠肺组织均有纤维化改变,以28 d组最为明显。BLM 7 d组肺组织羟脯氨酸含量与正常对照组和生理盐水组相比无统计学差异(P>0.05);14 d组和28 d组大鼠肺组织羟脯氨酸含量均高于正常对照组和生理盐水组(P<0.05)。各组肺组织PEPT2 mRNA的相对表达量无统计学差异(P>0.05)。结论 PEPT2 mRNA在博莱霉素致肺纤维化大鼠肺组织表达水平无明显变化,PEPT2可能是设计肺纤维化的新型肽类药物靶标之一。

  7. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.

    2009-01-15

    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  8. Introduction of the human pro. cap alpha. 1(I) collagen gene into pro. cap alpha. 1(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I collagen

    SciTech Connect

    Schnieke, A.; Dziadek, M.; Bateman, J.; Mascara, T.; Harbers, K.; Gelinas, R.; Jaenisch, R.

    1987-02-01

    The Mov-13 mouse strain carries a retroviral insertion in the pro..cap alpha..1(I) collagen gene that prevents transcription of the gene. Cell lines derived from homozygous embryos do not express type I collagen although normal amounts of pro..cap alpha..2 mRNA are synthesized. The authors have introduced genomic clones of either the human or mouse pro..cap alpha..1(I) collagen gene into homozygous cell lines to assess whether the human or mouse pro..cap alpha..1(I) chains can associate with the endogenous mouse pro..cap alpha..2(I) chain to form stable type I collagen. The human gene under control of the simian virus 40 promoter was efficiently transcribed in the transfected cells. Protein analyses revealed that stable heterotrimers consisting of two human ..cap alpha..1 chains and one mouse ..cap alpha..2 chain were formed and that type I collagen was secreted by the transfected cells at normal rates. However, the electrophoretic migration of both ..cap alpha..1(I) and ..cap alpha..2(I) chains in the human-mouse hybrid molecules were retarded, compared to the ..cap alpha..(I) chains in control mouse cells. Inhibition of the posttranslational hydroxylation of lysine and proline resulted in comigration of human and mouse ..cap alpha..1 and ..cap alpha..2 chains, suggesting that increased posttranslational modification caused the altered electrophoretic migration in the human-mouse hybrid molecules. Amino acid sequence differences between the mouse and human ..cap alpha.. chains may interfere with the normal rate of helix formation and increase the degree of posttranslational modifications similar to those observed in patients with lethal perinatal osteogenesis imperfecta. The Mov-13 mouse system should allow the authors to study the effect specific mutations introduced in transfected pro..cap alpha..1(I) genes have on the synthesis, assembly, and function of collagen I.

  9. Introduction of the human pro alpha 1(I) collagen gene into pro alpha 1(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I collagen.

    PubMed Central

    Schnieke, A; Dziadek, M; Bateman, J; Mascara, T; Harbers, K; Gelinas, R; Jaenisch, R

    1987-01-01

    The Mov-13 mouse strain carries a retroviral insertion in the pro alpha 1(I) collagen gene that prevents transcription of the gene. Cell lines derived from homozygous embryos do not express type I collagen although normal amounts of pro alpha 2 mRNA are synthesized. We have introduced genomic clones of either the human or mouse pro alpha 1(I) collagen gene into homozygous cell lines to assess whether the human or mouse pro alpha 1(I) chains can associate with the endogenous mouse pro alpha 2(I) chain to form stable type I collagen. The human gene under control of the simian virus 40 promoter was efficiently transcribed in the transfected cells. Protein analyses revealed that stable heterotrimers consisting of two human alpha 1 chains and one mouse alpha 2 chain were formed and that type I collagen was secreted by the transfected cells at normal rates. However, the electrophoretic migration of both alpha 1(I) and alpha 2(I) chains in the human-mouse hybrid molecules were retarded, compared to the alpha (I) chains in control mouse cells. Inhibition of the posttranslational hydroxylation of lysine and proline resulted in comigration of human and mouse alpha 1 and alpha 2 chains, suggesting that increased posttranslational modification caused the altered electrophoretic migration in the human-mouse hybrid molecules. Amino acid sequence differences between the mouse and human alpha chains may interfere with the normal rate of helix formation and increase the degree of posttranslational modifications similar to those observed in patients with lethal perinatal osteogenesis imperfecta. The Mov-13 mouse system should allow us to study the effect specific mutations introduced in transfected pro alpha 1(I) genes have on the synthesis, assembly, and function of collagen I. Images PMID:3468512

  10. Disorder of G2-M Checkpoint Control in Aniline-Induced Cell Proliferation in Rat Spleen.

    PubMed

    Wang, Jianling; Wang, Gangduo; Khan, M Firoze

    2015-01-01

    Aniline, a toxic aromatic amine, is known to cause hemopoietic toxicity both in humans and animals. Aniline exposure also leads to toxic response in spleen which is characterized by splenomegaly, hyperplasia, fibrosis and the eventual formation of tumors on chronic in vivo exposure. Previously, we have shown that aniline exposure leads to iron overload, oxidative DNA damage, and increased cell proliferation, which could eventually contribute to a tumorigenic response in the spleen. Despite our demonstration that cell proliferation was associated with deregulation of G1 phase cyclins and increased expression of G1 phase cyclin-dependent kinases (CDKs), molecular mechanisms, especially the regulation of G2 phase and contribution of epigenetic mechanisms in aniline-induced splenic cellular proliferation remain largely unclear. This study therefore, mainly focused on the regulation of G2 phase in an animal model preceding a tumorigenic response. Male Sprague-Dawley rats were given aniline (0.5 mmol/kg/day) in drinking water or drinking water only (controls) for 30 days, and expression of G2 phase cyclins, CDK1, CDK inhibitors and miRNAs were measured in the spleen. Aniline treatment resulted in significant increases in cell cycle regulatory proteins, including cyclins A, B and CDK1, particularly phosphor-CDK1, and decreases in CDK inhibitors p21 and p27, which could promote the splenocytes to go through G2/M transition. Our data also showed upregulation of tumor markers Trx-1 and Ref-1 in rats treated with aniline. More importantly, we observed lower expression of miRNAs including Let-7a, miR-15b, miR24, miR-100 and miR-125, and greater expression of CDK inhibitor regulatory miRNAs such as miR-181a, miR-221 and miR-222 in the spleens of aniline-treated animals. Our findings suggest that significant increases in the expression of cyclins, CDK1 and aberrant regulation of miRNAs could lead to an accelerated G2/M transition of the splenocytes, and potentially to a

  11. VGLUT1 and VGLUT2 mRNA expression in the primate auditory pathway

    PubMed Central

    Hackett, Troy A.; Takahata, Toru; Balaram, Pooja

    2011-01-01

    The vesicular glutamate transporters (VGLUTs) regulate storage and release of glutamate in the brain. In adult animals, the VGLUT1 and VGLUT2 isoforms are widely expressed and differentially distributed, suggesting that neural circuits exhibit distinct modes of glutamate regulation. Studies in rodents suggest that VGLUT1 and VGLUT2 mRNA expression patterns are partly complementary, with VGLUT1 expressed at higher levels in cortex and VGLUT2 prominent subcortically, but with overlapping distributions in some nuclei. In primates, VGLUT gene expression has not been previously studied in any part of the brain. The purposes of the present study were to document the regional expression of VGLUT1 and VGLUT2 mRNA in the auditory pathway through A1 in cortex, and to determine whether their distributions are comparable to rodents. In situ hybridization with antisense riboprobes revealed that VGLUT2 was strongly expressed by neurons in the cerebellum and most major auditory nuclei, including the dorsal and ventral cochlear nuclei, medial and lateral superior olivary nuclei, central nucleus of the inferior colliculus, sagulum, and all divisions of the medial geniculate. VGLUT1 was densely expressed in the hippocampus and ventral cochlear nuclei, and at reduced levels in other auditory nuclei. In auditory cortex, neurons expressing VGLUT1 were widely distributed in layers II – VI of the core, belt and parabelt regions. VGLUT2 was most strongly expressed by neurons in layers IIIb and IV, weakly by neurons in layers II – IIIa, and at very low levels in layers V – VI. The findings indicate that VGLUT2 is strongly expressed by neurons at all levels of the subcortical auditory pathway, and by neurons in the middle layers of cortex, whereas VGLUT1 is strongly expressed by most if not all glutamatergic neurons in auditory cortex and at variable levels among auditory subcortical nuclei. These patterns imply that VGLUT2 is the main vesicular glutamate transporter in subcortical

  12. Reflective and antireflective coatings for the optical chain of the ASTRI SST-2M prototype

    NASA Astrophysics Data System (ADS)

    Bonnoli, Giacomo; Canestrari, Rodolfo; Catalano, Osvaldo; Pareschi, Giovanni; Perri, Luca; Stringhetti, Luca

    2013-09-01

    ASTRI is a Flagship Project of the Italian Ministry of Education, University and Research, led by the Italian National Institute of Astrophysics, INAF. One of the main aims of the ASTRI Project is the design, construction and on-field verification of a dual mirror (2M) end-to-end prototype for the Small Size Telescope (SST) envisaged to become part of the Cherenkov Telescope Array. The ASTRI SST-2M prototype is designed according to the Schwarzschild-Couder optical scheme, and adopts a camera based on Silicon Photo Multipliers (SiPM); it will be assembled at the INAF astronomical site of Serra La Nave on mount Etna (Catania, Italy) in the second half of 2014, and will start scientific validation phase soon after. With its 4m wide primary dish, the telescope will be sensitive to multi-TeV Very High Energy (VHE) gamma rays up to 100 TeV and above, with a point spread function of ~2 arcminutes and a wide (semiaperture 4.8°) corrected field of view. The peculiarities of the optical design and of the SiPM bandpass pushed towards specifically optimized choices in terms of reflective coatings for both the primary and the secondary mirror. Fully dielectric multi-layer coatings have been developed and tested as an option for the primary mirror, aiming to filter out the large Night Sky Background contamination at wavelengths λ>~700 nm. On the other hand, for the large monolithic secondary mirror a simpler design with quartz-overcoated aluminium has been optimized for incidences far from normality. The conformation of the ASTRI camera in turn pushed towards the design of a reimaging system based on thin pyramidal light guides, that could be optionally integrated in the focal surface, aiming to increase the fill factor. An anti-reflective coating optimized for a wide range of incident angles faraway from normality was specifically developed to enhance the UV-optical transparency of these elements. The issues, strategy, simulations and experimental results are thoroughly

  13. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  14. Different patterns of 5{alpha}-reductase expression, cellular distribution, and testosterone metabolism in human follicular dermal papilla cells

    SciTech Connect

    Liu, Shicheng Yamauchi, Hitoshi

    2008-04-18

    Androgens regulate hair growth, and 5{alpha}-reductase (5{alpha}R) plays a pivotal role in the action of androgens on target organs. To clarify the molecular mechanisms responsible for controlling hair growth, the present study presents evidence that the human follicular dermal papilla cells (DPCs) from either beard (bDPCs) or scalp hair (sDPCs) possess endogenous 5{alpha}R activity. Real-time RT-PCR revealed that the highest level of 5{alpha}R1 mRNA was found in bDPCs, followed by sDPCs, and a low but detectable level of 5{alpha}R1 mRNA was observed in fibroblasts. Minimally detectable levels of 5{alpha}R2 mRNA were found in all three cell types. A weak band at 26 kDa corresponding to the human 5{alpha}R1 protein was detected by Western blot in both DPCs, but not in fibroblasts. Immuonofluorescence analysis confirmed that 5{alpha}R1 was localized to the cytoplasm rather than in the nuclei in both DPCs Furthermore, a 5{alpha}R assay using [{sup 14}C]testosterone labeling in intact cells revealed that testosterone was transformed primarily into androstenedione, and in small amounts, into DHT. Our results demonstrate that the 5{alpha}R activities of either bDPCs or sDPCs are stronger than that of dermal fibroblasts, despite the fact that the major steroidogenic activity is attributed to 17{beta}-HSD rather than 5{alpha}R among the three cell types. The 5{alpha}R1 inhibitor MK386 exhibited a more potent inhibitory effect on 5{alpha}R activity than finasteride (5{alpha}R2 inhibitor) in bDPCs.

  15. Mechanisms of reduced luteal sensitivity to prostaglandin F2alpha during maternal recognition of pregnancy in ewes.

    PubMed

    Costine, Beth A; Inskeep, E Keith; Blemings, Kenneth P; Flores, Jorge A; Wilson, Matthew E

    2007-02-01

    During maternal recognition of pregnancy, the conceptus stimulates endometrial secretion of PGF2alpha and PGE2. However, PGF2alpha is less effective in causing luteal regression in pregnant than in non-pregnant ewes. Experiments were conducted to elucidate mechanisms for reduced luteal sensitivity to PGF2alpha during maternal recognition of pregnancy. Corpora lutea (CL) were collected from pregnant and non-pregnant ewes 0, 4, or 12h following treatment with PGF2alpha on day 12 after estrus. Luteal PTGHS2 mRNA did not differ due to PGF2alpha or pregnancy status. Luteal PTGES mRNA was reduced in both pregnant and non-pregnant ewes after PGF2alpha treatment; while, luteal PTGFS mRNA was reduced 4h after PGF2alpha in pregnant, but not non-pregnant ewes. The result was a greater ratio of PTGES to PTGFS mRNA in pregnant ewes. Luteal mRNA for HPGD did not differ between pregnant and non-pregnant ewes on day 12. Luteal END1 mRNA was reduced in pregnant as compared to non-pregnant ewes prior to PGF2alpha challenge. Luteal END1 mRNA was increased after PGF2alpha in pregnant and non-pregnant ewes; however, ECE1 mRNA was reduced 4h after PGF2alpha in pregnant, but not non-pregnant ewes. The in vitro conversion of PGF2alpha to PGFM was greater in CL of pregnant than non-pregnant ewes at day 14. Luteal conversion of PGF2alpha to PGFM appears to be regulated post-transcriptionally. During maternal recognition of pregnancy, mechanisms of reduced luteal sensitivity to PGF2alpha may include a shift in prostaglandin production to the luteotropin PGE2, a reduction of ECE1 mRNA, and increased catabolism of PGF2alpha. PMID:16524686

  16. Localization of vesicular glutamate transporter 2 mRNA in the dorsal root ganglion of the pigeon (Columba livia).

    PubMed

    Atoji, Y; Islam, M R

    2009-11-01

    Our previous study showed localization of glutamate receptor 1 (GluR1) mRNA in neurons of the pigeon spinal cord, suggesting glutamatergic input from intrinsic and extrinsic origins. The present study examined localization of vesicular glutamate transporter 2 (VGLUT2) mRNA to confirm an extrinsic origin of glutamatergic neurons in the dorsal root ganglion (DRG). GluR1 and GluR2 mRNAs were examined in DRG and spinal cord to seek projection regions from VGLUT2 mRNA-expressing neurons. VGLUT2 mRNA was expressed in most DRG neurons and labelling intensity varied from weakly to intensely. Intense VGLUT2 mRNA expression was mainly seen in medium to large neurons. GluR1 and GluR2 mRNAs were expressed in the dorsal horn and GluR2 mRNA signal was also seen in the marginal nucleus. The results suggest that the pigeon DRG has an extrinsic glutamatergic origin that project to the dorsal horn and marginal nucleus of the spinal cord. PMID:19821818

  17. The New Instrument Suite of the TSU/Fairborn 2m Automatic Spectroscopic Telescope

    NASA Astrophysics Data System (ADS)

    Muterspaugh, Matthew W.; Maxwell, T.; Williamson, M. W.; Fekel, F. C.; Ge, J.; Kelly, J.; Ghasempour, A.; Powell, S.; Zhao, B.; Varosi, F.; Schofield, S.; Liu, J.; Warner, C.; Jakeman, H.; Avner, L.; Swihart, S.; Harrison, C.; Fishler, D.

    2014-01-01

    Tied with the Liverpool Telescope as the world's largest fully robotic optical research telescope, Tennessee State University's (TSU) 2m Automatic Spectroscopic Telescope (AST) has recently been upgraded to improve performance and increase versatility by supporting multiple instruments. Its second-generation instrument head enables us to rapidly switch between any of up to twelve fibers optics, each of which can supply light to a different instrument. In 2013 construction was completed on a new temperature-controlled guest instrument building, and two new high resolution spectrographs were commissioned. The current set of instrumentation includes (1) the telescope's original R=30,000 echelle spectrograph (0.38--0.83 microns simultaneous), (2) a single order R=7,000 spectrograph centered at Ca H&K features, (3) a single-mode-fiber fed miniature echelle spectrograph (R=100,000; 0.48--0.62 microns simultaneous), (4) the University of Florida's EXPERT-3 spectrograph (R=100,000; 0.38--0.9 microns simultaneous; vacuum and temperature controlled) and (5) the University of Florida's FIRST spectrograph (R=70,000$; 0.8--1.35 or 1.4--1.8 microns simultaneous; vacuum and temperature controlled). Future instruments include the Externally Dispersed Interferometry (EDI) Testbed, a combination low resolution dispersed spectrograph and Fourier Transform Spectrograph. We welcome inquiries from the community in regards to observing access and/or proposals for future guest instruments.

  18. Phosphorylation-dependent degradation of MEF2C contributes to regulate G2/M transition

    PubMed Central

    Badodi, Sara; Baruffaldi, Fiorenza; Ganassi, Massimo; Battini, Renata; Molinari, Susanna

    2015-01-01

    The Myocyte Enhancer Factor 2C (MEF2C) transcription factor plays a critical role in skeletal muscle differentiation, promoting muscle-specific gene transcription. Here we report that in proliferating cells MEF2C is degraded in mitosis by the Anaphase Promoting Complex/Cyclosome (APC/C) and that this downregulation is necessary for an efficient progression of the cell cycle. We show that this mechanism of degradation requires the presence on MEF2C of a D-box (R-X-X-L) and 2 phospho-motifs, pSer98 and pSer110. Both the D-box and pSer110 motifs are encoded by the ubiquitous alternate α1 exon. These two domains mediate the interaction between MEF2C and CDC20, a co-activator of APC/C. We further report that in myoblasts, MEF2C regulates the expression of G2/M checkpoint genes (14–3–3γ, Gadd45b and p21) and the sub-cellular localization of CYCLIN B1. The importance of controlling MEF2C levels during the cell cycle is reinforced by the observation that modulation of its expression affects the proliferation rate of colon cancer cells. Our findings show that beside the well-established role as pro-myogenic transcription factor, MEF2C can also function as a regulator of cell proliferation. PMID:25789873

  19. Cummingtonite: A reversible, nonquenchable transition from P21/m to C2/m symmetry

    USGS Publications Warehouse

    Prewitt, C.T.; Papike, J.J.; Ross, M.

    1970-01-01

    Cummingtonite from the Gouverneur, New York, talc district (Sample No. U.S.N.M. 115046) with the composition, (Ca0.36Na0.06Mn0.96Mg0.57) Mg5Si8O22 (OH)2, unit cell parameters a = 9.550 ?? 0.001, b = 18.007 ?? 0.003, c = 5.298 ?? 0.001 A ??, ?? = 102??39??? ?? 1???, and space group P21/m, has been used in a high-temperature, single-crystal, X-ray diffraction study. When diffraction patterns are taken of the crystals heated in a sealed silica capillary to 45??C or higher, these reflections disappear, indicating a transition to C2/m symmetry. The transition appears to be analogous to the P21/c to C2/c transition between 700?? and 800??C discovered recently in (Mg0.30Fe0.70) SiO3 clinopyroxene. In addition to the cummingtonite transition, we have also found a transition in pigeonite at higher temperatures. The transition occurs in this pigeonite (Gunflint Iron Formation, Minnesota, (Ca0.04Fe0.78Mg0.18)SiO3) at about 670??C. This is a significantly lower temperature than was found for the Ca-poor clinopyroxene. ?? 1970.

  20. Aerodynamic performance of a new LM 17.2 m rotor

    NASA Astrophysics Data System (ADS)

    Rasmussen, F.

    1985-03-01

    The aerodynamic properties of a 17.2 m diameter rotor mounted on a 55 kW windmill were measured. Power curves were measured for a range of blade tip angles to find the best angle in relation to energy production and stalling characteristics. With this optimum blade setting the flapwise blade root bending moment was measured as a function of wind speed. The drag coefficient at 90 deg angle of attack was calculated from measurements of the integrated value, i.e., the flapwise blade root bending moment as a function of wind speed during stand still. Profile properties are estimated from aerodynamic calculations, and the results compared to profile data from three dimensional wind tunnel measurements. The flapwise blade root bending moment versus blade angular position during one revolution was measured in skew wind and compared with calculations. The influence of surface roughnes introduced at a certain percentage of the section chord and the dependency on the Reynolds number is investigated, and discussed from observed discrepancies in the measured power curves.

  1. Rates of E1, E2, M1, and M2 transitions in Ni II

    NASA Astrophysics Data System (ADS)

    Cassidy, C. M.; Hibbert, A.; Ramsbottom, C. A.

    2016-03-01

    Aims: We present rates for all E1, E2, M1, and M2 transitions among the 295 fine-structure levels of the configurations 3d9, 3d84s, 3d74s2, 3d84p, and 3d74s4p, determined through an extensive configuration interaction calculation. Methods: The CIV3 code developed by Hibbert and coworkers is used to determine for these levels configuration interaction wave functions with relativistic effects introduced through the Breit-Pauli approximation. Results: Two different sets of calculations have been undertaken with different 3d and 4d functions to ascertain the effect of such variation. The main body of the text includes a representative selection of data, chosen so that key points can be discussed. Some analysis to assess the accuracy of the present data has been undertaken, including comparison with earlier calculations and the more limited range of experimental determinations. The full set of transition data is given in the supplementary material as it is very extensive. Conclusions: We believe that the present transition data are the best currently available. Full Table 4 and Tables 5-8 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/587/A107

  2. Gravitational force modulates G2/M phase exit in mechanically unloaded myoblasts

    PubMed Central

    Benavides Damm, Tatiana; Franco-Obregón, Alfredo; Egli, Marcel

    2013-01-01

    Prolonged spaceflight gives rise to muscle loss and reduced strength, a condition commonly referred to as space atrophy. During exposure to microgravity, skeletal muscle myoblasts are mechanically unloaded and respond with attenuated cell proliferation, slowed cell cycle progression, and modified protein expression. To elucidate the underlying mechanisms by which muscle mass declines in response to prolonged microgravity exposure, we grew C2C12 mouse muscle cells under conditions of simulated microgravity (SM) and analyzed their proliferative capacity, cell cycle progression, and cyclin B and D expression. We demonstrated that the retarded cell growth observed in SM was correlated with an approximate 16 h delay in G2/M phase progression, where cells accumulated specifically between the G2 checkpoint and the onset of anaphase, concomitantly with a positive expression for cyclin B. The effect was specific for gravitational mechanical unloading as cells grown under conditions of hypergravity (HG, 4 g) for similar durations of time exhibited normal proliferation and normal cell cycle progression. Our results show that SM and HG exert phenomenological distinct responses over cell cycle progression. The deficits of SM can be restored by terrestrial gravitational force, whereas the effects of HG are indistinguishable from the 1 g control. This suggests that the mechanotransduction apparatus of cells responds differently to mechanical unloading and loading. PMID:23974110

  3. The Yeast Tor Signaling Pathway Is Involved in G2/M Transition via Polo-Kinase

    PubMed Central

    Nakashima, Akio; Maruki, Yoshiko; Imamura, Yuko; Kondo, Chika; Kawamata, Tomoko; Kawanishi, Ippei; Takata, Hideki; Matsuura, Akira; Lee, Kyung S.; Kikkawa, Ushio; Ohsumi, Yoshinori; Yonezawa, Kazuyoshi; Kamada, Yoshiaki

    2008-01-01

    The target of rapamycin (Tor) protein plays central roles in cell growth. Rapamycin inhibits cell growth and promotes cell cycle arrest at G1 (G0). However, little is known about whether Tor is involved in other stages of the cell division cycle. Here we report that the rapamycin-sensitive Tor complex 1 (TORC1) is involved in G2/M transition in S. cerevisiae. Strains carrying a temperature-sensitive allele of KOG1 (kog1-105) encoding an essential component of TORC1, as well as yeast cell treated with rapamycin show mitotic delay with prolonged G2. Overexpression of Cdc5, the yeast polo-like kinase, rescues the growth defect of kog1-105, and in turn, Cdc5 activity is attenuated in kog1-105 cells. The TORC1-Type2A phosphatase pathway mediates nucleocytoplasmic transport of Cdc5, which is prerequisite for its proper localization and function. The C-terminal polo-box domain of Cdc5 has an inhibitory role in nuclear translocation. Taken together, our results indicate a novel function of Tor in the regulation of cell cycle and proliferation. PMID:18493323

  4. Anti-GD2 mAb and Vorinostat synergize in the treatment of neuroblastoma.

    PubMed

    Kroesen, Michiel; Büll, Christian; Gielen, Paul R; Brok, Ingrid C; Armandari, Inna; Wassink, Melissa; Looman, Maaike W G; Boon, Louis; den Brok, Martijn H; Hoogerbrugge, Peter M; Adema, Gosse J

    2016-06-01

    Neuroblastoma (NBL) is a childhood malignancy of the sympathetic nervous system. For high-risk NBL patients, the mortality rate is still over 50%, despite intensive multimodal treatment. Anti-GD2 monoclonal antibody (mAB) in combination with systemic cytokine immunotherapy has shown clinical efficacy in high-risk NBL patients. Targeted therapy using histone deacetylase inhibitors (HDACi) is currently being explored in cancer treatment and already shows promising results. Using our recently developed transplantable TH-MYCN NBL model, we here report that the HDAC inhibitor Vorinostat synergizes with anti-GD2 mAb therapy in reducing NBL tumor growth. Further mechanistic studies uncovered multiple mechanisms for the observed synergy, including Vorinostat-induced specific NBL cell death and upregulation of the tumor antigen GD2 on the cell surface of surviving NBL cells. Moreover, Vorinostat created a permissive tumor microenvironment (TME) for tumor-directed mAb therapy by increasing macrophage effector cells expressing high levels of Fc-receptors (FcR) and decreasing the number and function of myeloid-derived suppressor cells (MDSC). Collectively, these data imply further testing of other epigenetic modulators with immunotherapy and provide a strong basis for clinical testing of anti-GD2 plus Vorinostat combination therapy in NBL patients.

  5. A PRIMAL view of the Milky Way, made possible by Gaia and M2M modelling

    NASA Astrophysics Data System (ADS)

    Hunt, J. A. S.; Kawata, D.

    2014-07-01

    We have developed our original made-to-measure (M2M) algorithm, primal, with the aim of modelling the Galactic disc from upcoming Gaia data. From a Milky Way like N-body disc galaxy simulation, we have created mock Gaia data using M0III stars as tracers, taking into account extinction and the expected Gaia errors. In primal, observables calculated from the N-body model are compared with the target stars, at the position of the target stars. Using primal, the masses of the N-body model particles are changed to reproduce the target mock data, and the gravitational potential is automatically adjusted by the changing mass of the model particles. We have also adopted a new resampling scheme for the model particles to keep the mass resolution of the N-body model relatively constant. We have applied primalto this mock Gaia data and we show that primalcan recover the structure and kinematics of a Milky Way like barred spiral disc, along with the apparent bar structure and pattern speed of the bar despite the galactic extinction and the observational errors.

  6. Distributed net-centric architecture of m2m acquisition units with optical GVA

    NASA Astrophysics Data System (ADS)

    Guha, Dipnarayan; Choi, Jun; Hassan, Mashfique

    2005-05-01

    This paper describes the architecture of a low-latency symmetric multiprocessing optical soft memory system to cluster computing inside the core of an adaptive optical signal processor with the aid of soft decision algebraic polynomial algorithms. The optical system hardware is shown to evolve along with the iterator instantiations of the soft algorithm that forms the core of the memory map. The system enables efficient cache coherence protocols used in unit multiprocessors to be run across a homogeneous cluster in optical soft memory systems. We define a structure called the Optical Generalized Viterbi Algorithm Data Structure (Optical GVA DS) that makes up the system map for adaptive optical signal processing. The system executes transforms where algorithms for handling the entire data vector is processed, shortening the computational complexity effectively. Thus the optical soft memory system as described by the evolving Optical GVA DS iterator instantiates enables the design of parallel processors to handle modulated data in the optical domain. This is of importance in the realization of distributed netcentric architectures and forms the basis of large-scale real-time data processing and acquisition in m2m units.

  7. M2M modelling of the Galactic disc via PRIMAL: fitting to Gaia error added data

    NASA Astrophysics Data System (ADS)

    Hunt, Jason A. S.; Kawata, Daisuke

    2014-09-01

    We have adapted our made-to-measure (M2M) algorithm PRIMAL to use mock Milky Way like data constructed from an N-body barred galaxy with a boxy bulge in a known dark matter potential. We use M0 giant stars as tracers, with the expected error of the ESA (European Space Agency) space astrometry mission Gaia. We demonstrate the process of constructing mock Gaia data from an N-body model, including the conversion of a galactocentric Cartesian coordinate N-body model into equatorial coordinates and how to add error to it for a single stellar type. We then describe the modifications made to PRIMAL to work with observational error. This paper demonstrates that PRIMAL can recover the radial profiles of the surface density, radial velocity dispersion, vertical velocity dispersion and mean rotational velocity of the target disc, along with the pattern speed of the bar, to a reasonable degree of accuracy despite the lack of accurate target data. We also construct mock data which take into account dust extinction and show that PRIMAL recovers the structure and kinematics of the disc reasonably well. In other words, the expected accuracy of the Gaia data is good enough for PRIMAL to recover these global properties of the disc, at least in a simplified condition, as used in this paper.

  8. Stress and Thermal Analysis of the In-Vessel RMP Coils in HL-2M

    NASA Astrophysics Data System (ADS)

    Cen, Yishun; Li, Qiang; Ding, Yonghua; Cai, Lijun; Jiang, Jiaming; Li, Guangsheng; Liu, Yi

    2013-09-01

    A set of in-vessel resonant magnetic perturbation (RMP) coils for MHD instability suppression is proposed for the design of a HL-2M tokamak. Each coil is to be fed with a current of up to 5 kA, operated in a frequency range from DC to about 1 kHz. Stainless steel (SS) jacketed mineral insulated cables are proposed for the conductor of the coils. In-vessel coils must withstand large electromagnetic (EM) and thermal loads. The support, insulation and vacuum sealing in a very limited space are crucial issues for engineering design. Hence finite element calculations are performed to verify the design, optimize the support by minimizing stress caused by EM forces on the coil conductors and work out the temperature rise occurring on the coil in different working conditions, the corresponding thermal stress caused by the thermal expansion of materials is evaluated to be allowable. The techniques to develop the in-vessel RMP coils, such as support, insulation and cooling, are discussed.

  9. Evaluating climate change effects on runoff by statistical downscaling and hydrological model GR2M

    NASA Astrophysics Data System (ADS)

    Okkan, Umut; Fistikoglu, Okan

    2014-07-01

    The main purpose of this study is to evaluate the impacts of climate change on Izmir-Tahtali freshwater basin, which is located in the Aegean Region of Turkey. For this purpose, a developed strategy involving statistical downscaling and hydrological modeling is illustrated through its application to the basin. Prior to statistical downscaling of precipitation and temperature, the explanatory variables are obtained from National Centers for Environmental Prediction/National Center for Atmospheric Research reanalysis data set. All possible regression approach is used to establish the most parsimonious relationship between precipitation, temperature, and climatic variables. Selected predictors have been used in training of artificial neural networks-based downscaling models and the trained models with the obtained relationships have been operated to produce scenario precipitation and temperature from the simulations of third Generation Coupled Climate Model. Biases from downscaled outputs have been reduced after downscaling process. Finally, the corrected downscaled outputs have been transformed to runoff by means of a monthly parametric hydrological model GR2M to assess the probable impacts of temperature and precipitation changes on runoff. According to the A1B climate scenario results, statistically significant trends are foreseen for precipitation, temperature, and runoff in the study basin.

  10. The 64 Mpixel wide field imager for the Wendelstein 2m telescope: design and calibration

    NASA Astrophysics Data System (ADS)

    Kosyra, Ralf; Gössl, Claus; Hopp, Ulrich; Lang-Bardl, Florian; Riffeser, Arno; Bender, Ralf; Seitz, Stella

    2014-11-01

    The Wendelstein Observatory of Ludwig Maximilians University of Munich has recently been upgraded with a modern 2m robotic telescope. One Nasmyth port of the telescope has been equipped with a wide-field corrector which preserves the excellent image quality (<0.8 " median seeing) of the site (Hopp et al. 2008) over a field of view of 0.7 degrees diameter. The available field is imaged by an optical imager (WWFI, the Wendelstein Wide Field Imager) built around a customized 2×2 mosaic of 4 k×4 k 15 μm e2v CCDs from Spectral Instruments. This paper provides an overview of the design and the WWFI's performance. We summarize the system mechanics (including a structural analysis), the electronics (and its electromagnetic interference (EMI) protection) and the control software. We discuss in detail detector system parameters, i.e. gain and readout noise, quantum efficiency as well as charge transfer efficiency (CTE) and persistent charges. First on sky tests yield overall good predictability of system throughput based on lab measurements.

  11. McGee Mountain Shallow (2m) Temperature Survey, Humboldt County, Nevada 2009

    SciTech Connect

    Richard Zehner

    2009-01-01

    This shapefile contains location and attribute data for a shallow (2 meter) temperature survey conducted by Geothermal Technical Partners, Inc. during late 2008 and early 2009. Temperatures at 2m depth were measured at 192 separate points as outlined by Coolbaugh et al., 2007. The purpose of the survey was to try and detect a shallow thermal anomaly associated with the McGee Mountain geothermal area as discovered by Phillips Petroleum and Earth Power Resources in the late 1970’s. Drilling identified ~120oC temperatures at ~100m depth. This 2-meter survey delineated what was interpreted as a steam-heated fault zone centered along a range front fault in the vicinity of the drilled holes and fumaroles. Coolbaugh, M.F., Sladek, C., Faulds, J.E., Zehner, R.E., and Oppliger, G.L., 2007, Use of rapid temperature measurements at a 2-meter depth to augment deeper temperature gradient drilling: Proceedings, 32nd Workshop on Geothermal Reservoir Engineering, Stanford University, Stanford, CA, Jan. 22-24, 2007, p. 109-116. Zehner, R., Tullar, K., and Rutledge, E., 2012, Effectiveness of 2-Meter and geoprobe shallow temperature surveys in early stage geothermal exploration: Geothermal Resources Council Transactions, v. 36, in press.

  12. Tuning the hydrogen evolution activity of MS2 (M = Mo or Nb) monolayers by strain engineering.

    PubMed

    Chen, Xiaobo; Wang, Guangjin

    2016-04-14

    Strain engineering is an effective strategy to tune the electronic, magnetic and optical properties of atomically thin materials like graphene and monolayer transition-metal dichalcogenides (m-TMDs). Using first-principles calculations, we show that strain is also effective for tuning the catalytic activity of m-MS2 (M = Mo or Nb) towards the hydrogen evolution reaction (HER), which is essential for electrochemical hydrogen generation from water splitting. A wide strain range covering both compressive (0-6%) and tensile (0-10%) regions is considered. It is found that biaxial tensile strain can enhance the HER activity more effectively than uniaxial tensile strain, while compressive strain deteriorates the HER activity. Compared with monolayer 1T-NbS2, monolayers 1T-MoS2 and 1H-NbS2 exhibit better strain tunability towards their HER activities since more active sites can be induced with increasing strain. In contrast, monolayer 1H-MoS2 is catalytically inert in the considered strain range because H adsorption is too weak. We demonstrate that tensile strain can lead to decrease of the adiabatic proton affinity but simultaneously a larger magnitude of increase of the adiabatic electron affinity, thus enhancing the catalytic activity. Electronic structure calculations show that tensile strain can activate the relatively inert inner valence electrons and enlarge the d-band exchange splitting, both of which induce destabilization of the system and enhancement of catalytic activity. PMID:26878108

  13. Diosgenin induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma cells.

    PubMed

    Li, Yongjian; Wang, Xiaorong; Cheng, Silu; Du, Juan; Deng, Zhengting; Zhang, Yani; Liu, Qun; Gao, Jingdong; Cheng, Binbin; Ling, Changquan

    2015-02-01

    Diosgenin is a major compound of Dioscoreaceae plants such as yam, which is used as a drug in Traditional Chinese Medicine, and a common vegetable worldwide. The anticancer effect of diosgenin has been reported in various tumor cells, including leukemia, gastric, colorectal, and breast cancer. However, the activity of diosgenin on hepatocellular carcinoma (HCC) and the underlying mechanism have not been completely investigated. Therefore, we investigated the efficacy and associated mechanisms of diosgenin in HCC cells. Flow cytometric analysis was performed to determine the presence of cell cycle arrest and apopotic cells. Diosgenin significantly inhibited the growth of Bel-7402, SMMC-7721 and HepG2 HCC cells in a concentration-dependent manner. Diosgenin treatment for 24 h induced G2/M cell cycle arrest and apoptosis of hepatoma cells. Diosgenin inhibited Akt phosphorylation and upregulated p21 and p27 expression, but did not alter the expression of p53, suggesting diosgenin-induced upregulation of p21 and p57 is p53-independent in HCC cells. Diosgenin induced HCC cell apoptosis by activating caspase cascades -3, -8 and -9. However, diosgenin did not affect Bcl-2 and Bax levels. In conclusion, results of the present study suggest that diosgenin may be an active anti-HCC agent obtained from natural plants and provide new insights in understanding the mechanisms of diosgenin. PMID:25434486

  14. Numerical investigation of disruption characteristics for the snowflake divertor configuration in HL-2M

    NASA Astrophysics Data System (ADS)

    Xue, L.; Duan, X. R.; Zheng, G. Y.; Liu, Y. Q.; Pan, Y. D.; Yan, S. L.; Dokuka, V. N.; Lukash, V. E.; Khayrutdinov, R. R.

    2016-05-01

    Cold and hot vertical displacement events (VDEs) are frequently related to the disruption of vertically-elongated tokamaks. The weak poloidal magnetic field around the null-points of a snowflake divertor configuration may influence the vertical displacement process. In this paper, the major disruption with a cold VDE and the vertical disruption in the HL-2M tokamak are investigated by the DINA code. In order to better illustrate the effect from the weak poloidal field, a double-null snowflake configuration is compared with the standard divertor (SD) configuration under the same plasma parameters. Computational results show that the weak poloidal magnetic field can be partly beneficial for mitigating the vertical instability of the plasma under small perturbations. For major disruption, the peak poloidal halo current fraction is almost the same between the snowflake and the SD configurations. However, this fraction becomes much larger for the snowflake in the event of a hot VDE. Furthermore, during the disruption for a snowflake configuration, the distribution of electromagnetic force on a vacuum vessel gets more non-uniform during the current quench.

  15. The IEM2M rough-surface scattering model for complex-permittivity scattering media

    NASA Astrophysics Data System (ADS)

    Álvarez-Pérez, José L.

    2012-05-01

    The integral equation model (IEM) was developed in the late 1980s and arguably became the most cited and implemented rough-surface scattering model in the field of radar remote sensing for Earth observation. It was derived by applying a second-order iteration in the incident electromagnetic field to the integral equations of the surface fields as given by Poggio and Miller. It is thus an extension of the first-order, Born approximation of these equations that produce the classical Kirchhoff approximation. The IEM has been subject to numerous amendments and variations over the last 20 years due to the imperfect introduction and handling of the Weyl representation of the spherical wave in its first version. The work presented here is a further development of the contribution made by the same author in 2001 (IEM2M), which was the first version of IEM able to blend analytically both the Kirchhoff and the small-perturbation approximations for the bistatic case. The improvement reported in this article is concerned with the inclusion of evanescent waves in the formulation of the model and the extension of the range of applicability of the second-order scattering terms to interfaces with complex-permittivity scattering media.

  16. Fully automated high-resolution spectroscopy at Swiss 1.2 m La Silla telescope

    NASA Astrophysics Data System (ADS)

    Weber, Luc; Blecha, Andre; Davignon, Geert; Maire, Charles; Queloz, Didier; Russiniello, Giovanni B.; Simond, Gilles

    2000-06-01

    A Ritchey-Chretien 1.2 m telescope (EULER) and the High- Resolution echelle Spectrograph (CORALIE), a new Swiss observing facility at ESO La Silla Observatory, are operational and since Summer 1998. The Observatory operation is fully automated and supports the unattended, attended and interactive mode of operation under local or remote control. The control hardware is based on Local Control Units (LCU) built from PC/RedHat Linux computers and a Unix Computing Server. The Operational Software is built around INTER, a command language interpreter featuring communication control, data access, image processing functions and easy access to external resources. The general SW architecture is a non-hierarchical tree of pairs made of hardware- independent interpreters running on the Observing Server and hardware dependent servers running on the LCU's. The Operational Software includes the full access (Creation/Modification/Retrieval) to the input/output databases, telescope, instrument and auxiliary set-up and control files as well as a full data-reduction pipeline. We describe briefly the system architecture, summarize the performances and the experience gained over 18 months of operation and we discuss some critical issues: use of standard components, parallel operation, real-time requirements, system upgrade and maintenance.

  17. Development of a 2 m Pr2Fe14B Cryogenic Permanent Magnet Undulator at SOLEIL

    NASA Astrophysics Data System (ADS)

    Benabderrahmane, C.; Valléau, M.; Berteaud, P.; Tavakoli, K.; Marlats, J. L.; Nagaoka, R.; Béchu, N.; Zerbib, D.; Brunelle, P.; Chapuis, L.; Dallé, D.; Herbeaux, C.; Lestrade, A.; Louvet, M.; Couprie, M. E.

    2013-03-01

    A 2 m long 18 mm period Cryogenic Permanent Magnet Undulator (CPMU) has been constructed at SOLEIL. Praseodymium was chosen instead of Neodymium magnetic material, because of the absence of the Spin Reorientation Transition phenomenon. The use of Pr2Fe14B with a remnence Br of 1.35 T at room temperature enables to increase the peak magnetic field at 5.5 mm minimum gap, from 1.04 T at room temperature to 1.15 T at a cryogenic temperature of 77 K. The magnetic field reaches 1.91 T at a gap of 3 mm in case of FELs applications. Different corrections were performed first at room temperature to adjust the phase error, the electron trajectory and to reduce the multipolar components. A dedicated magnetic measurement bench to check the magnetic performance of the undulator at low temperature has been designed and assembled inside the vacuum chamber. The results of the magnetic measurements at low temperature and at room temperature are compared. The CPMU has been installed and commissioned in the storage ring.

  18. Results from recent hydrogen pellet acceleration studies with a 2-m railgun

    SciTech Connect

    Kim, K.; Zhang, D.J.; King, T.; Haywood, R.; Manns, W.; Venneri, F.

    1989-12-01

    A new 3.2-mm-diameter, two-stage, fuseless, plasma-arc-driven electromagnetic railgun has been designed, constructed, and successfully operated to achieve a record velocity of 2.67 km/s({sup b}) for 3.2 mmD {times} 4 mmL solid hydrogen pellet. The first stage of this hydrogen pellet injector is a combination of a hydrogen pellet generator and a gas fun. The second stage is a 2-m-long railgun which serves as a booster accelerator. The gas fun accelerates a frozen hydrogen pellet to a medium velocity and injects it into the railgun through a perforated coupling piece, which also serves a pressure-relieving mechanism. An electrical breakdown of the propellant gas, which has followed the pellet from the gas fun into the railgun, forms a conducting plasma-arc armature immediately behind the pellet allowing for fuseless operation of the railgun. Study of the pressure profile and the behavior of the plasma-arc armature inside the railgun bore led to elimination of spurious arcing, which prevents operation of the railgun at high voltages (and, therefore, at high currents). A timing circuit that can automatically measure the pellet input velocity and allows for accurate control of arc initiation behind the pellet helps prevent pellet disintegration and mistriggering of the arc initiation circuit. Results from the recent cryogenic operation of the two-stage pellet acceleration system are reported. 11 refs., 2 figs., 1 tab.

  19. Searching for the Holy Grail: HIV vaccine development in the new millennium.

    PubMed

    MacDougall, D S

    1999-08-01

    Many reasons for the difficulty in developing an HIV vaccine were discussed at the 5th National Symposium on Basic Aspects of Vaccines. The April 1999 conference was attended by nearly 200 researchers. Speakers included Dr. Neal Nathanson of the National Institutes of Health (NIH), who called HIV "particularly insidious." Topics included envelope glycoproteins; enhancing CTL responses; soluble CD40 ligand trimer and its effect on growth of antigen-specific T cells; responses of immunized monkeys to challenges with SHIV; CD8+ T cell responses in vaccinated chimpanzees; an anti-HIV vaccine regimen using DNA and E1-deleted adenoviral recombinant vaccines; use of plasma alpha-2 macroglobulin (A2M) for enhanced antigen processing; effects of a tandemly repeated HIV-1 V3 peptide sequence; intragastric immunization with listeria monocytogenes expressing HIV-1 gag protein; and production of antigenic determinants of HIV envelope protein using plant viruses. A reference list is included. PMID:11367310

  20. Application of cluster analysis and autoregressive neural networks for the noise diagnostics of the IBR-2M reactor

    NASA Astrophysics Data System (ADS)

    Pepelyshev, Yu. N.; Tsogtsaikhan, Ts.; Ososkov, G. A.

    2016-09-01

    The pattern recognition methodologies and artificial neural networks were used widely for the IBR-2M pulsed reactor noise diagnostics. The cluster analysis allows a detailed study of the structure and fast reactivity effects of IBR-2M and nonlinear autoregressive neural network (NAR) with local feedback connection allows predicting slow reactivity effects. In this work we present results of a study on pulse energy noise dynamics and prediction of liquid sodium flow rate through the core of the IBR-2M reactor using cluster analysis and an artificial neural network.

  1. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  2. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  3. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  4. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  5. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  6. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  7. Expression and modulation of IL-1 alpha in murine keratinocytes

    SciTech Connect

    Ansel, J.C.; Luger, T.A.; Lowry, D.; Perry, P.; Roop, D.R.; Mountz, J.D.

    1988-04-01

    Murine and human keratinocytes produce an IL-1-like factor that appears to be similar if not identical to monocyte-derived IL-1. IL-1 may be an important mediator in cutaneous inflammatory responses, however, little is currently known concerning factors that may modulate IL-1 expression in keratinocytes. To address this issue we examined the effect of LPS, UV, and the cell differentiation state on murine keratinocyte IL-1 mRNA expression. Our results indicated that as with the murine P388D1 monocyte cell line, PAM 212 keratinocytes constitutively express abundant amounts of IL-1 alpha mRNA. On exposure to LPS (100 micrograms/ml) for 8 h there was more than 10 times the increase in PAM 212 IL-1 alpha mRNA which was accompanied by a sixfold increase in supernatant IL-1 activity. Similarly UV irradiation had a significant effect on keratinocyte IL-1 alpha expression. High dose UV (300 mJ/cm2) inhibited PAM 212 IL-1 alpha expression at 4, 8, 24, 48 h post-UV whereas a lower dose of UV (100 mJ/cm2) inhibited UV at 4 and 8 h post-UV, but induced IL-1 expression at 24 and 48 h post-UV. The expression of IL-1 alpha varied with the differentiation state of the keratinocytes. Freshly removed newborn murine keratinocytes were found to constitutively express IL-1 alpha mRNA. Keratinocytes grown in low (Ca2+) tissue culture media (0.05 mM) for 6 days, functionally and phenotypically become undifferentiated and express increased quantities of IL-1 alpha mRNA, whereas cells grown in high (Ca2+) media (1.2 mM) for 6 days become terminally differentiated and IL-1 expression ceased. Keratinocytes cultured for 3 days in low (Ca2+) conditions expressed an intermediate level of IL-1 alpha. In contrast, little or no IL-1 beta mRNA was detected in either the PAM 212 cells or newborn murine keratinocytes.

  8. The ASTRI SST-2M telescope prototype for the Cherenkov Telescope Array: camera DAQ software architecture

    NASA Astrophysics Data System (ADS)

    Conforti, Vito; Trifoglio, Massimo; Bulgarelli, Andrea; Gianotti, Fulvio; Fioretti, Valentina; Tacchini, Alessandro; Zoli, Andrea; Malaguti, Giuseppe; Capalbi, Milvia; Catalano, Osvaldo

    2014-07-01

    ASTRI (Astrofisica con Specchi a Tecnologia Replicante Italiana) is a Flagship Project financed by the Italian Ministry of Education, University and Research, and led by INAF, the Italian National Institute of Astrophysics. Within this framework, INAF is currently developing an end-to-end prototype of a Small Size dual-mirror Telescope. In a second phase the ASTRI project foresees the installation of the first elements of the array at CTA southern site, a mini-array of 7 telescopes. The ASTRI Camera DAQ Software is aimed at the Camera data acquisition, storage and display during Camera development as well as during commissioning and operations on the ASTRI SST-2M telescope prototype that will operate at the INAF observing station located at Serra La Nave on the Mount Etna (Sicily). The Camera DAQ configuration and operations will be sequenced either through local operator commands or through remote commands received from the Instrument Controller System that commands and controls the Camera. The Camera DAQ software will acquire data packets through a direct one-way socket connection with the Camera Back End Electronics. In near real time, the data will be stored in both raw and FITS format. The DAQ Quick Look component will allow the operator to display in near real time the Camera data packets. We are developing the DAQ software adopting the iterative and incremental model in order to maximize the software reuse and to implement a system which is easily adaptable to changes. This contribution presents the Camera DAQ Software architecture with particular emphasis on its potential reuse for the ASTRI/CTA mini-array.

  9. Uncoupling protein-2 mRNA expression in mice subjected to intermittent hypoxia*

    PubMed Central

    Vieira, Luciana Rodrigues; Martinez, Denis; Forgiarini, Luiz Felipe; da Rosa, Darlan Pase; de Muñoz, Gustavo Alfredo Ochs; Fagundes, Micheli; Martins, Emerson Ferreira; Montanari, Carolina Caruccio; Fiori, Cintia Zappe

    2015-01-01

    Objective: To investigate the effect of intermittent hypoxia-a model of obstructive sleep apnea (OSA)-on pancreatic expression of uncoupling protein-2 (UCP2), as well as on glycemic and lipid profiles, in C57BL mice. Methods: For 8 h/day over a 35-day period, male C57BL mice were exposed to intermittent hypoxia (hypoxia group) or to a sham procedure (normoxia group). The intermittent hypoxia condition involved exposing mice to an atmosphere of 92% N and 8% CO2 for 30 s, progressively reducing the fraction of inspired oxygen to 8 ± 1%, after which they were exposed to room air for 30 s and the cycle was repeated (480 cycles over the 8-h experimental period). Pancreases were dissected to isolate the islets. Real-time PCR was performed with TaqMan assays. Results: Expression of UCP2 mRNA in pancreatic islets was 20% higher in the normoxia group than in the hypoxia group (p = 0.11). Fasting serum insulin was higher in the hypoxia group than in the normoxia group (p = 0.01). The homeostasis model assessment of insulin resistance indicated that, in comparison with the control mice, the mice exposed to intermittent hypoxia showed 15% lower insulin resistance (p = 0.09) and 21% higher pancreatic β-cell function (p = 0.01). Immunohistochemical staining of the islets showed no significant differences between the two groups in terms of the area or intensity of α- and β-cell staining for insulin and glucagon. Conclusions: To our knowledge, this is the first report of the effect of intermittent hypoxia on UCP2 expression. Our findings suggest that UCP2 regulates insulin production in OSA. Further study of the role that UCP2 plays in the glycemic control of OSA patients is warranted. PMID:25909153

  10. On the behavior of plasma with a negative current in the L-2M stellarator

    SciTech Connect

    Shchepetov, S. V. Khol’nov, Yu. V.; Vasil’kov, D. G.

    2015-09-15

    The behavior of plasma with a negative current in the range of 5 kA ≤ vertical bar J vertical bar ≤ 16 kA in the L-2M stellarator is studied. Plasma is created and heated by means of electron cyclotron resonance heating (ECRH). Here, the definition “negative” stands for a toroidal current directed in such a way that it reduces the initial rotational transform µ in absolute value. It is shown that, only at relatively small values of the negative current ( vertical bar J vertical bar ∼ 6 kA), the increase in the shear leads to a reduction in electromagnetic turbulence. As vertical bar J vertical bar rises, the average level of magnetic fluctuations in the stationary phase of the discharge gradually increases. After ECRH is switched off (i.e., when plasma cools down), there is a time interval in which the amplitude of magnetic field fluctuations increases. No coherent three-dimensional modes (e.g., double tearing modes) that could accompany the penetration of the current into the plasma were observed. As for axisymmetric perturbations with m ≠ 0, analysis of the experimental data shows that they are absent at vertical bar J vertical bar ≤ 8 kA, appear in some discharges at vertical bar J vertical bar = 9 kA, and are observed in each discharge at vertical bar J vertical bar ≥ 10 kA. The frequency of these oscillations is on the order of 10 kHz, the poloidal mode number is m = 2, and the duration is 4–6 ms. The absence of oscillations with m = 1 and the small value of the external magnetic field for the m = 2 perturbation indicate that the radial size of the magnetic island is less than 1 cm. This, in turn, suggests that the radial profile of the plasma current changes with increasing vertical bar J vertical bar.

  11. Cassegrain and Nasmyth adaptive optics systems of 8.2-m Subaru telescope

    NASA Astrophysics Data System (ADS)

    Iye, Masanori; Takami, Hideki; Takato, Naruhisa; Oya, Shin; Hayano, Yutaka; Guyon, Olivier; Colley, Stephen A.; Hattori, Masayuki; Watanabe, M.; Eldred, Michael; Saito, Yoshihiko; Saito, N.; Akagawa, Kazuyuki; Wada, Satoshi

    2004-12-01

    The performance of the Cassegrain Adaptive Optics (AO) system of the 8.2 m Subaru Telescope is reported. The system is based on a curvature wavefront sensor with 36 photon-counting avalanche photodiode modules and a bimorph wavefront correcting deformable mirror with 36 driving electrodes. This AO system has been in service since 2002 April for two open-use instruments, an infrared camera and spectrograph (IRCS) and a coronagraph imager with adaptive optics (CIAO). The Strehl ratio in the K-band is around 0.3 when a bright guide star is available under 0".4 seeing condition. High sensitivity of the wavefront sensor allows significant improvement in the image quality, even for faint guide stars down to R=18 mag. The design of the new Nasmyth Adaptive Optics system with 188 control elements under construction is described. This new system with fivefold increase in the number of control elements will provide twice higher Strehl ratio of 0.7. To increase the sky coverage for this new system, a power laser system to produce an artificail guide star in the upper atmosphere is also under construction. The AO system with laser guide capability enables the coverage up to 80% of the entire sky and offers diffraction limited observation for almost any target in the sky. An all solid-state 4W laser to generate the sodium D line emission by summing the two YAG laser frequencies is under development. The generated laser beam is tranmitted through a photonic crystal fiber to the laser launching telescope attached at the backside of the secondary mirror. Expected performance of this laser guide Nasmyth AO system is shown.

  12. Development x environment interactions control tph2 mRNA expression

    PubMed Central

    Lukkes, Jodi L.; Kopelman, Jared M.; Donner, Nina C.; Hale, Matthew W.; Lowry, Christopher A.

    2013-01-01

    Adverse early life experience is thought to increase an individual's susceptibility to mental health disorders, including anxiety and affective disorders, later in life. Our previous studies have shown that post-weaning social isolation of female rats during a critical period of development sensitizes an anxiety-related serotonergic dorsal raphe nucleus (DR) system in adulthood. Therefore, we investigated how post-weaning social isolation, in combination with a challenge with the anxiogenic drug, N-methyl-beta-carboline-3-carboxamide (FG-7142; a partial inverse agonist at the benzodiazepine allosteric site on the GABAA receptor), affects home cage behavior and serotonergic gene expression in the DR of female rats using in situ hybridization histochemistry. Juvenile female rats were reared in isolation or groups of three for a 3-week period from weaning (postnatal day (PD) 21 to mid-adolescence (PD42)), after which all rats were group-reared for an additional 16 days until adulthood. Among vehicle-treated rats, isolation-reared rats had decreased tryptophan hydroxylase 2 (tph2) mRNA expression in ventral and ventrolateral subdivisions of the DR, a pattern observed previously in a rat model of panic disorder. Isolation-reared rats, but not group-reared rats, responded to FG-7142 with increased duration of vigilance and arousal behaviors. In addition, FG-7142 decreased tph2 expression, measured 4 h following treatment, in multiple subregions of the DR of group-reared rats but had no effect in isolation-reared rats. No treatment effects were observed on 5-HT1A receptor or serotonin transporter gene expression. These data suggest that adolescent social isolation alters tph2 expression in specific subregions of the DR and alters the effects of stress-related stimuli on behavior and serotonergic systems. PMID:23403177

  13. The Protein Kinase Cδ Catalytic Fragment Is Critical for Maintenance of the G2/M DNA Damage Checkpoint*

    PubMed Central

    LaGory, Edward L.; Sitailo, Leonid A.; Denning, Mitchell F.

    2010-01-01

    Protein kinase Cδ (PKCδ) is an essential component of the intrinsic apoptotic program. Following DNA damage, such as exposure to UV radiation, PKCδ is cleaved in a caspase-dependent manner, generating a constitutively active catalytic fragment (PKCδ-cat), which is necessary and sufficient for keratinocyte apoptosis. We found that in addition to inducing apoptosis, expression of PKCδ-cat caused a pronounced G2/M cell cycle arrest in both primary human keratinocytes and immortalized HaCaT cells. Consistent with a G2/M arrest, PKCδ-cat induced phosphorylation of Cdk1 (Tyr15), a critical event in the G2/M checkpoint. Treatment with the ATM/ATR inhibitor caffeine was unable to prevent PKCδ-cat-induced G2/M arrest, suggesting that PKCδ-cat is functioning downstream of ATM/ATR in the G2/M checkpoint. To better understand the role of PKCδ and PKCδ-cat in the cell cycle response to DNA damage, we exposed wild-type and PKCδ null mouse embryonic fibroblasts (MEFs) to UV radiation. Wild-type MEFs underwent a pronounced G2/M arrest, Cdk1 phosphorylation, and induction of apoptosis following UV exposure, whereas PKCδ null MEFs were resistant to these effects. Expression of PKCδ-green fluorescent protein, but not caspase-resistant or kinase-inactive PKCδ, was able to restore G2/M checkpoint integrity in PKCδ null MEFs. The function of PKCδ in the DNA damage-induced G2/M cell cycle checkpoint may be a critical component of its tumor suppressor function. PMID:19917613

  14. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  15. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  17. Identification of the DNA sequences controlling the expression of the MAT alpha locus of yeast.

    PubMed Central

    Siliciano, P G; Tatchell, K

    1986-01-01

    We have excised a 28-base-pair DNA fragment from the MAT alpha intergenic region and tested its ability to direct diploid-specific transcriptional repression. This fragment (1643-1671, 5'-GCTTCCCAATGTAGAAAAGTACA-TCATA-3') lies within a region required for the normal diploid-specific repression of the MAT alpha transcripts. First, the fragment was inserted into a 53-base-pair MAT alpha deletion that expresses alpha 1 and alpha 2 constitutively. Insertion of the fragment restores proper diploid regulation to the MAT alpha transcripts: alpha 1 mRNA is strongly repressed and alpha 2 mRNA is reduced by a factor of approximately equal to 10 from its haploid level. The fragment works equally well in either orientation, and two copies of the fragment do not lead to stronger repression than a single copy. We also inserted the fragment at three sites upstream of the CYC1-lacZ fusion gene. Insertions placing the regulatory fragment between the CYC1 upstream activator sequence (UAS) and the coding region make beta-galactosidase efficiently in alpha haploids but produce 1/40th the enzyme in a/alpha diploids. This diploid-specific repression requires functional MATa-1 gene product. Insertion of the MAT fragment on the opposite side of the UAS (37 base pairs upstream of the UAS) also caused diploid repression of the fusion gene, but only by a factor of 7. When the regulatory fragment is inserted at a large distance on the far side of the UAS (375 base pairs), it has little if any effect on beta-galactosidase expression. We postulate that this sequence is the operator recognized by the diploid-specific repressor. Images PMID:3517864

  18. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  19. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  20. Characterizing Rocky and Gaseous Exoplanets with 2 m Class Space-based Coronagraphs

    NASA Astrophysics Data System (ADS)

    Robinson, Tyler D.; Stapelfeldt, Karl R.; Marley, Mark S.

    2016-02-01

    Several concepts now exist for small, space-based missions to directly characterize exoplanets in reflected light. While studies have been performed that investigate the potential detection yields of such missions, little work has been done to understand how instrumental and astrophysical parameters will affect the ability of these missions to obtain spectra that are useful for characterizing their planetary targets. Here, we develop an instrument noise model suitable for studying the spectral characterization potential of a coronagraph-equipped, space-based telescope. We adopt a baseline set of telescope and instrument parameters appropriate for near-future planned missions like WFIRST-AFTA, including a 2 m diameter primary aperture, an operational wavelength range of 0.4-1.0 μm, and an instrument spectral resolution of λ/Δλ = 70, and apply our baseline model to a variety of spectral models of different planet types, including Earth twins, Jupiter twins, and warm and cool Jupiters and Neptunes. With our exoplanet spectral models, we explore wavelength-dependent planet-star flux ratios for main-sequence stars of various effective temperatures and discuss how coronagraph inner and outer working angle constraints will influence the potential to study different types of planets. For planets most favorable to spectroscopic characterization—cool Jupiters and Neptunes as well as nearby super-Earths—we study the integration times required to achieve moderate signal-to-noise ratio spectra. We also explore the sensitivity of the integration times required to either detect the bottom or presence of key absorption bands (for methane, water vapor, and molecular oxygen) to coronagraph raw contrast performance, exozodiacal light levels, and the distance to the planetary system. Decreasing detector quantum efficiency at longer visible wavelengths makes the detection of water vapor in the atmospheres of Earth-like planets extremely challenging, and also hinders detections

  1. Recent results from the CMD-2 detector at the VEPP-2M collider

    SciTech Connect

    Solodov, E.P.

    1997-01-01

    The general-purpose detector CMD-2 is taking data at the Novosibirsk VEPP-2M e{sup -}e{sup -} collider in the energy range 360-1400 MeV, with luminosity of {approx} 5.0 x 10{sup 30} cm{sup -2} s{sup -1} for the {phi} resonance region. Data from {approx} 1500 nb{sup -1} of integrated luminosity around 1.02 GeV and {approx}500 nb{sup -1} in the 600-1000 MeV range have been collected and preliminary analyses performed. We present progress in studies of the {phi} meson and K{sub S}K{sub L} systems: (a) measurement of the {phi} meson parameters; (b) searches for {phi} rare decays. The new upper limits B({phi}{yields}{eta}{prime} {gamma}) < 2.4 x 10{sup -4}, B({phi} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}) < 1.0 x 10{sup -4}, and B({phi} {yields} f{sub 0}{gamma}) < 8 x 10{sup -4} have been obtained; (c) the study of the K{sub L} interactions in the CsI calorimeter; (d) with the help of 32,340 tagged K{sub S}, the semi-rare decay of K{sub S} {yields} {pi}{sup +}{pi}{sup -}{gamma} has been observed with a branching ratio of (1.82 {+-} 0.49)x10{sup -3}; and (e) selection of events with K{sub S}K{sub L} coupled decays and interactions. The regeneration cross section of the low moments K{sub L} was found to be {sigma}{sub reg}{sup Be} = 63 {+-} 19 mb. Data from the 600-1000 MeV energy range are used for high-accuracy measurement of the e{sup +}e{sup -} annihilation cross section, and the preliminary analysis is presented in this paper.

  2. beta-Sitosterol induces G2/M arrest, endoreduplication, and apoptosis through the Bcl-2 and PI3K/Akt signaling pathways.

    PubMed

    Moon, Dong-Oh; Kim, Mun-Ock; Choi, Yung Hyun; Kim, Gi-Young

    2008-06-18

    beta-Sitosterol (SITO) is a potentially valuable candidate for cancer chemotherapy, however the cellular and molecular mechanisms responsible for its anti-cancer activity are unknown. Therefore, we attempted to elucidate the mechanisms responsible for SITO-induced anti-proliferation in human leukemia cells. Treatment with SITO increased caspase-3 activation and DNA fragmentation in U937 and HL60 cells. This effect was associated with significant G2/M arrest and endoreduplication. We also demonstrated that SITO treatment significantly increases levels of polymeric alpha-tubulin and promoted microtubule polymerization. We next elucidated that ectopic expression of Bcl-2 accelerates endoreduplication in U937 cells. Furthermore, the specific Bcl-2 inhibitor, HA14-1, prevented endoreduplication through G2 phase arrest. Interestingly, SITO treatment did not significantly promote endoreduplication or decrease cell viability in Bcl-2 null K562 cells. SITO treatment also induced a gradual increase of phosphatidyl-inositol 3-kinase (PI3K) and Akt phosphorylation. Treatment with the selective PI3K/Akt inhibitor LY29004 completely blocked endoreduplication and apoptosis in the presence of SITO. In addition, treatment with SITO-induced phosphorylation of extracellular signal-regulated protein kinase (ERK), however significance of ERK activation in the execution of apoptosis and endoreduplication is unknown. These results suggest that SITO induces endoreduplication by promoting spindle microtubule dynamics through the Bcl-2 and PI3K/Akt signaling pathways.

  3. Human immunodeficiency virus type 1 envelope glycoprotein gp120 produces immune defects in CD4+ T lymphocytes by inhibiting interleukin 2 mRNA.

    PubMed Central

    Oyaizu, N; Chirmule, N; Kalyanaraman, V S; Hall, W W; Pahwa, R; Shuster, M; Pahwa, S

    1990-01-01

    Envelope glycoprotein gp120 of human immunodeficiency virus type 1 (HIV-1) is known to inhibit T-cell function, but little is known about the mechanisms of this immunosuppression. Pretreatment of a CD4+ tetanus toxoid-specific T-cell clone with soluble gp120 was found to exert a dose-dependent inhibition of soluble antigen-driven or anti-CD3 monoclonal antibody-driven proliferative response, interleukin 2 (IL-2) production, and surface IL-2 receptor (IL-2R) alpha-chain expression, all of which were reversed by the addition of exogenous IL-2. mRNA for the gene encoding IL-2 was suppressed by treatment with gp120, but IL-2R gene transcription was not inhibited. Bypass activation of the T-cell clone with phorbol 12-myristate 13-acetate plus ionomycin was unaffected by gp120 pretreatment. Thus, gp120-CD4 interaction interferes with an essential role of the CD4 molecule in signal transduction through the CD3-antigen receptor (Ti) complex. Such a mechanism of gp120-induced immunosuppression, if operative in vivo, could contribute to the depressed specific immune responses associated with HIV infection. Images PMID:2315327

  4. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  5. Genetic Control of the Trigger for the G2/M Checkpoint

    SciTech Connect

    Hall, Eric J.; Smilenov, Lubomir B.; Young, Erik F.

    2013-10-01

    system, the engagement of the G2/M checkpoint only occurs at doses where most of the cells are bound for mitotic catastrophe. Further, compound haploinsufficiency of various radiosensitizing genes does not impact the threshold of activation. The experiments confirm a threshold of activation for the G2/M checkpoint, hinting at two separate radiation response programs acting below and above this threshold. Small RNA transfer in bystander effect biology: Small regulatory RNA molecules have now risen in prominence and utility. Specific examples are small interfering RNAs (siRNA) which are employed in cell level expression ablation projects and micro-RNAs (miRNA) which are a pool of short transcription products which serve to modulate the expression of other transcripts emerging from the genome in a meta-regulatory fine tuning of gene expression. The existing tenets of bystander effect radiation biology involve the communication of inflammatory mediators or direct intercellular communication of reactive oxygen/nitrogen species in cell-to-cell communicative organelles called gap junctions. By ablating gap junctions, reducing the ROS/inflammatory cytokine expression one can attenuate bystander effect signaling in cell culture systems. We hypothesized that miRNAs are a competent intercellular communication molecule and therefore a possible component of the bystander response. This view is supported by the observation that miRNA are secreted from cells in exosomes found in the circulation. This circulating pool reports disease type and severity in humans. We proposed use of microbeam irradiation technology at our facilities and enhancement of this capability with a new sorting technology which would allow us to sort irradiated and non-irradiated cells with absolute fidelity. Pursuing direct quantitative transfer assessment, we succeeded in designing and constructing a new add-on sorting appliance which harmonized with our existing instruments. The sorter allowed us to gently sort

  6. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  7. Formation and Detectability of Terrestrial Planets Around Alpha Centauri B

    NASA Astrophysics Data System (ADS)

    Guedes, Javiera

    2009-01-01

    Alpha Centauri B belongs to a triple star system comprised of a central A/B binary and a third companion, Proxima Centauri. The system, our closest stellar neighbor, is of great interest for planet hunters because it may harbor Earth-mass planets possibly in the habitable zone of the stars of the A/B binary. To assess whether terrestrial planets can indeed form around these stars, we run a series of N-body accretionary simulations of a 1/r disk populated with 400-900 lunar-mass oligarchs is followed for 200 Myr. All simulations lead to the formation of multiple-planet systems with at least one planet in the 1-2 M_Earth mass range at 0.5-1.5 AU. We examine the detectability of our simulated planetary systems by generating synthetic radial velocity observations including noise. Using these synthetic observations, we find that we can reliably detect a 1.8 M_Earth planet in the habitable zone of Alpha Centauri B after only three years of high cadence observations. The observations will be carried out at the CTIO site in northern Chile on a 1.5-m underutilized telescope. We expect to report the detection (or non-detection) of Earth-like planets around Alpha Centauri B in 3 to 5 years.

  8. Interactions in L-phenylalanine/L-leucine/L-glutamic Acid/L-proline + 2 M aqueous NaCl/2 M NaNO3 systems at different temperatures

    NASA Astrophysics Data System (ADS)

    Riyazuddeen, Imran Khan; Afrin, Sadaf

    2012-12-01

    Density (ρ) and speed of sound ( u) in 2 M aqueous NaCl and 2 M NaNO3 solutions of amino acids: L-phenylalanine, L-leucine, L-glutamic acid, and L-proline have been measured for several molal concentrations of amino acids at different temperatures. The ρ and u data have been used to calculate the values of isothermal compressibility and internal pressure at different temperatures. The trends of variations of κ T and P i with an increase in molal concentration of amino acid and temperature have been discussed in terms of solute-solvent and solute-solute interactions in the systems.

  9. THE YOUNG PLANET-MASS OBJECT 2M1207b: A COOL, CLOUDY, AND METHANE-POOR ATMOSPHERE

    SciTech Connect

    Barman, Travis S.; Macintosh, Bruce; Konopacky, Quinn M.; Marois, Christian

    2011-07-10

    The properties of 2M1207b, a young ({approx}8 Myr) planet-mass companion, have lacked a satisfactory explanation for some time. The combination of low luminosity, red near-IR colors, and L-type near-IR spectrum (previously consistent with T{sub eff} {approx} 1600 K) implies an abnormally small radius. Early explanations for the apparent underluminosity of 2M1207b invoked an edge-on disk or the remnant of a recent protoplanetary collision. The discovery of a second planet-mass object (HR8799b) with similar luminosity and colors as 2M1207b indicates that a third explanation, one of a purely atmospheric nature, is more likely. By including clouds, non-equilibrium chemistry, and low gravity, an atmosphere with effective temperature consistent with evolution cooling-track predictions is revealed. Consequently, 2M1207b, and others like it, requires no new physics to explain nor do they belong to a new class of objects. Instead they most likely represent the natural extension of cloudy substellar atmospheres down to low T{sub eff} and log (g). If this atmosphere only explanation for 2M1207b is correct, then very young planet-mass objects with near-IR spectra similar to field T dwarfs may be rare.

  10. The telescope control of the ASTRI SST-2M prototype for the Cherenkov telescope Array: hardware and software design architecture

    NASA Astrophysics Data System (ADS)

    Antolini, Elisa; Cascone, Enrico; Schwarz, Joseph; Stringhetti, Luca; Tanci, Claudio; Tosti, Gino; Aisa, Damiano; Aisa, Simone; Bagaglia, Marco; Busatta, Andrea; Campeggi, Carlo; Cefala, Marco; Farnesini, Lucio; Giacomel, Stefano; Marchiori, Gianpiero; Marcuzzi, Enrico; Nucciarelli, Giuliano; Piluso, Antonfranco

    2014-07-01

    ASTRI (Astrofisica con Specchi a Tecnologia Replicante Italiana) is a flagship project of the Italian Ministry of Research and led by the Italian National Institute of Astrophysics (INAF). One of its aims is to develop, within the Cherenkov Telescope Array (CTA) framework, an end-to-end small-sized telescope prototype in a dual-mirror configuration (SST-2M) in order to investigate the energy range E ~ 1-100 TeV. A long-term goal of the ASTRI program is the production of an ASTRI/CTA mini-array composed of seven SST-2M telescopes. The prototype, named ASTRI SST-2M, is seen as a standalone system that needs only network and power connections to work. The software system that is being developed to control the prototype is the base for the Mini-Array Software System (MASS), which has the task to make possible the operation of both the ASTRI SST-2M prototype and the ASTRI/CTA mini-array. The scope of this contribution is to give an overview of the hardware and software architecture adopted for the ASTRI SST- 2M prototype, showing how to apply state of the art industrial technologies to telescope control and monitoring systems.

  11. Modulation of radiation-induced apoptosis and G{sub 2}/M block in murine T-lymphoma cells

    SciTech Connect

    Palayoor, S.T.; Macklis, R.M.; Bump, E.A.; Coleman, C.N.

    1995-03-01

    Radiation-induced apoptosis in lymphocyte-derived cell lines is characterized by endonucleolytic cleavage of cellular DNA within hours after radiation exposure. We have studied this phenomenon qualitatively (DNA gel electrophoresis) and quantitatively (diphenylamine reagent assay) in murine EL4 T-lymphoma cells exposed to {sup 137}Cs {gamma} irradiation. Fragmentation was discernible within 18-24 h after exposure. It increased with time and dose and reached a plateau after 8 Gy of {gamma} radiation. We studied the effect of several pharmacological agents on the radiation-induced G{sub 2}/M block and DNA fragmentation. The agents which reduced the radiation-induced G{sub 2}/M-phase arrest (caffeine, theobromine, theophylline and 2-aminopurine) enhanced the degree of DNA fragmentation at 24 h. In contrast, the agents which sustained the radiation-induced G{sub 2}/M-phase arrest (TPA, DBcAMP, IBMX and 3-aminobenzamide) inhibited the DNA fragmentation at 24 h. These studies on EL4 lymphoma cells are consistent with the hypothesis that cells with radiation-induced genetic damage are eliminated by apoptosis subsequent to a G{sub 2}/M block. Furthermore, it may be possible to modulate the process of radiation-induced apoptosis in lymphoma cells with pharmacological agents that modify the radiation-induced G{sub 2}/M block, and to use this effect in the treatment of patients with malignant disease. 59 refs., 7 figs.

  12. The Young Planet-mass Object 2M1207b: A Cool, Cloudy, and Methane-poor Atmosphere

    NASA Astrophysics Data System (ADS)

    Barman, Travis S.; Macintosh, Bruce; Konopacky, Quinn M.; Marois, Christian

    2011-07-01

    The properties of 2M1207b, a young (~8 Myr) planet-mass companion, have lacked a satisfactory explanation for some time. The combination of low luminosity, red near-IR colors, and L-type near-IR spectrum (previously consistent with T eff ~ 1600 K) implies an abnormally small radius. Early explanations for the apparent underluminosity of 2M1207b invoked an edge-on disk or the remnant of a recent protoplanetary collision. The discovery of a second planet-mass object (HR8799b) with similar luminosity and colors as 2M1207b indicates that a third explanation, one of a purely atmospheric nature, is more likely. By including clouds, non-equilibrium chemistry, and low gravity, an atmosphere with effective temperature consistent with evolution cooling-track predictions is revealed. Consequently, 2M1207b, and others like it, requires no new physics to explain nor do they belong to a new class of objects. Instead they most likely represent the natural extension of cloudy substellar atmospheres down to low T eff and log (g). If this atmosphere only explanation for 2M1207b is correct, then very young planet-mass objects with near-IR spectra similar to field T dwarfs may be rare.

  13. Induction of cytokine granulocyte-macrophage colony-stimulating factor and chemokine macrophage inflammatory protein 2 mRNAs in macrophages by Legionella pneumophila or Salmonella typhimurium attachment requires different ligand-receptor systems.

    PubMed Central

    Yamamoto, Y; Klein, T W; Friedman, H

    1996-01-01

    The attachment of bacteria to macrophages is mediated by different ligands and receptors and induces various intracellular molecular responses. In the present study, induction of cytokines and chemokines, especially granulocyte-macrophage colony-stimulating factor (GM-CSF) and macrophage inflammatory protein 2 (MIP-2), was examined, following bacterial attachment, with regard to the ligand-receptor systems involved. Attachment of Legionella pneumophila or Salmonella typhimurium to cultured mouse peritoneal macrophages increased the steady-state levels of cellular mRNAs for the cytokines interleukin 1beta (IL-1beta), IL-6, and GM-CSF as well as the chemokines MIP-1beta, MIP-2, and KC. However, when macrophages were treated with alpha-methyl-D-mannoside (alphaMM), a competitor of glycopeptide ligands, induction of cytokine mRNAs was inhibited, but the levels of chemokine mRNAs were not. Pretreatment of the bacteria with fresh mouse serum enhanced the level of GM-CSF mRNA but not the level of MIP-2 mRNA. In addition, serum treatment reduced the inhibitory effect of alphaMM on GM-CSF mRNA. These results indicate that bacterial attachment increases the steady-state levels of the cytokine and chemokine mRNAs tested by at least two distinct receptor-ligand systems, namely, one linked to cytokine induction and involving mannose or other sugar residues and the other linked to chemokine induction and relatively alphaMM insensitive. Furthermore, opsonization with serum engages other pathways in the cytokine response which are relatively independent of the alphaMM-sensitive system. Regarding bacterial surface ligands involved in cytokine mRNA induction, evidence is presented that the flagellum may be important in stimulating cytokine GM-CSF message but not chemokine MIP-2 message. Analysis of cytokine GM-CSF and chemokine MIP-2 signaling pathways with protein kinase inhibitors revealed the involvement of calmodulin and myosin light-chain kinase in GM-CSF but not MIP-2 m

  14. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  15. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  16. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  17. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  18. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  19. Anti-GD2 mAbs and next-generation mAb-based agents for cancer therapy.

    PubMed

    Horta, Zulmarie Perez; Goldberg, Jacob L; Sondel, Paul M

    2016-09-01

    Tumor-specific monoclonal antibodies (mAbs) have demonstrated efficacy in the clinic, becoming an important approach for cancer immunotherapy. Due to its limited expression on normal tissue, the GD2 disialogangloside expressed on neuroblastoma cells is an excellent candidate for mAb therapy. In 2015, dinutuximab (an anti-GD2 mAb) was approved by the US FDA and is currently used in a combination immunotherapeutic regimen for the treatment of children with high-risk neuroblastoma. Here, we review the extensive preclinical and clinical development of anti-GD2 mAbs and the different mechanisms by which they mediate tumor cell killing. In addition, we discuss different mAb-based strategies that capitalize on the targeting ability of anti-GD2 mAbs to potentially deliver, as monotherapy, or in combination with other treatments, improved antitumor efficacy.

  20. Alternative splicing of the guanine nucleotide-binding regulatory protein Go alpha generates four distinct mRNAs.

    PubMed Central

    Murtagh, J J; Moss, J; Vaughan, M

    1994-01-01

    Go alpha a guanine nucleotide-binding (G) protein abundant in brain and other neural tissues, has been implicated in ion channel regulation. Concerted efforts in several laboratories have revealed multiple Go alpha mRNAs and protein isoforms in different contexts. Go alpha is a single copy gene in mammalian species, although the structure, number and tissue localization of Go alpha mRNAs reported by investigators are inconsistent. To define the cell-specific expression of alternatively spliced variants of Go alpha mRNA, we employed several strategies, including Northern hybridizations with sequences-specific oligonucleotides, selective digestions of Go alpha mRNA using RNase H, and adaptations of the polymerase chain reaction. Four distinct alternatively spliced variants were identified, a 5.7-kb Go alpha 2 mRNA and three Go alpha 1 mRNAs with different 3' UTRs. The UTRs of the three Go alpha 1s are composed of different combinations of what have been referred to as UTR-A and UTR-B. The sequences of the spliced segments are well conserved among mammalian species, suggesting a functional role for these alternatively spliced 3' UTRs in post-transcriptional and/or tissue-specific regulation of Go alpha expression. The position of the intron-exon splice boundary at nucleotide 31 following T of the TGA stop codon is conserved in the Gi alpha 2 and Gi alpha 3 genes, consistent with the notion that similar alternative splicing of 3' UTRs occurs in products of these related genes. Images PMID:8139926

  1. PTEN enhances G2/M arrest in etoposide-treated MCF‑7 cells through activation of the ATM pathway.

    PubMed

    Zhang, Ruopeng; Zhu, Li; Zhang, Lirong; Xu, Anli; Li, Zhengwei; Xu, Yijuan; He, Pei; Wu, Maoqing; Wei, Fengxiang; Wang, Chenhong

    2016-05-01

    As an effective tumor suppressor, phosphatase and tensin homolog (PTEN) has attracted the increased attention of scientists. Recent studies have shown that PTEN plays unique roles in the DNA damage response (DDR) and can interact with the Chk1 pathway. However, little is known about how PTEN contributes to DDR through the ATM-Chk2 pathway. It is well-known that etoposide induces G2/M arrest in a variety of cell lines, including MCF-7 cells. The DNA damage-induced G2/M arrest results from the activation of protein kinase ataxia telangiectasia mutated (ATM), followed by the activation of Chk2 that subsequently inactivates CDC25C, resulting in G2/M arrest. In the present study, we assessed the contribution of PTEN to the etoposide-induced G2/M cell cycle arrest. PTEN was knocked down in MCF-7 cells by specific shRNA, and the effects of PTEN on the ATM-Chk2 pathway were investigated through various approaches. The results showed that knockdown of PTEN strongly antagonized ATM activation in response to etoposide treatment, and thereby reduced the phosphorylation level of ATM substrates, including H2AX, P53 and Chk2. Furthermore, depletion of PTEN reduced the etoposide-induced phosphorylation of CDC25C and strikingly compromised etoposide-induced G2/M arrest in the MCF-7 cells. Altogether, we demonstrated that PTEN plays a unique role in etoposide-induced G2/M arrest by facilitating the activation of the ATM pathway, and PTEN was required for the proper activation of checkpoints in response to DNA damage in MCF-7 cells.

  2. Preparation and physical properties of (M1-xYbx) Fe2As2 (M = Ca, Ba) single crystals

    NASA Astrophysics Data System (ADS)

    Chen, S. C.; Syu, K. J.; Lee, W. H.; Chen, Y. Y.

    2014-03-01

    As judged by x-ray diffraction data, single crystals in the series (M1-xYbx) Fe2As2 (M = Ca, Ba) with 0 < x <0.22 have been made by flux method. Magnetic and electrical properties as well as the specific heat data in the systems (M1-xYbx) Fe2As2 (M = Ca, Ba) investigated will be discussed. Supported by the National Science Council of Republic of China under Contract Number NSC-102-2112-M-194-005-MY3.

  3. Suppression of natural killer cell activity by rabbit antibody to human beta 2-microglobulin (beta 2m) is an Fc-mediated phenomenon and is not beta 2m specific.

    PubMed

    Jones, R A; Richards, S J; Patel, D; Scott, C S

    1991-07-01

    Natural killer (NK) cell cytotoxicity constitutes an important component of the host immune defence system. The NK effector cell has been relatively well defined in terms of immunophenotypic characteristics, but in contrast to the functional T-cell receptor molecule associated with major histocompatibility complex (MHC)-restricted cytotoxic activity, the NK cell receptor has not to date been defined. However, several studies have suggested that the beta 2-microglobulin (beta 2m) molecule is functionally associated with NK cell activity. Using various heterospecific and monoclonal antibodies, this study has shown that intact rabbit IgG antibody bound either directly or indirectly to peripheral mononuclear cell (PMNC) effector populations significantly reduced their lytic activity against K562 targets. Substitution of F(ab)2 fragments for rabbit IgG antibodies, or the use of monoclonal antibodies alone, failed to reduce peripheral blood mononuclear cell (PMNC) lytic activity. Addition of non-NK cell components labelled with rabbit anti-beta 2m to purified NK-enriched effector cell populations also suppressed K562 lysis. In contrast, pre-treatment of a NK-enriched PMNC fraction with rabbit anti-beta 2m enhanced target lysis. These results strongly suggest that antibody-induced suppression of PMNC NK activity is mediated via rabbit Fc attached to co-existing non-NK cells in the mononuclear fraction, and are inconsistent with the previously suggested functional association between NK activity and membrane beta 2m.

  4. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  5. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  6. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  7. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  8. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  9. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  10. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  11. Grazing-incidence monochromator for the 15--800 A wavelength range at the storage ring VEPP-2M

    SciTech Connect

    Gluskin, E. S.; Kuzminykh, V. S.; Trakhtenberg, E. M.; Koscheev, S. V.; Devyatov, V. G.; Cherkashin, A. E.; Blau, W.; Meisel, A.; Ehrhardt, H.

    1989-07-01

    A new Rowland monochromator with a fixed output slit, which operates according to the grazing-incidence scheme, is described. The device is notable for the capability to change the Rowland radius within 1--3 m. The monochromator was tested using synchrotron radiation from the storage ring VEPP-2M.

  12. Angiopoietin-2 mRNA expression is increased in chronic lymphocytic leukemia patients with poor prognostic features.

    PubMed

    Vrbacky, F; Smolej, L; Vroblova, V; Pekova, S; Hrudkova, M; Cervinka, M; Pecka, M; Krejsek, J; Maly, J

    2010-08-01

    Several studies have demonstrated the potential prognostic importance of angiogenesis in chronic lymphocytic leukemia (CLL). Elevated expression of angiopoietin-2 (Ang-2), an angiogenic cytokine, was recently reported in CLL. However, data regarding prognostic significance of Ang-2 in CLL are limited. Therefore, we quantitated Ang-2 mRNA in purified mononuclear cells of 33 untreated CLL patients and compared the transcript levels to traditional as well as modern prognostic factors in patients with CLL (clinical stage, disease course, IgVH mutation status, CD38, and ZAP-70 expression). Elevated Ang-2 mRNA concentrations were detected in 12 cases; 21 patients had very low or undetectable levels of Ang-2 transcript. There was significant association between high Ang-2 mRNA levels and unmutated IgVH genes (n=27, P=0.010) and with CD38 expression (n=32, P=0.011), but not with ZAP-70 expression (n=32, P=0.784), Rai stage (n=33, P=0.305) or stable versus progressive clinical course (n=33, P=0.443). There was a trend towards shorter progression-free survival in patients with high Ang-2 expression; however, it did not reach statistical significance (P=0.090). Our pilot data show that Ang-2 mRNA is differentially expressed in patients with CLL and its increased expression appears to be associated with poor prognostic features. Further studies are needed to confirm the results in a larger patient cohort.

  13. Environmental Solutions: A Summary of Contributions for FY05: PNNL Contributions to CH2M HILL Hanford Group, Inc.

    SciTech Connect

    Brouns, Thomas M.; Manke, Kristin L.

    2006-03-01

    This booklet describes Pacific Northwest National Laboratory's scientific and technical contributions in fiscal year 2005 to the CH2M HILL Hanford Group, Inc., the U.S. Department of Energy Office of River Protection's primte contractor for the Hanford Site radioactive waste tanks.

  14. Histone acetyltransferase HAT4 modulates navigation across G2/M and re-entry into G1 in Leishmania donovani

    PubMed Central

    Yadav, Aarti; Chandra, Udita; Saha, Swati

    2016-01-01

    Histone acetyltransferases impact multiple processes. This study investigates the role of histone acetyltransferase HAT4 in Leishmania donovani. Though HAT4 was dispensable for survival, its elimination decreased cell viability and caused cell cycle defects, with HAT4-nulls experiencing an unusually long G2/M. Survival of HAT4-nulls in macrophages was also substantially compromised. DNA microarray analysis revealed that HAT4 modestly regulated the expression of only a select number of genes, thus not being a major modulator of global gene expression. Significantly, cdc20 was among the downregulated genes. To ascertain if decreased expression of cdc20 was responsible for HAT4-null growth and cell cycle defects we expressed LdCdc20 ectopically in HAT4-nulls. We found this to alleviate the aberrant growth and cell cycle progression patterns displayed by HAT4-nulls, with cells navigating G2/M phase and re-entering G1 phase smoothly. HAT4-nulls expressing LdCdc20 ectopically showed survival rates comparable to wild type within macrophages, suggesting that G2/M defects were responsible for poor survival of HAT4-nulls within host cells also. These are the first data analyzing the in vivo functional role of HAT4 in any trypanosomatid. Our results directly demonstrate for the first time a role for Cdc20 in regulating trypanosomatid G2/M events, opening avenues for further research in this area. PMID:27272906

  15. Zinc Induced G2/M Blockage is p53 and p21 Dependent in Normal Human Bronchial Epithelial Cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The involvement of the p53 and p21 signal pathway in the G2/M cell cycle progression of zinc supplemented normal human bronchial epithelial (NHBE) cells was examined using the siRNA approach. Cells were cultured for one passage in different concentrations of zinc: <0.4 microM (ZD) as zinc-deficient;...

  16. Insulin delays the progression of Drosophila cells through G2/M by activating the dTOR/dRaptor complex

    PubMed Central

    Wu, Mary Y W; Cully, Megan; Andersen, Ditte; Leevers, Sally J

    2007-01-01

    In Drosophila and mammals, insulin signalling can increase growth, progression through G1/S, cell size and tissue size. Here, we analyse the way insulin affects cell size and cell-cycle progression in two haemocyte-derived Drosophila cell lines. Surprisingly, we find that although insulin increases cell size, it slows the rate at which these cells increase in number. By using BrdU pulse-chase to label S-phase cells and follow their progression through the cell cycle, we show that insulin delays progression through G2/M, thereby slowing cell division. The ability of insulin to slow progression through G2/M is independent of its ability to stimulate progression through G1/S, so is not a consequence of feedback by the cell-cycle machinery to maintain cell-cycle length. Insulin's effects on progression through G2/M are mediated by dTOR/dRaptor signalling. Partially inhibiting dTOR/dRaptor signalling by dsRNAi or mild rapamycin treatment can increase cell number in cultured haemocytes and the Drosophila wing, respectively. Thus, insulin signalling can influence cell number depending on a balance between its ability to accelerate progression through G1/S and delay progression through G2/M. PMID:17183368

  17. Generation of Pediatric Leukemia Xenograft Models in NSG-B2m Mice: Comparison with NOD/SCID Mice.

    PubMed

    Gopalakrishnapillai, Anilkumar; Kolb, E Anders; Dhanan, Priyanka; Bojja, Aruna Sri; Mason, Robert W; Corao, Diana; Barwe, Sonali P

    2016-01-01

    Generation of orthotopic xenograft mouse models of leukemia is important to understand the mechanisms of leukemogenesis, cancer progression, its cross talk with the bone marrow microenvironment, and for preclinical evaluation of drugs. In these models, following intravenous injection, leukemic cells home to the bone marrow and proliferate there before infiltrating other organs, such as spleen, liver, and the central nervous system. Moreover, such models have been shown to accurately recapitulate the human disease and correlate with patient response to therapy and prognosis. Thus, various immune-deficient mice strains have been used with or without recipient preconditioning to increase engraftment efficiency. Mice homozygous for the severe combined immune deficiency (SCID) mutation and with non-obese diabetic background (NOD/SCID) have been used in the majority of leukemia xenograft studies. Later, NOD/SCID mice deficient for interleukin 2 receptor gamma chain (IL2Rγ) gene called NSG mice became the model of choice for leukemia xenografts. However, engraftment of leukemia cells without irradiation preconditioning still remained a challenge. In this study, we used NSG mice with null alleles for major histocompatibility complex class I beta2-microglobulin (β2m) called NSG-B2m. This is a first report describing the 100% engraftment efficiency of pediatric leukemia cell lines and primary samples in NSG-B2m mice in the absence of host preconditioning by sublethal irradiation. We also show direct comparison of the engraftment efficiency and growth rate of pediatric acute leukemia cells in NSG-B2m and NOD/SCID mice, which showed 80-90% engraftment efficiency. Secondary and tertiary xenografts in NSG-B2m mice generated by injection of cells isolated from the spleens of leukemia-bearing mice also behaved similar to the primary patient sample. We have successfully engrafted 25 acute lymphoblastic leukemia (ALL) and 5 acute myeloid leukemia (AML) patient samples with

  18. Generation of Pediatric Leukemia Xenograft Models in NSG-B2m Mice: Comparison with NOD/SCID Mice.

    PubMed

    Gopalakrishnapillai, Anilkumar; Kolb, E Anders; Dhanan, Priyanka; Bojja, Aruna Sri; Mason, Robert W; Corao, Diana; Barwe, Sonali P

    2016-01-01

    Generation of orthotopic xenograft mouse models of leukemia is important to understand the mechanisms of leukemogenesis, cancer progression, its cross talk with the bone marrow microenvironment, and for preclinical evaluation of drugs. In these models, following intravenous injection, leukemic cells home to the bone marrow and proliferate there before infiltrating other organs, such as spleen, liver, and the central nervous system. Moreover, such models have been shown to accurately recapitulate the human disease and correlate with patient response to therapy and prognosis. Thus, various immune-deficient mice strains have been used with or without recipient preconditioning to increase engraftment efficiency. Mice homozygous for the severe combined immune deficiency (SCID) mutation and with non-obese diabetic background (NOD/SCID) have been used in the majority of leukemia xenograft studies. Later, NOD/SCID mice deficient for interleukin 2 receptor gamma chain (IL2Rγ) gene called NSG mice became the model of choice for leukemia xenografts. However, engraftment of leukemia cells without irradiation preconditioning still remained a challenge. In this study, we used NSG mice with null alleles for major histocompatibility complex class I beta2-microglobulin (β2m) called NSG-B2m. This is a first report describing the 100% engraftment efficiency of pediatric leukemia cell lines and primary samples in NSG-B2m mice in the absence of host preconditioning by sublethal irradiation. We also show direct comparison of the engraftment efficiency and growth rate of pediatric acute leukemia cells in NSG-B2m and NOD/SCID mice, which showed 80-90% engraftment efficiency. Secondary and tertiary xenografts in NSG-B2m mice generated by injection of cells isolated from the spleens of leukemia-bearing mice also behaved similar to the primary patient sample. We have successfully engrafted 25 acute lymphoblastic leukemia (ALL) and 5 acute myeloid leukemia (AML) patient samples with

  19. Generation of Pediatric Leukemia Xenograft Models in NSG-B2m Mice: Comparison with NOD/SCID Mice

    PubMed Central

    Gopalakrishnapillai, Anilkumar; Kolb, E. Anders; Dhanan, Priyanka; Bojja, Aruna Sri; Mason, Robert W.; Corao, Diana; Barwe, Sonali P.

    2016-01-01

    Generation of orthotopic xenograft mouse models of leukemia is important to understand the mechanisms of leukemogenesis, cancer progression, its cross talk with the bone marrow microenvironment, and for preclinical evaluation of drugs. In these models, following intravenous injection, leukemic cells home to the bone marrow and proliferate there before infiltrating other organs, such as spleen, liver, and the central nervous system. Moreover, such models have been shown to accurately recapitulate the human disease and correlate with patient response to therapy and prognosis. Thus, various immune-deficient mice strains have been used with or without recipient preconditioning to increase engraftment efficiency. Mice homozygous for the severe combined immune deficiency (SCID) mutation and with non-obese diabetic background (NOD/SCID) have been used in the majority of leukemia xenograft studies. Later, NOD/SCID mice deficient for interleukin 2 receptor gamma chain (IL2Rγ) gene called NSG mice became the model of choice for leukemia xenografts. However, engraftment of leukemia cells without irradiation preconditioning still remained a challenge. In this study, we used NSG mice with null alleles for major histocompatibility complex class I beta2-microglobulin (β2m) called NSG-B2m. This is a first report describing the 100% engraftment efficiency of pediatric leukemia cell lines and primary samples in NSG-B2m mice in the absence of host preconditioning by sublethal irradiation. We also show direct comparison of the engraftment efficiency and growth rate of pediatric acute leukemia cells in NSG-B2m and NOD/SCID mice, which showed 80–90% engraftment efficiency. Secondary and tertiary xenografts in NSG-B2m mice generated by injection of cells isolated from the spleens of leukemia-bearing mice also behaved similar to the primary patient sample. We have successfully engrafted 25 acute lymphoblastic leukemia (ALL) and 5 acute myeloid leukemia (AML) patient samples with

  20. PPAR{alpha} agonists up-regulate organic cation transporters in rat liver cells

    SciTech Connect

    Luci, Sebastian; Geissler, Stefanie; Koenig, Bettina; Koch, Alexander; Stangl, Gabriele I.; Hirche, Frank; Eder, Klaus . E-mail: klaus.eder@landw.uni-halle.de

    2006-11-24

    It has been shown that clofibrate treatment increases the carnitine concentration in the liver of rats. However, the molecular mechanism is still unknown. In this study, we observed for the first time that treatment of rats with the peroxisome proliferator activated receptor (PPAR)-{alpha} agonist clofibrate increases hepatic mRNA concentrations of organic cation transporters (OCTNs)-1 and -2 which act as transporters of carnitine into the cell. In rat hepatoma (Fao) cells, treatment with WY-14,643 also increased the mRNA concentration of OCTN-2. mRNA concentrations of enzymes involved in carnitine biosynthesis were not altered by treatment with the PPAR{alpha} agonists in livers of rats and in Fao cells. We conclude that PPAR{alpha} agonists increase carnitine concentrations in livers of rats and cells by an increased uptake of carnitine into the cell but not by an increased carnitine biosynthesis.

  1. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  2. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  3. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  4. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  5. Bud-Localization of CLB2 mRNA Can Constitute a Growth Rate Dependent Daughter Sizer.

    PubMed

    Spiesser, Thomas W; Kühn, Clemens; Krantz, Marcus; Klipp, Edda

    2015-04-01

    Maintenance of cellular size is a fundamental systems level process that requires balancing of cell growth with proliferation. This is achieved via the cell division cycle, which is driven by the sequential accumulation and destruction of cyclins. The regulatory network around these cyclins, particularly in G1, has been interpreted as a size control network in budding yeast, and cell size as being decisive for the START transition. However, it is not clear why disruptions in the G1 network may lead to altered size rather than loss of size control, or why the S-G2-M duration also depends on nutrients. With a mathematical population model comprised of individually growing cells, we show that cyclin translation would suffice to explain the observed growth rate dependence of cell volume at START. Moreover, we assess the impact of the observed bud-localisation of the G2 cyclin CLB2 mRNA, and find that localised cyclin translation could provide an efficient mechanism for measuring the biosynthetic capacity in specific compartments: The mother in G1, and the growing bud in G2. Hence, iteration of the same principle can ensure that the mother cell is strong enough to grow a bud, and that the bud is strong enough for independent life. Cell sizes emerge in the model, which predicts that a single CDK-cyclin pair per growth phase suffices for size control in budding yeast, despite the necessity of the cell cycle network around the cyclins to integrate other cues. Size control seems to be exerted twice, where the G2/M control affects bud size through bud-localized translation of CLB2 mRNA, explaining the dependence of the S-G2-M duration on nutrients. Taken together, our findings suggest that cell size is an emergent rather than a regulatory property of the network linking growth and proliferation. PMID:25910075

  6. ERK1/2 signaling plays an important role in topoisomerase II poison-induced G2/M checkpoint activation.

    PubMed

    Kolb, Ryan H; Greer, Patrick M; Cao, Phu T; Cowan, Kenneth H; Yan, Ying

    2012-01-01

    Topo II poisons, which target topoisomerase II (topo II) to generate enzyme mediated DNA damage, have been commonly used for anti-cancer treatment. While clinical evidence demonstrate a capability of topo II poisons in inducing apoptosis in cancer cells, accumulating evidence also show that topo II poison treatment frequently results in cell cycle arrest in cancer cells, which was associated with subsequent resistance to these treatments. Results in this report indicate that treatment of MCF-7 and T47D breast cancer cells with topo II poisons resulted in an increased phosphorylation of extracellular signal-regulated kinase 1 and 2 (ERK1/2) and an subsequent induction of G2/M cell cycle arrest. Furthermore, inhibition of ERK1/2 activation using specific inhibitors markedly attenuated the topo II poison-induced G2/M arrest and diminished the topo II poison-induced activation of ATR and Chk1 kinases. Moreover, decreased expression of ATR by specific shRNA diminished topo II poison-induced G2/M arrest but had no effect on topo II poison-induced ERK1/2 activation. In contrast, inhibition of ERK1/2 signaling had little, if any, effect on topo II poison-induced ATM activation. In addition, ATM inhibition by either incubation of cells with ATM specific inhibitor or transfection of cells with ATM specific siRNA did not block topo II poison-induced G2/M arrest. Ultimately, inhibition of ERK1/2 signaling greatly enhanced topo II poison-induced apoptosis. These results implicate a critical role for ERK1/2 signaling in the activation of G2/M checkpoint response following topo II poison treatment, which protects cells from topo II poison-induced apoptosis.

  7. Evolution of thioester-containing proteins revealed by cloning and characterization of their genes from a cnidarian sea anemone, Haliplanella lineate.

    PubMed

    Fujito, Naoko T; Sugimoto, Sanae; Nonaka, Masaru

    2010-07-01

    To elucidate the evolutionary origin of genes encoding thioester-containing proteins (TEPs), TEP genes were isolated from a cnidarian, a sea anemone, Haliplanella lineate. Phylogenetic tree analysis of the four identified cnidarian TEP genes and various TEP genes of many metazoa, indicated that they could be classified into two subfamilies: the alpha-2-macroglobulin (A2M) subfamily encodining A2M, CD109 and insect TEPs, and the C3 subfamily encoding complement C3, C4 and C5. Two of the four cnidarian TEP genes belonged to the A2M subfamily, showing a close similarity to human A2M and CD109, respectively and thus were termed HaliA2M and HaliCD109. The other two genes belonged to the C3 subfamily, and were termed HaliC3-1 and HaliC3-2. Cnidarian TEPs retained the basic domain structure and functionally important residues for each molecule, and their mRNA were detected at different parts of the sea anemone body. These results suggest that gene duplication and subsequent functional differentiation among C3, A2M and CD109 were very ancient events predating the divergence of the cnidaria and bilateria. PMID:20188753

  8. Increased messenger RNA levels of the antagonist thyroid hormone receptor erbA-alpha 2 and decreased levels of erbA-alpha 1 and erbA-beta 1 receptor messenger RNAs in neoplastic rodent cells.

    PubMed

    Too, C K; Guernsey, D L

    1992-04-15

    Nothern blot analysis of total RNA from the mouse C3H/10T1/2 cell line indicated that the erbA alpha gene transcribed three mRNA species of similar sizes (2.6, 5.5, 6.6 kilobases) as found in rodents. The 2.6-kilobase mRNA (erbA-alpha 2) was approximately 7- to 8-fold more abundant than either the 5.5- (erbA-alpha 1) or 6.6-kilobase species. The expression of the erbA-alpha 2 transcript increased 3- to 30-fold when "normal" mouse or rat cells were growth arrested by concluence. Triiodothyronine, at a concentration of 1 nM, had no effect on the levels of the erbA-alpha mRNA species in confluent cells nor on the levels of erbA-alpha 2 in proliferative normal or transformed C3H/10T1/2 cells. In log-phase growing cells there was a 2.5- to 5-fold increase in the relative expression of erbA-alpha 2 mRNA in transformed mouse C3H/10T1/2 cells, transformed cloned rat embryo fibroblasts (CREF), transformed rat embryo fibroblasts (REF), and a transformed temperature-sensitive rat mutant cell line (ts7E) when compared with their non-transformed counterparts. In contrast to the elevation of erbA-alpha 2 in transformed cells, erbA-alpha 1 and erbA-beta 1 mRNAs decreased in transformed mouse and rat cell lines. In conclusion, it is suggested that the increased levels of the erbA-alpha 2 transcript and the decreased levels of erbA-alpha 1 and erbA-beta 1 in neoplastic cells may account for the loss of thyroid hormone regulation of inducible pathways and decreased nuclear triiodothyronine binding as previously reported.

  9. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  10. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  11. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  12. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  13. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  14. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  15. Enhancement of ovalbumin-induced pulmonary eosinophilia by intranasal administration of alpha1-proteinase inhibitor type 2 antisense oligonucleotides.

    PubMed

    Sung, Ha-Na; Jeon, Chang-Hwan; Gill, Byoung-Chul; Kim, Hye-Rin; Cheong, Sun-Woo; Park, Joo-Hung

    2009-01-29

    To identify asthma-susceptibility genes, we did proteome analyses of the lung from control and ovalbumin-sensitized BALB/c mice. Among the 6 up-regulated proteins is alpha(1)-protease inhibitor (alpha(1)-PI) type 2, which is a member of the serine protease inhibitor superfamily of protease inhibitors that participate in a variety of physiological functions, including extracellular matrix remodeling and inflammation. The up-regulated expression of alpha(1)-PI type 2 was confirmed by real-time PCR. Then we examined mRNA expression of five members of the alpha(1)-PI family genes (alpha(1)-PI types 1-5) in several organs of BALB/c mice and found that in addition to the liver, all the organs tested also expressed different isoforms of alpha(1)-PI in a tissue-specific manner, albeit to a lesser extent compared with the liver. When a similar study was performed with C57BL/6 mice, which have been shown to be more susceptible to ovalbumin-induced asthma than BALB/c mice, a pair of remarkable differences between the mouse strains were revealed: (1) the magnitude of alpha(1)-PI type 2 mRNA in all the organs was much higher in BALB/c than in C57BL/6 mice and (2) alpha(1)-PI type 2 is the only isoform expressed in the lung of BALB/c, but not of C57BL/c mice. Using the antisense oligonucleotide technology to specifically down-regulate expression of alpha(1)-PI type 2, we demonstrated that pulmonary infiltration of eosinophils was significantly increased by intranasal administration of alpha(1)-PI type 2 antisense oligonucleotides in OVA-sensitized mice, suggesting that alpha(1)-PI type 2 may suppress the progress of asthma, probably by acting on neutrophil elastase, which can produce many of the pathological features of asthma.

  16. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  17. Regulation of valine and. alpha. -ketoisocaproate metabolism in rat kidney mitochondria

    SciTech Connect

    Miller, R.H.; Harper, A.E. )

    1988-10-01

    Activities of branched-chain amino acid (BCAA) aminotransferase (BCAT) and {alpha}-keto acid dehydrogenase (BCKD) were assayed in mitochondria isolated from kidneys of rats. Rates of transamination of valine and oxidation of keto acids {alpha}-ketoisocaproate (KIC) or {alpha}-ketoisovalerate (KIV) were estimated using radioactive tracers of the appropriate substrate from amounts of {sup 14}C-labeled products formed. Because of the high mitochondrial BCAT activity, an amino acceptor for BCAT, {alpha}-ketoglutarate ({alpha}-KG) or KIC, was added to the assay medium when valine was the substrate. Rates of valine transamination and subsequent oxidation of the KIV formed were determined with 0.5 mM {alpha}-KG as the amino acceptor; these rates were 5- to 50-fold those without added {alpha}-KG. Rates of CO{sub 2} evolution from valine also increased when KIC was present; however, with KIC concentrations above 0.2 mM, rates of CO{sub 2} evolution from valine declined although rates of transamination continued to rise. When 0.05 mM KIC was added to the assay medium, oxidation of KIC was suppressed by inclusion of valine or glutamate in the medium. When valine was present KIC was not oxidized preferentially, presumably because it was also serving as an amino acceptor for BCAT. These results indicate that as the supply of amino acceptor, {alpha}-KG or KIC, is increased in mitochondria not only is the rate of valine transamination stimulated but also the rate of oxidation of the KIV formed from valine. Thus the rate of oxidation of BCAA can be controlled by factors that influence the rate and direction of BCAA transamination and, thereby, the supply of substrate for BCKD.

  18. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  19. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  20. Preserving Smart Objects Privacy through Anonymous and Accountable Access Control for a M2M-Enabled Internet of Things

    PubMed Central

    Hernández-Ramos, José L.; Bernabe, Jorge Bernal; Moreno, M. Victoria; Skarmeta, Antonio F.

    2015-01-01

    As we get into the Internet of Things era, security and privacy concerns remain as the main obstacles in the development of innovative and valuable services to be exploited by society. Given the Machine-to-Machine (M2M) nature of these emerging scenarios, the application of current privacy-friendly technologies needs to be reconsidered and adapted to be deployed in such global ecosystem. This work proposes different privacy-preserving mechanisms through the application of anonymous credential systems and certificateless public key cryptography. The resulting alternatives are intended to enable an anonymous and accountable access control approach to be deployed on large-scale scenarios, such as Smart Cities. Furthermore, the proposed mechanisms have been deployed on constrained devices, in order to assess their suitability for a secure and privacy-preserving M2M-enabled Internet of Things. PMID:26140349

  1. Preserving Smart Objects Privacy through Anonymous and Accountable Access Control for a M2M-Enabled Internet of Things.

    PubMed

    Hernández-Ramos, José L; Bernabe, Jorge Bernal; Moreno, M Victoria; Skarmeta, Antonio F

    2015-07-01

    As we get into the Internet of Things era, security and privacy concerns remain as the main obstacles in the development of innovative and valuable services to be exploited by society. Given the Machine-to-Machine (M2M) nature of these emerging scenarios, the application of current privacy-friendly technologies needs to be reconsidered and adapted to be deployed in such global ecosystem. This work proposes different privacy-preserving mechanisms through the application of anonymous credential systems and certificateless public key cryptography. The resulting alternatives are intended to enable an anonymous and accountable access control approach to be deployed on large-scale scenarios, such as Smart Cities. Furthermore, the proposed mechanisms have been deployed on constrained devices, in order to assess their suitability for a secure and privacy-preserving M2M-enabled Internet of Things.

  2. Ideals generated by traces in the algebra of symplectic reflections {H_{1,{v_{1,}}{v_2}}}( {{I_2}( {2m} )} )

    NASA Astrophysics Data System (ADS)

    Konstein, S. E.; Tyutin, I. V.

    2016-05-01

    The associative algebra of symplectic reflections H: = {H_{1,{v_{1,}}{v_2}}}( {{I_2}( {2m} )} ) based on the group generated by the root system I 2(2m) depends on two parameters, ν 1 and ν 2. For each value of these parameters, the algebra admits an m-dimensional space of traces. A trace tr is said to be degenerate if the corresponding symmetric bilinear form B tr( x, y) = tr( xy) is degenerate. We find all values of the parameters ν 1 and ν 2 for which the space of traces contains degenerate traces and the algebra H consequently has a two-sided ideal. It turns out that a linear combination of degenerate traces is also a degenerate trace. For the ν 1 and ν 2 values corresponding to degenerate traces, we find the dimensions of the space of degenerate traces.

  3. Identification of an H2-M3-Restricted Listeria Epitope: Implications for Antigen Presentation by M3

    PubMed Central

    Lenz, Laurel L.; Dere, Beverley; Bevan, Michael J.

    2009-01-01

    Summary Using expression cloning, we have identified an H2-M3-restricted epitope of the intracellular bacterial pathogen Listeria monocytogenes. Picomolar concentrations of an amino-terminal N-formylated hexapeptide, fMIGWII, targeted cells for lysis by CD8+ cytotoxic T cells, while the nonformylated peptide was approximately 100-fold less active. The sequence of the 185 aa protein source of this epitope predicts a transmembrane protein that retains its N terminus and assumes an Nout–Cin topology. This membrane orientation offers an explanation for the protection of the epitope from deformylases present in the bacterial cell and suggests an explanation for the ability of phagocytes to present H2-M3-restricted bacterial epitopes via a vacuolar TAP-independent mechanism. PMID:8758895

  4. Preserving Smart Objects Privacy through Anonymous and Accountable Access Control for a M2M-Enabled Internet of Things.

    PubMed

    Hernández-Ramos, José L; Bernabe, Jorge Bernal; Moreno, M Victoria; Skarmeta, Antonio F

    2015-01-01

    As we get into the Internet of Things era, security and privacy concerns remain as the main obstacles in the development of innovative and valuable services to be exploited by society. Given the Machine-to-Machine (M2M) nature of these emerging scenarios, the application of current privacy-friendly technologies needs to be reconsidered and adapted to be deployed in such global ecosystem. This work proposes different privacy-preserving mechanisms through the application of anonymous credential systems and certificateless public key cryptography. The resulting alternatives are intended to enable an anonymous and accountable access control approach to be deployed on large-scale scenarios, such as Smart Cities. Furthermore, the proposed mechanisms have been deployed on constrained devices, in order to assess their suitability for a secure and privacy-preserving M2M-enabled Internet of Things. PMID:26140349

  5. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  6. The impact of heterogeneous surface temperatures on the 2-m air temperature over the Arctic Ocean in spring

    NASA Astrophysics Data System (ADS)

    Tetzlaff, A.; Kaleschke, L.; Lüpkes, C.; Ament, F.; Vihma, T.

    2012-07-01

    The influence of spatial surface temperature changes over the Arctic Ocean on the 2-m air temperature variability is estimated using backward trajectories based on ERA-Interim and the JRA25 wind fields. They are initiated at Alert, Barrow and at the Tara drifting station. Three different methods are used. The first one compares mean ice surface temperatures along the trajectories to the observed 2-m air temperatures at the stations. The second one correlates the observed temperatures to air temperatures obtained using a simple Lagrangian box model which only includes the effect of sensible heat fluxes. For the third method, mean sensible heat fluxes from the model are correlated with the difference of the air temperatures at the model starting point and the observed temperatures at the stations. The calculations are based on MODIS ice surface temperatures and four different sets of ice concentration derived from SSM/I and AMSR-E data. Under nearly cloud free conditions, up to 90% of the 2-m air temperature variance can be explained for Alert, and 60% for Barrow using these methods. The differences are attributed to the different ice conditions, which are characterized by high ice concentration around Alert and lower ice concentration near Barrow. These results are robust for the different sets of reanalyses and ice concentration data. Near-surface winds of both reanalyses show a large inconsistency in the Central Arctic, which leads to a large difference in the correlations between modeled and observed 2-m air temperatures at Tara. Explained variances amount to 70% using JRA and only 45% using ERA. The results also suggest that near-surface temperatures at a given site are influenced by the variability of surface temperatures in a domain of about 150 to 350 km radius around the site.

  7. Security Aspects of Smart Cards vs. Embedded Security in Machine-to-Machine (M2M) Advanced Mobile Network Applications

    NASA Astrophysics Data System (ADS)

    Meyerstein, Mike; Cha, Inhyok; Shah, Yogendra

    The Third Generation Partnership Project (3GPP) standardisation group currently discusses advanced applications of mobile networks such as Machine-to-Machine (M2M) communication. Several security issues arise in these contexts which warrant a fresh look at mobile networks’ security foundations, resting on smart cards. This paper contributes a security/efficiency analysis to this discussion and highlights the role of trusted platform technology to approach these issues.

  8. Monoclonal antibodies to HLA-E bind epitopes carried by unfolded β2 m-free heavy chains.

    PubMed

    Tremante, Elisa; Lo Monaco, Elisa; Ingegnere, Tiziano; Sampaoli, Camilla; Fraioli, Rocco; Giacomini, Patrizio

    2015-08-01

    Since HLA-E heavy chains accumulate free of their light β2 -microglobulin (β2 m) subunit, raising mAbs to folded HLA-E heterodimers has been difficult, and mAb characterization has been controversial. Herein, mAb W6/32 and 5 HLA-E-restricted mAbs (MEM-E/02, MEM-E/07, MEM-E/08, DT9, and 3D12) were tested on denatured, acid-treated, and natively folded (both β2 m-associated and β2 m-free) HLA-E molecules. Four distinct conformations were detected, including unusual, partially folded (and yet β2 m-free) heavy chains reactive with mAb DT9. In contrast with previous studies, epitope mapping and substitution scan on thousands of overlapping peptides printed on microchips revealed that mAbs MEM-E/02, MEM-E/07, and MEM-E/08 bind three distinct α1 and α2 domain epitopes. All three epitopes are linear since they span just 4-6 residues and are "hidden" in folded HLA-E heterodimers. They contain at least one HLA-E-specific residue that cannot be replaced by single substitutions with polymorphic HLA-A, HLA-B, HLA-C, HLA-F, and HLA-G residues. Finally, also the MEM-E/02 and 3D12 epitopes are spatially distinct. In summary, HLA-E-specific residues are dominantly immunogenic, but only when heavy chains are locally unfolded. Consequently, the available mAbs fail to selectively bind conformed HLA-E heterodimers, and HLA-E expression may have been inaccurately assessed in some previous oncology, reproductive immunology, virology, and transplantation studies. PMID:25982269

  9. DTL/CDT2 is essential for both CDT1 regulation and the early G2/M checkpoint.

    PubMed

    Sansam, Christopher L; Shepard, Jennifer L; Lai, Kevin; Ianari, Alessandra; Danielian, Paul S; Amsterdam, Adam; Hopkins, Nancy; Lees, Jacqueline A

    2006-11-15

    Checkpoint genes maintain genomic stability by arresting cells after DNA damage. Many of these genes also control cell cycle events in unperturbed cells. By conducting a screen for checkpoint genes in zebrafish, we found that dtl/cdt2 is an essential component of the early, radiation-induced G2/M checkpoint. We subsequently found that dtl/cdt2 is required for normal cell cycle control, primarily to prevent rereplication. Both the checkpoint and replication roles are conserved in human DTL. Our data indicate that the rereplication reflects a requirement for DTL in regulating CDT1, a protein required for prereplication complex formation. CDT1 is degraded in S phase to prevent rereplication, and following DNA damage to prevent origin firing. We show that DTL associates with the CUL4-DDB1 E3 ubiquitin ligase and is required for CDT1 down-regulation in unperturbed cells and following DNA damage. The cell cycle defects of Dtl-deficient zebrafish are suppressed by reducing Cdt1 levels. In contrast, the early G2/M checkpoint defect appears to be Cdt1-independent. Thus, DTL promotes genomic stability through two distinct mechanisms. First, it is an essential component of the CUL4-DDB1 complex that controls CDT1 levels, thereby preventing rereplication. Second, it is required for the early G2/M checkpoint.

  10. Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup.

    PubMed

    Singh, Sakshi; Singh, Ashish; Rajkumar, Raja; Sampath Kumar, Katakam; Kadarkarai Samy, Subburaj; Nizamuddin, Sheikh; Singh, Amita; Ahmed Sheikh, Shahnawaz; Peddada, Vidya; Khanna, Vinee; Veeraiah, Pandichelvam; Pandit, Aridaman; Chaubey, Gyaneshwer; Singh, Lalji; Thangaraj, Kumarasamy

    2016-01-01

    The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. Two branches of J2-M172, J2a-M410 and J2b-M102 make a considerable part of Y chromosome gene pool of the Indian subcontinent. We investigated the Neolithic contribution of demic dispersal from West to Indian paternal lineages, which majorly consists of haplogroups of Late Pleistocene ancestry. To accomplish this, we have analysed 3023 Y-chromosomes from different ethnic populations, of which 355 belonged to J2-M172. Comparison of our data with worldwide data, including Y-STRs of 1157 individuals and haplogroup frequencies of 6966 individuals, suggested a complex scenario that cannot be explained by a single wave of agricultural expansion from Near East to South Asia. Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent. PMID:26754573

  11. Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup

    PubMed Central

    Singh, Sakshi; Singh, Ashish; Rajkumar, Raja; Sampath Kumar, Katakam; Kadarkarai Samy, Subburaj; Nizamuddin, Sheikh; Singh, Amita; Ahmed Sheikh, Shahnawaz; Peddada, Vidya; Khanna, Vinee; Veeraiah, Pandichelvam; Pandit, Aridaman; Chaubey, Gyaneshwer; Singh, Lalji; Thangaraj, Kumarasamy

    2016-01-01

    The global distribution of J2-M172 sub-haplogroups has been associated with Neolithic demic diffusion. Two branches of J2-M172, J2a-M410 and J2b-M102 make a considerable part of Y chromosome gene pool of the Indian subcontinent. We investigated the Neolithic contribution of demic dispersal from West to Indian paternal lineages, which majorly consists of haplogroups of Late Pleistocene ancestry. To accomplish this, we have analysed 3023 Y-chromosomes from different ethnic populations, of which 355 belonged to J2-M172. Comparison of our data with worldwide data, including Y-STRs of 1157 individuals and haplogroup frequencies of 6966 individuals, suggested a complex scenario that cannot be explained by a single wave of agricultural expansion from Near East to South Asia. Contrary to the widely accepted elite dominance model, we found a substantial presence of J2a-M410 and J2b-M102 haplogroups in both caste and tribal populations of India. Unlike demic spread in Eurasia, our results advocate a unique, complex and ancient arrival of J2a-M410 and J2b-M102 haplogroups into Indian subcontinent. PMID:26754573

  12. H2-M polymorphism in mice susceptible to collagen-induced arthritis involves the peptide binding groove

    SciTech Connect

    Walter, W.; Loos, M.; Maeurer, M.J.

    1996-12-31

    The ability to develop type II collagen (CII)-induced arthritis (CIA) in mice is associated with the major histocompatibility I-A gene and with as yet poorly defined regulatory molecules of the major histocompatibility complex (MHC) class II antigen processing and presentation pathway. H2-M molecules are thought to be involved in the loading of antigenic peptides into the MHC class II binding cleft. We sequenced H2-Ma, H2-Mb1, and H2-Mb2 genes from CIA-susceptible and -resistant mouse strains and identified four different Ma and Mb2 alleles, and three different Mb1 alleles defined by polymorphic residues within the predicted peptide binding groove. Most CIA-resistant mouse strains share common Ma, Mb1, and Mb2 alleles. In contrast, H2-M alleles designated Ma-III, Ma-IV, Mb1-III, and Mb2-IV could be exclusively identified in the CIA-susceptible H2{sup r} and H2{sup q} haplotypes, suggesting that allelic H2-M molecules may modulate the composition of different CII peptides loaded onto MHC class II molecules, presumably presenting {open_quotes}arthritogenic{close_quotes} epitopes to T lymphocytes. 42 refs., 4 figs., 3 tabs.

  13. TinyECCK: Efficient Elliptic Curve Cryptography Implementation over GF(2m) on 8-Bit Micaz Mote

    NASA Astrophysics Data System (ADS)

    Seo, Seog Chung; Han, Dong-Guk; Kim, Hyung Chan; Hong, Seokhie

    In this paper, we revisit a generally accepted opinion: implementing Elliptic Curve Cryptosystem (ECC) over GF(2m) on sensor motes using small word size is not appropriate because XOR multiplication over GF(2m) is not efficiently supported by current low-powered microprocessors. Although there are some implementations over GF(2m) on sensor motes, their performances are not satisfactory enough to be used for wireless sensor networks (WSNs). We have found that a field multiplication over GF(2m) are involved in a number of redundant memory accesses and its inefficiency is originated from this problem. Moreover, the field reduction process also requires many redundant memory accesses. Therefore, we propose some techniques for reducing unnecessary memory accesses. With the proposed strategies, the running time of field multiplication and reduction over GF(2163) can be decreased by 21.1% and 24.7%, respectively. These savings noticeably decrease execution times spent in Elliptic Curve Digital Signature Algorithm (ECDSA) operations (signing and verification) by around 15-19%. We present TinyECCK (Tiny Elliptic Curve Cryptosystem with Koblitz curve-a kind of TinyOS package supporting elliptic curve operations) which is the first implementation of Koblitz curve on sensor motes as far as we know. Through comparisons with existing software implementations of ECC built in C or hybrid of C and inline assembly on sensor motes, we show that TinyECCK outperforms them in terms of running time, code size and supporting services. Furthermore, we show that a field multiplication over GF(2m) can be faster than that over GF(p) on 8-bit Atmegal28 processor by comparing TinyECCK with TinyECC, a well-known ECC implementation over GF(p). TinyECCK with sect163kl can generate a signature and verify it in 1.37 and 2.32 secs on a Micaz mote with 13,748-byte of ROM and 1,004-byte of RAM.

  14. Evolution of the thioester-containing proteins (TEPs) of the arthropoda, revealed by molecular cloning of TEP genes from a spider, Hasarius adansoni.

    PubMed

    Sekiguchi, Reo; Fujito, Naoko T; Nonaka, Masaru

    2012-02-01

    The thioester-containing protein (TEP) family of genes, found in most Eumetazoan genomes, is classified into two subfamilies: the alpha-2-macroglobulin (A2M) subfamily and the C3 subfamily. Many A2M subfamily members, including insect TEP (iTEP), have been reported from the Arthropoda, whereas the C3 subfamily members have been reported only from two horseshoe crab species thus far. To elucidate the evolution of these genes among the Arthropoda, TEP genes were isolated from a spider, Hasarius adansoni (Chelicerata), by reverse transcription polymerase chain reaction (RT-PCR) amplification using universal degenerate primers specific for the thioester region. Four different TEP genes were identified. Phylogenetic analysis using the entire amino acid sequences of these and various other TEP sequences from the Eumetazoa indicated that two of the spider genes are type C3 (HaadC3-1 and HaadC3-2), one is type A2M (HaadA2M) and the other is closely related to iTEP (HaadiTEP). These results suggest that the common ancestor of the Arthropoda possessed at least three TEP genes, C3, A2M and iTEP and that they were lost differentially in the Crustacean and Hexapodan lineages.

  15. Influences of the substituents on the M-M bonding in Cp4Al4 and Cp2M2X2 (M = B, Al, Ga; Cp = C5H5, X = halogen).

    PubMed

    Lu, Feifei; Li, Xiaoyan; Sun, Zheng; Zeng, Yanli; Meng, Lingpeng

    2015-08-21

    Although the geometries of CpAl4 (Cp* = C5Me5) and Cp4Al4 (Cp = C5H5) are similar, CpAl4 is more stable than Cp4Al4. CpAl2I2 is the first complex involving an Al(ii)-Al(ii) bond to be supported by Cp-type ligands. In this work, the stability of CpAl4 and Cp4Al4 (Cp = C5H5), the nature of M-M bonding in Cp2M2X2 (M = B, Al, and Ga), and the influences of the X atom on the M-M bonds have been analyzed and compared within the framework of the atoms in molecules (AIM) theory, electron localization function (ELF), energy decomposition analysis (EDA), and natural bond orbital (NBO) analysis. The calculated results show that CpAl4 is more stable than Cp4Al4 because of HH interactions between the methyl groups on the same and different Cp rings and not because of the Al-Al bonds. In Cp2M2X2, the B-B bond is stronger than the Al-Al and Ga-Ga bonds. The B-B bond is most consistent with covalent bonding, whereas the Al-Al and Ga-Ga bonds are more consistent with metallic bonding. The strengths of the B-B bond increase in the sequence X = F, Cl, Br, and I, whereas the Al-Al and Ga-Ga bonds decrease in the sequence X = F, Cl, Br, and I. The different change tendencies arise from the different M-M bonds and the orbital interactions between atoms X and M.

  16. Extracellular alpha-galactosidase from Debaryomyces hansenii UFV-1 and its use in the hydrolysis of raffinose oligosaccharides.

    PubMed

    Viana, Pollyanna A; de Rezende, Sebastião T; Marques, Virgínia M; Trevizano, Larissa M; Passos, Flávia M L; Oliveira, Maria G A; Bemquerer, Marcelo P; Oliveira, Jamil S; Guimarães, Valéria M

    2006-03-22

    Raffinose oligosaccharides (RO) are the factors primarily responsible for flatulence upon ingestion of soybean-derived products. ROs are hydrolyzed by alpha-galactosidases that cleave alpha-1,6-linkages of alpha-galactoside residues. The objectives of this study were the purification and characterization of extracellular alpha-galactosidase from Debaryomyces hansenii UFV-1. The enzyme purified by gel filtration and anion exchange chromatographies presented an Mr value of 60 kDa and the N-terminal amino acid sequence YENGLNLVPQMGWN. The Km values for hydrolysis of pNP alphaGal, melibiose, stachyose, and raffinose were 0.30, 2.01, 9.66, and 16 mM, respectively. The alpha-galactosidase presented absolute specificity for galactose in the alpha-position, hydrolyzing pNPGal, stachyose, raffinose, melibiose, and polymers. The enzyme was noncompetitively inhibited by galactose (Ki = 2.7 mM) and melibiose (Ki = 1.2 mM). Enzyme treatments of soy milk for 4 h at 60 degrees C reduced the amounts of stachyose and raffinose by 100%.

  17. Alpha-irradiation-induced G2 delay: a period of cell recovery

    SciTech Connect

    Lucke-Huhle, C.

    1982-02-01

    Exponentially growing Chinese hamster V79 cells were delayed in G2 very efficiently by 3.4-MeV ..cap alpha.. particles. In comparison with the effect caused by sparsely ionizing /sup 60/Co ..gamma.. rays, G2 delay after ..cap alpha.. irradiation was greater by a factor of 6.7 and 4.2 for doses <0.5 Gy and >0.5 Gy, respectively, if the slopes of the dose-effect curves are compared. While at low doses (0.03-0.5 Gy) G2 arrest was reversible within 10 hr, increasing doses (0.5-4.38 Gy) of ..cap alpha.. irradiation blocked increasing fractions of cells for more than 16 hr, as determined by flow cytometry, and only some of these were able to complete mitosis. Addition of caffeine, however, reduced G2 arrest considerably if given directly after irradiation and reversed G2 arrest if added 8 hr after 4.38 Gy of ..cap alpha.. particles, a time when most of the cells already had accumulated in G2, caffeine treatment during G2 decreased survival after ..cap alpha.. irradiation by factors of 1.3 and 1.7 for 1 and 2 mM caffeine, respectively.

  18. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  19. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  20. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  1. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  2. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  3. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  4. Early and Delayed Effects of Naturally Occurring Asbestos on Serum Biomarkers of Inflammation and Metabolism

    EPA Science Inventory

    Studies recently showed that intratracheal (IT) instillation of Libby amphibole (LA) increases circulating acute-phase proteins (APP; a-2 macroglobulin, A2M; and a-1 acid glycoprotein, AGP) and inflammatory biomarkers (osteopontin and lipocalin) in rats. In this study, objectives...

  5. Methyl Sartortuoate Inhibits Colon Cancer Cell Growth by Inducing Apoptosis and G2/M-Phase Arrest.

    PubMed

    Lan, Qiusheng; Li, Shoufeng; Lai, Wei; Xu, Heyang; Zhang, Yang; Zeng, Yujie; Lan, Wenjian; Chu, Zhonghua

    2015-08-17

    The potential anti-neoplastic activity of terpenoids is of continued interest. In this study, we investigate whether methyl sartortuoate, a terpenoid isolated from soft coral, induced cell cycle arrest and apoptosis in a human colon cancer cell line. Culture studies found that methyl sartortuoate inhibited colon cancer cell (LoVo and RKO) growth and caused apoptotic death in a concentration- and time-dependent manner, by activation of caspase-8, caspase-9, caspase-3, p53 and Bax, and inactivation of B-cell lymphoma 2 (Bcl-2) apoptosis regulating proteins. Methyl sartortuoate treatment led to reduced expression of cdc2 and up-regulated p21 and p53, suggesting that Methyl sartortuoate induced G2-M arrest through modulation of p53/p21/cdc2 pathways. Methyl sartortuoate also up-regulated phospho-JNK and phospho-p38 expression levels. This resulted in cell cycle arrest at the G2-M phase and apoptosis in LoVo and RKO cells. Treatment with the JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 prevented methyl sartortuoate-induced apoptosis in LoVo cells. Moreover, methyl sartortuoate also prevented neoplasm growth in NOD-SCID nude mice inoculated with LoVo cells. Taken together, these findings suggest that methyl sartortuoate is capable of leading to activation of caspase-8, -9, -3, increasing p53 and Bax/Bcl-2 ratio apoptosis through MAPK-dependent apoptosis and results in G2-M phase arrest in LoVo and RKO cells. Thus, methyl sartortuoate may be a promising anticancer candidate.

  6. Inhibition of lung cancer cell growth by quercetin glucuronides via G2/M arrest and induction of apoptosis.

    PubMed

    Yang, Jen-Hung; Hsia, Te-Chun; Kuo, Hsiu-Maan; Chao, Pei-Dawn Lee; Chou, Chi-Chung; Wei, Yau-Huei; Chung, Jing-Gung

    2006-02-01

    Lung cancer is the leading cause of cancer death in many developed countries, including Taiwan. Quercetin, a widely distributed bioflavonoid, is well known to induce growth inhibition in a variety of human cancer cells. Quercetin glucuronides are the main circulating metabolites after dietary supplements with quercetin in humans. However, there is little information available as to how quercetin glucuronides affect human cancer cells. We investigated the effects of quercetin glucuronides in a human lung cancer cell line NCI-H209. We checked the cell viability, cell cycle checkpoint proteins, pro- and antiapoptotic proteins, caspase-3 activity, and gene expression by flow cytometry and Western blot. The viability of cells decreased in a dose- and time-dependent manner. Cell cycle analysis revealed a significant increase of the proportion of cells in G2/M phase and subG0/G1 phase (corresponding to apoptotic cells). Moreover, quercetin glucuronides increased the expressions of cyclin B, Cdc25c-ser-216-p, and Wee1 proteins, indicating the G2/M arrest. We also demonstrated a concurrent decrease of the mitochondrial membrane potential, release of cytochrome c, up-regulation of Bax, down-regulation of Bcl-2, and activation of caspase-3, and subsequently, cleavage of poly(ADP-ribose) polymerase. In addition, quercetin glucuronide-induced apoptosis was totally blocked by the broad-spectrum caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone. Taken together, we demonstrated that quercetin glucuronides inhibited proliferation through G2/M arrest of the cell cycle and induced apoptosis via caspase-3 cascade in the human lung cancer cell line NCI-H209. Delineation of the biological effects of specific major quercetin metabolites on chemotherapeutic potential or chemoprevention of human cancers warrants further investigation. PMID:16280456

  7. Hydrothermal alteration in the Bosumtwi impact structure: Evidence from 2M1-muscovite, alteration veins, and fracture fillings

    NASA Astrophysics Data System (ADS)

    Petersen, Michael T.; Newsom, Horton E.; Nelson, Melissa J.; Moore, Duane M.

    Drill-core samples from the Bosumtwi impact structure (1.07 Myr old and 10.5 km in diameter) in Ghana exhibit mineralogical evidence for post-impact hydrothermal alteration. Nine samples of drill core obtained through the 2004 International Continental Scientific Drilling Project (ICDP) were studied, including an uppermost fallback layer overlying impactite breccias, and partly deformed massive meta-graywacke bedrock. The petrographic study revealed alteration veins containing secondary sericitic muscovite (comparable to 2M1-muscovite) crosscutting original bedding in meta-graywacke and forming a matrix between clasts in impactite breccias. X-ray diffraction (XRD) shows that these impactite samples are rich in 2M1-muscovite, consistent with post-impact fluid deposition and alteration. Optical analysis indicates the presence of a pre-impact stratiform chlorite in meta-graywacke samples and a secondary alteration chlorite occurring in all samples. Secondary illite was detected in upper impactites of drill core LB-08A and samples containing accretionary lapilli. The lower temperature constraint for the hydrothermal event is given by 2M1-muscovite, secondary chlorite, and illite, all of which form at temperatures greater than 280 °C. An absence of recrystallization of quartz and feldspar indicates an upper temperature constraint below 900 °C. The presence of alteration materials associated with fractures and veins in the uppermost impactites of drill cores LB-07A and LB-08A indicates that a post-impact hydrothermal system was present in and adjacent to the central uplift portion of the Bosumtwi impact structure. A sample containing accretionary lapilli obtained from drill core LB-05A exhibits limited evidence that hydrothermal processes were more widespread within the impactites on the crater floor.

  8. Effect of microwave reflection from the region of electron cyclotron resonance heating in the L-2M stellarator

    SciTech Connect

    Batanov, G. M.; Borzosekov, V. D.; Kolik, L. V.; Konchekov, E. M.; Malakhov, D. V.; Petrov, A. E.; Sarksyan, K. A.; Sakharov, A. S. Skvortsova, N. N.; Stepakhin, V. D.; Kharchev, N. K.

    2013-11-15

    In experiments on electron cyclotron resonance (ECR) heating of plasma at the second harmonic of the electron gyrofrequency in the L-2M stellarator, the effect of partial reflection of high-power gyrotron radiation from the ECR heating region located in the center of the plasma column was revealed. The reflection coefficient is found to be on the order of 10{sup −3}. The coefficient of reflection of an extraordinary wave from the second-harmonic ECR region is calculated in the one-dimensional full-wave model. The calculated and measured values of the reflection coefficient are found to coincide in order of magnitude.

  9. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  10. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  11. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  12. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  13. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  14. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  15. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  16. Inverse regulation of human ERBB2 and epidermal growth factor receptors by tumor necrosis factor alpha.

    PubMed

    Kalthoff, H; Roeder, C; Gieseking, J; Humburg, I; Schmiegel, W

    1993-10-01

    Recombinant human tumor necrosis factor (TNF) alpha decreased the expression of ERBB2 mRNA by stimulating p55 TNF receptors of pancreatic tumor cells. This decrease contrasts with an increase in epidermal growth factor receptor (EGFR) mRNA. Both effects were selectively achieved by TNF-alpha or -beta, whereas interferon alpha or gamma or transforming growth factor beta showed no such effects. The inverse regulatory effects of TNF on ERBB2 and EGFR mRNA levels were evoked by different signaling pathways of p55 TNF receptors. The TNF-mediated ERBB2 mRNA decrease was followed by a reduction in protein. Four of five pancreatic tumor cell lines exhibited this down-regulation. This decrease of ERBB2 is a singular example of a modulation of this growth factor receptor by TNF. Overexpression of ERBB2 has been reported to cause resistance to TNF and other cytotoxic cytokines. In our study we show that the TNF-mediated down-regulation of ERBB2 in pancreatic tumor cells is accompanied by an increase in growth inhibition at low doses of TNF. The simultaneous alteration of the ERBB2/EGFR balance by TNF represents a striking model of cytokine receptor transregulation in the growth control of malignant pancreatic epithelial cells.

  17. Inverse regulation of human ERBB2 and epidermal growth factor receptors by tumor necrosis factor alpha.

    PubMed Central

    Kalthoff, H; Roeder, C; Gieseking, J; Humburg, I; Schmiegel, W

    1993-01-01

    Recombinant human tumor necrosis factor (TNF) alpha decreased the expression of ERBB2 mRNA by stimulating p55 TNF receptors of pancreatic tumor cells. This decrease contrasts with an increase in epidermal growth factor receptor (EGFR) mRNA. Both effects were selectively achieved by TNF-alpha or -beta, whereas interferon alpha or gamma or transforming growth factor beta showed no such effects. The inverse regulatory effects of TNF on ERBB2 and EGFR mRNA levels were evoked by different signaling pathways of p55 TNF receptors. The TNF-mediated ERBB2 mRNA decrease was followed by a reduction in protein. Four of five pancreatic tumor cell lines exhibited this down-regulation. This decrease of ERBB2 is a singular example of a modulation of this growth factor receptor by TNF. Overexpression of ERBB2 has been reported to cause resistance to TNF and other cytotoxic cytokines. In our study we show that the TNF-mediated down-regulation of ERBB2 in pancreatic tumor cells is accompanied by an increase in growth inhibition at low doses of TNF. The simultaneous alteration of the ERBB2/EGFR balance by TNF represents a striking model of cytokine receptor transregulation in the growth control of malignant pancreatic epithelial cells. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8105469

  18. Toxic effect of silica nanoparticles on endothelial cells through DNA damage response via Chk1-dependent G2/M checkpoint.

    PubMed

    Duan, Junchao; Yu, Yongbo; Li, Yang; Yu, Yang; Li, Yanbo; Zhou, Xianqing; Huang, Peili; Sun, Zhiwei

    2013-01-01

    Silica nanoparticles have become promising carriers for drug delivery or gene therapy. Endothelial cells could be directly exposed to silica nanoparticles by intravenous administration. However, the underlying toxic effect mechanisms of silica nanoparticles on endothelial cells are still poorly understood. In order to clarify the cytotoxicity of endothelial cells induced by silica nanoparticles and its mechanisms, cellular morphology, cell viability and lactate dehydrogenase (LDH) release were observed in human umbilical vein endothelial cells (HUVECs) as assessing cytotoxicity, resulted in a dose- and time- dependent manner. Silica nanoparticles-induced reactive oxygen species (ROS) generation caused oxidative damage followed by the production of malondialdehyde (MDA) as well as the inhibition of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px). Both necrosis and apoptosis were increased significantly after 24 h exposure. The mitochondrial membrane potential (MMP) decreased obviously in a dose-dependent manner. The degree of DNA damage including the percentage of tail DNA, tail length and Olive tail moment (OTM) were markedly aggravated. Silica nanoparticles also induced G2/M arrest through the upregulation of Chk1 and the downregulation of Cdc25C, cyclin B1/Cdc2. In summary, our data indicated that the toxic effect mechanisms of silica nanoparticles on endothelial cells was through DNA damage response (DDR) via Chk1-dependent G2/M checkpoint signaling pathway, suggesting that exposure to silica nanoparticles could be a potential hazards for the development of cardiovascular diseases.

  19. Investigating bar structure of disc galaxies via PRIMAL: a particle-by-particle M2M algorithm

    NASA Astrophysics Data System (ADS)

    Hunt, Jason A. S.; Kawata, Daisuke; Martel, Hugo

    2013-07-01

    We have modified our particle-by-particle adaptation of the made-to-measure (M2M) method, with the aim of modelling the Galactic disc from upcoming Galactic stellar survey data. In our new particle-by-particle M2M algorithm, PRIMAL, the observables of the target system are compared with those of the model galaxy at the position of the target stars, i.e. particles. The mass of the model particles are adjusted to reproduce the observables of the target system, and the gravitational potential is automatically adjusted by the changing mass of the particles. This paper builds upon our previous work, introducing likelihood-based velocity constraints in PRIMAL. In this paper, we apply PRIMAL to barred disc galaxies created by an N-body simulation in a known dark matter potential, with no error in the observables. This paper demonstrates that PRIMAL can recover the radial profiles of the surface density, velocity dispersion in the radial and perpendicular directions, and the rotational velocity of the target discs, along with the apparent bar structure and pattern speed of the bar, especially when the reference frame is adjusted so that the bar angle of the target galaxy is aligned to that of the model galaxy at every timestep.

  20. Canthin-6-one displays antiproliferative activity and causes accumulation of cancer cells in the G2/M phase.

    PubMed

    Dejos, Camille; Voisin, Pierre; Bernard, Marianne; Régnacq, Matthieu; Bergès, Thierry

    2014-11-26

    Canthinones are natural substances with a wide range of biological activities, including antipyretic, antiparasitic, and antimicrobial. Antiproliferative and/or cytotoxic effects of canthinones on cancer cells have also been described, although their mechanism of action remains ill defined. To gain better insight into this mechanism, the antiproliferative effect of a commercially available canthin-6-one (1) was examined dose-dependently on six cancer cell lines (human prostate, PC-3; human colon, HT-29; human lymphocyte, Jurkat; human cervix, HeLa; rat glioma, C6; and mouse embryonic fibroblasts, NIH-3T3). Cytotoxic effects of 1 were investigated on the same cancer cell lines by procaspase-3 cleavage and on normal human skin fibroblasts. Strong antiproliferative effects of the compound were observed in all cell lines, whereas cytotoxic effects were very dependent on cell type. A better definition of the mechanism of action of 1 was obtained on PC-3 cells, by showing that it decreases BrdU incorporation into DNA by 60% to 80% and mitotic spindle formation by 70% and that it causes a 2-fold accumulation of cells in the G2/M phase of the cell cycle. Together, the data suggest that the primary effect of canthin-6-one (1) is antiproliferative, possibly by interfering with the G2/M transition. Proapoptotic effects might result from this disturbance of the cell cycle. PMID:25379743

  1. Induction of G2/M arrest by pseudolaric acid B is mediated by activation of the ATM signaling pathway

    PubMed Central

    Meng, Ai-guo; Jiang, Ling-ling

    2009-01-01

    Aim: The aim of this study was to investigate the mechanism of pseudolaric acid B (PLAB)-induced cell cycle arrest in human melanoma SK-28 cells. Methods: Cell growth inhibition was detected by MTT assay, the cell cycle was analyzed by flow cytometry, and protein expression was examined by Western blot analysis. Results: PLAB inhibited the growth of human melanoma cells and induced G2/M arrest in SK-28 cells, accompanied by an up-regulation of Cdc2 phosphorylation and a subsequent down-regulation of Cdc2 expression. Furthermore, PLAB decreased the expression of Cdc25C phosphatase and increased the expression of Wee1 kinase. Meanwhile, a reduction in Cdc2 activity was partly due to induction of the expression of p21waf1/cip1 in a p53-dependent manner. In addition, PLAB activated the checkpoint kinase, Chk2, and increased the expression of p53, two major targets of ATM kinase. These effects were inhibited by caffeine, an ATM kinase inhibitor. We also found that PLAB significantly enhanced ATM kinase activity. Conclusion: Taken together, these results suggest that PLAB induced G2/M arrest in human melanoma cells via a mechanism involving the activation of ATM, and the effect of PLAB on Cdc2 activity was mediated via interactions with the Chk2-Cdc25C and p53 signalling pathways, two distinct downstream pathways of ATM. PLAB may be a promising chemopreventive agent for treating human melanoma. PMID:19305423

  2. The long noncoding RNA ASNR regulates degradation of Bcl-2 mRNA through its interaction with AUF1.

    PubMed

    Chen, Jiahui; Liu, Lihui; Wei, Guifeng; Wu, Wei; Luo, Huaxia; Yuan, Jiao; Luo, Jianjun; Chen, Runsheng

    2016-01-01

    The identification and characterization of long non-coding RNAs (lncRNAs) in diverse biological processes has recently developed rapidly. The large amounts of non-coding RNAs scale consistent with developmental complexity in eukaryotes, indicating that most of these transcripts may have functions in the regulation of biological processes and disorder in the organisms. In particular, Understanding of the overall biological significance of lncRNAs in cancers still remains limited. Here, we found a nuclear-retained lncRNA, termed Lnc_ASNR (apoptosis suppressing-noncoding RNA), which serves as a repressor of apoptosis. Lnc_ASNR was discovered in a set of microarray data derived from four kinds of tumor and adjacent normal tissue samples, and displayed significant up-regulation in the tumor tissues. Using an RNA-pull down assay, we found that Lnc_ASNR interacted with the protein ARE/poly (U)-binding/degradation factor 1(AUF1), which is reported to promote rapid degradation of the Bcl-2 mRNA, an inhibitor of apoptosis. Lnc_ASNR binds to AUFI in nucleus, decreasing the cytoplasmic proportion of AUF1 which targets the B-cell lymphoma-2 (Bcl-2) mRNA. Taken together, the overall effect of Lnc_ASNR expression is thus a decrease in cell apoptosis indicating that Lnc_ASNR may play a vital role in tumorigenesis and carcinogenesis. PMID:27578251

  3. The long noncoding RNA ASNR regulates degradation of Bcl-2 mRNA through its interaction with AUF1

    PubMed Central

    Chen, Jiahui; Liu, Lihui; Wei, Guifeng; Wu, Wei; Luo, Huaxia; Yuan, Jiao; Luo, Jianjun; Chen, Runsheng

    2016-01-01

    The identification and characterization of long non-coding RNAs (lncRNAs) in diverse biological processes has recently developed rapidly. The large amounts of non-coding RNAs scale consistent with developmental complexity in eukaryotes, indicating that most of these transcripts may have functions in the regulation of biological processes and disorder in the organisms. In particular, Understanding of the overall biological significance of lncRNAs in cancers still remains limited. Here, we found a nuclear-retained lncRNA, termed Lnc_ASNR (apoptosis suppressing-noncoding RNA), which serves as a repressor of apoptosis. Lnc_ASNR was discovered in a set of microarray data derived from four kinds of tumor and adjacent normal tissue samples, and displayed significant up-regulation in the tumor tissues. Using an RNA-pull down assay, we found that Lnc_ASNR interacted with the protein ARE/poly (U)-binding/degradation factor 1(AUF1), which is reported to promote rapid degradation of the Bcl-2 mRNA, an inhibitor of apoptosis. Lnc_ASNR binds to AUFI in nucleus, decreasing the cytoplasmic proportion of AUF1 which targets the B-cell lymphoma-2 (Bcl-2) mRNA. Taken together, the overall effect of Lnc_ASNR expression is thus a decrease in cell apoptosis indicating that Lnc_ASNR may play a vital role in tumorigenesis and carcinogenesis. PMID:27578251

  4. Asperlin induces G{sub 2}/M arrest through ROS generation and ATM pathway in human cervical carcinoma cells

    SciTech Connect

    He, Long; Nan, Mei-Hua; Oh, Hyun Cheol; Kim, Young Ho; Jang, Jae Hyuk; Erikson, Raymond Leo; Ahn, Jong Seog; Kim, Bo Yeon

    2011-06-10

    Highlights: {yields} A new anti-cancer effect of an antibiotics, asperlin, is exploited. {yields} Asperlin induced human cervical cancer cell apoptosis through ROS generation. {yields} Asperlin activated DNA-damage related ATM protein and cell cycle associated proteins. {yields} Asperlin could be developed as a new anti-cancer therapeutics. -- Abstract: We exploited the biological activity of an antibiotic agent asperlin isolated from Aspergillus nidulans against human cervical carcinoma cells. We found that asperlin dramatically increased reactive oxygen species (ROS) generation accompanied by a significant reduction in cell proliferation. Cleavage of caspase-3 and PARP and reduction of Bcl-2 could also be detected after asperlin treatment to the cells. An anti-oxidant N-acetyl-L-cysteine (NAC), however, blocked all the apoptotic effects of asperlin. The involvement of oxidative stress in asperlin induced apoptosis could be supported by the findings that ROS- and DNA damage-associated G2/M phase arrest and ATM phosphorylation were increased by asperlin. In addition, expression and phosphorylation of cell cycle proteins as well as G2/M phase arrest in response to asperlin were significantly blocked by NAC or an ATM inhibitor KU-55933 pretreatment. Collectively, our study proved for the first time that asperlin could be developed as a potential anti-cancer therapeutics through ROS generation in HeLa cells.

  5. Investigation of the physical properties of the tetragonal CeMAl4Si2 (M = Rh, Ir, Pt) compounds

    DOE PAGES

    Ghimire, N. J.; Ronning, F.; Williams, D. J.; Scott, B. L.; Luo, Yongkang; Thompson, J. D.; Bauer, E. D.

    2014-12-15

    The synthesis, crystal structure and physical properties studied by means of x-ray diffraction, magnetic, thermal and transport measurements of CeMAl4Si2 (M = Rh, Ir, Pt) are reported, along with the electronic structure calculations for LaMAl4Si2 (M = Rh, Ir, Pt). These materials adopt a tetragonal crystal structure (space group P4/mmm) comprised of BaAl4 blocks, separated by MAl2 units, stacked along the c-axis. Both CeRhAl4Si2 and CeIrAl4Si2 order antiferromagnetically below TN1 = 14 and 16 K, respectively, and undergo a second antiferromagnetic transitition at lower temperature (TN2 = 9 and 14 K, respectively). CePtAl4Si2 orders ferromagnetically below TC = 3 Kmore » with an ordered moment of μsat = 0.8 μB for a magnetic field applied perpendicular to the c-axis. Electronic structure calculations reveal quasi-2D character of the Fermi surface.« less

  6. An insect TEP in a crustacean is specific for cuticular tissues and involved in intestinal defense.

    PubMed

    Wu, Chenglin; Noonin, Chadanat; Jiravanichpaisal, Pikul; Söderhäll, Irene; Söderhäll, Kenneth

    2012-02-01

    In an attempt to identify genes encoding thioester-containing proteins in the freshwater crayfish, Pacifastacus leniusculus, three different cDNAs were found. A phylogenetic analysis of these proteins indicates that they can be classified into two subfamilies: two alpha-2-macroglobulins (Pl-A2M1, Pl-A2M2) showing a close similarity to shrimp A2M, and one insect TEP-like protein (Pl-TEP). This is the first report of an insect TEP-like protein in a crustacean. Crayfish Pl-A2M1, Pl-A2M2 and Pl-TEP cDNAs encode proteins with 1480, 1586 or 1507 amino acids, respectively. Pl-A2M1, Pl-A2M2 and Pl-TEP have the basic domain structure and functionally important residues for each molecule, and their mRNA was detected in different parts of the body, suggesting that they may have different functions. Pl-A2M1 was mainly expressed in hemocytes and Pl-A2M2 was highly expressed in heart and nerve, while Pl-TEP was exclusively expressed in cuticular tissues such as gill and intestine. RNA interference of Pl-TEP in vivo resulted in that these animals were slightly less resistant when fed with the bacterium, Pseudomonas libanensis/gessardii. Furthermore, when TEP activity was blocked using methylamine followed by bacterial feeding, the animals were killed to a higher extent compared to a control group. Taken together, this indicates that Pl-TEP and/or Pl-A2M1, Pl-A2M2 may be important for the immune defense in crayfish intestine and function as a pattern recognition protein in crayfish cuticular tissues.

  7. An insect TEP in a crustacean is specific for cuticular tissues and involved in intestinal defense.

    PubMed

    Wu, Chenglin; Noonin, Chadanat; Jiravanichpaisal, Pikul; Söderhäll, Irene; Söderhäll, Kenneth

    2012-02-01

    In an attempt to identify genes encoding thioester-containing proteins in the freshwater crayfish, Pacifastacus leniusculus, three different cDNAs were found. A phylogenetic analysis of these proteins indicates that they can be classified into two subfamilies: two alpha-2-macroglobulins (Pl-A2M1, Pl-A2M2) showing a close similarity to shrimp A2M, and one insect TEP-like protein (Pl-TEP). This is the first report of an insect TEP-like protein in a crustacean. Crayfish Pl-A2M1, Pl-A2M2 and Pl-TEP cDNAs encode proteins with 1480, 1586 or 1507 amino acids, respectively. Pl-A2M1, Pl-A2M2 and Pl-TEP have the basic domain structure and functionally important residues for each molecule, and their mRNA was detected in different parts of the body, suggesting that they may have different functions. Pl-A2M1 was mainly expressed in hemocytes and Pl-A2M2 was highly expressed in heart and nerve, while Pl-TEP was exclusively expressed in cuticular tissues such as gill and intestine. RNA interference of Pl-TEP in vivo resulted in that these animals were slightly less resistant when fed with the bacterium, Pseudomonas libanensis/gessardii. Furthermore, when TEP activity was blocked using methylamine followed by bacterial feeding, the animals were killed to a higher extent compared to a control group. Taken together, this indicates that Pl-TEP and/or Pl-A2M1, Pl-A2M2 may be important for the immune defense in crayfish intestine and function as a pattern recognition protein in crayfish cuticular tissues. PMID:22193393

  8. EURONEAR—Recovery, follow-up and discovery of NEAs and MBAs using large field 1-2 m telescopes

    NASA Astrophysics Data System (ADS)

    Vaduvescu, O.; Birlan, M.; Tudorica, A.; Sonka, A.; Pozo, F. N.; Barr, A. D.; Asher, D. J.; Licandro, J.; Ortiz, J. L.; Unda-Sanzana, E.; Popescu, M.; Nedelcu, A.; Dumitru, D.; Toma, R.; Comsa, I.; Vancea, C.; Vidican, D.; Opriseanu, C.; Badescu, T.; Badea, M.; Constantinescu, M.

    2011-10-01

    We report on the follow-up and recovery of 100 program NEAs, PHAs and VIs using the ESO/MPG 2.2 m, Swope 1 m and INT 2.5 m telescopes equipped with large field cameras. The 127 fields observed during 11 nights covered 29 square degrees. Using these data, we present the incidental survey work which includes 558 known MBAs and 628 unknown moving objects mostly consistent with MBAs from which 58 objects became official discoveries. We planned the runs using six criteria and four servers which focus mostly on faint and poorly observed objects in need of confirmation, follow-up and recovery. We followed 62 faint NEAs within one month after discovery and we recovered 10 faint NEAs having big uncertainties at their second or later opposition. Using the INT we eliminated four PHA candidates and VIs. We observed in total 1286 moving objects and we reported more than 10,000 positions. All data were reduced by the members of our network in a team effort, and reported promptly to the MPC. The positions of the program NEAs were published in 27 MPC and MPEC references and used to improve their orbits. The O-C residuals for known MBAs and program NEAs are smallest for the ESO/MPG and Swope and about four times larger for the INT whose field is more distorted. For the astrometric reduction, the UCAC-2 catalog is recommended instead of USNO-B1. The incidental survey allowed us to study statistics of the MBA and NEA populations observable today with 1-2 m facilities. We calculate preliminary orbits for all unknown objects, classifying them as official discoveries, later identifications and unknown outstanding objects. The orbital elements a, e, i calculated by FIND_ORB software for the official discoveries and later identified objects are very similar with the published elements which take into account longer observational arcs; thus preliminary orbits were used in statistics for the whole unknown dataset. We present a basic model which can be used to distinguish between MBAs and

  9. Mouse model to study human A beta2M amyloidosis: generation of a transgenic mouse with excessive expression of human beta2-microglobulin.

    PubMed

    Zhang, Pengyao; Fu, Xiaoying; Sawashita, Jinko; Yao, Junjie; Zhang, Beiru; Qian, Jinze; Tomozawa, Hiroshi; Mori, Masayuki; Ando, Yukio; Naiki, Hironobu; Higuchi, Keiichi

    2010-06-01

    Patients on long-term hemodialysis can develop dialysis-related amyloidosis (DRA) due to deposition of beta(2)-microglobulin (beta(2)m) into amyloid fibrils (Abeta(2)M). Despite intensive biochemical studies, the pathogenesis of amyloid deposition in DRA patients remains poorly understood. To elucidate the mechanisms that underlie Abeta(2)M fibril formation in DRA, we generated transgenic mice that overexpress human beta(2)m protein in a mouse beta(2)m gene knockout background (hB2MTg(+/+) mB2m(+/+)). The hB2MTg(+/+)mB2m(-/-) mice express a high level of human beta(2)m protein in many tissues as well as a high plasma beta(2)m concentration (192.8 mg/L). This concentration is >100 times higher than that observed in healthy humans and >4 times higher than that detected in patients on dialysis. We examined spontaneous and amyloid fibril-induced amyloid deposition in these mice. Amyloid deposition of beta(2)m protein was not observed in aged or amyloid fibril injected animals. However, mouse senile apolipoprotein A-II amyloidosis (AApoAII) was detected, particularly in the joints of mice that were injected with AApoAII amyloid fibrils. This study demonstrates that this mouse model could be valuable in studying the components and conditions that promote DRA, and indicates that high plasma concentrations of hbeta(2)m as well as seeding with pre-existing amyloid fibrils may not be sufficient to induce Abeta(2)M.

  10. Resolution and in vitro and initial in vivo evaluation of isomers of iodine-125-labeled 1-azabicyclo[2.2.2]oct-3-yl alpha-hydroxy-alpha-(1-iodo-1-propen-3-yl)-alpha-phenylacetate: a high-affinity ligand for the muscarinic receptor.

    PubMed

    McPherson, D W; Lambert, C R; Jahn, K; Sood, V; McRee, R C; Zeeberg, B; Reba, R C; Knapp, F F

    1995-09-29

    1-Azabicyclo[2.2.2]oct-3-yl alpha-hydroxy-alpha-(1-iodo-1-propen-3-yl)- alpha-phenylacetate (IQNP, 1), is a highly selective ligand for the muscarinic acetylcholinergic receptor (mAChR). There are eight stereoisomers in the racemic mixture. The optical isomers of alpha-hydroxy-alpha-phenyl-alpha-(1-propyn-3-yl)acetic acid were resolved as the alpha-methylbenzylamine salts, and the optical isomers of 3-quinuclidinol were resolved as the tartrate salts. The E and Z isomers were prepared by varying the reaction conditions for the stannylation of the triple bond followed by purification utilizing flash column chromatography. In vitro binding assay of the four stereoisomers containing the (R)-(-)-3-quinuclidinyl ester demonstrated that each isomer of 1 bound to mAChR with high affinity. In addition, (E)-(-)-(-)-IQNP demonstrated the highest receptor subtype specificity between the m1 molecular subtype (KD, nM, 0.383 +/- 0.102) and the m2 molecular subtype (29.6 +/- 9.70). In vivo biodistribution studies demonstrated that iodine-125-labeled (E)-(-)-(+)-1 cleared rapidly from the brain and heart. In contrast, iodine-125-labeled (E)-(-)-(-)-, (Z)-(-)-(-)-, and (Z)-(-)-(+)-1 have high uptake and retention in mAChR rich areas of the brain. It was also observed that (E)-(-)-(-)-IQNP demonstrated an apparent subtype selectivity in vivo with retention in M1 (m1, m4) mAChR areas of the rain. In addition, (Z)-(-)-(-)-IQNP also demonstrated significant uptake in tissues containing the M2 (m2) mAChR subtype. These results demonstrate that the iodine-123-labeled analogues of the (E)-(-)-(-)- and (Z)-(-)-(-)-IQNP isomers are attractive candidates for single-photon emission-computed tomographic imaging of cerebral and cardiac mAChR receptor densities.

  11. The Gcn2 Regulator Yih1 Interacts with the Cyclin Dependent Kinase Cdc28 and Promotes Cell Cycle Progression through G2/M in Budding Yeast

    PubMed Central

    Silva, Richard C.; Dautel, Martina; Di Genova, Bruno M.; Amberg, David C.; Castilho, Beatriz A.; Sattlegger, Evelyn

    2015-01-01

    The Saccharomyces cerevisiae protein Yih1, when overexpressed, inhibits the eIF2 alpha kinase Gcn2 by competing for Gcn1 binding. However, deletion of YIH1 has no detectable effect on Gcn2 activity, suggesting that Yih1 is not a general inhibitor of Gcn2, and has no phenotypic defect identified so far. Thus, its physiological role is largely unknown. Here, we show that Yih1 is involved in the cell cycle. Yeast lacking Yih1 displays morphological patterns and DNA content indicative of a delay in the G2/M phases of the cell cycle, and this phenotype is independent of Gcn1 and Gcn2. Accordingly, the levels of phosphorylated eIF2α, which show a cell cycle-dependent fluctuation, are not altered in cells devoid of Yih1. We present several lines of evidence indicating that Yih1 is in a complex with Cdc28. Yih1 pulls down endogenous Cdc28 in vivo and this interaction is enhanced when Cdc28 is active, suggesting that Yih1 modulates the function of Cdc28 in specific stages of the cell cycle. We also demonstrate, by Bimolecular Fluorescence Complementation, that endogenous Yih1 and Cdc28 interact with each other, confirming Yih1 as a bona fide Cdc28 binding partner. Amino acid substitutions within helix H2 of the RWD domain of Yih1 enhance Yih1-Cdc28 association. Overexpression of this mutant, but not of wild type Yih1, leads to a phenotype similar to that of YIH1 deletion, supporting the view that Yih1 is involved through Cdc28 in the regulation of the cell cycle. We further show that IMPACT, the mammalian homologue of Yih1, interacts with CDK1, the mammalian counterpart of Cdc28, indicating that the involvement with the cell cycle is conserved. Together, these data provide insights into the cellular function of Yih1/IMPACT, and provide the basis for future studies on the role of this protein in the cell cycle. PMID:26176233

  12. Peptide-conformed beta2m-free class I heavy chains are intermediates in generation of soluble HLA by the membrane-bound metalloproteinase.

    PubMed

    Demaria, S; DeVito-Haynes, L D; Salter, R D; Burlingham, W J; Bushkin, Y

    1999-12-01

    Molecular mechanisms of soluble HLA-release by a membrane-bound metalloproteinase (MPase) are not defined. We have investigated the possibility that certain beta2-microglobulin (beta2m)-free heavy chains (HC) retain peptide-induced conformations before and after the cleavage by using mutant HLA-A2.242K HC with reduced affinity for beta2m. We show that dissociation of HC/beta2m complexes on the surface of C1R lymphoblastoid cells generates both conformed and non-conformed beta2m-free HC recognized by conformation-dependent antibodies. Conformed HC, having bound the HLA-A2-specific peptide HTLV-1 tax 11-19, can retain their proper conformations after dissociation of beta2m. Further, conformed and non-conformed surface beta2m-free HC are cleaved by the MPase, and some released HC preserve their conformations. Exogenous beta2m binds only to conformed HC, and protects them from cleavage as effectively as the MPase inhibitor BB-2116. We propose that soluble HLA-release requires generation of peptide-conformed beta2m-free HC intermediates on the cell surface, which are then cleaved by the MPase and in solution may reassociate with beta2m. Given the role of soluble HLA in the indirect allorecognition, the activity of this MPase may be important in transplant rejection. PMID:10626735

  13. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  14. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  15. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  16. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  17. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  18. Ligands internalized through coated or noncoated invaginations follow a common intracellular pathway

    SciTech Connect

    Tran, D.; Carpentier, J.L.; Sawano, F.; Gorden, P.; Orci, L.

    1987-11-01

    Cholera toxic (CT) represents a class of ligands that binds preferentially to noncoated pits on the cell surface. In the present study, the authors have investigated the mechanism of endocytosis of this class of ligand and compared it to the classic coated pit mechanism. When either CT coupled to colloidal gold particles (CT-gold) or /sup 125/I-labeled CT were incubated with 3T3 L1 fibroblasts at 4/sup 0/C, both ligands bound in a preferential fashion to small noncoated pits on the cell surface. CT-gold surface-labeled cells were then incubated at 22/sup 0/C. The labeled ligand progressively moved into noncoated vesicles and a tubulovesicular compartment composed of a network of tubules and vesicles closely associated with multivesicular bodies but distinct from the Golgi complexes. The ligand next passed into multivesicular bodies. By contrast, ..cap alpha../sub 2/-macroglobulin (..cap alpha../sub 2/m)-gold initially localized preferentially to coated pits and subsequently to coated vesicles and tubulovesicular structures before associating with multivesicular bodies. To directly compare the intracellular pathway followed by CT-gold to that followed by ..cap alpha../sub 2/m, CT-gold was coincubated with ..cap alpha../sub 2/m-gold. By 10 min of incubation at 22/sup 0/C, up to 66% of tubulovesicular units contained both ligands when analyzed in serial sections. Subsequently, both ligands were colocalized in multivesicular bodies. They conclude that CT-gold endocytosed via noncoated vesicles and ..cap alpha../sub 2/m-gold endocytosed through coated vesicles subsequently associate with the same tubulovesicular units, multivesicular bodies, and lysosomes.

  19. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  20. Selective induction of G2/M arrest and apoptosis in HL-60 by a potent anticancer agent, HMJ-38.

    PubMed

    Yang, Jai-Sing; Hour, Mann-Jen; Kuo, Sheng-Chu; Huang, Li-Jiau; Lee, Miau-Rong

    2004-01-01

    We previously reported that HMJ-38 was the most potent 2-phenyl-4-quinozolinone derivative in inhibiting tubulin polymerization and showed significant cytotoxicity against several human tumor cell lines. In this work, we studied its cytotoxic effect on HL-60 leukemia cells and the underlying mechanisms. We first investigated the effects of HMJ-38 on viability, cell cycle and induction of apoptosis in HL-60 and normal human peripheral blood mononuclear cells (PBMC). After 24-hour treatment with HMJ-38, a dose- and time-dependent decrease in the viability of HL-60 cells was observed and the approximate IC50 was 4.48 microM. The cytotoxic effect of HMJ-38 on PBMC was less significant than that on HL-60 cells, either with 24 or 48 hours of treatment. Cell cycle analysis showed that HMJ-38 induced significant G2/M arrest and apoptosis in HL-60 cells. The HMJ-38-induced G2/M arrest occurred before the onset of apoptosis. Within 24 hours of treatment, HMJ-38 influenced the CDK/cyclin B activity by increasing Chk1, Wee1 and p21 and decreasing Cdc25C protein levels. The HMJ-38-induced apoptosis was further confirmed by morphological assessment and DNA fragmentation assay. Induction of apoptosis in HMJ-38-treated HL-60 cells was accompanied by an apparent increase of cytosolic cytochrome c, down-regulation of Bcl-2, up-regulation of Bax and cleavage of pro-caspase-9, -3 and poly(ADP)ribosylpolymerase (PARP). The results of the significant reduction of caspase activities and apoptosis by caspase inhibitors indicated that the HMJ-38-induced apoptosis was mainly mediated by activation of caspases-9 and -3. HMJ-38 also activated ERK in HL-60 cells. Pre-incubating cells with ERK inhibitors (U0126 and PD98059) attenuated the HMJ-38-induced ERK activation and apoptosis. Nevertheless, cells remained arrested in G2/M. These results suggest that HMJ-38 is a potent anticancer drug and it shows a remarkable action on cell cycle before commitment for apoptosis is reached. PMID:15274354

  1. Semi-quantitative Measurement of a Specific Glycoform Using a DNA-tagged Antibody and Lectin Affinity Chromatography for Glyco-biomarker Development*

    PubMed Central

    Lee, Ju Hee; Cho, Chang Hee; Kim, Sun Hee; Kang, Jeong Gu; Yoo, Jong Shin; Chang, Chulhun Ludgerus; Ko, Jeong-Heon; Kim, Yong-Sam

    2015-01-01

    Aberrant glycosylation-targeted disease biomarker development is based on cumulative evidence that certain glycoforms are mass-produced in a disease-specific manner. However, the development process has been hampered by the absence of an efficient validation method based on a sensitive and multiplexed platform. In particular, ELISA-based analytical tools are not adequate for this purpose, mainly because of the presence of a pair of N-glycans of IgG-type antibodies. To overcome the associated hurdles in this study, antibodies were tagged with oligonucleotides with T7 promoter and then allowed to form a complex with corresponding antigens. An antibody-bound specific glycoform was isolated by lectin chromatography and quantitatively measured on a DNA microarray chip following production of fluorescent RNA by T7-trascription. This tool ensured measurement of targeted glycoforms of multiple biomarkers with high sensitivity and multiplexity. This analytical method was applied to an in vitro diagnostic multivariate index assay where a panel of hepatocellular carcinoma (HCC) biomarkers comprising alpha-fetoprotein, hemopexin, and alpha-2-macroglobulin (A2M) was examined in terms of the serum level and their fuco-fractions. The results indicated that the tests using the multiplexed fuco-biomarkers provided improved discriminatory power between non- hepatocellular carcinoma and hepatocellular carcinoma subjects compared with the alpha-fetoprotein level or fuco-alpha-fetoprotein test alone. The developed method is expected to facilitate the validation of disease-specific glycan biomarker candidates. PMID:25525205

  2. Semi-quantitative measurement of a specific glycoform using a DNA-tagged antibody and lectin affinity chromatography for glyco-biomarker development.

    PubMed

    Lee, Ju Hee; Cho, Chang Hee; Kim, Sun Hee; Kang, Jeong Gu; Yoo, Jong Shin; Chang, Chulhun Ludgerus; Ko, Jeong-Heon; Kim, Yong-Sam

    2015-03-01

    Aberrant glycosylation-targeted disease biomarker development is based on cumulative evidence that certain glycoforms are mass-produced in a disease-specific manner. However, the development process has been hampered by the absence of an efficient validation method based on a sensitive and multiplexed platform. In particular, ELISA-based analytical tools are not adequate for this purpose, mainly because of the presence of a pair of N-glycans of IgG-type antibodies. To overcome the associated hurdles in this study, antibodies were tagged with oligonucleotides with T7 promoter and then allowed to form a complex with corresponding antigens. An antibody-bound specific glycoform was isolated by lectin chromatography and quantitatively measured on a DNA microarray chip following production of fluorescent RNA by T7-trascription. This tool ensured measurement of targeted glycoforms of multiple biomarkers with high sensitivity and multiplexity. This analytical method was applied to an in vitro diagnostic multivariate index assay where a panel of hepatocellular carcinoma (HCC) biomarkers comprising alpha-fetoprotein, hemopexin, and alpha-2-macroglobulin (A2M) was examined in terms of the serum level and their fuco-fractions. The results indicated that the tests using the multiplexed fuco-biomarkers provided improved discriminatory power between non- hepatocellular carcinoma and hepatocellular carcinoma subjects compared with the alpha-fetoprotein level or fuco-alpha-fetoprotein test alone. The developed method is expected to facilitate the validation of disease-specific glycan biomarker candidates. PMID:25525205

  3. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  4. A Family Portrait of the Alpha Centauri System

    NASA Astrophysics Data System (ADS)

    2003-03-01

    Sun. Their masses nicely bracket that of their neighbour star, and they are only slightly older than the Sun. In addition to providing general information about stellar evolution, the detailed study of Alpha Centauri A and B is particular interesting as it allows verification of our current knowledge about the composition, structure and indeed, future development, of our own main energy source, the Sun. The VLTI observations ESO PR Photo 07c/03 ESO PR Photo 07c/03 [Preview - JPEG: 467 x 400 pix - 136k] [Normal - JPEG: 993 x 800 pix - 384k] ESO PR Photo 07d/03 ESO PR Photo 07d/03 [Preview - JPEG: 513 x 400 pix - 79k] [Normal - JPEG: 1026 x 800 pix - 208k] Caption: PR Photo 07c/03 shows the layout of the Very Large Telescope Interferometer (VLTI) on the observing platform at the summit of Cerro Paranal, with the locations of the main components (8.2-m Unit Telescopes; Auxiliary Telescope (AT) rail tracks and observing stations; Delay Line tunnel; Beam Combination (Interferometric) Laboratory) indicated. The E0-G0 and E0-G1 configurations (baselines) used for observations of Alpha Centauri A and Alpha Centauri B are shown. PR Photo 07d/03 displays the so-called "visibility curves" of these two stars (with a "calibration" star, Theta Centauri) from which the angular diameters, i.e. the angle subtended by their disks, can be deduced. The data from observations at different baselines, with the corresponding uncertainties, are indicated by red points. An international group of astronomers [3] has now used observations of Alpha Centauri A and Alpha Centauri B obtained with the ESO VLTI/Paranal team by the ESO Very Large Telescope Interferometer (VLTI) to measure the sizes of these two stars. Despite their proximity and brightness, these two southern stars have never before been resolved by long-baseline stellar interferometry, and the VINCI/VLTI observations are the first direct measurement of their angular diameters. For the observations of the A and B pair, the 0.35-m VLTI

  5. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  6. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  7. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  8. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  9. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  10. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  11. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  12. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  13. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  14. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  15. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  16. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  17. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  18. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  19. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  20. A Study on Marker Overlapping Control for M2M-Based Augmented Reality Multiple Object Loading Using Bresenham Algorithm

    NASA Astrophysics Data System (ADS)

    Jung, Sungmo; Song, Jae-Gu; Kim, Seoksoo

    The problem of one marker one object loading only available in marker-based augmented reality technology can be solved by PPHT-based augmented reality multiple objects loading technology which detects the same marker in the image and copies at a desirable location. However, since the distance between markers will not be measured in the process of detecting and copying markers, markers can be overlapped and thus the objects would not be augmented. To solve this problem, a circle having the longest radius needs to be created from a focal point of a marker to be copied, so that no object is copied within the confines of the circle. Therefore, a marker overlapping control for M2M-based augmented reality multiple object loading has been studied using Bresenham algorithm.

  1. Structural and mechanical properties of transition metal borides Nb2MB2 (M=Tc, Ru, and Os) under pressure

    NASA Astrophysics Data System (ADS)

    Li, Xiaofeng; Yan, Haiyan; Wei, Qun

    2016-10-01

    First-principle total energy calculations are employed to provide a fundamental understanding of the structural, mechanical, and electronic properties of transition metal borides Nb2MB2 (M=Tc, Ru, and Os) within the tetragonal superstructure P4/mnc structure. The mechanically and dynamically stabilities of three borides have been demonstrated by the elastic constants and phonons calculations under pressure. Among these three compounds, Nb2TcB2 exhibits the biggest bulk and Young's modulus, smallest Poission's ratio, and highest harness. Density of states of them revealed that the strong B-B, Nb-B and M-B covalent bonds are major driving forces for their high bulk and shear moduli as well as small Poisson's ratio.

  2. Synthesis and characterisation of new MO(OH)2 (M = Zr, Hf) oxyhydroxides and related Li2MO3 salts.

    PubMed

    Baklanova, Yana V; Denisova, Tatyana A; Maksimova, Lidiya G; Tyutyunnik, Alexander P; Baklanova, Inna V; Shein, Igor R; Neder, Reinhard B; Tarakina, Nadezda V

    2014-02-21

    Two new solid MO(OH)2 (M = Zr, Hf) oxyhydroxides have been synthesised by an ion-exchange reaction from Li2MO3 (M = Zr, Hf) precursors obtained by a citrate combustion technique. The crystal structure of the oxyhydroxides has been solved by direct methods and refined using Rietveld full profile fitting based on X-ray powder diffraction data. Both oxyhydroxides crystallize in a P2(1)/c monoclinic unit cell and have a structure resembling that of the related salts. Detailed characterisation of the fine-structure features and chemical bonding in precursors and oxyhydroxide powders has been performed using vibrational spectroscopy, nuclear magnetic resonance spectroscopy, scanning electron microscopy, pair distribution function analysis and quantum-chemical modelling. PMID:24343584

  3. VizieR Online Data Catalog: HST/WFC3 NIR photometry of 2M1207b (Zhou+, 2016)

    NASA Astrophysics Data System (ADS)

    Zhou, Y.; Apai, D.; Schneider, G. H.; Marley, M. S.; Showman, A. P.

    2016-05-01

    We obtained direct images of the 2M1207A+b system on UT 2014 April 11 from 08:07:47 (JD 2456758.838738) to 16:53:18 (JD 2456759.203681) using HST and its Wide Field Camera 3 (WFC3, pixel_scale=0.130mas/pixel) in the frame of the HST Program GO-13418 (PI: D. Apai). We acquired the observations in filters F125W (λpivot=1245.9nm, FWHM=301.5nm) and F160W (λpivot=1540.52, FWHM=287.9nm), roughly corresponding to the J and H bands. (2 data files).

  4. Design and simulation of the active support system for a 1.2m meniscus primary mirror

    NASA Astrophysics Data System (ADS)

    Liu, Haitao; Fan, Bin; Zeng, Zhige; Li, Xiaojin; Wang, Hongqiao; Liu, Rong

    2015-07-01

    Thin meniscus primary mirrors with active support have been used successfully in many large telescopes, and also draw attention of many optical fabricators. Because the active support system can correct the low order figure errors, such as astigmatism, coma, trefoil 3rd astigmatism, the optical fabricators can just focus on to remove high order figure errors. This will shorten the fabrication time. In this paper, we present an active support system for a 1.2m meniscus parabolic primary mirror. It contains 37 axial push-pull force supports, 3 axial fixed points, and 4 lateral restraints. Some basic performance of the active support system is analyzed and the figure error correction capability is also studied based on Zernike modes.

  5. Involvement of various organs in the initial plasma clearance of differently glycosylated rat liver secretory proteins.

    PubMed

    Gross, V; Heinrich, P C; vom Berg, D; Steube, K; Andus, T; Tran-Thi, T A; Decker, K; Gerok, W

    1988-05-01

    The initial plasma clearance and organ distribution of alpha 1-acid glycoprotein and alpha 2-macroglobulin carrying different types of oligosaccharide, side chains was studied in rats. The differently glycosylated proteins were synthesized by rat hepatocytes in culture in the presence of tunicamycin (unglycosylated form), swainsonine (hybrid type), or 1-deoxymannojirimycin (high-mannose type). Deglycosylated glycoproteins (Asn-GlcNAc) were obtained by endoglucosaminidase H treatment of high-mannose-type glycoproteins. Ten minutes after intravenous injection 3% of complex type, 26% of hybrid type, 84% of high-mannose type. 64% of unglycosylated and 80% of deglycosylated alpha 1-acid glycoprotein disappeared from the plasma. The respective values for alpha 2-macroglobulin were 26%, 42%, 59% and 67%. When the clearance of total hepatic secretory proteins was examined, major differences between glycosylated and unglycosylated (glyco)proteins were found, particularly in the case of low-molecular-mass polypeptides. Whereas complex-type alpha 1-acid glycoprotein and alpha 2-macroglobulin showed no accumulation in various organs, hybrid-type alpha 1-acid glycoprotein and alpha 2-macroglobulin were present in spleen and liver. High-mannose-type alpha 1-acid glycoprotein and alpha 2-macroglobulin also accumulated mainly in spleen and liver. Spleen had the highest specific activity; liver, due to its larger organ mass, represented the major organ for the uptake of high-mannose-type glycoproteins. Competition experiments with mannan and GlcNAc-bovine-serum-albumin showed a mannose/GlcNAc receptor-mediated removal. Whereas unglycosylated alpha 1-acid glycoprotein was taken up by the kidney, unglycosylated alpha 2-macroglobulin was found in the spleen. Deglycosylated glycoproteins (Asn-GlcNAc) were removed from the plasma via two different mechanisms: firstly, clearance by the kidney similar to the unglycosylated glycoproteins; secondly, clearance by a mannose/GlcNAc receptor

  6. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  7. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  8. Staphylococcus aureus-Induced G2/M Phase Transition Delay in Host Epithelial Cells Increases Bacterial Infective Efficiency

    PubMed Central

    Almeida, Sintia; Legembre, Patrick; Edmond, Valérie; Azevedo, Vasco; Miyoshi, Anderson; Even, Sergine; Taieb, Frédéric; Arlot-Bonnemains, Yannick; Le Loir, Yves; Berkova, Nadia

    2013-01-01

    Staphylococcus aureus is a highly versatile, opportunistic pathogen and the etiological agent of a wide range of infections in humans and warm-blooded animals. The epithelial surface is its principal site of colonization and infection. In this work, we investigated the cytopathic effect of S. aureus strains from human and animal origins and their ability to affect the host cell cycle in human HeLa and bovine MAC-T epithelial cell lines. S. aureus invasion slowed down cell proliferation and induced a cytopathic effect, resulting in the enlargement of host cells. A dramatic decrease in the number of mitotic cells was observed in the infected cultures. Flow cytometry analysis revealed an S. aureus-induced delay in the G2/M phase transition in synchronous HeLa cells. This delay required the presence of live S. aureus since the addition of the heat-killed bacteria did not alter the cell cycle. The results of Western blot experiments showed that the G2/M transition delay was associated with the accumulation of inactive cyclin-dependent kinase Cdk1, a key inducer of mitosis entry, and with the accumulation of unphosphorylated histone H3, which was correlated with a reduction of the mitotic cell number. Analysis of S. aureus proliferation in asynchronous, G1- and G2-phase-enriched HeLa cells showed that the G2 phase was preferential for bacterial infective efficiency, suggesting that the G2 phase delay may be used by S. aureus for propagation within the host. Taken together, our results divulge the potential of S. aureus in the subversion of key cellular processes such as cell cycle progression, and shed light on the biological significance of S. aureus-induced host cell cycle alteration. PMID:23717407

  9. Ovarian carcinoma cells in serous effusions show altered MMP-2 and TIMP-2 mRNA levels.

    PubMed

    Davidson, B; Reich, R; Berner, A; Givant-Horwitz, V; Goldberg, I; Risberg, B; Kristensen, G B; Trope, C G; Bryne, M; Kopolovic, J; Nesland, J M

    2001-11-01

    The expression of matrix metalloproteinases (MMP) and their inhibitor TIMP-2 in serous effusions from patients with ovarian carcinoma and its association with clinico-pathological parameters were analysed. The findings in carcinoma cells in effusions were compared with corresponding primary and metastatic lesions. Sixty-six effusions and 96 tissue sections were stained for MMP-1, MMP-2 and MMP-9 applying immunohistochemistry (IHC) and analysed for MMP-2, MMP-9 and TIMP-2 expression using mRNA in situ hybridisation (ISH). MMP-2 and MMP-9 mRNA levels in 30 effusions were subsequently analysed using reverse transcription- polymerase chain reaction (RT-PCR). MMP and TIMP expression was detected in both carcinoma and mesothelial cells in effusions. The levels were consistently higher in malignant cells, significantly so for MMP-1 (P=0.016) and MMP-2 (P=0.036) proteins, as well as for TIMP-2 mRNA (P=0.008). In tissue sections, MMP-1, MMP-2 and MMP-9 protein expression was mostly localised to tumour cells, while MMP-2, MMP-9 and TIMP-2 mRNA were predominantly detected in stromal cells. Adenocarcinoma cells in effusions showed a significant upregulation of MMP-2 expression compared with primary tumours, with a concomitant downregulation of TIMP-2. RT-PCR demonstrated the presence of MMP-2 and MMP-9 in 28/30 and 0/30 specimens, respectively. MMP and TIMP are thus mainly synthesised by cancer cells in effusions, while stromal cells have a similar role in solid tumours. MMP-1 and MMP-2 production predominates over that of MMP-9 in effusions. Increased MMP-2 and reduced TIMP-2 levels are seen in ovarian carcinoma cells in effusions, possibly marking the acquisition of a metastatic phenotype. PMID:11597382

  10. The 20-hydroxyecdysone-induced signalling pathway in G2/M arrest of Plodia interpunctella imaginal wing cells.

    PubMed

    Siaussat, David; Bozzolan, Françoise; Porcheron, Patrick; Debernard, Stéphane

    2008-05-01

    The mechanisms involved in the control of cellular proliferation by the steroid hormone 20-hydroxyecdysone (20E) in insects are not known. We dissected the 20E signalling pathway responsible for G2/M arrest of imaginal cells from the IAL-PID2 cells of the Indian meal moth Plodia interpunctella. We first used a 5'-3' RACE-based strategy to clone a 4479bp cDNA encoding a putative P. interpunctella HR3 transcription factor named PiHR3. The deduced amino acid sequence of PiHR3 was highly similar to those of HR3 proteins from other lepidopterans, e.g. Manduca sexta and Bombyx mori. Using double-stranded RNA-mediated interference (dsRNAi), we then succeeded in blocking the ability of 20E to induce the expression of PiEcR-B1, PiUSP-2 and PiHR3 genes that encode the P. interpunctella ecdysone receptor B1-isoform, Ultraspiracle-2 isoform, the insect homologue of the vertebrate retinoid X receptor, and the HR3 transcription factor. We showed that inhibiting the 20E induction of PiEcR-B1, PiUSP-2 and PiHR3 mRNAs prevented the decreased expression of B cyclin and consequently the G2/M arrest of IAL-PID2 cells. Using this functional approach, we revealed the participation of EcR, USP and HR3 in a 20E signalling pathway that controls the proliferation of imaginal cells by regulating the expression of B cyclin.

  11. 2-methoxyestradiol blocks cell-cycle progression at G(2)/M phase and inhibits growth of human prostate cancer cells.

    PubMed

    Kumar, A P; Garcia, G E; Slaga, T J

    2001-07-01

    2-Methoxyestradiol (2-ME), an endogenous metabolite of 17beta-estradiol, is present in human blood and urine. Here we show for the first time that 2-ME significantly inhibited the growth of normal prostate epithelial cells and androgen-dependent LNCaP and androgen-independent DU145 prostate cancer cells. This growth inhibition was accompanied by a twofold increase in the G(2)/M population, with a concomitant decrease in the G(1) population, as shown by cell-cycle analysis. 2-ME treatment affected the cell-cycle progression of prostate cancer cells specifically by blocking cells in the G(2) phase. Immunoblot analysis of the key cell-cycle regulatory proteins in the G(2)/M phase showed a 14-fold increase in the expression of p21 and an eightfold increase in the expression of p34 cell division cycle 2 (cdc2). We also found an accumulation of phosphorylated cdc2 after 2-ME treatment. Furthermore, Wee 1 kinase was detectable after 2-ME treatment. 2-ME treatment also led to an increase in the activity of caspase-3, followed by apoptosis, as shown by terminal deoxynucleotidyl transferase-mediated deoxyuridine 5-triphosphate-biotin nick end-labeling and fluorescein isothiocyanate-poly(ADP-ribose) polymerase assay. Estrogen receptor levels did not change after treatment with 2-ME. Examination of the signaling pathways that mediate 2-ME-induced apoptosis showed reduction in the level of p53 expression and its DNA-binding activity. Given the fact that p53 mutations are common in patients with metastatic prostate cancer, our finding that 2-ME-mediated growth inhibition of human prostate cancer cells occurred in a p53-independent manner has considerable clinical significance. These findings, combined with the limited toxicity of 2-ME, may have significant implications for alternative treatment of advanced prostate cancer. PMID:11479920

  12. Lithium Inventory of 2 M ⊙ Red Clump Stars in Open Clusters: A Test of the Helium Flash Mechanism

    NASA Astrophysics Data System (ADS)

    Carlberg, Joleen K.; Cunha, Katia; Smith, Verne V.

    2016-08-01

    The temperature distribution of field Li-rich red giants suggests the presence of a population of Li-rich red clump (RC) stars. One proposed explanation for this population is that all stars with masses near 2 M ⊙ experience a short-lived phase of Li-richness at the onset of core He-burning. Many of these stars have low 12C/13C, a signature of deep mixing that is presumably associated with the Li regeneration. To test this purported mechanism of Li enrichment, we measured abundances in 38 RC stars and 6 red giant branch (RGB) stars in four open clusters selected to have RC masses near 2 M ⊙. We find six Li-rich stars (A(Li) ≥ 1.50 dex) of which only two may be RC stars. None of the RC stars have Li exceeding the levels observed in the RGB stars, but given the brevity of the suggested Li-rich phase and the modest sample size, it is probable that stars with larger Li-enrichments were missed simply by chance. However, we find very few stars in our sample with low 12C/13C. Such low 12C/13C, seen in many field Li-rich stars, should persist even after lithium has returned to normal low levels. Thus, if Li synthesis during the He flash occurs, it is a rare, but potentially long-lived occurrence rather than a short-lived phase for all stars. We estimate a conservative upper limit of the fraction of stars going through a Li-rich phase to be \\lt 47 % , based on stars that have low 12C/13C for their observed A(Li).

  13. Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes

    PubMed Central

    Gao, Fei; Ma, Ningjie; Zhou, Hong; Wang, Qing; Zhang, Hao; Wang, Pu; Hou, Haoli; Wen, Huan; Li, Lijia

    2016-01-01

    As an engineered nanomaterial, zinc oxide nanoparticles (ZnO NPs) are used frequently in biological applications and can make contact with human skin. Here, we systematically investigated the effects of ZnO NPs on non-tumorigenic human epidermal keratinocytes, which were used as a test model for this in vitro study, at the epigenetic and molecular levels. Our results showed that ZnO NPs induced cell cycle arrest at the G2/M checkpoint before the viability of human epidermal keratinocytes was reduced, which was associated with the chromatin changes at the epigenetic level, including increased methylation of histone H3K9 and decreased acetylation of histone H4K5 accompanied by chromatin condensation at 24 hours. The mRNA expression of the methyltransferase genes G9a and GLP was also increased upon treatment with ZnO NPs, and the acetyltransferase genes GCN5, P300, and CBP were downregulated. Reactive oxygen species were found to be more abundant after treatment with ZnO NPs for 6 hours, and DNA damage was observed at 24 hours. Transmission electron microscopy and flow cytometry confirmed that ZnO NPs were absorbed into the cell when they were added to the medium. Apoptotic human epidermal keratinocytes were detected, and the expression of the proapoptotic genes Bax, Noxa, and Puma increased significantly, while the expression of the antiapoptotic gene Bcl-xl decreased 24 hours after exposure to ZnO NPs. These findings suggest that the ZnO NPs induced cell cycle arrest at G2/M, which was associated with epigenetic changes and accompanied by p53-Bax mitochondrial pathway-mediated apoptosis. PMID:27570453

  14. Fission yeast nucleolar protein Dnt1 regulates G2/M transition and cytokinesis by downregulating Wee1 kinase.

    PubMed

    Yu, Zhi-Yong; Zhang, Meng-Ting; Wang, Gao-Yuan; Xu, Dan; Keifenheim, Daniel; Franco, Alejandro; Cansado, Jose; Masuda, Hirohisa; Rhind, Nick; Wang, Yamei; Jin, Quan-Wen

    2013-11-01

    Cytokinesis involves temporally and spatially coordinated action of the cell cycle, cytoskeletal and membrane systems to achieve separation of daughter cells. The septation initiation network (SIN) and mitotic exit network (MEN) signaling pathways regulate cytokinesis and mitotic exit in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae, respectively. Previously, we have shown that in fission yeast, the nucleolar protein Dnt1 negatively regulates the SIN pathway in a manner that is independent of the Cdc14-family phosphatase Clp1/Flp1, but how Dnt1 modulates this pathway has remained elusive. By contrast, it is clear that its budding yeast relative, Net1/Cfi1, regulates the homologous MEN signaling pathway by sequestering Cdc14 phosphatase in the nucleolus before mitotic exit. In this study, we show that dnt1(+) positively regulates G2/M transition during the cell cycle. By conducting epistasis analyses to measure cell length at septation in double mutant (for dnt1 and genes involved in G2/M control) cells, we found a link between dnt1(+) and wee1(+). Furthermore, we showed that elevated protein levels of the mitotic inhibitor Wee1 kinase and the corresponding attenuation in Cdk1 activity is responsible for the rescuing effect of dnt1Δ on SIN mutants. Finally, our data also suggest that Dnt1 modulates Wee1 activity in parallel with SCF-mediated Wee1 degradation. Therefore, this study reveals an unexpected missing link between the nucleolar protein Dnt1 and the SIN signaling pathway, which is mediated by the Cdk1 regulator Wee1 kinase. Our findings also define a novel mode of regulation of Wee1 and Cdk1, which is important for integration of the signals controlling the SIN pathway in fission yeast.

  15. 6-Gingerol Inhibits Growth of Colon Cancer Cell LoVo via Induction of G2/M Arrest.

    PubMed

    Lin, Ching-Bin; Lin, Chun-Che; Tsay, Gregory J

    2012-01-01

    6-Gingerol, a natural component of ginger, has been widely reported to possess antiinflammatory and antitumorigenic activities. Despite its potential efficacy against cancer, the anti-tumor mechanisms of 6-gingerol are complicated and remain sketchy. In the present study, we aimed to investigate the anti-tumor effects of 6-gingerol on colon cancer cells. Our results revealed that 6-gingerol treatment significantly reduced the cell viability of human colon cancer cell, LoVo, in a dose-dependent manner. Further flow cytometric analysis showed that 6-gingerol induced significant G2/M phase arrest and had slight influence on sub-G1 phase in LoVo cells. Therefore, levels of cyclins, cyclin-dependent kinases (CDKs), and their regulatory proteins involved in S-G2/M transition were investigated. Our findings revealed that levels of cyclin A, cyclin B1, and CDK1 were diminished; in contrast, levels of the negative cell cycle regulators p27(Kip1) and p21(Cip1) were increased in response to 6-gingerol treatment. In addition, 6-gingerol treatment elevated intracellular reactive oxygen species (ROS) and phosphorylation level of p53. These findings indicate that exposure of 6-gingerol may induce intracellular ROS and upregulate p53, p27(Kip1), and p21(Cip1) levels leading to consequent decrease of CDK1, cyclin A, and cyclin B1 as result of cell cycle arrest in LoVo cells. It would be suggested that 6-gingerol should be beneficial to treatment of colon cancer.

  16. Staphylococcus aureus-induced G2/M phase transition delay in host epithelial cells increases bacterial infective efficiency.

    PubMed

    Alekseeva, Ludmila; Rault, Lucie; Almeida, Sintia; Legembre, Patrick; Edmond, Valérie; Azevedo, Vasco; Miyoshi, Anderson; Even, Sergine; Taieb, Frédéric; Arlot-Bonnemains, Yannick; Le Loir, Yves; Berkova, Nadia

    2013-01-01

    Staphylococcus aureus is a highly versatile, opportunistic pathogen and the etiological agent of a wide range of infections in humans and warm-blooded animals. The epithelial surface is its principal site of colonization and infection. In this work, we investigated the cytopathic effect of S. aureus strains from human and animal origins and their ability to affect the host cell cycle in human HeLa and bovine MAC-T epithelial cell lines. S. aureus invasion slowed down cell proliferation and induced a cytopathic effect, resulting in the enlargement of host cells. A dramatic decrease in the number of mitotic cells was observed in the infected cultures. Flow cytometry analysis revealed an S. aureus-induced delay in the G2/M phase transition in synchronous HeLa cells. This delay required the presence of live S. aureus since the addition of the heat-killed bacteria did not alter the cell cycle. The results of Western blot experiments showed that the G2/M transition delay was associated with the accumulation of inactive cyclin-dependent kinase Cdk1, a key inducer of mitosis entry, and with the accumulation of unphosphorylated histone H3, which was correlated with a reduction of the mitotic cell number. Analysis of S. aureus proliferation in asynchronous, G1- and G2-phase-enriched HeLa cells showed that the G2 phase was preferential for bacterial infective efficiency, suggesting that the G2 phase delay may be used by S. aureus for propagation within the host. Taken together, our results divulge the potential of S. aureus in the subversion of key cellular processes such as cell cycle progression, and shed light on the biological significance of S. aureus-induced host cell cycle alteration.

  17. AM251 induces apoptosis and G2/M cell cycle arrest in A375 human melanoma cells.

    PubMed

    Carpi, Sara; Fogli, Stefano; Romanini, Antonella; Pellegrino, Mario; Adinolfi, Barbara; Podestà, Adriano; Costa, Barbara; Da Pozzo, Eleonora; Martini, Claudia; Breschi, Maria Cristina; Nieri, Paola

    2015-08-01

    Human cutaneous melanoma is an aggressive and chemotherapy-resistant type of cancer. AM251 is a cannabinoid type 1 (CB1) receptor antagonist/inverse agonist with off-target antitumor activity against pancreatic and colon cancer cells. The current study aimed to characterize the in-vitro antimelanoma activity of AM251. The BRAF V600E mutant melanoma cell line, A375, was used as an in-vitro model system. Characterization tools included a cell viability assay, nuclear morphology assessment, gene expression, western blot, flow cytometry with Annexin V-FITC/7-AAD double staining, cell cycle analyses, and measurements of changes in intracellular cAMP and calcium concentrations. AM251 exerted a marked cytotoxic effect against A375 human melanoma cells with potency comparable with that observed for cisplatin without significant changes in the human dermal fibroblasts viability. AM251, at a concentration that approximates the IC50, downregulated genes encoding antiapoptotic proteins (BCL2 and survivin) and increased transcription levels of proapoptotic BAX, induced alteration of Annexin V reactivity, DNA fragmentation, chromatin condensation in the cell nuclei, and G2/M phase arrest.AM251 also induced a 40% increase in the basal cAMP levels, but it did not affect intracellular calcium concentrations. The involvement of GPR55, TRPA1, and COX-2 in the AM251 mechanism of action was excluded. The combination of AM251 with celecoxib produced a synergistic antitumor activity, although the mechanism underlying this effect remains to be elucidated. This study provides the first evidence of a proapoptotic effect and G2/M cell cycle arrest of AM251 on A375 cells. This compound may be a potential prototype for the development of promising diarylpyrazole derivatives to be evaluated in human cutaneous melanoma.

  18. Flavokawain derivative FLS induced G2/M arrest and apoptosis on breast cancer MCF-7 cell line.

    PubMed

    Ali, Norlaily Mohd; Akhtar, M Nadeem; Ky, Huynh; Lim, Kian Lam; Abu, Nadiah; Zareen, Seema; Ho, Wan Yong; Alan-Ong, Han Kiat; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Ismail, Jamil Bin; Yeap, Swee Keong; Kamarul, Tunku

    2016-01-01

    Known as naturally occurring biologically active compounds, flavokawain A and B are the leading chalcones that possess anticancer properties. Another flavokawain derivative, (E)-1-(2'-Hydroxy-4',6'-dimethoxyphenyl)-3-(4-methylthio)phenyl)prop-2-ene-1-one (FLS) was characterized with (1)H-nuclear magnetic resonance, electron-impact mas spectrometry, infrared spectroscopy, and ultraviolet ((1)H NMR, EI-MS, IR, and UV) spectroscopic techniques. FLS cytotoxic efficacy against human cancer cells (MCF-7, MDA-MB-231, and MCF-10A) resulted in the reduction of IC50 values in a time- and dose-dependent mode with high specificity on MCF-7 (IC50 of 36 μM at 48 hours) against normal breast cell MCF-10A (no IC50 detected up to 180 μM at 72 hours). Light, scanning electron, and fluorescent microscopic analysis of MCF-7 cells treated with 36 μM of FLS displayed cell shrinkage, apoptotic body, and DNA fragmentation. Additionally, induction of G2/M cell arrest within 24 hours and apoptosis at subsequent time points was discovered via flow cytometry analysis. The roles of PLK-1, Wee-1, and phosphorylation of CDC-2 in G2/M arrest and proapoptotic factors (Bax, caspase 9, and p53) in promotion of apoptosis of FLS against MCF-7 cells were discovered using fluorometric, quantitative real-time polymerase chain reaction, and Western blot analysis. Interestingly, the presence of SCH3 (thiomethyl group) on ring B structure contributed to the selective cytotoxicity against MCF-7 cells compared to other chalcones, flavokawain A and B. Overall, our data suggest potential therapeutic value for flavokawain derivative FLS to be further developed as a new anticancer drug.

  19. Soluble CD8 stabilizes the HLA class I molecule by promoting beta2M exchange: analysis in real-time.

    PubMed

    Morgan, C L; Price, C P; Cohen, S B; Madrigal, J A; Newman, D J

    1999-05-01

    Human soluble CD8 (sCD8) is secreted by activated CD8+/- cytotoxic T lymphocytes (CTLs). The immunological role of sCD8 is poorly defined, however. We have studied the influence of sCD8 on HLA class I interactions by real-time analysis. Using an optical biosensor we demonstrated that the binding of sCD8 to HLA-A2 promotes exchange of beta2-microglobulin (beta2m) in order to stabilize the complex. Kinetic analysis showed that sCD8 significantly increased the affinity (K(A)) of HLA-A2 for immobilized human beta2m; from 1.14 +/- 0.04 x 10(9) M(-1) in its absence, to 2.18 +/- 0.21 x 10(9) M(-1) following preincubation with sCD8. This suggests that the sCD8:HLA class I complex is unlikely to be degraded at the cell surface. Even in the presence of exogenous peptide (HLA-A2 specific or nonspecific), sCD8 has a stabilizing influence on the HLA class I molecule. These findings point to an immunosuppressive role for sCD8, because the binding of sCD8 to HLA class I would block the binding site for CTL-bound CD8 and, therefore, interfere with T cell activation and proliferation. This may have particular significance in pathological situations where elevated levels of sCD8 are found in extracellular fluids, and sCD8 may provide an alternative approach for immunosuppressive therapy. PMID:10447404

  20. Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes.

    PubMed

    Gao, Fei; Ma, Ningjie; Zhou, Hong; Wang, Qing; Zhang, Hao; Wang, Pu; Hou, Haoli; Wen, Huan; Li, Lijia

    2016-01-01

    As an engineered nanomaterial, zinc oxide nanoparticles (ZnO NPs) are used frequently in biological applications and can make contact with human skin. Here, we systematically investigated the effects of ZnO NPs on non-tumorigenic human epidermal keratinocytes, which were used as a test model for this in vitro study, at the epigenetic and molecular levels. Our results showed that ZnO NPs induced cell cycle arrest at the G2/M checkpoint before the viability of human epidermal keratinocytes was reduced, which was associated with the chromatin changes at the epigenetic level, including increased methylation of histone H3K9 and decreased acetylation of histone H4K5 accompanied by chromatin condensation at 24 hours. The mRNA expression of the methyltransferase genes G9a and GLP was also increased upon treatment with ZnO NPs, and the acetyltransferase genes GCN5, P300, and CBP were downregulated. Reactive oxygen species were found to be more abundant after treatment with ZnO NPs for 6 hours, and DNA damage was observed at 24 hours. Transmission electron microscopy and flow cytometry confirmed that ZnO NPs were absorbed into the cell when they were added to the medium. Apoptotic human epidermal keratinocytes were detected, and the expression of the proapoptotic genes Bax, Noxa, and Puma increased significantly, while the expression of the antiapoptotic gene Bcl-xl decreased 24 hours after exposure to ZnO NPs. These findings suggest that the ZnO NPs induced cell cycle arrest at G2/M, which was associated with epigenetic changes and accompanied by p53-Bax mitochondrial pathway-mediated apoptosis. PMID:27570453

  1. Flavokawain derivative FLS induced G2/M arrest and apoptosis on breast cancer MCF-7 cell line.

    PubMed

    Ali, Norlaily Mohd; Akhtar, M Nadeem; Ky, Huynh; Lim, Kian Lam; Abu, Nadiah; Zareen, Seema; Ho, Wan Yong; Alan-Ong, Han Kiat; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Ismail, Jamil Bin; Yeap, Swee Keong; Kamarul, Tunku

    2016-01-01

    Known as naturally occurring biologically active compounds, flavokawain A and B are the leading chalcones that possess anticancer properties. Another flavokawain derivative, (E)-1-(2'-Hydroxy-4',6'-dimethoxyphenyl)-3-(4-methylthio)phenyl)prop-2-ene-1-one (FLS) was characterized with (1)H-nuclear magnetic resonance, electron-impact mas spectrometry, infrared spectroscopy, and ultraviolet ((1)H NMR, EI-MS, IR, and UV) spectroscopic techniques. FLS cytotoxic efficacy against human cancer cells (MCF-7, MDA-MB-231, and MCF-10A) resulted in the reduction of IC50 values in a time- and dose-dependent mode with high specificity on MCF-7 (IC50 of 36 μM at 48 hours) against normal breast cell MCF-10A (no IC50 detected up to 180 μM at 72 hours). Light, scanning electron, and fluorescent microscopic analysis of MCF-7 cells treated with 36 μM of FLS displayed cell shrinkage, apoptotic body, and DNA fragmentation. Additionally, induction of G2/M cell arrest within 24 hours and apoptosis at subsequent time points was discovered via flow cytometry analysis. The roles of PLK-1, Wee-1, and phosphorylation of CDC-2 in G2/M arrest and proapoptotic factors (Bax, caspase 9, and p53) in promotion of apoptosis of FLS against MCF-7 cells were discovered using fluorometric, quantitative real-time polymerase chain reaction, and Western blot analysis. Interestingly, the presence of SCH3 (thiomethyl group) on ring B structure contributed to the selective cytotoxicity against MCF-7 cells compared to other chalcones, flavokawain A and B. Overall, our data suggest potential therapeutic value for flavokawain derivative FLS to be further developed as a new anticancer drug. PMID:27358555

  2. Flavokawain derivative FLS induced G2/M arrest and apoptosis on breast cancer MCF-7 cell line

    PubMed Central

    Ali, Norlaily Mohd; Akhtar, M Nadeem; Ky, Huynh; Lim, Kian Lam; Abu, Nadiah; Zareen, Seema; Ho, Wan Yong; Alan-Ong, Han Kiat; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Ismail, Jamil bin; Yeap, Swee Keong; Kamarul, Tunku

    2016-01-01

    Known as naturally occurring biologically active compounds, flavokawain A and B are the leading chalcones that possess anticancer properties. Another flavokawain derivative, (E)-1-(2′-Hydroxy-4′,6′-dimethoxyphenyl)-3-(4-methylthio)phenyl)prop-2-ene-1-one (FLS) was characterized with 1H-nuclear magnetic resonance, electron-impact mas spectrometry, infrared spectroscopy, and ultraviolet (1H NMR, EI-MS, IR, and UV) spectroscopic techniques. FLS cytotoxic efficacy against human cancer cells (MCF-7, MDA-MB-231, and MCF-10A) resulted in the reduction of IC50 values in a time- and dose-dependent mode with high specificity on MCF-7 (IC50 of 36 μM at 48 hours) against normal breast cell MCF-10A (no IC50 detected up to 180 μM at 72 hours). Light, scanning electron, and fluorescent microscopic analysis of MCF-7 cells treated with 36 μM of FLS displayed cell shrinkage, apoptotic body, and DNA fragmentation. Additionally, induction of G2/M cell arrest within 24 hours and apoptosis at subsequent time points was discovered via flow cytometry analysis. The roles of PLK-1, Wee-1, and phosphorylation of CDC-2 in G2/M arrest and proapoptotic factors (Bax, caspase 9, and p53) in promotion of apoptosis of FLS against MCF-7 cells were discovered using fluorometric, quantitative real-time polymerase chain reaction, and Western blot analysis. Interestingly, the presence of SCH3 (thiomethyl group) on ring B structure contributed to the selective cytotoxicity against MCF-7 cells compared to other chalcones, flavokawain A and B. Overall, our data suggest potential therapeutic value for flavokawain derivative FLS to be further developed as a new anticancer drug. PMID:27358555

  3. Induction of cyclo-oxygenase-2 mRNA by prostaglandin E2 in human prostatic carcinoma cells

    NASA Technical Reports Server (NTRS)

    Tjandrawinata, R. R.; Dahiya, R.; Hughes-Fulford, M.

    1997-01-01

    Prostaglandins are synthesized from arachidonic acid by the enzyme cyclo-oxygenase. There are two isoforms of cyclooxygenases: COX-1 (a constitutive form) and COX-2 (an inducible form). COX-2 has recently been categorized as an immediate-early gene and is associated with cellular growth and differentiation. The purpose of this study was to investigate the effects of exogenous dimethylprostaglandin E2 (dmPGE2) on prostate cancer cell growth. Results of these experiments demonstrate that administration of dmPGE2 to growing PC-3 cells significantly increased cellular proliferation (as measured by the cell number), total DNA content and endogenous PGE2 concentration. DmPGE2 also increased the steady-state mRNA levels of its own inducible synthesizing enzyme, COX-2, as well as cellular growth to levels similar to those seen with fetal calf serum and phorbol ester. The same results were observed in other human cancer cell types, such as the androgen-dependent LNCaP cells, breast cancer MDA-MB-134 cells and human colorectal carcinoma DiFi cells. In PC-3 cells, the dmPGE2 regulation of the COX-2 mRNA levels was both time dependent, with maximum stimulation seen 2 h after addition, and dose dependent on dmPGE2 concentration, with maximum stimulation seen at 5 microg ml(-1). The non-steroidal anti-inflammatory drug flurbiprofen (5 microM), in the presence of exogenous dmPGE2, inhibited the up-regulation of COX-2 mRNA and PC-3 cell growth. Taken together, these data suggest that PGE2 has a specific role in the maintenance of human cancer cell growth and that the activation of COX-2 expression depends primarily upon newly synthesized PGE2, perhaps resulting from changes in local cellular PGE2 concentrations.

  4. Folding, stability, and physical properties of the alpha subunit of bacterial luciferase.

    PubMed

    Noland, B W; Dangott, L J; Baldwin, T O

    1999-12-01

    Bacterial luciferase is a heterodimeric (alphabeta) enzyme composed of homologous subunits. When the Vibrio harveyi luxA gene is expressed in Escherichia coli, the alpha subunit accumulates to high levels. The alpha subunit has a well-defined near-UV circular dichroism spectrum and a higher intrinsic fluorescence than the heterodimer, demonstrating fluorescence quenching in the enzyme which is reduced in the free subunit [Sinclair, J. F., Waddle, J. J., Waddill, W. F., and Baldwin, T. O. (1993) Biochemistry 32, 5036-5044]. Analytical ultracentrifugation of the alpha subunit has revealed a reversible monomer to dimer equilibrium with a dissociation constant of 14.9 +/- 4.0 microM at 18 degrees C in 50 mM phosphate and 100 mM NaCl, pH 7.0. The alpha subunit unfolded and refolded reversibly in urea-containing buffers by a three-state mechanism. The first transition occurred over the range of 0-2 M urea with an associated free-energy change of 2.24 +/- 0.25 kcal/mol at 18 degrees C in 50 mM phosphate buffer, pH 7.0. The second, occurring between 2.5 and 3.5 M urea, comprised a cooperative transition with a free-energy change of 6.50 +/- 0.75 kcal/mol. The intermediate species, populated maximally at ca. 2 M urea, has defined near-UV circular dichroism spectral properties distinct from either the native or the denatured states. The intrinsic fluorescence of the intermediate suggested that, although the quantum yield had decreased, the tryptophanyl residues remained largely buried. The far-UV circular dichroism spectrum of the intermediate indicated that it had lost ca. 40% of its native secondary structure. N-Terminal sequencing of the products of limited proteolysis of the intermediate showed that the C-terminal region of the alpha subunit became protease labile over the urea concentration range at which the intermediate was maximally populated. These observations have led us to propose an unfolding model in which the first transition is the unfolding of a C

  5. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  6. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  7. The biosynthesis of acute-phase proteins in primary cultures of rat hepatocytes.

    PubMed

    Andus, T; Gross, V; Tran-Thi, T A; Schreiber, G; Nagashima, M; Heinrich, P C

    1983-07-01

    The biosynthesis and secretion of alpha 2-macroglobulin, transferrin, alpha 1-acid glycoprotein and alpha 1-proteinase inhibitor were studied in rat hepatocyte primary cultures. After labeling with [35S]methionine, two forms, which can be separated electrophoretically differing by molecular weight, were found for each of the four glycoproteins. The following molecular weights were estimated for the intracellular precursors and the secreted forms: alpha 2-macroglobulin, 176 000 and 182 000; transferrin, 84 000 and 86 000; alpha 1-acid glycoprotein, 39 000 and 43 000-60 000; alpha 1-proteinase inhibitor, 49 000 and 54 000. Carbohydrate moieties could be removed from intracellular forms by treatment with endoglucosaminidase H indicating that their oligosaccharide chains were of the high-mannose type. The extracellular forms were sensitive to sialidase. They incorporated [3H]galactose and [3H]fucose showing that their oligosaccharide chains were of the complex type. Pulse-chase experiments revealed a precursor-product relationship for the high-mannose and the complex type glycoproteins. In the hepatocyte medium newly synthesized albumin was detected after 30 min and newly synthesized glycoproteins after 60 min. Unglycosylated alpha 2-macroglobulin (162 000), transferrin (79 000), alpha 1-acid glycoprotein (23 000), and alpha 1-proteinase inhibitor (41 000) were found in the cells as well as in the medium, when the transfer of oligosaccharide chains onto the polypeptide chains was blocked by tunicamycin. Tunicamycin led to a marked reduction of the secretion of alpha 2-macroglobulin, alpha 1-acid glycoprotein and alpha 1-proteinase inhibitor, whereas the secretion of transferrin was less affected. PMID:6602705

  8. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  9. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  10. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  11. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  12. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  13. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  14. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  15. Determination of the rate coefficients for the reactions IO + NO2 + M (air) --> IONO2 + M and O(3P) + NO2 --> O2 + NO using laser-induced fluorescence spectroscopy.

    PubMed

    Dillon, Terry J; Blitz, Mark A; Heard, Dwayne E

    2006-06-01

    Laser-induced fluorescence spectroscopy via excitation of the A2pi(3/2) <-- X2pi(3/2) (2,0) band at 445 nm was used to monitor IO in the presence of NO2 following its generation in the reactions O(3P) + CF3I and O(3P) + I2. Both photolysis of O3 (248 nm) and NO2 (351 nm) were used to initiate the production of IO. The rate coefficients for the thermolecular reaction IO + NO2 + M --> IONO2 + M were measured in air, N2, and O2 over the range P = 18-760 Torr, covering typical tropospheric conditions, and were found to be in the falloff region. No dependence of k1 upon bath gas identity was observed, and in general, the results are in good agreement with recent determinations. Using a Troe broadening factor of F(B) = 0.4, the falloff parameters k0(1) = (9.5 +/- 1.6) x 10(-31) cm6 molecule(-2) s(-1) and k(infinity)(1) = (1.7 +/- 0.3) x 10(-11) cm3 molecule(-1) s(-1) were determined at 294 K. The temporal profile of IO at elevated temperatures was used to investigate the thermal stability of the product, IONO2, but no evidence was observed for the regeneration of IO, consistent with recent calculations for the IO-NO2 bond strength being approximately 100 kJ mol(-1). Previous modeling studies of iodine chemistry in the marine boundary layer that utilize values of k1 measured in N2 are hence validated by these results conducted in air. The rate coefficient for the reaction O(3P) + NO2 --> O2 + NO at 294 K and in 100 Torr of air was determined to be k2 = (9.3 +/- 0.9) x 10(-12) cm3 molecule(-1) s(-1), in good agreement with recommended values. All uncertainties are quoted at the 95% confidence limit.

  16. Accelerating K-Alpha Resonance Fluorescence Via Monochromatic X-Ray Beams And Comparison With LCLS-XFEL

    NASA Astrophysics Data System (ADS)

    Pradhan, Anil; Nahar, Sultana; Lim, Sara

    2015-05-01

    The presence of K-alpha resonances below the K-edge has been studied theoretically for high-Z (Fe, Pt, Au) and low-Z (Al, Ti, Cu) atoms, and recently observed experimentally at the LCLS x-ray free-electron laser facility in ``warm dense matter''. We present a mechanism for possible enhancement of the ``Auger cycle'' by employing a twin-beam monochromatic x-ray beams setup. We extend the theoretical formulation to construct a detailed radiative-cascade model using atomic rates computed using atomic structure and R-matrix codes. We also report preliminary results on K-alpha resonance fluorescence from experiments at the European Synchrotron Research Facility using a tungsten target. In addition, we describe a simple Broadband-to-Monchromatic (B2M) x-ray conversion device for potential use in monochromatic K-alpha imaging and other applications.

  17. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  18. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  19. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  20. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  1. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  2. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  3. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  4. Structure elucidation via stereoselective synthesis of the acetate center of 1-Azabicyclo[2.2.2]oct-3-yl {alpha}-hydroxy-{alpha}(1-iodo-1-propen-3-yl)-{alpha}-phenylacetate (IQNP). A high affinity muscarinic imaging agent for SPECT

    SciTech Connect

    McPherson, D.W.; Knapp, F.F. Jr.

    1996-11-15

    A facile stereoselective synthesis of {alpha}-hydroxy-{alpha}-phenyl-{alpha}-(1-propyn-3-yl)acetic acid in high enantiomeric excess has been developed and allows determination of the (R/S) conformation at this center. In addition, comparison of the specific rotation, HPLC, and NMR data of (E)-(R,R)-and (E)-(R,S)-IQNP to those prepared by a classical resolution of the acetate moiety allows the assignment of (E)-(R,R)-IQNP as the isomer demonstrating binding to the M{sub 1} mAChR subtype and (Z)-(R,R)-IQNP as the isomer binding to both the M{sub 1} and M{sub 2} mAChR subtypes.

  5. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  6. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  7. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  8. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  9. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  10. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  11. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  12. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  13. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  14. Human leucocyte neutral proteases, with special reference to collagen metabolism.

    PubMed

    Kobayashi, S; Nagai, Y

    1978-09-01

    Three different types of neutral proteases related to collagen metabolism have been found in the granule fraction of human leucocytes from normal adults, using collagen, gelatin, and synthetic peptides as substrates. These are collagenase, an enzyme showing a potent hydrolytic activity against gelatin but little against native collagen, and one splitting the cross-links region of collagen. Their molecular weights were estimated to be about 75,000 150,000, and 25,000, respectively, by gel chromatography. The former two enzymes were inhibited by a alpha2-macroglobulin and ethylenediaminetetraacetate, but not by alpha1-proteinase inhibitor (alpha1-antitrypsin) or phenylmethylsulfonylfluoride, while the latter enzyme, associated in behavior with an enzyme hydrolyzing succinyl-(l-alanyl)3-p-nitroanilide, was inhibited by alpha1-proteinase inhibitor, alpha2-macroglobulin, and phenylmethylsulfonylfluoride, but not by ethylenediaminetetraacetate. A possible cooperative function of these enzymes in collagen catabolism is discussed.

  15. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  16. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  17. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  18. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  19. Juxtaposition of C(2)M and the transverse filament protein C(3)G within the central region of Drosophila synaptonemal complex

    PubMed Central

    Anderson, Lorinda K.; Royer, Suzanne M.; Page, Scott L.; McKim, Kim S.; Lai, Ann; Lilly, Mary A.; Hawley, R. Scott

    2005-01-01

    The synaptonemal complex (SC) is intimately involved in the process of meiotic recombination in most organisms, but its exact role remains enigmatic. One reason for this uncertainty is that the overall structure of the SC is evolutionarily conserved, but many SC proteins are not. Two putative SC proteins have been identified in Drosophila: C(3)G and C(2)M. Mutations in either gene cause defects in SC structure and meiotic recombination. Although neither gene is well conserved at the amino acid level, the predicted secondary structure of C(3)G is similar to that of transversefilament proteins, and C(2)M is a distantly related member of the α-kleisin family that includes Rec8, a meiosis-specific cohesin protein. Here, we use immunogold labeling of SCs in Drosophila ovaries to localize C(3)G and C(2)M at the EM level. We show that both C(3)G and C(2)M are components of the SC, that the orientation of C(3)G within the SC is similar to other transverse-filament proteins, and that the N terminus of C(2)M is located in the central region adjacent to the lateral elements (LEs). Based on our data and the known phenotypes of C(2)M and C(3)G mutants, we propose a model of SC structure in which C(2)M links C(3)G to the LEs. PMID:15767569

  20. Superconducting Bi2Te: Pressure-induced universality in the (Bi2)m(Bi2Te3)n series

    DOE PAGES

    Stillwell, Ryan L.; Jeffries, Jason R.; Jenei, Zsolt; Weir, Samuel T.; Vohra, Yogesh K.

    2016-03-09

    Using high-pressure magnetotransport techniques we have discovered superconductivity in Bi2Te, a member of the infinitely adaptive (Bi2)m(Bi2Te3)n series, whose end members, Bi and Bi2Te3, can be tuned to display topological surface states or superconductivity. Bi2Te has a maximum Tc = 8.6 K at P = 14.5 GPa and goes through multiple high pressure phase transitions, ultimately collapsing into a bcc structure that suggests a universal behavior across the series. High-pressure magnetoresistance and Hall measurements suggest a semi-metal to metal transition near 5.4 GPa, which accompanies the hexagonal to intermediate phase transition seen via x-ray diffraction measurements. In addition, the linearitymore » of Hc2 (T) exceeds the Werthamer-Helfand-Hohenberg limit, even in the extreme spin-orbit scattering limit, yet is consistent with other strong spin-orbit materials. Furthermore, considering these results in combination with similar reports on strong spin-orbit scattering materials seen in the literature, we suggest the need for a new theory that can address the unconventional nature of their superconducting states.« less